```markdown
## Goal/Experiment:
The goal of this experiment is to amplify the 16S and gyrB bacterial genes using PCR for subsequent sequencing with PacBio Sequel II and Illumina MiSeq platforms.

# 16S and GyrB Bacterial Amplification

**DOI:** [dx.doi.org/10.17504/protocols.io.36wgg31nylk5/v1](dx.doi.org/10.17504/protocols.io.36wgg31nylk5/v1)

**Author:** Robert Nichols  
**Institution:** Pennsylvania State University

**Protocol Status:** Working  
We use this protocol and it's working.

**Created:** January 03, 2024  
**Last Modified:** July 12, 2024  
**Protocol Integer ID:** 92918  
**Keywords:** PCR, gyrB, PacBio, MiSeq

---

## Abstract
This protocol is used for the amplification of the bacterial _gyrB_ gene and the _16S_ gene for both PacBio Sequel II and Illumina MiSeq sequencing. This protocol is used in the paper titled *Long-read Sequencing Increases the Accuracy and Specificity of the gyrB Phylogenetic Marker Gene*.

---

## Materials

- **Isolated bacterial DNA**
- **Nuclease-free water** (VWR Cat # 103307-278)
- **Invitrogen Platinum SuperFi PCR Master Mix** (ThermoFisher Scientific, Cat # 12368250)
- **1× TAE** (Tris base [Millipore Sigma, Cat # 648311], acetic acid [Millipore Sigma, Cat # 695092], and EDTA [Millipore Sigma, Cat # E9884]) buffer
- **OmniPur agarose** (VWR, Cat # EM-2070)
- **GelRed dye** (VWR, Cat # 10098-684)
- **6x Gel loading dye** (no SDS) (Biolabs, Cat# B7025S)
- **100-bp DNA ladder** (VWR, Cat# PAG2101)
- **Ice bath**
- **NanoDrop UV-Vis Spectrophotometer Lite** (Thermo-Scientific)
- **Sterile 0.2-ml thin-wall PCR Tubes**, strips of 8 tubes (Denville)
- **Sterile 0.5- to 10-µl pipettes** (Denville)
- **Sterile 10- to 200-µl pipettes** (Denville)
- **Sterile 1000-µl pipettes** (Denville)
- **T100 Thermal cycler** (BioRad)
- **Gel electrophoresis box** (Labnet)
- **ChemiDoc XRS+** (BioRad)

---

## Primer Information

| Primer Name      | Primer Description                               | Primer Sequence                               | Platform  |
|------------------|--------------------------------------------------|-----------------------------------------------|-----------|
| **V4_16S_F**     | Forward primer for V4 16S sequencing             | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGTGYCAGCMGCCGCGGTAA | MiSeq     |
| **V4_16S_R**     | Reverse primer for V4 16S sequencing             | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGTATTACNVGGGTWTTCAAT | MiSeq     |
| **FL_16S_F**     | Forward primer for full-length 16S sequencing    | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCACAGRGTYTGAATMGGCTCA | PacBio    |
| **FL_16S_R**     | Reverse primer for V4 full-length sequencing     | /5AmMc6/TGCGACGTCTTGGCACAGATCACTCGAAATGRETCAGGCTTAGR | PacBio    |
| **SR_GyrB_Bac_F**| Forward primer to amplify the _gyrB_ gene from Bacteroidaceae | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGGGGTAAARTTCGAYAAAGG  | MiSeq |
| **SR_GyrB_Bac_R**| Reverse primer to amplify the _gyrB_ gene from Bacteroidaceae | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACRT TTYYTCTTCRCGCGCGTAACG | MiSeq |
| **SR_GyrB_Bif_F**| Forward primer to amplify the _gyrB_ gene from Bifidobacteriaceae | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGGACCRACGGNCGNGCG | MiSeq |
| **SR_GyrB_Bif_R**| Reverse primer to amplify the _gyrB_ gene from Bifidobacteriaceae | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACCT CCGCTTTGNAACGWAATGC  | MiSeq |
| **SR_GyrB_Lac_F**| Forward primer to amplify the _gyrB_ gene from Lachnospiraceae | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGGGGWCG GayCGAATTAG | MiSeq |
| **SR_GyrB_Lac_R**| Reverse primer to amplify the _gyrB_ gene from Lachnospiraceae | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACGGA TRGGTCTGGACCTGRCRTTTCCG | MiSeq |
| **LR_GyrB_Bac_F**| Forward primer to amplify the _gyrB_ gene from Bacteroidaceae | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCACATACGAYGTT  | PacBio |
| **LR_GyrB_Bac_R**| Reverse primer to amplify the _gyrB_ gene from Bacteroidaceae | /5AmMc6/TGCGACGTCTTGGCACAGATCACTCGAAAGATTYGCTGTCART | PacBio |
| **LR_GyrB_Bif_F**| Forward primer to amplify _gyrB_ gene from Bifidobacteriaceae | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCAGACCGCGWCTCGA | PacBio |
| **LR_GyrB_Bif_R**| Reverse primer to amplify the _gyrB_ gene from Bifidobacteriaceae | TCGARGTSAGCATTCTGCCC | PacBio |
| **LR_GyrB_Lac_F**| Forward primer to amplify the _gyrB_ gene from Lachnospiraceae | /5AmMc6/GCAGTCGAACATGTAGCTGACTCAGGTCAGCTTYACNCGNWNTA | PacBio |
| **LR_GyrB_Lac_R**| Reverse primer to amplify the _gyrB_ gene from Lachnospiraceae | /5AmMc6/TGCGACGTCTTGGCACAGATCACTCGAAAGATRCCWGWTNNTT | PacBio |

---

## Before Start
Before starting, ensure you have isolated bacterial DNA and selected primers for amplification.

---

## Prepare DNA for Amplification

1. **Thaw the isolated DNA**  
2. **Measure DNA concentration on the Nanodrop**  
   This requires only 1 μL of isolated DNA. Concentration values typically range from 100 ng/μL to 400 ng/μL. The NanoDrop provides an estimate of total DNA concentration. For more accurate results, submit samples for quantification on a Bioanalyzer.  
3. **Create a 100 μL aliquot at 10 ng/μL concentration**.  
   3.1. **Calculate required DNA volume**  
   - Divide 1000 by the average DNA concentration.  
     Example: If average DNA concentration is 254 ng/μL, then 1000/254 = 3.94. Therefore, use 3.94 μL of original DNA.  
   3.2. **Calculate water volume**  
   - Subtract the calculated volume from 100. Example: 100 - 3.94 = 96.06 μL of nuclease-free water.  
   - Result: 3.94 μL original DNA + 96.06 μL nuclease-free water = 10 ng/μL DNA solution.

---

## 16S and _gyrB_ PacBio and Illumina Amplicon PCR Protocol

### PCR Mix Preparation

4. **Prepare the PCR mix.**

| Reagent                   | Concentration | Volume to make 20 µL of product |
|------------------------|--------------|-----------------------|
| Forward primer         | 10 µM        | 0.4 µL                |
| Reverse primer         | 10 µM        | 0.4 µL                |
| Platinum SuperFi Master Mix | N/A        | 10 µL                 |
| Nuclease-Free water    | N/A          | 8.2 µL                |

Adjust volumes based on the number of samples plus one or two extra to ensure sufficient master mix availability. For example, for 15 sample PCR, multiply each volume by 17 (15 samples + 2 extra).

5. **Fill PCR wells**  
   Fill adequate number of wells with 19 μL of master mix per well.  
6. **Add DNA to wells**  
   Add 1 μL of 10 ng/μL DNA directly into the master mix of each well.  
7. **Mix and spin**  
   Ensure reagents are mixed by gently flicking and quickly spinning in a mini centrifuge.  
8. **Run PCR**  

### PCR Settings

8.1 **16S samples for MiSeq**

| Cycle Number | Time       | Temperature | Description         |
|--------------|------------|-------------|---------------------|
| 1 cycle      | 2 minutes  | 98°C        | Initial denaturation |
| 25 cycles    | 10 seconds | 98°C        | Denaturation        |
|              | 20 seconds | 56.6°C      | Annealing           |
|              | 15 seconds | 72°C        | Extension           |
| 1 cycle      | 5 minutes  | 72°C        | Final extension     |

> Optimize PCR cycles for specific requirements to reduce chimeric sequences.

8.2 **16S samples for PacBio**

| Cycle Number | Time       | Temperature | Description         |
|--------------|------------|-------------|---------------------|
| 1 cycle      | 30 seconds | 95°C        | Initial denaturation |
| 25 cycles    | 30 seconds | 95°C        | Denaturation        |
|              | 30 seconds | 57°C        | Annealing           |
|              | 1 minute   | 72°C        | Extension           |
| 1 cycle      | 5 minutes  | 72°C        | Final extension     |

> Optimize PCR cycles to reduce chimeric sequences.

8.3 **GyrB samples for MiSeq**

| Cycle Number | Time       | Temperature | Description         |
|--------------|------------|-------------|---------------------|
| 1 cycle      | 2 minutes  | 98°C        | Initial denaturation |
| 30 cycles    | 10 seconds | 98°C        | Denaturation        |
|              | 20 seconds | 56.6°C      | Annealing           |
|              | 15 seconds | 72°C        | Extension           |
| 1 cycle      | 5 minutes  | 72°C        | Final extension     |

> Optimize PCR cycles to reduce chimeric sequences.

8.4 **GyrB samples for PacBio**

| Cycle Number | Time       | Temperature | Description         |
|--------------|------------|-------------|---------------------|
| 1 cycle      | 30 seconds | 95°C        | Initial denaturation |
| 30 cycles    | 30 seconds | 95°C        | Denaturation        |
|              | 30 seconds | 57°C        | Annealing           |
|              | 1 minute   | 72°C        | Extension           |
| 1 cycle      | 5 minutes  | 72°C        | Final extension     |

> Optimize PCR cycles to reduce chimeric sequences.

---

## Check for Amplification

9. **Create a 1x agarose gel**  
   - Combine 1 g of agarose and 100 mL of 1x TAE. Microwave for 1 minute and 45 seconds.  
   - Pour into a mold with appropriate comb. Add 10 μL of Gel Red dye (10,000x). Let cool for 45 minutes to 1 hour.  

10. **Prep amplicons for electrophoresis**

| Reagent          | Concentration | Volume |
|------------------|---------------|--------|
| Gel loading dye  | 6x            | 8 µL   |
| Nuclease-free water | NA        | 16 µL  |

   - Multiply volumes by the number of samples.
   - Add 20 µL of amplified product to wells with 24 µL of dye-water mix.

11. **Run electrophoresis**  
    - Run gel at 80 volts for 1 hour.
    - Check gel in a gel doc to see amplified bands.  

---

## Clean Amplicon Samples with Gel Clean-up Kit

12. **Cut out bands from gel**
    - Use specialized pipette tips to punch out bands under UV light (wear proper PPE).  

13. **Clean-up with QIAquick Gel Extraction Kit**  
    - Dissolve gel punch-outs in provided buffer at 50°C for 10 minutes. Add dissolved punch-out mixture to columns. Wash twice with provided buffers and elute with nuclease-free water or elution buffer.  

14. **Submit for sequencing**  
    - MiSeq: 250x250 Illumina MiSeq  
    - PacBio: PacBio Sequel II  

---

**endofoutput**
```