Upload 959 files

.gitattributes

@@ -136,3 +136,4 @@ pdf-files/vestibular-evoked-myogenic-potential-vemp-triggere-nxbdfin.pdf filter=
 pdf-files/workflow-for-beta-range-forest-plots-bootstrap-rid-czcix2ue.pdf filter=lfs diff=lfs merge=lfs -text
 TXT.jsonl filter=lfs diff=lfs merge=lfs -text
 Base64.jsonl filter=lfs diff=lfs merge=lfs -text
+Caduceus_Data.jsonl filter=lfs diff=lfs merge=lfs -text

Caduceus_Data.jsonl

@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:67ede707c95a611f239e95e27c19ca7be5e2868a6c00d8f2999e8255a94dc19d
+size 285639134

markdown-output/0-1m-edta-0-2m-mgcl2-0-2m-ascorbate-buffer-c2yyfv.md

@@ -0,0 +1,97 @@
+```markdown
+# Goal/Experiment:
+Preparation of iron chloride resuspension buffer using disodium EDTA dihydrate and magnesium chloride in Tris buffer.
+
+# 0.1M EDTA-0.2M MgCl2-0.2M Ascorbate Buffer
+
+## Abstract
+Preparation of iron chloride resuspension buffer using disodium EDTA dihydrate and magnesium chloride in Tris buffer.
+
+Citation: Seth John, Bonnie Poulos, Christine Schirmer 0.1M EDTA-0.2M MgCl2-0.2M Ascorbate Buffer. protocols.io dx.doi.org/10.17504/protocols.io.c2yyfv
+
+Published: 20 Jul 2015
+
+## Guidelines
+
+### Recipe as developed by Seth:
+| Reagent                    | Formula Weight | Amount  | Final Concentration |
+|----------------------------|----------------|---------|---------------------|
+| Tris-base                  | FW=121.14      | 1.51g   | 0.125M              |
+| Na₂-EDTA dihydrate         | FW= 372.24     | 3.72g   | 0.1M                |
+| MgCl₂ hexahydrate          | FW=203.3       | 4.07g   | 0.2M                |
+| Ascorbic Acid              | FW=176.12      | 3.52g   | 0.2M                |
+| 5N NaOH                    |                | ~4.0ml  | to pH 6.5 final     |
+| MilliQ H₂O                 |                | to 100ml|                     |
+
+1. **Tris-base**: A common buffering agent.
+2. **Na₂-EDTA dihydrate**: Chelating agent to bind divalent cations.
+3. **MgCl₂ hexahydrate**: Source of Mg²⁺ ions.
+4. **Ascorbic Acid**: Reductant to improve virus infectivity.
+5. **5N NaOH**: Used to adjust pH.
+
+*Oxalic acid can be substituted for ascorbic acid to improve virus infectivity. Use oxalic acid dihydrate (FW=126.07) at 2.52g/100ml for 0.2M.*
+
+### 2X Ascorbic Acid Buffer:
+Keep the amount of Tris-base, water, and NaOH the same, but double the amount of EDTA, Mg and ascorbate. Check the pH and add NaOH or HCl to get final pH to 6.5. If increasing 2x, use 1 ml for every 2 mg Fe.
+
+### Notes:
+- The new formulation uses EDTA and MgCl₂.
+- Ensure EDTA has a pH above 8.0 to dissolve.
+- Ascorbic acid may come out of solution if the pH is very high (above 5.0).
+
+### Recipe tested with diluted amounts of key reagents:
+| Reagent                   | ½ Na₂-EDTA (1.86g/100ml) | ½ MgCl₂ (2.04g/100ml) | ½ Oxalic Acid-2H₂O (1.46g/100ml)  |
+|---------------------------|--------------------------|------------------------|-----------------------------------|
+| Tris-base 1.51g/100ml     | clear; pH 10.79          | clear; pH 10.82        | clear; pH 10.78                   |
+| Na₂-EDTA 3.72g/100ml      | clear                    | clear                  | clear                             |
+| MgCl₂·6H₂O 4.07g/100ml    | clear; pH 7.68           | clear; pH 4.89         | clear; pH 4.59                    |
+| 5N NaOH                   | none; pH 7.68            | 1.25ml; pH 7.23        | 1.5ml; pH 7.51                    |
+| Oxalic acid·2H₂O 2.52g/100ml | white; pH 1.68          | cloudy; pH 3.02        | white; pH 3.30                    |
+
+- Final results showed best results with ½ MgCl₂, intermediate results with ½ Oxalic acid, and worst results with ½ Na₂-EDTA.
+
+![Photo of solutions after final pH](path_to_image)
+
+## Protocol
+
+### 1x Buffer
+
+#### Step 1.
+Dissolve 1.51g Tris-base in 80ml Milli Q water.
+
+#### Step 2.
+Dissolve 3.72g Na₂-EDTA dihydrate into solution.
+> **Note:** pH will be ~10.0
+
+#### Step 3.
+Once EDTA is in solution, dissolve 4.07g MgCl₂.
+> **Note:** pH will drop to ~8.0
+
+#### Step 4.
+Add 3ml of NaOH.
+> **Note:** This will drop the pH to ~4.5 and the solution will become cloudy indicating that the EDTA is coming out of solution.
+
+#### Step 5.
+Dissolve the reductant (3.52g of ascorbic acid or 2.52g of oxalic acid).
+> **Note:** The pH will increase to ~8.3 and the solution will clear up.
+
+#### Step 6.
+Once the reductant is in solution, add the last 1ml of NaOH.
+
+#### Step 7.
+Check the pH using pH paper (the buffer should be at pH 6.0 - 6.5).
+> **Note:** The solution may need some minor adjusting with NaOH or HCl to achieve a pH of 6.0, which is ideal for good recovery of viruses.
+
+#### Step 8.
+Check the volume and add MilliQ water for a total volume of 100ml.
+
+#### Step 9.
+Store the buffer in the dark (bottle wrapped in foil) and visually inspect prior to use. It should be clear without precipitates.
+> **Note:** The buffer will start to change color after about 24 hours but it is okay to use if slightly discolored. Do not use after about 36 hours.
+
+## Warnings
+- EDTA needs a pH above 8.0 to dissolve and will come out of solution at pH below 5.0.
+- Ascorbic acid may come out of solution if the pH is very high.
+
+endofoutput
+```

markdown-output/16s-and-gyrb-bacterial-amplification-c6ywzfxe.md

@@ -0,0 +1,204 @@
+```markdown
+## Goal/Experiment:
+The goal of this experiment is to amplify the 16S and gyrB bacterial genes using PCR for subsequent sequencing with PacBio Sequel II and Illumina MiSeq platforms.
+
+# 16S and GyrB Bacterial Amplification
+
+**DOI:** [dx.doi.org/10.17504/protocols.io.36wgg31nylk5/v1](dx.doi.org/10.17504/protocols.io.36wgg31nylk5/v1)
+
+**Author:** Robert Nichols  
+**Institution:** Pennsylvania State University
+
+**Protocol Status:** Working  
+We use this protocol and it's working.
+
+**Created:** January 03, 2024  
+**Last Modified:** July 12, 2024  
+**Protocol Integer ID:** 92918  
+**Keywords:** PCR, gyrB, PacBio, MiSeq
+
+---
+
+## Abstract
+This protocol is used for the amplification of the bacterial _gyrB_ gene and the _16S_ gene for both PacBio Sequel II and Illumina MiSeq sequencing. This protocol is used in the paper titled *Long-read Sequencing Increases the Accuracy and Specificity of the gyrB Phylogenetic Marker Gene*.
+
+---
+
+## Materials
+
+- **Isolated bacterial DNA**
+- **Nuclease-free water** (VWR Cat # 103307-278)
+- **Invitrogen Platinum SuperFi PCR Master Mix** (ThermoFisher Scientific, Cat # 12368250)
+- **1× TAE** (Tris base [Millipore Sigma, Cat # 648311], acetic acid [Millipore Sigma, Cat # 695092], and EDTA [Millipore Sigma, Cat # E9884]) buffer
+- **OmniPur agarose** (VWR, Cat # EM-2070)
+- **GelRed dye** (VWR, Cat # 10098-684)
+- **6x Gel loading dye** (no SDS) (Biolabs, Cat# B7025S)
+- **100-bp DNA ladder** (VWR, Cat# PAG2101)
+- **Ice bath**
+- **NanoDrop UV-Vis Spectrophotometer Lite** (Thermo-Scientific)
+- **Sterile 0.2-ml thin-wall PCR Tubes**, strips of 8 tubes (Denville)
+- **Sterile 0.5- to 10-µl pipettes** (Denville)
+- **Sterile 10- to 200-µl pipettes** (Denville)
+- **Sterile 1000-µl pipettes** (Denville)
+- **T100 Thermal cycler** (BioRad)
+- **Gel electrophoresis box** (Labnet)
+- **ChemiDoc XRS+** (BioRad)
+
+---
+
+## Primer Information
+
+| Primer Name      | Primer Description                               | Primer Sequence                               | Platform  |
+|------------------|--------------------------------------------------|-----------------------------------------------|-----------|
+| **V4_16S_F**     | Forward primer for V4 16S sequencing             | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGTGYCAGCMGCCGCGGTAA | MiSeq     |
+| **V4_16S_R**     | Reverse primer for V4 16S sequencing             | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGTATTACNVGGGTWTTCAAT | MiSeq     |
+| **FL_16S_F**     | Forward primer for full-length 16S sequencing    | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCACAGRGTYTGAATMGGCTCA | PacBio    |
+| **FL_16S_R**     | Reverse primer for V4 full-length sequencing     | /5AmMc6/TGCGACGTCTTGGCACAGATCACTCGAAATGRETCAGGCTTAGR | PacBio    |
+| **SR_GyrB_Bac_F**| Forward primer to amplify the _gyrB_ gene from Bacteroidaceae | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGGGGTAAARTTCGAYAAAGG  | MiSeq |
+| **SR_GyrB_Bac_R**| Reverse primer to amplify the _gyrB_ gene from Bacteroidaceae | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACRT TTYYTCTTCRCGCGCGTAACG | MiSeq |
+| **SR_GyrB_Bif_F**| Forward primer to amplify the _gyrB_ gene from Bifidobacteriaceae | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGGACCRACGGNCGNGCG | MiSeq |
+| **SR_GyrB_Bif_R**| Reverse primer to amplify the _gyrB_ gene from Bifidobacteriaceae | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACCT CCGCTTTGNAACGWAATGC  | MiSeq |
+| **SR_GyrB_Lac_F**| Forward primer to amplify the _gyrB_ gene from Lachnospiraceae | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGGGGWCG GayCGAATTAG | MiSeq |
+| **SR_GyrB_Lac_R**| Reverse primer to amplify the _gyrB_ gene from Lachnospiraceae | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACGGA TRGGTCTGGACCTGRCRTTTCCG | MiSeq |
+| **LR_GyrB_Bac_F**| Forward primer to amplify the _gyrB_ gene from Bacteroidaceae | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCACATACGAYGTT  | PacBio |
+| **LR_GyrB_Bac_R**| Reverse primer to amplify the _gyrB_ gene from Bacteroidaceae | /5AmMc6/TGCGACGTCTTGGCACAGATCACTCGAAAGATTYGCTGTCART | PacBio |
+| **LR_GyrB_Bif_F**| Forward primer to amplify _gyrB_ gene from Bifidobacteriaceae | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCAGACCGCGWCTCGA | PacBio |
+| **LR_GyrB_Bif_R**| Reverse primer to amplify the _gyrB_ gene from Bifidobacteriaceae | TCGARGTSAGCATTCTGCCC | PacBio |
+| **LR_GyrB_Lac_F**| Forward primer to amplify the _gyrB_ gene from Lachnospiraceae | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCAGCTTYACNCGNWNTA | PacBio |
+| **LR_GyrB_Lac_R**| Reverse primer to amplify the _gyrB_ gene from Lachnospiraceae | /5AmMc6/TGCGACGTCTTGGCACAGATCACTCGAAAGATRCCWGWTNNTT | PacBio |
+
+---
+
+## Before Start
+Before starting, ensure you have isolated bacterial DNA and selected primers for amplification.
+
+---
+
+## Prepare DNA for Amplification
+
+1. **Thaw the isolated DNA**  
+2. **Measure DNA concentration on the Nanodrop**  
+   This requires only 1 μL of isolated DNA. Concentration values typically range from 100 ng/μL to 400 ng/μL. The NanoDrop provides an estimate of total DNA concentration. For more accurate results, submit samples for quantification on a Bioanalyzer.  
+3. **Create a 100 μL aliquot at 10 ng/μL concentration**.  
+   3.1. **Calculate required DNA volume**  
+   - Divide 1000 by the average DNA concentration.  
+     Example: If average DNA concentration is 254 ng/μL, then 1000/254 = 3.94. Therefore, use 3.94 μL of original DNA.  
+   3.2. **Calculate water volume**  
+   - Subtract the calculated volume from 100. Example: 100 - 3.94 = 96.06 μL of nuclease-free water.  
+   - Result: 3.94 μL original DNA + 96.06 μL nuclease-free water = 10 ng/μL DNA solution.
+
+---
+
+## 16S and _gyrB_ PacBio and Illumina Amplicon PCR Protocol
+
+### PCR Mix Preparation
+
+4. **Prepare the PCR mix.**
+
+| Reagent                   | Concentration | Volume to make 20 µL of product |
+|------------------------|--------------|-----------------------|
+| Forward primer         | 10 µM        | 0.4 µL                |
+| Reverse primer         | 10 µM        | 0.4 µL                |
+| Platinum SuperFi Master Mix | N/A        | 10 µL                 |
+| Nuclease-Free water    | N/A          | 8.2 µL                |
+
+Adjust volumes based on the number of samples plus one or two extra to ensure sufficient master mix availability. For example, for 15 sample PCR, multiply each volume by 17 (15 samples + 2 extra).
+
+5. **Fill PCR wells**  
+   Fill adequate number of wells with 19 μL of master mix per well.  
+6. **Add DNA to wells**  
+   Add 1 μL of 10 ng/μL DNA directly into the master mix of each well.  
+7. **Mix and spin**  
+   Ensure reagents are mixed by gently flicking and quickly spinning in a mini centrifuge.  
+8. **Run PCR**  
+
+### PCR Settings
+
+8.1 **16S samples for MiSeq**
+
+| Cycle Number | Time       | Temperature | Description         |
+|--------------|------------|-------------|---------------------|
+| 1 cycle      | 2 minutes  | 98°C        | Initial denaturation |
+| 25 cycles    | 10 seconds | 98°C        | Denaturation        |
+|              | 20 seconds | 56.6°C      | Annealing           |
+|              | 15 seconds | 72°C        | Extension           |
+| 1 cycle      | 5 minutes  | 72°C        | Final extension     |
+
+> Optimize PCR cycles for specific requirements to reduce chimeric sequences.
+
+8.2 **16S samples for PacBio**
+
+| Cycle Number | Time       | Temperature | Description         |
+|--------------|------------|-------------|---------------------|
+| 1 cycle      | 30 seconds | 95°C        | Initial denaturation |
+| 25 cycles    | 30 seconds | 95°C        | Denaturation        |
+|              | 30 seconds | 57°C        | Annealing           |
+|              | 1 minute   | 72°C        | Extension           |
+| 1 cycle      | 5 minutes  | 72°C        | Final extension     |
+
+> Optimize PCR cycles to reduce chimeric sequences.
+
+8.3 **GyrB samples for MiSeq**
+
+| Cycle Number | Time       | Temperature | Description         |
+|--------------|------------|-------------|---------------------|
+| 1 cycle      | 2 minutes  | 98°C        | Initial denaturation |
+| 30 cycles    | 10 seconds | 98°C        | Denaturation        |
+|              | 20 seconds | 56.6°C      | Annealing           |
+|              | 15 seconds | 72°C        | Extension           |
+| 1 cycle      | 5 minutes  | 72°C        | Final extension     |
+
+> Optimize PCR cycles to reduce chimeric sequences.
+
+8.4 **GyrB samples for PacBio**
+
+| Cycle Number | Time       | Temperature | Description         |
+|--------------|------------|-------------|---------------------|
+| 1 cycle      | 30 seconds | 95°C        | Initial denaturation |
+| 30 cycles    | 30 seconds | 95°C        | Denaturation        |
+|              | 30 seconds | 57°C        | Annealing           |
+|              | 1 minute   | 72°C        | Extension           |
+| 1 cycle      | 5 minutes  | 72°C        | Final extension     |
+
+> Optimize PCR cycles to reduce chimeric sequences.
+
+---
+
+## Check for Amplification
+
+9. **Create a 1x agarose gel**  
+   - Combine 1 g of agarose and 100 mL of 1x TAE. Microwave for 1 minute and 45 seconds.  
+   - Pour into a mold with appropriate comb. Add 10 μL of Gel Red dye (10,000x). Let cool for 45 minutes to 1 hour.  
+
+10. **Prep amplicons for electrophoresis**
+
+| Reagent          | Concentration | Volume |
+|------------------|---------------|--------|
+| Gel loading dye  | 6x            | 8 µL   |
+| Nuclease-free water | NA        | 16 µL  |
+
+   - Multiply volumes by the number of samples.
+   - Add 20 µL of amplified product to wells with 24 µL of dye-water mix.
+
+11. **Run electrophoresis**  
+    - Run gel at 80 volts for 1 hour.
+    - Check gel in a gel doc to see amplified bands.  
+
+---
+
+## Clean Amplicon Samples with Gel Clean-up Kit
+
+12. **Cut out bands from gel**
+    - Use specialized pipette tips to punch out bands under UV light (wear proper PPE).  
+
+13. **Clean-up with QIAquick Gel Extraction Kit**  
+    - Dissolve gel punch-outs in provided buffer at 50°C for 10 minutes. Add dissolved punch-out mixture to columns. Wash twice with provided buffers and elute with nuclease-free water or elution buffer.  
+
+14. **Submit for sequencing**  
+    - MiSeq: 250x250 Illumina MiSeq  
+    - PacBio: PacBio Sequel II  
+
+---
+
+**endofoutput**
+```

markdown-output/2-agarose-gel-cac7sazn.md

@@ -0,0 +1,115 @@
+```markdown
+# Goal/Experiment:
+To prepare and use a 2% agarose gel for the separation and analysis of DNA fragments through gel electrophoresis.
+
+# 2% Agarose Gel
+
+**Author:** George Testo  
+**Affiliation:** The Pathogen & Microbiome Institute  
+**Date:** May 31, 2022  
+**Protocol Shared via:** [protocols.io link](https://protocols.io/view/2-agarose-gel-cac7szan)  
+**Date of Protocol:** Jun 03, 2022  
+
+**Disclaimer:**
+TO THE EXTENT ALLOWED BY LAW, LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) WILL NOT BE LIABLE FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING YOUR USE OF IT.
+
+## Introduction
+
+Agarose gel electrophoresis is a method used in biochemistry, molecular biology, genetics, and clinical chemistry to separate a mixed population of macromolecules such as DNA or proteins in a matrix of agarose, one of the two main components of agar. The molecules are separated by applying an electric field to move the charged molecules through an agarose matrix, with separation primarily based on size.
+
+Routinely, agarose gels are suitable for separating DNA of various size ranges, can be stained and visualized under UV light, and DNA fragments can be extracted from the gel easily.
+
+## Reagents
+
+- 1 x DI Water
+- 1 x bottle of TAE (or TBE)
+- 1 x bottle of Agarose Powder
+- 1 x bottle of SYBR Safe
+- 1 x bottle of 6x Loading Dye
+
+## Supplies
+
+- Green temporary seal(s)
+- Foil seal(s)
+
+## Equipment
+
+- 10µL pipette, tip box, & tips
+- 20µL pipette, tip box, & tips
+- 200uL pipette, tip box, & tips
+- 1000uL pipette, tip box, & tips
+- Serological pipette & 10mL tip
+
+### Note on SYBR™ Safe Dye:
+SYBR™ Safe DNA gel stain showed no or very low mutagenic activity in tests and is not classified as hazardous waste under U.S. Federal regulations. However, standard care should be taken when handling and disposing of this reagent in compliance with all local regulations.
+
+#### Storage:
+SYBR™ Safe DNA gel stain can be stored between 2°C to 25°C. SYBR™ Safe in DMSO freezes at low temperatures; it must be completely thawed and mixed before use.
+
+## Procedure
+
+### Pouring a Standard 2% Agarose Gel (21 min)
+
+1. **Measure 1g of Agarose.**
+
+2. **Prepare Agarose Solution:**
+   - Mix agarose powder with **49mL of DI water and 1mL of 50x TAE** in a microwavable flask.
+
+3. **Dissolve Agarose:**
+   - Microwave for **1-3 minutes** until the agarose is completely dissolved.
+     > **Note:** Do not overboil to avoid buffer evaporation which alters gel percentage. Prefer pulse microwaving to avoid boiling.
+
+4. **Cool Agarose Solution:**
+   - Let the solution cool down to **about 50°C for about 5 minutes**.
+
+5. **(Optional) Stain Agarose:**
+   - Add **5uL of SYBR Safe** to the flask.
+     > **Note:** SYBR Safe binds to DNA, allowing visualization under UV light. If using EtBr, handle it with caution as it's a mutagen.
+
+6. **Pour Gel:**
+   - Pour the agarose into a gel tray with well comb in place.
+
+7. **Solidify Gel:**
+   - Place newly poured gel at **4°C for 15 minutes** or let it sit at room temperature for 30 minutes until completely solidified.
+     > **Note:** Pour slowly to avoid disrupting bubbles. Use a pipette tip to push the bubbles away if they form.
+
+### Loading Samples and Running an Agarose Gel (21 min)
+
+8. **Add Loading Buffer to Samples:**
+   - Prepare ladder dilution: **Molecular Grade Water + 10uL of 1kb Ladder**.
+   - Mix at least **10uL of ladder or sample with 2uL of 6x Loading Dye** for a total volume of 12uL.
+     > For lower DNA concentrations, mix **15uL of ladder or sample with 2.5uL of 6x Loading Dye.**
+
+9. **Place Gel in Box:**
+   - Once solidified, place the agarose gel into the gel box (electrophoresis unit).
+
+10. **Add Running Buffer:**
+    - Fill the gel box with **1x TAE** (or TBE) until the gel is covered.
+
+11. **Load Ladder:**
+    - Carefully load a molecular weight ladder into the first lane of the gel.
+
+12. **Load Samples:**
+    - Carefully load your samples into the additional wells of the gel.
+
+13. **Run Gel:**
+    - Run the gel at **80-150V** until the dye line is approximately **75-80% of the way down the gel**.
+      > Typical run time is about 1-1.5 hours, depending on gel concentration and voltage.
+      > **Note:** Always run to RED (positive electrode).
+
+### Analyzing Your Gel (21 min)
+
+14. **Stop Run:**
+    - Turn OFF power, disconnect electrodes, and carefully remove the gel from the box.
+      > If EtBR was used, place the gel into running buffer and destain.
+
+15. **Visualize Gel:**
+    - Visualize DNA fragments using a UV light device.
+      > **Note:** For longer storage or less damage, use long-wavelength UV and minimize exposure time.
+
+**Caution:** When using UV light, protect your hands and eyes by wearing appropriate PPE (Personal Protective Equipment).
+
+---
+
+**End of Output**
+```

markdown-output/2023-genometrakr-proficiency-testing-exercise-puls-cs8uwhww.md

@@ -0,0 +1,192 @@
+```markdown
+# 2023 GenomeTrakr Proficiency Testing Exercise (PulseNet Harmonized) V.7
+
+## Goal/Experiment:
+The goal of this proficiency testing exercise is to provide standardized guidelines for GenomeTrakr (GT) laboratories to process isolates, generate sequencing data, and report results for the 2023 GenomeTrakr Proficiency Testing exercise. The exercise aims to ensure consistent and accurate detection of foodborne pathogens using Whole Genome Sequencing (WGS).
+
+### Authors:
+Maria Balkey¹, Ruth Timme¹, Julie Haendiges¹, Tina.Pfefer¹
+¹ U.S. Food and Drug Administration
+
+## Abstract:
+This Standard Operating Procedure (SOP) outlines guidelines for processing the isolates for the 2023 GenomeTrakr (GT) Proficiency Testing exercise. It is applicable to all GenomeTrakr labs participating in the 2023 GenomeTrakr Proficiency Testing exercise (PulseNet Harmonized).
+
+### Version Updates:
+- **v5:** Added links to GalaxyTrakr_PT_exercise_report_2022.xlsx
+- **v6:** added 2023 PT strains; edited Steps 1, 2, 4, and 5 to include references to growth of Listeria on BHIA plates; Updated Tables in Steps 7.1 and 8.1 with sample information for 2023 PT strains.
+- **v7:** Section 9 and Section 11: deleted file GalaxyTrakr_PT_exercise_report_2023.xlsx; uploaded new file version GalaxyTrakr_PT_exercise_report_2023-v2.xlsx
+
+### Proficiency Testing Isolates:
+The FDA GenomeTrakr program will ship the following proficiency testing isolates in April 2023:
+
+| Strain ID     | Organism                |
+| ------------- | ----------------------- |
+| ESP23-5286    | Escherichia/Shigella    |
+| ESP23-9201    | Escherichia/Shigella    |
+| SAP23-3307    | Salmonella              |
+| LMP23-6714    | Listeria                |
+
+Completion of the entire proficiency test entails the following:
+- GT participating laboratory generates sequencing data (fastq files) using the PT strains provided by CDC through FDA-CFSAN-WGS Program-GT in accordance with GT and/or PulseNet SOPs.
+- Populate sample sheet according to 2023 GT Proficiency Testing exercise (PulseNet Harmonized) SOP.
+- Submission of sequencing records to the appropriate project on BaseSpace or Isilon according to GT SOPs.
+- By participating in the 2023 GT Proficiency Testing exercise (PulseNet Harmonized), GT labs provide consent to use the PT exercise data in subsequent analysis and manuscript publications. Participants will be acknowledged for their contribution on any publication that might require processing data from the 2023 GT PT exercise.
+
+## Materials
+### Materials Needed:
+- Sterile sturdy forceps
+- 1 ml pipetman
+- 1 ml sterile pipet tips
+- 1 µl and/or 10 µl sterile inoculating loop
+
+### Reagents Needed:
+- Trypticase Soy + 5% Sheep Blood Agar plates (BAP) or equivalent media
+- BHIA plates
+- Sterile reagent grade water or Phosphate Buffered Saline (0.01M PBS; pH 7.4)
+- BHI broth
+- 70% isopropyl alcohol
+
+## Safety Warnings
+- **Biological Safety Warning:** _Escherichia/Shigella_, _Salmonella_, and _Listeria_ strains are considered Level 2 biological agents by the U.S. Department of Health and Human Services. Use appropriate precautions when handling the vial or culture. Carry out laboratory work in a biological safety cabinet when applicable to ensure aseptic conditions and personal safety.
+
+## Before Start Instructions:
+There are four sections in this protocol:
+1. Culture preparation of lyophilized isolates.
+2. Sequencing
+3. Data Transfer
+
+## Culture Preparation
+### 1. Salmonella, Escherichia/Shigella, and Listeria Lyophilized cultures:
+#### Day 1:
+1. Document the isolate number(s) and the lyophilized date(s) for your records. Wipe the aluminum cover and outside of the vial with isopropyl alcohol. Using sturdy forceps, aseptically remove the aluminum cover and rubber stopper from the vial containing the lyophilized culture. Wipe the outside of the rubber stopper and neck of the vial with isopropyl alcohol before removing the stopper.
+2. Re-suspend the lyophilized cells with 1 ml of sterile reagent grade water. Allow to stand for a few minutes and/or mix gently to produce a uniform suspension. Plate 10 µl of this suspension onto a blood agar plate (BAP) (or BHIA plate for Listeria) and incubate at 37°C overnight in aerobic conditions. It is recommended to plate in duplicate to ensure adequate growth.
+3. Add the rest of the suspension to 5 mL of BHI broth and incubate the culture overnight at 37°C in aerobic conditions.
+
+#### Day 2 and 3:
+4. Check the BAPs and BHIA plates; if the culture appears pure, pick an isolated colony, and streak it on a fresh plate; incubate at 37°C overnight in aerobic conditions. Use the growth from this plate to make DNA templates of the PT strains. Transfer culture to fresh medium and incubate at 37°C overnight; this will ensure that the same culture can be retested, if necessary.
+
+#### Optional:
+5. If plates don't show bacterial growth, prepare a new plate by taking a loop from the BHI overnight culture (prepared at step 3), streak it on a BAP or BHIA plate as appropriate and incubate at 37°C overnight in aerobic conditions. On the next day check BAP or BHIA plate and proceed as step 4.
+
+## Sequencing
+### 6. Perform DNA extraction, library preparation and sequencing according to lab's normal workflow described on SOPs posted at GenomeTrakr protocols.io:
+   - [Manual DNA Extraction Using Qiagen DNeasy Blood & Tissue Kit](https://www.protocols.io/view/manual-dna-extraction-using-qiagen-dneasy-blood-an-81wgqb391qvk/v1)
+   - [Procedure for Operation and Maintenance of the Illumina MiSeq](https://www.protocols.io/view/procedure-for-operation-and-maintenance-of-the-ill-rm7vz8z52wx1/v1)
+   - [Illumina DNA Prep (M)-Tagmentation Library Preparation](https://www.protocols.io/view/illumina-dna-prep-m-tagmentation-library-preparati-x54v9m7ezg3e/v2)
+   - [DNA Quantification Using the Qubit Fluorometer](https://www.protocols.io/view/dna-quantification-using-the-qubit-fluorometer-81wgbp3x3vpk/v1)
+
+### PulseNet Labs:
+- Will process isolates according to PulseNet Guidelines.
+- Isolates must be processed exactly as any routine isolate would be processed in the laboratory.
+
+### 7. Sequencing sample sheets must be filled out according to Table 1:
+#### 7.1 Sample_ID:
+Include in this field the values from the Sample_ID column of Table 1,*do not modify these IDs*. You will also find this identifier in the vial of the lyophilized culture.
+
+| Sample_ID    | Sample_Name           | Project                                  | Description |
+| ------------ | ----------------------| -----------------------------------------| ------------|
+| ESP23-5286   | ESP23-5286-M0XXXX-20230424 | PR0403_2023_Proficiency_Testing_Exercise | Escherichia/Shigella |
+| ESP23-9201   | ESP23-9201-M0XXXX-20230424 | PR0403_2023_Proficiency_Testing_Exercise | Escherichia/Shigella |
+| SAP23-3307   | SAP23-3307-M0XXXX-20230424 | PR0403_2023_Proficiency_Testing_Exercise | Salmonella |
+| LMP23-6714   | LMP23-6714-M0XXXX-20230424 | PR0403_2023_Proficiency_Testing_Exercise | Listeria |
+
+#### Non PulseNet Labs:
+NextSeq 1000/2000 and MiSeq systems running Windows 10 (MCS v4 and up) have only Sample_ID available in the sequencing sample sheet, populate the Sample_ID column with the values in the Sample_ID column of Table 1.
+
+### 7.2 Sample_name:
+#### Non PulseNet Labs:
+- Fill out this field according to example provided in column Sample_Name of table 1. Include the isolate identifier, instrument ID (M0XXXX where "XXXX" corresponds to the instrument identifier) and run start date. (e.g. ESP23-5286_M01001-20230424).
+
+#### PulseNet Labs:
+- Include the isolate identifier, lab ID, Instrument ID (M0XXXX where "XXXX" corresponds to the instrument identifier) and run start date. (e.g. ESP23-5286-GA-M01001-20230424).
+
+### 7.3 Project:
+- Please fill out the project field with the project identifier PR0403_2023_Proficiency_Testing_Exercise.
+
+### 7.4 Description:
+- For your use only, we do not track this field. Organism names might be included in this field.
+
+## Replicates
+### 8. Are you running more than one set of PT isolates in a run?
+- **YES:** Proceed to Step 8.1
+- **NO:** Proceed to Step 9.
+
+### 8.1 Modify Isolate identifiers (IDs at vial of lyophilized culture) to create unique identifiers for PT replicated isolates by adding suffixes such as: "_2" or "_3" to isolate identifiers.
+
+#### Non-PulseNet Laboratories:
+If you choose to run replicates, the sample sheet must contain unaltered isolate identifiers for each PT strain in the Sample_name field. Identifiers in the sample_ID field must include the isolate identifier, replicate, instrument Id and start run date.
+
+| Sample_ID               | Sample_Name | Project                             | Description           |
+| ----------------------- | ----------- | ----------------------------------- |-----------------------|
+| ESP23-5286-1-M0XXXX-20230424 | ESP23-5286 | PR0403_2023_Proficiency_Testing_Exercise | Escherichia/Shigella  |
+| ESP23-9201-1-M0XXXX-20230424 | ESP23-9201 | PR0403_2023_Proficiency_Testing_Exercise | Escherichia/Shigella  |
+| SAP23-3307-1-M0XXXX-20230424 | SAP23-3307 | PR0403_2023_Proficiency_Testing_Exercise | Salmonella            |
+| LMP23-6714-1-M0XXXX-20230424 | LMP23-6714 | PR0403_2023_Proficiency_Testing_Exercise | Listeria              |
+...
+
+#### PulseNet Laboratories:
+- Identifiers in the sample_ID and sample_Name fields must include the isolate identifier, replicate, lab ID, instrument Id and start run date.
+
+| Sample_ID                         | Sample_Name         | Project                             | Description           |
+| --------------------------------- | ------------------- | ----------------------------------- |-----------------------|
+| ESP23-5286_1_GA_M0XXXX_20230424   | ESP23-5286_1_GA_M0XXXX_20230424 | PR0403_2023_Proficiency_Testing_Exercise | Escherichia/Shigella  |
+| ESP23-9201_1_GA_M0XXXX_20230424   | ESP23-9201_1_GA_M0XXXX_20230424 | PR0403_2023_Proficiency_Testing_Exercise | Escherichia/Shigella  |
+| SAP23-3307_1_GA_M0XXXX_20230424   | SAP23-3307_1_GA_M0XXXX_20230424 | PR0403_2023_Proficiency_Testing_Exercise | Salmonella            |
+| LMP23-6714_1_GA_M0XXXX_20230424   | LMP23-6714_1_GA_M0XXXX_20230424 | PR0403_2023_Proficiency_Testing_Exercise | Listeria              |
+...
+
+### 8.2 Project:
+- Please fill out the project field with the project identifier PR0403_2023_Proficiency_Testing_Exercise.
+
+### 8.3 Description:
+- For your use only, we do not track this field.
+
+## Quality of sequencing run
+### 9. Data analysis results must be reported to GenomeTrakr in the spreadsheet included in the attachment.
+- Check the quality of your sequencing records by following the SOP [Assessing sequence quality in GalaxyTrakr](https://). Note that Shigella isolates will be predicted as Escherichia coli with PubMLST scanning of contigs. The result is acceptable. Report your findings in the spreadsheet GalaxyTrakr_PT_exercise_report_2023-v2.xlsx, sheet MicroRunQC.
+- Run the tool [ShigaTyper](https://) for Shigella genoserotyping. Report your findings in the spreadsheet GalaxyTrakr_PT_exercise_report_2023, sheet ShigaTyper.
+- Run the tool [SeqSero2](https://) for Salmonella serotyping. Report your findings in the spreadsheet GalaxyTrakr_PT_exercise_report_2023, sheet SeqSero.
+
+## Data Transfer
+### 10. Data Transfer
+After checking the quality of your records, transfer the data and associated QC results to GenomeTrakr.
+
+#### 10.1 Sharing a run in BaseSapce
+- Click the Runs tab in the Illumina BaseSpace website.
+- Select the run that you would like to share with the GenomeTrakr team.
+- Go to the summary tab and click at the share button.
+- Enter the email address for the FDA team ([email protected]), and then click Add Collaborator.
+- Click Save Settings. Your run will be automatically shared with the GenomeTrakr team.
+
+#### 10.2 Sharing a project in BaseSapce
+- Click the Projects tab in the Illumina BaseSpace website.
+- Select the project (PR0403_2023_Proficiency_Testing_Exercise) that you would like to share with the GenomeTrakr team.
+- Click the share project button.
+- Enter the email address for the FDA team ([email protected]), and then click Add Collaborator.
+- Click Save Settings. Your project will be automatically shared with the GenomeTrakr team.
+
+#### 10.3 Labs inside the FDA network
+- Must share the sequencing files by transferring the sequencing run folder to the isilon storage drive.
+
+### 11. PT Exercise Completion Notification
+- Notify GenomeTrakr of your completion of the PT exercise by sending an email to: [email protected]. The subject line should include “2023 WGS Proficiency Testing_YourLabName”, attach sequencing sample sheet and include the following information in the body of the email:
+  - Run name:
+  - Sequenced by:
+  - Results submitted by:
+  - MiSeq ID:
+  - Flow cell ID:
+  - SOP Protocol: (Select one of the options)
+    - PulseNet SOP
+    - GenomeTrakr SOP
+
+#### Non-PulseNet Laboratories, please include
+- GalaxyTrakr_PT_exercise_report_2023-v2.xlsx in the attachments of the notification email.
+
+#### PulseNet Laboratories
+- Must send the 2023 Proficiency Testing exercise data and results to PulseNet.
+
+### 12. 
+00:00:00
+
+endofoutput
+```

markdown-output/3-39-tagseq-library-preparation-protocol-cgcbtssn.md

@@ -0,0 +1,257 @@
+```markdown
+# Goal/Experiment:
+3' TagSeq Library Preparation Protocol
+
+## Abstract
+
+Purpose: This protocol is designed for constructing libraries targeting the 3' ends of mRNA for gene expression profiling and offers an alternative to standard RNA-Seq.
+
+**DOI:**  
+[dx.doi.org/10.17504/protocols.io.q26g7yrr3gwz/v1](dx.doi.org/10.17504/protocols.io.q26g7yrr3gwz/v1)
+
+**Protocol Citation:**  
+anni.wang 2022. 3' TagSeq Library Preparation Protocol. protocols.io [URL](https://protocols.io/view/3-39-tagseq-library-preparation-protocol-cgcbtssn)
+
+**License:**  
+This is an open access protocol distributed under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/).
+
+**Created:**  
+Sep 08, 2022  
+**Last Modified:**  
+Sep 09, 2022  
+
+## Materials
+
+| Reagent                                 | Vendor/Catalog #            | Storage           |
+| --------------------------------------- | --------------------------- | ----------------- |
+| 10mM dNTPs                              | NEB/N0447L                  | Freezer           |
+| 0.1M DTT (aliquots)                     | ThermoFisher/707265ML       | Freezer           |
+| 5X First Strand (FS) buffer             | Takara(Clontech)/639537     | Freezer           |
+| SMARTScribe Reverse Transcriptase       | Takara(Clontech)/639537     | Freezer           |
+| Klentaq DNA polymerase                  | DNA Polymerase tech/SKU: 100 | Freezer           |
+| 10X Klentaq 1 buffer                    | DNA Polymerase tech/SKU: 100 | Freezer           |
+| 3iLL-30TV primer                        | IDT                         | Freezer           |
+| 5iLL primer                             | IDT                         | Freezer           |
+| Template Switching Oligos (TSO) 4 oligos | IDT                         | -80                |
+| Agencourt AMPure Beads XP               | Beckman Coulter A63881      | Fridge            |
+| 80% EtOH                                | Prepared fresh              | Flammable cabinet |
+| Eppendorf twin-tec 96-well PCR plate    | Eppendorf (VWR:95041-440)   | Shelf             |
+| Adhesive PCR plate foil seal            | Fisher                      | Shelf             |
+| 96-well plate magnet                    | ThermoFisher AM10027        | Shelf             |
+| Bioanalyzer kits (HS and Pico)          | Aligent: HS DNA: 5067-4626; RNA 6000 Pico: 5067-1513 | Fridge |
+| Index Primers                           | IDT                         | Freezer           |
+| Pippin Prep Cassettes/Reagents          | BDF1510                     | Shelf and Fridge  |
+| MinElute Column                         | Qiagen #28006               | Fridge            |
+| PB Binding Buffer                       | Qiagen #28006               | Shelf             |
+| PE Wash Buffer                          | Qiagen #28006               | Shelf             |
+
+### Template Switching Oligos (4) Specifications
+
+1. Order on IDT [IDT URL](https://idtdna.com)
+   - Go to "DNA&RNA" -> "Custom RNA oligos"
+   - Order RNA oligos by the tube and customize each oligo in their template.
+
+**General Specifications:**
+- Product: 100nmole RNA Oligo
+- Guarantee: 0.3 nmol
+- Purification: RNase-Free HPLC
+- Additional Services: Level II Setup Fee
+
+### Index Primer 96 Well Adapter Plate
+
+**General Specifications:**
+- Guarantee: 1.38 nmol
+- Final Concentration: 10 µM
+- Quantity: 1.38 nmol
+- Buffer: IDTE Buffer pH 8.0 (10mM Tris-HCl/0.1 mM EDTA)
+- Purification: Standard Desalting
+- Plate Product: Tru-Seq - Compatible Indexing Primer, 16 rxn
+- Plate Type: Matrix- Screw Top
+
+## RNA Fragmentation and RT Primer Annealing
+
+### 1. RNA Fragmentation and RT Primer Annealing
+
+*Input material should be at least 25 µl of high-quality DNAse-treated RNA in water normalized to 50 ng/µl (acceptable range: 5ng/µl to 100ng/µl).*
+
+1.1 Clean bench, pipettes, ice bucket, and all equipment with RNaseZAP and 70% EtOH. Thaw RNA and reagents on ice.
+
+1.2. Preheat the thermocycler to 95°C for 10-15 min.
+
+1.3. Label a 96-well plate with appropriate information (plate#, date, initials, and SOP step).
+
+1.4. Pipette RNA and nuclease-free H2O to a total of 10 µl (50ng-1000ng) into each well. This can be done using a liquidator or a 20 µl multichannel pipette.
+
+1.5. Prepare the RNA fragmentation/RT master mix:
+
+| Reagent          | Volume per Sample | Volume in Master Mix for 40 Samples +10% (44 total) |
+| ---------------- | ----------------- | -------------------------------------------------- |
+| dNTPs (10mM)     | 1 µl              | 44 µl                                              |
+| 0.1M DTT         | 2 µl              | 88 µl                                              |
+| 5x FS buffer     | 4 µl              | 176 µl                                             |
+| 3iLL-30TV (10uM) | 1 µl              | 44 µl                                              |
+| Total RNA (H2O if needed) | 10 µl   | 440 µl                                             |
+| Total volume     | 18 ��l             | 352 µl                                             |
+
+1.6. Mix the master mix by gentle inversion or pipetting and briefly spin in a mini-centrifuge.
+
+1.7. Aliquot 8 µl of master mix into each RNA sample using a multi-channel pipette, pipette 3-5 times to mix.
+
+1.8. Cover the plate with foil seal, briefly spin, and start the fragmentation program as specified in an RT thermocycler.
+
+1.9. Remove the plate and incubate on ice for 2 minutes.
+
+1.10. **Optional:** Perform fragment analysis on a subset of samples if necessary. Replace 1.5 µl of 1x FS buffer into each well.
+
+### 2. First-Strand cDNA Synthesis
+
+2.1. Briefly centrifuge and remove foil seal from the RNA plate, return the plate to ice.
+
+2.2. Prepare the master mix:
+
+| Reagent             | Volume per Sample | Volume in Master Mix for 40 Samples +10% (44 total) |
+| ------------------- | ----------------- | -------------------------------------------------- |
+| Template switch oligo pool (10 µM) | 0.1 µl       | 4.4 µl |
+| SMARTScribe RT      | 1 µl               | 44 µl                                              |
+
+2.3. Add 2 µl of the oligo/RT master mix to each sample. Pipet 4-5 times to mix.
+
+2.4. Start the first strand cDNA synthesis program in a thermocycler:
+
+   - 42°C for 1 hr
+   - 65°C for 15 min
+
+### 3. AMPure Bead Purification
+
+3.1. Vortex AMPure beads well, dispense enough (45 µl/sample) to a 50 mL reservoir. Prepare a second reservoir with nuclease-free H2O.
+
+3.2. Briefly centrifuge the first-strand cDNA plate in a mini plate spinner. Add 30 µl of H2O to each sample, bringing the total volume to 50 µl.
+
+3.3. Perform a 0.9x AMPure bead purification: adding 45 µl AMPure beads, mixing well, incubating 15 minutes at RT.
+
+3.4. Prepare 80% EtOH during incubation (200 µl EtOH/sample).
+
+3.5. Place the plate on the magnet until beads are collected (approx. 5 min).
+
+3.6. Wash beads with 100 µl 80% EtOH, incubate 30 sec, discard wash. Repeat.
+
+3.7. Remove remaining EtOH and let samples air dry for 3-5 min. Avoid over-drying.
+
+3.8. Resuspend beads in 15 µl H2O, mix well, and collect on magnet.
+
+3.9. Transfer 10 µl of cleaned cDNA to new 96-well plate using Liquidator or multi-channel. Label the plate accordingly.
+
+3.10. This is a safe stopping point. Cover plate with foil seal and store in freezer.
+
+### 4. cDNA Amplification
+
+4.1. Prepare the master mix for cDNA amplification:
+
+| Reagent                    | Volume per sample | Volume in Master Mix for x10 Samples |
+| -------------------------- | ----------------- | ------------------------------------ |
+| RNA/DNA-free H2O           | 6 µl              | 60 µl                                |
+| dNTPs (10mM)               | 0.5 µl            | 5 µl                                 |
+| 10x Klentaq 1 buffer       | 2 µl              | 20 µl                                |
+| 10 µM 5iLL oligo           | 0.5 µl            | 5 µl                                 |
+| 10 µM 3iLL-30TV oligo      | 0.5 µl            | 5 µl                                 |
+| Klentaq                    | 0.5 µl            | 5 µl                                 |
+| Purified cDNA              | 10 µl             | 100 µl                               |
+| Total Volume               | 20 µl             | 200 µl                               |
+
+4.2. Mix by inversion, briefly spin.
+
+4.3. Aliquot 10 µl of master mix into each cDNA sample. Pipet, cover with foil seal, spin, and start thermocycler program:
+
+| RNA Input            | PCR Cycle #   |
+| -------------------- | ------------- |
+| <150 ng              | 18 cycles     |
+| 150-400 ng           | 14 cycles     |
+| 400-1000 ng          | 10 cycles     |
+
+   - Initial Denaturation: 94°C, 5 min
+   - Denaturation: 94°C, 1 min
+   - Annealing: 63°C, 2 min
+   - Extension: 72°C, 2 min
+   - Hold: 4°C, infinite
+
+### 5. AMPure Cleanup
+
+5.1. Vortex AMPure beads, dispense 45 µl/sample to reservoir. Prepare a second reservoir with H2O.
+
+5.2. Centrifuge cDNA plate, add 30 µl H2O, bringing volume to 50 µl.
+
+5.3. Add 45 µl AMPure beads, mix well, incubate 15 min at RT, wash twice with 100 µl 80% EtOH.
+
+5.4. Remove any remaining ethanol and air-dry for 3-5 min.
+
+5.5. Resuspend samples in 22 µl water, mix well, collect beads on magnet for 5 min.
+
+5.6. Transfer 10 µl amplified cDNA into two new 96-well plates; one for Index PCR, the other for storage (freezer).
+
+### 6. Index Addition via PCR
+
+6.1. Document the index primer correlates. Add 3 µl of index (3.9µM) to each sample.
+
+6.2. Prepare the following master mix:
+
+| Reagent              | Volume per sample | Volume in Master Mix for x10 Samples |
+| -------------------- | ----------------- | ------------------------------------ |
+| RNA/Nuclease-free H2O| 12.65 µl          | 126.5 µl                             |
+| dNTPs                | 0.75 µl           | 7.5 µl                               |
+| 10x PCR buffer       | 3 µl              | 30 µl                                |
+| Klentaq              | 0.6 µl            | 6 µl                                 |
+| Amplified cDNA       | 10 µl             | 100 µl                               |
+| Total Volume         | 30 µl             | 300 µl                               |
+
+6.3. Mix by inversion, briefly spin.
+
+6.4. Add master mix to samples depending on index plate used. Run thermocycler program:
+
+   - Initial Denaturation: 95°C, 5 min
+   - Denaturation: 95°C, 40 sec (4 cycles)
+   - Annealing: 63°C, 2 min
+   - Extension: 72°C, 2 min
+   - Hold: 4°C, infinite
+
+### 7. AMPure Cleanup
+
+7.1. Vortex AMPure beads, dispense 27 µl/sample to reservoir. Prepare a second reservoir with H2O.
+
+7.2. Perform 0.9X AMPure bead purification:
+
+   - Add 27 µl AMPure beads
+   - Mix 10 times
+   - Incubate 15 min at RT
+   - Wash with 100 µl 80% EtOH (twice)
+   - Remove ethanol, air dry for 3-5 min
+   - Resuspend samples in 28 µl water and mix well
+
+7.3. Remove 25 µl to a new 96-well plate, label accordingly.
+
+### 8. PicoGreen and Library QC
+
+*Supplement with tapestation protocol if desired.*
+
+8.1. PicoGreen the plate using standards starting at 50ng/µl. Run and save values.
+
+8.2. Verify library concentration using Qubit if PicoGreen shows low levels.
+
+8.3. Troubleshoot as necessary, repeat library prep if needed.
+
+### 9. Pooling
+
+9.1. Designate pools of 24-32 samples, aiming for 50ng per sample.
+
+9.2. Enter the ng amount for sample pooling, adjust as necessary.
+
+9.3. Centrifuge final library plate, label and store tubes.
+
+### 10. Size Selection
+
+10.1. Adjust pool volume to 60 µl, use Speedvac for drying or H2O for adjustment.
+
+10.2. Run 2% dye-free gel on Blue Pippin system to size-select 350-550bp fragments.
+
+10.3. Label tubes as final libraries, confirm size selection, and store.
+
+**endofoutput**

markdown-output/3-level-sci-rna-seq-with-facs-buxdnxi6.md

@@ -0,0 +1,238 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to perform a 3-level sci RNA-Seq (single-cell combinatorial indexing RNA sequencing) with the addition of Fluorescence Activated Cell Sorting (FACS) to decrease background noise during the library preparation stage.
+
+## 3-level sci RNA-Seq with FACS
+
+**David Fraser Read¹, Cole Trapnell¹**  
+¹University of Washington, Dept. of Genome Sciences  
+
+**DOI:** [dx.doi.org/10.17504/protocols.io.buxdnxi6](https://dx.doi.org/10.17504/protocols.io.buxdnxi6)
+
+### Abstract
+This protocol is a variant of "3 level sci RNA-Seq" which includes a FACS sorting step before the PCR stage. This notable addition helps to decrease background in the library preparation.
+
+### Guidelines
+This protocol is an adaptation and includes:
+- Addition of FACS sorting to reduce background noise.
+- Omission of the USER enzyme reaction step.
+- Modified reverse transcription temperature ramp to enhance the number of unique molecular identifiers (UMIs) recovered per nucleus.
+
+### Materials
+
+#### Supplies
+- **Nuclease-free water** (Ambion, AM 9937)
+- **Snap Cap FACS Tube** (Corning, 08-771-23)
+- **SUPERase In RNase Inhibitor 20 U/μL** (Thermo Fisher Scientific, AM2696)
+- **BSA 20 mg/mL** (NEB, B9000S)
+- **1M Tris-HCl (pH 7.4)** (Thermo Fisher Scientific, AM9759)
+- **5M NaCl** (Thermo Fisher Scientific, AM9759)
+- **1M MgCl2** (Thermo Fisher Scientific, AM9530G)
+- **Triton X-100 for molecular biology** (Sigma Aldrich, 93443-100ML)
+- **10mM dNTP** (Thermo Fisher Scientific, R0192)
+- Indexed oligo-dT primers (100uM, 5'/5Phos/CAGACGNNNNNNNNNNT10bp barcode)
+- **Superscript IV RNase Inhibitor** (Invitrogen, 10777019)
+- **Quick ligation kit** (NEB, M2200L)
+- **Elution buffer** (Qiagen, 19086)
+- **NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module** (NEB, E7550S)
+- **DNA binding buffer** (Zymo Research, D4004-1-L)
+- **AMPure XP beads** (Beckman Coulter, A63882)
+- **Ethanol** (Sigma Aldrich, 459844-4L)
+- **Qubit dsDNA HS kit** (Invitrogen, Q32854)
+- **Qubit tubes** (Invitrogen, Q32856)
+- **Nextera 96 plate** (Illumina)
+- Various falcon tubes and tips
+- **BrightLine™ Hemacytometer** (Sigma Aldrich)
+- **LoBind clear 1.5 mL PCR clean** (Eppendorf, 03-395-565; 22343102)
+
+#### Equipment
+- **FACS Aria II Sorter** with 96 well plate holder
+- **Ice buckets**
+- **Refrigerated centrifuge** with 15 mL tube holders
+- **ScreenTape** (Agilent)
+- **Qubit** (Thermo)
+
+#### N7-loaded Tn5
+The original use of the protocol involved custom Tn5 loaded with Nextera N7 adapters (commercial equivalent example: Illumina FC-121-1030). Alternatively, unloaded Tn5 can be purchased and adapters loaded per the method described [here](https://www.biorxiv.org/content/10.1101/2019.12.17.879304v1.full.pdf).
+
+## Protocol
+
+### Buffer Preparation
+
+1. **Nuclei Buffer:**
+   - Combine: 
+     - 10 mM Tris-HCl (pH 7.4)
+     - 10 mM NaCl
+     - 3 mM MgCl2  
+   - Store at 4°C.
+
+2. **Nuclei Suspension Buffer (NSB):**
+   - 1 mL Nuclei Buffer  
+   - 10 μL BSA  
+   - 10 μL SUPERaseIn  
+   - Chill on ice.
+
+3. **Nuclei Buffer with BSA (NBB):**
+   - 1 mL Nuclei Buffer
+   - 10 μL BSA
+   - Chill on ice.
+
+4. **10% Triton X-100 Stock:**
+   - 1 mL Triton X-100  
+   - 9 mL Nuclease-free water.  
+   - Store at 4°C.
+
+5. **Permeabilization Buffer:**
+   - 500 μL per sample:
+   - 12.5 μL of 10% Triton X-100
+   - 487.5 μL NSB
+   - Pre-chill on ice.
+
+### Permeabilization
+
+6. **Thaw**
+   - Thaw frozen aliquots at 37°C in water bath.
+
+7. **Buffer Addition**
+   - Add 400 μL of Permeabilization Buffer. Mix gently.
+
+8. **Incubate**
+   - Incubate for 3 minutes on ice.
+
+9. **Pellet and Resuspend**
+   - Pellet at 500g for 5 min (4°C), discard supernatant and resuspend.
+
+10. **Recentrifuge**
+    - Pellet at 500g for 5 min (4°C), discard supernatant.
+
+11. **Resuspend**
+    - Resuspend in 300 μL NSB and count nuclei with hemocytometer.
+
+### Reverse Transcription
+
+12. **Setup RT reaction**
+    - 30,000 nuclei in 22 μL Nuclei buffer
+    - 2 μL 10mM dNTP
+    - 2 μL indexed oligo-dT primer (100uM)
+    - Incubate at 55°C for 5 min, then cool on ice.
+
+13. **Prepare RT Mix**
+    - 8 μL SuperScript IV First-Strand Buffer
+    - 2 μL 100mM DTT
+    - 2 μL SuperScript IV reverse transcriptase
+    - 2 μL RNaseOUT RNase Inhibitor
+
+14. **Distribute RT mix and Incubate**
+    - Distribute 14 μL to each well. Incubate at following steps:
+      - 4°C for 2 mins
+      - 10°C for 2 mins
+      - 20°C for 2 mins
+      - 30°C for 2 mins
+      - 40°C for 2 mins
+      - 50°C for 2 mins
+      - 53°C for 15 mins
+      - 55°C for 10 mins
+    - Add 60 μL ice-cold NBB post reaction.
+
+15. **Pool Nuclei**
+    - Pool Nuclei, pellet at 600 RCF for 10 min (4°C).
+
+### Ligation
+
+16. **Resuspend Nuclei**
+    - Resuspend nuclei in 1 mL NSB.
+
+17. **Distribute and Add Indexing Oligos**
+    - Distribute 10 μL to each well, add 8 μL indexing oligos (100uM).
+
+18. **Prepare Ligation Mix**
+    - Combine:  
+      - 2 μL Quick Ligase
+      - 20 μL Quick Ligase buffer  
+    - Distribute 22 μL to each well.
+
+19. **Mix and Ligate**
+    - Mix by pipetting, then incubate at 25°C for 10 min.  
+    - Add 60 μL NBB, pool all wells.
+
+20. **Spin and Resuspend**
+    - Add 10 mL NBB, spin at 600 RCF, 10 min (4°C), supernatant discarded.  
+    - Resuspend in 1 mL Elution Buffer.
+
+21. **Add DAPI and Filter**
+    - Add 10 μL of 300 μM DAPI, mix gently.
+    - Filter through a 35 μM FACS tube.
+
+### FACS Sorting
+
+22. **Sort Nuclei**
+    - Add 4 μL Elution Buffer to each well, sort based on DAPI.
+
+### Second Strand Synthesis
+
+23. **Volume Check**
+    - Ensure volume in well is ~12 μL. Adjust input volumes if necessary.
+
+24. **Prepare and Add Second Strand Mix**
+    - For each well, prepare:
+      - 1.33 μL second strand buffer
+      - 0.67 μL enzyme mix  
+    - Add 2 μL per well.
+
+25. **Incubate**
+    - Incubate at 16°C for 3 hours.
+
+### Tagmentation
+
+26. **Make TD Buffer**
+    - 1.2 mL tagmentation salt buffer
+    - 300 μL dimethylformamide
+
+27. **Prepare Mix**
+    - 12.5 μL 2x TD buffer,  
+    - 12.5 μL second tagmentation mix 
+    - (optional: 0.02 μL N7 loaded Tn5)
+    - Incubate 5 min at 55°C.
+
+### Ampure Bead Purification
+
+28. **Add 50 μL of Ampure Beads**
+    - Incubate 5 min, transfer to magnet, incubate 3 min more.
+
+29. **Wash beads**
+    - Twice with ~150 μL 80% ethanol.
+
+30. **Resuspend Beads**
+    - Add 17 μL EB.
+
+### Post-Bead Cleanup
+
+31. **Bead Cleanup**
+    - With .7 volumes bead volume, wash with 80% ethanol.
+
+### PCR
+
+32. **Setup PCR**
+    - 2 μL indexed P5 PCR primer (10uM)
+    - 2 μL P7 primer (10uM)
+    - 20 μL NEBNext master mix
+    - PCR setting:  
+      - 72°C 5 min
+      - 98°C 30 secs
+      - 17 cycles: 98°C 10 secs, 66°C 30 secs, 72°C 30 secs
+      - 72°C 5 min
+
+### Quantify and Sequence
+
+33. **Quantify & Sequence Sample**
+    - Quantified using Qubit and Agilent ScreenTape.
+    - Sequenced on Illumina Nextseq 2000, 100 bp kit.
+  
+    - Read settings:
+      - Read 1: 34 bases
+      - Read 2: 66 bases
+      - Index 1: 10 bases
+      - Index 2: 10 bases
+
+endofoutput
+```

markdown-output/605ceft-resting-medium-no-selection-c4mqyu5w.md

@@ -0,0 +1,136 @@
+```markdown
+# 605CefT - Resting Medium (no selection)
+
+## Author
+[leiboffs](https://protocols.io/researchers/70532)  
+Oregon State University, College of Agricultural Sciences, Department of Botany and Plant Pathology
+
+## Disclaimer
+**DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK**
+
+The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to [protocols.io](https://protocols.io) is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. 
+
+## License
+This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+## Protocol Status
+Working  
+We use this protocol and it's working
+
+## Created
+Nov 06, 2023
+
+## Last Modified
+Nov 07, 2023
+
+## Protocol Integer ID
+90512
+
+## Funding Acknowledgement
+NSF  
+Grant ID: IOS-2211435
+
+## Goal/Experiment
+This protocol provides guidelines for preparing 605CefT medium, used in the transformation protocol for somatic embryogenesis of B104 immature maize embryos. The focus is on preventing Agrobacterium contamination and encouraging rapid plant growth.
+
+## Abstract
+This part of the Leiboff Lab maize transformation protocol aims to transfer embryos from Co-cultivation Medium 562v-MSM to Resting Medium 605CefT to suppress Agrobacterium contamination. This ensures growth and preparation of embryos for further experimental procedures.
+
+Embryos will be transferred scutellum side up after 3 days of infection, using 605CefT for 7 days before moving to 605CefTB. 605CefT includes synthetic auxin (2,4-D) and uses Cefotaxime and Timentin for suppressing Agrobacterium contamination.
+
+### Professional/Scientific Terms and Reagents
+- **2,4-D (2,4-Dichlorophenoxyacetic acid):** A synthetic auxin used for promoting callus formation and shoot growth.
+- **Cefotaxime and Timentin:** Antibiotics used to control Agrobacterium contamination.
+- **Sucrose and D-Glucose:** Sugars that support rapid plant growth.
+- **Casein Hydrolysate:** A mixture of amino acids and peptides used as a nitrogen source.
+- **Phytagar:** A gelling agent used to solidify the medium.
+
+### Equipment and Vendors
+- **pH Meter:** Hanna Instruments
+- **Autoclave:** Cord 3112 and 4112
+- **Beakers, Stir Bars, and Graduated Cylinders:** Standard lab suppliers
+
+### Alternative Methods
+If specific reagents are difficult to source:
+- Casein Hydrolysate can be replaced with a similar complex nitrogen source.
+- If synthetic auxin (2,4-D) is unavailable, consider using another auxin-like Indole-3-acetic acid (IAA).
+
+## Planning
+1. Estimate the volume of 605CefT needed:
+
+    \[
+    \text{Volume} = 30 \text{mL} \times \text{Number Plates}
+    \]
+
+2. Prepare mixing ingredients:
+    - **Retrieve Heat-Stable Ingredients:**
+        - 605 Medium
+        - Casein Hydrolysate
+        - 2,4-D (5 mg/mL)
+        - Sucrose
+        - D-Glucose
+        - Agar, Phyto
+
+3. Equipment set-up:
+    - Graduated cylinder
+    - Beaker with a stir bar
+
+## Procedure
+
+### Mixing Heat-Stable Ingredients
+
+1. **Clean equipment:** 
+    - Rinse stir bar, beaker, and graduated cylinder with MQ H2O.
+
+2. **Prepare solution in beaker:**
+    - Add approximately 90% of final volume using MQ H2O to the beaker.
+    - Place on a magnetic stir plate.
+
+3. **Add ingredients:** 
+    - Use a dry spatula/pipette for each ingredient.
+    - Use the table for specific quantities.
+
+    | Ingredient | 100 mL | 200 mL | 300 mL | 600 mL |
+    |------------|--------|--------|--------|--------|
+    | 605 Medium | 1.1 g  | 2.2 g  | 3.3 g  | 6.6 g  |
+    | Casein Hydrolysate | 0.03 g | 0.06 g | 0.09 g | 0.18 g |
+    | 2,4-D | 11.5 µL | 23 µL | 34.5 µL | 69 µL |
+    | Sucrose | 2.0 g | 4.0 g | 3.0 g | 6.0 g |
+    | D-Glucose | 0.06 g | 0.12 g | 0.18 g | 0.36 g |
+
+4. **Adjust pH:**
+    - Set pH to 5.7 using 0.1 M KOH, stir solution.
+
+### Bring to Target Volume and Autoclave
+
+1. Bring solution to target volume:
+    - Add water, transfer to a graduated cylinder.
+
+2. Add Phytoagar:
+    - According to required mass.
+
+3. Autoclave:
+    - Loosely cap the bottle, autoclave using 'Liquid' setting for 20-25 min.
+
+### Adding Heat-sensitive Ingredients
+1. Retrieve solution from autoclave, cool to 55°C.
+2. Add heat-sensitive ingredients: 
+    - Use table below for quantities.
+
+    | Ingredient | 100 mL | 200 mL | 300 mL | 600 mL |
+    |------------|--------|--------|--------|--------|
+    | Dicamba | 120 µL | 240 µL | 360 µL | 720 µL |
+    | Silver nitrate | 340 µL | 680 µL | 1020 µL | 2040 µL |
+    | Cef | 100 ��L | 200 µL | 300 µL | 600 µL |
+    | Tim | 33 µL | 67 µL | 100 µL | 200 µL |
+
+### Final Steps
+
+1. Pour media into clean sterile plates (~30 mL/plate).
+2. Close plates to solidify in a laminar flow hood.
+
+## Storage
+- Store plates upside-down at 4°C for up to 1 week.
+
+endofoutput
+```

markdown-output/605ceftb-resting-medium-basta-selection-c4utywwn.md

@@ -0,0 +1,207 @@
+```markdown
+# Goal/Experiment:
+### Maize Transformation Protocol for Somatic Embryogenesis of B104 Immature Embryos Using Resting Medium (basta selection)
+
+## Title: 605CefTB - Resting Medium (basta selection)
+
+### Author:
+leiboffs<sup>1</sup>
+
+1 Oregon State University, College of Agricultural Sciences, Department of Botany and Plant Pathology
+
+### DISCLAIMER
+> DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
+> 
+> The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to [protocols.io](https://protocols.io) is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with [protocols.io](https://protocols.io), can be held responsible for your use of the information contained in or linked to the protocol or any of our Sites/Apps and Services.
+
+## ABSTRACT
+This protocol is a part of the Leiboff Lab maize transformation protocol for somatic embryogenesis of B104 immature embryos. This protocol is a combination of methods from Chen et al. 2022 and Kang et al. 2022 with modifications for material availability. It is intended for the GRF-GIF/BBM somatic embryogenesis transformation strategy with the LBA4404 Met- auxotrophic Agrobacterium strain.
+
+Embryos will be transferred (scutellum side up) from Resting Medium 605CefT to Resting Medium 605CefTB, 10 days after infection (DAI). 605CefT should be used for 7 days, before moving embryos to Shoot Maturation Medium 13329A. Resting Medium contains added synthetic auxin (2,4-D) to encourage callus and shoot growth. 605CefTB is high in sucrose and uses a small amount of glucose to encourage rapid plant growth. 605CefTB contains 5 mg/L of bialaphos (preferred for basta selection in maize over glufosinate) as a plant selective agent, and uses both Cefotaxime and Timentin to control Agrobacterium contamination. Concentrations here are sufficient to control the LBA4404 Met- strain, but not wild-type LBA4404 in prior trials.
+
+605CefTB solid media should be prepared in 15x100 (standard) petri plates, planning for ~20 embryos per plate. Material on 605CefTB will be sealed with micropore tape and incubated at 28°C in the dark. Embryos are ready to move off 605CefTB after 1 week. Noticeable growth should occur on the scutellum side, indicating somatic embryo establishment.
+
+## Planning
+1. Estimate the volume of 605CefTB needed:
+    \[
+    \text{Volume} = 30mL \times \text{NumberPlates}
+    \]
+
+    Round up the volume. Check the table below to plan your media needs.
+
+## Mixing Heat-Stable Ingredients
+2. Retrieve the following heat-stable ingredients:
+    - 605 Medium - Stored in Main Lab, 4C Refrigerator, Top Shelf
+    - Casien Hydrolysate - Stored in Main Lab, Chemical shelf 'C', use Megraw stock
+    - 2,4-D (5 mg/mL) - Stored in Main Lab, -20C Freezer, Bottom drawer 'Tissue Culture 1'
+    - Sucrose - Stored in Main Lab, Chemical shelf 'S', use Fowler refillable container
+    - D-Glucose - Stored in Main Lab, Chemical shelf 'G'
+    - Agar, Phyto - Stored in Main Lab, Chemical shelf 'A'
+
+3. Retrieve a graduated cylinder for measuring your final solution.
+    - Place a stir bar in a beaker 1.5x the volume of your solution.
+    - Rinse stir bar and beaker with MQ H2O, discard rinse water in sink.
+
+## Preparation of Medium
+4. Add approximately 90% of final media volume in MQ H2O to the beaker.
+    - Place beaker on a magnetic stir plate.
+    - Turn stir plate on to generate a vigorous stir.
+
+5. Using fresh weigh paper and dry spatula/scoopula/pipette tip for each ingredient, add the following to your beaker:
+
+| Volume (mL)   | 605 Medium (g) | Casien Hydrolysate (g) | 2,4-D (μL) | Sucrose (g) | D-Glucose (g) |
+|---------------|-----------------|------------------------|------------|-------------|---------------|
+| 100           | 1.1             | 0.03                   | 11.5       | 2.0         | 0.06          |
+| 200           | 2.2             | 0.06                   | 23         | 4.0         | 0.12          |
+| 300           | 3.3             | 0.09                   | 34.5       | 3.0         | 0.18          |
+| 600           | 6.6             | 0.18                   | 69         | 6.0         | 0.36          |
+
+6. Thoroughly rinse all used tools with running water.
+    - Place clean tools in drying rack.
+    - Return chemical reagents to their original storage location.
+
+## Adjust Solution pH to 5.7 with 0.1 M KOH
+7. Turn on the Hanna Instruments pH meter.
+    - Unscrew and remove the small green pH probe exchange cover and set cap aside.
+    - Gently remove probe from storage tube and set storage tube aside.
+    - Using squeeze bottle, rinse the glass probe with H2O, catch rinse water in a waste beaker.
+    - Gently blot probe with laboratory tissue paper to dry.
+
+8. Using adjustable arm, lower the pH probe into the beaker with stir plate on.
+    - Ensure stir bar does not strike the probe.
+    - Electrode at the base of the probe must be fully submerged.
+
+9. Using a plastic transfer pipette, add 0.1M KOH to solution until pH 5.7 is measured.
+    - Note: KOH can be added rapidly until pH 5.4, then one drop at a time to reach pH 5.7. pH between 5.6 - 5.8 is acceptable.
+
+10. Using the adjustable arm, remove pH probe from beaker.
+    - Using squeeze bottle, rinse the glass probe with H2O, catch rinse water in a waste beaker.
+    - Gently blot probe with laboratory tissue paper to dry.
+    - Return probe to storage tube – ensure the electrode bulb is fully submerged in storage solution.
+    - Return and secure the small probe exchange cover.
+    - Turn off the pH meter.
+
+## Bring Solution to Target Volume, Add Phytoagar, and Autoclave
+11. Turn off the stir plate and remove your beaker.
+    - Hold a large stir bar in your hand to stabilize the one in your beaker.
+    - Pour solution into the graduated cylinder– do not include the stir bar.
+    - Add a small amount (50-100 mL) of water to your beaker.
+    - Carefully add water from the beaker to the graduated cylinder until solution reaches the target volume– do not include the stir bar.
+
+12. Retrieve a clean dry bottle and matching cap.
+    - Using fresh weigh paper and dry spatula/scoopula:
+
+    | Volume (mL) | Phytoagar (g) |
+    |-------------|---------------|
+    | 100         | 0.6           |
+    | 200         | 1.2           |
+    | 300         | 1.8           |
+    | 600         | 3.6           |
+
+    - Add phytoagar to dry bottle.
+    - Note: Adding phytoagar to dry bottle avoids clumping which is undesirable for final media.
+
+13. Loosely place cap on bottle.
+    - Add a small piece of autoclave tape on cap and bottle.
+    - Place bottle in an autoclave-safe bin.
+    - Autoclave 20-25 min using the 'Liquid' setting.
+    - Note: Recommended autoclaves are in Cord 3112 and 4112. Complete cycle will take ~1 hr.
+
+14. Rinse all used tools and glassware in running water.
+    - Place clean items on drying rack.
+    - Return chemical reagents to original storage location.
+
+## Adding Heat-sensitive Ingredients
+15. Return to autoclave to pick up your solution– Be prompt, sucrose can degrade if left too long.
+    - Using autoclave gauntlets, gently seal cap of bottle.
+    - Swirl autoclaved solution to evenly mix phytoagar.
+
+16. Carefully return to lab with autoclave bin and sealed bottle.
+    - Place sealed solution into large 55°C water bath in main lab.
+    - Discard any liquid remaining in autoclave bin and return to bin storage.
+    - Note: Solution needs to reach ~55°C before adding heat-sensitive ingredients.
+
+17. Retrieve the following heat-sensitive ingredients:
+    - Dicamba (1 mg/mL) - Stored in Main Lab, -20C Freezer, Bottom drawer 'Tissue Culture 2'
+    - Silver nitrate (1 mg/mL) - Stored in Main Lab, -20C Freezer, Bottom drawer 'Tissue Culture 2'
+    - Cefotaxime (100 mg/mL), 'Cef' - Stored in Main Lab, -20C Freezer, 'Antibiotics 2'
+    - Timentin (300 mg/mL), 'Tim' - Stored in Main Lab, -20C Freezer, 'Antibiotics 2'
+    - Bialaphos (1 mg/mL) - Stored in Main Lab, -20C Freezer, 'Tissue Culture 3'
+
+18. Turn on laminar flow hood, airflow, and lamp.
+    - Using 70% EtOH spray bottle and paper towels, sterilize working area inside laminar flow hood.
+    - Retrieve sterile petri plates.
+    - Using fine-tipped sharpie, write '605CefT' and date along bottom rim of plate.
+
+19. When solution reads 55°C with digital thermometer gun:
+    - Transfer sealed bottle to laminar flow hood.
+    - Bottle should be warm, but safe to handle.
+    - Sterilize outside of bottle and gloved hands with 70% ethanol spray.
+
+20. Using fresh filter tip for each ingredient, add the following to your bottle:
+
+| Volume (mL) | Dicamba (μL) | Silver nitrate (μL) | Cef (μL) | Tim (μL) | Bialaphos (μL) |
+|-------------|---------------|---------------------|----------|----------|----------------|
+| 100         | 120           | 340                 | 100      | 33       | 500            |
+| 200         | 240           | 680                 | 200      | 67       | 1000           |
+| 300         | 360           | 1020                | 300      | 100      | 1500           |
+| 600         | 720           | 2040                | 600      | 200      | 3000           |
+
+    Used tips may be disposed of in regular lab waste – no contact with rDNA or modified cells is anticipated.
+
+21. Gently swirl media bottle to mix thoroughly, but avoid introducing bubbles.
+    - Pour media into plates, ~30 mL per plate.
+    - Note: Each plate should be more than half-full with media.
+    - Close plates to solidify in laminar flow hood.
+
+22. Using paper towels, clean any spilled media and discard in regular lab waste.
+    - When plates are poured, rinse media bottle in lab sink and hang on bottle rack to dry.
+    - Return reagents to original storage location.
+    - Using 70% EtOH spray bottle and paper towels, sterilize working area inside laminar flow hood for next worker.
+
+23. Leave closed plates to solidify in laminar flow hood with the fan on, 3 hrs - overnight.
+    - Note: Keep plates ~10 cm (4 in) away from back of flow hood to avoid drying out.
+
+When plates are solid, wrap in a clean plate bag or individually seal with parafilm and store upside-down at 4°C, up to 1 week.
+
+---
+
+## Terms and Reagents:
+1. **605 Medium:** Basal medium for plant tissue culture.
+2. **Casien Hydrolysate:** Protein hydrolysate used as a complex supplement.
+3. **2,4-D (2,4-Dichlorophenoxyacetic acid):** Synthetic auxin to promote plant growth and callus induction.
+4. **Sucrose:** Disaccharide sugar critical for energy and carbon source.
+5. **D-Glucose:** Simple sugar used for metabolic energy.
+6. **Phytoagar:** Solidifying agent for culture media.
+7. **Dicamba:** Synthetic auxin used as a growth regulator.
+8. **Silver Nitrate:** Used for its antimicrobial properties.
+9. **Cefotaxime:** Antibiotic to control bacterial contamination.
+10. **Timentin:** Combination antibiotic for broader antibacterial spectrum.
+11. **Bialaphos:** Phosphinothricin-based herbicide for plant selection.
+12. **KOH (Potassium hydroxide):** Used to adjust pH.
+
+## Equipment:
+- Magnetic Stir Plate
+- Graduated Cylinder
+- Beaker
+- Stir Bar
+- Laminar Flow Hood
+- Autoclave (`Cord 3112` and `Cord 4112`)
+- Digital Thermometer Gun
+- pH Meter (`Hanna Instruments`)
+- Petri Plates (15x100 mm)
+
+## Vendors:
+- Chemical shelf locations in Main Lab
+
+## Alternatives:
+- 2,4-D can be substituted with other auxins based on availability.
+- Phytoagar can be replaced with other high-quality agars, though consistency should be tested.
+
+## Funders:
+- NSF, Grant ID: IOS-2211435
+
+---
+
+**endofoutput**
+```

markdown-output/a-cellprofiler-computational-pipeline-to-quantify-dhja34ie.md

@@ -0,0 +1,125 @@
+```markdown
+# Goal/Experiment:
+To quantify the density of mouse striatal dopaminergic processes using a CellProfiler computational pipeline.
+
+# A CellProfiler Computational Pipeline to Quantify the Density of Mouse Striatal Dopaminergic Processes
+
+### DOI
+[dx.doi.org/10.17504/protocols.io.x54v92km4l3e/v1](https://dx.doi.org/10.17504/protocols.io.x54v92km4l3e/v1)
+
+### Authors
+- **Ebsy Jaimon**
+- **Sreeja V Nair**
+- **Suzanne R Pfeffer**
+
+**Department of Biochemistry, Stanford University School of Medicine and Aligning Science Across Parkinson's**
+
+### Protocol Citation
+_Ebsy Jaimon, Sreeja V Nair, Suzanne R Pfeffer 2024. A CellProfiler computational pipeline to quantify the density of mouse striatal dopaminergic processes. **protocols.io**_
+
+### License
+This is an open access protocol distributed under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+### Protocol Status
+Working
+
+### Created
+July 19, 2024
+
+### Last Modified
+July 19, 2024
+
+### Protocol Integer ID
+103746
+
+### Keywords
+- ASAPCRN
+- LRRK2
+- Primary cilia
+- Dorsal striatum
+
+### Funders Acknowledgement
+Aligning Science Across Parkinson's - Grant ID: ASAP-000463
+
+## Abstract
+Here, we present a CellProfiler software pipeline to quantify the density and intensity of dopaminergic processes in the mouse striatum. The dopaminergic processes in the striatum are stained using an anti-tyrosine hydroxylase antibody. The same sections are stained using an antibody that recognizes total neuronal NeuN (neuronal nuclear antigen biomarker) for staining normalization. For the examples shown herein, images were acquired using a Zeiss LSM 900 laser scanning confocal microscope with a 63X 1.4 oil immersion objective.
+
+*References:*
+1. Stirling DR, Swain-Bowden MJ, Lucas AM, Carpenter AE, Cimini BA, Goodman A (2021). CellProfiler 4: improvements in speed, utility, and usability. BMC Bioinformatics, 22 (1), 433. PMID: 34507520 PMCID: PMC8431850.
+
+## Materials
+1. `.czi` files from Zeiss Laser Scanning Microscope
+2. FIJI/ImageJ
+3. CellProfiler software 4.0+ 
+
+## Methods
+
+### Batch Process Images
+1. Use the FIJI macro as described in [dx.doi.org/10.17504/protocols.io.3byl4bpo8vo5/v1](https://dx.doi.org/10.17504/protocols.io.3byl4bpo8vo5/v1) to Z-project the `.czi` images from the Zeiss LSM microscope.
+2. Open the images that need to be processed, choose the output folder, run the code for maximum intensity Z projection, and save the file as .TIFF.
+
+### Import Files and Extract Metadata
+1. Open CellProfiler. Go to the Images module, drag and drop the maximum intensity projected .TIFF files as indicated. Select "no filtering" in the filter images option.
+2. Go to the Metadata module:
+   - Set _Extract Metadata?_ to Yes.
+   - Set _Metadata extraction method_ to Extract from image file headers.
+   - Set _Extract metadata from_ to All images.
+   - Click _Extract metadata_.
+   - Click on Add another extraction method.
+   - Set _Metadata extraction method_ to Extract from file/folder names.
+   - Set _Metadata source_ to File name.
+   - Set Regular expression to extract from file name:
+     ```
+     ^.*br(?P<brain_number>[0-9]{1,2}).*#(?P<image_number>[0-9]{2})
+     ```
+        Note these steps:
+        - In Regex, ^ indicates the beginning of the file name.
+        - The program recognizes and extracts brain and image numbers.
+   - Click _update_ to populate the metadata field.
+   - Set _Metadata data type_ to Text.
+3. Go to the NamesAndTypes module:
+   - Assign a name to images matching rules.
+   - Process as 3D: No
+   - Match "All" of the following rules.
+   - Select the rule criteria: Metadata/Does/Have C matching/0
+   - Name to assign these images: TyrosineHydroxylase
+   - Set the image type: Grayscale image
+   - Click on Add another image and set similar parameters for NeuN staining.
+
+### Density Measurement
+1. To binarize the images:
+   - Select the input image: TyrosineHydroxylase
+   - Name the output image: Thresholded_TyrosineHydroxylase
+   - Threshold strategy: Global
+   - Thresholding method: Minimum Cross-Entropy
+   - Set threshold scales and corrections as required.
+
+Note: Use test settings to ensure the best results.
+
+2. Add `MeasureImageAreaOccupied` module:
+   - Measure the area occupied by: Binary image.
+   - Select binary images to measure: Thresholded_TyrosineHydroxylase.
+
+### Intensity Measurement
+1. To segment Tyrosine Hydroxylase and NeuN:
+   - Add IdentifyPrimaryObjects module.
+   - Use advanced settings: Yes.
+   - Segment objects according to parameters.
+   - Adjust modules and test mode settings.
+
+2. Segment NeuN:
+   - Add Smooth module, then IdentifyPrimaryObjects for segmentation.
+   - Similar advanced settings as previous steps.
+
+3. Add modules MeasureObjectIntensity and MeasureObjectSizeShape to measure the integrated intensity and area of the objects (THoverjects and NeuNobject).
+
+### Export Data
+- Add ExportToSpreadsheet module:
+  - Select measurements to export under specific categories and criteria.
+  - Save the pipeline and run the analysis.
+
+## Protocol References
+1. Stirling DR, Swain-Bowden MJ, Lucas AM, Carpenter AE, Cimini BA, Goodman A (2021). CellProfiler 4: improvements in speed, utility and usability. BMC Bioinformatics, 22 (1), 433. PMID: 34507520 PMCID: PMC8431850.
+
+endofoutput
+```

markdown-output/a-high-throughput-assay-for-quantifying-phenotypic-bxptpmnn.md

@@ -0,0 +1,105 @@
+```markdown
+# Goal/Experiment:
+This experiment aims to measure 10 phenotypic traits of centric diatoms using high-throughput methodologies. This versatile assay provides detailed insights into the various characteristics of microalgae, particularly focusing on growth rates, reactive oxygen species production, photophysiological traits, and other key indicators of cellular health and activity.
+
+## A High-Throughput Assay for Quantifying Phenotypic Traits of Microalgae
+
+### Authors
+Phoebe Argyle<sup>1,2</sup>, Jana Hinners<sup>3</sup>, Nathan G. Walworth<sup>4</sup>, Sinéad Collins<sup>5</sup>, Naomi M. Levine<sup>4</sup>, Martina A. Doblin<sup>1,6</sup>
+
+1. Climate Change Cluster, University of Technology Sydney, Sydney, NSW, 2007, Australia
+2. Ministry of Marine Resources, Cook Islands
+3. Institute of Coastal Ocean Dynamics, Helmholtz-Zentrum Hereon, 21502, Geesthacht, Germany
+4. Department of Biological Sciences, University of Southern California, Los Angeles, CA, 90089-0371, USA
+5. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh, EH9 3JF, UK
+6. Sydney Institute of Marine Science, Mosman, NSW, 2088, Australia
+
+### Abstract
+This outlines a workflow for measuring 10 phenotypic traits of centric diatoms using a variety of methodologies.
+
+### Citation
+- Argyle, P. A., Hinners, J., Walworth, N. G., Collins, S., Levine, N. M., & Doblin, M. A. (2021). A high-throughput assay for quantifying phenotypic traits of microalgae. *Frontiers in microbiology*, 12, 706235.
+  
+## Protocol Steps
+
+### Set up Experimental Cultures
+
+1. **Initial Setup (Approx. 5 minutes)**: 
+    - Grow experimental cultures in 12-well tissue culture plates.
+    - Use triplicate cultures per treatment.
+    - Initial cell concentration: 2000 cells/mL, adjustable based on growth expectations.
+
+2. **Stock Preparation**: 
+    - Add 400 µL of stock culture (at 11000 cells/mL) to 4 mL of growth media per well, achieving 4.4 mL total volume with 2000 cells/mL.
+    - Measure concentration of initial stock using flow cytometry:
+        ```markdown
+        **Protocol:** Measuring Growth Rates of Diatom Cells in Culture
+        **Created By:** Phoebe Argyle
+        ```
+
+3. **Concentration Adjustment**:
+    - Use centrifugation (1000 x g, 20°C, 5 minutes) to adjust concentration if required.
+
+4. **Sealing Plates**:
+    - Seal plates with breathable seal (Breathe-Easy<sup>®</sup> sealing membrane from Sigma-Aldrich, SKU: Z380059-1PAK).
+
+### Track Growth
+
+3. **Initial Fluorescence Measurement**: 
+    - Take in vivo fluorescence measurement post-inoculation with a microplate reader:
+        ```markdown
+        **Protocol:** Measuring Growth Rates of Diatom Cells in Culture
+        **Created By:** Phoebe Argyle
+        ```
+
+4. **Daily Monitoring**:
+    - Measure in vivo fluorescence daily at least 1 hour post-photoperiod onset (e.g., 9 am post 6 am light onset on a 12:12 light cycle).
+    - Monitor the growth phase and note exponential growth for trait measurement.
+
+### Trait Measurements
+
+5. **Mid-Exponential Phase**:
+    - Once culture reaches mid-exponential phase, begin trait measurements.
+        - Ensure staggered harvesting due to varying readiness of culture wells.
+
+### Detailed Workflow (Quantitative Phenotyping Assay - QPA)
+
+#### At Mid-Exponential Phase
+
+6. **Split Culture (Flow Cytometry Preparation)**:
+    - 200 µL culture + PFA fixative for flow cytometry.
+
+7. **Reactive Oxygen Species (ROS) Measurement**:
+    - 2 x 500 µL culture (1 stained H<sub>2</sub>DCFDA + 1 blank control).
+    - 2-hour dark incubation at growth temperature, followed by fluorescence reading.
+
+8. **Photophysiological Traits**:
+    - Daily in vivo fluorescence tracking.
+    - Measure using Water-PAM for Rapid Light Curves.
+
+9. **Silicification**:
+    - 1 mL culture + 1 mL artificial seawater into a quartz cuvette.
+    - Analyze post-Water-PAM measurements.
+
+10. **Additional Flow Cytometry**:
+    - Use BODIPY 10-minute incubation, followed by flow cytometry.
+    - Traits measured: Cell Size, Granularity, Chlorophyll a, Neutral Lipids, Silicification.
+
+### Statistical Analysis
+
+11. **Data Analysis**:
+    - Perform Principal Component Analysis (PCA) to visualize multivariate trait data.
+    - Identify differences between strains/species and relationships between traits.
+
+```markdown
+### References
+- Argyle, P., et al. (2021). High-throughput assay for quantifying phenotypic traits of microalgae. Frontiers in microbiology, 12, 706235.
+```
+
+```markdown
+- Licenses: This protocol follows the Creative Commons Attribution License.
+- Protocol Status: Working, created on Aug 25, 2021.
+```
+
+## endofoutput
+```

markdown-output/a-high-throughput-cost-efficient-library-preparati-rt8d6rw.md

@@ -0,0 +1,219 @@
+```markdown
+Goal/Experiment:
+To develop a high throughput, cost-efficient library preparation protocol for large-scale next generation sequencing using a Tn5 transposase-based library construction procedure.
+
+# A High Throughput, Cost-efficient Library Preparation Protocol for Large Scale Next Generation Sequencing (Version 2)
+
+yunjun Zan, Örjan Carlborg
+
+## Abstract
+
+Previously, Picelli et al. (Picelli et al., 2014) reported a Tn5 transposase-based library construction procedure for Illumina sequencing. Here, we describe an optimized procedure for high throughput library preparation to facilitate large-scale sequencing that does not rely on advanced lab equipment. The Tn5 transposase used can be purified using a publicly available construct (Picelli et al., 2014). Reaction buffers and primers can be prepared using standard chemicals available from common suppliers.
+
+**Citation:** yanjun Zan, Örjan Carlborg A high throughput, cost-efficient library preparation protocol for large scale next generation sequencing. *protocols.io* dx.doi.org/10.17504/protocols.io.rt8d6rw  
+**Published:** 23 Jul 2018
+
+## Guidelines
+
+### 1. Introduction
+
+Previously, Picelli et al. (Picelli et al., 2014) reported a Tn5 transposase-based library construction procedure for Illumina sequencing. Here, we describe an optimized procedure for high throughput library preparation to facilitate large-scale sequencing that does not rely on advanced lab equipment. The Tn5 transposase used can be purified using a publicly available construct (Picelli et al., 2014). Reaction buffers and primers can be prepared using standard chemicals available from common suppliers.
+
+### 2. DNA Input Recommendations
+
+#### 2.1. Sensitivity to DNA Preparation Protocol
+
+We have tested this protocol with DNA prepared using several different methods (QIAGEN Maxi Blood kits, QIAGEN DNeasy Blood & Tissue Kits, QIAGEN Gentra Puregene Blood Kit) with DNA eluded in water and TE. We did not find the protocol to be sensitive to these factors.
+
+#### 2.2. DNA Quality and Quantity
+
+The quality of the input DNA is not a major concern for preparation of sequencing libraries using this protocol. We have prepared libraries using DNA stored in -20°C for up to ~20 years from chicken and foxes with good results.
+
+This protocol is optimized for DNA input of 10 ng. Lower DNA input, 1-5 ng, will yield sufficient amount of library for sequencing by increasing the number of PCR cycles. If possible, we would recommend using 10 ng to reduce the amount of PCR duplicates.
+
+## Protocol
+
+### 3. Enzyme Purification
+
+**Step 1:**  
+The enzyme was produced from a plasmid constructed by Picelli et al. (Picelli et al., 2014), which has been deposited to AddGene ([http://www.addgene.org/](http://www.addgene.org/), pTXB1-Tn5; plasmid # 60240). A protocol describing enzyme purification from this is available in Picelli et al. (Picelli et al., 2014).
+
+### 4. Buffer Preparation
+
+**Step 2:**
+
+#### 4.1. 2xTn5 Dialysis Buffer (DF)
+
+| Component          | Final Concentration   | 1L (H₂O added to vol.)       |
+|--------------------|-----------------------|------------------------------|
+| 100 mM Hepes, pH 7.2 | 100 mL 1M or 23.83 g  |
+| 200 mM NaCl          | 11.69 g NaCl          |
+| 0.2 mM EDTA          | 400 ul 500 mM         |
+| 2 mM DTT             | 2 ml 1M               |
+| 0.2% Triton X-100    | 2 ml Triton X-100     |
+| 20% Glycerol         | 252 g 100% Glycerol   |
+
+#### 4.2. 5X TAPS-MgCl₂
+
+- 50 mM TAPS-NaOH at pH 8.5, 25 mM MgCl₂
+
+All chemicals are ordered from Sigma ([https://www.sigmaaldrich.com/](https://www.sigmaaldrich.com/)).
+
+### 5. Workflow
+
+**Step 3:**  
+The workflow includes the following steps (numbers in parentheses refer to sections below): Primer annealing (6) - indexing primer preparation (7) - Assemble transposon (8) - Tagmentation and deactivating the Tn5 (9) - PCR amplification (10) - Double size selection (11) - Quantification and Pooling (12).
+
+### 6. Primer Annealing
+
+**Step 4:**  
+Three oligos, Tn5-rev, Tn5-A and Tn5 B were ordered from IDT ([eu.idtdna.com](https://eu.idtdna.com/)) with standard desalting. Their sequences are:
+
+- **Tn5-rev:**  
+  `5′- [phos]CTGTCTCTTATACACATCT-3′`
+- **Tn5-A (Illumina FC-121-1030):**  
+  `5′-TCGTGGCAGCGTCAGATGTGTATAAGAGACAG-3′`
+- **Tn5-B (Illumina FC-121-1031):**  
+  `5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′`
+
+Two double-stranded primers, Primer A and Primer B are obtained by mixing equal molar of the corresponding oligos.
+
+- **Primer A:** mix equal molar Tn5-rev with Tn5-A
+- **Primer B:** mix equal molar Tn5-rev with Tn5-B
+
+Prepare the two primers (A & B) separately using two 1.5 ml Eppendorf tubes. First denature them by incubating at 70°C for 1 min and then anneal them by chilling on ice afterwards. If performed in a PCR tube, the incubation time should be reduced to 30s.
+
+### 7. Indexing Primer Preparation
+
+**Step 5:**  
+PCR indexing primers can be synthesized using, for example, the Illumina adapter sequences described on page 14 in the Illumina Nextera XT Index Kit v2 (Index 2 i5/i7 adapters; [https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-06.pdf](https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-06.pdf)). We ordered the indexing primers from IDT with standard desalting. The primers were diluted to 10 uM and arranged in a 96 well plate. As 24 and 16 primers are available at the i5/i7 sides, 384 unique indexes are available. We recommend users to be careful in this step to avoid contamination.
+
+**Figure 1. Layout of the indexing primer plate.** In this case, well A1 will contain index primer N702 and S502 with concentration both at 10 uM.
+
+### 8. Transposon Assembly in Solution and Assay of Transposase Activity
+
+**Step 6:**
+
+#### 8a. Transposon Assembly
+
+The transposon needs to be assembled every time before tagmentation as the assembled solution cannot be stored in -20°C. We assume that the Tn5 is stored in 1X DF buffer as described in Picelli et al. (Picelli et al., 2014).
+
+##### 8a.1. Reaction (sufficient for 280 DNA samples):
+
+| Reagent                   | Volume         |
+|---------------------------|----------------|
+| Tn5 (100 μl | 340 μg))    | 100 μl         |
+| Pre-annealed primer A (100uM) | 64 μl       |
+| Pre-annealed primer B (100uM) | 64 μl       |
+| 2X DF buffer               | 128 μl         |
+| **Total**                 | 356 μl         |
+
+Incubate at room temperature for at least 60 min, we have extended it to several hours without problems.  
+*Note:* This reaction uses 100 ul Tn5, assuming the concentration of Tn5 is 3.4 μg/μl. The volume of Tn5 should be adjusted according to the actual concentration of the prepared enzyme to ensure 340 μg Tn5 is added.
+
+#### 8b. Assay of Transposase Activity
+
+Every time a new batch of enzyme is purified, an assay of its activity should be performed. This can be skipped if an old batch with known activity is used (proceed to step 9).
+
+##### 8b.1. Reaction
+
+| Reagent                          | Volume |
+|----------------------------------|--------|
+| H₂O                              | 13.5 μl|
+| 5X TAPS-MgCl₂-PEG 8000           | 4 μl   |
+| Target DNA at 50 ng/μl           | 1 μl   |
+| Tn5                              | 1.5 μl |
+| **Total**                        | 20 μl  |
+
+Incubate the reaction for 10 min at 55°C. Then add 2.5 ul 0.2% SDS and incubate another 7 min at 55°C. Load sample on an agar gel, where a successfully assembled transposase should produce a smear ranging in size from 100-1000 bp.
+
+### 9. Tagmentation
+
+**Step 7:**
+
+#### 9.1. Reaction
+
+| Reagent                          | Volume |
+|----------------------------------|--------|
+| 5X TAPS buffer                   | 2 μl   |
+| 40% PEG                          | 2 μl   |
+| Tn5                              | 1.2 μl |
+| DNA(10 ng/μl)                    | 1μl    |
+| Water                            | 3.8 μl |
+| **Total**                        | 10 μl  |
+
+Incubate reaction at 55°C for 10 min. Add 2.5 ul 0.2% SDS and incubate at 55°C for another 7 min to deactivate the Tn5.
+
+### 10. PCR Enrichment
+
+**Step 8:**
+
+#### 10.1. Reaction
+
+| Reagent                                | Volume |
+|----------------------------------------|--------|
+| Tagmentation product from from above (step 9) | 12.5 μl|
+| 5X PCR buffer                          | 5 μl   |
+| HiFi PCR Enzyme                        | 0.2 μl |
+| dNTP (10mM)                            | 0.3 μl |
+| Index1 (10 uM)                         | 2.5 μl |
+| Index2 (10 uM)                         | 2.5 μl |
+| Water                                  | 2 μl   |
+| **Total**                              | 25 μl  |
+
+#### 10.2. PCR Program
+
+- 72°C 3min (Gap filling)
+- 10 cycles of:
+  - 98°C 30s
+  - 98°C 30s
+  - 63°C 30s
+  - 72°C 3min
+
+### 11. Double Size Selection Using AMPure Beads
+
+**Step 9:**
+
+Check if there is evaporation, especially for wells located around the border of the 96 well plate. If so, fill them to the correct volume with water before bead purification is initiated.
+
+We use Ambion Magnetic Stand-96, (P/N: AM10027). However, any magnetic stand for 96-well plate will work equally well. Double-size selection is performed to cut under-tormented fragments and remove primer/primer dimers. The resulting insert size should be around 350 bp.
+
+#### 11.1 Procedure
+
+1. Warm up AMPure beads to room temperature (30 min in room temperature - RT).
+2. Add 7.5 ul beads to each sample, mix it evenly using a vortex and then incubate it for 10 min at RT. Leave it on the magnetic stand until the solution is clear to remove large fragments (> 1kb).
+3. Pipette the supernatant into a new tube and add 4.8 ul beads, incubate for 10 min at RT and put it on the magnetic stands until the solution is clear (5min) to remove small fragments (<200bp).
+4. Add 70 ul 80% ethanol, quickly flip the plates (with the magnets stand on) and pour out the liquid. Wipe the plate clean using a paper towel.
+5. Repeat step 4 one more time and dry the samples by leaving them at RT for 5 min.
+6. Add 20 ul water to the sample and suspend the beads by vortex. Incubate for 5-10 min at RT and then put the plate on magnetic stands until the solution is clear (5min).
+7. The sequencing library is obtained by carefully pipetting off the supernatant to a new tube. We recommend discarding the last 3-4 ul to avoid contamination.
+
+### 12. Quality Control and Pooling
+
+**Step 10:**  
+The concentration of the generated library can be measured using Qubit™ dsDNA HS Assay Kit. For example, Qubit for individual samples or a TECAN Infinite® 200 PRO for high-through measurements.
+
+To save time and costs, checking of insert sizes are performed after pooling of the libraries. Equal amount of DNA (20 ng) from each sample are mixed in a pool. Insert sizes for the libraries in the pooled sample are then checked using a TapeStation (Agilent High Sensitivity D1000 ScreenTape). If primer contamination is observed, additional bead selection can be performed (adding 0.75X beads to the pool and repeat 11.1 step 4 to 7 as described above).
+
+### 13. Sequencing
+
+**Step 11:**  
+We have obtained high-quality sequences from libraries prepared using this protocol of Illumina HiSeq 4000 and HiSeq X10. In principle, however, the libraries should be useful for sequencing on any Illumina sequencing platform supporting the Nextera protocol.
+
+### 14. Troubleshooting
+
+**Step 12:**  
+For troubleshooting, we refer the reader to the full publication describing the development of the original protocol (Picelli et al., 2014).
+
+### 15. Acknowledgements
+
+**Step 13:**  
+We thank Simone Picelli for helpful advice with the initial library preparation and the Protein Science Facility (PSF) at the Karolinska Institute, Stockholm for help with production of the Tn5 enzyme. pTXB1-Tn5 was a gift from Rickard Sandberg (Addgene plasmid # 60240).
+
+### 16. References
+
+**Step 14:**  
+Picelli, S., Björklund, A. K., Reinius, B., Sagasser, S., Winberg, G., & Sandberg, R. (2014). Tn5 transposase and tagmentation procedures for massively scaled sequencing projects. *Genome Research,* 24(12), 2033-2040. [http://doi.org/10.1101/gr.177881.114](http://doi.org/10.1101/gr.177881.114)
+
+endofoutput
+```

markdown-output/a-membrane-enriched-preparation-of-culture-samples-bdapi2dn.md

@@ -0,0 +1,168 @@
+```markdown
+# Goal/Experiment:
+Preparation of culture samples for mass spectrometry-based proteomics
+
+# A membrane-enriched preparation of culture samples for mass spectrometry-based proteomics
+
+*Gwendolyn Gallagher¹*  
+¹Gwendolyn Gallagher [University of Chicago], Jacob Waldbauer [University of Chicago]
+
+Coleman Lab  
+Gwendolyn Gallagher
+
+## Abstract
+
+### Purpose:
+Preparation of culture samples for mass spectrometry-based proteomics
+
+### Principle:
+Utilizing a membrane-enrichment method of lysing cells and preparing peptides has yielded higher representation of membrane proteins in our mass spectrometry-based proteomic results. Traditional methods do not adequately extract or digest hydrophobic, transmembrane proteins. Particularly, we can now see full expression patterns of proteorhodopsin, something we could not detect using traditional mass spec proteomics prep. This protocol builds on the work of Molloy (2008) Methods Mol Biol (doi:10.1007/978-1-60327-064-9_30), Erde et al. (2014) J. Proteome Res. (doi:10.1021/pr4010019), and Waldbauer, et al. (2017) Anal. Chem. (doi:10.1021/acs.analchem.7b02752).
+
+### Summary:
+Pure culture samples were spun down and flash frozen for proteomics. A carbonate extraction protocol was used for membrane enrichment before eFASP. The membrane fraction was enzymatically digested with both chymotrypsin and trypsin and the cytosolic fraction was digested with just trypsin. These samples were then ready to be processed further by in vitro isotopic peptide labeling (diDO-IPTL).
+
+## Materials Text
+
+### Equipment
+- QSonica high power sonicator
+- Optima MAX-XP Beckman Coulter centrifuge
+- Regular benchtop centrifuge for Eppendorf tubes
+- Labconco CentriVap Cold Trap
+- Sonicator bath
+- Dry Block
+- Incubator (37°C)
+- Vortex + Eppendorf tube attachment
+- 10, 20, 200, and 1000 μL pipettes
+- Tube racks
+
+### Materials
+- 10, 20, 200, and 1000 μL tips
+- Wash solution
+- Carbonate extraction solution
+- Polypropylene microfuge tube (Beckman Coulter: 357448)
+- Exchange buffer
+- 1x LDS buffer
+- Dithiothreitol (DTT)
+- Iodoacetamide
+- Digestion Buffer
+- Peptide Recovery Buffer
+- Protein LoBind Tube (Eppendorf: 022431081)
+- Filtrate tubes and Vivacon 500 (30,000 MWCO HY) concentrator (Sartorius)
+- Parafilm
+- Ethyl acetate
+- Trifluoroacetic acid (TFA)
+
+### Reagents and Solutions
+- **Wash Solution:** 50 mM Tris-HCl, pH 7.5
+- **Carbonate extraction solution:** 100 mM sodium carbonate
+- **Exchange buffer:** 8 M urea, 0.2% (w/v) deoxycholate, 1 M ammonium bicarbonate
+- **1x LDS buffer:** 0.666 g Tris HCl, 0.682 g Tris Base, 0.800 g LDS, 0.006 g EDTA, 4 g glycerol in 20 mL milliQ
+- **Digestion Buffer:** 50 mM ammonium bicarbonate with 0.2% (w/v) deoxycholate
+- **Peptide Recovery Buffer:** 50 mM ammonium bicarbonate
+
+## Cell Lysis Protocol (3h)
+
+1. **Lysis:**
+    - Cell pellets resuspended in 333 μL wash solution and lysed with QSonica high power sonication (15 min, 1 sec pulse, Ampl 85%)
+    - All samples were previously derived from 4.5 mL pure cultures spun down and flash frozen
+
+2. **Centrifugation:**
+    - After sonication, the tubes were centrifuged (2500×g, 8 min) to pellet unlysed debris
+
+3. **Carbonate Addition:**
+    - Supernatant was drawn off and added to 830 μL carbonate extraction solution in a polypropylene microfuge tube
+    - It is very important to check that tubes are compatible with ultracentrifuge
+
+4. **Shaking:**
+    - Shake samples in polypropylene tubes in 4°C for 1 hour
+
+5. **Membrane Pellet:**
+    - After balancing tubes with additional carbonate extraction solution, membrane pellets were spun down in an ultracentrifuge (115,000×g, 1 hr)
+
+6. **Fraction Separation:**
+    - Draw off supernatant and preserve as “cytosolic” fraction and save pellet as “membrane” fraction.
+
+## Cytosolic Fraction Prep (1h)
+
+7. **Dilution:**
+    - Dilute cytosolic fraction samples in 1:1 in exchange + 20 mM DTT. Additional Eppendorf tubes may be necessary.
+
+8. **Cysteine Alkylation:**
+    - Alkylate cysteine thiols with 60 nM iodoacetamide and incubate at room temperature for an hour in the dark.
+
+## Membrane Fraction Prep (3h)
+
+9. **Sonication:**
+    - Disturb membrane pellets with QSonica high power sonication (10 min, 1 sec pulse, Ampl 85%) in 500 μL LDS buffer + 20 mM DTT.
+
+10. **Heating:**
+    - Incubate samples at 95°C for 20 minutes
+
+11. **Cooling:**
+    - Incubate samples at 37°C for 30 minutes
+
+12. **Cysteine Alkylation:**
+    - Alkylate cysteine thiols with 60 nM iodoacetamide and incubate at room temperature for an hour in the dark.
+
+## Enhanced Filter Aided Sample Preparation (eFASP) (3d)
+
+13. **Filter Loading:**
+    - Mix 50 μL lysate (membrane or cytosolic fraction) with 400 μL exchange buffer on filter unit.
+
+14. **Centrifugation:**
+    - Spin at 14,000×g for 10 minutes and discard filtrate
+
+15. **Repeat Steps:**
+    - Repeat steps 13-14 until all lysate is concentrated on filter
+
+16. **Washing:** 
+    - Wash filter unit 3 times with 200 μL exchange buffer by spinning at 14,000×g for 10 minutes. Discard filtrate each time.
+
+17. **Digestion Buffer:**
+    - Wash filter 2 times with 200 μL digestion buffer (spin down at 14,000×g for 10 min)
+
+18. **Transfer:**
+    - Transfer filter unit to passivated collection tube.
+
+19. **Peptide Digestion Incubation:**
+
+    **For MEMBRANE fraction:** 
+    - Add 100 μL digestion buffer and 2 μg chymotrypsin on filter. Incubate overnight at room temperature (seal tubes with parafilm). After overnight incubation, add 2 μg Trypsin and incubate again overnight at room temperature.
+
+    **For CYTOSOLIC fraction:** 
+    - Add 100 μL digestion buffer and 2 μg trypsin on filter. Incubate overnight at room temperature (seal tubes with parafilm).
+
+20. **Centrifugation:**
+    - Centrifuge (14,000×g for 10 minutes).
+    - **Keep filtrate**
+
+21. **Peptide Recovery:**
+    - Add 50 μL peptide recovery buffer and centrifuge for 10 minutes at 14,000×g.
+    - **Keep filtrate**
+
+22. **Recovery Replication:**
+    - Repeat step 21
+
+23. **Ethyl Acetate:**
+    - Add 200 μL ethyl acetate to the filtrate and transfer to LoBind tube.
+
+24. **TFA Addition:**
+    - Add 2.5 μL TFA and vortex gently.
+
+25. **Sonication:**
+    - Nearly fill each tube with ethyl acetate, sonicate for 10 s (note: not high power), centrifuge at 14,000×g for 10 minutes, then discard upper organic layer.
+
+26. **Replication:**
+    - Repeat step 25 two more times.
+
+27. **Dry Block:**
+    - Place sample tubes (uncovered/caps off) in Dry Block set to 60°C for 5 minutes.
+
+28. **Freezing:**
+    - Freeze sample (-80°C), then centrivap to dryness.
+
+29. **Usage:**
+    - Dried samples can now be used for IPTL labeling or can be loaded on mass spec in 2% Acetonitrile, 0.1% formic acid as an unlabeled sample.
+
+endofoutput
+```

markdown-output/a-novel-laboratory-method-to-simulate-climatic-str-b927r8hn.md

@@ -0,0 +1,105 @@
+```markdown
+# Goal/Experiment:
+To isolate individual ticks and control their environment in order to examine how different humidity levels affect the survival and host-seeking behavior of three medically important tick species.
+
+# A Novel Laboratory Method to Simulate Climatic Stress with Successful Application to Experiments with Medically Relevant Ticks V.2
+
+**Authors:**  
+Sang Hyo Kim¹, Caleb Nielebeck¹, Lauren Dedmon¹, Mark Pangilinan¹, Jahred Quan¹, William Ota¹, Javier D. Monzón¹  
+¹Pepperdine University
+
+**DOI:**  
+[dx.doi.org/10.17504/protocols.io.rm7vzyo8rlx1/v2](dx.doi.org/10.17504/protocols.io.rm7vzyo8rlx1/v2)
+
+**Citation:**
+Sang Hyo Kim, Caleb Nielebeck, Lauren Dedmon, Mark Pangilinan, Jahred Quan, William Ota, Javier D. Monzón. 2022. A Novel Laboratory Method to Simulate Climatic Stress with Successful Application to Experiments with Medically Relevant Ticks. *protocols.io*. DOI:10.17504/protocols.io.rm7vzyo8rlx1/v2
+
+## Introduction
+
+This protocol details a novel method to isolate individual ticks and manipulate their environment. We successfully used this method to investigate how humidity affects survival and host-seeking (questing) behavior of three species of ticks: the lone star tick (Amblyomma americanum), American dog tick (Dermacentor variabilis), and black-legged tick (Ixodes scapularis). We placed 72 adult females of each species into individual plastic tubes and separated them into three experimental relative humidity (RH) treatments representing distinct climates: 32% RH, 58% RH, and 84% RH. For 30 days, we assessed the survival and questing behavior of each tick. 
+
+## Materials
+
+### Required Ticks
+- 72 adult female *Amblyomma americanum*
+- 72 adult female *Dermacentor variabilis*
+- 72 adult female *Ixodes scapularis*
+
+### Equipment
+- 1 Climate Chamber (e.g. Percival I-41VL)
+- 216 - 20 cm x 2.5 cm Clear PETG plastic tubes
+- 216 - 20 cm Wooden skewers
+- 36 - 2 L Airtight containers
+- 12 - 32% RH Boveda Two-Way Humidity Control Packs
+- 12 - 58% RH Boveda Two-Way Humidity Control Packs
+- 12 - 84% RH Boveda Two-Way Humidity Control Packs
+- 1 Temperature/Relative Humidity Data Logger (e.g. ONSET UX100-003)
+- 70% Ethanol
+- Colored dot stickers
+- Sharpie
+
+### Other Tools
+- Entomology forceps
+- 30 cm ruler
+- White surface (e.g. lab bench diaper)
+
+> **Note:** Always handle ticks with blunt entomology forceps, as regular forceps can injure them. Always handle ticks over a white surface so that they can easily be spotted in case they are dropped.
+
+### Alternative Methods
+For hard-to-find supplies such as specific humidity control packs, these can be made using saturated salt solutions to maintain different humidity levels:
+- 32% RH: Saturated solution of magnesium chloride
+- 58% RH: Saturated solution of sodium bromide
+- 84% RH: Saturated solution of potassium chloride
+
+## Experimental Setup
+
+### Preparation
+1. **Incubator Setup:**
+   - Program the climate chamber to cycle between 20°C and 30°C with specific temperature increments.
+   - Ensure a 12:12 light:dark photoperiod.
+
+2. **Setup Time: 2h**
+   - Place a single tick with one wooden skewer in each tube and seal with a cap, labeling each tube with an individual identifier.
+   - Place six tubes in each airtight container along with a humidity pack, labeling each container.
+   - Confirm the humidity in one container of each RH level with the data logger.
+   - Program the climate chamber.
+
+### Program the Climate Chamber
+To cycle between 20°C to 30°C, the temperature increments should be as follows:
+   - 3:00 - 25°C
+   - 6:00 - 27.5°C
+   - 9:00 - 30°C
+   - 12:00 - 27.5°C
+   - 15:00 - 25°C
+   - 18:00 - 22.5°C
+   - 21:00 - 20°C
+   - 24:00 - 22.5°C
+
+### Data Collection: 5w 5d
+3. Place all the airtight containers, filled with ticks and humidity packs, into the climate chamber and start the program.
+
+4. Each day thereafter, during the 9:00 to 12:00 or 30°C increment, assess each tick for survivorship and questing behavior. Only take one container out of the chamber at a time. Collect a binary outcome for survivorship and questing, and measure the tick's height (to the nearest 0.5 cm) in the tube if it is found questing.
+
+5. Periodically move the data logger to a new bin to confirm that no unexpected changes to the climate inside the containers have occurred.
+
+6. Repeat steps 4 and 5 for 30 days or until all ticks have died.
+
+### Questing Qualifications
+- The individual is not walking but is still with its front legs extended.
+
+![](https://example.com/amblyomma_questing.jpg)
+*Example of an **Amblyomma** tick questing.*
+
+![](https://example.com/dermacentor_questing.jpg)
+*Example of a **Dermacentor** tick questing.*
+
+### Death Qualifications
+- If any tick appears dead, lightly blow on it since ticks respond to carbon dioxide exhaled by potential hosts.
+- If the tick does not move at all in 2 minutes, it should be counted as dead and placed in 70% ethanol.
+
+## Results
+This method allows for in-depth analysis of tick behavior under controlled humidity conditions, providing valuable insights into their survivorship and questing behavior.
+
+---
+endofoutput
+```

markdown-output/a-protocol-for-agrobacterium-mediated-transformati-8vghw3w.md

@@ -0,0 +1,195 @@
+```markdown
+# Goal/Experiment:
+A protocol for **Agrobacterium** mediated transformation of **Mimulus guttatus** from leaf petiole explants.
+
+## Authors 
+**Srinidhi Hollalu1, Benjamin Blackman2**
+1Department of Plant & Microbial Biology, UC Berkeley, 2University of California, Berkeley
+
+## Aim:
+This protocol aims to conduct Agrobacterium-mediated transformation of Mimulus guttatus from leaf petiole explants including the following procedures:
+1. Surface sterilization of seeds
+2. Agrobacterium culture preparation
+3. Agrobacterium infection and co-cultivation
+4. Callus induction and shoot induction
+5. Rooting of shoots
+
+---
+
+## Guidelines:
+1. **Check Active Ingredients:** Verify active ingredient in herbicide formula (Basta or Phosphinothricin) before use to modify the selection protocol accordingly.
+2. **Pilot Kill-Curve Test:** May be necessary to determine optimum herbicide concentration for each M. guttatus population.
+3. **Sterilization of Antibiotics/Hormones:** Antibiotics and hormones must be filter-sterilized and added to medium post-autoclaving.
+4. **Prepare Fresh Medium:** Cool solid medium overnight at room temperature post-pouring in petri-dish to avoid condensation.
+5. **Herbicide Resistance:** This protocol was standardized for herbicide resistance selection.
+
+---
+
+## Materials
+
+| Name                                      | Catalog #  | Vendor                |
+|-------------------------------------------|------------|-----------------------|
+| Timentin (Ticarcillin-clavulanate)        | T-104-2    | Gold Biotechnology    |
+| Cefotaxime                                | C-104-25   | Gold Biotechnology    |
+| Phosphinothricin                          | P-165-250  | Gold Biotechnology    |
+| 4-CPPU                                    | C279       | Phytotech Labs        |
+| Meta-toplin                               | T841       | Phytotech Labs        |
+| Murashige & Skoog basal salts with vitamins | M404       | Phytotech Labs        |
+| Acetosyringone                            | 2478-38-8  | Sigma Aldrich         |
+
+---
+
+### Growth Medium Composition
+
+**Murashige & Skoog Basal Salt Medium (MS salts)**
+
+| Components                               | Concentration  |
+|------------------------------------------|----------------|
+| Murashige & Skoog basal salt medium      | 4 g/L          |
+| Sucrose                                  | 20 g/L         |
+| Calcium gluconate                        | 1.3 g/L        |
+| MES (2-(N-Morpholino) ethanesulfonic acid hydrate) | 0.25 g/L |
+| Gelrite                                  | 0.25%          |
+| Adjust pH to 5.6 with KOH before adding Gelrite |
+
+**Agrobacterium Virulence Induction Medium**
+
+| Components                               | Concentration  |
+|------------------------------------------|----------------|
+| Murashige & Skoog basal salt medium      | 2 g/L          |
+| Sucrose                                  | 10 g/L         |
+| MES                                       | 0.5 g/L        |
+| 2-(N-Morpholino) ethanesulfonic acid hydrate | 0.25 g/L |
+| Acetosyringone (Dissolved in DMSO & added before use) | 200 µM           |
+| Adjust pH to 5.5 with KOH & autoclave    |
+
+**Co-Cultivation Medium**
+
+| Components                               | Concentration  |
+|------------------------------------------|----------------|
+| Murashige & Skoog basal salt medium      | 4 g/L          |
+| Sucrose                                  | 20 g/L         |
+| Calcium gluconate                        | 1.3 g/L        |
+| MES                                       | 0.25 g/L       |
+| 2-(N-Morpholino) ethanesulfonic acid hydrate | 0.25 g/L |
+| Gelrite                                  | 0.25%          |
+| CPPU                                     | 1 mg/L         |
+| Acetosyringone*                          | 100 µM         |
+| * Filter sterilize before adding to the medium |
+
+**Callus Induction Medium**
+
+| Components                               | Concentration  |
+|------------------------------------------|----------------|
+| Murashige & Skoog basal salt medium      | 4 g/L          |
+| Sucrose                                  | 20 g/L         |
+| Calcium gluconate                        | 1.3 g/L        |
+| MES                                       | 0.25 g/L       |
+| 2-(N-Morpholino) ethanesulfonic acid hydrate | 0.25 g/L |
+| Gelrite                                  | 0.25%          |
+| CPPU                                     | 1 mg/L         |
+| Timentin (Ticarcillin-clavulanate)*      | 200 mg/L       |
+| Cefotaxime*                              | 50 mg/L        |
+| Phosphinothricin*                        | 6 mg/L         |
+| * Filter sterilize before adding to the medium |
+
+**Shoot Induction Medium**
+
+| Components                               | Concentration  |
+|------------------------------------------|----------------|
+| Murashige & Skoog basal salt medium      | 4 g/L          |
+| Sucrose                                  | 20 g/L         |
+| Calcium gluconate                        | 1.3 g/L        |
+| MES                                       | 0.25 g/L       |
+| 2-(N-Morpholino) ethanesulfonic acid hydrate | 0.25 g/L |
+| Gelrite                                  | 0.25%          |
+| Meta-toplin*                             | 0.1 mg/L       |
+| Timentin (Ticarcillin-clavulanate)*      | 200 mg/L       |
+| Cefotaxime*                              | 50 mg/L        |
+| Phosphinothricin*                        | 6 mg/L         |
+| * Filter sterilize before adding to the medium |
+
+**Root Induction Medium**
+
+| Components                               | Concentration  |
+|------------------------------------------|----------------|
+| Murashige & Skoog basal salt medium      | 2 g/L          |
+| Sucrose                                  | 10 g/L         |
+| Calcium gluconate                        | 1.3 g/L        |
+| MES                                       | 0.25 g/L       |
+| 2-(N-Morpholino) ethanesulfonic acid hydrate | 0.25 g/L |
+| Gelrite                                  | 0.25%          |
+| Naphthalene Acetic Acid (NAA)*           | 0.1 mg/L       |
+| Timentin (Ticarcillin-clavulanate)*      | 200 mg/L       |
+| Cefotaxime*                              | 50 mg/L        |
+| Phosphinothricin*                        | 6 mg/L         |
+| * Filter sterilize before adding to the medium |
+
+**Safety Warnings**
+For safety information and warnings, please refer to the SDS (Safety Data Sheet).
+
+---
+
+## Procedure
+
+### Surface Sterilization of Seeds (2.5-3 months)
+
+1. **Collect Mature Seeds** 
+   - From plants grown in greenhouse/growth chamber to reduce contamination risk.
+2. **Sterilize Seeds**
+   - Place seeds in **1.5 ml** Eppendorf tube.
+   - Fill tube with surface sterilization solution (**15% laundry bleach and a drop of hand soap**).
+   - Shake vigorously for **8-10 min**.
+   - Discard sterilizing solution; **rinse seeds with sterile water** by shaking for **30 sec**. Repeat 5-6 times.
+   - Add **1 ml** sterilized water to later plate seeds.
+3. **Store Seeds**
+   - **4 ºC** for at least **2-3 weeks** to cold stratify seeds.
+4. **Transfer & Grow Seeds**
+   - Spread sterilized seeds on growth medium.
+   - Incubate jars at **20-21 ºC** under cool fluorescent lamps.
+5. **Harvest Shoots**
+   - Subculture onto new jars as needed to avoid senescence.
+
+### Agrobacterium Culture Preparation (4 days)
+
+1. **Streak Agrobacterium EH105**
+   - Harboring binary plasmid on LB/YEP agar plate; incubate at **28 ºC** for **two days**.
+2. **Inoculate Culture**
+   - Single colony into **10 ml** YEP liquid medium with rifampicin (40 µg/mL) and appropriate antibiotic.
+   - Incubate at **28 ºC** for **36-48 hrs** at **200 rpm**.
+3. **Centrifuge Cultures**
+   - Pellet at **4000 rpm**; resuspend in **5 ml** virulence induction medium.
+   - Incubate for **3-4 hrs** with gentle shaking **(50-80 rpm)** in darkness at **Room temperature**, adjusting pH to **5.5**.
+4. **Adjust Agrobacterium OD**
+   - To **0.2** using liquid half-strength MS medium.
+
+### Agrobacterium Infection and Co-cultivation (3-4 days)
+
+1. **Infect Petioles**
+   - Pull shoots onto sterile petri dish; infect each petiole with Agrobacterium on co-cultivation medium.
+   - Incubate in darkness/low light at **Room temperature** for **2-3 days**.
+2. **Day 3**: 
+   - Wash explants in sterile timentin (100 mg/L) + cefotaxime (50 mg/L) solution and transfer to callus induction medium with phosphinothricin.
+   - Incubate at **21 ºC** under cool fluorescent lamps.
+
+### Callus Induction and Shoot Induction (4-5 months)
+
+1. **Subculture Explants after 21-24 days**
+   - Retain partial callus and culture on callus induction medium. Repeat subculturing every **21-24 days**.
+   - Transfer mature callus to Meta-toplin medium with acclimation.
+2. **Signatures of Differentiation**
+   - Transfer compact callus to shoot induction medium.
+
+### Rooting of Shoots (3 weeks)
+
+1. **When Shoots Emerge**
+   - Separate and plate individual shoots on rooting medium.
+2. **Subculture**
+   - Half-strength rooting medium for further rooting/hardening.
+3. **Move Shoots to Greenhouse**
+   - Move rooted shoots to potting medium and leave for at least two weeks to harden.
+
+---
+
+`endofoutput`
+```

markdown-output/a-sars-cov-2-surveillance-sequencing-protocol-opti-butbnwin.md

@@ -0,0 +1,235 @@
+```markdown
+# Goal/Experiment:
+To identify and monitor SARS-CoV-2 variant evolution, using a surveillance sequencing protocol optimized for Oxford Nanopore PromethION.
+
+---
+
+## A SARS-CoV-2 Surveillance Sequencing Protocol Optimized for Oxford Nanopore PromethION
+
+**Authors**:
+Jannatul Ferdous, Torri Weathers, Visva Bharati Barua, Erin Stiers, Adam France, Kevin C Lambirth, Cynthia Gibas, Jessica A Schlueter  
+*UNC Charlotte*  
+
+**Published**: October 15, 2021  
+**DOI**: [dx.doi.org/10.17504/protocols.io.butbnwin](https://dx.doi.org/10.17504/protocols.io.butbnwin)  
+
+---
+
+### Introduction
+To identify and monitor SARS-CoV-2 variant evolution, UNC Charlotte has introduced a surveillance sequencing program. This protocol, optimized for the Oxford Nanopore PromethION, prepares SARS-CoV-2 viral genome libraries for next-generation sequencing. The protocol is designed to work in a 96-well format, producing sufficient sequence data for genome assembly to meet GISAID and NCBI submission standards. It addresses isolate sequencing failures due to low viral titers and provides guidelines for cost-effective sequencing of high Cq value clinical samples.
+
+---
+
+### Safety and Preparations
+- **Wear PPE** at all times.
+- **Clean workbench** and pipettes with 70% ethanol before use.
+- **Handle samples carefully** during SPRI clean-up, barcoding, and adapter ligation to avoid significant loss of beads.
+
+---
+
+### Reagents and Equipment
+#### cDNA Synthesis
+- **ABI HC cDNA kit** (Fisher cat #4368813)
+- **10x RT Buffer** (ABI HC cDNA kit, Fisher cat #4368813)
+- **10x RT Random primers** (ABI HC cDNA kit, Fisher cat #4368813)
+- **25x dNTPs Mix**, 100 mM
+- **Multiscribe RT**, 50 U/µL (ABI HC cDNA kit, Fisher cat #4368813)
+- **MgCl2**, 50 mM
+
+#### ARTIC PCR Amplification
+- **Q5 Reaction Buffer** (New England Biolabs, cat #M0491L)
+- **Q5 High Fidelity Polymerase** (New England Biolabs, cat #M0491L)
+- **ARTIC V3 primer pool 1** (IDT DNA, diluted to 10 µM)
+- **ARTIC V3 primer pool 2** (IDT DNA, diluted to 10 µM)
+- **2.5 mM dNTP Mix**
+
+#### SPRI Clean-up
+- **AMPure XP beads** (Beckman Coulter cat #A63881)
+- **80% Ethanol**, fresh
+- **Omega EB** (Omega BioTek, PD089)
+
+#### Qubit Quantification
+- **Invitrogen Qubit 1x dsDNA HS Assay Kit** (Fisher cat #Q33231)
+
+#### Library End-Repair
+- **Ultra II End-Prep Reaction Buffer**
+- **Ultra II End-Prep Reaction Enzyme**
+
+#### Sample Barcoding
+- **Native Barcoding Expansion 96** (Oxford Nanopore, EXP-NBD196)
+- **Ultra II Ligation Master Mix** (New England Biolabs cat #E7546L)
+- **Ultra II Ligation Enhancer** (New England Biolabs cat #E7546L)
+- **Short Fragment Buffer** (Oxford Nanopore, EXP-SFB001)
+- **Elution Buffer** (EB)
+
+#### Adapter Ligation
+- **Adapter Mix II** (Oxford Nanopore, EXP-MRT001 or part of EXP-NBD196)
+- **Quick T4 DNA Ligase** (New England Biolabs cat #E6056L)
+- **Short Fragment Buffer** (Oxford Nanopore, EXP-SFB001)
+- **Elution Buffer** (EB; Oxford Nanopore EXP-AUX001)
+
+---
+
+### Protocol
+
+#### cDNA Synthesis
+
+1. **Reagents:**
+   - 10x RT Buffer
+   - 50mM MgCl2
+   - 10x RT Random Primer
+   - 25x dNTPs Mix
+   - Multiscribe RT
+
+2. **Prepare Master Mix 1 (MM1) in a 1.5 mL Lobind tube on ice:**
+   - *For 96 samples*  
+     Nuclease Free Water: 424 µL  
+     10x Random Primer: 212 µL  
+     25x dNTPs Mix: 84.8 µL  
+
+3. **Array RNA into Plate and Mix:**
+   - *For Regular Samples:*  
+     Array 10 µL RNA into a 96-well plate on an ice block. Add 6.8 µL of MM1 to each well.
+
+   - *For High Cq Samples:*  
+     Array 20 µL RNA and add 13.6 µL MM1 to each well.
+
+   - *For Reduced Cost Samples:*  
+     Array 5 µL RNA and add 3.4 µL MM1 to each well.
+
+4. **Incubate Reaction:**
+   - Seal plate, mix by quick spin. Incubate at 65°C for 5 minutes.
+
+5. **Prepare Master Mix 2 (MM2) in a 1.5 mL Lobind tube on ice:**
+   - *For 96 samples*  
+     10x RT Buffer: 212 µL  
+     Multiscribe RT: 106 µL  
+     MgCl2: 21.2 µL  
+
+6. **Add MM2 to Each Well:**
+   - *For Regular Samples:* Add 3.2 µL MM2 to the RNA plate.
+   - *For High Cq Samples:* Add 6.4 µL MM2 per well.
+   - *For Reduced Cost Samples:* Add 1.6 µL MM2 per well.
+
+7. **Incubate Further:**
+   - Seal and mix by quick spin.  
+   25°C for 10 minutes  
+   37°C for 2 minutes  
+   85°C for 5 minutes  
+   Hold at 4°C
+
+8. **Store Plate:** 
+   - For long term: -20°C  
+   - Short term: 4°C
+
+#### ARTIC PCR Amplification
+
+9. **Reagents:**
+   - 5x Q5 Reaction Buffer
+   - Q5 High Fidelity Polymerase
+   - V3 ARTIC primer pool 1 (diluted to 10 µM)
+   - V3 ARTIC primer pool 2 (diluted to 10 µM)
+
+10. **PCR Plate Setup:**
+    - **ARTIC Pool 1:**  
+      Master Mix:  
+      Nuclease-free water: 927.5 µL  
+      Reaction Buffer: 530 µL  
+      V3 Pool 1: 424 µL  
+      2.5mM dNTP mix: 212 µL  
+      Q5 High fidelity polymerase: 26.5 µL  
+
+    - **ARTIC Pool 2:**  
+      Master Mix:  
+      Nuclease-free water: 927.5 µL  
+      Reaction Buffer: 530 µL  
+      V3 Pool 2: 424 µL  
+      2.5mM dNTP mix: 212 µL  
+      Q5 High fidelity polymerase: 26.5 µL
+
+11. **Distribute PCR Components for ARTIC Pools 1 & 2:**
+    - Mix 20 µL MM1 into the ARTIC Pool 1 plate and add 5 µL of cDNA.
+    - Mix 20 µL MM2 into the ARTIC Pool 2 plate and add 5 µL of cDNA.
+
+12. **Set PCR Cycling Program:**
+    - 1 Cycle: 98°C for 30 seconds  
+    - 20 Cycles: 94°C for 16 seconds → 65°C for 5 minutes → 94°C for 16 seconds → 65°C for 5 minutes  
+    - Hold at 4°C.
+
+    **Store at**  
+    - Long term: -20°C  
+    - Short term: 4°C
+
+#### SPRI Clean-Up
+
+13. **Reagents:**
+    - AMPure XP Beads
+    - 80% Ethanol Fresh
+    - Omega EB
+
+14. **Prepare Fresh 80% Ethanol:**
+    - Mix 40 mL 100% Ethanol with 10 mL H2O in a 50 mL tube.
+
+15. **Clean-up Procedure:**
+    - Spin PCR Product Plates.
+    - Transfer and mix AMPure Beads.
+    - Incubate 15 minutes.
+    - Wash with 80% ethanol.
+    - Elute DNA with 33 µL Omega EB.
+
+#### Qubit Quantification
+
+16. **Reagents:**
+    - Qubit Quantification Kit (dsDNA HS Assay)
+    - Standards (Included in Kit)
+
+17. **Qubit reagent preparation:**
+    - dsDNA HS Buffer: 24278 µL
+    - Qubit Dye: 122 µL
+    - Mix well, vortex and spin.
+
+18. **Run Qubit Assay Using Standard Protocols:**
+
+#### Library End-Repair
+
+19. **Reagents:**
+    - NEB Ultra II End-Prep Reaction Buffer & Enzyme
+
+20. **Prepare Master Mix for 96 Samples:**
+    - Reaction Buffer: 213.59 µL
+    - Enzyme: 91.425 µL
+    - Mix and distribute into the 96-well plate.
+
+21. **Standardize DNA:**
+    - Normalization using qubit data and spreadsheet.
+    - Incubate, perform end-repair.
+
+#### Sample Barcoding
+
+22. **Reagents:**
+    - Native Barcoding Expansion (EXP NBD 196)
+    - NEB Ultra II Ligation Master Mix and Enhancer
+
+23. **Prepare Master Mix:**
+    - Nuclease-Free Water: 604.2 µL
+    - Ligation Master Mix: 1060 µL
+    - Ligation Enhancer: 31.8 µL
+    - Mix thoroughly.
+
+#### Adapter Ligation & Final Steps
+
+24. **Reagents:**
+    - Adapter Mix II
+    - NEB Quick Ligase and Buffer
+    - Elution Buffer
+
+25. **Complete Ligation Steps:**
+    - Mix Polishes, Spin, Elute, and Store.
+
+---
+
+**End of Document**
+---
+
+endofoutput
+```

markdown-output/a-scoping-review-of-remote-rehabilitation-interven-bh9aj92e.md

@@ -0,0 +1,124 @@
+```markdown
+Goal/Experiment: Conduct a scoping review of “remote” rehabilitation interventions to address COVID-19 sequalae.
+
+# A Scoping Review of “Remote” Rehabilitation Interventions to Address COVID-19 Sequelae
+
+**Authors:**
+Julie Whitney<sup>1</sup>, Lindsay Bearne<sup>1</sup>, Patrick White<sup>1</sup>, Arietta Spinou<sup>1</sup>, Emma Godfrey<sup>1</sup>, Matthew O’Connell<sup>1</sup>, Julia Fox-Rushby<sup>2</sup>, Graham Fisher<sup>2</sup>, Katie Sheehan<sup>1</sup>
+
+<sup>1</sup>King’s College London, University of London  
+<sup>2</sup>Patient representative
+
+DOI: [dx.doi.org/10.17504/protocols.io.bh9aj92e](https://dx.doi.org/10.17504/protocols.io.bh9aj92e)
+
+---
+
+### Abstract
+
+**Plain English Summary**
+
+Many people who have been unwell with COVID-19 are suffering long-term problems with their fitness and ability to participate in usual activities of daily life. Symptoms include muscle weakness, breathlessness, changes in sensation, pain and fatigue. There are also effects on psychological and mental health. Rehabilitation could help with these issues. However, there are challenges in providing this rehabilitation because so many patients need to access these services and because face to face treatment is not always possible due to social distancing. 
+
+There has been increasing interest in remote rehabilitation interventions from researchers and app developers in recent years. Remote interventions use technology such as video, smartphone applications, and interactive conferencing (e.g., Zoom) to deliver rehabilitation programmes.
+
+We will search for evidence about remote rehabilitation interventions and application stores to identify existing remote interventions that might meet the needs of COVID-19 survivors. This information will allow rehabilitation teams to direct patients to suitable remote interventions. This may be needed to replace or to enhance their rehabilitation programme.
+
+---
+
+## Attachments
+
+[scoping review protocol version 4.pdf](#)  
+
+### Protocol Citation
+
+Julie Whitney, Lindsay Bearne, Patrick White, Arietta Spinou, Emma Godfrey, Matthew O’Connell, Julia Fox-Rushby, Graham Fisher, Katie Sheehan 2020. A scoping review of “remote” rehabilitation interventions to address COVID-19 sequelae. *protocols.io*. [dx.doi.org/10.17504/protocols.io.bh9aj92e](https://dx.doi.org/10.17504/protocols.io.bh9aj92e)
+
+### License
+
+This is an open access protocol distributed under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+### Protocol Details
+
+**Created:** Jul 06, 2020  
+**Last Modified:** Jul 08, 2020  
+**Protocol Integer ID:** 38914
+
+---
+
+## 1. Protocol Registration
+
+The protocol is registered on protocols.io.
+
+## 2. Inclusion Criteria
+
+Papers/applications that describe a rehabilitation intervention:
+
+- Aimed at long-term symptoms known to be associated with COVID-19 (e.g., fatigue, breathlessness, weakness).
+- Aimed at the community-based or self-management level of acuity (excluding hospital or inpatient rehabilitation).
+- Delivered remotely.
+
+The intervention type, dose, and delivery should be clearly described/replicable. The intervention should be currently accessible as an application/web-based tool to the public (although may be behind a paywall). 
+
+Programs should be available in English language and based in the UK. 
+
+Types of evidence sources: meta-analysis, systematic review, randomized controlled trial, non-randomized or before/after study design as well as selected commentaries.
+
+## 3. Search Strategy
+
+The review will use a five-step search strategy:
+
+1. An initial search of two databases (MEDLINE and CINAHL) with selected papers analysed for potential additional keywords.
+2. A full search across all databases (Embase, Cochrane trials register) using any newly identified keywords as search terms.
+3. A search of reference lists of selected papers.
+4. A search of grey literature including conference proceedings from tech in health conferences; selected commentaries.
+5. App stores search (Apple, Google Play, and NHS Apps library) and in the website [www.fnd.io](https://fnd.io).
+
+## 4. Data Extraction
+
+Data from papers:
+
+- **Source details**
+  - Author / date
+  - Conditions/populations for which the intervention is designed (including acuity)
+  - Media type
+
+- **Type of rehabilitation**
+  - Type of exercise/activity
+  - Dose (intensity/frequency/duration) of intervention
+
+- **Delivery of the intervention**
+  - Qualifications/profession of developer/instructor
+  - Motivational tools incorporated into the intervention (use template to quantify)
+  - Theories to support delivery
+  - Opportunity for social interaction/peer support incorporated into the intervention
+  - Follow up/support provided within the tool/intervention
+  - Costs of the interventions (simple i.e. whether it requires a fee to use)
+
+Data from applications:
+
+- **Source information**
+  - App name, platform, version, developer, size, star rating, number of installs.
+  - Privacy policy statement and medical product status.
+  - Conditions/populations for which the intervention is designed (and acuity)
+
+- **Type of rehabilitation**
+  - Type of exercise/activity
+  - Dose (intensity/frequency/duration) of intervention
+
+- **Delivery of the intervention**
+  - Qualifications/profession of developer/instructor
+  - Motivational tools incorporated into the intervention (use template to quantify)
+  - Theories to support delivery
+  - Opportunity for social interaction/peer support incorporated into the intervention
+  - Follow up/support provided within the tool/intervention
+  - Costs of the interventions (simple i.e. whether it requires a fee to use)
+
+## 5. Analysis
+
+Interventions will be summarised narratively according to target condition and demographic, media type and rehabilitation type (dose—frequency, intensity, duration—and support provided) using tables and/or charts. Interventions relevant to different COVID-19 rehabilitation needs (addressing different symptoms) will be illustrated using tables and/or charts.
+
+**Consultation:**
+Findings will be reviewed by a stakeholder group of rehabilitation clinicians and academics that have assembled for a related project.
+
+endofoutput
+```

markdown-output/a-versatile-nuclei-extraction-protocol-for-single-crw4v7gw.md

@@ -0,0 +1,129 @@
+```markdown
+# Goal/Experiment:
+Develop a versatile nuclei extraction protocol for single-cell multimodal ATAC and gene expression analysis in non-model species to ensure high-quality nuclei isolation for subsequent molecular biology applications.
+
+# A Versatile Nuclei Extraction Protocol for Single Cell Multimodal ATAC and Gene Expression in Non-Model Species
+
+**Authors:**
+Rose Ruiz Daniels<sup>1</sup>, Richard S Taylor<sup>1</sup>, Ioannis Konstantinidis<sup>2</sup>, Sarah Salisbury<sup>1</sup>, Diego Perojil Morata<sup>1</sup>, Jorge Manuel de Oliveira Fernandes<sup>2</sup>, Emily Clark<sup>1</sup>, Dan Macqueen<sup>1</sup>, Diego Robledo<sup>1</sup>
+**Affiliations:**
+1. The Roslin Institute and Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Edinburgh EH25 9RG, UK.
+2. Nord University, Bodø, Hovedbygning 2060, Norway.
+
+**DOI:** [10.17504/protocols.io.bp2l69wnrlqe/v1](https://doi.org/10.17504/protocols.io.bp2l69wnrlqe/v1)
+
+## Abstract
+
+This protocol presents a modified version of an approach to extract nuclei from various tissue types for single-cell sequencing and aims to extract high-quality nuclei for single-cell multimodal ATAC and gene expression analysis using the 10x Chromium system. Key modifications include varied RNase inhibitor concentrations, nuclear isolation buffer quantities, and specific steps for multimodal analysis. 
+
+For bulk ATAC-seq, use protease inhibitor cocktail PIC instead of RNase inhibitor in the snRNA-seq version of this protocol.
+
+### Goal
+Develop a high-quality nuclei extraction protocol from diverse tissue types for single-cell multi-omic applications ensuring optimal nuclei integrity and yield.
+
+## Guidelines
+
+**Trial Preparation:**
+Conduct a trial run before library preparation, especially with new tissue types, to adjust parameters (e.g., mincing times, filter size) and optimize nuclei quality. Adjusting these parameters helps prevent RNAse introduction and ensures the production of nuclei with intact membranes.
+
+## Materials
+
+### Equipment and Supplies
+- **Noyes Spring Scissors - Tungsten Carbide** (Fine Science Tools Catalog #15514-12)
+- **Tungsten Carbide Straight Scissors 11.5 cm** (Fine Science Tools Catalog #14558-11)
+- **40 µm Falcon™ Cell Strainers** (Fisher Scientific Catalog #08-771-2)
+- **Corning™ Falcon™ Test Tube with 35 µm Cell Strainer Snap Cap** (Corning Catalog #352235)
+- **pluriStrainer Mini 20 µm (Cell Strainer)** (pluriSelect Catalog #43-10020-50)
+- X500 Eppendorf DNA LoBind Tubes, 1.5ml, PCR clean
+- Cryotube
+- 6-well tissue culture plate (Stem Cell Technologies)
+- Falcon tubes 15 ml (Corning)
+- **INCYTO C-Chip™ Disposable Hemacytometers** (VWR International Catalog #82030-468)
+
+## Sampling and Storage for Nuclear Isolation
+
+### Sampling
+- **Euthanize and Process:** Euthanize animals humanely and immediately process the tissues.
+- **Sample Preparation:** Freeze ~60 mg of sammond tissue in a cryotube and flash freeze in liquid nitrogen. If liquid nitrogen is unavailable, use dry ice. The tissue preservation step is critical.
+- **Storage:** Store tissue samples at -80°C for up to one year. Older samples may still yield viable nuclei but require testing.
+
+### Critical Steps
+- **Immediate Freezing:** Preserve tissue samples as quickly as possible to maintain nuclear integrity.
+
+## Reagents
+
+Chill all reagents on ice before use.
+
+**2X Stock of Salt-Tris Solution (10 mL)**
+
+| Component             | Catalog Number                             | Stock Solution | Volume | Final Concentration |
+|-----------------------|--------------------------------------------|----------------|--------|---------------------|
+| NaCl (5 M) RNase-free | Thermo Fisher Scientific Catalog #AM9759   | 292 µL         |        | 146 mM              |
+| Tris-HCl pH 7.5       | Thermo Fisher Catalog #15567027            | 100 µL         |        | 10 mM               |
+| CaCl2 1 M Solution    | VWR International Catalog #97062-820       | 10 µL          |        | 1 mM                |
+| MgCl2 1.00 M Solution | MilliporeSigma (Sigma-Aldrich) Catalog M1028 | 210 µL         |        | 21 mM               |
+| Nuclease-free Water   | VWR International Catalog #97062-794       | 9388 µL        |        |                     |
+
+### RNase Inhibitor-Containing Buffers
+
+**Protector RNase Inhibitor** (Merck MilliporeSigma Catalog #3335399001)
+
+**1X ST Buffer Solution**
+- Dilute 2X ST with equal volumes of nuclease-free water (1:1) to create the 1X solution.
+- 250 µL RNase inhibitor (200 U/mL) per 1X ST solution (10 mL).
+
+**Working Solutions:**
+1X ST with additional components:
+  
+| Component              | Catalog Number                  |  Volume | Final Concentration |
+|------------------------|---------------------------------|---------|---------------------|
+| 2X ST Buffer           |                                 |   2 mL  |                     |
+| 1% Tween-20            | Sigma-Aldrich Catalog #P-7949   | 120 µL  |                     |
+| 2% BSA                 | NEB Biolabs Catalog #B9000S     |  20 µL  |                     |
+| Nuclease-free water    |                                 | 1810 µL |                     |
+| RNase inhibitor        |                                 |  50 µL  | 1000 U/mL           |
+
+Prepare and chill solutions immediately before use.
+
+## Nucleus Isolation Workflow for ST-based Buffers
+
+### Step 1: Initial Sample Preparation (30m)
+- Keep samples frozen on dry ice until nuclei isolation.
+- Pre-chill the centrifuge to 4°C.
+- Place frozen tissue into a 6-well plate with 1 mL TST buffer.
+- If tissue sticks to the cryotube, transfer using tweezers on dry ice.
+
+### Step 2: Mincing (10m)
+- Mince tissue with Tungsten Carbide scissors for 30 seconds, then switch to Noyes Spring Scissors for total of 10 minutes for hard tissues.
+- For soft tissues, use spring scissors only for 10 minutes.
+
+#### Step 2.1: Dissociation
+- Pipette tissue gently using a P1000 pipette with a low-retention tip.
+- Critical Step: Assess timing by examining nuclei under a microscope.
+    - **Head Kidney Nuclei:** Insufficient dissociation time - not ideal.
+    - **Blood Nuclei:** Perfect dissociation - ideal.
+    - **Liver Nuclei:** Over-dissociation - not ideal.
+
+### Step 3: Lysate Processing
+- Pass lysate through a 40 µm cell strainer.
+    - Rinse with 1 mL TST and add 3 mL freshly prepared ST buffer.
+    - Collect 5 mL of lysate in a Falcon tube on ice.
+
+### Step 4: Centrifugation (5m)
+- Centrifuge at 500 x g for 5 minutes at 4°C in a swinging bucket centrifuge.
+
+### Step 5: Pellet Resuspension
+- Remove excess liquid with a P200 pipette carefully without disturbing the pellet.
+- Gently resuspend the pellet with a P1000 pipette aiming to recover 6000 nuclei using a diluted nuclei buffer containing 1U/µL RNase inhibitor.
+
+### Step 6: Nuclei Counting
+- Use a C-chip disposable haemocytometer to count nuclei.
+- Confirm counts and assess debris and nuclear membrane integrity.
+
+### Step 7: Confirmation
+- Confirm nuclei counts with a Bio-Rad TC20 for viable cells. Ideal live cell proportion: 1-4%.
+
+---
+
+## End of Output
+```

markdown-output/aav-injection-in-the-nodose-ganglia-in-mouse-cfpgtmjw.md

@@ -0,0 +1,105 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to inject Adeno-Associated Virus (AAV) into the nodose ganglia in mice to study the role of specific cell populations in the bidirectional communication between the brain and body via the vagus nerve. This protocol aims to describe a practical surgical approach to access the vagal trunk and the jugular-nodose ganglion (JNG) complex in mice.
+
+# AAV Injection in the Nodose Ganglia in Mouse
+### Santiago Unda¹, Michael G. Kaplitt¹
+¹Weill Cornell Medicine
+
+#### ASAP Collaborative Research Network
+
+#### Kaplitt Protocols
+
+#### Eileen Ruth Torres
+#### Weill Cornell Medicine
+
+#### DOI:
+[dx.doi.org/10.17504/protocols.io.5qpvobjmdl4o/v1](https://dx.doi.org/10.17504/protocols.io.5qpvobjmdl4o/v1)
+
+#### Protocol Status:
+Working - We use this protocol and it is working
+
+### Abstract
+The gut-brain axis links the visceral organs to the medulla oblongata via the vagus nerve. Accessing the afferent vagal pathway is crucial to dissect the role of cell populations in the communication between the brain and body. The jugular-nodose ganglion (JNG) complex has varied neural subpopulations responsible for sensing physiological conditions of the thoracic and abdominal organs. Studying these ganglia is challenging in small animals due to their size and location. Herein, we describe a practical surgical approach to the vagal trunk and the JNG complex in mice.
+
+## Materials
+
+| Equipment | Type | Brand | SKU | Link |
+| --------- | ---- | ----- | --- | ---- |
+| 10μl, Neuros Syringe, Model 1701 RN, 33 gauge | Syringe | Hamilton | 65460-06 | |
+| Sub-Microliter Injection System | Injection System | World Precision Instruments | N/A  | [wpiinc.com](https://www.wpiinc.com/var-3167-sub-microliter-injection-system) |
+| NanoFil Application Kits | Application Kit | World Precision Instruments | IO-KIT | [wpiinc.com](https://www.wpiinc.com/var-3327-nanofil-application-kits) |
+| 36-gauge Beveled NanoFil needle | Needle | World Precision Instruments | NF36BV-2 | |
+| Micromanipulator | Manipulator | Miller Design | P#10 | |
+
+## Before Start Instructions
+
+1. Disinfect the surgical work surface with 70% ethanol and prepare sterile instruments (e.g., fine scissors, forceps, retractor).
+2. Use gauzes, staples, and swabs sterilized by autoclaving.
+3. For multiple surgeries, clean and re-sterilize instruments with 70% ethanol or a dry bead sterilizer between mice.
+4. A surgical mask, clean lab coat, hair bonnet, and sterile gloves should be worn.
+5. These ganglia are approximately 1mm wide and located deep in the cervical carotid triangle. A surgical microscope will be needed for the entire procedure.
+
+## Preparation of the Surgical Setup
+
+1. **Turn on the heating pad to 37°C.**
+2. **Position the surgical microscope.**
+3. **Prepare the AAV aliquot:**
+   - Thaw the aliquot, mix well, and keep on ice.
+   - For intraneural injections (vagus trunk), use the mosaic AAVrg/rh10 for better efficiency and mainly transduce afferent neurons with minimal impact on the efferent vagal pathway. Titer: 1-3×10¹²vg/ml; Volume: 4-6μl.
+   - For intraganglionic injections, use AAV9. Titer: 1-3×10¹²vg/ml; Volume: 2-3μl.
+4. **Withdraw the AAV with a 10μl 33G syringe.**
+5. **Remove locking cap and gasket from the 10μl syringe.**
+6. **Connect the NanoFil sub-microliter injection system.**
+7. **Attach the SilFlex tubing to the 10μl syringe and the other end to the Neuros Syringe.**
+8. **Secure the 36G beveled NanoFil needle to the injection holder.**
+9. **De-gas the NanoFil system by slowly pushing the plunger.**
+
+## Surgery
+
+1. **Anesthetize mice** using a mixture of ketamine (110mg/kg) and xylazine (8mg/kg) or isoflurane.
+2. **Shave** the whole anterior cervical area with an electric razor or shaving cream.
+3. **Lay the mouse flat** on supine position on a heating pad.
+4. **Apply ophthalmic ointment** to the mouse’s eyes.
+5. **Sterilize the surgical area** with 70% alcohol, complex iodine, and 70% alcohol again. Place a surgical gauze in the sterile area.
+6. **Make a small incision** in the skin with straight thin scissors or a scalpel.
+7. **Retract the submandibular glands** laterally to expose the cervical musculature.
+8. **Dissect the sternocleidomastoid muscle** laterally and the omohyoid muscle medially.
+9. **Identify the carotid bifurcation** and gently dissect the connective tissue surrounding the area.
+10. **Remove the connective tissue** surrounding the vagus trunk above the carotid bifurcation (Proceed if intra neural injections are required).
+11. **Identify the temporal bone** underneath the posterior belly of the digastric muscle.
+12. **Dissect the muscle fibers**, next to the mastoid notch of the temporal bone to reveal the JNG swelling.
+
+## Stepwise Procedure
+
+1. **Make a small incision** in the middle of the neck.
+2. **Retract the submandibular glands** laterally.
+3. **Dissect the sternocleidomastoid muscle** laterally and the omohyoid muscle medially.
+4. **Identify the carotid bifurcation** and gently dissect the connective tissue surrounding the vagus trunk above it.
+5. **Remove the connective tissue** around the vagus trunk above the carotid bifurcation. (Intra neural injections proceed).
+6. **Identify the temporal bone** and dissect the muscle fibers to reveal JNG swelling.
+7. **Visualize JNG**, proceed with intraganglionic injection.
+8. **Open the muscle fibers** behind the posterior belly of the digastric muscle for clear view if needed.
+9. **Injection volume and method**: Use a micromanipulator or free-handed; inject using 10μl syringe at 2nl/s infusion rate with a total volume of 500nl.
+
+## Post-Surgery Procedures
+
+1. **Close the skin** with sterile suture, apply povidone-iodine.
+2. **Apply antibiotic ointment** and inject 5mg/kg Carprofen for analgesia.
+3. **Maintain the mouse under a heat lamp** until fully awake; return to the cage when fully recovered.
+
+## Visual Guide
+![Visual Guide](surgical_steps_image.jpg)
+1. Midline incision
+2. Submandibular glands
+3. Muscle dissection
+4. Carotid bifurcation
+5. Left vagus trunk
+6. Intra neural injection site
+
+End of Protocol.
+
+---
+End of Output.
+```
+endofoutput

markdown-output/activation-and-intracellular-staining-of-whole-blo-hukb6uw.md

@@ -0,0 +1,127 @@
+```markdown
+# Goal/Experiment:
+**Activation and Intracellular Staining of Whole Blood: For the Detection of Intracellular Cytokines and Other Intracellular Targets**
+
+## BioLegend, Inc.
+
+### Abstract
+This is part of BioLegend's, "Intracellular Flow Cytometry Staining Protocol: For the Detection of Intracellular Cytokines and Other Intracellular Targets."
+
+### Guidelines
+
+#### Application Notes
+
+1. **Activated Cell Preparation:**
+   - Activated cell populations can be prepared from in vivo-stimulated tissues or vitro-stimulated cultures (e.g., antigen-specific activation or mitogen-induced).
+   - For cytokine and chemokine detection, include a protein transport inhibitor such as brefeldin A (BioLegend Cat. No. 420601) or monensin (BioLegend Cat. No. 420701) in the last 4-6 hours of cell culture activation.
+   - The cells can be suspended and distributed to 12 x 75 mm plastic tubes or microwell plates for immunofluorescent staining.
+
+2. **Optimization of Stimulation Conditions:**
+   - Different cytokines/chemokines have different production peaks. Stimulation conditions for each stimulant should be optimized.
+
+3. **Surface Marker Antibodies:**
+   - Some antibodies recognizing native cell surface markers may not bind to fixed/denatured antigens.
+   - It is recommended that staining of cell surface antigens be done with live, unfixed cells PRIOR to fixation/permeabilization and staining of intracellular targets. 
+
+#### Note
+To confirm specific anti-cytokine staining, a blocking experiment is recommended:
+- Cells fixed/permeabilized then preincubated with an excess amount of unlabeled anti-cytokine antibody and/or the recombinant cytokine of interest is preincubated with fluorophore-conjugated anti-cytokine antibody before its addition to the cells.
+
+### Related Information
+
+1. Assenmacher, M., et al. 1994. Eur. J. Immunol. 24:1097.
+2. Elson, L.H., et al. 1995. J. Immunol. 1995. 154:4294.
+3. Jung T, et al. 1993. J. Immunol. Methods 159:197.
+4. Prussin C., et al. 1995. J. Immunol. Methods 188:117.
+5. Vikingsson A., et al. 1994. J. Immunol. Methods 173:219.
+
+### Reagent List
+
+1. **Cell Staining Buffer** (BioLegend Cat. No. 420201)
+2. **Monensin** (BioLegend Cat. No. 420701)
+3. **RBC Lysis Buffer** (BioLegend Cat. No. 420301)
+4. **Brefeldin A** (BioLegend Cat. No. 420601)
+5. **Fixation Buffer** (BioLegend Cat. No. 420801)
+6. **Intracellular Staining Perm Wash Buffer** (BioLegend Cat. No. 421002)
+7. **Cyto-Last™ Buffer** (BioLegend Cat. No. 422501)
+
+### Protocol
+
+#### Activation
+
+**Step 1.**
+- Dilute heparinized whole blood 1:1 with sterile appropriate tissue culture medium.
+
+**Step 2.**
+- Perform in vitro cellular stimulation by either antigen or mitogen.
+- If staining intracellular cytokines or chemokines (e.g., IFN-γ or IL-4), add a protein transport inhibitor such as brefeldin A (BioLegend Cat. No. 420601) or monensin (BioLegend Cat. No. 420701).
+
+**Step 3.**
+- Aliquot 200 µl of the whole blood cell suspension into 12 x 75 mm plastic tubes.
+- Incubate for 4-6 hours in 5% CO2 at 37°C.
+
+**Step 4.**
+- Add 2 ml of 1X Red Blood Cell Lysis Buffer (BioLegend Cat. No. 420301) and incubate for 5-10 minutes at room temperature.
+
+**Step 5.**
+- Centrifuge at 350 x g for 5 minutes and discard the supernatant.
+
+**Step 6.**
+- Wash cells 1X with Cell Staining Buffer.
+
+**Step 7.**
+- If staining intracellular antigens (e.g., IFN-γ or IL-4), first perform cell surface antigen staining as described in BioLegend’s [Cell Surface Immunofluorescence Staining Protocol](https://biolegend.com) then fix cells in 0.5 ml/tube Fixation Buffer (BioLegend Cat. No. 420801) in the dark for 20 minutes at room temperature.
+
+**Step 8.**
+- Centrifuge at 350 x g for 5 minutes and discard the supernatant.
+
+**Step 9.**
+- To put the experiment "on hold" for future staining and analysis:
+  - Wash cells 1x with Cell Staining Buffer (BioLegend Cat. No. 420201).
+  - Resuspend cells in Cell Staining Buffer and store cells at 4°C (short term) or in 90% FCS/10% DMSO for storage at -80°C (long term, for fixed cells without surface antigen staining).
+
+  _Note: Alternatively, cells can be kept in Cyto-Last™ Buffer (BioLegend Cat. No. 422501) for the storage of cytokine-producing cells for up to two weeks._
+
+#### Permeabilization
+
+**Step 10.**
+- Dilute 10X Intracellular Staining Perm Wash Buffer (BioLegend Cat. No. 421002) to 1X in DI water.
+
+**Step 11.**
+- Resuspend fixed cells in Intracellular Staining Perm Wash Buffer and centrifuge at 350 x g for 5-10 minutes. (1/3)
+
+**Step 12.**
+- Resuspend fixed cells in Intracellular Staining Perm Wash Buffer and centrifuge at 350 x g for 5-10 minutes. (2/3)
+
+**Step 13.**
+- Resuspend fixed cells in Intracellular Staining Perm Wash Buffer and centrifuge at 350 x g for 5-10 minutes. (3/3)
+
+#### Intracellular Staining
+
+**Step 14.**
+- Resuspend fixed/permeabilized cells in residual Intracellular Staining Perm Wash Buffer and add a predetermined optimum concentration of fluorophore-conjugated antibody of interest (e.g., PE anti-IFN-γ) or an appropriate negative control for 20 minutes in the dark at room temperature.
+
+**Step 15.**
+- Wash with 2 ml of Intracellular Staining Perm Wash Buffer and centrifuge at 350 x g for 5 minutes. (1/2)
+
+**Step 16.**
+- Wash with 2 ml of Intracellular Staining Perm Wash Buffer and centrifuge at 350 x g for 5 minutes. (2/2)
+
+**Step 17.**
+- If primary intracellular antibody is biotinylated, perform fluorophore-conjugated Streptavidin incubations and subsequent washes in Intracellular Staining Perm Wash Buffer.
+
+**Step 18.**
+- Resuspend fixed and intracellularly labeled cells in 0.5 ml Cell Staining Buffer and analyze with appropriate controls.
+
+#### Flow Cytometric Analysis
+
+**Step 19.**
+- Set PMT voltage and compensation using cell surface staining controls.
+- Set quadrant markers based on blocking controls, isotype controls, or unstained cells.
+
+  _Note: For proper flow cytometric analysis, cells stained by this method should be inspected by light microscopy and/or flow light scatter patterns to confirm that they are well dispersed._
+
+  _Note: Bivariate dot plots or probability contour plots can be generated upon data analysis to display the frequencies of and patterns by which individual cells coexpress certain levels of cell surface antigen and intracellular cytokine proteins._
+
+endofoutput
+```

markdown-output/adding-solid-fertilisers-to-soil-in-pot-experiment-4engtde.md

@@ -0,0 +1,96 @@
+```markdown
+# Goal/Experiment:
+To determine the appropriate methods for calculating and adding granular/dry fertilizers to soil in pot experiments before planting.
+
+## Adding Solid Fertilisers to Soil in Pot Experiments V.2
+**Matema L.E. Imakumbili**  
+Sokoine University of Agriculture   
+[dx.doi.org/10.17504/protocols.io.4engtde](http://dx.doi.org/10.17504/protocols.io.4engtde)
+
+---
+
+### Abstract
+This protocol describes how rates of granular/dry fertilizer can be calculated and incorporated into soil for pot experiments before planting.
+
+### Guidelines
+It is important to clean all apparatus (shovels, pots, brushes, etc.) before use. This can be done by washing the equipment with tap water and soap. Thoroughly rinse off the soap with clean tap water. All equipment must be properly dried before use.
+
+### Materials
+
+- Soil
+- Fertilizer (e.g., urea, TSP, muriate of potash)
+- Large plastic sheet (2 m × 5 m)
+- Weighing scale (5-20 kg capacity)
+- Empty pots
+- Analytical balance
+- Small plastic bags (2 cm × 15 cm)
+- Marker pen
+- Mechanical kitchen/hanging scale (20 kg capacity)
+- A brush or small broom to sweep soil with
+- A dustpan
+
+### 1. Determining the Amount of Fertilizer to Add to Soil in Pots
+Field-based fertilizer rates (in kg/ha) are often used and converted to pot-based rates (in g/kg or mg/kg of soil) in pot experiments. This conversion requires some calculations. 
+
+#### Fertilizer Calculation Example:
+In this example, we will add potassium to the soil at a rate of 80 kg/ha. The fertilizer used is muriate of potash (MOP), also known as potassium chloride (KCl), which contains 60% potassium oxide (K2O).
+
+##### Calculation:
+1. Amount of potassium to be added to each kilogram of soil:
+
+\[
+\text{mass of } K \text{ (kg)} = \frac{80 \text{ kg}}{2,000,000 \text{ kg of soil}} = 0.04 \text{ g K/kg of soil}
+\]
+
+2. Potassium to be added to 5 kg of oven-dry soil:
+
+\[
+\text{mass of } K \text{ to be added to 5 kg of soil} = 0.04 \text{ g K/kg } \times 5 \text{ kg} = 0.2 \text{ g K}
+\]
+
+3. Calculate the equivalent K2O needed:
+
+\[
+\text{Mass of one mole of } K_2O = 2 \times \text{K} + \text{O} = 78.1966 \text{ g K/kg}
+\]
+
+4. Using the mass ratio:
+
+\[
+\frac{0.2 \text{ g K}}{78.1966 \text{ g K}} = 0.241 \text{ g K}_2O
+\]
+
+5. Adjust for the 60% purity of MOP:
+
+\[
+\text{Amount of } MOP = \frac{0.241 \text{ g K}_2O \times 100 \text{ g MOP}}{60 \text{ g K}_2O} = 0.402 \text{ g MOP}
+\]
+
+### 2. Weighing the Fertilizer to Be Added to Pots
+Using an analytical balance with an accuracy of ± 0.0001 g, weigh out the required amount of muriate of potash to be added to each pot. Ensure correct labeling and separate packing of the weighed packets of fertilizer for easy identification.
+
+### 3. Mixing the Fertilizer into the Pot
+
+#### Procedure:
+1. Use a large plastic sheet for mixing the soil and fertilizer.
+2. Divide the soil for each treatment into roughly equal portions.
+3. Mix the fertilizer into a small amount of soil first and then into a larger amount.
+4. Combine all parts thoroughly to ensure uniform mixing.
+
+**Figures:**
+- **Fig 1.** Fertilizer packed in small plastic bags for pot experiments.  
+![Fig 1](image_url)
+
+- **Fig 2.** Bulked pile of soil on a plastic sheet.  
+![Fig 2](image_url)
+
+### Notes:
+
+1. **Accuracy:** Precision is crucial for each step of the process.
+2. **Hygroscopic Nature:** Fertilizers tend to absorb moisture; pack tightly.
+3. **Contamination:** Regularly clean equipment to avoid cross-contamination.
+
+---
+
+endofoutput
+```

markdown-output/addition-of-rna-sequins-to-sample-for-rna-sequenci-x8cfrsw.md

@@ -0,0 +1,85 @@
+```markdown
+Goal/Experiment:
+The goal of the experiment is to assess the impact of technical bias and sample complexity in RNA sequencing by using RNA sequins as internal controls. RNA sequins act as synthetic genes to normalize and control variations in RNA sequencing experiments.
+
+# Addition of RNA Sequins to Samples for RNA Sequencing
+
+**Version 1**  
+**Tim Mercer**  
+**Garvan Institute of Medical Research**  
+[doi.org/10.17504/protocols.io.x8cfrsw](dx.doi.org/10.17504/protocols.io.x8cfrsw)
+
+## Abstract
+RNA sequencing can measure both gene or isoform expression and reconstruct novel and complex spliced isoforms. However, the sheer size and complexity of the transcriptome, as well as technical bias, can confound analysis with RNA-seq. To assess the impact of these variables, we developed a set of RNA sequins that represent synthetic genes that act as internal controls during RNA sequencing.
+
+Each RNA sequin represents an individual isoform, with multiple isoforms forming artificial gene loci that are encoded within the *in silico* chromosome (chrIS). By modulating the relative abundance of individual sequin isoforms, we can emulate alternative splicing while modulating the abundance of multiple isoforms to emulate gene expression. Accordingly, RNA sequins are mixed at different concentrations to emulate differences in gene expression and alternative splicing.
+
+By sequentially diluting sequins, we can establish a reference ladder across a range of gene expressions. We formulate multiple alternative mixtures that differ in the concentration of individual sequins. By comparing mixtures, we can emulate differential gene expression and alternative splicing between samples. By contrast, RNA sequins with invariant concentrations between mixtures provide static scaling factors that enable quantitative normalization between multiple RNAseq libraries.
+
+The RNA sequin mixture is added to a user’s RNA sample at a fractional concentration prior to library preparation. The combined sample and sequins then undergo sequencing. The sequins can then be distinguished in the output library by their synthetic sequence, and analyzed as internal controls.
+
+For further detailed background on the design, validation, and use of sequins, we refer users to "Spliced synthetic genes as internal controls in RNA sequencing experiments" by Hardwick et al., (2016) Nature Methods.
+
+**External Link:**  
+[www.sequinstandards.com](www.sequinstandards.com)
+
+**This protocol accompanies the following publication:**  
+**Hardwick et. al., Spliced synthetic genes as internal controls in RNA sequencing experiments. (2016) Nature Methods.**
+
+## Protocol Status
+**Working**  
+We use this protocol in our group, and it is working.
+
+## Materials
+
+| Name                | Catalog # | Vendor  |
+|---------------------|-----------|---------|
+| RNA sequins standards | [View](https://www.sequinstandards.com)   | Sequins |
+
+## Step Materials
+
+| Name                | Catalog # | Vendor  |
+|---------------------|-----------|---------|
+| RNA sequins standards | [View](https://www.sequinstandards.com)   | Sequins |
+
+### Re-suspension and Storage of Sequins
+
+1. **RNA Sequins Standards**  
+   ![RNA Sequins Standards](https://www.sequinstandards.com)
+
+   Upon receipt of RNA sequins, first check to ensure they have not thawed during shipment and immediately transfer the RNA sequins to frozen storage at -80°C (sequins should not be stored in a -20°C frost-free freezer).
+
+   ![RNA Sequin Mixture Traces](https://www.sequinstandards.com)
+
+   *Figure 1. Example traces of RNA sequins using an Agilent 2100 BioAnalyzer with the RNA Nano Kit (Agilent Technologies) for (left upper) neat Sequin Mixture A and (left lower) neat Sequins Mixture B. Also shown are example traces for (right upper) K562 with Sequin Mixture A and (right lower) GM12878 with Sequins Mixture B.*
+
+2. Each tube contains RNA sequins provided in solution in 10 µL nuclease-free water at a concentration of 15 ng/µL. On first thaw, spin the tube down to collect the contents at the bottom of the tube, and prepare smaller single-use aliquots to minimize subsequent freeze-thaw cycles. The exact amount of RNA sequins required for a single-use aliquot depends on the sample input required for your preferred library preparation method.
+
+   **Table 1. Guidelines for diluting RNA sequins according to sample RNA amounts (recommended 1% spike-in).**
+
+   | Sample RNA | Sequin Mass | Sequin Volume (dilution from 15 ng/µL stock)|
+   |------------|-------------|---------------------------------------------|
+   | 20 ng      | 0.2 ng      | 1 µL (1:75)                                 |
+   | 50 ng      | 0.5 ng      |  1 µL (1:30)                                |
+   | 100 ng     | 1.0 ng      |  1 µL (1:15)                                |
+   | 500 ng     | 5.0 ng      |  1 µL (1:3)                                 |
+   | 1000 ng    | 10.0 ng     |  1 µL (2:3)                                 |
+
+#### Addition of Sequins to Sample, Library Preparation, and Sequencing
+
+3. The diluted RNA sequins should then be added directly to the sample RNA prior to any subsequent processing steps (such as poly-A enrichment or rRNA depletion). While this enables an assessment of these processing steps, the amount and dilution of RNA sequins added may need to be modified accordingly.
+
+   > **COMMENT:** RNA sequins are provided in two alternative mixture formulations: Mix A and B. Each contains the same sequin isoforms, however they have been formulated at molar ratios. This emulates fold-change differences in gene expression and alternative splicing between the two mixtures. If a gene-profiling RNAseq experiment is being performed to identify differences in gene expression and splicing between two conditions, it is suggested that Mixture A and B be added alternately to separate samples from each condition being compared (ensure that both mixtures are not added to a single sample). This enables the use of RNA sequins to assess the detection of fold-change differences between samples.
+
+4. Use the combined sample and sequins as input according to the protocol of your preferred library preparation kit.
+
+   > **COMMENT:** The downstream library preparation workflow may require the user to concentrate the sample RNA after the addition of the RNA sequins. RNA samples can be concentrated using either ethanol precipitation, SPRI® bead purification (e.g. RNAClean® XP, Beckman Coulter), column-based methods (e.g. RNA Clean & Concentrator™ Kit, Zymo Research), or using vacuum centrifugation.
+
+   ![Successful Sequenced Libraries](https://www.sequinstandards.com)
+
+   *Figure 2. Successful sequin-containing (total) RNA Libraries. A, K562 with Sequins Mix A. B, GM12878 with Sequins Mix B. Samples analyzed by Agilent 2100 BioAnalyzer trace (size distributions sequenced on an Illumina HiSeq 2500 Instrument).*
+
+5. The library that is generated from the combined RNA sample and sequins is then sequenced per manufacturer’s instructions. In this example, Illumina HiSeq 2500 was used.
+
+endofoutput
+```

markdown-output/adrenal-chromaffin-cell-cultures-bpkzmkx6.md

@@ -0,0 +1,130 @@
+```markdown
+# Goal/Experiment:
+To culture adrenal chromaffin cells derived from Sprague Dawley rats aged 7 to 12 days.
+
+# Adrenal Chromaffin Cell Cultures
+
+**Authors:**  
+Ellen Kantar<sup>1</sup>, David Sulzer<sup>1</sup>  
+<sup>1</sup>Columbia University  
+
+**Date:**  
+May 18, 2021
+
+**DOI:**  
+[dx.doi.org/10.17504/protocols.io.bpkzmkx6](https://dx.doi.org/10.17504/protocols.io.bpkzmkx6)
+
+## Abstract
+This protocol details the culturing of adrenal chromaffin cells from rats. Adrenal glands from 7- to 12-day-old Sprague Dawley rats are dissected in ice-cold Hanks Balanced Salt Solution (HBSS).
+
+### Keywords
+rat-derived cultures, cell culture, adrenal, chromaffin, rat
+
+### License
+This protocol is distributed under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/), permitting unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+## Guidelines
+### Suggestions for Plating Density for Rat and Mouse CC Cultures:
+- 3 × 10-day-old rat pups – 8 dishes
+- 5 × 10-day-old rat pups – 16 dishes
+- 2 adult mice – 12 dishes
+- 10 × 10-day-old mouse pups – 12 dishes
+
+## Materials
+
+### Reagents:
+- **Ketamine (Anaesthetic) if decapitation is not an approved protocol: Ketase®**  
+  *Vendor*: FORT DODGE  
+  *Catalog #: NDC-0856-2013-01*
+
+- **L-Glutamine solution, 200 mM**  
+  *Vendor*: Sigma  
+  *Catalog #: G2150*
+
+- **Penicillin-Streptomycin**  
+  *Vendor*: Sigma  
+  *Catalog #: P0781*
+
+- **Fetal Bovine Serum, qualified, heat-inactivated, United States**  
+  *Vendor*: Thermo Fisher  
+  *Catalog #: 16140063*
+
+- **DMEM - Low Glucose**  
+  *Vendor*: Sigma  
+  *Catalog #: D5546*
+
+- **HBSS, no calcium, no magnesium, no phenol red**  
+  *Vendor*: Thermo Fisher  
+  *Catalog #: 14175095*
+
+- **Collagenase Type I**  
+  *Vendor*: Worthington Biochemical Corporation  
+  *Catalog #: LS004197*
+
+- **Deoxyribonuclease I**  
+  *Vendor*: Worthington Biochemical Corporation  
+  *Catalog #: LS002006*
+
+### Preparation:
+
+#### CC Media (200 mL):
+- 2 mL L-Glutamine
+- 240 µL Pen-Strep
+- 20 mL Fetal Bovine Serum, heat-inactivated
+- 180 mL DMEM
+
+#### Trituration Solution (110 mL):
+- 10 mL HBSS
+- 30 µL DNase stock (final concentration 0.02%)
+- 100 µL Fetal Bovine Serum, heat-inactivated
+
+#### Preparation of DNase I Stock Solution:
+- Reconstitute with HBSS to a concentration of 2000 U/mL (e.g., a vial with 20 mg and 3364 U/mg is reconstituted with 33.64 mL HBSS).
+- Store in 500 µL aliquots at -80 °C.
+
+### Safety Warnings:
+For hazard information and safety warnings, please refer to the SDS (Safety Data Sheet).
+
+## Protocol Steps:
+
+1. **Animal Preparation:**
+   - Animals are decapitated (anaesthetize the animals with Ketase® KETAMINE, FORT DODGE® NDC-0856-2013-01 if decapitation is not an approved protocol).
+
+2. **Body disinfection and pinning:**
+   - Decapitate and pin the body belly-down. Spray with 70% ethanol.
+
+3. **Back skin opening:**
+   - Cut the skin along the spinal column (easier starting from the neck) and pull it out to both sides, using scissors to separate the skin from underlying tissue. The back of the body is now open.
+
+4. **Removal of adrenal glands:**
+   - Grab the vertical column with forceps and pull it up while cutting along both sides through the ribs. Alternate cuts on each side as you work back. Once the diaphragm is reached, open the scissors and place onto the diaphragm approximately 1/3 of the way up from the bottom. Pull the spine up while holding the diaphragm down. Expose the abdominal cavity showing two kidneys with adrenal glands on top.
+
+5. **Isolation of adrenal glands:**
+   - Remove the glands with fine forceps (preferably curved), pinch off the tissue under the glands, and pull up. Place into ice-cold HBSS (Ca²⁺/Mg²⁺-free).
+
+6. **Removal of capsule:**
+   - Adrenal glands are encased by adipose tissue and a capsule. Remove using two fine forceps, pull the capsule open like a bag, and use the other to roll off the gland. Cut the adrenal glands in half or thirds depending on their size.
+
+7. **Cleaning and digestion:**
+   - After several washes with HBSS (using a sterile plastic transfer pipette), digest the tissue with Collagenase I in 10 mL HBSS, Ca²⁺/Mg²⁺-free, (250-350 U/mL, Worthington) for about 30:00 at 37 °C with stirring. Stop the digestion once the solution becomes cloudy.
+
+8. **Rinse and triturate:**
+   - Rinse the digested tissue with HBSS and triturate gently in a solution containing 1% heat-inactivated fetal bovine serum and 0.02% DNase I. Use large bore tech-tips for trituration, medium bore if needed.
+
+9. **Centrifuge and resuspend cells:**
+   - Centrifuge dissociated cells at 1000 x g, 00:03:00 to form a pellet. Resuspend in culture medium with DMEM, 10% fetal bovine serum, 50 U/mL penicillin, 50 µg/mL streptomycin, and 2 mM Glutamine.
+
+10. **Plating cells:**
+    - Plate cell suspension on poly-D-lysine and laminin-coated glass wells in 50 mm dishes (cells from 5 rat 10-day-old pups onto 16 dishes), and after 2:00:00, flood dishes with culture medium (3 mL per dish).
+
+11. **Incubation:**
+    - Maintain cells in a 5% CO₂ incubator at 37 °C. Conduct all measurements between 1 and 7 post-plating days.
+
+---
+
+Please refer to the "Ventral Midbrain Cultures" protocol for instructions on how to prepare and coat dishes.
+
+---
+
+endofoutput
+```

markdown-output/agarose-gel-electrophoresis-1-2-with-ethidum-bromi-ds76hm.md

@@ -0,0 +1,133 @@
+```markdown
+# Agarose Gel Electrophoresis, 1.2% with Ethidium Bromide
+
+### Goal/Experiment:
+The goal of this experiment is to separate DNA molecules based on size using agarose gel electrophoresis. This protocol is suitable for checking DNA after a restriction digest and can resolve DNA fragments ranging from 400bp to 7kb.
+
+### Abstract
+This protocol separates molecules based on size and is great for checking DNA after a restriction digest. The protocol utilizes a 1.2% agarose gel, sufficient for resolving DNA from 400bp to 7kb. The electrophoresis system has a 7.5cm x 10cm gel bed area with an approximately 15cm electrode distance. The minimum volume for a 7.5cm x 10cm x 0.5cm gel is 37.5mL, and the maximum volume for a 50mL gel is 0.67cm in height.
+
+**Citation**: Harold Bien Agarose gel electrophoresis, 1.2% with Ethidium bromide. protocols.io dx.doi.org/10.17504/protocols.io.ds76hm  
+**Published**: 11 Sep 2015
+
+---
+
+### Before Start
+- Ensure you have a DNA sample ready, either from PCR or a recently performed restriction digest.
+- Dilute the 50X TAE Buffer to 1X using sterile filtered water.
+- For the dual-sided 1.0mm gel comb MHC-10-0816 the maximum volume is 35/13μL.
+- For the dual-sided 1.5mm gel comb MHC-15-1014, the maximum sample volume is 38/25μL.
+
+---
+
+### Materials
+
+| Reagent/Equipment                                     | Specification                   | Vendor                                           |
+|-------------------------------------------------------|---------------------------------|--------------------------------------------------|
+| 2-Log DNA Ladder                                      | 100-200 gel lanes               | N3200S by New England Biolabs                    |
+| Gel Loading Dye, Purple (6X), no SDS                  | 4.0 mL                          | B7025S by New England Biolabs                    |
+| GeneMate LE Quick Dissolve Agarose                    | 500g                            | E-3119-500 by Bioexpress                         |
+| Ethidium bromide                                      | 10mg/mL, 10mL                   | X328-10ML by Amresco                             |
+| TAE (Tris-Acetate-EDTA) Buffer, 50X                   |                                 | K915 by Amresco                                  |
+| Horizontal mini-gel kit                               |                                 | MHU-202 by C.b.s Scientific                      |
+
+---
+
+### Protocol
+
+#### Prep Work
+
+##### Step 1
+Weigh out 0.6 g (1.2% w/v of 50mL) agarose and add it to the Erlenmeyer flask.
+
+- **Amount:** 1 g
+- **Reagents:** GeneMate LE Quick Dissolve Agarose, 500g [E-3119-500 by Bioexpress]
+
+##### Step 2
+Add 50mL of 1x TAE buffer.
+
+- **Amount:** 50 mL
+- **Reagents:** TAE (Tris-Acetate-EDTA) Buffer, 1X
+
+##### Step 3
+Place Erlenmeyer flask in microwave. Set to wait 30 seconds, then full power (P10, 1250W) for 20 seconds followed by low power (P1, 125W) for 30 seconds or until the solution is clear and agarose is completely dissolved.
+
+**Duration:** 50 seconds
+
+**Notes:**  
+- Ensure the agarose is fully dissolved in the buffer solution.
+
+##### Step 4
+Remove Erlenmeyer flask from microwave and let it sit on the lab bench to cool just until you can comfortably pick it up.
+
+**Duration:** 3 minutes
+
+##### Step 5
+Add 1μL concentrated ethidium bromide (10mg/mL) into the flask and swirl to mix, taking care not to introduce bubbles.
+
+- **Amount:** 1 μL
+- **Reagents:** Ethidium bromide, 10mg/mL, 10mL [X328-10ML by Amresco]
+- **Notes:** The final concentration of ethidium bromide will be 10μg/50mL or 0.2μg/mL (Carcinogen, handle with care).
+
+##### Step 6
+Place gel tray on clamp and clamp securely. Add well plates where you want wells and use a level to ensure it is balanced.
+
+**Notes:**  
+- Good well balance is crucial for even sample loading.
+
+---
+
+### Running the Agarose Gel
+
+#### Running the Gel
+
+##### Step 7
+Pour contents of the Erlenmeyer Flask into the gel tray and let it sit for 30 minutes, or until a blue tint appears.
+
+- **Duration:** 30 minutes
+
+##### Step 8
+Remove the well plates carefully to avoid tearing the gel and remove the tray from the clamp, ensuring the gel remains in the tray.
+
+##### Step 9
+Place gel tray into the gel electrophoresis apparatus with the wells closer to the negative/black end.
+
+##### Step 10
+Pour additional TAE Buffer to fill each side of the apparatus and to create a thin layer of buffer covering the top of the gel.
+
+##### Step 11
+Prepare DNA ladder and samples by adding 6x blue dye.
+
+- **Reagents:** Gel Loading Dye Blue (6X) - 4.0 ml [B7021S by New England Biolabs]
+- **Notes:**  
+  - Dilute the DNA ladder 1:10 in sterile filtered water when using the 1.5mm thick 14-well lane.
+
+##### Step 12
+Pipette your samples into each well.
+
+- **Notes:**  
+  - For the 1.5mm gel comb MHC-15-1014, recommended DNA mass is 200-500ng for 14-well.
+
+##### Step 13
+Place the lid on the apparatus and plug cables into the high voltage power supply. Run at 100V (6.6V/cm) for 45-60 minutes or until the loading dye has sufficiently migrated down the gel.
+
+- **Duration:** 45-60 minutes
+- **Notes:**  
+  - Ensure that the negative terminal (typically black) is plugged into the negative/black terminal on the power supply and the wells are at the negative side.
+
+---
+
+#### Visualizing DNA Bands
+
+##### Step 14
+Gel can be imaged on UV transilluminator through the UV-transparent gel tray or removed and wrapped in plastic wrap for storage at 4°C for later use.
+
+---
+
+### Warnings
+Ethidium Bromide potentially acts as a mutagen or carcinogen. Handle with proper safety measures.
+
+---
+
+endofoutput
+```

markdown-output/aktiv-formulations-keto-bhb-100-safe-and-effective-b96qr9dw.md

@@ -0,0 +1,77 @@
+```markdown
+# Goal/Experiment:
+Evaluate the claims and effectiveness of Aktiv Formulations Keto BHB as a safe and effective weight-loss supplement.
+
+## Aktiv Formulations Keto BHB 100% Safe and Effective Formulation! (Legit Or Scam?)
+
+### Product Information
+- **Product Name:** [Aktiv Formulations Keto BHB](https://aktivformulationsketobhb.com)
+- **Composition:** Natural
+- **Side Effects:** NIL
+- **Price:** [Check Online/Offline](https://aktivformulationsketobhb.com)
+- **Rating:** (User ratings not provided)
+- **Official Sponsor:** [aktivformulationsketobhb.com](https://aktivformulationsketobhb.com)
+
+### Overview
+Aktiv Formulations Keto BHB is a weight reduction dietary supplement designed to help users reduce excess fat effectively. The supplement claims to harness natural ingredients to boost the body's fat-burning process, primarily through ketosis.
+
+---
+
+## What Exactly Is Aktiv Formulations Keto BHB Diet Program?
+
+Aktiv Formulations Keto BHB is advertised as a weight-loss nutritional supplement aimed at reducing extra fat and maintaining a lean body. It does this by leveraging the processes associated with ketosis, where the body burns fats instead of carbohydrates for energy.
+
+### Key Functions:
+1. **Promotes Weight Loss:** Helps reduce extra fat and maintain a lean body.
+2. **Natural Ingredients:** Contains BHB ketones, Rice-flour, Silicon Dioxide, and Green Coffee-bean.
+3. **Burns Fat Efficiently:** Targets body portions like buttocks, back, thighs, and wrists.
+4. **Inhibits Fat Accumulation:** Prevents the storage of new fat in the body.
+
+### Ingredients and Their Functions:
+1. **BHB Ketones:** A combination of BHB magnesium and BHB sodium, critical in inducing ketosis and providing energy by burning fat.
+2. **Rice-flour:** Provides low carbohydrates and aids in burning fats naturally. Acts as an anti-oxidant to promote fat reduction.
+3. **Silicon Dioxide:** Enhances the body's ability to lose weight by encouraging fat reduction naturally.
+4. **Green Coffee-bean:** Contains chlorogenic acid that helps in weight reduction and boosts metabolism. Also contains caffeine which acts as a natural stimulant.
+
+### Additional Useful Compounds:
+1. **Hoodia Gordonii:** Known for suppressing appetite, essential for those facing challenges with cravings and excess weight.
+2. **Magnesium:** Assists in further fat reduction, supports overall body health, and aids muscle fortification.
+
+---
+
+## Mechanism of Action
+### Aktiv Formulations Keto BHB's Working Principle:
+- **Induces Ketosis:** By leveraging BHB ketones, the supplement aims to switch the body's fuel source from carbohydrates to fats, promoting efficient weight loss.
+- **Enhances Fat Burning:** Burns off saved fats while inhibiting carbohydrate conversion into fats.
+
+**Ketosis Details:** Ketosis occurs when the body burns fat instead of carbs due to lower carbohydrate intake. This is facilitated by the BHB ketones present in the supplement.
+
+### Proper Usage:
+- The supplement is provided in capsule form.
+- Recommended dosage: Two capsules daily.
+- Drink plenty of water and engage in regular physical activities to enhance the supplement's effectiveness.
+
+### Suitable For:
+- Individuals seeking substantial weight loss.
+- People ready to supplement their diet with a ketogenic regimen.
+- Adults (not recommended for individuals under 20, pregnant women, or those with high blood pressure).
+
+### Potential Side Effects:
+- Reported as minimal to zero due to the natural composition.
+- Users are advised to consult with physicians if they have underlying medical conditions.
+
+### Purchase Information:
+Aktiv Formulations Keto BHB can be purchased online through the [official website](https://aktivformulationsketobhb.com).
+
+---
+
+## Conclusion
+Aktiv Formulations Keto BHB appears to be a credible natural weight loss supplement focused on leveraging the ketogenic process. Its efficacy is enhanced when combined with regular exercise and a balanced diet.
+
+### Recommended Actions:
+- Ensure adherence to a ketogenic diet.
+- Engage in regular physical exercises.
+- Monitor health regularly and consult a healthcare provider as needed.
+
+endofoutput
+```

markdown-output/algorithm-for-gestational-age-assessment-at-birth-bawbifan.md

@@ -0,0 +1,107 @@
+```markdown
+# Goal/Experiment:
+The goal of this protocol is to develop a reliable algorithm for assessing the gestational age of a newborn at birth. This is achieved through the use of either the mother's last menstrual period (LMP) or an obstetric ultrasound conducted early in the pregnancy. The aim is to standardize and automate the process to provide the most accurate estimate of gestational age at birth.
+
+# Algorithm for Gestational Age Assessment at Birth
+
+**Authors**: Zilma Reis, Juliano de Souza Gaspar, Sara Oliveira Elias, Regina Amelia Lopes Pessoa De Aguiar  
+**Institution**: Universidade Federal de Minas Gerais  
+**Published**: Jan 16, 2020  
+**DOI**: [10.17504/protocols.io.bawbifan](http://dx.doi.org/10.17504/protocols.io.bawbifan)
+
+## Abstract
+This protocol presents an algorithm for gestational age assessment when a reliable last menstrual period or an obstetric ultrasound is available in the birth scenario. A software was developed to automatically process data entries into the best estimate of the gestational age at birth.
+
+It shall be used by the multicenter team of researchers, duly trained in accordance with the Good Clinical Practice Protocol, during the enrollment of newborns. This protocol is complementary documentation for scientific publications related to the clinical trials.
+
+Relevant Clinical Trials:
+- "Prematurity detection evaluating interaction between the skin of the newborn and light: protocol for the preemie-test multicenter clinical trial in Brazilian hospitals to validate a new medical device." Register number: [RBR-3f5bm5](http://ensaiosclinicos.gov.br/rg/RBR-3f5bm5).
+- "Premature or small for gestational age? International multicenter trial protocol for classification of the low birth weight newborn through the optical properties of the skin." Register number: [RBR33rnjf](http://ensaiosclinicos.gov.br/rg/RBR33rnjf).
+
+## Guidelines
+The scientific references for the best recommendation to assist gestational age calculation at birth were:
+1. Committee on Obstetric Practice, the Society for Maternal-Fetal Medicine. Committee Opinion No 700: Methods for estimating the due date. Obstet Gynecol. 2017;129(5):e150-4. PMID: 28426621. DOI: [10.1097/AOG.0000000000002046](http://dx.doi.org/10.1097/AOG.0000000000002046).
+2. Papageorghiou AT, Kennedy SH, Salomon LJ, et al. International standards for early fetal size and pregnancy dating based on ultrasound measurement of crown-rump length in the first trimester of pregnancy. Ultrasound Obstet Gynecol 2014;44:641-8. DOI: [10.1002/uog.13448](http://dx.doi.org/10.1002/uog.13448).
+3. Nguyen TH, Larsen T, Engholm G, et al. Increased adverse pregnancy outcomes with unreliable last menstruation. Obstet Gynecol 2000;95(6 Pt 1):867-73. DOI: [10.1016/s0029-7844(99)00639-0](http://dx.doi.org/10.1016/s0029-7844(99)00639-0).
+
+## Materials
+- **Reagents and Equipment:**
+  - Standardized Clinical Trial Data Collection Form
+  - Tablet for data collection
+
+## Safety Warnings
+- Ensure that patient consent forms are completed.
+- Obtain necessary ethical approvals for conducting the research.
+
+## Before Starting
+Researchers should identify and prepare to interview the woman if she is conscious and agrees to participate in the study. Sources of data to assist in determining gestational age should include antenatal obstetric ultrasound reports with their images and medical records from prenatal care.
+
+## Methodology
+
+### 1. Menstrual Cycle Reference
+
+#### 1.1 The Last Menstrual Period (LMP) Reference
+The interview aims to qualify the information about the last menstrual period, in terms of its reliability.
+- **Documentary Analysis**:
+  - When did your last menstrual period occur? Please confirm if it was the first day of menstruation.
+  - Are you sure about this date?
+  - Are your menstrual cycles regular? Clarify if the cycle duration did not change for more than one week.
+  - Two months before your last menstrual period, did you use any contraceptive method (pills, injections, Mirena IUD, skin implant, vaginal ring)?
+  - Two months before your last menstrual period, had you had an abortion or delivered a child?
+  
+- **Further Verification**:
+  - Take a picture of the personal prenatal care book where the LMP is reported to verify the accuracy.
+
+### 2. Ultrasound Reference
+
+#### 2.1 The First Obstetric Ultrasound Reference
+Assess the best antenatal ultrasound record to determine gestational age. The assessment should occur between 7 weeks 0 days and 13 weeks 6 days of pregnancy, and the crown-rump-length (CRL) of the embryo is the primary reference.
+
+- Chronologically organize the antenatal obstetric ultrasound reports.
+- Select the first gestational assessment with an available CRL measurement between 7w+0d and 13w+6d.
+- Take note of the assessment date and reported gestational age.
+- Verify the CRL measurement, using the International Fetal Size standard for early pregnancy to adjust the gestational age accordingly.
+
+### 3. Gestational Age Assessment, According to an Automated Algorithm
+- Use software to process pregnancy dating at birth, following best practices for gestational age calculation.
+
+The algorithm automates methods as follows:
+- **Adjustment of CRL to the Intergrowth-21st Reference**: Based on international standards (Papageorghiou AT et al., 2014).
+- **Reliable Last Menstrual Period Concept**: Addressing increased adverse pregnancy outcomes with unreliable LMP (Nguyen TH et al., 2000).
+- **Gestational Age Assisted by CRL or LMP**: According to recommendations by the Committee on Obstetric Practice (2017).
+
+#### 3.1 Data Collection
+Insert the following details into the information system:
+
+| Variable        | Data                                           | Details         |
+|-----------------|------------------------------------------------|-----------------|
+| LMP_Date        | Date of the last menstrual period              | Date            |
+| LMP_1           | Question 1                                      | Yes/No          |
+| LMP_2           | Question 2                                      | Yes/No          |
+| LMP_3           | Question 3                                      | Yes/No          |
+| LMP_4           | Question 4                                      | Yes/No          |
+| LMP_5           | Question 5                                      | Yes/No          |
+| LMP_GA_Days     | Number of days between the LMP_Date and Childbirth_Date | Date            |
+| US_CRL          | Crown-rump-length (mm) reported in the ultrasound | Value           |
+| GA_CRL          | Gestational age reported in the ultrasound (days) | Value           |
+| Childbirth_Date | Date of the childbirth                         | Date             |
+| US_Date         | Date of the reference obstetric ultrasound     | Date            |
+| US_GA           | Gestational age reported in the ultrasound (days) | Value           |
+| DIFF            | Day difference by LMP and US days of pregnancy | Value           |
+| DB_Intergrowth  | Database with Intergrowth's CRL standard curves | Reference values|
+
+#### 3.2 Decision-tree Details
+Refer to the algorithm's decision tree for handling different data points regarding LMP and ultrasound measurements.
+
+### 4. Experts Checking and Adjustments
+Researchers are required to recheck data, referring to sources such as photos of ultrasound reports, digital images of the crown-rump length measurement, and copies of personal prenatal care records. Gestational age data should be validated against registered information.
+
+Once validation is complete, the algorithm will process the optimal dating for gestational age at birth.
+
+## Conclusion
+This protocol provides a systematic process to determine the gestational age of a newborn at birth reliably. The accuracy of the assessment is enhanced by integrating data from two primary sources: the last menstrual period and early obstetric ultrasound measurements.
+
+---
+
+endofoutput
+```

markdown-output/alm-window-surgery-bqstmwen.md

@@ -0,0 +1,88 @@
+```markdown
+**Goal/Experiment:**
+The goal of this protocol is to provide a detailed, step-by-step method for performing ALM (anterior lateral motor) window surgery in mice. This includes preparation, craniotomy, window installation, recovery, and post-operative care. This method is designed for researchers conducting in vivo imaging and other experimental studies on cortical structures.
+
+# ALM Window Surgery
+
+**Authors:**
+Kayvon Daie¹, Tim Wang¹, Amrita Singh¹, Arseny Finkelstein¹, Marton Rozsa¹, JJ Kim², Karel Svoboda¹ 
+
+¹Janelia Research Campus; ²HHMI Janelia Research Campus, Johns Hopkins University School of Medicine
+
+**Publication Date:** Dec 15, 2020  
+**Last Modified:** Oct 23, 2023  
+**Protocol ID:** 45619
+
+## Abstract
+Protocol for Head Post and Cranial Window Surgery developed at Janelia Research Campus in the Svoboda Lab.
+
+Developed and improved by:
+- Karel Svoboda for Trachtenberg et al 2002
+- Anthony Holtmaat for Holtmaat et al 2006 and Holtmaat et al 2009
+- Daniel Huber for Huber et al 2012
+
+Compiled and modified by various researchers over the years, the latest version was compiled by JJ Kim in 2019.
+
+**Note:** This outline provides practical step-by-step advice. Surgeons must adhere to the official animal protocol and current procedures posted on the Svoboda lab wiki.
+
+## Guidelines
+### ALM Craniotomy Considerations
+- **Coordinates**: 1.5 mm lateral and 2.5 mm anterior to Bregma. The medial edge of the circle should fall over the midline.
+- **Head post placement**: Just posterior to the outer edge of the glass window.
+- **Skull preparation**: Rotate the skull when drilling and measuring.
+- **Blood vessel management**: Handle major blood vessels carefully to minimize bleeding.
+- **Triple glass window**: Use 2.5 mm/2.5 mm/3 mm glasses.
+- **Thinning the skull**: The skull varies in thickness; lateral edges are particularly thick.
+- **Avoid dural thickening**: Thin down the skull adequately.
+- **Bleeding management**: Blood coagulates in ~90 seconds.
+
+## Protocol
+
+### Animal Preparation
+1. **Weigh Mouse**: Transfer mouse to a new cage if needed. Note ear tags or mark first mouse.
+2. **Prepare Cage**: Allow mouse to adjust to a new cage several hours before surgery.
+3. **Food Preparation**: Remove wirebar, provide food pellets, and add dietgel to the cage.
+
+### Drug Preparation
+4. **Buprenex dilution**: Dose 0.1 mg/kg, draw up using an insulin syringe. Administer dexamethasone (optional), marcaine (50 µL), ketoprofen (5 mg/kg).
+
+### Preparation and Mounting
+5. **Surgical Prep**:
+    - **Gloves and Gown**: Wear protective clothing.
+    - **Prepare Viruses**: If needed.
+    - **Surgery Area**: Sterilize with Virkon-s and set up the necessary equipment.
+
+6. **Induction**:
+    - **Isoflurane**: Turn it to 3%, place the mouse in the induction chamber, and monitor.
+7. **Securing the mouse**:
+    - **Nose Cone**: Gently secure the mouse ensuring comfort.
+8. **Prepare for Surgery**:
+    - Cover eyes with artificial tears and inject marcaine subcutaneously.
+    - Apply betadine and perform a clean incision to remove scalp and expose skull.
+
+### Craniotomy and Window Installation
+18. **Drill Window**:
+    - *Mark and drill*: Carefully thin the skull without penetrating fully.
+    - *Install Window*: Place and secure the triple glass window.
+
+### Recovery
+38. **Post-Surgery**:
+    - Lower isoflurane and clean the surgical site.
+    - Secure mouse on a heating pad until recovery reflexes are observed.
+    - Administer ketoprofen and buprenex, record the end time and details.
+
+### Virus Injections (If Applicable)
+44. **Virus Preparation**:
+    - Backfill pipette with mineral oil, prepare injection apparatus, and spin down the virus if needed.
+48. **Performing Injections**:
+    - Use stereotactic equipment to inject virus precisely.
+
+### Post-Operation Care
+41. **Noting Care**: Ensure post-op care instructions are clear for follow-up.
+
+## End Notes
+- **References**: Include scholarly articles for detailed readings.
+- **Attachments**: Detailed diagrams and supplementary PDF for visualization.
+
+**endofoutput**
+```

markdown-output/amplicon-multiplex-pcr-sequencing-of-rift-valley-f-ckb2usqe.md

@@ -0,0 +1,277 @@
+```markdown
+# Goal/Experiment:
+Amplicon multiplex PCR sequencing of Rift Valley fever virus (RVFV) on Illumina MiSeq
+
+## Abstract
+Amplicon sequencing protocol for Rift Valley fever virus (RVFV).
+
+## RNA Extraction
+
+1. Extract viral RNA from serum or cell-culture supernatants using QIAamp Viral RNA kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. Begin with a volume of 140 µL.
+
+## RT-qPCR
+
+2. Determine cycle threshold (Ct) values on RNA samples using probe-based reverse transcription quantitative real-time PCR against the highly conserved domain on the L-segment of the virus (using 5' Fam reporter dye and 3' BHQ1 quencher dye).
+
+| RVFV segment | Primer name        | Sequence 5’-3’                       |
+|--------------|--------------------|--------------------------------------|
+| L            | RVFL-2912FwdGG     | TGAAAATTCCCTGAGACACATGG              |
+| L            | RVFL-2981revAC     | ACTTCCTTGCATCACTGATG                 |
+| L            | RVFL-probe-2950    | CAATGTAAGGGGCCTGTTGTGGCAGCTGTG       |
+
+Table 1. Primers and probe set used for RT-qPCR assay (Bird et al., 2007).
+
+### Mix the following components in PCR strip-tubes/plate
+
+| Component                         | Volume (µL) |
+|-----------------------------------|-------------|
+| KiCqStart™ One-Step Probe RT-qPCR ReadyMix™ | 7.5         |
+| Nuclease-free water               | 4.75        |
+| RVFV Oligos (2912FwdGG, 2981revAC, probe-2950) | 0.75    |
+| RNA                               | 2.0         |
+| Total                             | 15          |
+
+Note: Set up the reaction on ice. Incubate the reaction on an Applied Biosystems machine as follows:
+
+- 50 °C for 10:00
+- 95 °C for 2:00
+- 95 °C for 0:03, 40 cycles
+- 60 °C for 0:30
+
+## cDNA Synthesis
+
+3. Prepare RNA samples and include a negative control (nuclease-free water) per library. If previously frozen, mix by vortexing briefly and quick spin to collect the liquid. At all times, keep the samples on ice. Mix the following components in PCR strip-tubes/plate. Gently mix by pipetting and performing quick spin to collect the liquid.
+   
+| Component       | Volume (µL) |
+|-----------------|-------------|
+| LunaScript RT Supermix (5X) | 2        |
+| Template RNA    | 8           |
+| Total           | 10          |
+
+Note: To prevent pre-PCR contamination the mastermix should be added to the PCR strip-tubes/plate in the mastermix cabinet, which should be cleaned with decontamination wipes and UV sterilized before and after use. RNA samples should be added in the extraction/sample addition cabinet which should be cleaned with decontamination wipes and UV sterilized before and after use.
+
+3. Incubate the reaction as follows:
+   - 25 °C for 2:00
+   - 55 °C for 10:00
+   - 95 °C for 1:00
+   - Hold at 4 °C
+
+## Primer Pool Preparation
+
+4. If making up primer pools from individual oligos, fully resuspend lyophilized oligos in 1xTE to a concentration of 100 micromolar (µM), vortex thoroughly, and spin down.
+
+### Preparing the primer pools:
+
+4.1 Sort all odd regions primers into one or more tube racks. Add 5 µL of each odd region primer to a 1.5 mL Eppendorf tube labeled "Pool 1 (100 µM)". Repeat the process for all even region primers for Pool 2. These are your 100 µM stocks of each primer pool.
+
+Note: Primers should be diluted and pooled in the mastermix cabinet which should be cleaned with decontamination wipes and UV sterilized before and after use.
+
+4.2 Dilute 100 µM pools 1:10 in molecular grade water, to generate 10 µM primer stocks.
+
+Note: Primers are used at a final concentration of 15 nanomolar (nM) per primer. In this case, V1 pools have 38 primers in pool 1 and 36 primers in pool 2, so the requirements are approx. 1.4 µL primer pool (100 µM) per 25 µL reaction.
+
+Note: Make up several 100 µL aliquots of 10 µM primer dilutions and freeze them in case of degradation and/or contamination.
+
+## Multiplex PCR
+
+5. Set up the two PCR reactions per sample as follows in strip-tubes or plates. Gently mix by pipetting and pulse spin the tube to collect liquid at the bottom of the tube.
+
+| Component                     | Reaction 1 (µL)         | Reaction 2 (µL)         |
+|-------------------------------|-------------------------|-------------------------|
+| Q5 Hotstart Mastermix Buffer (5X) | 12.5                    | 12.5                    |
+| V1 Primer Pool 1              | 1.425                   | 0                       |
+| V1 Primer Pool 2              | 0                       | 1.35                    |
+| Nuclease-free water           | 6.575                   | 6.65                    |
+| Mastermix Volume              | 20.5                    | 20.5                    |
+| (cDNA)                         | 4.5                     | 4.5                     |
+| **Total reaction Volume**     | **25**                  | **25**                  |
+
+Note: To prevent pre-PCR contamination the mastermix for each pool should be made up in the mastermix cabinet, which should be cleaned with decontamination wipes and UV sterilized before and after use and aliquoted into PCR strip-tubes/plate.
+
+### 5.2 Add 4.5 µL cDNA to each of the PCR reactions, gently mix by pipetting and pulse spin the tube to collect liquid at the bottom of the tube.
+
+Note: cDNA should be added in the extraction and sample addition cabinet which should be cleaned with decontamination wipes and UV sterilized before and after use.
+
+### Set up the following program on the thermal cycler:
+
+| Step           | Temperature | Time             | Cycles  |
+|----------------|-------------|------------------|---------|
+| Heat activation| 98 °C       | 0:30             | 1       |
+| Denaturation   | 95 °C       | 0:15             | 35      |
+| Annealing      | 63 °C       | 5:00             | 35      |
+| Hold           | 4 °C        | Indefinite       | 1       |
+
+## Amplicon Clean-up
+
+6. Combine the two pools of amplicons. Add 12.5 µL of each primer pool (Pool 1 and Pool 2, total of 25 µL) in new PCR strip-tubes/plate. Perform NEBNext Sample Purification Beads/AMPure XP bead cleanup as follows:
+
+### 6.1 Add 20 µL (0.8X) of AMPure XP beads (thoroughly vortexed and at Room temperature). Cover the plate with seal, gently mix on a plate mixer and pulse spin to bring down the components at the bottom of the tube. Incubate at Room temperature for 5 minutes.
+
+### 6.2 Place the tube/plate on a magnetic stand for 5 minutes or until the beads have pelleted and the supernatant is completely clear.
+
+### 6.3 Remove and discard the liquid from each well with a multichannel pipette, being careful not to touch the bead pellet.
+
+### Note: Caution: do not discard the beads.
+
+### 6.4 Add 200 µL of freshly prepared, Room temperature 80% ethanol to each well/tube, incubate for 30 seconds at Room temperature and then carefully remove and discard the supernatant.
+
+### Note: Be careful not to disturb the beads that contain DNA targets.
+
+### 6.5 Repeat ethanol wash (step 6.3 and 6.4). Be sure to remove all visible liquid after the second wash. If necessary, briefly spin the tube/plate, place back on the magnet and remove traces of ethanol with a p10 pipette tip.
+
+### 6.6 Air dry the beads for up to 5 minutes while the tube/plate is on the magnetic stand with the lid open.
+
+### Note: Caution: Do not over-dry the beads. This may result in lower recovery of DNA. Elute the samples when the beads are still dark brown and glossy looking, but when all visible liquid has evaporated. When the beads turn lighter brown and start to crack, they are too dry.
+
+### 6.7 Remove the tube/plate from the magnetic stand. Elute the DNA target from the beads by adding 28 µL 0.1X TE or Elution Buffer (EB).
+
+### 6.8 Mix well by pipetting up and down 10 times, or on a vortex mixer. Incubate for at least 2 minutes at room temperature. If necessary, quickly spin the sample to collect the liquid from the sides of the tube or plate wells before placing back on the magnetic stand.
+
+### 6.9 Place the tube/plate on the magnetic stand. After 5 minutes (or when the solution is clear).
+
+### 6.10 Transfer 25 µL to a new PCR tube, ensuring no beads are transferred.
+
+## Gel Electrophoresis or Tapestation
+
+7. Use remaining volumes from Pool 1 and Pool 2 to confirm amplification (step 5.3).
+
+### 7.1 Make 1% agarose gels with enough wells for all samples.
+
+### 7.2 Load 2 µL of the 100 bp ladder into gel on either side of each row of wells.
+
+### 7.3 Dispense 2 µL of 6X loading dye into each sample with a multichannel pipette, mix and load 2 µL of this mix into the gel.
+
+### 7.4 Run at 240V for 20 minutes. Visualize PCR products, confirm bands of approximately 400bp.
+
+### Run pooled cDNA amplicons on a TapeStation® without cleanup. To run on a TapeStation, dilute an aliquot of the pooled amplicons 10-fold with 0.1X TE Buffer and run 2 µL on a DNA High Sensitivity ScreenTape.
+
+## Amplicon Quantification
+
+8. Quantify amplicons using Qubit dsDNA High Sensitivity kit and plate reader according to directions.
+
+## Library Preparation
+
+9. Prepare sequencing libraries with NEBNext Ultra II RNA Library Prep kit at half volume, as follows.
+
+### 9.1 End-Prep
+
+Add the following components to a sterile nuclease-free tube:
+
+| Component                         | Volume (µL) |
+|-----------------------------------|-------------|
+| NEBNext Ultra II End Prep Enzyme Mix | 1.5         |
+| NEBNext Ultra II Reaction Buffer  | 3.5         |
+| Targeted cDNA amplicon            | 25          |
+| **Total volume**                  | **30**      |
+
+Set a 100 µL or 200 µL pipette to 25 µL and then pipette the entire volume up and down at least 10 times to mix thoroughly. Perform a quick spin to collect all liquid from the sides of the tube.
+
+In a thermal cycler with lid heated to 75 °C, run the following program:
+
+| Temperature | Time     |
+|-------------|----------|
+| 20 °C       | 30:00    |
+| 65 °C       |          |
+| 4 °C        | Indefinite|
+
+### 9.2 Adaptor-ligation
+
+Add the following components directly to the End Prep Reaction Mixture:
+
+| Component                    | Volume (µL) |
+|------------------------------|-------------|
+| End Prep Reaction Mixture (step 9.1) | 30    |
+| NEBNext Adaptor for Illumina | 1.25        |
+| NEBNext Ultra II Ligation Master Mix | 15  |
+| **Total volume**             | **46.25**   |
+
+Note: Mix the NEBNext Ultra II Ligation Master Mix by pipetting up and down several times prior to adding to the reaction. The NEBNext adaptor is provided in NEBNext Oligo kits. NEB has several oligo options which are supplied separately from the library prep kit. Please see www.neb.com/oligos for additional information.
+
+### Do not premix adaptor with the Ligation Master Mix.
+
+### 9.3 Set a 100 µL or 200 µL pipette to 40 µL and then pipette the entire volume up and down at least 10 times to mix thoroughly. Perform a quick spin to collect all liquid from the sides of the tube.
+
+Note: Caution: The NEBNext Ultra II Ligation Master Mix is very viscous. Care should be taken to ensure adequate mixing of the ligation reaction, as incomplete mixing will result in reduced ligation efficiency. The presence of a small amount of bubbles will not interfere with performance.
+
+### 9.4 Incubate at 20 °C for 15 minutes in a thermal cycler with the heated lid off.
+
+### 9.5 Add 1.5 µL of USER® Enzyme to the ligation mixture from Step 9.4.
+
+Note: Steps 9.5 and 9.6. are only required for use with NEBNext Adaptors. USER enzyme can be found in the NEBNext Multiplex Oligos (www.neb.com/oligos).
+
+### 9.6 Mix well and incubate at 37 °C for 15 minutes with the heated lid set to ≥ 47 °C.
+
+Note: Samples can be stored overnight at –20°C. Note: Only a portion of the ligation reaction (7.5 µl) will move forward to PCR enrichment.
+
+## PCR Enrichment of Adaptor-ligated DNA
+
+10. Follow Section 10.1 if you are using the following oligos: Use option A for any NEBNext Oligo kit where index primers are supplied in tubes. These kits have the forward and reverse primers supplied in separate tubes. Primers are supplied at 10 micromolar (µM).
+
+   Follow Section 10.2. if you are using the following oligos: Use Option B for any NEBNext Oligo kit where index primers are supplied in a 96-well plate format. These kits have the forward and reverse (i7 and i5) primers combined. Primers are supplied at 10 micromolar (µM).
+
+### 10.1 Add the following components to a sterile strip tube:
+Separate Forward and Reverse Primers
+
+| Component                             | Volume (µL) |
+|---------------------------------------|-------------|
+| Adaptor Ligated DNA Fragments (step 9.4 or 9.6) | 7.5       |
+| NEBNext Library PCR Master Mix        | 12.5        |
+| Universal PCR Primer/i5 Primer        | 2.5         |
+| Index (X) /i7 Primer                  | 2.5         |
+| **Total volume**                      | **25**      |
+
+### 10.2 Add the following components to a sterile strip tube:
+Premixed Forward and Reverse Primers
+
+| Component                             | Volume (µL) |
+|---------------------------------------|-------------|
+| Adaptor Ligated DNA Fragments (step 9.4 or 9.6) | 7.5       |
+| Adaptor Ligated DNA Fragments (step 9.4 or 9.6) | 12.5      |
+| Index Primer Mix                      | 5           |
+| **Total volume**                      | **25**      |
+
+### 10.3 Set a 100 µL pipette to 20 µL and then pipette the entire volume up and down at least 10 times to mix thoroughly. Perform a quick spin to collect all liquid from the sides of the tube.
+
+### 10.4 Run the PCR program to amplify the libraries:
+
+| Step                  | Temperature | Time           | Cycles |
+|-----------------------|-------------|----------------|--------|
+| Initial Denaturation  | 98 °C       | 0:30           | 1      |
+| Denaturation          | 98 °C       | 0:10           | 7      |
+| Annealing             | 65 °C       | 1:15           | 7      |
+| Extension             | 65 °C       | 5:00           | 1      |
+| Hold                  | 4 °C        | Indefinite     | 1      |
+
+## Library Clean-up
+
+11. Clean Up Libraries:
+Repeat the same clean up process as step 6 using 20 µl of AMPure XP beads or NEBNext Sample Purification Beads and 28 µL of Elution Buffer (EB)/ 0.1X TE.
+
+## Library Quantification and Normalization
+
+12. 
+
+### 12.1 Analyze 2 µL library using a Qubit dsDNA HS Assay kit.
+
+### 12.2 Calculate the molarity value using the following formula. Use the band size from gel electrophoresis or Tapestation readings (step 7).
+
+Library concentration (µg/µL) / (660 g/mol * average library size (bp)) * 10^6.
+
+### 12.3 Normalize each library by dilution with nuclease free water.
+
+### 12.4 Pool equal volume (e.g., 5 µL) from each of the normalized libraries into a single 1.5 mL Eppendorf tube.
+
+## Sequencing
+
+13. Denature and load pooled libraries as follows:
+
+### 13.1 Denature the pooled libraries by mixing 5 µL of pooled libraries and 5 µL of 0.2N NaOH solution.
+
+### 13.2 Incubate for 5 minutes.
+
+### 13.3 Add 990 µL of HT1 buffer and mix well with denatured pooled library by pipetting up and down 10 times with P1000.
+
+### 13.4 Load 600 µL of the denatured, diluted pooled library into the loading position of the Illumina reagent cartridge (V2, 300 cycle kit). Load reagent cartridge, flow cell, and PR2 buffer into MiSeq instrument, confirm the metrics and start the run.
+
+endofoutput
+```

markdown-output/an-axenic-plant-culture-system-for-sporobolus-alte-cu5ewy3e.md

@@ -0,0 +1,164 @@
+```markdown
+# An axenic plant culture system for Sporobolus alterniflorus
+
+### Goal/Experiment:
+Develop a reliable protocol for generating axenic Sporobolus alterniflorus plants derived from seeds for in vitro culture purposes.
+
+## Abstract
+
+* **Sporobolus alterniflorus** is a native grass crucial to the U.S. East and Gulf coasts, particularly for salt marsh ecosystems. It tolerates various abiotic stresses, including high salinity, anoxia, and toxic sulfide concentrations. This protocol focuses on generating axenic plants from seeds, offering a simplified and efficient alternative to existing methods.
+
+## Guidelines
+
+This protocol involves the following steps:
+1. Collection of seeds in the field.
+2. Seed germination.
+3. In vitro establishment of cultures.
+
+A modified MS (Murashige and Skoog) medium is selected to favor root adventitious regeneration and lateral shoot development without altering plant morphology.
+
+## Materials
+
+### General Supplies
+- 1 L plastic containers
+- Aluminum foil
+- Tweezers
+- Surgical blades
+- 50 mL conical tubes
+- Petri dishes
+- Pyrex 1L bottles
+- ~1 L glass culture vessels
+
+### Reagents
+- Soil
+- Bleach (commercial, typically around 5-6%)
+- Autoclaved distilled water
+- Modified Murashige and Skoog medium 
+- Indole-3-acetic acid (IAA)
+- Kinetin
+- Agar
+- Sucrose
+
+### Equipment
+- Growing lights
+- pH meter
+- Autoclave
+- Tissue culture hood
+
+### Safety Warnings
+**Caution**: Bleach is harmful. Hazards include skin and eye burns and severe damage.
+
+### Ethics Statement
+No animals or humans were involved in this protocol.
+
+## Before Start Instructions
+Consult your institution about procedures related to soil processing and disposal.
+
+## Procedure
+
+### 1. Seed Storage and Germination
+
+#### 1.1 Seed Storage (30m)
+1. Collect mature seeds from flower stalks in the field.
+2. Transfer to a clean ziplock bag.
+3. Keep seeds wet and store at 4°C in darkness.
+4. Properly stored seeds are viable for 6-12 months.
+
+#### 1.2 Preparation of Containers for Seed Germination (3d)
+1. Fill autoclave containers 1/4 full with soil and saturate completely with water.
+2. Cover openings with aluminum foil and autoclave for 1h.
+3. After 48h, repeat autoclaving and let cool to room temperature before sowing seeds.
+
+#### 1.3 Seed Preparation and Germination (Surface Sterilization) (2w)
+1. Place seeds in a 50 mL conical tube.
+2. Add 40 mL 20% commercial bleach solution.
+3. After 20m, remove bleach and rinse twice with autoclaved distilled water (5m each).
+4. Sow seeds in autoclaved soil containers under 100 μE light at 20°C, 16h light/8h dark.
+5. Germination in 1-2 weeks.
+
+**Note**: High seed numbers per container ensure a continuous seedling supply. Glumes removal is labor-intensive and negligible for this experiment.
+
+![Figure 1](img1.png)
+*Fig.1 - Mature seeds preparation.*
+
+### 2. Removal of Root System
+
+#### 2.1 Remove Seedlings from Soil (10m)
+1. Pull seedlings gently from the soil.
+2. Clean by placing in autoclaved water.
+3. Transfer to a clean work area.
+
+#### 2.2 Remove Radicle from Seedling (10m)
+1. Use tweezers and clean blades to remove root tissue and external seed covers.
+2. Maintain secondary roots from the crown area.
+
+![Figure 2](img2.png)
+*Fig.2 - Smooth cordgrass seedlings.*
+
+![Figure 3](img3.png)
+*Fig.3 - Removal of root tissues.*
+
+### 3. Surface Sterilization of Trimmed Seedlings
+
+#### 3.1 Surface Sterilization (25m)
+1. Place 10-15 seedlings in a 50 mL tube with 40 mL 20% bleach solution.
+2. Incubate at room temperature for 20 minutes.
+
+#### 3.2 Rinsing (20m)
+1. Rinse seedlings in an autoclave hood.
+2. Follow with 3 rinses in autoclaved distilled water.
+3. Incubate 5m between each rinse.
+
+### 4. Inducing New Roots in Surface Sterilized Trimmed Seedlings
+
+#### 4.1 Root Induction Medium (Prepare in Advance) (2h)
+1. **Modified MS Medium**:
+    - 4.43g MS powder in 1L autoclave bottle.
+    - 30g/L sucrose.
+    - Adjust pH to 5.8.
+    - Add 8g/L agar, autoclave for 40m.
+    - Pour into sterile Petri dishes under hood (~25 mL/dish).
+
+**Note**: Modified MS includes specific macro-and micronutrients and vitamin concentrations enhancing root formation. 
+
+#### 4.2 Transfer Seedlings to Root Induction Medium (1h)
+1. Place seedlings on the agar surface, ensuring crown area contact.
+2. Seal Petri dishes with parafilm.
+
+#### 4.3 Root Induction (1w)
+1. Illuminate seedlings (~100 μE light, 16h light/8h dark).
+2. Roots will emerge within ~3 days.
+
+![Figure 4](img4.png)
+*Fig.4 - Root Induction.*
+
+### 5. Transfer Re-Rooted Seedlings into Culture Vessels
+
+#### 5.1 Prepare the Plant Growing Medium (2h)
+1. Prepare medium as in step 4.1.
+2. Autoclave 150 mL for 15 minutes in culturing vessels.
+
+#### 5.2 Transfer the Rooted Seedlings to Culture Vessels (1h)
+1. Under the hood, place seedlings into the 1 L vessels with media.
+2. Sterilize media by autoclaving for 30 minutes.
+3. Grow under ~200 μE light, 16h light/8h dark.
+
+![Figure 5](img5.png)
+*Fig.5 - Re-rooted seedlings in culture chamber.*
+
+### 6. In Vitro Propagation of *Sporobolus alterniflorus*
+
+#### 6.1 Lateral Shoot and Rhizomes Development (1h)
+1. Separate new shoots from mother plants to initiate individual cultures.
+2. Develop new vitroplants within 4-6 weeks.
+
+**Note**: Transfer plants to hormone-free MS medium once roots are established for continued growth.
+
+## License 
+This protocol is distributed under the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+## Citation
+Elena L. Peredo, Suzanne M Thomas, Zoe Cardon. (2023). An axenic plant culture system for Sporobolus alterniflorus. DOI: [10.17504/protocols.io.x54v9d94qg3e/v1](https://dx.doi.org/10.17504/protocols.io.x54v9d94qg3e/v1).
+
+**End of Output**
+```

markdown-output/an-improved-deep-learning-method-for-predicting-dn-2rdgd26.md

@@ -0,0 +1,79 @@
+```markdown
+# Goal/Experiment:
+Develop a deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences.
+
+# An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
+
+*PLOS One*  
+*Ruixiong Ma*  
+*USTB*
+
+[DOI Link http://dx.doi.org/10.17504/protocols.io.2rdgd26](http://dx.doi.org/10.17504/protocols.io.2rdgd26)
+
+## Abstract
+With the explosively increased amount of newly discovered proteins, predicting the function of these proteins from amino acid sequences is becoming one of the main challenges in functional annotation of genomes. 
+
+Nowadays a number of computational approaches have been developed to predict DNA-binding proteins effectively and accurately from amino acid sequences, such as SVM, DNABP, and CNN-RNN. However, these methods do not consider the context in amino acid sequences, which makes it difficult for them to capture sequence features adequately.
+
+In this paper, we propose CNN-BiLSTM, a new method for predicting DNA-binding proteins, elaborately reconciling convolutional neural network and bi-directional long short-term memory recurrent neural network. CNN-BiLSTM can explore the potential contextual relationships of amino acid sequences to obtain more features than traditional models.
+
+The experimental results show that the prediction accuracy of the proposed CNN-BiLSTM method on the test set is 96.5%, which is 7.8% higher than that of SVM, 9.6% higher than that of DNABP and 3.7% higher than that of CNN-RNN respectively.
+
+Being tested on 20,000 independent samples provided by UniProt that weren't involved in model training, the accuracy of CNN-BiLSTM is 94.5%, which is 12% higher than that of SVM, 4.9% higher than that of DNABP and 4% higher than that of CNN-RNN respectively.
+
+The model training process is visualized and compared with that of CNN-RNN, and it is found that the training process of CNN-BiLSTM support better generalization from the training data set, which shows that CNN-BiLSTM has a wider range of adaptations to protein sequences. 
+
+On the independent samples set, CNN-BiLSTM presents better credibility, for its predicted scores are closer to the labels of the samples than those of CNN-RNN. Therefore, the proposed CNN-BiLSTM is a more powerful method for identifying DNA-binding proteins.
+
+## External Link
+[https://doi.org/10.1371/journal.pone.0225317](https://doi.org/10.1371/journal.pone.0225317)
+
+## Guidelines
+This is a method of recognizing DNA binding proteins by deep learning.
+
+## Materials Text
+[Various encrypted data, not transcribed here for brevity]
+
+## Safety Warnings
+Pay attention to the temperature of the computer.
+
+## Before Starting
+### What you need to prepare:
+
+- Python 3
+- TensorFlow
+- Keras
+
+## Step-by-Step Procedure
+### Step 1: Prepare the dataset
+- **Data Extraction**: In the process of extracting data from UniProt, we removed those sequences with length less than 50 or greater than 1,280 amino acids, resulting in 17,651 DNA-binding protein sequences selected as positive samples. At the same time, we got 50,500 non-DNA-binding protein sequences as negative samples.
+
+**UniProt**: UniProt is a comprehensive, high-quality and freely accessible resource of protein sequence and functional information. It provides the scientific community with a vivid, integrated and richly annotated view of protein knowledge.
+
+- **Independent Samples**: Taking sequences from both positive and negative samples as independent test samples, we selected 500 sequences each.
+
+- **Training and Test Sets**: For the remaining 17,151 positive and 50,000 reverse samples, we randomly selected 85% of them as training sets and the remaining 15% as test sets for model training.
+
+### Step 2: Build Model
+The deep learning model is composed of four parts:
+
+1. **Coding Layer**: Each amino acid is represented as a particular number.
+2. **Embedding Layer**: Translates amino acid sequences into continuous vectors.
+3. **Convolution Layer**: Consists of two convolutions and two maximal pooling operations.
+4. **BiLSTM Layer**: Grasp the context features of amino acid sequences.
+
+We use the Keras platform to build this model.
+
+### Step 3: Model Training
+- The data is trained in the built model using GPU.
+- At the end of this process, we get a DNA binding protein predictor.
+
+## References
+This is an open access protocol distributed under the terms of the Creative Commons Attribution License [License URL](https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+---
+
+*Note*: This compiled information assists in understanding and applying the described process, ensuring adequate preparation of materials and systematic implementation of the steps.
+
+`endofoutput`
+```

markdown-output/analysis-of-islet-function-by-insulin-enzyme-linke-bz7bp9in.md

@@ -0,0 +1,139 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to quantify the insulin secretion and content from human pancreatic islets after glucose stimulation to assess islet function. This protocol provides a detailed methodology for performing Insulin Enzyme-linked Immunosorbent Assay (ELISA) to measure insulin concentrations.
+
+# Analysis of Islet Function by Insulin Enzyme-linked Immunosorbent Assay (ELISA)
+
+**Date of Publication:** December 02, 2021  
+**DOI:** [dx.doi.org/10.17504/protocols.io.bz7bp9in](https://dx.doi.org/10.17504/protocols.io.bz7bp9in)  
+**Cited by:** IIDP-HIPP  
+
+This Standard Operating Procedure (SOP) is based on the Vanderbilt University Medical Center Human Islet Phenotyping Program (HIPP) Islet Functional Analysis. This SOP provides the HIPP procedure for measuring islet insulin content and secretion to assess islet function. It defines the assay method used by the Human Islet Phenotyping Program (HIPP) for the qualitative determination of Purified Human Pancreatic Islet product, post-shipment, for use in National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)-sponsored research in the Integrated Islet Distribution Program (IIDP).
+
+**SOP #: HIPP-09-v01**
+
+## Organizations & Key Terms
+
+### Integrated Islet Distribution Program (IIDP)
+The IIDP is a grant-funded program commissioned and funded by the NIDDK to provide quality human islets to the diabetes research community to advance scientific discoveries and translational medicine.
+
+### IIDP Coordinating Center (CC)
+The IIDP CC integrates an interactive group of academic laboratories including the subcontracted IIDP centers.
+
+### Human Islet Phenotyping Program (HIPP)
+The HIPP is a subcontracted entity of the IIDP through the COH and Vanderbilt University. 
+
+### Islet Equivalent (IEQ)
+An islet with a diameter of 150 μm determined mathematically by compensating for islet shape.
+
+### Islet Perfusion Assay
+A functional assay that acquires dynamic hormone secretory profiles simultaneously from islet cell types.
+
+### Enzyme-linked immunosorbent assay (ELISA)
+A sensitive in vitro assay technique used to measure concentrations of antigens by making use of an enzyme conjugated to an antibody recognizing an antigen of interest.
+
+## Equipment
+
+1. The following equipment is necessary to assess human islet function by Insulin ELISA:
+    - **1.1 Micropipettes:** (10-100 µL, 20-200 µL, and 100-1000 µL ranges)
+    - **1.2 Multi-channel micropipette:** (20-200 µL range)
+    - **1.3 Computer:** with Excel (Microsoft) and Prism (Graphpad) software
+    - **1.4 epMotion Liquid Handling Workstation:** (Eppendorf 5075)
+    - **1.5 Benchmark Orbi shaker:** (BT1502)
+    - **1.6 Fisherbrand accuWash microplate washer:** (5165100) or similar plate washer (14-377-577 or 14-377-578)
+    - **1.7 BMG Labtech CLARIOstar microplate reader:** (Plus Model)
+        - **1.7.1 CLARIOstar software**
+        - **1.7.2 MARS data analysis software**
+    - **1.8 Vortex mixer**
+
+## Supplies and Materials
+
+2. The following supplies and materials are necessary to assess human islet function by Insulin ELISA:
+    - **2.1 Human Insulin ELISA Kit, Mercodia**
+        - **Catalog #10-1113-10**
+        - **2.1.1 Coated 96-well plates:** (20-2622)
+        - **2.1.2 Calibrators 0, 1, 2, 3, 4, 5:** Insulin concentrations are known values provided by manufacturer (20-2615, 20-2616, 20-2617, 20-2618, 20-2619, 20-2620)
+        - **2.1.3 Enzyme Conjugate 11X:** (20-2631)
+        - **2.1.4 Enzyme Conjugate Buffer:** (20-2630)
+        - **2.1.5 Washer Buffer 21X:** (20-3194)
+        - **2.1.6 Substrate TMB:** (20-3136)
+        - **2.1.7 Stop Solution:** (20-2694)
+    - **2.2 Buffer, Mercodia**
+        - **Catalog #10-1195-01**
+    - **2.3 Human Diabetes Antigen Controls**
+        - **Catalog #10-1134-01**
+    - **2.4 50 µL epMotion pipette tip, Eppendorf**
+        - **Catalog #30014421**
+    - **2.5 10 mL (Fisher Scientific 13-678-11E) and 25 mL (Fisher Scientific 13-678-11) serological pipets**
+    - **2.6 2 mL microcentrifuge tube, Sarstedt**
+        - **Catalog #72.695.500**
+    - **2.7 200 µL (ART P-200) and 1000 µL (ART P-1250) pipette tips**
+
+## Procedures
+
+### 1. Preparation of Samples, Standards, and Internal Quality Controls
+1.1 Thaw archived samples intended for analysis in room temperature water. Once thawed, invert capped samples ten times to thoroughly mix.
+
+1.2 Retrieve the islet hormone extracts and keep on ice.
+
+1.3 Prepare serial dilutions of hormone extract (1:100, 1:1000, 1:2000, 1:5000, and 1:10000) in 2 mL tubes using the Calibrator 0 media from the ELISA Kit or Diabetes Sample Buffer (See Figure 1). Vortex each tube to mix contents before generating subsequent dilutions.
+
+1.4 Generate 1:3 dilutions for perfusion fractions #23, #24, #25, and #43 by adding 40 µL sample to 80 µL of Calibrator 0 or Diabetes Sample Buffer in 2 mL tubes.
+
+1.5 Transfer all Calibrators and Antigen Controls from original bottles to 2 mL tubes.
+
+### 2. Preparation of Enzyme Conjugate and Wash Buffer Solutions
+
+2.1 Prepare Enzyme Conjugate 1X solution by diluting Enzyme Conjugate 11X in Enzyme Conjugate Buffer. Mix gently. Prepare a volume sufficient to add 100 µL to each well (see step 3.2).
+
+2.2 Prepare Wash Buffer 1X solution by diluting Wash Buffer 21X in redistilled water. Mix thoroughly. Prepare a volume sufficient to add 4.2 mL to each well (see step 3.4).
+
+### 3. Performing Insulin Assay
+
+3.1 By using epMotion 5075 or hand-pipetting, pipette 25 µL each of Calibrators and Antigen Controls (in duplicate), samples, extract dilutions, and sample dilutions into appropriate wells of ELISA 96-well plate.
+
+3.2 Add 100 µL of enzyme conjugate 1X solution to each well.
+
+3.3 Incubate ELISA 96-well plate on a microplate shaker (900 rpm, orbital movement) for 1 hour at room temperature (18-25°C).
+
+3.4 Using the plate washer, wash 6 times with 700 µL wash buffer 1X solution. After final wash, invert and tap the plate firmly against absorbent paper. Do not include soak step in washing procedure.
+
+3.5 Add 200 µL Substrate TMB into each well.
+
+3.6 Incubate on the bench for 15 minutes at room temperature (18-25°C).
+
+3.7 Add 50 µL Stop Solution to each well. Mix thoroughly for 5 seconds by tapping gently on all sides of the plate without dispersing liquid in wells.
+
+3.8 Using the microplate reader, determine the optical density and insulin concentration of each well within 30 minutes of adding stop solution. Set to 450 nm.
+
+### 4. Data Analysis
+
+4.1 Values for all standards must be within ±15% of their expected values and replicate values of each standard must have a Coefficient of Variation (CV) ≤20%. If standards vary beyond these limits, the assay must be repeated.
+
+4.2 Values for quality control samples, corresponding to lower and upper assay detection ranges, must be within their known ranges. If QCs vary beyond these limits, the assay must be repeated.
+
+4.3 Calculate the average of the insulin concentrations from the 4 extract dilutions to determine insulin content, expressed as ng/mL.
+
+4.4 Normalize secreted insulin concentrations per islet volume (IEQs), expressed as ng/100 IEQs/min and islet insulin content, expressed as % content/min.
+
+4.5 Use Prism software to create graphs and to calculate stimulation index (SI) and area under curve (AUC) values.
+    - 4.5.1 **Stimulation index (SI):** A ratio calculated as maximum response to a given stimulus relative to baseline.
+    - 4.5.2 **Area under curve (AUC):** Calculated by integrating islet secretory response to a given stimulus over time.
+
+## Data Storage and Reporting
+
+### 5. Data Storage and Reporting
+
+5.1 To facilitate data management and ensure data security, the VUMC HIPP uses an institutional server-based platform for data storage and analysis.
+
+5.2 Upon analysis completion, the VUMC HIPP uploads raw data, including hormone levels, data analysis, and graphical representations of each human islet perfusion into the IIDP HIPP database. Example of human islet perfusion results performed in HIPP is shown in **Figure 1**.
+
+5.3 Functional data on islet insulin and glucagon secretion will be uploaded within 3 business days to the HIPP database built by IIDP programming team and immediately available to IIDP-affiliated investigators and islet isolation centers.
+
+## Deviations and Resolutions
+
+### 6. Deviations and Resolutions
+Document any deviations that occurred during this protocol that affect the final results and report with the analysis of the assay.
+
+endofoutput
+```

markdown-output/analysis-of-the-time-evolution-of-auditory-steady-wejfbcn.md

@@ -0,0 +1,132 @@
+```markdown
+# Goal/Experiment:
+Analysis of the time evolution of auditory steady-state responses (ASSR) recorded in rats.
+
+## Analysis of the time evolution of auditory steady-state responses (ASSR) recorded in rats
+
+#### Version 2
+
+**Authors:**
+1. Pavel Prado - Advanced Center for Electrical and Electronic Engineering (AC3E), Universidad Técnica Federico Santa María, Chile
+2. Eduardo Martínez-Montes - Cuban Neuroscience Center
+3. Matías Zañartu - Department of Electronic Engineering, Universidad Técnica Federico Santa María, Valparaíso, Chile
+
+dx.doi.org/10.17504/protocols.io.wejfbcn
+
+## Abstract
+
+Auditory steady-state responses (ASSRs) are brain oscillations locked to the periodic properties of acoustic stimuli. Audiological tests based on the acquisition of ASSR are useful for estimating hearing sensitivity, mainly because multiple hearing frequencies can be simultaneously assessed, and the auditory response can be objectively detected using statistical tests.
+
+Typically, the extraction of the auditory response from the measured signal relies on averaging epochs of the EEG, time-locked to the stimulus. This assumes that the auditory response is steady over time and that averaging increases the signal-to-noise ratio of the measurement.
+
+Since time-domain averaging of epochs within a recording does not allow distinction between methodological and physiological related variations in the amplitude of the ASSR, we designed a protocol for analyzing the dynamics of the auditory response during the acquisition procedure. The protocol allows us to compute the ASSR amplitude at a given time window without being compromised by the segments of the preceding EEG. 
+
+## Guidelines
+
+The study must be performed under the approval of the local Animal Research and Ethics Committee. Specifically, this study followed the guidelines of the Cuban Neuroscience Center and the National Center for Animal Breeding of Cuba. 
+
+## Safety Warnings
+
+Handle animals following standard safety procedures. Standard safety procedures should also be adhered to when handling disposable needles and syringes. National and local electrical safety regulations must be followed.
+
+## Before Starting
+
+Care, feeding, breeding, and maintenance of animals should follow standard local guidelines. Animals should be housed in a standard bio-clean animal room under a 12-hour light/dark cycle at 22-24°C, with free access to food and tap water.
+
+## Preparation
+
+1. **Anesthesia:**
+    - Administer ketamine (75.0 mg/kg, intraperitoneal) and diazepam (5.0 mg/kg, intraperitoneal).
+
+2. **Supplemental anesthesia:**
+    - Maintain the animal in an areflexic state with supplemental doses during the experiment.
+
+3. **Atropine sulfate:**
+    - Administer 0.06 mg/kg intramuscularly to decrease mucosal secretions.
+
+4. **Temperature control:**
+    - Maintain body temperature at 37.0±0.1°C using a body temperature control system.
+
+5. **Post-experiment care:**
+    - Return animals to the colony after recovery from anesthesia—animal sacrifice is not required.
+
+## Acoustic Stimulation and EEG Recording
+
+6. **Presentation:**
+    - Acoustic stimuli are presented monaurally via an ER-3A Etymotic Research Insert Earphone.
+
+7. **Custom ear molds:**
+    - Use custom-fitted ear molds to replace the original foam for coupling the earphone to the rat’s ear.
+
+8. **Stimulation system calibration:**
+    - Refer acoustic levels to a Brüel & Kjær artificial ear (type 4152). Calibrate with a Brüel & Kjær 2250 sound level meter and type 4144 microphone.
+
+9. **Acoustic stimuli generation:**
+    - Generate stimuli using standard hardware/software. Example: continuous tones of 8 kHz sinusoidally-modulated in amplitude at 115 Hz are generated using the ASSR software module of the AUDIX system (Havana, Cuba). Stimulus intensity is fixed at 50 dB SPL.
+
+10. **Electrophysiological responses:**
+    - Record responses differentially using stainless-steel needle electrodes inserted subdermally (vertex positive; neck negative; thorax reference).
+    - Amplify recordings with a gain of 1.2x10^4 and band-pass filter frequencies from 10 to 300 Hz.
+
+12. **Digitization:**
+    - Digitize the output at 16-bit resolution and sample at 920 Hz.
+
+13. **Artifact rejection:**
+    - Reject segments with electrical oscillations exceeding 50 mV online.
+
+14. **Data acquisition:**
+    - Complete 60 artifact-free epochs of 4.45 s duration each (4096 time-points each). Allow 10 minutes between consecutive recordings. Thirty recordings are acquired from each animal.
+
+## Data Processing
+
+15. **Software Processing:**
+    - Perform data processing using in-house MATLAB codes (MathWorks, USA).
+
+16. **Data Matrix Arrangement:**
+    - Rearrange the 60 sequential epochs of the 30 recordings offline into a data matrix of 30 rows and 60 columns (one matrix per animal).
+
+17. **Noise Influence Reduction (Optional):**
+    - Modify the dataset to reduce noise influence on auditory response computation.
+
+18. **Column-wise Averaging:**
+    - Average the 30 epochs column-wise for each time window to reduce EEG background noise and detect the ASSR amplitude.
+
+19. **ASSR Amplitude Computation:**
+    - Compute the amplitude for each group of epochs using Fast Fourier Transform (FFT). Use an FFT length of 4096 time-points, aligning with the length of an epoch (4.45 s). With sampling at 920 Hz, the FFT resolution is 0.22 Hz. Windowing technique is not implemented.
+
+20. **Spectral Amplitude:**
+    - Define amplitude as the spectral amplitude at 115 Hz. Vector average the amplitude of 30 spectral components to calculate residual noise level (RNL).
+
+21. **Statistical Comparison:**
+    - Compare ASSR amplitudes with corresponding RNL using Hotelling’s T2 multivariate test in the AUDIX system, considering both amplitude and phase oscillations.
+
+22. **Time Evolution:**
+    - Plot ASSR amplitudes as a function of time. Fit to time courses using negative exponential functions if R^2>0.85 and p<0.05.
+
+23. **Statistical Tests:**
+    - Apply statistical tests, such as One-way ANOVAs (p<0.05) and post-hoc analyses (Tukey test, p<0.05), as needed to analyze the stability of the ASSR amplitude and RNL.
+
+### Calculation of Adaptive Behavior Index:
+
+When an adaptive behavior is detected, the adaptation index (P_adapt) of the response is calculated using the equation:
+
+\[ P_{\text{adapt}} = 100 \left( \frac{A_{\text{mp}\max} - A_{\text{mpadapt}}}{A_{\text{mp}\max}} \right) \]
+
+Where:
+- \( A_{\text{mp}\max} \) represents the maximum amplitude of the fitted curve.
+- \( A_{\text{mpadapt}} \) represents its asymptotic value (defined as the amplitude estimated when the recording length was three times the time constant of the fitted exponential function).
+
+## Summary
+
+A summary of the protocol:
+1. Presenting acoustic stimuli modulated in amplitude at 115 Hz.
+2. Organizing the dataset (matrix with 60 columns and 30 rows).
+3. Spectral analysis of the averaged measurement.
+4. Graphical representation of ASSR dynamics.
+
+![Protocol Diagram](https://example.com/path/to/protocol-diagram.png)
+
+This protocol is distributed under the terms of the Creative Commons Attribution License.
+
+endofoutput
+```

markdown-output/antioxidant-rescue-of-c-elegans-behaviour-on-keio-cgehttb6.md

@@ -0,0 +1,92 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to screen candidate behaviour-modifying E. coli/BW25113 single-gene deletion mutants from the 'Keio Collection’ to investigate their effects on *Caenorhabditis elegans* behaviour in the presence of antioxidants.
+
+# Antioxidant Rescue of *C. elegans* Behaviour on Keio E. coli Mutants (6-Well Plates)
+
+DOI: [dx.doi.org/10.17504/protocols.io.j8nlkw5kdl5r/v1](https://dx.doi.org/10.17504/protocols.io.j8nlkw5kdl5r/v1)
+
+Author: Saul Moore  
+Imperial College London, MRC London Institute of Medical Sciences (LMS)
+
+## Abstract
+Protocol for screening candidate behaviour-modifying *E. coli* BW25113 single-gene deletion mutants from the 'Keio Collection' to investigate their effects on *Caenorhabditis elegans* behaviour in the presence of antioxidants.
+
+## Disclaimer
+**DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK**
+
+## License
+This is an open access protocol distributed under the terms of the Creative Commons Attribution License.
+
+## Materials
+- 6-well flat bottom plates ('imaging plates')
+- 60mm Petri plates ('maintenance plates')
+- 90mm Petri plates ('nursery plates')
+- 50mL Erlenmeyer flasks
+
+## Reagents
+- 500mL LB broth
+- 1L NGM agar (for ingredients, see protocol for making NGM agar)
+
+## Preparing NGM Agar + Pouring Plates
+1. Prior to screening, prepare the materials needed for screening *C. elegans* on selected Keio *E. coli* mutants:
+    - 6-well plates (imaging plates)
+    - 15 mL Falcon tubes
+    - 50 mL Erlenmeyer flasks
+    - 90 mm Petri plates (maintenance plates)
+    - 150 mm Petri plates (nursery plates)
+2. Make 1L normal Nematode Growth Media (NGM) agar, following the protocol: [Making normal NGM for imaging plates (Cabreiro Lab)](dx.doi.org/10.17504/protocols.io.6bhhaj6)
+3. Pour 15 mL NGM agar into each 60 mm maintenance plate, and 35 mL NGM agar into each 90 mm nursery plate, following the protocol for Plate pouring [here](dx.doi.org/10.17504/protocols.io.6bhhaj6). Keep the remaining agar warm in a water bath set to 65°C, for pouring into 6-well imaging plates afterwards.
+4. Using the Integra ViaFill, dispense 4 mL NGM agar into each well of the 6-well plates, following the protocol: [Dispensing agar into multiwell plates](dx.doi.org/10.17504/protocols.io.8g2ww7e)
+5. Leave the plates on the lab bench (with lids on) until the agar has cooled and solidified (approximately 1 hour, timing depends on humidity).
+
+## Preparing Worms
+9. Inoculate 10 mL LB broth media with *E. coli* BW25113 (Keio background wild-type strain, used as negative control and for raising worms, no Kanamycin) in an Erlenmeyer flask for overnight culture following the protocol: [Inoculating a Liquid Bacterial Culture](dx.doi.org/10.17504/protocols.io.dd8i2h6)
+10. Place the inoculation in a shaking incubator at 37°C at 200 rpm and leave to grow overnight.
+11. Remove the BW culture from the shaking incubator and place in 4°C fridge until seeding.
+12. Remove the plates from storage and the BW culture from the fridge, and leave on the bench for approximately 30 minutes to acclimate to room temperature.
+13. Using aseptic technique, seed the 60 mm maintenance plates each with approximately 250 µL of BW25113 culture.
+14. Leave under hood until dry (with lids on, timing depends on humidity).
+15. Using a platinum pick, gently pick 30 adult N2 Bristol *C. elegans* onto each maintenance plate, and store in an incubator at 20°C.
+16. After 24 hours, remove the adult worms, leaving the eggs behind to hatch into L1 larvae.
+17. Inoculate a further 10 mL LB broth with BW25113 bacteria for overnight culture (no Kanamycin), following the protocol [here](dx.doi.org/10.17504/protocols.io.5dbp2i6) and place in a shaking incubator at 37°C, 200 rpm.
+18. After 24 hours, remove the culture from the incubator, and the 90 mm nursery plates from storage, and leave to acclimate on bench top for 30 minutes.
+19. Seed the nursery plates each with approximately 1 mL of fresh BW25113 culture. Leave under hood until dry.
+20. Wash the worms off the BW-seeded maintenance plates, into two 15 mL Falcon tubes.
+21. Perform an egg prep on worms in the Falcon tubes, following the protocol: [Egg Prep for Bleach Synchronization (Cabreiro Lab)](dx.doi.org/10.17504/protocols.io.4h4gp3w)
+
+## Preparing Bacteria
+23. Fill 2 separate Erlenmeyer flasks with 25 mL LB. Add 50 µg/mL Kanamycin to one flask, and leave the other flask without Kanamycin for the BW25113 control.
+24. Remove the required Keio frozen stock plates from -80°C containing the strains for antioxidant testing. Gently remove the aluminium film and leave to partially thaw for a minute or so. 
+    > **Safety Information**: To avoid damaging the bacterial stocks through repeated freeze-thawing, do not let the wells completely defrost. Just enough to be able to pick up some cells with the replicator.
+25. Inoculate the Erlenmeyer flasks with the desired strains for antioxidant testing from Keio frozen stock plates, following the protocol: [Inoculating a Liquid Bacterial Culture](dx.doi.org/10.17504/protocols.io.dd8i2h6)
+26. Incubate the cultures overnight at 37°C in a shaking incubator at 200 rpm.
+27. Remove the overnight cultures from the incubator. Inoculate 2 more Erlenmeyer flasks for a second round of overnight cultures from the first, this time without Kanamycin (to avoid exposing the worms to the antibiotics), and incubate overnight at 37°C at 200 rpm.
+28. After 24 hours, remove the cultures from the incubator and store at 4°C until used for experiments.
+
+## Seeding Imaging Plates (6-Well)
+29. Remove the imaging plates from 4°C storage.
+30. Ensure that imaging plates have lost approximately 3-5% of their original weight (so that they are not too wet for imaging when seeded). Place under a hood or drying cabinet until they have.
+31. Remove overnight cultures of Keio strains from 4°C storage. Using a pipette, seed 30 µL of bacterial culture into the wells of each 6-well imaging plate.
+32. Place the seeded plates under a laminar flow hood to dry for 20 minutes, then place in an incubator at 25°C (no shaking) for 7 hours 40 minutes (total lawn growth time: 8 hours).
+33. After 8 hours, remove the plates from the incubator and store at 4°C.
+
+## Adding Antioxidants (6-Well)
+34. On the day of tracking, remove the seeded imaging plates from 4°C, and dry for 30 minutes under a laminar flow hood.
+35. Remove the antioxidants from 4°C. Prepare 100 mM NAC or Vitamin C (in H2O).
+36. Using a pipette, dispense 40 µL of antioxidant solution into each desired well of the 6-well imaging plates (for a final concentration of 1 mM in 4 mL agar).
+37. Leave the plates to dry under a hood for a further 30 minutes. Record the weight of the plates after drying (as weight at imaging).
+
+## Picking Worms + Hydra Tracking (6-Well)
+38. Prior to tracking, ensure that the imaging cave air conditioning is turned on (and there has not been a power-cut) and also empty the dehumidifier waste water tray (see pre-imaging checklist).
+39. Remove the nursery plates from the incubator.
+40. Using a platinum worm pick, carefully pick 10 Day1 worms onto the edge of the lawns in each well of the 6-well imaging plates, then place in incubator at 20°C until tracking (at +4 hours on food).
+41. 30 minutes prior to tracking with the Hydra rig (each run is performed every 20-30 minutes), remove 5 imaging plates from the 20°C incubator and leave to acclimate in the imaging cave.
+42. Record worm behaviour on the bacterial food for 15 minutes at the 4-hour timepoint (25 fps, exposure: 25000 msec, blue-light stimulation).
+
+## Post-Tracking
+43. After tracking, discard the plates in a biological waste bin.
+44. Check tracking checklist to ensure that all videos have been saved correctly: `'/Volumes/behavgenom$/Documentation/Protocols/analysis/tracking-checklist-20210210.docx'`
+
+endofoutput
+```

markdown-output/application-of-phyto-pam-ii-compact-version-for-ru-cjgtujwn.md

@@ -0,0 +1,109 @@
+```markdown
+# Goal/Experiment:
+To acquire photosynthetic efficiency (F<sub>v</sub>/F<sub>m</sub>) and quantum yield of photosystem II (Y(II)) of Microcystis aeruginosa cultures using far-red acclimation with the PHYO-PAM-II Compact Version.
+
+# Application of PHYTO-PAM-II (Compact Version) For Running Rapid Light Curves on Cyanobacterial Samples
+
+**Forked from**: [Application of PHYTO-PAM-II (Compact Version) on Aureococcus anophagefferens cultures for photosynthetic efficiency and quantum yield of PSII](https://dx.doi.org/10.17504/protocols.io.eq2ly7jqelx9/v1)
+
+### Citation:
+Gwen Stark, Emily E. Chase, Steven W. Wilhelm 2022. Application of PHYTO-PAM-II (Compact Version) For Running Rapid light curves on Cyanobacterial samples. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly7jqelx9/v1
+
+### Contributors:
+Gwen Stark<sup>1</sup>, Emily E. Chase<sup>2</sup>, Steven W. Wilhelm<sup>1</sup>
+1. The University of Tennessee, Knoxville
+2. University of Tennessee, Knoxville
+
+---
+
+## Abstract
+A protocol to acquire photosynthetic efficiency (F<sub>v</sub>/F<sub>m</sub>) and quantum yield of photosystem II (Y(II)) of Microcystis aeruginosa cultures using far-red acclimation.
+
+## Keywords
+- Photosynthetic efficiency
+- Quantum yield
+- F<sub>v</sub>/F<sub>m</sub>
+- HAB
+- Chlorophyll fluorescence
+- Cyanobacteria
+
+## License
+This is an open access protocol distributed under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+---
+
+## Guidelines
+The collection of quantum yield and photosynthetic efficiency is highly sensitive to modifications in sampling protocol.
+
+## Materials
+- PHYTO-PAM-II Compact Version and components
+- Laptop with a USB port, and PhytoWin_3 installed
+- Measurement cuvettes
+- At least 3 mL of culture material for each sample
+- 70% Ethanol
+- KimWipes
+- Necessary materials and setup for both dark adapting cultures, and a no light or low light environment for sampling
+
+## Before Starting
+Familiarize yourself with the PHYTO-PAM-II equipment, manufacturer’s provided manual, and the basics of chlorophyll fluorescence parameters for full use of data collected and accuracy of results.
+
+---
+
+## Equipment Preparation
+1. **Setting Up the PHYTO-PAM-II Compact Version:**
+    - Toggle the power and connect to a laptop via USB.
+    - Open the PhytoWin_3 program and select "Phyto Compact Unit."
+    - Ensure the program is in "MEASURE" mode, and that the "ML" light is green (indicating it is ready).
+    - Ensure that "AL" and "FR" lights are not selected.
+
+![Equipment Setup](image1.png)
+
+2. **Adjusting Settings:**
+    - Modify Phyto-Pam settings based on the species being tested.
+    - Use the "View Pulse" check box to observe the saturation pulse kinetics, ensuring a distinct plateau is seen.
+  
+---
+
+## Sample Preparation
+3. **Sample Transfer:**
+    - Transfer 3 mL of culture to a quartz cuvette and minimize exposure time.
+    - Place the cuvette in the optical port and cover with the darkening hood.
+
+4. **Auto-Adjust Gain:**
+    - Perform a zero-offset function using Zoff-determination to blank the PHYTO-PAM-II before runs.
+    
+5. **Far-Red Acclimation:**
+    - Apply far-red light acclimation to induce photosystem I and oxidize the PQ pool.
+    - Dark acclimation is not recommended for cyanobacteria.
+
+    > **Note:** Evaluate the necessity between no acclimation and weak far-red acclimation for consistent results.
+
+---
+
+## Measurement Acquisition
+6. **Experimental Measurements:**
+    - Measurements can now be collected.
+
+7. **Running Far-Red Light Acclimation:**
+    - Transfer 3 mL of culture into the cuvette, auto-adjust gain, and run acclimation.
+    - Turn on the "ML" button and wait for the light to turn green.
+
+8. **Taking Measurements:**
+    - Choose F<sub>v</sub>/F<sub>m</sub> measurements or run a rapid light curve.
+    - Adjust PAR and exposure times appropriately.
+    - Aim for the ETR curve to hit a maximum peak and level off.
+
+9. **Recording Data:**
+    - Data will be recorded automatically.
+    - Use 70% ethanol to clean the cuvette between different treatments.
+
+10. **Data Storage:**
+    - Save and export data as a .csv file.
+    - Unplug the equipment and charge fully for long-term storage.
+
+> **Recommendation:** Regularly charge the equipment if stored unused for extended periods.
+
+---
+
+### endofoutput
+```

markdown-output/around-the-horn-pcr-and-cloning-rf2d3qe.md

@@ -0,0 +1,142 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to perform 'around-the-horn' or 'divergent' PCR, where primers extend in opposite directions on a plasmid to generate a linear product.
+
+# Around-the-horn PCR and Cloning
+*Stephen Floor*
+
+## Abstract
+This protocol is designed for 'around-the-horn' or 'divergent' PCR, where primers go around most or all of a plasmid but are pointed away from each other so they generate a linear product. Note that this protocol is written for Q5 polymerase but works fine with other polymerases. To switch polymerases, just change the PCR reaction setup.
+
+**Citation:** Stephen Floor Around-the-horn PCR and cloning. [protocols.io](https://dx.doi.org/10.17504/protocols.io.rf2d3qe) doi:10.17504/protocols.io.rf2d3qe  
+**Published:** 03 Jul 2018
+
+## Before start
+Program the thermocycler with the PCR program in the main protocol.
+
+## Materials
+- **Q5 Hot Start High-Fidelity DNA Polymerase** - 500 units (M0493L) by New England Biolabs
+- **Phusion Hot Start Flex DNA Polymerase** - 100 units (M0535S) by New England Biolabs
+- **HotStart ReadyMix (KAPA HiFi PCR kit)** (KK2601) by Kapa Biosystems
+- **dNTP** (639125) by Takara
+- **Forward primer (25 µM)** by Contributed by users
+- **Reverse primer (25 µM)** by Contributed by users
+- **Template** (5 ng/µl) by Contributed by users
+
+## Protocol
+
+### Design Primers
+The basic idea of this protocol is that primers head 'away' from each other on a plasmid backbone, which gives a lot of flexibility in what can be done. Downsides are that it generates a linear product instead of a circular one, so it must be phosphorylated and ligated, and the PCR process takes a while.
+
+Insertion (region in blue are inserted):  
+![Insertion Diagram](img_insertion)
+ 
+Deletion (region in red is deleted):  
+![Deletion Diagram](img_deletion)
+
+Note that deletions and insertions can be combined. This strategy can be helpful when designing products for Gibson cloning.
+
+### Set up the PCR
+**Step 1.**  
+Mix the following on ice:
+
+| Reagent                   | Volume for 1 reaction |
+|---------------------------|-----------------------|
+| Q5 buffer                 | 10 µl                 |
+| dNTPs (10 mM)             | 1 µl                  |
+| Forward primer (25 µM)    | 1 µl                  |
+| Reverse primer (25 µM)    | 1 µl                  |
+| Template (5 ng/µl)        | 5 µl                  |
+| Q5 polymerase             | 0.5 µl                |
+| ddH₂O                     | 31.5 µl               |
+
+### Run the PCR
+**Step 2.**  
+Run this PCR:
+
+- 95°C for 2 minutes
+- 95°C for 15 seconds
+- 65°C for 15 seconds
+- 72°C for 10 minutes
+
+Repeat the above 30 times
+
+- 72°C for 15 minutes
+
+Note that the extension times at 72°C can be adjusted to the plasmid. In general, allow 1 minute for each kb of plasmid.
+
+### Remove the Template DNA
+**Step 3.**  
+This strategy will have high background unless you remove the template DNA. DNA from most *E. coli* strains is methylated and can be degraded by the relatively nonspecific restriction enzyme Dpn1.
+
+Add 1 µl Dpn1 to each PCR tube and incubate for 30 minutes to overnight at 37°C.
+
+### Purify the PCR Product
+**Step 4.**  
+In general, it is recommended to gel purify PCR products from these reactions both to further get rid of template DNA and to avoid cloning any truncated PCR products.
+
+**Step 5.**  
+Pour a 1% agarose gel in 0.5X TBE.
+
+- 75 ml 0.5X TBE
+- 750 mg agarose
+
+Mix and microwave until boiling and clear - about 90 seconds  
+Mix and check that the agarose is dissolved.  
+Add 7.5 µl SYBR safe
+
+**Step 6.**  
+Casting gel  
+Assemble the gel cassette with combs. Use combs that are big enough to accommodate the entire PCR. Typically, these have four or five lanes per gel. Can use two combs per gel.  
+Pour hot agarose into cassette and let cool to RT.
+
+**Step 7.**  
+Running gel  
+Put RT gel into a tank with 0.5X TBE  
+Ensure gel is submerged in TBE.
+
+Load ladder into one well. Typically, 10 µl ladder is sufficient, even in large lanes.  
+Load samples into remaining lanes.  
+Run gel at 120V for 30 minutes
+
+**Step 8.**  
+Cut PCR product bands  
+Image gel on the blue light imager  
+Prepare one 1.5 ml tube for each successful band  
+Cut band out with a clean razor blade and transfer to tube.
+
+**Step 9.**  
+Gel purify the PCR product according to a mini-spin protocol, eluting in 15 µl. Quantify the product using a nanodrop. Good yields are 50 ng/µl; often yields are 10 ng/µl (which can still work).
+
+### Phosphorylate, Ligate, and Transform
+**Step 10.**  
+Ligation of unphosphorylated DNA can be accomplished by simultaneous phosphorylation using T4 PNK and ligation with T4 DNA ligase. The reaction setup is simple but ensure you use T4 DNA ligase buffer and **not** T4 PNK buffer, since PNK buffer has no ATP.
+
+**Step 11.**  
+**Phosphorylation**  
+Mix the following in a tube:  
+- 1 µl 10X T4 ligase buffer
+- 1 µl PNK
+- 50 ng of gel purified PCR product
+- Water to 9 µl
+
+Incubate for 30 minutes at 37°C
+
+**Step 12.**  
+**Ligation**  
+Move to RT, add 1 µl T4 DNA ligase  
+Incubate for 1 or more hours at RT (1 hour typically sufficient)
+
+**Step 13.**  
+**Transformation**  
+Thaw competent cells from -80°C on ice  
+Add 4 µl reaction to 33 µl competent cells in a microfuge tube  
+Incubate on ice for 25 minutes  
+Heat shock at 42°C for 1 minute  
+Incubate on ice for 2 minutes  
+Add 180 µl LB or SOC media  
+Shake at 37°C for 1 hour  
+Plate 75 µl on a plate with proper antibiotic
+
+**endofoutput**
+```

markdown-output/assay-for-determination-of-functional-concentratio-cstjwekn.md

@@ -0,0 +1,182 @@
+```markdown
+# Goal/Experiment:
+Assay for determination of functional concentration of Tn5 transposase
+
+## Assay for determination of functional concentration of Tn5 transposase
+**Adrian Mcnairn**  
+*Cornell University*
+
+## Abstract
+Tn5 is used by multiple labs worldwide for its ability to introduce DNA oligos and barcode sequences into libraries and for genomic assays. In many instances, labs produce their own Tn5 enzyme in-house rather than from commercial sources. Our method provides a means of determining the functional concentration of Tn5 in preparations by qPCR to standardize amounts of Tn5 used in assays and identify batch/lot variability. The current standard for assaying in-house produced Tn5 is a plasmid smear. Purified Tn5 is loaded with oligonucleotides and mixed with a plasmid substrate. The plasmid is then run on an agarose gel and checked for smearing, indicating the DNA was cut by the Tn5. The amount of Tn5 is standardized by measuring protein concentration using a protein assay or absorbance at 280nm which provides an approximation based on total protein present, not the functional concentration. This method is modified from Rykalina et al. to evaluate and empirically determine the functional concentration of Tn5 transposomes in homemade enzyme preps by qPCR. 
+
+The principle is based on decreased Cp (or Cq) values correlating with increased fragmentation caused by the transposome. The change in Cp values functions as a measurement of the activity of the Tn5 at that concentration of oligonucleotide (the greater the number of cycles required to produce a product correlates with the increased cleavage of the plasmid substrate by Tn5) as plasmids with transposomes insertions (cleaved regions) will not amplify. The change in Cp values is then plotted against the oligonucleotide concentration in a line graph, and a plateau will appear at the concentration at which the Tn5 is saturated by oligo. The first point in the plateau is the functional concentration.
+
+This method may also be applied to testing the efficiency of changing DNA sequences in oligos used to assemble transposomes as the activity of the transposase is dependent upon the binding sequences contained within the oligo as well as secondary structure formed by the oligo. This property enables testing of oligo variations and barcode efficiencies in our assay. For instance, oligos containing different lengths or different barcodes sequences can be assembled in transposomes and tested in comparison to standard oligos.
+
+## Materials
+
+| Reagent                              | Vendor          | Catalog Number    |
+|-------------------------------------|-----------------|------------------|
+| HEPES, pH 7.2 (1M)                   | FisherScientific| AAJ16924K2       |
+| NaCl (5M)                            | Invitrogen      | AM9760G          |
+| EDTA (0.5M)                          | Invitrogen      | AM9260G          |
+| Triton X-100 (10%)                   | VWR             | 97063-864         |
+| DTT (1M)                             | Krackeler       | 45-43816-50ML    |
+| Glycerol (100%)                      | VWR             | MK509202         |
+| Nuclease-free water                  | Invitrogen      | AM9932           |
+| Tn5 or TDE1                          | homemade or Illumina | 20034197     |
+| SDS (10%)                            | Invitrogen      | 15553027         |
+| pUC19                                | NEB             | N3041S           |
+| EcoRI                                | NEB             | R3101S           |
+| Zymo Research Clean and Concentrate-5| Zymo            | D4014            |
+| LUNA 2x qPCR master mix              | NEB             | M3003S           |
+| Qubit 1X dsDNA HS Assay Kit          | Invitrogen      | Q33231           |
+
+### Equipment:
+- Eppendorf Thermomixer
+- qPCR thermocycler
+- Qubit
+
+### Primers:
+
+**Transposome Primers**
+
+| A                                   | B                                              |
+|-------------------------------------|------------------------------------------------|
+| Tn5ME_Rev                           | /5Phos/CTGTCTCTTATACACATCT                     |
+| Tn5ME-A (Illumina FC-121-1030)      | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG               |
+| Tn5ME-B (Illumina FC-121-1031)      | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG             |
+
+**qPCR Primers**
+
+| A                    | B                                | C               |
+|----------------------|----------------------------------|-----------------|
+| Name                 | Sequence                         | pUC19 location(bp) |
+| 591bp_pUC19_Tn5_F    | GCTCACTCAAAGGCGTAAT              | 748-1319        |
+| 591bp_pUC19_Tn5_R    | CTTCAGCAGAGCGAGATAC              |                 |
+| 602bp_pUC19_Tn5_F    | CTTTCCACAGCGTTTTGGG              | 2396-248        |
+| 602bp_pUC19_Tn5_R    | GCTGCGTAATAGCGAAGAG              |                 |
+| 610bp_pUC19_Tn5_F    | CCTATCTCAGCGATCTGTTATTTC         | 1651-2241       |
+| 610bp_pUC19_Tn5_R    | GCGCGGTATTATCCCGTATT             |                 |
+
+## Transposome preparation and assembly
+
+1. **Prepare ME A/Rev or ME-B/rev oligos by annealing equal concentrations of primers.** Typically target 40uM stocks.  
+  Example: 40uL 100uM Tn5-ME-A + 40uL 100uM Tn5-ME-B + 20uL nuclease-free water or 0.1x TE (can be scaled as needed).  
+  Thermocycler program: 95°C for 2min, slow cool to 25deg at 0.1°C/sec, total time ~22 minutes.  
+  **Duration:** 22 min
+
+2. **Prepare working stocks of annealed oligos by serial dilution (1:1):**  
+   - Concentrations: 1.25uM, 2.5uM, 5uM, 10uM, 20uM, 40uM
+
+3. **Prepare Tn5 transposomes by combining 9uL of the Tn5 to be tested with 1uL annealed oligos**  
+   - Final concentrations: 0.125uM, 0.25uM, 0.5uM, 1uM, 2uM, 4uM
+
+| Oligo Concentration (uM)| 1.25 | 2.5 | 5 | 10 | 20 | 40 |
+|-------------------------|-----|-----|---|----|----|----|
+| Oligo (uL)              | 1   | 1   | 1 | 1  | 1  | 1  |
+| Tn5 (uL)                | 9   | 9   | 9 | 9  | 9  | 9  |
+| Final vol (uL)          | 10  | 10  | 10| 10 | 10 | 10 |
+| Final Conc. (uM)        | 0.125 | 0.25 | 0.5 | 1 | 2 | 4 |
+
+4. **Incubate for 21 hours at 25°C with shaking (600rpm) on Eppendorf Thermomixer**  
+   **Note:** Shorter incubation (1 hour) is possible but longer incubation provides more consistent results.  
+   **Duration:** Overnight 21 h
+
+## Template preparation
+
+1. **Digest pUC19 with EcoRI to generate a linear template:**  
+   a. Column purify the plasmid DNA and adjust concentration to 25ng/uL  
+   b. Digest reaction may be scaled to provide a stock of linearized plasmid for future use  
+   **Duration:** 1 h
+
+## Tagmentation
+
+1. **In duplicate, prepare tagmentation master mix and test each concentration of transposome on 25ng linearized pUC19**  
+   a. Include a no Tn5 control for reference (0uM)  
+   b. For no Tn5 control, increase water to 11.5uL/reaction  
+   c. 10X Tango restriction enzyme buffer (ThermoFisher) or 10X CutSmart buffer (NEB) are used to provide the magnesium Tn5 requires for tagmentation.
+
+| Stock                           | Vol per 25uL rxn (uL) |
+|--------------------------------|-----------------------|
+| 10X Tango RE Buffer             | 2.5                   |
+| Nuclease-free water             | 18                    |
+| DMF                             | 2.5                   |
+| Linearized pUC19 (25ng/uL)      | 1                     |
+| Tn5                             | 1                     |
+
+**Tagmentation Master Mix:**
+
+2X Tagmentation Buffer
+
+| Stock                           | Vol for 10mL | Final Conc. | Supplier                  |
+|--------------------------------|--------------|-------------|--------------------------|
+| 1M Tris-HCl pH7-8              | 200uL        | 20mM        | Invitrogen #AM9850G      |
+| 1M MgCl2                       | 100uL        | 10mM        | Invitrogen #AM5930G      |
+| Nuclease-free water            | 9.7mL        |             | Invitrogen AM9932        |
+
+2. **Incubate at 37°C for 1 hour at 600rpm**
+
+3. **Stop the reaction by adding 1uL of 2% SDS to each reaction (final conc. 0.08%)**  
+   a. 55°C for 7 minutes to remove transposomes  
+   **Duration:** 7 min
+
+4. **Quench SDS by adding 3uL 10% Triton X-100 to reactions**
+
+5. **Final volume should be 29uL**
+
+6. **Qubit or nanodrop DNA for normalization (~0.86ng/uL)**  
+   a. Quantifying the DNA first enables the assay to be more quantitative
+
+## qPCR
+
+1. **Dilute transposed DNA 1:10 in nuclease-free water for qPCR:**  
+   a. Using too much DNA may lead to difficulty in determining Cp and higher data variability  
+   b. Controls: linearized pUC19 without Tn5 and an NTC control
+
+2. **Setup qPCR reactions using primer pairs (recommend running at least 2 pairs):**  
+   a. Pairs 591, 602, and 610 may be run on the same program
+
+3. **Run qPCR using the following settings:**  
+   a. 95°C for 1 min, followed by 35 (minimum) to 45 cycles of 95°C for 15 sec, 60°C for 20 sec, 72°C for 30 sec, then a melt curve  
+   **Note:** Two-step protocols may also be used alternating 95°C for 15 sec, 60°C for 20 sec
+
+4. **Analyze and graph delta Cp versus concentration:**  
+   a. The no Tn5 control provides the reference value as the plasmid should be intact (i.e., Subtract the Geomean of the no Tn5 replicates from the Cp of the test samples).  
+   b. The higher the delta Cp, the more cleavage of the plasmid, indicating higher Tn5 tagmentation activity  
+   c. The concentration at which the graph plateaus or peaks at is the functional concentration of the Tn5 prep
+
+## Data Analysis Example
+
+| Primer pair: 610 |                  |                  |         |
+|------------------|------------------|------------------|---------|
+| Sample           | Cp               | Ave Cp           | delta Cp|
+| 0.5              | 8.89             | 8.78             | 8.88    | 0.74 |
+| 0.5              | 9.12             | 8.81             | 8.97    | 0.83 |
+| 1                | 9.74             | 9.80             | 9.74    | 1.62 |
+| 1                | 9.67             | 9.99             | 9.79    | 1.68 |
+| 2.2              | 11.36            | 11.34            | 11.49   | 3.26 |
+| 2.2              | 11.37            | 11.67            | 11.57   | 3.40 |
+| 3.5              | 12.52            | 12.63            | 12.63   | 4.49 |
+| 3.5              | 12.70            | 12.74            | 12.86   | 4.63 |
+| 5                | 9.83             | 9.94             | 9.92    | 1.76 |
+| 5                | 9.79             | 10.05            | 9.97    | 1.80 |
+| noTn5            | 8.20             | 8.02             | 8.18    | -0.01|
+| noTn5            | 8.25             | 7.97             | 8.21    | 0.00 |
+| NTC              | 24.04            | 23.92            | 23.96   | 15.81|
+| NTC              | 24.27            | 24.25            | 24.26   | 16.12|
+
+Example results from qPCR testing of a Tn5 prep  
+| Primer pair: 610 |                  |                  |          |
+|------------------|------------------|------------------|----------|
+| Conc. (uM)       | ave delta CP     | stdev            |
+| 0.5uM            | 0.79             | 0.06             |
+| 1uM              | 1.65             | 0.04             |
+| 2.2uM            | 3.33             | 0.10             |
+| 3.5uM            | 4.56             | 0.10             |
+| 5uM              | 1.78             | 0.03             |
+
+![Graph](data:image/png;base64,...)
+
+endofoutput
+```

markdown-output/assessing-coastal-risk-and-the-economics-of-climat-miyc4fw.md

@@ -0,0 +1,92 @@
+```markdown
+Goal/Experiment:
+
+The goal of this experiment is to assess coastal flood risk and the economics of climate adaptation. This involves identifying areas at risk, quantifying losses and damages under various scenarios, and comparing potential adaptation solutions using cost-benefit analysis.
+
+# Assessing Coastal Risk and the Economics of Climate Adaptation
+
+**Authors:** Borja G. Reguero, David N. Bresch
+
+**Citation:** Borja G. Reguero, David N. Bresch Assessing Coastal Risk and the Economics of Climate Adaptation. protocols.io dx.doi.org/10.17504/protocols.io.miyc4fw
+
+**Published:** 10 Jan 2018
+
+## Abstract
+
+As climate change progresses, so does the risk from hurricanes, flooding, and other natural disasters. As sea levels rise, tropical cyclones will pose a greater risk of extreme flooding and are likely to inflict the greatest damages on highly populated shorelines. This protocol describes a quantitative risk assessment framework to evaluate the cost-effectiveness of different adaptation measures. These options may include natural solutions (e.g., oyster reef restoration), structural solutions (e.g., seawalls), and policy measures (e.g., home elevation or coastal development policies).
+
+## Guidelines
+
+The protocol is part of the ‘Economics of Climate Adaptation’ framework and is implemented in climada, particularly the ‘coastal module’.
+
+For more information, consult: [www.swissre.com/eca/](http://www.swissre.com/eca/)
+
+## Before Start
+
+Risk occurs at the intersection of economic assets and the hazard of coastal flooding. Adaptation can impact each risk component. There are three parts to assess the cost-effectiveness of adaptation measures:
+
+### 1. Assessing Current Risk
+
+Risk is quantified as a probable loss. The total loss from a natural hazard (e.g., floods) is a combination of three factors:
+
+- **Hazard (or 'peril')**: Defined by the location, frequency, and intensity of events.
+- **Assets exposed**: Defined by the location and value of buildings and assets.
+- **Damages to assets**: The relationship between the extent of damage and event intensity, determined by damage (or vulnerability) curves.
+
+### 2. Assessing Future Risk
+
+Future risk arises from climate and economic changes. Factors include land subsidence, sea level rise, and changes in storm patterns. Coastal exposure changes, due to development intensification, also contribute to future risk.
+
+### 3. Assessing the Economics of Adaptation Measures
+
+The cost and benefits (losses averted) of adaptation measures are assessed by:
+
+1. Defining adaptation strategies.
+2. Estimating the benefits of each measure in protecting a percentage of property.
+3. Calculating the cost of each measure.
+4. Calculating the Net Present Value (NPV) of costs and benefits, calculated as follows:
+   - Calculate both baseline risk (current) and future risk (e.g., 2050).
+   - Discount benefits and costs to present terms.
+5. Calculating the benefit-to-cost ratio.
+
+Cost estimates for each adaptation measure can be derived from the review of past projects or local estimates.
+
+## Protocol
+
+### Assessment of Coastal Flooding
+
+**Step 1.** 
+- Historical and synthetic storms are simulated with climada.
+- Total water levels are calculated based on surges, tides, sea level rise, and wave runup.
+
+**Software Package (Matlab):** [CLIMADA - COASTAL, 1.0](https://github.com/borjagreguero/climada_coastal_hazards_module)
+**Dataset:** [Sea Level Rise NOAA measurements](#)
+
+### Assessment of Coastal Exposure
+
+**Step 2.**
+- In GIS, data on building value is calculated for each ground height.
+- Flood maps are created using a bathtub approach for each ground height.
+
+**Dataset:** [Elevation model](#)
+
+### Calculation of Damages
+
+**Step 3.**
+- Damages are calculated in climada, considering asset distribution for each ground height.
+
+**Software Package (Matlab):** [CLIMADA - COASTAL, 1.0](https://github.com/borjagreguero/climada_coastal_hazards_module)
+
+### Calculation of Cost and Benefits
+
+**Step 4.**
+a) Estimate adaptation strategies for hazard attenuation, location, cost, and protection percentage.
+
+b) Calculate net present value over the period the adaptation measure is designed for.
+
+**Software Package (Matlab):** [CLIMADA - COASTAL, 1.0](https://github.com/borjagreguero/climada_coastal_hazards_module)
+
+---
+
+endofoutput
+```

markdown-output/assessment-of-prepulse-inhibition-ppi-of-the-acous-cr4cv8sw.md

@@ -0,0 +1,103 @@
+```markdown
+# Goal/Experiment:
+**Goal:** Assessment of Prepulse Inhibition (PPI) of the Acoustic Startle Reflex in Rodents
+
+## Assessment of Prepulse Inhibition (PPI) of the Acoustic Startle Reflex in Rodents
+
+**Authors:** Franciele Kich Giongo1, Matheus Gallas-Lopes1, Ana P Herrmann1  
+**Institution:** Universidade Federal do Rio Grande do Sul
+
+1 Universidade Federal do Rio Grande do Sul
+
+### Abstract
+The acoustic startle reflex is an automatic and involuntary response that occurs in humans and other animals when they are exposed to sudden and intense auditory stimuli, such as loud noises. This response can be influenced by several factors, including the intensity and timing of the stimulus, the individual's state of alertness, and contextual factors. It can also be modulated by prior exposure to a weak prepulse shortly before the startling stimulus, a phenomenon known as prepulse inhibition (PPI).
+
+PPI reflects the brain's ability to filter out irrelevant or non-threatening sensory information and is an important indicator of sensorimotor gating. Here we describe a protocol to measure PPI in mice and rats using a startle chamber from Insight® (SP, Brazil).
+
+## Materials
+
+### Software
+| Name                            | OS      | Developer                |
+|---------------------------------|---------|--------------------------|
+| Monitor de Sobressalto para Ratos e Camundongos | Windows | Insight Equipamentos Ltda |
+
+### Equipment
+| Name                     | Brand                  | SKU | Link                                                 |
+|--------------------------|------------------------|-----|------------------------------------------------------|
+| EP-175 Startle Sobressalto | Insight Equipamentos Ltda | N/A | [EP-175 Startle Sobressalto](https://www.insightltda.com.br/produto/ep-175-startle-sobressalto/) |
+
+## Before Start Instructions
+This is a step-by-step guide developed at PsychoLab to set up the software used to assess prepulse inhibition (PPI) of the acoustic startle reflex in mice or rats using the equipment acquired from Insight Equipamentos Ltda.
+
+- Ensure the speakers and ventilation of the apparatus are turned on.
+- Avoid using any light source inside the box.
+- Read the entire protocol before starting.
+
+## Setting up the Protocol
+
+1. **To create a new protocol:** Click on the logo in the upper left corner and select "Edit" and then "Procedure".
+
+2. **To create a new prepulse protocol:** Select "Create a new procedure file starting with a standard PPI block" and name the protocol.
+
+3. **If you already have a saved protocol file:** Select "Open an existent procedure file" and then select the file (e.g., example.sbs).
+
+4. **To calibrate the background noise:**
+    - Place the decibel meter inside the equipment, just above the accelerometer.
+    - Ensure the decibel meter’s battery is charged or new.
+    - Position the decibel meter on the accelerometer and adjust the detection range as necessary (range 30-80 dB for background noise; 80-130 dB for other measurements).
+    - To see the readings of the decibel meter, remove the lid of the equipment and close the door.
+
+5. **Select the speaker:** The button to select the speaker is pointed by the red arrow. Speaker identification will be shown in the box "Confirmação de Ips" for selection.
+
+6. **Adjust the intensity:** Adjust the intensity of the sound manually in the percentage bar and press play. Check the decibel meter to see if the desired range is shown. For other stimuli, repeat the process outlined in step 2.
+
+7. **Note percentages:** Take notes of the percentages shown in each stimulus for easier stimulus calibration.
+
+8. **Configure stimulus settings:** Set the duration of each period in the first line according to your protocol. Each stimulus will have its own configuration regarding background noise, white noise, pure tone, shock, and light.
+
+9. **Save stimulus settings:** Once you have entered the stimulus settings for each block, click the checked box icon below the table, then save.
+
+10. **To create new stimuli blocks:** Click on the "add PPI" icon. Set the desired percentage for pulse and prepulse. Adjust the decibel meter accordingly.
+
+11. **Scale calibration:**
+    - First, remove the decibel meter from the scale.
+    - Click on the option "No, scale calibration presents considerable errors. Repeat scale calibration process now".
+    - Check whether the scale displays the weight of 50g correctly.
+    - Calibrate the scale at the beginning of the tests, if measuring is accurate, no need to recalibrate.
+    - Click on "Yes, current scale calibration is satisfactory. Execute the next step".
+
+12. **Session configuration:** Create stimuli presentation order.
+    - Check the box for habituation with background noise if needed.
+    - Transfer blocks from procedure blocks to execution session.
+    - Transfer blocks in the same order, and randomly as needed.
+    - Fill in the session parameters (habituation period, inter-trial interval, etc.).
+    - Click on "Execute procedure file now".
+
+13. **Adjust scale gain:**
+     - For mice, set scale gain to 1.
+     - For rats up to 200g, set scale gain to 2.
+     - For rats over 200g, set scale gain to 3.
+
+## Running the Protocol
+
+1. **To start the test:** Place the subject in the apparatus, close the lid, and click the play icon. The test will start automatically after selecting where to save the summary results.
+    - If there is a habituation period, a countdown will show.
+    - The session will end and a notification will pop up.
+
+## Retrieving the Data
+
+1. **Full reports:** Click on "Reports" on the main screen to export full reports. Use parameters set in step 8 as filters. Export data in `.xls`, `.doc`, or `.txt`.
+
+## Data Analysis
+
+1. **Reactivity Values:**
+    - Use the `mean value` of each stimulus for pulse and prepulse reactivity.
+
+2. **Prepulse Inhibition Values:**
+    - Use the formula `(pulse alone - prepulse + pulse) / pulse alone * 100` for each combination.
+
+3. **Mean PPI:**
+    - Use the mean value of all %PPI calculated for each combination of stimulus.
+
+endofoutput
+```

markdown-output/assessment-of-tuberculosis-transmission-probabilit-dc622zge.md

@@ -0,0 +1,111 @@
+```markdown
+## Goal/Experiment:
+Assess and compare the probability of tuberculosis transmission in three Thai prisons based on five dynamic models.
+
+## Assessment of Tuberculosis Transmission Probability in Three Thai Prisons Based on Five Dynamic Models
+
+**DOI:** [dx.doi.org/10.17504/protocols.io.6qpvr868zlmk/v1](dx.doi.org/10.17504/protocols.io.6qpvr868zlmk/v1)
+
+**Authors:**
+- Nithinan Mahawan, Thanapoom Rattananupong, Puchong Sri-Uam, Wiroj Jiamjarasrangsi  
+  1Faculty of Medicine, Chulalongkorn University  
+  2Center for Safety, Health and Environment of Chulalongkorn University
+
+**Corresponding Author:**
+- Nithinan Mahawan, Faculty of Medicine, Chulalongkorn University
+
+**Protocol Status:** Working
+
+**Created:** May 05, 2024  
+**Last Modified:** June 25, 2024  
+**Protocol Integer ID:** 99258  
+
+**Keywords:** Probability of tuberculosis transmission, dynamic models, model parameters, prisons
+
+---
+
+## Abstract
+This study aimed to assess and compare the probability of tuberculosis (TB) transmission based on five dynamic models: the Wells–Riley equation, two Rudnick & Milton-proposed models based on air changes per hour (ACH) and liters per second per person (L/s/p), the model proposed by Issarow et al., and the Applied Susceptible-Exposed-Infected-Recovered (SEIR) TB transmission model. The study aimed to determine the impact of model parameters on such probabilities in three Thai prisons. The results revealed that the median (Quartiles 1 and 3) of TB transmission probability among these cells was 0.052 (0.017, 0.180). Compared to the pioneering Wells–Riley model, the remaining models projected a discrepant TB transmission probability from less to more commensurate to the degree of model modification. The ventilation rate and the number of infectious TB patients were the greatest impact factors on the estimated TB transmission probability. All stakeholders must urgently address these influential parameters to reduce TB transmission in prisons.
+
+---
+
+## Materials and Methods
+
+### Materials
+1. **Absolute Ventilation Rate Measurement:**
+   - Using the Kimo HQ210 with SCOH 112 probe (Sauermann Industries, ZA Bernard Mouliend, Montpon, France) for measuring CO₂ concentrations.
+   
+2. **ACH (Air Changes per Hour):**
+   - Classical metric assessing infection control risk; wind speed in cells using a hot wire thermo-anemometer (Model SDL350, Extech Instruments, Waltham, MA).
+
+### Before Start
+1. **Literature Review Goals:**
+    - Incidence and prevalence of TB in prisons globally and in Thailand.
+    - Evidence of prisons as TB reservoirs.
+    - Humanitarian issues and health problems.
+    - Factors affecting TB transmission in prisons.
+    - Comparison of dynamic models of TB transmission.
+    
+2. **Contact Department of Corrections:**
+   - Walkthrough to assess suitability in June 2019.
+
+---
+
+## Research Ethics
+1. Ethical approval from Chulalongkorn University Faculty of Medicine (Ref: 610/63).
+2. Permission from the Department of Corrections, Ministry of Justice needed.
+3. Inform and gain consent from relevant stakeholders, but inmate personal information not required for the study.
+
+---
+
+## Data Collection
+1. Train research team on protocols.
+2. CO₂ collection inside and outside cells using Kimo HQ210; measured by trained inmates and researchers.
+3. Measure wind speeds with thermo-anemometer (Model SDL350).
+4. Collection of infection data by health volunteers.
+5. Survey of cell architecture and characteristics.
+6. Literature review for model parameters.
+
+---
+
+## Statistical Analysis
+1. **Estimation of TB Transmission Probability:**
+   - Calculation based on dynamic models.
+   - Assess agreement using Spearman’s rank correlation.
+   - Bland–Altman analysis for agreement pattern.
+   - Model parameter influence using Wilcoxon rank-sum (Mann-Whitney test) and linear regression.
+   
+2. **Parameters Analysed:** 
+   - Ventilation rates.
+   - Number of infectious inmates.
+
+---
+
+## Results and Conclusion
+1. **Variant Model Projections:**
+   - Different transmission probabilities across models.
+   - Wells–Riley model as reference showed low to high probability variance.
+   
+2. **Risk Factors:**
+   - Key factors: low ventilation rates, high TB inmate numbers.
+   - Models: Similar patterns of TB transmission probability with varying high and low extremes.
+   - Urged addressing ventilation and inmate number issues.
+   
+3. **Recommendations:**
+   - Validation and further studies required for more accurate TB incidence prediction in prison settings.
+
+---
+
+## Protocol References
+1. World Health Organization. Global tuberculosis report 2023. Geneva: WHO; 2023.
+2. United States Agency International Development. Tuberculosis in prisons: a growing public health challenge [Internet]. USAID; 2014 [Cited 2021 August 8].
+3. World Health Organization [Internet]. Tuberculosis: Key facts. [Cited 2021 August 8].
+4. World Prison Brief, Institute for Crime & Justice Policy Research, Birkbeck University of London. 
+5. Walter KS, Martinez L, et al. Lancet. 2021;397(10284):1591-6.
+6. Mabud TS, de Lourdes Delgado Alves M, et al. PLoS Med. 2019;16(1):e1002737.
+... [Additional 30 references] ...
+
+---
+
+endofoutput
+```

markdown-output/aureococcus-anophagefferens-population-count-and-r-cgzftx3n.md

@@ -0,0 +1,93 @@
+```markdown
+# Goal/Experiment:
+To identify and count the population and relative size of the brown tide alga *Aureococcus anophagefferens* using flow cytometry techniques, specifically utilizing the Violet Side Scatter (SSC) channel on a Beckman Coulter CytoFLEX S Flow Cytometer.
+
+# Aureococcus anophagefferens Population Count, and Relative Size (Violet SSC) by Flow Cytometry (CytoFLEX S Flow Cytometer Beckman Coulter)
+
+### Authors
+- Emily E. Chase
+- Alex Truchon
+- Steven W Wilhelm
+
+*[The University of Tennessee, Knoxville](https://www.utk.edu)*
+
+Published Dec 01, 2022
+
+### DOI
+[https://dx.doi.org/10.17504/protocols.io.q26g7yby9gwz/v1](https://dx.doi.org/10.17504/protocols.io.q26g7yby9gwz/v1)
+
+### Keywords
+- cytoflex
+- flow cytometry
+- violet side scatter
+- cell size
+- cell counts
+- Aureococcus anophagefferens
+
+### Abstract
+A method for obtaining relative cell size, population density, etc., of the brown tide algae *Aureococcus anophagefferens* by a Violet Side Scatter (SSC) configuration on a Beckman Coulter CytoFLEX S Flow Cytometry System (CytExpert software).
+
+### License
+This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+---
+
+## Guidelines
+To achieve the intended results of this protocol, a configuration using a violet laser must be set up for a CytoFLEX S Flow Cytometer. This protocol is based on a CytoFLEX with Violet SSC on the violet laser at the 405/10 position. Refer to the "Setting Up Violet Side Scatter (VSSC) Channel" section of the CytoFLEX manual. Visualization of *A. anophagefferens* can be achieved without a violet laser, but it will not be possible to determine relative cell size.
+
+## Materials
+- **CytoFLEX S Flow Cytometer**: A flow cytometry device used to count and analyze particles suspended in a fluid.
+- **CytExpert Software + desktop computer with appropriate specs**: Software used to control the CytoFLEX system and analyze data.
+- **96 well CoStar Assay Plates [REF#3795]**: Plates used for sample preparation and analysis.
+- **1000mL pipette and tips**: For transferring samples.
+  
+  **Note**: Sheath fluid + cleaning fluid + Milli-Q water (or alternative) as required for cytometer maintenance only.
+
+## Before Starting
+Boot up the CytExpert Software and follow the start up protocol. Familiarity with the machine and its settings will permit necessary adjustments for your experiments and help ensure accurate results.
+
+## Protocol
+
+### CytoFLEX Experiment Setup
+
+1. **Create a new experiment with sample acquisition settings as follows:**
+
+    - FSC 200
+    - SSC 40
+    - VioSSC 75
+    - FITC 200
+    - PerCP 150
+    - PB450 1 (placeholder; this could be set for a different dye than Pacific Blue shown here, this will not change the results)
+    - Threshold: (manual) PerCP 5000
+  
+    Set the flow rate to medium (30 µL/minute), the sampling to 60 seconds (not by events), and the display to 100,000 events.
+
+    **Note:** 
+    - Flow rate may need to be adjusted for a high abort percentage (>10%), both adjusting the rate (custom or otherwise) and diluting dense culture samples will solve this problem. Users should aim for a certain number of events per second, typically between 300–2000.
+    - Settings can be adjusted in real time by selecting "run" on samples and changing the acquisition settings.
+
+2. **Optional**: Create a combination of density plots and histograms best suited for your analyses. An example set up is provided in the image below (Figure 2), where **A. anophagefferens** populations are clearly achieved. 
+
+    - It is recommended to set up a histogram with time on the x-axis (final histogram) to account for the machine's measuring consistency as sampling will often start out slower and then stabilize.
+
+    ![Figure 1. Detector configuration setup for the CytoFLEX Flow Cytometer used to establish this protocol.](image_url_1)
+
+3. **Sampling Process**:
+    - 250 µL of each sample to be measured (e.g., *A. anophagefferens* culture) are pipetted into a 96 well CoStar [REF#3795] Assay Plate round bottom plate (can be substituted) and loaded into the CytoFLEX. 
+    - After opening the "Plate" window and clicking "Add Plate", samples can then be labelled.
+
+    **Note:** 
+    - Volumes can be reduced after taking into account the flow rate and sample timing.
+
+4. **Data Acquisition**:
+    - Labelled samples can then be run sequentially using the "Auto Record". 
+    - Upon completion, data can be either exported (most conveniently as a .csv) or reviewed using the "Statistics" window according to all events and events within user defined gated populations.
+    - Population counts are achieved by number of events within the *A. anophagefferens* gates, and subsequent relative size of events (cells) can be achieved through Violet Side Scatter channel results.
+
+    **Note:** 
+    - Relative size by Violet SSC cannot be achieved for every cell type (normally "larger" microalgae cannot), a priori comparisons with other cell size calculation methods (e.g., FlowCam) must be conducted.
+
+![Figure 2. CytoFLEX S Flow Cytometer discovery of Aureococcus anophagefferens cell populations. Lassoed (i.e., gated) populations represent A. anophagefferens classified events.](image_url_2)
+
+endofoutput
+```

markdown-output/automated-bar-seq-library-preparation-and-pooling-dhu936z6.md

@@ -0,0 +1,136 @@
+```markdown
+# Goal/Experiment:
+The goal of this protocol is to prepare and pool barcoded DNA libraries for multiplexed Illumina sequencing using automated steps. This involves several rounds of PCR, cleanup processes, and pooling samples to ensure balanced representation in sequencing.
+
+## Automated Bar-Seq Library Preparation and Pooling V.2
+
+### DOI
+[dx.doi.org/10.17504/protocols.io.3byl49qdjgo5/v2](https://dx.doi.org/10.17504/protocols.io.3byl49qdjgo5/v2)
+
+### Authors
+- David Ross, Nina Alperovich
+
+### Affiliation
+- NIST
+
+### Collaborating Initiative
+- Open Datasets Initiative
+
+### License
+This protocol is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+### Protocol Status
+- Working
+
+### Creation Date
+- May 24, 2024
+
+### Last Modified
+- July 25, 2024
+
+### Protocol Integer ID
+- 104065
+
+---
+
+## Abstract
+
+**Protocol for automated Bar-Seq Library preparation**
+
+This protocol prepares 96 DNA samples, representing 24 samples from 4 different timepoints, for multiplexed Illumina sequencing. The process starts with two rounds of PCR, each followed by a bead-based cleanup. The first round of PCR attaches primers that serve as tags to identify the timepoint and sample. The second round of PCR attaches flow-cell adapters required for Illumina sequencing. Following the PCR and cleanup steps, the protocol outlines procedures for pooling samples together to ensure balanced representation during sequencing. The process includes quantifying the DNA concentration and diluting/ pooling samples from the same timepoint.
+
+#### NOTES:
+- Prepare the magnetic bead suspension before implementing this protocol, following the **Preparation of Sera-mag SpeedBeads protocol**.
+- This protocol should be implemented after the **Automation Protocol for Plasmid DNA Extraction from E. coli protocol**.
+- A fragment analyzer can also be used instead of a gel to determine if the PCR cleanup process was successful.
+
+---
+
+## Materials
+
+### Starting Samples
+- 96 DNA samples resulting from the Automation Protocol for Plasmid DNA Extraction from *E. coli* protocol
+
+### Reagents
+- Nuclease-free water (ThermoFisher Scientific 4387936)
+- 80% Absolute Ethanol (Fisher Bioreagents BP2818500)
+- Elution Buffer (Qiagen 19086)
+- Phusion Flash PCR Mastermix (ThermoFisher Scientific F548L)
+- Multiplexing Primers
+- Universal Illumina Primers
+
+### Labware
+- Three 96-well DeepWell reagent plates (Abgene AB-0765) - one used as a reagent plate and two used as midi plates
+- Two 96-well PCR plates (Bio-Rad HSP9635 or HSP9645)
+- Three PCR plate lids (Agilent 202497-100)
+- 96-well output plate (Eppendorf 30603303)
+
+### Primers
+
+| Primer Name | Description | Sequence |
+|-------------|-------------|----------|
+| BarSeq_1_F1 | forward barSeq PCR 1 primer, with sample multiplex tag: CG | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNGTGATTGGCCTAGACGTGTGATAgactcagtc |
+| BarSeq_1_F2 | forward barSeq PCR 1 primer, with sample multiplex tag: AT | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNTTACTTAGCAGCCTCAGACGTGTGATAgactcagtc |
+| BarSeq_1_F3 | forward barSeq PCR 1 primer, with sample multiplex tag: TC | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNTCTCTAGGCCCTAGACGTGTGATAgactcagtc |
+| BarSeq_1_F4 | forward barSeq PCR 1 primer, with sample multiplex tag: GA | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNCCGATAGGCCTAGACGTGTGATAgactcagtc |
+| BarSeq_1_F5 | forward barSeq PCR 1 primer, with sample multiplex tag: GG | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNGATTGTGGCACTCTTCCAGACGTGTGATAgactcagtc |
+| BarSeq_1_F6 | forward barSeq PCR 1 primer, with sample multiplex tag: CC | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNGGGTAGGACGACTAGACGTGTGATAgactcagtc |
+| BarSeq_1_F7 | forward barSeq PCR 1 primer, with sample multiplex tag: GA | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNGTAGAAGGCACTGAACGACTCTGC |
+| BarSeq_1_F8 | forward barSeq PCR 1 primer, with sample multiplex tag: TC | ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTAGAGGATGACTCGACTCTGAAG |
+| BarSeq_2_F | forward barSeq PCR 2 primer | AATGATACGGCGACCACCGAGATCTACACTC | 
+| BarSeq_2_R | reverse barSeq PCR 2 primer| CAAGCAGAAGACGGCATACGATCTCGTATGCCGTCTTCTGCTTG |
+
+[Table continues similarly for other primers...]
+
+## Methods
+
+### Transfer Plasmid DNA to PCR Plate and Dilute with DI Water
+
+1. Pre-heat the on-deck thermocycler (ODTC) for 1st PCR step.
+2. Remove lids from PCR-Plate 1, Sample-Plate, and Reagent Plate.
+3. Pipette 10 µL nuclease-free water to each well in PCR plate 1.
+   - Mix 6x after dispensing.
+   - Dispense 1 mm above the bottom of the well.
+4. Transfer 35 µL of extracted plasmid DNA to each well of PCR Plate 1.
+   - This step is done 24 times (one sample at a time).
+5. Remove plasmid sample input Sample-Plate.
+
+### Run First PCR -Using Primers to Identify Samples from Each Timepoint
+
+6. Add 28.125 µL Master Mix with reverse primer for the appropriate timepoint and sample to each well of PCR plate 1.
+   - Dispense 0.5 mm below liquid surface, with liquid following On.
+7. Add 28.125 µL Master Mix with forward primer for the appropriate timepoint and sample to each well of PCR plate 1.
+   - Mix 10x after dispensing.
+   - Dispense 0.5 mm below liquid surface, with liquid following On.
+8. Place a PCR plate lid on the PCR plate 1.
+9. Move PCR-Plate 1 to ODTC.
+10. Run the First PCR using the following conditions (101.25 µL volume):
+    - 98°C for 60 s
+    - 3 cycles at:
+      - 98°C for 10 s
+      - 58°C for 20 s
+      - 72°C for 20 s
+    - 72°C for 60 s
+    - 23°C for 10 s
+   
+### First PCR Cleanup Part 1: Bind Template Plasmid DNA to Beads and Keep the Supernatant
+
+11. Pipette 54 µL magnetic bead suspension into each well of Midi Plate 1.
+    - Bead ratio: 0.6x
+12. Move PCR plate 1 from ODTC; take lid off PCR plate 1.
+13. Shake Midi plate 1 for 10 s at 1800 RPM.
+14. Transfer 90 µL of each sample from PCR plate 1 to Midi Plate 1.
+15. Incubate for 7 minutes at room temperature.
+16. Move Midi Plate 1 to the magnet base and wait for 4 minutes.
+17. Remove the supernatant (209.4 µL).
+
+[Continue similarly for all steps]
+
+...
+
+### Protocol References
+
+This protocol is based on a similar protocol described by Tack et al., Mol Syst Biol (2021), [https://doi.org/10.15252/msb.202010179](https://doi.org/10.15252/msb.202010179).
+
+endofoutput
+```

markdown-output/automated-procedure-for-estimation-of-methylation-b3ptqmnn.md

@@ -0,0 +1,124 @@
+```markdown
+# Goal/Experiment:
+This protocol outlines an automated procedure for estimating methylation levels using Methylation-Sensitive High-Resolution Melting (MS-HRM) analysis. The goal is to facilitate the detection and quantification of disease-related DNA methylation changes which can provide clinically relevant information in personalized patient care.
+
+# Automated Procedure for Estimation of Methylation Levels in MS-HRM Analysis
+
+**Authors:**  
+- Sally Samsø Mathiasen  
+- Jan Bińkowski  
+- Tina Kjeldsen  
+- Tomasz K Wojdacz  
+- Lise Lotte Hansen
+
+**Affiliations:**
+- ¹Department of Biomedicine, Aarhus University, Aarhus DK-8000, Denmark
+- ²Independent Clinical Epigenetics Laboratory, Pomeranian Medical University, Szczecin, Poland
+- ³Department of Biomedicine, Aarhus University, Aarhus DK-8000, Denmark
+
+## Abstract
+Testing for disease-related DNA methylation changes provides clinically relevant information in personalized patient care. Methylation-Sensitive High-Resolution Melting (MS-HRM) is a method used for measuring methylation changes and has already been employed in diagnostic settings. This method uses one set of primers that initiate the amplification of both methylated and non-methylated templates. Quantification of methylation levels using MS-HRM is hampered by PCR bias, leading to inaccurate calculations. This protocol utilizes the Area Under the Curve (AUC), a derivative of the HRM curves, and least square approximation (LSA) to improve accuracy. Limitations of the technique have been comprehensively evaluated, leading to a procedure that allows methylation level inference with specific measurement limitations.
+
+## Protocol Citation
+```
+Sally Samsø Mathiasen, Jan Bińkowski, Tina Kjeldsen, Tomasz K Wojdacz, Lise Lotte Hansen. Automated procedure for estimation of methylation levels in MS-HRM analysis. protocols.io. https://protocols.io/view/automated-procedure-for-estimation-of-methylation-b3ptqmn
+```
+
+## License
+This protocol is made available under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/), permitting unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+## Experimental Procedure
+
+### Data Import
+1. **MS-HRM Data Preparation for the Analyses (when using Light Cycler system – other PCR systems may require adjusting the data format):**
+    1.1 Normalize the HRM curves using the Gene Scanning software (we recommend default settings for normalization).  
+    1.2 Generate difference plots for each normalized melting curve with the 100% methylation melting curve as the baseline/reference.  
+    1.3 If data for any samples contain obvious outliers, consider removing them (note the name of the outlier).  
+    1.4 Export the difference plot as a text file (example layout in supplementary materials S8-S11).  
+      
+    > **IMPORTANT:** Calculations using the Methylation Level Calculator (MLC) require layout as described in "Plate set up" section of the MLC template. Modify columns and rows accordingly for other layouts.
+
+### Calculation of Experiment Specific Standard Curve
+
+2. **Methylation Levels Estimation Procedure:**
+    2.1 Open the Methylation Levels Calculator (MLC).  
+    2.2 Open the exported text file from LC480 instrument (e.g., S10-S11 MGMT assay text without outliers).  
+    2.3 Copy all data and paste into the "imported data" sheet starting in cell B3. Ensure names in rows 2 and 3 match.
+    
+    > **IMPORTANT:** Make sure the digital separator in the file exported from LC480 and Excel are the same. Modify the MLC for different sample layouts accordingly.
+
+    2.4 MLC will calculate and display AUC for each control and sample in row 1 of "Imported data" sheet.  
+    2.5 Check if AUC for each replicate in row 1 is within the acceptable range. Replace outliers with 0 if necessary.  
+    > **IMPORTANT:** If MLC does not perform calculations automatically, change Excel settings to Automatic (`Formulas > Calculation options > Automatic`).
+
+    2.6 Go to sheet "0 variable":
+       - Panel 1: AUC for each control replicate is calculated.
+       - Panel 2: Equation 1 calculates theoretical AUC for each methylation level.
+       - Panel 3: Theoretical and obtained AUC values for controls are plotted.
+       
+    2.7 Go to sheet "1 variable":
+       - Panel 1: AUC for each control replicate is calculated.
+       - Panel 2: Equation 2 calculates theoretical AUC with M value set to 1.
+       - Panel 3: Theoretical and obtained AUC values for controls are plotted.
+     
+    2.8 Go to sheet "1 variable after LSA":
+       - Solver Add-in is used.
+       
+    2.9 Go to `Data > Solver > Solve`. Recalculate M value by LSA and recalculate standard curve.
+   
+    2.10 Go to the sheet "2 variables":
+       - Panel 1: AUC for each control replicate is calculated.
+       - Panel 2: Equation 3 calculates theoretical AUC with N value set to 1.
+       - Panel 3: Theoretical and obtained AUC values for controls are plotted.
+     
+    2.11 Go to sheet "2 variables after LSA":
+       - Solver Add-in is used.
+       
+    2.12 Go to `Data > Solver > Solve`. Recalculate M and N values by LSA and recalculate standard curve.
+
+### Estimation of Methylation Level in Unknown Samples
+
+3. **Estimation of Methylation Level in Unknown Samples:**
+    - MLC uses polynomial trend function for calculation.
+
+    3.1 Go to sheet "PTF":
+       - Panel 1: Transform standard curve to describe methylation level as a function of AUC.
+       - Panel 2: Polynomial trend function describes the standard curve.
+    
+    3.2 Go to sheet "USC":
+       - Panel 1.1: Sample name.
+       - Panel 1.2: AUC for each replicate.
+       - Panel 1.3: Methylation level calculated using equation 3 with M and N variables.
+
+### Calculation of Experiment Specific Detection Window
+
+4. **Calculation of Experiment Specific Detection Window:**
+    4.1 Go to sheet "Cut off (CO)":
+        - Panel 1.1-1.2: Calculate AUC for each control replicate.
+        - Panel 1.3-1.4: Calculate standard deviation and mean for each control replicate.
+        - Panel 2: Plot normal distribution for each control.
+  
+    4.2 Go to sheet "Detection window":
+        - Panel 1.1-1.2: Calculate AUC for each control replicate.
+        - Panel 1.3-1.4: Calculate standard deviation and mean for each control replicate.  
+        - Panel 2: Calculate overlap between consecutive controls.  
+        - Panel 3: Fill lower (10%) and upper limits (50%-60%) of detection window in cells P7 and Q7.
+      
+### Calculation of Methylation Levels in the Assay Specific Detection Window
+
+5. **Calculation of Methylation Levels in the Assay Specific Detection Window:**
+    5.1 Go to sheet "2 variables within DW":
+        - Solver Add-in is used. If calculations are not automatic, change Excel settings to Automatic.
+        
+    5.2 Go to `Data > Solver > Solve`. Recalculate M and N values by LSA and standard curve.
+
+    5.3 Go to sheet "PTF within DW":
+       - The same procedure is applied within the detection window.
+    
+    5.4 Go to sheet "USC within DW":
+       - Panel 1.1: Sample name.
+       - Panel 1.2: AUC for each sample replicate.
+       - Panel 1.3: Calculate methylation level with M and N variables within detection window.
+
+endofoutput
+```

markdown-output/behavioural-phenotyping-of-c-elegans-on-uv-killed-b2dhqa36.md

@@ -0,0 +1,196 @@
+```markdown
+# Goal/Experiment:
+Behavioural phenotyping of *C. elegans* on UV-killed *E. coli* mutants
+
+## Introduction
+
+**Saul Moore**
+Imperial College London  
+[DOI: 10.17504/protocols.io.b2dhqa36](https://dx.doi.org/10.17504/protocols.io.b2dhqa36)  
+*Behavioral Genomics*
+
+**Abstract:**
+Protocol for screening candidate behaviour-modifying *E. coli* BW25113 single-gene deletion mutants from the 'Keio Collection', to investigate their effects on *Caenorhabditis elegans* behaviour when killed by ultraviolet (UV) light.
+
+## Materials
+
+- 12 x Whatman Square Well Flat Bottom UNIPLATE, 7701-1651
+- 25 x ThermoFisher Scientific Nunc™ 96-Well Polystyrene Round Bottom Microwell Plates, Non-Treated, [268200](https://www.thermofisher.com/order/catalog/product/268200)
+- 100 x 60mm Petri plates
+- 3 x 90mm Petri plates
+- 3 x 150mm Petri plates
+- 2 x 50mL Erlenmeyer flask
+- 1 x 96-pin replicator
+- 500mL LB broth media
+- 1L NGM agar (for ingredients, see protocol for making NGM agar)
+- 110 x 15mL Falcon tubes
+
+## Preparing NGM Agar and Pouring Plates
+
+1. Prior to screening, prepare the materials needed for screening *C. elegans* on selected *Keio* *E. coli* mutants (9 candidate mutants + wild-type BW control). For a single experiment replicate (10 biological replicates of each mutant, screened in 2 runs with the laboratory's 'Hydra' imaging rig):
+
+- 12 Whatman 96-square-well flat-bottom plates ('imaging plates')
+- 25 Nunc™ 96-round-well round-bottom microwell plates ('culture' plates)
+- 3 x 150mm Petri plates ('nursery' plates)
+- 3 x 90mm Petri plates ('maintenance' plates)
+- 100 x 60mm Petri plates ('uv-killing plates')
+- 110 x 15mL Falcon tubes
+- 2 x 50mL Erlenmeyer flasks
+
+2. Make 1L normal Nematode Growth Media (NGM) agar, following the protocol: [Making normal NGM for imaging plates (Cabreiro Lab)](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+3. Pour 20ml NGM agar into each maintenance plate, and 50ml NGM agar into each nursery plate, following the protocol for plate pouring: [Plate pouring protocol]( https://dx.doi.org/10.17504/protocols.io.6bhhaj6).
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.6bhhaj6) **Keep the remaining agar warm in a water bath set to 65°C, for dispensing into 96-well imaging plates afterwards.**
+
+4. Using the Integra ViaFill, dispense 200μL of NGM agar into each well of the 10 imaging plates, following the protocol: [Dispensing agar into multiwell plates](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+5. Leave the plates on the lab bench (with lids on) until the agar has cooled and solidified (approximately 1 hour, timing depends on humidity).
+
+6. Measure the weight of 3 imaging plates (with lids on) and record average plate weight on day of pouring.
+
+7. Dry the imaging plates under a hood (or drying cabinet) until the plates lose between 3-5% of their original plate weight (with lids on).
+
+8. Store the imaging plates upside-down at 4°C until used for experiments.
+
+## Seeding Petri Plates and Worm Maintenance
+
+9. Inoculate 10ml LB broth media with *E. coli* BW25113 (Keio background wild-type strain, used as negative control and for raising worms, no Kanamycin) in an Erlenmeyer flask for overnight culture following the protocol: [Inoculating a Liquid Bacterial Culture](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+10. Place the inoculation in a shaking incubator at 37°C at 200 rpm and leave to grow overnight.
+
+11. Remove the BW culture from the shaking incubator and place in 4°C fridge until seeding.
+
+12. Remove the plates from storage and the BW culture from the fridge, and leave on the bench for approximately 30 minutes to acclimate to room temperature.
+
+13. Using aseptic technique, seed the maintenance plates each with 400μL of BW25113 culture.
+
+14. Leave under hood until dry (with lids on, timing depends on humidity).
+
+15. Using a platinum pick, gently pick 30 adult N2 Bristol *C. elegans* onto each maintenance plate, and store in an incubator at 20°C (Monday).
+
+16. After 24 hours, remove the adult worms, leaving the eggs behind to hatch into L1 larvae (Tuesday).
+
+17. Inoculate a further 10ml LB broth media with BW25113 bacteria for overnight culture, following the protocol in step #9 and place in a shaking incubator at 37°C, 200 rpm (Wednesday).
+
+18. After 24 hours, remove the culture from the incubator, and the nursery plates from storage, and leave to acclimate on bench top for 30 minutes (Thursday).
+
+19. Seed the nursery plates each with 1mL of fresh BW25113 culture. Leave under hood until dry.
+
+20. Wash the worms off the BW-seeded maintenance plates, into two 15mL Falcon tubes (Friday).
+
+21. Perform an egg prep on worms in the Falcon tubes, following the protocol: [Egg Prep for Bleach Synchronization](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+22. At around noon the next day, wash L1 larvae off the empty plate and re-feed onto the BW-seeded nursery plates using a glass Pasteur pipette. Aim to dispense around 3000 worms per plate. Incubate at 20°C (Saturday).
+
+## Inoculating from Frozen Stocks (96-well)
+
+23. Remove the required stock plates from -80°C containing the selected candidate strains. Gently remove the aluminium film and leave to partially thaw for a minute or so.
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.b2dhqa36) **To avoid damaging the bacterial stocks through repeated freeze-thawing, do not let the wells completely defrost. Just enough to be able to pick up some cells with the replicator.**
+
+24. Inoculate individual vials containing 4mL LB broth and 50μg/mL Kanamycin from the selected wells of the Keio frozen stock plates, following the protocol: [Inoculating a Liquid Bacterial Culture](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+25. Wet some tissue with MilliQ water, wrap the culture plates in the tissue, and incubate overnight at 37°C (no shaking).
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.b2dhqa36) **The tissue provides humidity that aids growth, while the presence of Kanamycin should prevent contamination.**
+
+26. Also inoculate 10mL LB broth media in an Erlenmeyer flask with BW control, and place in a shaking incubator overnight at 37°C, 200 rpm.
+
+27. Using a multi-pipette, fill half of wells (those designated for live bacterial cultures) of 10 x 96-well culture plates with 200μL LB broth (as per the desired plate layout). Fill those wells with 50μg/mL Kanamycin, except for the wells that are reserved for BW control.
+
+28. Remove the overnight cultures from the incubator. Using a sterile pipette tip (or inoculation loop), inoculate the wells of the culture plates with strains from the overnight culture vials designated for live culture. Inoculate the wells without Kanamycin with the BW control.
+
+Optional: Make a template stock plate for -80°C storage (live strain layout only): mix 200μL culture with 15% glycerol in each well.
+
+29. Fill another round of individual 15mL Falcon tubes each with 4mL fresh LB broth, for overnight culture of strains destined for UV-treatment. Add 50μg/mL Kanamycin to all tubes except those reserved for the UV-treated BW control.
+
+30. For strains designated for UV-treatment, inoculate the new Falcon tubes from the previous overnight culture, following the above protocol in step #24.
+
+31. Incubate both the live cultures in 96-well format (no shaking) and the cultures for UV-treatment in vials (shaking) overnight at 37°C.
+
+32. Remove the overnight cultures from the incubator. Again, fill half of the wells of 10 culture plates (designated for live bacteria) with 200μL LB broth. This time do not add Kanamycin. (Thursday).
+
+33. Inoculate the second round of overnight cultures from the first in 96-well format (for live bacteria), using a 96-pin replicator, following the protocol: [Growing overnight bacterial culture in 96WP](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+34. Fill another round of 15mL Falcon tubes with 4mL fresh LB broth for the second round of inoculations of the overnight cultures in vials for UV-treatment (no Kanamycin).
+
+35. Inoculate the new vials from the previous overnight cultures, by following the above protocol for Inoculating a Liquid Bacterial Culture in step #24.
+
+36. Place the 96-well culture plates (no shaking) and the vials (shaking) in an incubator for overnight culture at 37°C.
+
+## UV-Killing Bacteria
+
+37. Clean the CL-1000 Ultraviolet crosslinker machine by wiping down with distilled MilliQ water and 70% ethanol. Turn on the UV light and leave for 5 minutes to decontaminate (Friday).
+
+38. Remove the overnight cultures in vials from the incubator, add 4mL fresh LB broth to each culture vial (total 8mL) and pour into empty 60mm plates for UV-killing (10 replicates for each strain tested; 10 strains = 100 plates).
+
+39. Place the plates inside the machine, and remove their lids.
+
+40. Expose the bacterial cultures to UV light (365nm wavelength) for 10 minutes.
+
+41. Remove the plates from the machine, replace the lids, and leave to stand for 5 minutes.
+
+42. Repeat steps #40 to #42 six more times, to ensure that the bacteria are dead.
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.b2dhqa36) **This process may need to be repeated (in batches of up to 25 plates) due to the maximum capacity of the UV machine.**
+
+43. Transfer the bacterial cultures to separate 15mL Falcon tubes, and top up to 15mL with LB broth.
+
+44. Centrifuge the bacteria for 10 minutes at 4,000 rpm to pellet the bacteria at the bottom of the tubes.
+
+45. Remove the supernatant using a plastic Pasteur pipette, and store at 4°C.
+
+## Seeding Imaging Plates (96-well)
+
+46. Remove the imaging plates from 4°C storage and record the average weight of 3 randomly selected plates (Friday).
+
+47. Ensure that imaging plates have lost approximately 3-5% of their original weight. Place under a hood or drying cabinet until they have.
+
+48. Remove overnight cultures of live Keio strains and the pelleted dead Keio strains from 4°C storage.
+
+49. Re-suspend the bacteria by adding 3mL LB broth and vortexing.
+
+50. Add 200μL of re-suspended dead bacterial culture to the empty wells of the overnight culture plate with live bacteria, to complete the experimental plate layout, with an equal proportion of wells with live bacterial cultures and wells with dead bacterial cultures.
+
+51. Using the Integra ViaFlo, seed 10μL of bacterial culture from the wells of each live overnight culture plate into the corresponding wells of each imaging plate.
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.b2dhqa36) **Ensure correct plate orientation under the Integra ViaFlo, with well A1 in the top left corner.**
+
+52. Place seeded plates under a hood to dry for 20 minutes, then place in an incubator at 25°C (no shaking) for 7 hours 40 minutes (total lawn growth time: 8 hours).
+
+53. After 8 hours, remove the plates from the incubator and store at 4°C.
+
+## COPAS Worm-Sorting and Hydra Tracking (96-well)
+
+54. Prior to tracking, ensure that the imaging cave air conditioning is turned on (and there has not been a power-cut) and also empty the dehumidifier waste water tray (see pre-imaging checklist) (Tuesday).
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.b2dhqa36) **Normal temperature range: 19 - 21°C, Humidity: 35 - 45%**
+
+55. Remove the nursery plates from the incubator. Wash the worms off the plates into two 15ml Falcon tubes using approximately 10mL sterile PBS 'A' buffer.
+
+56. Fill up the tubes to 15ml with PBS 'A' and centrifuge at 1000rpm for 2 minutes.
+
+57. Remove the supernatant using a Pasteur pipette.
+
+58. Repeat steps #57 to #58 four more times to thoroughly rinse off any remaining control BW25113 bacteria.
+
+59. Re-suspend the worms and divide them equally into two 50ml Falcon tubes (for the COPAS), and fill them both up to approximately 40ml with PBS 'A'.
+
+60. Use the COPAS to dispense three Day1 adult worms into each well of the 10 imaging plates, following the protocol: [COPAS wormsorter v.2](https://dx.doi.org/10.17504/protocols.io.b2dhqa36).
+
+61. Leave the plates to dry under a hood for 30 minutes to 1 hour (until dry, timing depends on humidity), then place in incubator at 20°C until tracking (at +4 hours on food).
+
+![Alert](https://dx.doi.org/10.17504/protocols.io.b2dhqa36) **Check that worms are crawling (not swimming) on plates, and lawns appear matt in colour (not wet).**
+
+62. 30 minutes prior to tracking with the Hydra rig (every 20 minutes, 2 runs in total), remove 5 imaging plates from the 20°C incubator and leave to acclimate in the imaging cave.
+
+63. Record worm behaviour on the bacterial food for 15 minutes at the 4-hour timepoint (25 fps, exposure: 25000 msec, blue-light stimulation).
+
+64. After tracking, discard the plates in a biological waste bin.
+
+65. Check tracking checklist to ensure that all videos have been saved correctly:  
+`'/Volumes/behavgenom$/Documentation/Protocols/analysis/tracking-checklist-20210210.docx'`
+
+_endofoutput_
+```

markdown-output/bgiseq-500-wgs-library-construction-ps5dng6.md

@@ -0,0 +1,249 @@
+```markdown
+# Goal/Experiment:
+Construct a Whole Genome Sequencing (WGS) Library using BGI's BGISEQ-500.
+
+# BGISEQ-500 WGS Library Construction
+
+**Authors:** Jie Huang, Xinming Liang, Yuankai Xuan, Chunyv Geng, Yuxiang Li, Haorong Lu, Shoufang Qu, Xianglin Mei, Hongbo Chen, Ting Yu, Nan Sun, Junhua Rao, Jiahao Wang, Wenwei Zhang, Ying Chen, Sha Liao, Hui Jiang, Xin Liu, Zhaopeng Yang, Feng Mu, Shangxian Gao
+
+## Abstract
+BGISEQ-500 is a desktop sequencer developed by BGI. Using DNA nanoball and combinational probe anchor synthesis developed from Complete Genomics™ sequencing technologies, it generates short reads at a large scale. Library construction on the platform includes fragmentation, size selection, end repair and A-tailing, adaptor ligation, PCR amplification, and splint circularization.
+
+## Materials
+- Fresh 80% ethanol by [XILONG SCIENTIFIC](https://www.xilong.cn/)
+- ERAT Buffer by Contributed by users
+- ERAT Enzyme by Contributed by users
+- Adapter Mix by Contributed by users
+- Ligation Buffer by Contributed by users
+- Ligation Enzyme by Contributed by users
+- TE buffer by [Ambion](https://www.thermofisher.com/)
+- PCR Enzyme Mix by Contributed by users
+- Splint Buffer by Contributed by users
+- Digestion Buffer by Contributed by users
+- Digestion Enzyme by Contributed by users
+
+## Protocol
+
+### Overview
+Step 1.
+
+![Flow Chart](images/flow_chart.png)
+
+### DNA Fragmentation
+**Step 2.**
+
+#### 1) Input Genomic DNA Sample
+
+**Genomic DNA Sample Recommendation**
+
+| Nucleic Acid | High-quality genomic DNA |
+|--------------|---------------------------|
+| Molecular Weight | >23k bp |
+| Amount | 1µg |
+| Concentration | ≥12.5ng/µL |
+| Purity | OD260/OD280=1.82.0 |
+
+> High-quality genomic DNA should be free of salt or organics. It could run as an intact band with DNA length >23kb during 1% agarose gel electrophoresis.
+
+#### 2) Fragmentation
+Use the Covaris Focused-ultrasonicator for genomic DNA fragmentation following the instructions of the instrument. Optimization should be performed on DNA prior to the experiment and analyzed with agarose electrophoresis or an Agilent 2100 BioAnalyzer.
+
+**Sequencing with Input Amount Reaction Volume Derived Fragments**
+
+|                        | PE 100 | PE 50  | PE 150 |
+|------------------------|--------|--------|--------|
+| Input Amount           | 1µg    | 1µg    | 1µg    |
+| Reaction Volume        | 80µL   | 80µL   | 80µL   |
+| Derived Fragments      | 100-700 bp (main band≈200-300 bp) | 100-500 bp (main band≈200 bp) | 100-700 bp (main band≈400 bp) |
+
+#### 3) Bead-based Cleanup
+1. Place AMPure XP magnetic beads at room temperature (RT) for 30 min, fully thaw before use.
+2. **PE100:** Pipette 48µL AMPure XP magnetic beads to 80µL shearing product, and mix well by gently pipetting 10 times, incubate for 5 min at room temperature *(PE50: Pipette 40µL AMPure XP magnetic beads to 80µL shearing product, and mix well by gently pipetting 10 times, incubate for 5 min at room temperature. PE150: Pipette 44µL AMPure XP magnetic beads to 80µL shearing product, and mix well by gently pipetting 10 times, incubate for 5 min at room temperature.)”
+3. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, carefully transfer the supernatant to a new non-stick tube with a pipette.
+4. **PE100:** Pipette 16µL AMPure XP magnetic beads to 128µL supernatant, mix well by gently pipetting 10 times, and incubate at room temperature for 5 min. *(PE50: Pipette 40µL AMPure XP magnetic beads to 160µL supernatant, mix well by gently pipetting 10 times, and incubate at room temperature for 5 min. PE150: Pipette 12µL AMPure XP magnetic beads to 124µL supernatant, mix well by gently pipetting 10 times, and incubate at room temperature for 5 min.)*
+5. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, remove and discard the supernatant with a pipette.
+6. Add 500µL of fresh 80% ethanol, while the tube remains on the magnet, then, rotate the tubes in the rack by half turns 4 times to wash the beads then carefully remove and discard the supernatant after 1 min.
+7. Repeat step 6 once, and remove all liquid from the tube without disrupting the beads.
+
+#### 4) Homogenization
+1. Use a double-strand DNA quantification kit such as Qubit® dsDNA HS Assay Kit or Quant-iT™ PicoGreen® dsDNA Assay Kit, and quantify the sample as per the instructions of the quantification kit.
+2. Remove 50ng of sample (calculated based on its concentration) to a new 0.2mL PCR tube, and add NF water to the final volume of 40µL.
+
+### End Repair and Tailing
+**Step 3.**
+
+1. Prepare the mixture as follows in PCR tube (do not vortex enzymes):
+
+    **Components**
+
+    | DNA | Volume |
+    |----------------|--------------|
+    | DNA | 40µL |
+    | ERAT Buffer | 7.1µL |
+    | ERAT Enzyme | 2.9µL |
+    | **Total** | **50µL** |
+
+2. Mix well by gently pipetting (Do not mix by vortexing), concentrate the reaction liquid to tube bottom by brief centrifugation.
+3. Place the PCR tube containing the reaction mixture of the above step in a Thermal Cycler, and initiate the reaction as per the following conditions:
+
+    | Temperature | Time |  |
+    |-------------|------|--|
+    | Heated lid  | On     |  |
+    | 37°C | 30 min |  |
+    | 65°C | 15 min |  |
+    | 4°C | Hold |  |
+
+### Ligate Adapters
+**Step 4.**
+
+1. Add 5µL of Adapter Mix to above PCR tube, and mix well by pipetting. Now 16 Adapter Mix are available, 8 libraries in one lane strategy, every sample with 4 different barcodes.
+2. Prepare the following reaction mixture (Note: Ligation Buffer II is viscous, pipette slowly):
+
+    **Components**
+
+    | | Volume |
+    |-----------------|--|
+    | Ligation Buffer | 23.4µL |
+    | Ligation Enzyme | 1.6 µL |
+    | **Total** | **25µL** |
+
+3. Add 25µL of the above reaction mixture to the reaction solution containing adapters from above step.
+4. Place the tube in a Thermal Cycler, then initiate reaction as per following condition:
+
+    | Temperature | Time |  |
+    |-------------|------|----------------------|
+    | Heated lid  | On     |  |
+    | 23°C | 30 min |  |
+    | 4°C | Hold |  |
+
+5. After ligation, add 20µL TE to the final volume of 100µL, then transfer the entire volume to a non-stick tube containing 50µL of room temperature AMPure beads and mix by slow pipetting 10 times to avoid bubble formation.
+
+### Purify Ligated DNA
+**Step 5.**
+
+1. Incubate at room temperature for 5 min.
+2. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, remove and discard the supernatant with a pipette.
+3. Add 500µL of fresh 80% ethanol, while the tube remains on the magnet, then, rotate the tubes in the rack by half turns 4 times to wash the beads. Carefully remove and discard the supernatant after 1 min.
+4. Repeat step 4 once, remove all liquid from tube without disrupting the beads.
+5. Open the cap of non-stick tube, while the tube remains on the magnet, and dry at room temperature for 3 min.
+6. Remove the non-stick tube from the magnet, add 46µL of TE for DNA elution, mix well by pipetting, and incubate at room temperature for 5 min.
+7. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, transfer all 44µL of supernatant to a new 0.2mL PCR tube ready for PCR in the next step or store at -20°C.
+
+### PCR
+**Step 6.**
+
+1. Prepare the PCR reaction mixture as follows:
+
+    **Components**
+
+    | | Volume |
+    |----------------|----|
+    | DNA | 44µL |
+    | PCR Enzyme Mix | 50µL |
+    | PCR Primer Mix | 6µL |
+    | **Total** | 100µL |
+
+2. Place the above PCR tube in a Thermal Cycler and initiate the reaction as per the following conditions:
+
+    | Temperature | Time | Cycles |
+    |-------------|------|--------|
+    | Heated lid    | On     |          |
+    | 95°C         | 3 min  |          |
+    | 98°C         | 20 sec |          |
+    | 60°C         | 15 sec | 8       |
+    | 72°C         | 30 sec |          |
+    | 72°C         | 10 min |          |
+    | 4°C          | Hold   |          |
+
+### Purify PCR Product
+**Step 7.**
+
+1. Place AMPure XP magnetic beads at room temperature 30 min in advance, mix well by vortexing before use.
+2. Add 100µL of AMPure XP magnetic beads to 100µL of PCR product, mix well by gently pipetting 10 times, and incubate at room temperature for 5 min.
+3. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, remove and discard the supernatant with a pipette.
+4. Add 500µL of fresh 80% ethanol, while the tube remains on the magnet, then rotate the tubes in the rack by half-turns 4 times to wash the beads. Carefully remove and discard the supernatant after 1 min.
+5. Repeat step 4 once, try to suck up all liquid from the tube's bottom.
+6. Open the cap of the non-stick tube, while the tube remains on the magnet, and dry at room temperature for 3 min.
+7. Remove the non-stick tube from the magnet, add 32µL of TE water for DNA elution, mix well by pipetting, and incubate at room temperature for 5 min.
+8. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, transfer the supernatant to a new non-stick tube. Proceed to the next step of the reaction or store at -20°C.
+
+### Homogenization
+**Step 8.**
+
+1. Use double strrand DNA quantification kit such as Qubit® dsDNA HS Assay Kit or Quant-iT™ PicoGreen® dsDNA Assay Kit, and quantify the sample as per the instructions of the quantification kit.
+2. It is recommended to mix samples of different Barcodes here.
+3. Add mixed sample (calculated based on its concentration) to a PCR tube, and add NF water to the final volume of 48µL.
+
+### Circularization
+**Step 9.**
+
+1. Denature the homogenized PCR product on a Thermal Cycler at 95°C for 3 min, then immediately transfer to an ice bath.
+2. Prepare reaction mixture on ice as per the following system:
+
+    **Components**
+
+    | | Volume |
+    |-----------------|--|
+    | Splint Buffer     | 11.6µL |
+    | Ligation Enzyme | 0.2 µL |
+    | **Total** | 11.8µL |
+
+3. Add 11.8µL of the above reaction mixture to 48µL of denatured DNA.
+4. Place the above PCR tube in a Thermal Cycler and initiate the reaction as per the following conditions:
+
+    | Temperature | Time |  |
+    |-------------|------|--|
+    | Heated lid  | On   |  |
+    | 37°C        | 30 min |  |
+    | 4°C         | Hold |  |
+
+### Digestion
+**Step 10.**
+
+1. Prepare digestion reaction solution on ice as per the following system:
+
+    **Components**
+
+    | | Volume |
+    |----------------|----|
+    | Digestion Buffer | 1.4µL |
+    | Digestion Enzyme | 2.6 µL |
+    | **Total** | 4µL |
+
+2. After the circularization reaction is finished, directly add 4µL of digestion reaction solution into the circularized DNA solution, mix well and briefly centrifuge, then place the PCR tube in a Thermal Cycler, and initiate the reaction as per the following conditions:
+
+    | Temperature | Time |  |
+    |-------------|------|--|
+    | Heated lid  | on  |  |
+    | 37°C        | 30 min |  |
+    | 4°C         | Hold |  |
+
+3. Add 7.5µL of Digestion Stop Buffer to each reaction, mix well to terminate the reaction.
+4. Transfer all the reaction solution to a new non-stick tube, ready for purification.
+
+### Purify Digestion Product
+**Step 11.**
+
+1. Place AMPure XP magnetic beads and place at room temperature for 30 min in advance. Mix well by vortexing before use.
+2. Pipette 168µL AMPure XP magnetic beads to the digestion product, mix well by pipetting 10 times, and incubate at room temperature for 10 min.
+3. After transient centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, remove and discard the supernatant with a pipette.
+4. Add 500µL of fresh 80% ethanol, while the tube remains on the magnet, then, rotate the tubes in the rack by half turns 4 times to wash the beads. Carefully remove and discard the supernatant after 1 min.
+5. Repeat step 4 once, and try to suck up all liquid from the tube bottom.
+6. Open the cap of a non-stick tube, while the tube remains on the magnet, and dry at room temperature for 3 min.
+7. Remove the non-stick tube from the magnet, add 32µL of TE for DNA elution, mix well by pipetting and incubate at room temperature for 10 min.
+8. After brief centrifugation, place the non-stick tube on the magnet for 2 min until the liquid clears, transfer the supernatant to a new non-stick tube. Store at -20°C, ready for preparing DNB.
+
+## Reagents and Their Functions:
+- **ERAT Buffer**: Used for end repair and A-tailing of fragmented DNA.
+- **ERAT Enzyme**: Enzyme used along with ERAT buffer for end repair and A-tailing.
+- **Adapter Mix**: Mix of different adapters used for ligation.
+- **Ligation Buffer/Enzyme**: Reagents used for ligating the adapters to the DNA fragments.
+- **TE Buffer**: Tris-EDTA buffer used for elution and storage of DNA.
+- **PCR Enzyme Mix**: Enzymes for PCR amplification of the ligated DNA.
+- **Splint Buffer and Digestion Buffer/Enzyme**: Reagents used for the circularization and digestion steps to create DNA nanoballs.
+- **AMPure XP Beads**: Magnetic beads used for purification steps.
+
+---
+
+**endofoutput**
+``'

markdown-output/big-redesign-protocol-version-2-chddt226.md

@@ -0,0 +1,236 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to provide a comprehensively structured and detailed big redesign protocol.
+
+# Big Redesign Protocol Version-2 V.1
+*Authors: Maria Gul¹, Katarina¹* \
+*Affiliation: 1qa* \
+*Version 1, Published on Oct 04, 2022*
+
+--- 
+
+## Disclaimer
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis.
+```
+
+## Abstract
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis.
+
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis. Etiam quis quam. Aliquam ornare wisi eu metus. Curabitur bibendum justo non orci. Pellentesque sapien. Nullam at arcu a est sollicitudin euismod. Phasellus rhoncus. Maecenas libero. Praesent vitae arcu tempor neque lacinia pretium. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Phasellus faucibus molestie nisl. Vivamus ac leo pretium faucibus.
+
+Etiam neque. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nulla est. Etiam ligula pede, sagittis quis, interdum ultricies, scelerisque eu. Nulla quis diam. Curabitur ligula sapien, pulvinar a vestibulum quis, facilisis vel sapien. Sed convallis magna eu sem. Nulla accumsan, elit sit amet varius semper, nulla mauris mollis quam, tempor suscipit diam nulla vel leo. Etiam ligula pede, sagittis quis, interdum ultricies, scelerisque eu. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Vestibulum erat nulla, ullamcorper nec, rutrum non, nonummy ac, erat. Aenean vel massa quis mauris vehicula lacinia. Maecenas sollicitudin. Integer vulputate sem a nibh rutrum consequat. Etiam bibendum elit eget erat. Etiam neque. Aliquam erat volutpat. Aliquam erat volutpat.
+```
+
+## Attachments
+[sample2.pdf](sample2.pdf)
+
+## External Link
+[Google](https://www.google.com/)
+
+## Protocol Citation
+```
+Maria Gul, Katarina 2022. big redesign protocol Version-2. protocols.io 
+https://protocols.io/view/big-redesign-protocol-version-2-chddt226 
+Version created by Maria Gul
+```
+
+## Funders Acknowledgement
+```
+name \
+Grant ID
+```
+
+## Manuscript Citation
+```
+manuscript citation test - edited
+```
+
+## Keywords
+```
+qa, test, protocol, redesign
+```
+
+## License
+```
+This is an open access protocol distributed under the terms of the Creative Commons Attribution License [https://creativecommons.org/licenses/by/4.0/](https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+```
+
+## Image Attribution
+```
+image attribution test
+```
+
+## Created
+```
+Oct 04, 2022
+```
+
+## Last Modified
+```
+Oct 04, 2022
+```
+
+## Protocol Integer ID
+```
+70789
+```
+
+## Guidelines
+
+### Guidelines
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum.
+```
+
+### Formula
+```
+ωUp = VE / R tg(ϕ) + U sin(ϕ)
+```
+
+## Materials Text
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis. Etiam quis quam. Aliquam ornare wisi eu metus. Curabitur bibendum justo non orci. Pellentesque sapien. Nullam at arcu a est sollicitudin euismod. Phasellus rhoncus. Maecenas libero. Praesent vitae arcu tempor neque lacinia pretium. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur? Phasellus faucibus molestie nisl. Vivamus ac leo pretium faucibus.
+```
+
+- ⧫ **Vitamin K 3 P212121**
+
+## Safety Warnings
+### Safety Warnings
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis. Etiam quis quam. Aliquam ornare wisi eu metus. Curabitur bibendum justo non orci. Pellentesque sapien. Nullam at arcu a est sollicitudin euismod. Phasellus rhoncus. Maecenas libero. Praesent vitae arcu tempor neque lacinia pretium. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Phasellus faucibus molestie nisl. Vivamus ac leo pretium faucibus.
+```
+
+## Disclaimer
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis.
+```
+
+## Before Starting
+### Before start
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis.
+```
+
+### Section 1
+1. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue.
+
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur? In convallis. Etiam quis quam. Aliquam ornare wisi eu metus.
+```
+
+![figure](figure.jpg)
+
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur. In convallis.
+```
+
+![figure](figure.jpg)
+
+- ⧫ **Vitamin K 3 P212121** \
+Nullam at arcu a est sollicitudin euismod. Phasellus rhoncus. Maecenas libero. Praesent vitae arcu tempor neque lacinia pretium. Duis aute irure dolor in reprehenderit in voluptate velit essa cillum dolore eu fugiat nulla pariatur. Phasellus faucibus molestie nisl. Vivamus ac leo pretium faucibus.
+
+## Section 2
+2. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur. In convallis.
+
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor.
+```
+
+- ⧫ **Riboflavin (Vitamin B2) P212121** \
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. 
+
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue.
+```
+
+## Section 3
+3. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices.
+
+- ![clock](clock.jpg) ⏰ 00:10:23.
+- Nullam at arcu a est sollicitudin euismod. 
+
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices.
+```
+
+### Task
+- ⏰ 00:00:23
+- ⧫ 125 Aliquam ornare wisi eu metus. Curabitur bibendum justo non orci.
+
+## Section 4
+4. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum.
+
+### Citation
+```
+mar gul (2022). test citation. test citation journal. 
+http://dx.doi.org/10.17504/protocols.io.ewovn1n7qkqr2/v1
+```
+
+⏩
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum.
+```
+
+![check](check.jpg)
+
+## Section 5
+5. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices.
+
+### Required Row
+```
+| **required row** |
+| ---------------- |
+| Test test test   |
+| Test test        |
+| Test test test   |
+```
+
+### Unrequired Row
+
+```
+| **unrequired row** |
+| ---------------- |
+| Test test test   |
+| Test test        |
+| Test test test   |
+```
+
+## Section 5.1
+- ⏰ 10 rpm, 30°C, 00:01:23
+
+```
+Aliquam ornare wisi eu metus. Curabitur 👁️ bibendum justo non orci. Pellenst.
+```
+
+- ⏰ 12 rpm, 24°C, 00:14:35 shaker
+
+## Section 5.2
+![🔖](🔖.jpg)
+
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. \
+Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor.
+
+- Sample: [Sample1.pdf ⧫](Sample1.pdf)
+
+## Section 6
+
+```
+Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer in sapien. Praesent id justo in neque elementum ultrices. Cras elementum. Sed ac dolor sit amet purus malesuada congue. Nunc auctor. Quis autem vel eum iure reprehenderit qui in ea voluptate velit esse quam nihil molestiae consequatur, vel illum qui dolorem eum fugiat quo voluptas nulla pariatur. In convallis.
+```
+
+## Formula 
+```
+\[ ωUp = \frac{\ VE \ }{ \ R tg(\ \varphi \ )} + U sin(\ \varphi ) \]
+```
+
+## Miscellaneous 
+
+```
+Test Test Test
+Test Test 01, Test 02, Test 03
+```
+
+endofoutput
+```

markdown-output/biochemical-analysis-of-quail-blood-s7yehpw.md

@@ -0,0 +1,158 @@
+```markdown
+# Goal/Experiment:
+Biochemical analysis of quail blood.
+
+## Biochemical analysis of quail blood
+
+**Authors:**
+Gamal Mehaisen, Ahmed O. Abass
+
+**Citation:**
+Gamal Mehaisen, Ahmed O. Abass Biochemical analysis of quail blood. protocols.io dx.doi.org/10.17504/protocols.io.s7yehpw
+
+**Published:**
+03 Sep 2018
+
+---
+
+## Protocol
+
+### Sample preparation:
+
+#### Step 1.
+
+1. Blood samples were collected into heparinized tubes.
+2. Samples were centrifuged at 2000 xg for 10 min at 4º C.
+3. The plasma was separated and stored at -20 ºC until analyzed.
+
+### Lipid peroxidation (Colorimetric MDA Assay Kit, ab118970, Abcam, UK):
+
+#### Step 2.
+
+1. Add 600 µL of Thiobarbituric Acid (TBA) solution to 200 µL standard and 200 µL test samples.
+2. Incubate TBA-standard/TBA-sample mixture at 95 °C for 60 minutes.
+3. Cool to room temperature in an ice bath for 10 minutes.
+4. Pipette 200 µL from each 800 µL TBA-standard and TBA-sample reaction mixture into a 96 well microplate.
+5. Measure plate immediately at OD532 nm for colorimetric assay.
+
+### Alanine aminotransferase (Colorimetric ALT Assay Kit, Ref-264, Spectrum Diagnostics, Egypt):
+
+#### Step 3.
+
+1. Add 0.5 mL of R1 (100 mmol Phosphate buffer, 200 mmol DL-Alanine, 6 mmol 2-Oxoglutarate, and 12 mmol Sodium Azide) to 100 µL of distilled water or test samples.
+2. Mix and incubate for exactly 30 minutes at 37 °C.
+3. Add 0.5 mL of R2 (2,4-dinitrophenyl hydrazine) to all tubes.
+4. Mix and incubate for exactly 20 minutes at 20-25 °C.
+5. Mix with 0.5 mL of sodium hydroxide (0.4 mol/L).
+6. Measure absorbance of samples against reagent blank at 546 nm after 5 minutes.
+7. The sensitivity of this assay is 4 U/L and the analytical range is 4-94 U/L.
+
+### Aspartate aminotransferase (Colorimetric AST Assay Kit, Ref-260, Spectrum Diagnostics, Egypt):
+
+#### Step 4.
+
+1. Add 0.5 mL of R1 (100 mmol Phosphate buffer, 100 mmol L-aspartate, 5 mmol 2-Oxoglutarate, 140 mmol sodium hydroxide, and 12 mmol Sodium Azide) to 100 µL of distilled water or test samples.
+2. Mix and incubate for exactly 30 minutes at 37 °C.
+3. Add 0.5 mL of R2 (2 mmol 2,4-dinitrophenyl-hydrazine and 8.4 % HCl) to all tubes.
+4. Mix and incubate for exactly 20 minutes at 20-25 °C.
+5. Mix with 0.5 mL of sodium hydroxide (0.4 mol/L).
+6. Measure absorbance of samples against reagent blank at 546 nm after 5 minutes.
+7. The sensitivity of this assay is 7 U/L and the analytical range is 7-89 U/L.
+
+### Triglycerides (GPO-PAP-enzymatic colorimetric Assay Kit, Ref-314, Spectrum Diagnostics, Egypt):
+
+#### Step 5.
+
+1. Add 1.0 mL of prepared Reagent to 10 µL of standard triglyceride (200 mg/dl) or test samples.
+2. Mix and incubate for 5 minutes at 37 °C.
+3. Measure absorbance of samples (Asp) and standard (Asd) against reagent blank at 546 nm within 30 minutes.
+4. Triglycerides conc. (mg/dL) is calculated as (Asp/Asd) x 200.
+
+### Cholesterol (CHOD-PAP-enzymatic colorimetric Assay Kit, Ref-230, Spectrum Diagnostics, Egypt):
+
+#### Step 6.
+
+1. Add 1.0 mL of prepared Reagent to 10 µL of standard cholesterol (200 mg/dl) or test samples.
+2. Mix and incubate for 5 minutes at 37 °C.
+3. Measure absorbance of samples (Asp) and standard (Asd) against reagent blank at 546 nm within 30 minutes.
+4. Cholesterol conc. (mg/dL) is calculated as (Asp/Asd) x 200.
+
+### Calcium (O-CPC colorimetric Assay Kit, Ref-226, Spectrum Diagnostics, Egypt):
+
+#### Step 7.
+
+1. Mix 0.5 mL of R1 (0.3 mol 2-Amino-2-methyl-1-propanol, pH 10.5) and 0.5 mL of R2 (0.16 mmol O-cresolphthalein complexone, 7 mmol 8-hydroxyquinoline).
+2. Add the mixture to 10 µL of standard calcium (10 mg/dl) or to 10 µL of test samples.
+3. Incubate for 5 minutes at 20-25 °C.
+4. Measure absorbance of samples (Asp) and standard (Asd) against reagent blank at 578 nm.
+5. Calcium conc. (mg/dL) is calculated as (Asp/Asd) x 10.
+
+### Phosphorus (UV colorimetric Assay Kit, Ref-294, Spectrum Diagnostics, Egypt):
+
+#### Step 8.
+
+1. Add 1.0 mL of Reagent (3.5 mmol ammonium molybdate, 750 mmol sulphuric acid, and 1% Surfactants) to 10 µL of either blank reagent (distilled water), standard reagent (5 mg/dl phosphorus) or test samples.
+2. Mix and wait for 5 minutes at 37 °C.
+3. Measure absorbance of samples (Asp) and standard (Asd) against reagent blank at 340 nm within 30 minutes.
+4. Phosphorus conc. (mg/dL) is calculated as (Asp/Asd) x 5.
+
+### Total protein (Biuret colorimetric Assay Kit, Ref-310, Spectrum Diagnostics, Egypt):
+
+#### Step 9.
+
+1. Add 1.0 mL of Reagent (750 mmol sodium hydroxide, 12 mmol copper sulphate, 40.9 mmol sodium potassium tartrate, and 19.8 mmol potassium iodide) to 20 µL of either standard total protein (6 mg/dL) or test samples.
+2. Mix and incubate for 10 minutes at room temperature.
+3. Measure absorbance of samples (Asp) and standard (Asd) against reagent blank at 546 nm within 30 minutes.
+4. Protein conc. (mg/dL) is calculated as (Asp/Asd) x 6.
+
+### Albumin (BCG colorimetric Assay Kit, Ref-211, Spectrum Diagnostics, Egypt):
+
+#### Step 10.
+
+1. Add 1.0 mL of Reagent (100 mmol acetate buffer, 0.27 mmol Bromocresol green, and detergent) to 10 µL of either standard albumin (4 g/dL) or test samples.
+2. Mix and incubate for approximately 5 minutes at 20-25 °C.
+3. Measure absorbance of samples (Asp) and standard (Asd) against reagent blank at 623 nm within 60 minutes.
+4. Protein conc. (mg/dL) is calculated as (Asp/Asd) x 4.
+
+### Corticosterone (Chicken CORT ELISA Kit, MBS701668, MyBioSource Inc., USA):
+
+#### Step 11.
+
+1. Add 50 µL of standard and sample per well.
+2. Add 50 µL Antibody to each well immediately.
+3. Mix well with the pipette for 30 seconds and cover with the adhesive strip provided.
+4. Incubate for 30 minutes at 25 °C.
+5. Aspirate each well and wash with Wash Buffer (250µl) using a multi-channel pipette.
+6. Repeat the process three times for a total of four washes.
+7. After the last wash, remove any remaining Wash Buffer and blot the plate inversely against clean paper towels.
+8. Add 100 µL HRP-conjugate to each well immediately and cover with the adhesive strip provided.
+9. Incubate for 30 minutes at 25°C.
+10. Repeat the aspiration/wash process for four times as in step 5.
+11. Add 100 µL of TMB Substrate to each well.
+12. Incubate for 15 minutes at 25°C, protecting from light.
+13. Add 50 µL of Stop Solution to each well and gently tap the plate to ensure thorough mixing.
+14. Determine the optical density of each well within 5 minutes, using a microplate reader set to 450 nm, 540 nm or 570 nm.
+15. Subtract readings at 540 nm or 570 nm from the readings at 450 nm.
+
+### Tumor necrosis factor alpha (Chicken TNF-α ELISA Kit, MBS701522, MyBioSource Inc., USA):
+
+#### Step 12.
+
+1. Set a Blank well without any solution.
+2. Add 50 µL of standard and sample per well.
+3. Add 50 µL HRP-conjugate (1x) to each standard/sample wells immediately.
+4. Mix well with the pipette for 60 seconds and cover with the adhesive strip provided.
+5. Incubate for 40 minutes at 37 °C.
+6. Aspirate each well and wash with Wash Buffer (250µl) using a multi-channel pipette.
+7. Repeat the process three times for a total of four washes.
+8. After the last wash, remove any remaining Wash Buffer and blot the plate inversely against clean paper towels.
+9. Add 90 µL of TMB Substrate to each well.
+10. Incubate for 20 minutes at 37 °C, protecting from light.
+11. Add 50 µL of Stop Solution to each well and gently tap the plate to ensure thorough mixing.
+12. Determine the optical density of each well within 5 minutes, using a microplate reader set to 450 nm, 540 nm or 570 nm.
+13. Subtract readings at 540 nm or 570 nm from the readings at 450 nm.
+
+---
+
+endofoutput
+```

markdown-output/bisulfite-pyrosequencing-protocol-for-human-sperm-n52dg8e.md

@@ -0,0 +1,180 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to isolate human sperm DNA, treating it with bisulfite, and performing pyrosequencing to analyze the methylation status of specific DNA regions.
+
+# Bisulfite Pyrosequencing Protocol for Human Sperm DNA
+**Version 2**
+
+**Zhaoxu Lu, Mei Qiang**
+
+**Published: 30 Mar 2018**
+
+## Abstract
+Citation: Zhaoxu Lu, Mei Qiang Bisulfite pyrosequencing protocol for Human sperm DNA. protocols.io dx.doi.org/10.17504/protocols.io.ns2dg8e
+
+## Protocol
+
+### Human Sperm DNA Isolation Procedure
+
+#### Step 1
+**Extraction buffer of sperm DNA**
+
+1. 21.2 ml 6mol/L guanidine thiocyanate
+2. 600 µl 5mol/L NaCl
+3. 1 ml 30% N-lauroylsarcosine sodium salt
+4. 3 ml 1mol/l dithiothreitol (DTT)
+5. 600 µl 10mg/ml proteinase K
+6. 3.6 ml Doubly deionized water
+
+#### Step 2
+Add 150 µl of semen to a 1.5 ml micro-centrifuge tube.
+
+#### Step 3
+Wash with 1 ml of PBS (0.1 mol/L).
+
+#### Step 4
+Centrifuge at 1500 ×g for 10 min at 4°C.
+
+#### Step 5
+Repeat washing 2 times as described in step 3-4.
+
+#### Step 6
+Add 0.5 ml extraction buffer into sperm pellet.
+
+#### Step 7
+Place in a 65°C water bath for 12 hours.
+
+#### Step 8
+Cool at room temperature.
+
+#### Step 9
+Add 10 µl of RNase A (10 mg/ml), mix by pulse-vortexing for 15 seconds, and incubate for 10 min at room temperature.
+
+#### Step 10
+Briefly centrifuge the tube.
+
+#### Step 11
+Add 510 µl of isopropanol and centrifuge at 10000 ×g for 10 min at 4°C.
+
+#### Step 12
+Add 800 µl of ethanol (75%), and reverse mix for multiple times.
+
+#### Step 13
+Incubate for 12 hours at -20°C.
+
+#### Step 14
+Centrifuge at 10000 ×g for 10 min at 4°C. Then dry sample at room temperature.
+
+#### Step 15
+Sperm DNA is dissolved in 50 µl of Elution Buffer.
+
+#### Step 16
+Incubate in a 65°C water bath for 2 hours.
+
+### Procedure for Bisulfite Treatment
+
+#### Step 17
+Add 130 µl of the CT Conversion Reagent solution to 1000 ng of your DNA sample in a PCR tube.
+
+#### Step 18
+Place the sample tube in a thermal cycler and perform the following steps:
+- 98°C for 10 minutes
+- 64°C for 2.5 hours
+- 4°C
+
+#### Step 19
+Add 600 µl of M-Binding Buffer into a Zymo-Spin IC™ Column and place the column into a provided Collection Tube.
+
+#### Step 20
+Load sample (from Step 2) into the Zymo-Spin IC™ Column containing the M-Binding Buffer. Close the cap and mix by inverting the column several times.
+
+#### Step 21
+Centrifuge at full speed (>10,000 ×g) for 30 seconds. Discard the flow-through.
+
+#### Step 22
+Add 100 µl of M-Wash Buffer to the column. Spin at full speed for 30 seconds.
+
+#### Step 23
+Add 200 µl of M-Desulphonation Buffer to the column and let stand at room temperature (20°C-30°C) for 15-20 minutes. After the incubation, spin at full speed for 30 seconds.
+
+#### Step 24
+Add 200 µl of M-Wash Buffer to the column. Spin at full speed for 30 seconds. Add another 200 µl of M-Wash Buffer and spin at top speed for 30 seconds.
+
+#### Step 25
+Add 8 µl of M-Elution Buffer directly to the column matrix. Place the column into a 1.5 ml tube. Spin briefly at full speed to elute the DNA. Add 7 µl of M-Elution Buffer and additional repeated 1-time eluting was subsequently performed.
+
+#### Step 26
+The DNA is ready for immediate analysis or can be stored at or below -20°C for later use.
+
+### PCR Amplification of Bisulfite-Treated Sperm DNAs
+
+#### Step 27
+All reactions are performed with provided PCR mixtures (total volume at 25 µl) provided in Table 1. Each reaction also contains 2.5 µl of CoralLoad Concentrate (10x) for checking amplicons on an agarose gel.
+
+| Components | Volume (µl) | Final concentration |
+|------------|-------------|---------------------|
+| PyroMark PCR Master Mix, 2x | 12.5 | 1x |
+| CoraLoad Concentrate, 10x | 2.5 | 1x |
+| Q-solution, 5x | 5 | 1x |
+| Primer forward (10 uM) | 0.5 | 0.2uM |
+| Primer reverse (10 uM) | 0.5 | 0.2uM |
+| Template DNA | 50ng | |
+| Final volume | 25 | |
+
+#### Step 28
+PCR and pyrosequencing primers are designed and listed in Table 2. Reverse primer is conjugated to biotin.
+
+| Primer | Sequence |
+|--------|----------|
+| DMR Forward primer | * |
+| Reverse primer | * |
+| Sequencing primer H19 | GTATATGGGTATTTTTTGAGGTT |
+| H19 | ATAATCCGTATTCCAAAATA |
+| Sequence primer | * |
+| DMR-PCR product | * |
+| Sequence primer | * |
+| H19 | * |
+| Sequencing primer H19 | * |
+| H19 | * |
+
+#### Step 29
+The PCR conditions are as following:
+- 94 °C for 15 minutes
+- 45 cycles of:
+  - 94 °C, 30 secs
+  - 56 °C, 30 secs
+  - 72 °C, 30 secs
+- Final extension step:
+  - 72 °C for 10 minutes
+
+### Pyrosequencing
+
+#### Step 30
+Add 40 µl of Binding Buffer, 3 µl of streptavidin-sepharose beads, and 17 µl DDW into 20 µl of PCR products.
+
+#### Step 31
+Seal film and shake at 1400 rpm for 10 min to room temperature.
+
+#### Step 32
+PCR products on streptavidin-sepharose beads are washed with ethanol (10%) for 5 seconds.
+
+#### Step 33
+Place sample (from Step 31) into denaturation solution for 5 seconds.
+
+#### Step 34
+Place sample (from Step 31) into Wash Buffer for 10 seconds for getting purified biotinylated single stranded PCR products. These single stranded PCR products are isolated using the Pyrosequencing Work Station.
+
+#### Step 35
+Transfer purified biotinylated single stranded PCR products into PSQ 96 Plate Low with 40 µl annealing buffer and 1.6 µl sequencing primer (10µmol/L).
+
+#### Step 36
+Heat PSQ 96 Plate Low at 80 °C for 2 minutes.
+
+#### Step 37
+Undergo pyrosequencing on a Pyromark Q96 MD pyrosequencing instrument and sequence using PyroMark Gold Q96 kit.
+
+#### Step 38
+The degree of methylation at each CpG site is determined using PyroMark CpG Software (Biotage AB, Uppsala, Sweden). Pyrosequencing assays are performed in duplicate in sequential runs (technical replicates), and the values show represent the mean methylation for each individual CpG site.
+
+**endofoutput**
+```

markdown-output/boston-biopharma-carestart-rapid-diagnostic-antige-bkzxkx7n.md

@@ -0,0 +1,155 @@
+```markdown
+# Goal/Experiment:
+To evaluate the efficacy and procedure of the Boston Biopharma CareStart™ COVID-19 Rapid Diagnostic Antigen Test for the detection of SARS-CoV-2.
+
+# Boston Biopharma CareStart™ Rapid Diagnostic Antigen Test
+
+**Authors:**
+- tclark¹ 
+- Ahmad Hashem¹ 
+- Jun Yong Ha² 
+- Charlie Mize³
+
+¹Boston Biopharma  
+²Access Bio  
+³Boston Biopharma
+
+**Date:**
+- Created: Sep 07, 2020
+- Last Modified: Sep 08, 2020
+
+**Keywords:**
+- Covid-19 antigen test
+
+**License:**
+This is an open access protocol distributed under the terms of the [Creative Commons Attribution License](https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+**DOI:**
+[dx.doi.org/10.17504/protocols.io.bkzxkx7n](https://dx.doi.org/10.17504/protocols.io.bkzxkx7n)
+
+**Protocol Integer ID:**
+- 41751
+
+### Guidelines
+
+- For prescription and *in vitro* diagnostic use only.
+- This test has not been FDA cleared or approved.
+- As with all diagnostic tests, all results must be interpreted with other clinical information available to the physician.
+- Immediately use after opening the test device in the pouch.
+- Follow the package insert to obtain accurate results.
+- Avoid excess blood or mucus on the swab specimen to prevent interference with test performance.
+- Avoid touching bleeding areas of the nasopharynx when collecting specimens.
+- Do not interpret test results before 10 minutes or after 15 minutes of starting the test.
+- Do not use the test device package if it is damaged.
+- Do not use kit contents beyond the expiration date.
+
+## Materials
+
+### CareStart™ Antigen Kit Contents
+
+| Contents Name                | Quantity (in a kit) | Description                                                                 |
+|------------------------------|---------------------|-----------------------------------------------------------------------------|
+| Test device                  | 20 each             | Foil-pouched test device containing one test strip enclosed in a plastic cassette. |
+| Extraction vial / cap        | 20 vials and caps   | The extraction vial contains 400 ml of extraction buffer solution.          |
+| Nasopharyngeal swab          | 20 each             | Swabs for nasopharyngeal specimen collection.                               |
+| Positive control swab        | 1 each              | Recombinant SARS-CoV-2 nucleocapsid protein antigen dried on a foam-tipped head.  |
+| Negative control swab        | 1 each              | Blank Universal Viral Transport media (BD UVT) dried on a foam-tipped head. |
+| Package insert               | 1 each              | Instructions for use.                                                       |
+| Quick Reference Instructions (QRI) | 1 each              | Quick reference instructions.                                       |
+
+### Safety Warnings
+
+- Do not eat, drink, or smoke in areas where specimens and kit contents are handled.
+- Use appropriate precautions in the collection, handling, storage, and disposal of patient samples and used kit contents.
+- Dispose of used contents as biohazardous waste following federal, state, and local requirements.
+- Wear nitrile or latex gloves when performing this test.
+- If extraction buffer contacts the skin or eye, flush with water.
+- Handle all specimens as if infectious.
+- Follow established precautions against microbiological hazards.
+- Sodium azide (in reagents) is harmful and may react with metals to form explosive azides. Ensure proper disposal.
+- Do not interchange kit contents from different lots.
+- Do not re-use any kit contents as they are for single-use only.
+
+## Before Starting
+
+- Store the test kit between 1 – 30°C.
+- Do not use beyond the expiration date.
+- Ensure the test device remains in the sealed pouch until use.
+- Do not freeze any contents.
+- Allow contents to equilibrate to room temperature (15 – 30°C) before testing.
+
+## Procedure
+
+### Temperature Equilibrium
+
+1. **Room Temperature**
+   - Allow test devices, reagents, specimens, and/or controls to equilibrate to room temperature (15 – 30°C).
+
+### Nasopharyngeal Swab Specimen Collection
+
+2. **Swab Removal**
+   - Remove a nasopharyngeal swab from the pouch.
+
+3. **Specimen Collection**
+   - Place the swab into one of the patient’s nostrils and advance to the posterior nasopharynx.
+   - Rotate the swab 3-5 times over the surface of the posterior nasopharynx.
+   - Remove the swab from the nostril.
+
+### Test Procedure
+
+6. **Device and Extraction Vial Preparation**
+   - Remove the test device and extraction vial from the pouch.
+
+7. **Foil Seal Removal**
+   - Peel off the aluminum foil seal from the extraction vial.
+
+8. **Insert Swab**
+   - Insert the swab into the extraction vial and rotate vigorously at least 5 times.
+
+9. **Swab Removal**
+   - Remove the swab while squeezing the sides of the vial to release liquid from the swab.
+
+10. **Close Vial**
+    - Close the vial with the provided cap.
+
+11. **Mix Sample**
+    - Mix the sample thoroughly by flicking the bottom of the tube.
+
+12. **Sample Application**
+    - Invert the extraction vial and hold above the sample well.
+    - Squeeze the vial gently to allow three drops of sample to fall into the sample well.
+
+13. **Reading the Result**
+    - Read and interpret the test results at 10 minutes (do not read after 15 minutes).
+
+### Interpretation of Results
+
+14. **Results at 10 Minutes**
+    - Test results should be read and interpreted no later than 15 minutes after application.
+    
+15. **Positive Result**
+    - One red-colored line next to “C” and one blue-colored line next to “T” indicates a positive result.
+
+16. **Negative Result**
+    - One red-colored line only next to “C” indicates a negative result.
+
+17. **Invalid Result**
+    - If the red-colored line next to “C” is not visible, the result is invalid and the test must be re-run.
+
+## Limitations
+
+- Proper specimen collection, handling, storage, and preparation are crucial.
+- The test indicates the presence of SARS-CoV-2 nucleocapsid protein from viable and non-viable virus.
+- This is a qualitative test and does not provide viral concentration information.
+- The test cannot rule out infections caused by other pathogens.
+
+### Internal Quality Control
+
+22. The CareStart™ COVID-19 Antigen test includes an internal procedural control that should show a red-colored line in the control region "C" to validate the test. If this line doesn't appear, the test is invalid and must be retested with a new device.
+
+### External Quality Control
+
+23. It is recommended to use external control swabs to validate each new lot shipment and user. If external control results are invalid, contact the manufacturer or distributor.
+
+endofoutput
+```

markdown-output/bulk-rnaseq-delivery-c3kzykx6.md

@@ -0,0 +1,162 @@
+```markdown
+# Goal/Experiment:
+The goal of this experiment is to provide an overview of the Genomics Research Center (GRC) data delivery structure and results files for bulk RNA sequencing (RNASeq) analysis.
+
+# Bulk RNASeq Delivery V.4
+
+**Tyler Stahl**  
+*Genomics Research Center*  
+*Version 4 - October 17, 2023*
+
+## Abstract
+This protocol will give an overview of the GRC data delivery structure and results files.
+
+## Protocol Citation
+Tyler Stahl 2023. Bulk RNASeq Delivery. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vzzx9rgx1/v4
+
+## License
+This is an open-access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
+
+## Protocol Status
+Working - We use this protocol and it's working.
+
+## Created
+October 17, 2023
+
+## Analysis Overview
+The RNASeq analysis follows these stages:
+1. Pre-processing (quality control/filtering/trimming)
+2. Alignment
+3. Post-processing
+4. Feature quantification
+5. Differential expression analysis between sample groups using DESeq2.
+
+A detailed overview of the analysis can be found in the `README.txt` and `RNASeq_methods.txt` files. Below is the workflow diagram for data processing.
+
+![RNASeq Workflow](images/RNASeq_Workflow.png)
+
+## Delivery Structure
+The delivery email includes three download links corresponding to:
+1. Raw (fastq) files
+2. Aligned (bam/bigWig) files
+3. Results files
+
+### Download Links
+- **RNA-Seq Analysis Results and QC:** [Download Link](https://grcweb.circ.rochester.edu/pickup/230821130441-10817/deliv_NHD13_GEO_results.tar.gz) (Checksum: 1e2e1da41926b5d45ef24c103c7a5f48e)
+- **RNA-Seq Analysis Aligned Data:** [Download Link](https://grcweb.circ.rochester.edu/pickup/230821130431-10715/deliv_NHD13_GEO_align.tar.gz) (Checksum: 3c57a3de7218cae0ded7f842b9b2fdd7)
+- **RNA-Seq Raw Data (for GEO submission):** [Download Link](https://grcweb.circ.rochester.edu/pickup/230821130423-10606/deliv_NHD13_GEO_raw.tar.gz) (Checksum: 59b130b3986ebc9174a75ef809db1ce2)
+
+**Note:** These URLs will expire in 10 days.
+
+To uncompress the delivery directory, use FREE compression software [7zip](http://www.7-zip.org).
+
+If you are on a PC, download compression software to unzip the folders. Macs have built-in zip software.
+
+### FASTQ, BAM, and Results Files
+- **.fastq files:** Contain nucleotide and quality information generated from the Illumina Sequencer.
+- **.bam files:** Store alignment data and mapping quality scores in a binary format.
+- **Results folder:** Contains quality control information and results files from DESeq2.
+
+## MultiQC Report
+MultiQC aggregates QC information from multiple different analysis outputs into a single interactive report.
+
+![MultiQC Report](images/MultiQC_Report.png)
+
+### General Statistics
+The general statistics include:
+- **Fastp:** % Duplication, GC content, % PF, % Adapter
+- **Star:** % aligned, M aligned
+- **Feature counts:** % assigned, M assigned
+- **Salmon:** % aligned, M aligned
+
+Each section is detailed below:
+
+#### Fastp
+- **Filtering statistics:** Metrics including read quality, read length, N-Content.
+- **Sequencing Quality:** Phred quality scores assigned to each base. A higher Phred score means higher confidence and lower error rate.
+- **N Content:** Percentage of ambiguous or unknown bases.
+- **GC content:** Proportion of guanine (G) or cytosine (C) bases in the RNA sequence.
+
+#### STAR Alignment
+- **Uniquely mapped:** Reads aligned to a single loci.
+- **Mapped to multiple loci:** Reads aligned to multiple loci.
+- **Mapped to too many loci:** Reads aligned to excessive locations.
+- **Mapped too short:** Reads aligned to genome but fall short of the filtering metrics.
+- **Unmapped: other:** Non-alignable reads.
+
+#### Feature Counts
+- **Assigned:** Reads assigned to a genomic feature (i.e., gene).
+- **Unassigned: Multi Mapping:** Reads aligning to multiple genomic features.
+- **Unassigned: No Features:** Reads that could not be aligned to any defined genomic features.
+- **Unassigned: Ambiguity:** Reads aligning to multiple features, categorized as `Ambiguity`.
+
+#### Salmon
+- **Fragment length distribution:** Refers to the distribution of fragment lengths generated in the sample.
+
+## DESeq2 Results
+Two reports in the `deSeq2` folder:
+1. Star-feature (gene-level)
+2. Salmon (transcript level)
+
+### Files in Star and Salmon Folders
+- **deSeq2_counts.txt:** Raw count values.
+- **deSeq2_NormCounts.txt:** Count values normalized with DESeq2's median of ratio.
+- **deSeq2_rlog_NormCounts.txt:** Log of the normalized counts.
+
+### Comparison Files
+Example file: `deSeq2_NHD13_vs_WT.txt`
+
+| A      | B             | C      | D       | E         | F       |
+|--------|---------------|--------|---------|-----------|---------|
+| BaseMean | log2FoldChange | stat    | pvalue  | padj      |
+| Hoxa9  | 636.168       | 2.557  | 21.331  | 5.92E-101 | 8.68E-97 |
+| Pbx3   | 456.879       | 3.091  | 20.932  | 2.76E-97  | 2.03E-93 |
+| Pbx1   | 401.557       | -3.27  | -16.477 | 5.38E-61  | 2.63E-57 |
+
+**Terms Definitions:**
+- **BaseMean:** Average expression level across samples.
+- **log2FoldChange:** Log2 fold change in gene's expression between conditions/groups.
+- **stat:** Test statistic to assess significance of differential expression.
+- **p-value:** Calculated using a negative binomial distribution.
+- **padj:** Adjusted p-value for multiple testing using Benjamini and Hochberg method.
+
+### EnrichR Files
+EnrichR is used for gene set enrichment querying four common libraries: KEGG, GO, Wiki Pathways, and ChEA. 
+
+Note: EnrichR is not run for salmon outputs.
+
+Example EnrichR file:
+
+| Database  | Term                              | Overlap | P-value | Adjusted-P-value | Combined Score | Genes                                            |
+|-----------|-----------------------------------|---------|---------|------------------|----------------|--------------------------------------------------|
+| GO_Biological_Process_2021 | mRNA processing (GO:0006397) | 69/190  | 5.48E-22 | 2.21E-18         | 485.4247       | PUS1,PUS3,ATRX,DDX6,ZGRF1,ABCF2,ZNF148,RPL5,PUM1 |
+
+More info on EnrichR can be found [here](https://enrichr.maayanlab.cloud/).
+
+## FAQ
+### What are the salmon results?
+Salmon uses a different alignment algorithm, mapping reads at the transcript level rather than whole gene.
+
+### Why do I not see enrichR results?
+There must be at least 50 differentially expressed genes for EnrichR.
+
+### Why is my RNASeq data showing a weak knockdown of my gene of interest despite being validated with qRT-PCR?
+Discrepancies may arise due to alignment of a non-functional transcript. Viewing aligned files in a Genome Browser may help.
+
+### Can I remove a sample from the analysis?
+It is recommended not to remove samples based on clustering alone, unless there is clear experimental reasoning.
+
+### Can the GRC re-analyze my RNA-Seq experiment?
+Use the BulkDeSeq application in HyperGen, a custom no-code genomics analytics software.
+
+### What counts files do I use and where?
+Use the `deSeq2_counts.txt` files within HyperGen BulkDeqSeq application.
+
+For Gene Set Enrichment Analysis (GSEA), use the `deSeq2_NormCounts.txt` files. Guide to get started: [GSEA Guide](https://www.protocols.io/view/gene-set-enrichment-analysis-kqdg3x67qgq25/v1)
+
+## Further Educational Resources
+- [Genomics Biology Article](https://genomebiology.biomedcentral.com/articles/10.1186/s13059-014-0550-8)
+- [DGE Workshop Lesson](https://hbctraining.github.io/DGE_workshop/lessons/04_DGE_DESeq2_analysis.html)
+
+**endofoutput**
+```