File size: 1,730 Bytes
6ff8ce3 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 |
---
license: apache-2.0
tags:
- pretrained
- mistral
- DNA
- plant
- Arabidopsis thaliana
---
# Model Card for Mistral-DNA-v1-422M-Athaliana (Mistral for DNA)
The Mistral-DNA-v1-422M-Athaliana Large Language Model (LLM) is a pretrained generative DNA sequence model with 422M parameters.
It is derived from Mixtral-8x7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced.
The model was pretrained using 10kb DNA sequences from 7 A. thaliana genome assemblies (from https://1001genomes.org/data/MPIPZ/MPIPZJiao2020/releases/current/full_set/).
## Model Architecture
Like Mixtral-8x7B-v0.1, it is a transformer model, with the following architecture choices:
- Grouped-Query Attention
- Sliding-Window Attention
- Byte-fallback BPE tokenizer
- Mixture of Experts
## Load the model from huggingface:
```
import torch
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-422M-Athaliana", trust_remote_code=True)
model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-422M-Athaliana", trust_remote_code=True)
```
## Calculate the embedding of a protein sequence
```
insulin = "TGATGATTGGCGCGGCTAGGATCGGCT"
inputs = tokenizer(insulin, return_tensors = 'pt')["input_ids"]
hidden_states = model(inputs)[0] # [1, sequence_length, 256]
# embedding with max pooling
embedding_max = torch.max(hidden_states[0], dim=0)[0]
print(embedding_max.shape) # expect to be 256
```
## Troubleshooting
Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer.
## Notice
Mistral-DNA-v1-422M-Athaliana is a pretrained base model for DNA.
## Contact
Raphaël Mourad. [email protected] |