```markdown
# Goal/Experiment:
The goal of this protocol is to prepare and pool barcoded DNA libraries for multiplexed Illumina sequencing using automated steps. This involves several rounds of PCR, cleanup processes, and pooling samples to ensure balanced representation in sequencing.

## Automated Bar-Seq Library Preparation and Pooling V.2

### DOI
[dx.doi.org/10.17504/protocols.io.3byl49qdjgo5/v2](https://dx.doi.org/10.17504/protocols.io.3byl49qdjgo5/v2)

### Authors
- David Ross, Nina Alperovich

### Affiliation
- NIST

### Collaborating Initiative
- Open Datasets Initiative

### License
This protocol is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

### Protocol Status
- Working

### Creation Date
- May 24, 2024

### Last Modified
- July 25, 2024

### Protocol Integer ID
- 104065

---

## Abstract

**Protocol for automated Bar-Seq Library preparation**

This protocol prepares 96 DNA samples, representing 24 samples from 4 different timepoints, for multiplexed Illumina sequencing. The process starts with two rounds of PCR, each followed by a bead-based cleanup. The first round of PCR attaches primers that serve as tags to identify the timepoint and sample. The second round of PCR attaches flow-cell adapters required for Illumina sequencing. Following the PCR and cleanup steps, the protocol outlines procedures for pooling samples together to ensure balanced representation during sequencing. The process includes quantifying the DNA concentration and diluting/ pooling samples from the same timepoint.

#### NOTES:
- Prepare the magnetic bead suspension before implementing this protocol, following the **Preparation of Sera-mag SpeedBeads protocol**.
- This protocol should be implemented after the **Automation Protocol for Plasmid DNA Extraction from E. coli protocol**.
- A fragment analyzer can also be used instead of a gel to determine if the PCR cleanup process was successful.

---

## Materials

### Starting Samples
- 96 DNA samples resulting from the Automation Protocol for Plasmid DNA Extraction from *E. coli* protocol

### Reagents
- Nuclease-free water (ThermoFisher Scientific 4387936)
- 80% Absolute Ethanol (Fisher Bioreagents BP2818500)
- Elution Buffer (Qiagen 19086)
- Phusion Flash PCR Mastermix (ThermoFisher Scientific F548L)
- Multiplexing Primers
- Universal Illumina Primers

### Labware
- Three 96-well DeepWell reagent plates (Abgene AB-0765) - one used as a reagent plate and two used as midi plates
- Two 96-well PCR plates (Bio-Rad HSP9635 or HSP9645)
- Three PCR plate lids (Agilent 202497-100)
- 96-well output plate (Eppendorf 30603303)

### Primers

| Primer Name | Description | Sequence |
|-------------|-------------|----------|
| BarSeq_1_F1 | forward barSeq PCR 1 primer, with sample multiplex tag: CG | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNGTGATTGGCCTAGACGTGTGATAgactcagtc |
| BarSeq_1_F2 | forward barSeq PCR 1 primer, with sample multiplex tag: AT | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNTTACTTAGCAGCCTCAGACGTGTGATAgactcagtc |
| BarSeq_1_F3 | forward barSeq PCR 1 primer, with sample multiplex tag: TC | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNTCTCTAGGCCCTAGACGTGTGATAgactcagtc |
| BarSeq_1_F4 | forward barSeq PCR 1 primer, with sample multiplex tag: GA | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNCCGATAGGCCTAGACGTGTGATAgactcagtc |
| BarSeq_1_F5 | forward barSeq PCR 1 primer, with sample multiplex tag: GG | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNGATTGTGGCACTCTTCCAGACGTGTGATAgactcagtc |
| BarSeq_1_F6 | forward barSeq PCR 1 primer, with sample multiplex tag: CC | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNGGGTAGGACGACTAGACGTGTGATAgactcagtc |
| BarSeq_1_F7 | forward barSeq PCR 1 primer, with sample multiplex tag: GA | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNGTAGAAGGCACTGAACGACTCTGC |
| BarSeq_1_F8 | forward barSeq PCR 1 primer, with sample multiplex tag: TC | ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTAGAGGATGACTCGACTCTGAAG |
| BarSeq_2_F | forward barSeq PCR 2 primer | AATGATACGGCGACCACCGAGATCTACACTC | 
| BarSeq_2_R | reverse barSeq PCR 2 primer| CAAGCAGAAGACGGCATACGATCTCGTATGCCGTCTTCTGCTTG |

[Table continues similarly for other primers...]

## Methods

### Transfer Plasmid DNA to PCR Plate and Dilute with DI Water

1. Pre-heat the on-deck thermocycler (ODTC) for 1st PCR step.
2. Remove lids from PCR-Plate 1, Sample-Plate, and Reagent Plate.
3. Pipette 10 µL nuclease-free water to each well in PCR plate 1.
   - Mix 6x after dispensing.
   - Dispense 1 mm above the bottom of the well.
4. Transfer 35 µL of extracted plasmid DNA to each well of PCR Plate 1.
   - This step is done 24 times (one sample at a time).
5. Remove plasmid sample input Sample-Plate.

### Run First PCR -Using Primers to Identify Samples from Each Timepoint

6. Add 28.125 µL Master Mix with reverse primer for the appropriate timepoint and sample to each well of PCR plate 1.
   - Dispense 0.5 mm below liquid surface, with liquid following On.
7. Add 28.125 µL Master Mix with forward primer for the appropriate timepoint and sample to each well of PCR plate 1.
   - Mix 10x after dispensing.
   - Dispense 0.5 mm below liquid surface, with liquid following On.
8. Place a PCR plate lid on the PCR plate 1.
9. Move PCR-Plate 1 to ODTC.
10. Run the First PCR using the following conditions (101.25 µL volume):
    - 98°C for 60 s
    - 3 cycles at:
      - 98°C for 10 s
      - 58°C for 20 s
      - 72°C for 20 s
    - 72°C for 60 s
    - 23°C for 10 s
   
### First PCR Cleanup Part 1: Bind Template Plasmid DNA to Beads and Keep the Supernatant

11. Pipette 54 µL magnetic bead suspension into each well of Midi Plate 1.
    - Bead ratio: 0.6x
12. Move PCR plate 1 from ODTC; take lid off PCR plate 1.
13. Shake Midi plate 1 for 10 s at 1800 RPM.
14. Transfer 90 µL of each sample from PCR plate 1 to Midi Plate 1.
15. Incubate for 7 minutes at room temperature.
16. Move Midi Plate 1 to the magnet base and wait for 4 minutes.
17. Remove the supernatant (209.4 µL).

[Continue similarly for all steps]

...

### Protocol References

This protocol is based on a similar protocol described by Tack et al., Mol Syst Biol (2021), [https://doi.org/10.15252/msb.202010179](https://doi.org/10.15252/msb.202010179).

endofoutput
```