Datasets:

---

acmc

/

beamit-annotated_full_texts_dataset

like 0

[ "Adult", "Breast Neoplasms", "Female", "Humans", "Liver Neoplasms", "Mastectomy", "Neoplasm Staging", "Nomograms" ]

[ "Statistical Analysis", "Development of Nomogram", "Validation of Nomogram", "Clinical Use" ]

[ "Statistical analysis was performed using SPSS® version 21.0 (IBM, Armonk, New York, USA) and statistical software package R version 3.5.1 (http://www.r-project). The clinical characteristics of the patients are mainly summarized as the variables of the classification. Comparison between groups was performed using a chi-square test to analyze categorical variables. Receiver Operating Characteristics (ROC) curve was built using SPSS® software. We firstly used univariate and multivariate analysis to determine factors that predict postoperative liver metastasis. Then, we identified the factors predicting postoperative liver metastasis by using a binary logistic regression model. Subsequently, we constructed a nomogram for predicting postoperative liver metastasis from the results of multivariate analysis using the rms package in R. Internal verification of the nomogram was performed with bootstraps with 1000 resampling. Later, we evaluated the predicted performance of the established nomogram by C-index measurement and the calibration curve is plotted to assess the calibration of the model, tested by Hosmer-Lemeshow test [20]. Decision curve analysis in the internal validation was set to determine the clinical value of the nomogram by quantifying the net benefit when considering different threshold probabilities [21, 22]. Besides, we constructed a clinical impact curve to assess the clinical impact of risk prediction models with decision curve analysis [23]. Finally, the breast cancer cohort of the SEER database was used for external validation.", "Logistic regression model identified 3 variables associated with liver metastasis: tumor size (odds ratio (OR) 3.62, 95% CI, 1.91 to 6.87; P < 0.001), lymph node metastasis (OR 2.26, 95% CI, 1.18 to 4.34); P = 0.014) and HER2 status (OR 1.86, 1.02 to 3.41; P = 0.045) (Table 2).\nRisk Factors for Liver Metastasis as Determined by Logistic Regression.\nOR: Odds Ratio.\nA nomogram containing these 3 factors was constructed (Figure 1). Good agreement between prediction and observation was displayed by the calibration curve of the training group (Figure S1A, supporting information). The Hosmer-Leme display test yielded a P value of 0.853, indicating that the model fit well. The C-index of the predicted nomogram is 0.699.\nNomogram to predict postoperative liver metastasis in patients with nonmetastatic breast cancer. There are 6 rows in the nomogram. Significant variables are displayed in lines 2 through 4, and the points of each variable are read from the scale of line 1. Add the points of the 3 variables to the total and mark them on the scale of line 5. The risk of liver metastasis is read from the scale of line 6 by drawing a vertical line from the total point marked in line 5 and the points are translated to the probability of liver metastasis.", "The calibration curve shows good agreement between predicted and observed liver metastasis in the internal validation set (Figure S1, supporting information) due to the non-significant P value (0.972) produced by the Hosmer-Lemeshow test. The C-index of the predicted nomogram is 0.814. The ROC curve was constructed for the derived and validated groups (Figure 2). For the training and verification groups, the area under the curve (AUC) is 0.699 and 0.815, respectively, and the corresponding cutoff values are 0.052 and 0.031.\nThe Receiver operating characteristic (ROC) curves for training (A), internal validation (B) cohorts; Areas under the ROC curve are 0.699 (A) and 0.815 (B). Cut-off values (marked with a symbol) are 0.052 (A) and 0.031 (B).\nFurthermore, we used the breast cancer cohort of the SEER database to further validate this nomogram. The results of the SEER database further confirmed the results of the training cohort, and also supported that HER2 status (odd ratio (OR) 1.88, 95%CI (1.74-2.04); P < 0.001), tumor size (OR 6.72, 95%CI (6.12-7.38); P < 0.001) and lymph node metastasis(OR 3.11, 95%CI (2.87-3.37); P < 0.001) were risk factors for breast cancer liver metastasis. The C-index of the SEER cohort nomogram is 0.791. The calibration curve showed good agreement between predicted and observed liver metastasis in the SEER cohort.", "The decision curve analysis of the nomogram is shown in Figure 3A. This analysis showed that when the threshold probability was in the range of 0-0.7, the use of a nomogram to predict liver metastasis increased more net benefit than the treat-all or treat-none strategy. Within this range, the net benefit based on the nomogram overlaped at several points.\nDecision curve analysis (A) and clinical impact curve analysis (B) of the validation cohort. (A): The y-axis represents net benefit. The x-axis shows the threshold probability. “All” means that all patients have assumed liver metastasis, and “none” means that the patient has no liver metastasis. Using a nomogram to predict, if the score is in the range of 0 to 0.7, liver metastasis increases more net benefit than the treat-all or treat-none strategy. (B): The red curve (Number high risk) indicates the number of patients who are classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) is the number of true positives at each threshold probability.\nThe clinical impact curve analysis of the nomogram was shown in Figure 3B. The red curve (Number high risk) indicated the number of people who were classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) was the number of true positive at each threshold probability." ]

[ null, null, null, null ]

[ "Introduction", "Methods", "Statistical Analysis", "Results", "Development of Nomogram", "Validation of Nomogram", "Clinical Use", "Discussion", "Conclusion", "Supplemental Material" ]

[ "Breast cancer is one of the leading causes of cancer-related deaths among women worldwide.1 Although only 6%-10% of breast cancer patients are diagnosed with metastatic disease, approximately 30% of women diagnosed with the nonmetastatic disease will relapse after treatment.2,3 Breast cancer mainly metastasizes to bone, lung, liver and brain through circulation; among them, the liver is the third most common distant metastatic site of breast cancer.4 Liver metastasis is reported to be responsible for approximately 20% to 35% of metastatic breast cancer patients’ death.5-7 Studies have shown that breast cancer patients with liver metastasis exhibit poor prognosis and short median survival. The median survival time of those patients without any treatment was about 4-8 months8 compared to 13-31 months2,3,9,10 after systemic treatment. For the treatment, systematic therapy is still the backbone to treat breast cancer with liver metastasis patients although surgery, radiofrequency ablation, or radiotherapy can be used for liver metastasis.11,12\n\nCurrently, the occurrence of liver metastasis from breast cancer cannot be accurately predicted. The construction of nomograms based on known prognostic factors is increasing and widely used to predict specific outcomes.13,14 We hypothesized a nomogram could be constructed by combining selected clinical and pathological variables using a multivariate model to predict the likelihood of postoperative liver metastasis in early breast cancer patients. This nomogram can be used to identify subgroups of high-risk patients, develop targeted screening and new preventive treatment strategies for early-stage breast cancer patients, and even improve life quality and survival outcomes.15,16 Therefore, we constructed and validated such a nomogram using retrospectively study data from 2 breast cancer patient populations.", "The electronic database of the department of breast cancer at Sun Yat-sen University Cancer was searched and retrospectively reviewed from January 2008 to December 2010. Information from 1840 consecutive patients with nonmetastatic breast cancer was collected to serve as the basis for this study. The inclusion criteria for this study were: (1) female; (2) stage I-III breast cancer; (3) underwent mastectomy or breast-conserving surgery; (4) confirmed by the pathological diagnosis as invasive carcinoma. Exclusion criteria were: (1) male; (2) distant metastasis at initial diagnosis; (3) incomplete information such as TNM staging or pathological diagnosis; (4) other primary malignancies, including pre-diagnosis or follow-up of breast cancer. The staging of the tumor was based on the eighth edition of the TNM malignant tumor classification. The primary tumor and metastasis were confirmed by pathology. The classification of tumor size is: the maximum diameter of T1 tumor ≤ 20 mm; the maximum diameter of T2 tumor is > 20 mm, but ≤ 50 mm; The maximum diameter of T3 tumor is > 50 mm; T4 is directly invading the chest wall or skin regardless of tumor size. The diagnostic criteria for breast cancer liver metastasis were as follows: (1) BCLM was confirmed by histopathological examination;(2) When the patient is unable to undergo the pathological examination of liver metastases, we mainly diagnose BCLM based on clinical manifestations and imaging examinations. For patients without pathological examination, breast oncologists and imaging physicians jointly confirm the diagnosis of BCLM based on ultrasound, CT, and MRI.\nConsecutive patients from January 2008 to December 2009 were included in the training cohort, while consecutive patients from January 2010 to December 2010 were included in the internal validation cohort from the same institutional database using the same criteria as the derived cohort.\nThe database includes the patient’s treatment and pathological variables (age, menopausal status, tumor size, lymph node metastasis, histological grade, ER, PR, HER2 and lymphatic vessel invasion, etc.). The criteria for HER2 positivity is IHC 3+ (defined as > 30% of invasive tumor cells with uniform strong membrane staining) or FISH amplification (defined as the ratio of HER2 to CEP17 > 2.2 or the average copy number of the HER2 gene has a signal/core ratio greater than 6 when no internal reference probe is used in this detection system).\nThe retrospectively maintained database of early breast cancer patients, as well as this study, was approved by the Institutional Review Board of the Sun Yat-sen University Cancer Center.\nStatistical Analysis Statistical analysis was performed using SPSS® version 21.0 (IBM, Armonk, New York, USA) and statistical software package R version 3.5.1 (http://www.r-project). The clinical characteristics of the patients are mainly summarized as the variables of the classification. Comparison between groups was performed using a chi-square test to analyze categorical variables. Receiver Operating Characteristics (ROC) curve was built using SPSS® software. We firstly used univariate and multivariate analysis to determine factors that predict postoperative liver metastasis. Then, we identified the factors predicting postoperative liver metastasis by using a binary logistic regression model. Subsequently, we constructed a nomogram for predicting postoperative liver metastasis from the results of multivariate analysis using the rms package in R. Internal verification of the nomogram was performed with bootstraps with 1000 resampling. Later, we evaluated the predicted performance of the established nomogram by C-index measurement and the calibration curve is plotted to assess the calibration of the model, tested by Hosmer-Lemeshow test [20]. Decision curve analysis in the internal validation was set to determine the clinical value of the nomogram by quantifying the net benefit when considering different threshold probabilities [21, 22]. Besides, we constructed a clinical impact curve to assess the clinical impact of risk prediction models with decision curve analysis [23]. Finally, the breast cancer cohort of the SEER database was used for external validation.\nStatistical analysis was performed using SPSS® version 21.0 (IBM, Armonk, New York, USA) and statistical software package R version 3.5.1 (http://www.r-project). The clinical characteristics of the patients are mainly summarized as the variables of the classification. Comparison between groups was performed using a chi-square test to analyze categorical variables. Receiver Operating Characteristics (ROC) curve was built using SPSS® software. We firstly used univariate and multivariate analysis to determine factors that predict postoperative liver metastasis. Then, we identified the factors predicting postoperative liver metastasis by using a binary logistic regression model. Subsequently, we constructed a nomogram for predicting postoperative liver metastasis from the results of multivariate analysis using the rms package in R. Internal verification of the nomogram was performed with bootstraps with 1000 resampling. Later, we evaluated the predicted performance of the established nomogram by C-index measurement and the calibration curve is plotted to assess the calibration of the model, tested by Hosmer-Lemeshow test [20]. Decision curve analysis in the internal validation was set to determine the clinical value of the nomogram by quantifying the net benefit when considering different threshold probabilities [21, 22]. Besides, we constructed a clinical impact curve to assess the clinical impact of risk prediction models with decision curve analysis [23]. Finally, the breast cancer cohort of the SEER database was used for external validation.", "Statistical analysis was performed using SPSS® version 21.0 (IBM, Armonk, New York, USA) and statistical software package R version 3.5.1 (http://www.r-project). The clinical characteristics of the patients are mainly summarized as the variables of the classification. Comparison between groups was performed using a chi-square test to analyze categorical variables. Receiver Operating Characteristics (ROC) curve was built using SPSS® software. We firstly used univariate and multivariate analysis to determine factors that predict postoperative liver metastasis. Then, we identified the factors predicting postoperative liver metastasis by using a binary logistic regression model. Subsequently, we constructed a nomogram for predicting postoperative liver metastasis from the results of multivariate analysis using the rms package in R. Internal verification of the nomogram was performed with bootstraps with 1000 resampling. Later, we evaluated the predicted performance of the established nomogram by C-index measurement and the calibration curve is plotted to assess the calibration of the model, tested by Hosmer-Lemeshow test [20]. Decision curve analysis in the internal validation was set to determine the clinical value of the nomogram by quantifying the net benefit when considering different threshold probabilities [21, 22]. Besides, we constructed a clinical impact curve to assess the clinical impact of risk prediction models with decision curve analysis [23]. Finally, the breast cancer cohort of the SEER database was used for external validation.", "A total of 817 patients underwent breast-conserving surgery (including axillary lymph node dissection or sentinel lymph node biopsy); 1023 patients underwent modified radical mastectomy. The distribution of molecular subtypes in the training set is 68.8% in HR+/HER2-, 14.3% in HR+/HER2+, 7.0% in HR-/HER2+, and 10.0% in TN subtypes. The distribution of molecular subtypes in the verification concentration is: 63.5% in HR + /HER2-, 11.1% in HR + / HER2 +, 7.5% in HR− / HER2 +, and 12.0% in TN subtype. Our data analysis showed that in the training group of 1,149 patients with early breast cancer, 51 patients (4.44%) had clinical evidence of liver metastasis after a median follow-up of 71 months. There are 4 patients with extensive systemic metastases, 2 patients with lung metastases, 2 patients with bone metastases, and 1 patient with brain metastases. The demographic and clinical characteristics of the patients in both cohorts are summarized in Table 1. In the internal validation cohort, 28 patients (4.05%) developed liver metastasis after a median follow-up of 59 months. There was no significant difference in liver metastasis between the 2 cohorts (P = 0.723). In univariate analysis, HER2 status, tumor size, and lymph node metastasis were associated with liver metastasis in breast cancer (Table 1). Subsequent liver metastasis was not significantly associated with age at diagnosis (P = 0.062), ER status (P = 0.271), PR status (P = 0.361), lymphovascular invasion (P = 0.078), pathologic stage (P = 0.33) or menopause status at diagnosis (P = 0.881). In addition, we also used Cox regression to analyze the time-dependent risk factors for liver metastasis. The results of the training cohort suggested that HER2 status (Hazard ratio (HR) 1.80, 95%CI (1.01-3.22); P = 0.047), tumor size (HR 4.45, 95%CI (2.41-8.24); P < 0.001) and lymph Node metastasis (HR 2.19, 95%CI (1.15-4.15); P = 0.016) were independent risk factors for liver metastasis (Table. S1). The COX regression of the internal validation cohort basically obtained similar results, although the effect of HER2 status on the recurrence time of liver metastasis did not reach statistical significance.\nClinical and Pathological Features of Patients in the Training and Validation Cohort Based on Liver Metastatic Status.\nDevelopment of Nomogram Logistic regression model identified 3 variables associated with liver metastasis: tumor size (odds ratio (OR) 3.62, 95% CI, 1.91 to 6.87; P < 0.001), lymph node metastasis (OR 2.26, 95% CI, 1.18 to 4.34); P = 0.014) and HER2 status (OR 1.86, 1.02 to 3.41; P = 0.045) (Table 2).\nRisk Factors for Liver Metastasis as Determined by Logistic Regression.\nOR: Odds Ratio.\nA nomogram containing these 3 factors was constructed (Figure 1). Good agreement between prediction and observation was displayed by the calibration curve of the training group (Figure S1A, supporting information). The Hosmer-Leme display test yielded a P value of 0.853, indicating that the model fit well. The C-index of the predicted nomogram is 0.699.\nNomogram to predict postoperative liver metastasis in patients with nonmetastatic breast cancer. There are 6 rows in the nomogram. Significant variables are displayed in lines 2 through 4, and the points of each variable are read from the scale of line 1. Add the points of the 3 variables to the total and mark them on the scale of line 5. The risk of liver metastasis is read from the scale of line 6 by drawing a vertical line from the total point marked in line 5 and the points are translated to the probability of liver metastasis.\nLogistic regression model identified 3 variables associated with liver metastasis: tumor size (odds ratio (OR) 3.62, 95% CI, 1.91 to 6.87; P < 0.001), lymph node metastasis (OR 2.26, 95% CI, 1.18 to 4.34); P = 0.014) and HER2 status (OR 1.86, 1.02 to 3.41; P = 0.045) (Table 2).\nRisk Factors for Liver Metastasis as Determined by Logistic Regression.\nOR: Odds Ratio.\nA nomogram containing these 3 factors was constructed (Figure 1). Good agreement between prediction and observation was displayed by the calibration curve of the training group (Figure S1A, supporting information). The Hosmer-Leme display test yielded a P value of 0.853, indicating that the model fit well. The C-index of the predicted nomogram is 0.699.\nNomogram to predict postoperative liver metastasis in patients with nonmetastatic breast cancer. There are 6 rows in the nomogram. Significant variables are displayed in lines 2 through 4, and the points of each variable are read from the scale of line 1. Add the points of the 3 variables to the total and mark them on the scale of line 5. The risk of liver metastasis is read from the scale of line 6 by drawing a vertical line from the total point marked in line 5 and the points are translated to the probability of liver metastasis.\nValidation of Nomogram The calibration curve shows good agreement between predicted and observed liver metastasis in the internal validation set (Figure S1, supporting information) due to the non-significant P value (0.972) produced by the Hosmer-Lemeshow test. The C-index of the predicted nomogram is 0.814. The ROC curve was constructed for the derived and validated groups (Figure 2). For the training and verification groups, the area under the curve (AUC) is 0.699 and 0.815, respectively, and the corresponding cutoff values are 0.052 and 0.031.\nThe Receiver operating characteristic (ROC) curves for training (A), internal validation (B) cohorts; Areas under the ROC curve are 0.699 (A) and 0.815 (B). Cut-off values (marked with a symbol) are 0.052 (A) and 0.031 (B).\nFurthermore, we used the breast cancer cohort of the SEER database to further validate this nomogram. The results of the SEER database further confirmed the results of the training cohort, and also supported that HER2 status (odd ratio (OR) 1.88, 95%CI (1.74-2.04); P < 0.001), tumor size (OR 6.72, 95%CI (6.12-7.38); P < 0.001) and lymph node metastasis(OR 3.11, 95%CI (2.87-3.37); P < 0.001) were risk factors for breast cancer liver metastasis. The C-index of the SEER cohort nomogram is 0.791. The calibration curve showed good agreement between predicted and observed liver metastasis in the SEER cohort.\nThe calibration curve shows good agreement between predicted and observed liver metastasis in the internal validation set (Figure S1, supporting information) due to the non-significant P value (0.972) produced by the Hosmer-Lemeshow test. The C-index of the predicted nomogram is 0.814. The ROC curve was constructed for the derived and validated groups (Figure 2). For the training and verification groups, the area under the curve (AUC) is 0.699 and 0.815, respectively, and the corresponding cutoff values are 0.052 and 0.031.\nThe Receiver operating characteristic (ROC) curves for training (A), internal validation (B) cohorts; Areas under the ROC curve are 0.699 (A) and 0.815 (B). Cut-off values (marked with a symbol) are 0.052 (A) and 0.031 (B).\nFurthermore, we used the breast cancer cohort of the SEER database to further validate this nomogram. The results of the SEER database further confirmed the results of the training cohort, and also supported that HER2 status (odd ratio (OR) 1.88, 95%CI (1.74-2.04); P < 0.001), tumor size (OR 6.72, 95%CI (6.12-7.38); P < 0.001) and lymph node metastasis(OR 3.11, 95%CI (2.87-3.37); P < 0.001) were risk factors for breast cancer liver metastasis. The C-index of the SEER cohort nomogram is 0.791. The calibration curve showed good agreement between predicted and observed liver metastasis in the SEER cohort.\nClinical Use The decision curve analysis of the nomogram is shown in Figure 3A. This analysis showed that when the threshold probability was in the range of 0-0.7, the use of a nomogram to predict liver metastasis increased more net benefit than the treat-all or treat-none strategy. Within this range, the net benefit based on the nomogram overlaped at several points.\nDecision curve analysis (A) and clinical impact curve analysis (B) of the validation cohort. (A): The y-axis represents net benefit. The x-axis shows the threshold probability. “All” means that all patients have assumed liver metastasis, and “none” means that the patient has no liver metastasis. Using a nomogram to predict, if the score is in the range of 0 to 0.7, liver metastasis increases more net benefit than the treat-all or treat-none strategy. (B): The red curve (Number high risk) indicates the number of patients who are classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) is the number of true positives at each threshold probability.\nThe clinical impact curve analysis of the nomogram was shown in Figure 3B. The red curve (Number high risk) indicated the number of people who were classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) was the number of true positive at each threshold probability.\nThe decision curve analysis of the nomogram is shown in Figure 3A. This analysis showed that when the threshold probability was in the range of 0-0.7, the use of a nomogram to predict liver metastasis increased more net benefit than the treat-all or treat-none strategy. Within this range, the net benefit based on the nomogram overlaped at several points.\nDecision curve analysis (A) and clinical impact curve analysis (B) of the validation cohort. (A): The y-axis represents net benefit. The x-axis shows the threshold probability. “All” means that all patients have assumed liver metastasis, and “none” means that the patient has no liver metastasis. Using a nomogram to predict, if the score is in the range of 0 to 0.7, liver metastasis increases more net benefit than the treat-all or treat-none strategy. (B): The red curve (Number high risk) indicates the number of patients who are classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) is the number of true positives at each threshold probability.\nThe clinical impact curve analysis of the nomogram was shown in Figure 3B. The red curve (Number high risk) indicated the number of people who were classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) was the number of true positive at each threshold probability.", "Logistic regression model identified 3 variables associated with liver metastasis: tumor size (odds ratio (OR) 3.62, 95% CI, 1.91 to 6.87; P < 0.001), lymph node metastasis (OR 2.26, 95% CI, 1.18 to 4.34); P = 0.014) and HER2 status (OR 1.86, 1.02 to 3.41; P = 0.045) (Table 2).\nRisk Factors for Liver Metastasis as Determined by Logistic Regression.\nOR: Odds Ratio.\nA nomogram containing these 3 factors was constructed (Figure 1). Good agreement between prediction and observation was displayed by the calibration curve of the training group (Figure S1A, supporting information). The Hosmer-Leme display test yielded a P value of 0.853, indicating that the model fit well. The C-index of the predicted nomogram is 0.699.\nNomogram to predict postoperative liver metastasis in patients with nonmetastatic breast cancer. There are 6 rows in the nomogram. Significant variables are displayed in lines 2 through 4, and the points of each variable are read from the scale of line 1. Add the points of the 3 variables to the total and mark them on the scale of line 5. The risk of liver metastasis is read from the scale of line 6 by drawing a vertical line from the total point marked in line 5 and the points are translated to the probability of liver metastasis.", "The calibration curve shows good agreement between predicted and observed liver metastasis in the internal validation set (Figure S1, supporting information) due to the non-significant P value (0.972) produced by the Hosmer-Lemeshow test. The C-index of the predicted nomogram is 0.814. The ROC curve was constructed for the derived and validated groups (Figure 2). For the training and verification groups, the area under the curve (AUC) is 0.699 and 0.815, respectively, and the corresponding cutoff values are 0.052 and 0.031.\nThe Receiver operating characteristic (ROC) curves for training (A), internal validation (B) cohorts; Areas under the ROC curve are 0.699 (A) and 0.815 (B). Cut-off values (marked with a symbol) are 0.052 (A) and 0.031 (B).\nFurthermore, we used the breast cancer cohort of the SEER database to further validate this nomogram. The results of the SEER database further confirmed the results of the training cohort, and also supported that HER2 status (odd ratio (OR) 1.88, 95%CI (1.74-2.04); P < 0.001), tumor size (OR 6.72, 95%CI (6.12-7.38); P < 0.001) and lymph node metastasis(OR 3.11, 95%CI (2.87-3.37); P < 0.001) were risk factors for breast cancer liver metastasis. The C-index of the SEER cohort nomogram is 0.791. The calibration curve showed good agreement between predicted and observed liver metastasis in the SEER cohort.", "The decision curve analysis of the nomogram is shown in Figure 3A. This analysis showed that when the threshold probability was in the range of 0-0.7, the use of a nomogram to predict liver metastasis increased more net benefit than the treat-all or treat-none strategy. Within this range, the net benefit based on the nomogram overlaped at several points.\nDecision curve analysis (A) and clinical impact curve analysis (B) of the validation cohort. (A): The y-axis represents net benefit. The x-axis shows the threshold probability. “All” means that all patients have assumed liver metastasis, and “none” means that the patient has no liver metastasis. Using a nomogram to predict, if the score is in the range of 0 to 0.7, liver metastasis increases more net benefit than the treat-all or treat-none strategy. (B): The red curve (Number high risk) indicates the number of patients who are classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) is the number of true positives at each threshold probability.\nThe clinical impact curve analysis of the nomogram was shown in Figure 3B. The red curve (Number high risk) indicated the number of people who were classified as positive (high risk) by the simple model at each threshold probability; the blue curve (Number high risk with events) was the number of true positive at each threshold probability.", "We have developed and validated a nomogram that predicts the development of postoperative liver metastasis in early breast cancer patients. The nomogram included 3 items, tumor size, lymph node metastasis, and HER2 status, and showed good agreement between the predicted and actual probabilities in the derived and validated cohorts.\nLiver metastasis is a growing problem in the treatment of breast cancer.17 Liver metastasis severely affects patients’ life quality and prognosis. Therefore, predicting higher risk liver metastasis breast cancer patients will enrich the population who should be treated more specifically and thereby improve clinical outcomes in these patients.18\n\nBased on this nomogram, assuming a breast cancer patient with T3-4, lymph node metastasis and HER2-positive tumors, her total score was 205, as shown in Figure 1. Using a nomogram, the patient is expected to have a 20% possibility to develop liver metastasis. Therefore, patients with the above characteristics are expected to benefit from liver metastasis screening.\nIn contrast, an assuming patient with a T1-2 tumor, no lymph node metastasis, and the HER2 negative status had a total score of 0, as shown in Figure 1. Using a nomogram, the predicted chance for this patient to get liver metastasis is relatively low (less than 5%).\nThere is currently no specific preventive treatment to reduce the incidence of liver metastasis in breast cancer. But due to the local liver treatment (surgery, intrahepatic local chemotherapy, etc.), strengthen surveillance may bring benefits for high-risk metastatic breast cancer patients. We are not the only ones trying to establish a nomogram on breast cancer liver metastasis. Lin and his colleagues constructed a nomogram using variables such as sex, histology type, N stage, grade, age, ER, PR, HER2 status.19 The problem with their nomogram is that the patients they enrolled are de novo liver metastasis, which means that the diagnosis of liver metastasis and the diagnosis of breast cancer are simultaneous and thus it doesn’t have enough predictive value. The patients included in this study were those who had liver recurrences after early breast cancer treatment. Thus, our nomogram has a more superior predictive value than theirs. Additionally, when T1 and T2 are divided into 2 groups, the ROC curve and the calibration curve of this new nomogram are almost the same as the previous results (Figure S2, supporting information).\nIt is worth noting that this study also has some limitations. First of all, this nomogram was constructed using retrospective data, so prospective studies should be performed for further validation. Secondly, we did not evaluate the impact of adjuvant CT, endocrine, and targeted therapy due to the unavailability of data. Thirdly, we also did not evaluate the effect of the eighth edition of TNM staging on liver metastasis due to the unavailability of data. Finally, the AUC in the ROC analysis of the training cohort is relatively low.", "In summary, we developed a nomogram, which is a powerful tool for predicting subsequent liver metastasis in nonmetastatic breast cancer patients. Our model will help us in identifying patients at high risks of liver metastasis, thereby we could design preventive trials for them correspondingly. Further researches are needed to determine whether it can be applied to other subgroups of patients.", "Click here for additional data file.\nSupplemental Material, sj-jpg-1-ccx-10.1177_1073274821997418 for Predictive Nomogram of Subsequent Liver Metastasis After Mastectomy or Breast-Conserving Surgery in Patients With Nonmetastatic Breast Cancer by Anli Yang, Weikai Xiao, Shaoquan Zheng, Yanan Kong, Yutian Zou, Mingyue Li, Feng Ye and Xiaoming Xie in Cancer Control\nClick here for additional data file.\nSupplemental Material, sj-pdf-1-ccx-10.1177_1073274821997418 for Predictive Nomogram of Subsequent Liver Metastasis After Mastectomy or Breast-Conserving Surgery in Patients With Nonmetastatic Breast Cancer by Anli Yang, Weikai Xiao, Shaoquan Zheng, Yanan Kong, Yutian Zou, Mingyue Li, Feng Ye and Xiaoming Xie in Cancer Control\nClick here for additional data file.\nSupplemental Material, sj-tif-1-ccx-10.1177_1073274821997418 for Predictive Nomogram of Subsequent Liver Metastasis After Mastectomy or Breast-Conserving Surgery in Patients With Nonmetastatic Breast Cancer by Anli Yang, Weikai Xiao, Shaoquan Zheng, Yanan Kong, Yutian Zou, Mingyue Li, Feng Ye and Xiaoming Xie in Cancer Control" ]

[ "intro", "methods", null, "results", null, null, null, "discussion", "conclusions", "supplementary-material" ]

[ "breast cancer", "postoperative liver metastasis", "nomogram", "prediction", "validation" ]

[ 262, 266, 293, 290 ]

[ "metastasis", "liver", "liver metastasis", "nomogram", "curve", "breast", "cancer", "patients", "breast cancer", "risk" ]

[ "liver metastasis relatively", "liver metastasis cohorts", "predict liver metastasis", "metastasis breast cancer", "metastatic breast cancer" ]

[ "Albumins", "Gastric Bypass", "Humans", "Obesity, Morbid", "Postoperative Complications", "Protein-Energy Malnutrition", "Retrospective Studies", "Weight Loss" ]

[ "2. Materials and Methods", "2.1. Statistical Analysis", "2.2. Revisional Surgery Technique Highlights" ]

[ "A retrospective review of a single bariatric center database, and the hospital computerized medical record system were performed. Ten OAGB patients reoperated at our medical center (January 2015 to December 2021) due to severe PEM were included in this study. Nine of them underwent the OAGB in our medical center. In the period corresponding to the study, 1425 cases of OAGB were performed in our bariatric center. Prior to OAGB, all patients were found eligible for BMS by the multidisciplinary bariatric team, according to the American Society for Metabolic and Bariatric Surgery (ASMBS) guidelines. \nBefore revisional surgery, all patients underwent a thorough workup by a multidisciplinary team, including psychological and/or psychiatric evaluation, nutritional assessment, anthropometric studies (weight, height, body mass index (BMI)) laboratory tests, gastrointestinal investigation (upper and lower gastrointestinal endoscopy, computed tomography, barium swallow test, abdominal ultrasound). All patients received nutritional support, including enteral and/or total parenteral nutrition and micronutrient supplements. High-dose Loperamide and Pancreolipase were given to 8/10 and 7/10 patients, respectively. All patients gave their written informed consent, following elaborate explanations about the indication for reoperation, surgical options, possible complications, surgical re-interventions, and implications on future bariatric and metabolic outcomes.\nOur threshold for revisional surgery: we defined severe PEM as the criterion for revision. \nOur definition of severe PEM: significant symptoms of hypoalbuminemia, such as edema, and weakness, with or without micronutrient deficiency, that persisted or recurred despite nutritional optimization. \nSignificant micronutrient deficiency: moderate-severe deficiency of iron, calcium, vitamin D3, B1, B6, B12, and folic acid [11]. \nData retrieved at both surgeries (OAGB and reoperation) included demographic information, clinical characteristics, work-up findings, nutritional parameters and intervention, medical treatment, operative information, and postoperative outcomes. Early (30-day) and late (>30-day) complications were graded according to the Clavien–Dindo (CD) classification [12].\n2.1. Statistical Analysis Continuous data are presented as medians (interquartile range (IQR)). Proportions are presented as n (%). Dichotomous data were analyzed using the Fisher’s exact test. Continuous data were analyzed using the Mann–Whitney test.\nContinuous data are presented as medians (interquartile range (IQR)). Proportions are presented as n (%). Dichotomous data were analyzed using the Fisher’s exact test. Continuous data were analyzed using the Mann–Whitney test.\n2.2. Revisional Surgery Technique Highlights \n1.Reversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.2.BPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.3.Conversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\n\nReversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. \nConstruction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nBPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.\nRefashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nConversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nResection of the gastro-jejunal complex, using 3 firings of a linear stapler.\nRe-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.\nConversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nThe study was approved by the Tel-Aviv Sourasky Medical Center Institutional Review Board (TLV-16-0325/2019) and was performed in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in this study. \n\n1.Reversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.2.BPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.3.Conversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\n\nReversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. \nConstruction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nBPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.\nRefashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nConversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nResection of the gastro-jejunal complex, using 3 firings of a linear stapler.\nRe-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.\nConversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nThe study was approved by the Tel-Aviv Sourasky Medical Center Institutional Review Board (TLV-16-0325/2019) and was performed in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in this study. ", "Continuous data are presented as medians (interquartile range (IQR)). Proportions are presented as n (%). Dichotomous data were analyzed using the Fisher’s exact test. Continuous data were analyzed using the Mann–Whitney test.", "\n1.Reversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.2.BPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.3.Conversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\n\nReversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. \nConstruction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nBPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.\nRefashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nConversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nResection of the gastro-jejunal complex, using 3 firings of a linear stapler.\nRe-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.\nConversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nThe study was approved by the Tel-Aviv Sourasky Medical Center Institutional Review Board (TLV-16-0325/2019) and was performed in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in this study. " ]

[ null, null, null ]

[ "1. Introduction", "2. Materials and Methods", "2.1. Statistical Analysis", "2.2. Revisional Surgery Technique Highlights", "3. Results", "4. Discussion", "5. Conclusions" ]

[ "One anastomosis gastric bypass (OAGB) is the third most commonly performed bariatric metabolic surgery (BMS) worldwide [1], and the most common in our bariatric center. It combines restriction with a dominant malabsorptive component, and it is simple to perform, with a short learning curve [2,3]. OAGB is considered safe and effective as both primary and secondary BMS. It confers good outcomes in terms of satisfactory weight reduction and resolution of obesity-associated medical problems [4,5,6]. OAGB results in equal or better outcomes compared with Roux-en-Y gastric bypass (RYGB) on the one hand and more nutritional deficiencies on the other hand, owing to its stronger malabsorptive component [7,8], i.e., the longer biliopancreatic limb (BPL). \nSevere protein–energy malnutrition (PEM) is an uncommon complication following OAGB that rarely requires corrective surgery [9] like in other BMS [10]. There is no uniform definition in the bariatric literature for protein–energy malnutrition, its severity grading or threshold for revisional surgery. \nWe aimed to evaluate the safety and outcomes of revisional surgery for severe PEM.", "A retrospective review of a single bariatric center database, and the hospital computerized medical record system were performed. Ten OAGB patients reoperated at our medical center (January 2015 to December 2021) due to severe PEM were included in this study. Nine of them underwent the OAGB in our medical center. In the period corresponding to the study, 1425 cases of OAGB were performed in our bariatric center. Prior to OAGB, all patients were found eligible for BMS by the multidisciplinary bariatric team, according to the American Society for Metabolic and Bariatric Surgery (ASMBS) guidelines. \nBefore revisional surgery, all patients underwent a thorough workup by a multidisciplinary team, including psychological and/or psychiatric evaluation, nutritional assessment, anthropometric studies (weight, height, body mass index (BMI)) laboratory tests, gastrointestinal investigation (upper and lower gastrointestinal endoscopy, computed tomography, barium swallow test, abdominal ultrasound). All patients received nutritional support, including enteral and/or total parenteral nutrition and micronutrient supplements. High-dose Loperamide and Pancreolipase were given to 8/10 and 7/10 patients, respectively. All patients gave their written informed consent, following elaborate explanations about the indication for reoperation, surgical options, possible complications, surgical re-interventions, and implications on future bariatric and metabolic outcomes.\nOur threshold for revisional surgery: we defined severe PEM as the criterion for revision. \nOur definition of severe PEM: significant symptoms of hypoalbuminemia, such as edema, and weakness, with or without micronutrient deficiency, that persisted or recurred despite nutritional optimization. \nSignificant micronutrient deficiency: moderate-severe deficiency of iron, calcium, vitamin D3, B1, B6, B12, and folic acid [11]. \nData retrieved at both surgeries (OAGB and reoperation) included demographic information, clinical characteristics, work-up findings, nutritional parameters and intervention, medical treatment, operative information, and postoperative outcomes. Early (30-day) and late (>30-day) complications were graded according to the Clavien–Dindo (CD) classification [12].\n2.1. Statistical Analysis Continuous data are presented as medians (interquartile range (IQR)). Proportions are presented as n (%). Dichotomous data were analyzed using the Fisher’s exact test. Continuous data were analyzed using the Mann–Whitney test.\nContinuous data are presented as medians (interquartile range (IQR)). Proportions are presented as n (%). Dichotomous data were analyzed using the Fisher’s exact test. Continuous data were analyzed using the Mann–Whitney test.\n2.2. Revisional Surgery Technique Highlights \n1.Reversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.2.BPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.3.Conversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\n\nReversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. \nConstruction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nBPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.\nRefashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nConversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nResection of the gastro-jejunal complex, using 3 firings of a linear stapler.\nRe-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.\nConversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nThe study was approved by the Tel-Aviv Sourasky Medical Center Institutional Review Board (TLV-16-0325/2019) and was performed in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in this study. \n\n1.Reversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.2.BPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.3.Conversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\n\nReversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. \nConstruction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nBPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.\nRefashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nConversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nResection of the gastro-jejunal complex, using 3 firings of a linear stapler.\nRe-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.\nConversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nThe study was approved by the Tel-Aviv Sourasky Medical Center Institutional Review Board (TLV-16-0325/2019) and was performed in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in this study. ", "Continuous data are presented as medians (interquartile range (IQR)). Proportions are presented as n (%). Dichotomous data were analyzed using the Fisher’s exact test. Continuous data were analyzed using the Mann–Whitney test.", "\n1.Reversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.2.BPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.3.Conversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\n\nReversal to normal anatomy:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. b.Construction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch. \nConstruction of wide side-to-side gastro-gastrostomy, using a 60 mm cartridge linear stapler and a continuous self- retaining suture for defect closure.\nBPL shortening:\na.Horizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.b.Refashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nHorizontal antimesenteric transection of the gastro-jejunostomy, while preserving adequate intestinal continuity, using a linear stapler. The old staple line is then resected off the distal pouch.\nRefashioning of the BPL length at 65, 100, and 120 cm (from 170, 170, and 220 cm, respectively) and the creation of a new side-to-side gastro-jejunostomy.\nConversion to RYGB:\na.Resection of the gastro-jejunal complex, using 3 firings of a linear stapler.b.Re-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.c.Conversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nResection of the gastro-jejunal complex, using 3 firings of a linear stapler.\nRe-establishment of bowel continuity by construction of side-to-side jejuno-jejunostomy.\nConversion to RYGB, with a BPL length of 50 and 100 cm (instead of 350 and 200 cm, respectively).\nThe study was approved by the Tel-Aviv Sourasky Medical Center Institutional Review Board (TLV-16-0325/2019) and was performed in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in this study. ", "Ten patients underwent revisional surgery due to severe PEM. The incidence of revisional surgery for PEM in our bariatric center is only 0.63% (9/1425 OAGB). Patients` characteristics at OAGB are presented in Table 1. The male-to-female ratio was 2:8, the median (interquartile range) age was 47.5 years (range 42.2, 58.2), and the median BMI was 44.2 kg/m2 (range 35.8, 47). The OAGB was primary or secondary in five patients each. Previous BMS included sleeve gastrectomy, adjustable gastric banding, and silastic ring vertical gastroplasty (n = 2, 2, and 1, respectively). The median BPL length was 200 cm (range 177, 200). All patients were in good nutritional status before undergoing OAGB, and 3/10 had mild micronutrient deficiency (iron, B12, or vitamin D).\nThe patients’ characteristics of PEM are presented in Table 2. The median EWL was 103.7% (range 57.6, 114), and the median TWL was 43% (range 35.7, 56.9). Symptoms included mainly marked weakness, dizziness, syncope, peripheral edema, and diarrhea (watery or steatorrhea). The lowest albumin was median 24 g/dL (range 19, 27), and 8/10 patients had >1 significant vitamin/ mineral deficiencies (iron, calcium, vitamin D3, B1, B6, B12, folic acid). Nutritional optimization included nutritional supplements and medications to aid absorption, consisting of enteral nutrition (EN), total parenteral nutrition (TPN), multivitamins (MV), loperamide, and pancreolipase (n = 10, 5, 10, 4, 8, and 7, respectively).\nThe patients’ characteristics at revisional surgery are presented in Table 3. Revision was performed at a median interval of 18.4 months (range 15.7, 27.8) after OAGB. At revision, the median age, BMI, and highest albumin were 49.5 years (range 43.5, 61.5), 22.4 kg/m2 (range 20.6, 30.3), and 35.5 g/dL (range 29.2, 41), respectively. The type of revision included reversal to normal anatomy, BPL shortening, and conversion to RYGB, performed in five, three, and two patients, respectively. Revisional surgery was laparoscopic in 8/10 patients, and through laparotomy in 2/10 patients (one reversal and another conversion to RYGB). BPL was found longer than reported in 2/10 patients (250 instead of 200, and 350 instead of 250 cm), and the median actual BPL length was 200 cm (range 177, 227). At revision, the common channel was found of at least 300 cm, except one, who was operated on at another hospital for the OAGB. The median operative time was 88.5 min (range 66.8, 117). The median LOS was 8 days (range 7.2, 12.2) and early complications CD >3 occurred in one patient (1/10), who had an anastomotic leak after BPL shortening and underwent debridement with primary repair. There was no occurrence of mortality. None of the patients had liver function derangements. None of the patients had villous atrophy or other gastrointestinal tract pathologies on pre-revision investigation (0/10) or in examined operative specimen (0/6). \nThe median follow-up after revision was 25.4 months (range 3.1, 45). The median weight, BMI, and albumin increased from 60 kg (range 51.7, 79.2), 22.4 kg/m2 (range 20.6, 30.3), and 35.5 g/dL (range 29.2, 41), respectively, at revision to 73.5 kg (range 59, 89), 27.5 kg/m2 (range 22.2, 32.4), and 39.5 g/dL (range 37.2, 41.7), respectively, at last follow-up (median 25.4 months, range 3.1, 45). PEM has resolved in 7/10 patients, improved in 2/10 still on supportive medications for PEM and nutritional support, and did not change in 1/10. The latter had undergone BPL shortening and is a candidate for reversal to normal anatomy. BPL shortening did not result in complete resolution, as opposed to conversion to RYGB and reversal. In a univariate analysis including all of the aforementioned parameters, we found that only the type of revision had a significant correlation with the complete resolution of PEM. Prior to revision, all patients had a BPL length >150 cm, and in a univariate analysis, none of the variables were found as a risk factor for the development of PEM. The BMS effects were maintained in 9/10 patients, whereas 1/10 patients regained weight significantly to BMI >40 kg/m2. All the patients that had T2D (n = 3) and NAFLD (n = 4) at OAGB had a complete resolution at revisional surgery and last follow-up.", "OAGB is one of three commonly performed, acceptable BMSs [13]. There is cumulative evidence of satisfactory excess weight loss—88% at 2 years, 77% at 6 years, and 70% at 12 years postoperatively [6]—and remission or improvement of obesity associated medical problems, especially type II diabetes (T2D) resolution—85–90% at 1 year postoperatively [4,14] and ~70% at 5–15 years [15]. OAGB is safe, with 5% overall morbidity and 0.2% mortality rates [5]. However, as in other BMSs, worrisome, delayed onset complications might develop and affect patients’ health and quality of life. These include mainly bile reflux, anastomotic ulcer, and PEM and may infrequently require revisional surgery [16]. Khrucharoen et al. showed in a systematic review that 26% (46/179) of OAGB revisions were for PEM [17]. \nThe incidence of revisions for PEM is variable between different studies. Rutledge reported that 31/2410 patients (1.28%) underwent reversal due to excessive weight loss [18]. Parmar et al. found a cumulative rate of 0.71% (range, 0–3.8%) in a systematic review of 12,807 OAGB patients [19]. Recent studies, such as the Italian multi-institutional survey of Musella et al. [16] and the single center studies of Jedamzik et al. [20] and Almuhanna et al. [15], reported rates of 0.18% (16/8676 OAGB patients), 0.9% (9/1025 OAGB patients), and 2.3% (51/2223 OAGB patients), respectively. In the current single-center study, the rate is only 0.63% (9/1425 OAGB). In-line with the literature, most of our patients (7/10) had their OAGB to revision interval within the second postoperative year. However, it can develop thereafter. We encourage more surgeons to report their long-term rates of this uncommon complication. \nPEM after OAGB is mainly attributed to its strong malabsorptive component, i.e., the BPL length. In a comparative study of BPL lengths of 150, 180, and 250 cm, Ahuja et al. [21] found no significant difference in OAGB effectiveness at 1 year (i.e., EWL, resolution of T2D, HTN); however, 250 cm BPL was associated with worse nutritional deficiencies, and one patient died of liver failure. In another comparative study of BPL lengths of 150, 180, and 200 cm, Pizza et al. [22] did not find any significant difference in effectiveness or nutritional status at 2 years, except for iron and ferritin levels, which were significantly lower in 200 cm BPL. Nevertheless, in both studies, none of the patients underwent revisional surgery. In contrast, the current study focuses on patients operated for severe PEM, and none of them had a BPL length of 150 cm (median 200 cm, range 177, 227). In 2/10 patients, the actual BPL found at revision was longer than reported at OAGB. We therefore advise to count the BPL length out loud during OAGB, for team double-checking. We do not routinely measure the total small bowel length (SBL) at the OAGB. In the first years, we used a fixed ~200 cm BPL and occasionally a 250 cm-BPL for BMI > 60 without counting the total SBL. Following accumulating data and personal experience, though uncommon occurrence of significant diarrhea, excessive weight loss, and nutritional deficiencies, we changed the BPL length into 150–200 cm, depending mainly on the patient’s BMI, and indication (primary or secondary OAGB). Ramos et al. have outlined the 2020 IFSO consensus conference statement on OAGB, postulating a clear consensus that BPL length <200 cm was adequate, BPL should only be >200 cm if total SBL is measured and suitably long, and that BPL length can be determined according to the BMI [23]. Total SBL varies widely [24]; therefore, some surgeons routinely measure the total SBL and tailor the BPL accordingly, in order to gain adequate bariatric and metabolic goals on the one hand and minimize PEM occurrence on the other hand. Komaei et al. [25] retrospectively compared outcomes between fixed 200 cm BPL without SBL measurements to tailored BPL of 40% from total SBL. There was no significant difference in terms of efficacy, but more patients in the fixed BPL group had nutritional deficiencies (p < 0.05), none of them necessitated revision. Many surgeons have not endorsed this approach, and there is no consensus regarding its necessity or the ideal BPL percentage of total SBL [23]. Furthermore, we share the fear of other bariatric surgeons of adding a risk of unintentional bowel injury as an argument against routine total SBL measurements. Instead, we believe such measurements are important at revisional surgery of OAGB in cases of severe PEM or following weight regain (WR) when considering malabsorption intensification as in the case of RYGB [26]. \nProjecting from WR, the etiology of PEM is probably multifactorial [26]. An altered gut–hormonal balance may explain cases of PEM that are refractory to intensive treatment and cases of ongoing PEM despite BPL shortening. Further investigation is needed to support or refute our assumption. New-onset anorexia or pre-existing psychiatric disorders are other possible causes. Some patients do not comply with the strict nutritional recommendations, perhaps due to their high cost, even in the event of PEM. Secondary pathologies such as colitis, enteritis with atrophy of the villi, undiagnosed celiac disease, pancreatic insufficiency, or small intestinal bacterial overgrowth could serve as another explanation. In our cohort, all patients were in good nutritional status before undergoing OAGB, and none of them had any evidence of the aforementioned GI pathologies, but they were non-compliant with nutritional recommendations after OAGB. Revisional surgery for PEM should be preceded by nutritional status optimization, which is also partly dependent on patients’ compliance. \nThere are several revision options described in the literature, including BPL shortening, conversion to RYGB, conversion to SG, and reversal to normal anatomy. All these surgical options are generally feasible and relatively safe. However, PEM-wise, it is difficult to assess the cumulative complication and resolution rates for each revision option. This is for several reasons. Most studies do not focus on PEM as a sole indication for revision. The complication rate of revision for PEM may be higher than for other indications, especially if not amenable for optimal correction prior to revision, as occurred in one of our patients. In addition, most reports do not elaborate on PEM outcomes after revision, and some studies did not specify which revision types were performed. Furthermore, there is lack of standardized criteria for revisional surgery, and most studies do not specify their definition of severe PEM, and rather simply use the terms: ‘malnutrition’, ‘protein–energy/calorie malnutrition’, ‘excessive weight loss’, ‘macro or micro—nutrient deficiency’, ‘hypoalbuminemia’, etc. There is no standardized protocol of nutritional status optimization prior to revision either. In addition, there is variance regarding BPL lengths and other OAGB parameters. Henceforth, it is difficult to assess the best revisional surgery for PEM or delineate guidelines or algorithm for the management of severe PEM after OAGB. \nDespite these limitations, few observations can be made regarding the different revisional options. Reversal of OAGB is generally feasible, safe, and simple to perform [27]. Gesner et al. [28] reported a high rate of overall morbidity, which was reduced when they switched from simple transection of the gastro-jejunostomy to resection and construction of jejuno-jejunostomy (50 vs. 8.3%, p = 0.03). In their first 14 cases, they left the old gastro-jejunal staple line untouched and consequently had 4 complications there (leak and stenosis), while in the current study, although we had fewer patients, we prevented these complications (0/5 patients) by resecting the old staple line and assuring adequate patency of the intestinal lumen. We therefore suggest to beware of two pitfalls: First, simple transection of the gastro-jejunal anastomosis should be performed only if it is possible to preserve an adequate intestinal patency (i.e., without narrowing the lumen) and provided the old staple line is completely resected. Otherwise, resection with jejuno-jejunal anastomosis is advised. Second, gastro-gastrostomy should be wide enough (>6 cm) to prevent stricture. Reversal to normal anatomy is advantageous since it ensures resolution of PEM, and we believe it is more adequate for patients with severe PEM, especially non-compliant ones. The disadvantage of reversal is the possible risk of significant weight regain and recurrence of obesity-associated problems. Consequently, many patients refuse this option and prefer one of the revisional alternatives, which are more likely to preserve BMS outcomes. \nBPL shortening maintains the ‘OAGB structure’ while reducing the malabsorptive component and therefore is supposed to result in PEM resolution. Interestingly, while Hussain et al. [29] reported the resolution of intractable diarrhea, PEM, or deranged liver functions in eight patients undergoing BPL shortening to 150 cm (from >200 cm), none of our three patients had resolution of PEM, despite a shorter revised BPL of 65–120 cm (from 170 or 220 cm). We assume that for longer initial BPL, shortening may sometimes be adequate; however, this revisional option mandates careful surveillance due to the risk of ongoing PEM. More data are needed. \nConversion to RYGB or SG are other options that are likely to preserve BMS outcomes. Chen et al. [30] performed conversion to sleeve gastrectomy by transecting the gastro-jejunal anastomosis, applying hand-sewn anastomosis of the distal gastric pouch to the antrum of the remnant stomach and vertical resection of the remnant stomach over an endoscope. They reported significant improvement in malnutrition with a maintained weight loss at early follow-up. Their study included, however, both OAGB and RYGB patients and other indications for revision, and the overall complication rate was 8.1% for the entire cohort. We did not perform this type of revisional surgery because of the possibility to replace PEM with other complications of SG (for example, gastroesophageal reflux disease or stricture) and because it prevents future reversal to normal anatomy in case of persistent nutritional deficiencies. Jedamzik et al. performed conversions to RYGB and concluded that BPL shortening to 35–100 cm with conversion to RYGB is feasible and safe for severe malnutrition [20]. Similarly, two of our patients were converted to RYGB with 50–100 cm revised BPL and achieved PEM resolution. \nKhrucharoen et al. [17] concluded that although revision to RYGB was technically simpler than revision to SG or normal anatomy, it should be avoided in PEM, due to the risk of further malabsorption posed by the remaining bypassed BPL. They also mentioned that a three-limb measurement is important to decide if we need to relocate the gastrojejunal anastomosis or simply create the jejunojejunostomy, since the latter option might exacerbate malnutrition. They also concluded that reversal to original anatomy is beneficial, though can be technically challenging and may be associated with an increased risk of complications (i.e., gastrojejunal leak and stenosis). Haddad et al. [1] reported in the IFSO worldwide OAGB survey the operative data of 239/277 patients that underwent revision for malnutrition or steatorrhea. Revisions included: conversion to RYGB (43%), reversal (32%), BPL shortening (20%), and conversion to SG (5%). BPL length data were available in 244/277 patients, revealing that, most commonly, the BPL length in these patients was 200 cm. They also reported a 5% (5/98 OAGB mortalities) mortality rate due to liver failure or malnutrition. Kermansaravi [31] reported a cumulative rate of revisions for PEM of 0.84% (153/17,938 patients) and suggested avoiding creating a BPL >150 cm to reduce the rates of PEM, given that BMS outcomes seem similar for 150 cm compared with 200 cm [32]. In the current study, we found the revision type is an important factor for complete resolution of PEM; however, large comparative studies are needed to examine all aspects of revisional surgery for severe PEM following OAGB. \nOur study has several limitations. This is a retrospective observational study of a small cohort and no comparative groups. The real incidence of PEM may be underestimated, due to a ~30% ‘loss to follow-up’. Large comparative studies are needed to appreciate the proper surgical management of severe PEM, to delineate uniform threshold for revisional surgery, and to identify risk factors for the development of PEM.\nDespite these limitations, this is a very important issue for further discussion and investigation since it might rarely lead to hepatic insufficiency and death. We have described in detail this uncommon complication and outcomes of three different revisional options. We believe that OAGB is a very good surgery to treat severe obesity, and it is associated with uncommon occurrence of delayed complications occurring in other BMS. ", "Revisional surgery of OAGB for severe PEM is feasible and safe after nutritional optimization. Our results suggest that the type of revision may be an important factor for PEM resolution. Comparative studies are needed to better define the role of each revisional option. " ]

[ "intro", null, null, null, "results", "discussion", "conclusions" ]

[ "one anastomosis gastric bypass", "protein", "malnutrition", "revisional surgery", "reversal", "conversion", "bariatric metabolic surgery" ]

[ 1858, 45, 684 ]

[ "bpl", "cm", "patients", "gastro", "pem", "oagb", "jejunostomy", "linear stapler", "linear", "stapler" ]

[ "surgery pem bariatric", "en gastric bypass", "bariatric metabolic outcomes", "oagb performed bariatric", "gastric bypass oagb" ]

[ "Adult", "Case-Control Studies", "Female", "Humans", "Male", "Micronuclei, Chromosome-Defective", "Micronucleus Tests", "Mouth Mucosa", "Mouth Neoplasms", "Mutagenicity Tests", "Tobacco Use Disorder" ]

[ "Author Contribution Statement" ]

[ "Study conception and design - Kokila Sivakumar and Harikrishnan Prasad. Clinical studies and sample collection - Kokila Sivakumar. Data acquisition and analysis - Kokila Sivakumar. Statistical analysis - Harikrishnan Prasad. General supervision - Srichinthu Keniyan Kumar, Rajmohan Muthusamy, Mahalakshmi Loganathan, Shanmuganathan Sivanandham, Prema Perumal. Manuscript preparation - Kokila Sivakumar and Harikrishnan Prasad. Manuscript editing and suggestions – Harikrishnan Prasad and Srichinthu Keniyan Kumar. All the authors have equal contribution in the study and manuscript works. All of them reviewed the results and approved the final version of the manuscript." ]

[ null ]

[ "Introduction", "Materials and Methods", "Results", "Discussion", "Author Contribution Statement" ]

[ "Oral cancer is one of the top three cancers in India accounting for 30% of all the cancers. The most widespread form of oral cancer mainly depends of tobacco consumption in any form, which is closely associated not only with the development of oral cancer, but also with a poor prognosis (Kashyap et al., 2012). The most aggressive chemicals present in tobacco cause extensive genetic damage to the human body, some of which are irreversible. Genetic damage gets started long before the clinical lesion appears. So, early diagnosis and prevention is very essential. Buccal cells, being the first barrier, represent a preferred target site for early genotoxic events induced by carcinogenic agents through inhalation or ingestion route and are capable of metabolizing proximate carcinogens to reactive products (Torres-Bugarin et al., 2014). These changes include formation of micronuclei, and alterations in nuclear size, cell size, nuclear cytoplasmic ratio, nuclear shape, nuclear discontinuity, optical density and nuclear texture. Exfoliative cytology could be of great value for identifying these genotoxic changes. The present study was undertaken to assess these genotoxic changes like micronuclei frequency, nuclear area, cytoplasmic area and the nuclear-cytoplasmic ratio of the squames from clinically normal buccal mucosa of tobacco users (smokers, tobacco chewers and combined habit group) and non-users of tobacco and to compare and correlate the findings.", "Institutional ethical clearance was obtained before commencing the study. A total number of 120 individuals without oral lesions were included in the study.\n• Group I - Individuals habituated with smoking tobacco - 30\n• Group II - Individuals habituated with smokeless tobacco - 30\n• Group III - Individuals habituated with both smoking and smokeless tobacco - 30\n• Group IV - Individuals without any deleterious habits – 30 (Controls)\nIndividuals with any history of systemic diseases and recent history of any viral infection or hospitalization, recent exposure to radiologic investigations, habituated with alcohol were excluded from the study.\nSmears were taken by scraping the buccal mucosa of the participants gently in relation to premolar-molar area with the use of wooden spatula. The smears were taken in pre-cleaned, number coded microscopic slides and were fixed in 70% ethanol. Four smears were collected from each individual. All the smears were stained using Papanicolaou stain (PAP) using the manufacturer recommended protocol provided in the Rapid PAP kit. Feulgen staining was done using the protocol mentioned by (Gopal & Padma, 2018). All the PAP and Feulgen-stained slides were viewed under light microscope and cytomorphometric analysis was done with the help of Jenoptik pRogress software. Hundred cells per patient were evaluated for micronuclei using the criteria mentioned by (Tolbert et al., 1992). The extra nuclear cytoplasmic DNA fragments satisfying the following criteria were counted as micronuclei. \n• Micronuclei must be clearly separated from the main nucleus. \n• Micronuclei must have a smooth, oval or round shape. \n• Texture similar to nucleus. \n• Less than a third the diameter of associated nucleus, but large enough to discern shape and color. \n• Staining intensity similar to nucleus. \n• Same focal plane as nucleus. \nThe criteria for excluding cells for micronuclei assessment by (Tolbert et al., 1992) were also followed. The cells with the following features were not taken for micronuclei assessment: \n• Cells with two nuclei.\n• Dead or degenerating cells (karyolysis, karyorrhexis, nuclear fragmentation). \n• Nuclear blebbings (micronucleus- like structure connected with the main nucleus with a bridge). \n• Anucleated cells.\nThe mean number of micronuclei, mean micronuclei per cell, frequency of cells showing micronuclei were evaluated for each patient. Cytomorphometric assessment of nuclear area, cytoplasmic area and nuclear-cytoplasmic area was done for 100 cells in each patient using Jenoptik pRogress software tools. Results obtained were analysed using one-way ANOVA, Kruskal Wallis test, and Mann Whitney test followed by post-hoc tests.", "Results obtained were similar using either PAP or Feulgen stain in almost all the parameters evaluated. The mean number of micronuclei, mean micronuclei per cell, and frequency of cells showing micronuclei were significantly higher in tobacco users (Groups I, II and III) when compared with controls (Group IV). Among the participants habituated to tobacco, all the parameters related to micronuclei were highest in the combined tobacco users (Group III) followed by smokeless tobacco users (Group II), and smokers (Group I) (p<0.001) (Table 1). \nCytomorphometric assessment of nuclear area, cytoplasmic area (Cell area - Nuclear area), and nuclear-cytoplasmic ratio was done using Papanicolaou stain. Mean nuclear area was significantly higher in tobacco users when compared with controls. Among the habits groups, nuclear area was significantly increased in smokers followed by smokeless tobacco users and combined tobacco users (p<0.001) (Table 2). Comparison of mean cytoplasmic area and nuclear-cytoplasmic ratio using one-way-ANOVA showed no significant difference among the various study groups. \nIntergroup Comparisons of Mean Number of Micronuclei, Mean Micronuclei Per Cell, Frequency of Cells Showing Micronuclei among Various Study Groups Using Feulgen Stain\n†, Kruskal Wallis, post hoc. two sided P.value ≤ 0.05\nComparison of Mean Nuclear Area among the Study Groups Using Pap Stain\nIntergroup Comparison of Mean Nuclear Area among the Different Groups Using Pap Stain\nSmears Stained with Feulgen Stain Showing Micronuclei (Arrows)\nCytomorphometric Analysis of Nuclear Area, Cytoplasmic Area using Pap Stain", "Oral cancer is a multistage disease; it arises from normal mucosa, progresses to dysplasia and ultimately ends as cancer. Development of oral cancer proceeds through discrete genetic changes that occurs due to loss of genomic integrity after the continuous exposure to carcinogenic agent (Park et al., 2011).\nThe carcinogenic effect of the tobacco habits inducing genotoxic effect on oral mucosal cells can be found with investigations. It is widely accepted that genotoxic studies in exfoliated buccal cells remains one of the reliable sensitive markers in early diagnosis of oral cancer in tobacco users (Singam et al., 2019). Our study assesses the genotoxic effect of different types tobacco on the oral mucosa before the lesions appear in the oral cavity. Our study was designed to evaluate micronuclei and cytomorphometric changes (nuclear area, cytoplasmic area, nuclear-cytoplasmic ratio) associated with smokers, smokeless tobacco users, combined tobacco users and healthy individuals without any habits. Buccal smears from all subjects in the four study groups were stained with PAP and Feulgen stain and the parameters were evaluated.\nWe observed that the mean number of micronuclei and mean micronuclei per cell were increased in combined tobacco users than smokers and smokeless tobacco users. Our results were in accordance with the studies conducted by (Sellapa et al., 2009; Dash et al., 2018). On the other hand, our findings were contradictory to the findings observed by (Bonaasi et al., 2003; Pradeep et al., 2014) who stated that the number of micronuclei was increased in smokers than other groups. We also found that frequency of cells showing micronuclei was significantly increased in combined tobacco users when compared with other groups. Similar findings were observed by (Upadhyay et al., 2019; Chandirasekar et al., 2019). The micronuclei related genotoxic alterations in the cells may be due to the possibility that the buccal mucosa cells get direct exposure to the carcinogenic amines present in the tobacco (Proia et al., 2006). The cells bearing the damaged DNA will mostly survive and replicate with the damage and result in higher frequency of micronuclei (Moghaddam et al., 2020). Tobacco specific nitrosamines are believed to be responsible for the induction of micronuclei (Muhammed et al., 2021). Increase in all the micronuclei related changes may be due to the synergistic effect of combined use of smoking and smokeless tobacco which results in a higher genotoxicity in buccal mucosa cells than when they are consumed alone (Dash et al., 2018). Heat and chemical exposure from smoking and continuous exposure of tobacco specific amines while taking the smokeless tobacco prevents the cells from further dividing and in turn the nuclei get disintegrated due to the carcinogenic exposure and induces the formation of micronuclei. Smoking and smokeless tobacco when consumed together has been associated with increased risk of oral squamous cell carcinoma (Mello et al., 2019). Individuals with the habit of smoking and alcohol together are more prone to oral cancers than those to have the habits separately (Liu et al., 2015).\nWe found that the smokers group showed the highest mean nuclear area when compared to smokeless tobacco users and combined tobacco users. Similar findings were observed by (Einstein et al., 2005; Khot et al., 2015). Tobacco causes increase in nuclear size of the buccal cells. It is due to cellular adaptation of the cell in response to the carcinogens in the tobacco. Buccal epithelial cells have a decreased turn over and they will be in cell cycle for long periods which in turn increases the nuclear area. We found that mean cytoplasmic area is significantly higher in control group when compared to tobacco users group. Similar findings were observed by (Parmar et al., 2010; Babuta et al., 2014; Santos et al., 2017;). Decrease in the cytoplasmic area of smokeless tobacco users may be due to the fact that there is a close contact between the smokeless tobacco and oral mucosa. It causes the carcinogenic by-products to infiltrate into the mucosa since it will be kept in the oral cavity for longer period. As a result, the cell undergoes dehydration and causes the shrinkage of cytoplasm. We also found that the nuclear-cytoplasmic ratio was significantly higher in smokeless tobacco group when compared to smokers and controls. Similar findings were observed by (Singh et al., 2014; Khot et al., 2015). The increase in nuclear cytoplasmic area in smokeless tobacco might be due to the synchronous increase in the nuclear area and decrease in cytoplasmic area. Our results were in accordance with the study conducted by (Parmar et al., 2015; Mohan et al., 2017)\nThere are limited studies which evaluate the micronuclei and cytomorphometric changes in clinically normal appearing oral mucosa in comparison with different type of tobacco users. To the best of our knowledge, this is the first study to compare the cytotoxic effects of smoking tobacco users, smokeless tobacco users and combined tobacco users in clinically healthy mucosa. \nWe observed that all parameters related to micronuclei were increased in the habits groups. It was the highest in the combined users group, which suggests that the synergistic effect of smoking and smokeless tobacco could cause greater genomic damage. Smokers group, however, showed pronounced alterations in cytomorphometric parameters, especially the nuclear area. Smokeless tobacco users had an elevated nuclear cytoplasmic ratio, suggesting that individuals with smokeless tobacco habit show both nuclear alterations, and changes in cytoplasmic area. Based on the findings of our study, we conclude that different tobacco related habits have different deleterious effects on the buccal mucosal cells, and these effects are more pronounced when the patients have both types of habits together.", "Study conception and design - Kokila Sivakumar and Harikrishnan Prasad. Clinical studies and sample collection - Kokila Sivakumar. Data acquisition and analysis - Kokila Sivakumar. Statistical analysis - Harikrishnan Prasad. General supervision - Srichinthu Keniyan Kumar, Rajmohan Muthusamy, Mahalakshmi Loganathan, Shanmuganathan Sivanandham, Prema Perumal. Manuscript preparation - Kokila Sivakumar and Harikrishnan Prasad. Manuscript editing and suggestions – Harikrishnan Prasad and Srichinthu Keniyan Kumar. All the authors have equal contribution in the study and manuscript works. All of them reviewed the results and approved the final version of the manuscript." ]

[ "intro", "materials|methods", "results", "discussion", null ]

[ "Micronuclei", "cytomorphometry", "tobacco", "cytoplasmic area", "Feulgen", "exfoliated buccal cells" ]

[ 102 ]

[ "tobacco", "nuclear", "micronuclei", "area", "users", "tobacco users", "cells", "cytoplasmic", "smokeless", "smokeless tobacco" ]

[ "development oral cancer", "genotoxic effect oral", "genotoxic studies exfoliated", "response carcinogens tobacco", "carcinogens tobacco buccal" ]

[ "Adenocarcinoma", "Adult", "Aged", "Aged, 80 and over", "Algeria", "Female", "Humans", "Male", "Middle Aged", "Multivariate Analysis", "Neoplasm Recurrence, Local", "Neoplasm Staging", "Prognosis", "Proportional Hazards Models", "Rectal Neoplasms", "Retrospective Studies", "Survival Rate" ]

[ "Méthodes", "Résultats", "Etat des connaissances actuelles sur le sujet", "Contribution de notre étude à la connaissance" ]

[ "Répondre à la problématique sus énoncé, une étude pronostic mono centrique a été menée, portant sur les dossiers de malades admis et opérés pour CR au service de chirurgie viscérale «A» au centre hospitalo-universitaire de Tlemcen, sur une période de 6 ans allant de Janvier 2009 à Mai 2015. Nous avons inclus dans cette étude tout patient présentant un adénocarcinome prouvé histologiquement et dont le siège de la tumeur était situé entre 0 et 12 cm de la marge anale. Était exclus l’étude, tout adénocarcinome rectal associé à des métastases à distance (hépatiques, pulmonaires, péritonéales), une tumeur située au delà de 12 cm le la marge anale et ceux de la jonction récto-sigmoïdienne, ainsi que toute tumeur rectal non glandulaire, un traitement non curatif, cancer opéré en urgence et enfin tout dossier incomplet. Cinquante-huit patients qui réunissaient les critères de l’étude étaient retenus, pour lesquels une courbe de survie a été réalisée. Les paramètres étudiés étaient, le sexe, l’âge, le siège tumoral, le degrés de différenciation de l'adénocarcinome, le dosage des anti gènes carcino-embryonnaires (ACE), les traitements associés a celui de la chirurgie (néo-adjuvant et adjuvant), le type de traitement chirurgical, nombres de ganglions envahis, stade tumoral, et enfin l'existence ou non d'une récidive tumorale. Pour ce qui est de l'analyse statistique, on procède d'abord à une description de la population de l’étude on exprimons par des pourcentages pour des données qualitatives et sous forme de moyenne ± écart type pour les données quantitatives, puis une analyse de survie globale et en fonction des facteurs pronostics on utilisera la méthode de Kaplan Meier tout on estimons la moyenne et la médiane de survie avec des comparaisons de la survie on fonction des facteurs pronostic par le test de Long-Rang (p < 0,05).\nLes facteurs pronostics ayant un seuil de signification statistique < ou = 3% étaient introduites dans un modèle de régression Cox pour l'analyse multi-variée.", "Sur l'ensemble des 86 dossiers d'adénocarcinome du rectum, nous avons colligé 58 patients qui présentaient un cancer du rectum prouvé histologiquement et dont les dossiers étaient complets. L’âge moyen des patients étaient de 58 ans ± 11,6 avec des extrêmes «30-84ans». Il s'agissait de 52% d'hommes (n = 30) et de 48% de femmes (n = 28) avec sex-ratio (1,08). L'examen endoscopique montrait que la tumeur était située au moyen rectum dans 41,37% (n = 24), 34,48% (n = 20) au bas rectum et dans 24,13% (n = 14) au niveau du haut rectum. Sur le plan histologique la biopsie avait montré que l'adénocarcinome liberkunien était bien différencié dans 75,86% (n = 44), moyennement différencié dans 20,68% (n = 12) et dans 3,44% (n = 2) peu différencié. L'antigène carcino-embryonnaire (ACE) été dosé dans 48,77% (n = 28) et révélait un taux supérieur à 5ng/ml chez 28,57% (n = 8) patients. Sur le plan thérapeutique, un traitement néo-adjuvant par radio-chimiothérapie (RCC) était pratiqué chez 18,95% (n = 11) et une radiothérapie seul cycle court pour 6,90% (n = 4). Une exérèse chirurgicale de type amputation abdomino pelvienne (AAP) était réalisée chez 22,41% des cas (n = 13), alors qu'une chirurgie conservatrice de l'appareil sphinctérien était possible dans 77,58% des cas (n = 45). Les suites postopératoires étaient marquées par une mortalité de l'ordre de 8,62% (n = 5), et une morbidité de 24,15%(n = 14). La durée de séjour hospitalier était de 17, 90 jours ±6,24 avec des extrêmes de «6-32 jours». L'examen anatomopathologique sur pièce opératoire avait précisé que la taille moyenne tumorale était de 4,42 cm ±1,98 avec des extrêmes «1-8cm» et que la taille tumorale était supérieure à 5 cm dans 15,70% (n = 10) et inférieure à 5 cm dans 84,30% (n = 48). En analysant l'envahissement ganglionnaire, le curage avait permis de prélever en moyenne 10,77 ganglions ±5,513 avec des extrêmes de «00-33». Étaient envahis en moyenne 2,25 ganglions ±2,928 avec des extrêmes de «00-17». L’étude histologique avait permis de classer les patients selon la classification TNM avec 17,65% des patients au stade I (n = 10),18,61% au stade II (n = 11), 53,44% au stade III(n = 33) et 7,84% au stade IV (n = 4). En postopératoire vingt deux patients (41,50%) avait bénéficié d'une radio-chimiothérapie, vingt neuf patients (54,71%), d'une chimiothérapie systémique et deux patients d'une radiothérapie seule (3,77%).\nPar ailleurs, dix patients (18,86%) avaient présenté une récidive et dont le délai moyen était de 18,90±9,53 mois avec des extrêmes de« 6-36 mois» (Tableau 1). La survie médiane globale était de 40 mois ±2,937 mois (Figure 1). L'analyse univariée de la survie en fonction du sexe ne retrouvait pas de différence significative P = 0,661. De même en comparant la survie en fonction de l’âge, entre un groupe de patients moins de 50 ans et un groupe âgé plus de 50 ans. Le siège de la tumeur n'avait aucune différence significative sur la survie entre le haut, moyen et bas rectum. Selon le geste pratiqué, celui-ci ne montrait pas une différence significative entre un geste ne conservant pas l'appareil sphinctérien (AAP) et un geste conservant l'appareil sphinctérien (RA) (Tableau 2). La survie en fonction d'un traitement néo adjuvant n'avait pas de différence significative. En analysant la survie en fonction du stade tumoral, le stade III et IV avait un faible taux de survie (19%) a 3 ans tandis que le stade I, II avait un taux de survie de (75%) à 3 ans. (P = 0,000) (IC 95%) (Figure 2). La survie à 3 ans en fonction de la taille tumorale était significativement différente, lorsque la taille tumorale était supérieure à 5 cm. La survie était faible par rapport à une taille inférieur à 5 cm (P = 0,021) (Figure 3). Les patients ayant présenté des récidives tumorales avait un taux de survie faible à 3 ans par rapport à ceux n'ayant pas eu de récidives tumorales (30,85% contre 64,30% P = 0,043) (Figure 4). D'autres facteurs ont été analysés, tel que l'existence d'un traitement adjuvant, l'envahissement ganglionnaire et le taux de l'ACE. Mais il n'avait aucune influence sur la survie dans notre étude. L'analyse univariée avait permis l'identification de trois variables significatives (taille, stade tumorale et récidive). Ces derniers étaient inclus dans un modèle de Cox et un seul facteur déterminant à savoir la récidive tumorale qui sortait et avait une influence significative sur la survie à trois ans.\nAnalyse de la survie globale des malades opères pour cancer du rectum non métastatique\nAnalyse de la survie en fonction du stade de la maladie tumorale, 1-Stade tardif (III, IV) 0-Stade précoce (I-II)\nAnalyse de la survie en fonction de la taille tumorale en centimètres\nAnalyse de la Survie en fonction des récidives tumorale\nCaractéristiques des patients dans notre série selon les variables étudiés\n28 patients ont eu le dosage\nradio chimiothérapie préopératoire\nAnalyse univariée des facteurs influençant la des malades opérés pour cancer du rectum non métastatique dans notre série", "\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.\n\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.", "\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;On confirme que la taille tumorale et la récidive ont une influence sur la survie.\n\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;\nOn confirme que la taille tumorale et la récidive ont une influence sur la survie." ]

[ null, null, null, null ]

[ "Introduction", "Méthodes", "Résultats", "Discussion", "Conclusion", "Etat des connaissances actuelles sur le sujet", "Contribution de notre étude à la connaissance" ]

[ "Le cancer du rectum (CR) est souvent intégré dans les îlots des cancers colorectaux (CCR). Il est de plus en plus fréquent et pose un réel problème de diagnostic et de prise en charge dans les pays en développement [1]. En Algérie, son incidence annuelle est de 31,8 cas pour 100 000 habitants, soit une moyenne annuelle de 1500 cas incident. Le CR se situe au 2émè rang des cancers digestifs [2]. Il représente la deuxième cause de mortalité dans les pays développés [1–3]. Les progrès réalisés en matière de diagnostic et thérapeutique (Traitement néo-adjuvant) ont amélioré la survie qui ne dépasse pas 50% à 5 ans [4]. Reconnaître les facteurs pronostics du CR conditionne la survie à long terme. Déterminer ces facteurs est d'une importance capitale permettant ainsi d'orienter les patients vers un Protocol thérapeutique plus adéquat avec un calendrier de surveillance mieux adapté. L'objectif de notre travail est d'analyser les facteurs histo-pronostiques des cas de cancer du rectum pris en charge durant une période de six ans au service de chirurgie «A» du centre hospitalo-universitaire de Tlemcen à ouest Algérien.", "Répondre à la problématique sus énoncé, une étude pronostic mono centrique a été menée, portant sur les dossiers de malades admis et opérés pour CR au service de chirurgie viscérale «A» au centre hospitalo-universitaire de Tlemcen, sur une période de 6 ans allant de Janvier 2009 à Mai 2015. Nous avons inclus dans cette étude tout patient présentant un adénocarcinome prouvé histologiquement et dont le siège de la tumeur était situé entre 0 et 12 cm de la marge anale. Était exclus l’étude, tout adénocarcinome rectal associé à des métastases à distance (hépatiques, pulmonaires, péritonéales), une tumeur située au delà de 12 cm le la marge anale et ceux de la jonction récto-sigmoïdienne, ainsi que toute tumeur rectal non glandulaire, un traitement non curatif, cancer opéré en urgence et enfin tout dossier incomplet. Cinquante-huit patients qui réunissaient les critères de l’étude étaient retenus, pour lesquels une courbe de survie a été réalisée. Les paramètres étudiés étaient, le sexe, l’âge, le siège tumoral, le degrés de différenciation de l'adénocarcinome, le dosage des anti gènes carcino-embryonnaires (ACE), les traitements associés a celui de la chirurgie (néo-adjuvant et adjuvant), le type de traitement chirurgical, nombres de ganglions envahis, stade tumoral, et enfin l'existence ou non d'une récidive tumorale. Pour ce qui est de l'analyse statistique, on procède d'abord à une description de la population de l’étude on exprimons par des pourcentages pour des données qualitatives et sous forme de moyenne ± écart type pour les données quantitatives, puis une analyse de survie globale et en fonction des facteurs pronostics on utilisera la méthode de Kaplan Meier tout on estimons la moyenne et la médiane de survie avec des comparaisons de la survie on fonction des facteurs pronostic par le test de Long-Rang (p < 0,05).\nLes facteurs pronostics ayant un seuil de signification statistique < ou = 3% étaient introduites dans un modèle de régression Cox pour l'analyse multi-variée.", "Sur l'ensemble des 86 dossiers d'adénocarcinome du rectum, nous avons colligé 58 patients qui présentaient un cancer du rectum prouvé histologiquement et dont les dossiers étaient complets. L’âge moyen des patients étaient de 58 ans ± 11,6 avec des extrêmes «30-84ans». Il s'agissait de 52% d'hommes (n = 30) et de 48% de femmes (n = 28) avec sex-ratio (1,08). L'examen endoscopique montrait que la tumeur était située au moyen rectum dans 41,37% (n = 24), 34,48% (n = 20) au bas rectum et dans 24,13% (n = 14) au niveau du haut rectum. Sur le plan histologique la biopsie avait montré que l'adénocarcinome liberkunien était bien différencié dans 75,86% (n = 44), moyennement différencié dans 20,68% (n = 12) et dans 3,44% (n = 2) peu différencié. L'antigène carcino-embryonnaire (ACE) été dosé dans 48,77% (n = 28) et révélait un taux supérieur à 5ng/ml chez 28,57% (n = 8) patients. Sur le plan thérapeutique, un traitement néo-adjuvant par radio-chimiothérapie (RCC) était pratiqué chez 18,95% (n = 11) et une radiothérapie seul cycle court pour 6,90% (n = 4). Une exérèse chirurgicale de type amputation abdomino pelvienne (AAP) était réalisée chez 22,41% des cas (n = 13), alors qu'une chirurgie conservatrice de l'appareil sphinctérien était possible dans 77,58% des cas (n = 45). Les suites postopératoires étaient marquées par une mortalité de l'ordre de 8,62% (n = 5), et une morbidité de 24,15%(n = 14). La durée de séjour hospitalier était de 17, 90 jours ±6,24 avec des extrêmes de «6-32 jours». L'examen anatomopathologique sur pièce opératoire avait précisé que la taille moyenne tumorale était de 4,42 cm ±1,98 avec des extrêmes «1-8cm» et que la taille tumorale était supérieure à 5 cm dans 15,70% (n = 10) et inférieure à 5 cm dans 84,30% (n = 48). En analysant l'envahissement ganglionnaire, le curage avait permis de prélever en moyenne 10,77 ganglions ±5,513 avec des extrêmes de «00-33». Étaient envahis en moyenne 2,25 ganglions ±2,928 avec des extrêmes de «00-17». L’étude histologique avait permis de classer les patients selon la classification TNM avec 17,65% des patients au stade I (n = 10),18,61% au stade II (n = 11), 53,44% au stade III(n = 33) et 7,84% au stade IV (n = 4). En postopératoire vingt deux patients (41,50%) avait bénéficié d'une radio-chimiothérapie, vingt neuf patients (54,71%), d'une chimiothérapie systémique et deux patients d'une radiothérapie seule (3,77%).\nPar ailleurs, dix patients (18,86%) avaient présenté une récidive et dont le délai moyen était de 18,90±9,53 mois avec des extrêmes de« 6-36 mois» (Tableau 1). La survie médiane globale était de 40 mois ±2,937 mois (Figure 1). L'analyse univariée de la survie en fonction du sexe ne retrouvait pas de différence significative P = 0,661. De même en comparant la survie en fonction de l’âge, entre un groupe de patients moins de 50 ans et un groupe âgé plus de 50 ans. Le siège de la tumeur n'avait aucune différence significative sur la survie entre le haut, moyen et bas rectum. Selon le geste pratiqué, celui-ci ne montrait pas une différence significative entre un geste ne conservant pas l'appareil sphinctérien (AAP) et un geste conservant l'appareil sphinctérien (RA) (Tableau 2). La survie en fonction d'un traitement néo adjuvant n'avait pas de différence significative. En analysant la survie en fonction du stade tumoral, le stade III et IV avait un faible taux de survie (19%) a 3 ans tandis que le stade I, II avait un taux de survie de (75%) à 3 ans. (P = 0,000) (IC 95%) (Figure 2). La survie à 3 ans en fonction de la taille tumorale était significativement différente, lorsque la taille tumorale était supérieure à 5 cm. La survie était faible par rapport à une taille inférieur à 5 cm (P = 0,021) (Figure 3). Les patients ayant présenté des récidives tumorales avait un taux de survie faible à 3 ans par rapport à ceux n'ayant pas eu de récidives tumorales (30,85% contre 64,30% P = 0,043) (Figure 4). D'autres facteurs ont été analysés, tel que l'existence d'un traitement adjuvant, l'envahissement ganglionnaire et le taux de l'ACE. Mais il n'avait aucune influence sur la survie dans notre étude. L'analyse univariée avait permis l'identification de trois variables significatives (taille, stade tumorale et récidive). Ces derniers étaient inclus dans un modèle de Cox et un seul facteur déterminant à savoir la récidive tumorale qui sortait et avait une influence significative sur la survie à trois ans.\nAnalyse de la survie globale des malades opères pour cancer du rectum non métastatique\nAnalyse de la survie en fonction du stade de la maladie tumorale, 1-Stade tardif (III, IV) 0-Stade précoce (I-II)\nAnalyse de la survie en fonction de la taille tumorale en centimètres\nAnalyse de la Survie en fonction des récidives tumorale\nCaractéristiques des patients dans notre série selon les variables étudiés\n28 patients ont eu le dosage\nradio chimiothérapie préopératoire\nAnalyse univariée des facteurs influençant la des malades opérés pour cancer du rectum non métastatique dans notre série", "L'incidence du CR est plus élevée dans les pays du nord qu'en Afrique [5]. Comme très peu de régions en Afrique sont couvertes par un registre, en Algérie l'incidence du CR reste sous-estimée et difficile à préciser. Et d'après les dernier données épidémiologiques publiées en 2009 [2], le CR en Algérie occupe le 4ème rang parmi les cancers chez l'homme et le 5ème chez la femme. L’âge moyen de nos patients était de 58 ans comparable à celui rapporté aux autres séries Africaines Nigérienne et Béninoise [6, 7] où l’âge moyen variait entre 46,7 à 51,2 ans. Ainsi, le CR apparaît à un âge relativement plus bas chez les africains que chez les occidentaux où le pic de fréquence se situe entre 60 et 70 ans [5]. Nos patients semblent plus jeunes en raison de la jeunesse de notre population. Dans notre série le sex-ratio était de 1,08 identique à celui qui était retrouvé dans la littérature [8, 9]. L’étude des facteurs pronostiques permet au clinicien de sélectionner les patients pour un traitement donné. Si le principal facteur reste le stade évolutif de la tumeur au moment du diagnostic [10], il est important de déterminer d'autres facteurs pronostiques qui conditionnent la survie. Parmi ces facteurs pronostiques cliniques étudiés dans la littérature: l’âge, ce dernier reste un facteur discutable. Six études sur quinze qui évaluaient ce facteur avaient conclu que la survenue d'un CR chez le sujet jeune était de mauvais pronostic [11]. Dans notre étude nous n'avions pas trouvé de différence significative en termes de survie en fonction des tranches d’âge de nos patients. La prédominance masculine était dominante dans notre série. Trois études multi variées avaient affirmé que la survie à long terme était meilleure chez la femme par rapport à l'homme [12–15]. Cette constatation n’était pas identifiée dans notre série puisque nous n'avons pas trouvé de différence significative de survie entre les deux sexes. Selon la topographie et en comparant la survie en fonction du siège tumoral, une étude de Jatzco [16] qui étudiait l'influence du siège tumoral sur la survie et ces constatations avaient conclus qu'il n'y avait pas d'influence. Il en est de même dans notre série où il n'y avait pas de différence significative selon le siège tumoral (P = 0,123).\nSur le plan biologique, parmi les marqueurs tumoraux, l'ACE est le marqueur tumoral le plus utilisé en pathologie colorectale. Toute élévation de ce marqueur en pré-opératoire, était un facteur de mauvais pronostic dans plusieurs études publiées [17, 18, 10]. Dans notre série, l’élévation du taux sérique de l'ACE n’était pas un facteur influençant la survie. En ce qui concerne les facteurs thérapeutiques étudiés, depuis la fin des années 90, l'association de la chimiothérapie à la radiothérapie a encore amélioré le pronostic carcinologique et fonctionnel du CR. Une méta-analyse réalisée en 2013 [19] qui comparait la radio-chimiothérapie néo-adjuvante versus chirurgie seule, avait prouvé qu'il n'y avait pas de différence significative sur la survie globale à long terme. Dans notre étude, il n'y avait pas de différance significative (p = 0,576) entre un traitement néo-adjuvant chirurgie versus chirurgie seule. Mais ceci reste à prendre avec précaution car l’échantillon de notre série était faible. En ce qui concerne le traitement chirurgical, deux études prospectives réalisées chez 2136 et 1219 malades [20, 21] avaient comparé les différentes techniques chirurgicales à savoir les amputations abdomino-périnéales et une résection antérieure pour la tumeur du moyen et bas rectum. Ces études n'avaient pas trouvé de différence significative sur la survie globale. Ce qui a été retrouvé dans notre étude. En dehors des facteurs pronostiques cliniques, biologiques et thérapeutiques, d'autres facteurs d'importance capitale ont été étudiés par différentes études. C'est l’étude anatomopathologique qui a analysé l'aspect macroscopique et microscopique de la tumeur. Parmi les facteurs analysés macroscopiquement, c'est l'influence de la taille tumorale sur la survie, qui reste controversée dans la littérature. Park JY et He WJ [22, 23] rapportait dans leurs analyses multi-variées que la taille de la tumeur n’était pas un facteur pronostic influençant la survie. Par contre, d'autres études ont prouvé le contraire tel l’étude de Xu FY qui avait trouvé que lorsque la taille supérieure à 6 cm était de mauvais pronostic [24]. Dans notre analyse, la taille tumorale était un facteur influençant sur la survie globale de façon significative (P = 0,023). En ce qui concerne l'influence de l'envahissement ganglionnaire du CR sur la survie, des études ont confirmés cette influence sur la survie [25, 26]. Pour notre part l'envahissement ganglionnaire et le nombre de ganglions n’étaient pas un facteur influençant. En comparant la survie des différents stades tumoraux dans notre série, les stades III et IV (19% a trois ans) avaient un taux de survie plus faible, tandis que les stades I et II avaient meilleur taux de survie (79% à trois ans). Ces mêmes résultats sont retrouvés dans 2 études multi variées comparant les stades tumoraux [15–27]. Dans une étude analytique Tunisienne réalisée en 2006 [10], qui avait démontré que les patients présentant une récidive avaient un taux de survie plus faible. Cette conclusion a été retrouvé dans notre analyse, puisqu'il n'y'avait une différence significative entre les deux groupes (P < 103)", "Dans cette série, l’étude univarié des différents facteurs pronostiques conditionnant la survie n'a permis de retenir que trois facteurs influençant la survie, a savoir la taille tumorale, le stade, et les récidives tumorales. En analyse multi variée en utilisant le modèle Cox un seul facteur été retenu c'est la récidive tumorale\n Etat des connaissances actuelles sur le sujet \nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.\n\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.\n\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.\n\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.\n Contribution de notre étude à la connaissance \nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;On confirme que la taille tumorale et la récidive ont une influence sur la survie.\n\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;\nOn confirme que la taille tumorale et la récidive ont une influence sur la survie.\n\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;On confirme que la taille tumorale et la récidive ont une influence sur la survie.\n\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;\nOn confirme que la taille tumorale et la récidive ont une influence sur la survie.", "\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.\n\nLa survie est influencée par deux facteurs: la taille tumorale; la récidive tumorale.", "\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;On confirme que la taille tumorale et la récidive ont une influence sur la survie.\n\nLes facteurs suivant n'influencent pas la survie: le type de chirurgie, le siège de la tumeur, l'association ou non à un traitement néo-adjuvant;\nOn confirme que la taille tumorale et la récidive ont une influence sur la survie." ]

[ "intro", null, null, "discussion", "conclusion", null, null ]

[ "Adénocarcinome rectale", "survie", "récidive", "Rectal adenocarcinoma", "survival", "recurrence" ]

[ 373, 1058, 34, 91 ]

[ "de", "la", "survie", "le", "la survie", "en", "les", "un", "dans", "des" ]

[ "carcinologique fonctionnel du", "récidives tumorales en", "cancer du rectum", "récidive tumorale contribution", "le pronostic carcinologique" ]

[ "Animals", "Antineoplastic Agents", "Chlorocebus aethiops", "Gymnema sylvestre", "HT29 Cells", "Humans", "Microscopy, Electron, Scanning", "Nanoparticles", "Plant Extracts", "Plant Leaves", "Plants, Medicinal", "Saponins", "Silver", "Silver Nitrate", "Spectroscopy, Fourier Transform Infrared", "Triterpenes", "Vero Cells", "X-Ray Diffraction" ]

[ "Collection of plants", "Preparation of aqueous extract", "Synthesis of SNPs", "Characterization of SNPs", "In vitro anticancer activity", "Cell line and culture medium", "Cell viability by MTT assay", "Morphological changes", "Phytochemical screening of G. sylvestre leaf extract", "Characterization of biofunctionalized SNPs", "In vitro anticancer activity", "Conclusion" ]

[ "Fresh leaves of G. sylvestre from plants of same age group of a single population were collected from the experimental Herbal Garden, Tamil University, Thanjavur, Tamil Nadu, India, in July, 2010. The herbarium was prepared for authentication (Ref No: SRM\\CENR\\PTC\\2010\\03), and taxonomic identification was done by Dr Jayaraman, Professor, Department of Botany, Madras Christian College, Tambaram, Chennai, Tamil Nadu. The herb sample is maintained in the research laboratory for further reference.", "The leaves of G. sylvestre were washed with distilled water to remove the dirt and further washed with mild soap solution and rinsed thrice with distilled water. The leaves were blot-dried with tissue paper and shade dried at room temperature for 2 weeks. After complete drying, the leaves were cut into small pieces and powdered in a mixer and sieved using a 20-μm mesh sieve to get a uniform size range for further studies. Twenty grams of the sieved leaf powder was added to 100 mL of sterile distilled water in a 500-mL Erlenmeyer flask and boiled for 5 minutes. The flask was kept under continuous dark conditions at 30°C in a shaker. The extract was filtered and stored in an airtight container and protected from sunlight for further use.37", "Silver nitrate (AgNO3) was purchased from Sigma-Aldrich (St Louis, MO, USA), and all solutions were freshly made for the synthesis of SNPs. The aqueous leaf extract of G. sylvestre was used for the bioreduction synthesis of the NPs. The SNPs were synthesized by adding 5 mL of plant extract to 15 mL of 1 mM aqueous AgNO3 solution in a 250-mL Erlenmeyer flask and incubated in a rotary shaker at 150 rpm in dark. The synthesis of NPs was confirmed spectrophotometrically at every 30-minute interval till no reduction was observed. The reduction was observed by the color change in the colloidal solution, which confirmed the formation of SNPs.42,43", "The GSNPs were characterized periodically by measuring the bioreduction of AgNO3 using a UV–vis 3000+ double-beam spectrophotometer (Lab India, Maharashtra, India). The spectrometric range was 200–800 nm, and scanning interval was 0.5 nm.\nThe surface morphology of the biofunctionalized SNPs was characterized by high-resolution SEM analysis (JSM-5600LV; JEOL, Tokyo, Japan) and the elemental compositions were determined by EDAX analysis (S-3400N; Hitachi, Tokyo, Japan). The functional characterization of biomolecules present in the GSNPs from the leaf extract of G. sylvestre was done by FTIR spectrometry (RX1; Perkin-Elmer, Waltham, MA, USA).44\nThe crystal lattice and the size of the synthesized NPs were determined by XRD measurements using an XRD-6000 X-ray diffractometer (Shimadzu, Kyoto, Japan). The crystal-lite domain size was calculated from the width of the XRD peaks, as described in our previous papers.17,45–47", " Cell line and culture medium Vero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\nVero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\n Cell viability by MTT assay MTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\nMTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\n Morphological changes The cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49\nThe cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49", "Vero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17", "MTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48", "The cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49", "The preliminary phytochemical screening of aqueous extracts of G. sylvestre revealed the presence of alkaloids, phenols, flavonoids, sterols, tannins, and triterpenes (Table 1). As shown in Table 2, 125.62±26.84 μg/g of total flavonoids, 285.23±1.11 μg/g of total phenols, and 111.53±15.13 μg/g of tannin were present in the aqueous extract of G. sylvestre. The flavonoids and phenolic compounds exhibited a wide range of biological activities, such as antioxidant and lipid peroxidation inhibition.13\nThe estimated total antioxidant activity was 9.13±0.04 μg/g and the DPPH radical scavenging activity was 52.14%±0.32% (Table 2).", "The color change observed in the aqueous silver nitrate solution showed that the SNPs were formed rapidly within 30 minutes of incubation of the plant extract with aqueous AgNO3 solution. The colorless solution changed to ruby red, confirming the formation of SNPs (Figure 1). The intensity of the red color increased with time because of the excited surface plasmon resonance effect and reduced AgNO3. The control aqueous AgNO3 solution (without leaf extract) showed no change of color with time and was taken as the blank reference.\nUV–vis spectrometry is a reliable and reproducible technique that can be used to accurately characterize the metal NPs though it does not provide direct information regarding the particle sizes. The surface plasmon bands (absorbance spectra) are influenced by the size and shape of the NPs produced, along with the dielectric constant of the surrounding media.\nFigure 2 shows the time-dependent intensity of the absorption band, which reached its maximum peak at 12 hours, after which no further change in the spectrum was observed indicating that the precursors had been consumed. Initially, the UV–vis spectrum did not show evidence of any absorption in the region 350–600 nm, but after the addition of extract a distinct band was observed at 432 nm.\nWhen silver nitrate was added to the aqueous plant extract of G. sylvestre, it was reduced to SNPs by the aldehyde group present in the flavonoids (125.6 μg/g), which was further oxidized to the carboxyl group. Also, the carboxyl groups of the phenols from the G. sylvestre extract (285.23 μg/g) acted as a surfactant to attach the major phytochemicals from the plant extract to the surface of the SNPs. Our previous study on the synthesis of SNPs using aqueous extracts of Memecylon edule,37\nMemecylon umbellatum,47\nChrysopogon zizanioides46 and Indigofera aspalathoides50 showed that the color of the reaction mixture during the formation of GSNPs changed to ruby red color from colorless/straw color. Our results are also comparable with the other available reports for plant-extract-mediated synthesis of SNPs.\nFrom Figure 3, it is clear that the synthesized SNPs were approximately spherical and of different sizes. The SEM images in the figure clearly indicated a thin layer of phytochemicals from the plant extract covering the synthesized SNPs. Mostly the total phenolic content, flavonoids, and tannins were responsible for the bioreduction of the SNPs. In this green synthesis, the phytochemicals from the plant extract acted as a surfactant to prevent the aggregation of the synthesized SNPs. The SEM images of our earlier research had revealed that this biologically eco-friendly synthesis of NPs utilizing the leaf extracts of M. edule,37\nC. zizanioides,46 and M. umbellatum47 showed no aggregation due to the biomolecules from the plant extract. And the mechanism behind this particle formation with no aggregation may be the spontaneous nucleation and isotropic growth of NPs along with the plant extract. As these chains grow in diameter with increasing silver deposition, spherical particles break off from these structures forming nanospherical particles which can be typically observed from this synthesis.51\nThe elemental composition of green-synthesized AgNPs was analyzed through EDAX. These measurements confirmed the presence of the elementary silver signal of the SNPs. The vertical axis displays the number of X-ray counts and the horizontal axis displays the energy in keV.\nThe EDAX spectrum of the biofunctionalized SNPs in Figure 4 clearly shows the strong signals from silver atoms along with the weaker signals from carbon and oxygen present from biomolecules of the plant extract. The elemental silver peak at 2–4 keV, which is the major emission peak specified for metallic silver, with minor peaks of C and O were also seen due to the capping of Ag NPs by the biomolecules of G. sylvestre leaf extract, and the absence of other peaks evidenced the purity of the Ag NPs.\nFTIR analysis in Figure 5 shows that the SNPs produced by G. sylvestre extract were coated by phytocompounds and secondary metabolites such as saponins, terpenoids, and gymnemagenin derivative of gymnemic acid containing the functional groups of amines, aldehydes, carboxylic acids, and alcohols.\nThe presence of the amide linkages seen in Figure 5 suggests that the different functional groups of the proteins present in the plant extracts might be capping the NPs and playing an important role in the stabilization of the green NPs formed. The band at 1,443 cm−1 was assigned to the methylene scissoring vibrations of proteins, and the bands located at 1,318 cm−1 and 1,089 cm−1 are due to the C–N stretching vibration of aromatic and aliphatic amines, respectively, which agrees with earlier reports of Suman et al.52\nThe positions of these bands were comparable to those reported for phytochemicals reported in the G. sylvestre extract as total phenols, flavonoids, and tannins (Table 2). Thus, we can confirm that the nanocapping of the phytochemicals from the G. sylvestre extract is responsible for the reduction and subsequent stabilization of the SNPs. The absorption bands that appear in the IR spectrum of the aqueous extract could also be seen in the IR spectra of phyto-capped Ag NPs, confirming the role of the phyto constituents (mostly gymnemic acid) in protecting the Ag NPs from aggregation.\nAlso, during our repeated experiments there were no batch-to-batch variations in size, regardless of the isotopic composition, and the particles diameters of the SNPs formed were known to a high degree of accuracy. A detailed study on the large-scale synthesis and elemental composition on the synthesized NPs can be carried out using inductively coupled plasma mass spectrometry to obtain reproducible compositions in every batch. In future, the elemental analysis can be carried out as described earlier by other researchers.53,54\nXRD analysis of NPs represented in Figure 6 shows several size-dependent features leading to irregular peak position, height, and width. XRD was mainly carried out to study the crystalline nature of the green-synthesized G. sylvestre SNPs. From the figure, the GSNPs are seen to exhibit monocrystallinity. The XRD peaks at 38.2°, 44.5°, 64.7°, and 77.7° can be indexed to the [111], [200], [220], and [311] planes, indicating that the SNPs are highly crystalline. Similar results were reported for Abelmoschus esculentus, Citrus limon, Citrus reticulate, and Citrus sinensis55,56 and in our previous studies using C. zizanioides.46\nTable 3 shows the characteristic features of the GSNPs using various plant parts of different plant species reported by various researchers along with our previous reports.", "From Figure 7, it can be observed that, as the concentration of the GSNPs increased, the percentage of viable cells decreased in the cytotoxicity studies by MTT assay. The GSNPs were taken up by mammalian cells through different mechanisms such as pinocytosis, endocytosis, and phagocytosis.75 Once the NPs enter the cells, they interact with the cellular materials and cause DNA damage and cell death.\nThe GSNPs at 85 μg/mL concentration showed 95.23% inhibition of HT29 cell growth. The concentration of the NPs was chosen based on the TC ID50 value (results not shown). Another promising result was that G. sylvestre plant extracts alone at 85 μg/mL concentration showed 30.77% inhibition of HT29 cell lines growth. From our results, it can be concluded that the GSNPs could have induced intracellular reactive oxygen species generation, which can be evaluated using intracellular peroxide-dependent oxidation, and caused cell death. The control cells were clustered, healthy, and viable cells (Figure 8A), whereas the HT29 cells’ proliferation was significantly inhibited by GS (Figure 8B). The SNP-treated cells showed increased apoptotic morphological changes (Figure 8C), also the clearly visible cell debris in Figure 8D is due to cell death by 85 μg/mL SNP treatment.\nThese results indicate that the sensitivity of HT29 human colon cancer cell line for cytotoxic drugs is higher than that of the Vero cell line for the same cytotoxic agents. Sahu et al76 have reported the presence of four new tritepenoid saponins, namely gymnemasins A, B, C, and D, from the leaves of G. sylvestre, while Chan has identified the presence of acylation with diangeloyl groups at the C21–22 positions in triterpenoid saponins, which is essential for cytotoxcity toward tumor cells.77 Tang et al78 have reported that saponin could induce apoptosis of U251 cells, and both BAD-mediated intrinsic apoptotic signaling pathway and caspase-8-mediated extrinsic apoptotic signaling pathway were involved in the apoptosis.\nThe promising saponins were further studied as potential anticancer agents by many researchers. Ai et al79 proposed a qualitative method that can be used to recognize the presence or absence of cancer cells with gold NPs for targeted cancer cell imaging and efficient photodynamic therapy. As reported by Raghavendra et al80 the size effects and multifunctionality are the main characteristics of NPs, so our method of one-step synthesis of SNPs using the aqueous extract of G. sylvestre may serve as a potential anticancer drug for cancer therapy. Further studies have to be carried out to understand the nature of cytotoxicity and the death or proliferation of cells caused by GSNPs from G. sylvestre leaf extract.", "The green synthesis of biofunctionalized SNPs from the leaves of G. sylvestre was economical, nontoxic, and environmentally benign. Due to the reducing and capping nature of the bioactive phytocompounds present in the aqueous extract of G. sylvestre, a cap was formed around the silver ions of the biofunctionalized SNPs which were stable. The presence of the functional group of the bioactive compounds was confirmed by FTIR spectra. The particle size and the spherical shape of the SNPs were determined by XRD and SEM analyses. Since the plant extract and the biofunctionalized SNPs showed anticancer activity against cancer cells, G. sylvestre may serve as a source for potential anticancer drugs. The present study showed the anticancer activities of both the bioactive compounds of the leaf extract and the biofunctionalized SNPs synthesized against HT29 human adenocarcinoma cells in vitro. Our studies provide an important basis for the application of NPs for in vitro anticancer activity against human colon adenocarcinoma cells. Our earlier reports have also shown the potential antiulcer properties of G. sylvestre in mice.13 So GSS is a good plant candidate for further studies in alternative medicine due its multifunctional medical properties" ]

[ null, null, null, null, null, null, null, null, null, null, null, null ]

[ "Introduction", "Materials and methods", "Collection of plants", "Preparation of aqueous extract", "Qualitative and quantitative phytochemical analysis", "Synthesis of SNPs", "Characterization of SNPs", "In vitro anticancer activity", "Cell line and culture medium", "Cell viability by MTT assay", "Morphological changes", "Results", "Phytochemical screening of G. sylvestre leaf extract", "Characterization of biofunctionalized SNPs", "In vitro anticancer activity", "Conclusion" ]

[ "For treatment of various diseases, bioactive components from medicinal plants that are similar to chemical compounds are used.1 In recent years, the use of ethno-botanical information in medicinal plant research has gained considerable attention in some segments of the scientific community.2 In one of the ethno-botanical surveys of medicinal plants commonly used by the Kani tribals in Tirunelveli hills of the Western Ghats in Tamil Nadu, India, it was revealed that Gymneme sylvestre is the most important species based on its use.2 The use of plant parts and isolated phytochemicals for the prevention and treatment of various health ailments has been in practice for many decades.3\nG. sylvestre R. Br, commonly known as “Meshasringi”, is distributed over most of India and has a reputation in traditional medicine as a stomachic, diuretic, and a remedy to control diabetes mellitus. G. sylvestre R. Br4 is a woody, climbing plant that grows in the tropical forests of Central and Southern India and in parts of Asia.5 It is a pubescent shrub with young stems and branches, and has a distichous phyllotactic opposite arrangement pattern of leaves which are 2.5–6 cm long and are usually ovate or elliptical. The flowers are small, yellow, and in umbellate cymes, and the follicles are terete, lanceolate, and up to 3 inches in length.6\nIn homeopathy, as well as in folk and ayurvedic medicine, G. sylvestre has been used for diabetes treatment.7\nG. sylvestre has bioactive components that can cure asthma, eye ailments, snakebite, piles, chronic cough, breathing troubles, colic pain, cardiopathy, constipation, dyspepsia, hemorrhoids, and hepatosplenomegaly, as well as assist in family planning.8 In addition, it also possesses antimicrobial,9 antitumor,5 anti-obesity,10 anti-inflammatory,11 anti-hyperglycemic,12 antiulcer, anti-stress, and antiallergic activity.13\nThe presence of flavonoids, saponins, anthraquinones, quercitol, and other alkaloid have been reported in the flowers, leaves, and fruits of G. sylvestre.14 The presence of other therapeutic agents, such as gymnemagenin, gymnemic acids, gymnemanol, and β-amyrin-related glycosides, which play a key role in therapeutic applications, have also been reported. The focus of the present work is to assess the potential therapeutic medicinal value of this herb and to understand/enhance the mechanistic action of their bioactive components.14\nG. sylvestre contains triterpenes, saponins, and gymnemic acids belonging to the oleane and dammarene classes.15,16 The plant extract has also tested positive for alkaloids, acidic glycosides, and anthraquinone derivatives. Oleanane saponins are gymnemic acids and gymnema saponins, while dammarene saponins are gymnemasides.\nAs reported by Thakur et al14 the aqueous extracts of the G. sylvestre leaves showed the presence of gymnemic acids Ι–VΙ, while the saponin fraction of the leaves tested positive for the presence of gymnemic acids XV–XVIII. The gymnemic acid derivative of gymnemagenin was elucidated from the fraction VIII–XII, which is responsible for the antidiabetic activity, and the fraction VIII stimulates the pancreas for insulin secretion. The novel D-glucoside structure with anti-sweet principle is present in the I–V saponin fraction. The presence of pentatriacontane, α- and β-chlorophylls, phytin, resins, D-quercitol, tartaric acid, formic acid, butyric acid, lupeol, and stigmasterol has been reported as other plant constituents of G. sylvestre,14 while the extract has also been tested positive for alkaloids.13,17\nSharma et al have reported the antioxidant activity of oleane saponins from G. sylvestre plant extract and determined the IC50 values for 2,2-diphenylpicrylhydrazyl (DPPH) scavenging, superoxide radical scavenging, inhibition of in vitro lipid peroxidation, and protein carbonyl formation as 238 μg/mL, 140 μg/mL, 99 μg/mL, and 28 μg/mL, respectively, which may be due to the presence of flavonoids, phenols, tannins, and triterpenoids.18 The enhanced radiation (8 Gy)-induced augmentation of lipid peroxidation and depletion of glutathione and protein in mouse brain were reported by Sharma et al18 using multiherbal ayurvedic formulations containing extracts of G. sylvestre, such as “Hyponidd” and “Dihar”. They also demonstrated the antioxidant activity by increasing the levels of superoxide dismutase, glutathione, and catalase in rats through in vivo studies.19\nKang et al20 proved the role of antioxidants from G. sylvestre in diabetic rats using ethanolic extracts. Using several antioxidant assays, eg, thiobarbituric acid assay with slight modifications, egg yolk lecithin or 2-deoxyribose (associated with lipid peroxidation) assay, superoxide dismutase-like activity assay, and 2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonic acid) assay.\nThe potent anticancer activity of G. sylvestre against the human lung adenocarcinoma cell lines (A549) and human breast carcinoma cell lines (MCF7) using alcoholic extracts of the herb has been reported by Srikant et al.21 Also, Amaki et al22 reported the inhibition of the breast cancer resistance protein using the alcoholic extract of G. sylvestre.\nMany plant-derived saponins, eg, ginsenosides, soyasaponins, and saikosaponins, have been found to exhibit significant anticancer activity. The anticancer activity of gymnemagenol on HeLa cancer cell lines in in vitro conditions was determined by the MTT cell proliferation assay for cytotoxic activity of saponins. Using 5 μg/mL, 15 μg/mL, 25 μg/mL, and 50 μg/mL concentrations of gymnemagenol, the IC50 value was found to be 37 μg/mL after 96 hours. The isolated bioactive constituent, gymnemagenol, showed a high degree of inhibition to HeLa cancer cell line proliferation, and saponins were not found to be toxic to the growth of normal cells under in vitro conditions.23\nAlready many researchers have reported that the leaves of G. sylvestre lower blood sugar, stimulate the heart, uterus, and circulatory systems, and exhibit anti-sweet and hepatoprotective activities.20,24–31 Administration of G. sylvestre extract to diabetic rats increased superoxide dismutase activity and decreased lipid peroxide by either directly scavenging the reactive oxygen species, due to the presence of various antioxidant compounds, or by increasing the synthesis of antioxidant molecules (albumin and uric acid).24,30,32\nTherefore, in this study, an attempt was made to synthesize the silver nanoparticles (SNPs) from aqueous extracts of the G. sylvestre leaves. These green-synthesized SNPs (GSNPs) of G. sylvestre were examined by ultraviolet–visible (UV–vis) spectroscopy, scanning electron microscopy (SEM), energy dispersive X-ray analysis (EDAX), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) analysis for studying their size and shape. The synthesized and well-characterized nanoparticles (NPs) were tested for their cytotoxicity effect. Our findings clearly demonstrate that it is indeed possible to have a much greener way to synthesize SNPs without compromising their antibacterial properties and thus plant extracts may prove to be a good alternative to obtain such NPs with improved antibacterial and antiviral properties for diabetic wound healing applications. Goix et al33 and Boholm and Arvidsson34 have pointed out that silver is either beneficial or harmful in relation to four main values: the environment, health, sewage treatment, and product effectiveness. As reported by Barua et al35 poly(ethylene glycol)-stabilized colloidal SNPs showed the nonhazardous anticancer and antibacterial properties. Jin et al36 have reported the therapeutic applications of plant-extract-based scaffolds for wound healing and skin reconstitution studies.", " Collection of plants Fresh leaves of G. sylvestre from plants of same age group of a single population were collected from the experimental Herbal Garden, Tamil University, Thanjavur, Tamil Nadu, India, in July, 2010. The herbarium was prepared for authentication (Ref No: SRM\\CENR\\PTC\\2010\\03), and taxonomic identification was done by Dr Jayaraman, Professor, Department of Botany, Madras Christian College, Tambaram, Chennai, Tamil Nadu. The herb sample is maintained in the research laboratory for further reference.\nFresh leaves of G. sylvestre from plants of same age group of a single population were collected from the experimental Herbal Garden, Tamil University, Thanjavur, Tamil Nadu, India, in July, 2010. The herbarium was prepared for authentication (Ref No: SRM\\CENR\\PTC\\2010\\03), and taxonomic identification was done by Dr Jayaraman, Professor, Department of Botany, Madras Christian College, Tambaram, Chennai, Tamil Nadu. The herb sample is maintained in the research laboratory for further reference.\n Preparation of aqueous extract The leaves of G. sylvestre were washed with distilled water to remove the dirt and further washed with mild soap solution and rinsed thrice with distilled water. The leaves were blot-dried with tissue paper and shade dried at room temperature for 2 weeks. After complete drying, the leaves were cut into small pieces and powdered in a mixer and sieved using a 20-μm mesh sieve to get a uniform size range for further studies. Twenty grams of the sieved leaf powder was added to 100 mL of sterile distilled water in a 500-mL Erlenmeyer flask and boiled for 5 minutes. The flask was kept under continuous dark conditions at 30°C in a shaker. The extract was filtered and stored in an airtight container and protected from sunlight for further use.37\nThe leaves of G. sylvestre were washed with distilled water to remove the dirt and further washed with mild soap solution and rinsed thrice with distilled water. The leaves were blot-dried with tissue paper and shade dried at room temperature for 2 weeks. After complete drying, the leaves were cut into small pieces and powdered in a mixer and sieved using a 20-μm mesh sieve to get a uniform size range for further studies. Twenty grams of the sieved leaf powder was added to 100 mL of sterile distilled water in a 500-mL Erlenmeyer flask and boiled for 5 minutes. The flask was kept under continuous dark conditions at 30°C in a shaker. The extract was filtered and stored in an airtight container and protected from sunlight for further use.37\n Qualitative and quantitative phytochemical analysis The qualitative phytochemical analysis of G. sylvestre extracts were performed following the methods of Parekh and Chanda38 to determine the presence of alkaloids (Mayer, Wagner, Dragendorff), flavonoids (alkaline reagent, Shinoda), phenolics (lead acetate, alkaline reagent test), triterpenes (Liberman-Burchard test), saponins (foam test), and tannins (gelatin).39 The results were qualitatively expressed as positive (+) or negative (−).40 The chemicals used for the study were purchased from Sigma-Aldrich (Chennai, India).\nPhytochemical quantitative analyses are described briefly in our previous paper.13 The total phenolic content was measured using the Folin–Ciocalteu colorimetric method. The flavonoids were estimated using aluminum chloride colorimetric method. Gallic acid was used as standard for the analysis of total antioxidant capacity, and the DPPH radical scavenging activity was done following the methods described by Blios.41\nThe qualitative phytochemical analysis of G. sylvestre extracts were performed following the methods of Parekh and Chanda38 to determine the presence of alkaloids (Mayer, Wagner, Dragendorff), flavonoids (alkaline reagent, Shinoda), phenolics (lead acetate, alkaline reagent test), triterpenes (Liberman-Burchard test), saponins (foam test), and tannins (gelatin).39 The results were qualitatively expressed as positive (+) or negative (−).40 The chemicals used for the study were purchased from Sigma-Aldrich (Chennai, India).\nPhytochemical quantitative analyses are described briefly in our previous paper.13 The total phenolic content was measured using the Folin–Ciocalteu colorimetric method. The flavonoids were estimated using aluminum chloride colorimetric method. Gallic acid was used as standard for the analysis of total antioxidant capacity, and the DPPH radical scavenging activity was done following the methods described by Blios.41\n Synthesis of SNPs Silver nitrate (AgNO3) was purchased from Sigma-Aldrich (St Louis, MO, USA), and all solutions were freshly made for the synthesis of SNPs. The aqueous leaf extract of G. sylvestre was used for the bioreduction synthesis of the NPs. The SNPs were synthesized by adding 5 mL of plant extract to 15 mL of 1 mM aqueous AgNO3 solution in a 250-mL Erlenmeyer flask and incubated in a rotary shaker at 150 rpm in dark. The synthesis of NPs was confirmed spectrophotometrically at every 30-minute interval till no reduction was observed. The reduction was observed by the color change in the colloidal solution, which confirmed the formation of SNPs.42,43\nSilver nitrate (AgNO3) was purchased from Sigma-Aldrich (St Louis, MO, USA), and all solutions were freshly made for the synthesis of SNPs. The aqueous leaf extract of G. sylvestre was used for the bioreduction synthesis of the NPs. The SNPs were synthesized by adding 5 mL of plant extract to 15 mL of 1 mM aqueous AgNO3 solution in a 250-mL Erlenmeyer flask and incubated in a rotary shaker at 150 rpm in dark. The synthesis of NPs was confirmed spectrophotometrically at every 30-minute interval till no reduction was observed. The reduction was observed by the color change in the colloidal solution, which confirmed the formation of SNPs.42,43\n Characterization of SNPs The GSNPs were characterized periodically by measuring the bioreduction of AgNO3 using a UV–vis 3000+ double-beam spectrophotometer (Lab India, Maharashtra, India). The spectrometric range was 200–800 nm, and scanning interval was 0.5 nm.\nThe surface morphology of the biofunctionalized SNPs was characterized by high-resolution SEM analysis (JSM-5600LV; JEOL, Tokyo, Japan) and the elemental compositions were determined by EDAX analysis (S-3400N; Hitachi, Tokyo, Japan). The functional characterization of biomolecules present in the GSNPs from the leaf extract of G. sylvestre was done by FTIR spectrometry (RX1; Perkin-Elmer, Waltham, MA, USA).44\nThe crystal lattice and the size of the synthesized NPs were determined by XRD measurements using an XRD-6000 X-ray diffractometer (Shimadzu, Kyoto, Japan). The crystal-lite domain size was calculated from the width of the XRD peaks, as described in our previous papers.17,45–47\nThe GSNPs were characterized periodically by measuring the bioreduction of AgNO3 using a UV–vis 3000+ double-beam spectrophotometer (Lab India, Maharashtra, India). The spectrometric range was 200–800 nm, and scanning interval was 0.5 nm.\nThe surface morphology of the biofunctionalized SNPs was characterized by high-resolution SEM analysis (JSM-5600LV; JEOL, Tokyo, Japan) and the elemental compositions were determined by EDAX analysis (S-3400N; Hitachi, Tokyo, Japan). The functional characterization of biomolecules present in the GSNPs from the leaf extract of G. sylvestre was done by FTIR spectrometry (RX1; Perkin-Elmer, Waltham, MA, USA).44\nThe crystal lattice and the size of the synthesized NPs were determined by XRD measurements using an XRD-6000 X-ray diffractometer (Shimadzu, Kyoto, Japan). The crystal-lite domain size was calculated from the width of the XRD peaks, as described in our previous papers.17,45–47\n In vitro anticancer activity Cell line and culture medium Vero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\nVero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\n Cell viability by MTT assay MTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\nMTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\n Morphological changes The cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49\nThe cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49\n Cell line and culture medium Vero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\nVero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\n Cell viability by MTT assay MTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\nMTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\n Morphological changes The cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49\nThe cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49", "Fresh leaves of G. sylvestre from plants of same age group of a single population were collected from the experimental Herbal Garden, Tamil University, Thanjavur, Tamil Nadu, India, in July, 2010. The herbarium was prepared for authentication (Ref No: SRM\\CENR\\PTC\\2010\\03), and taxonomic identification was done by Dr Jayaraman, Professor, Department of Botany, Madras Christian College, Tambaram, Chennai, Tamil Nadu. The herb sample is maintained in the research laboratory for further reference.", "The leaves of G. sylvestre were washed with distilled water to remove the dirt and further washed with mild soap solution and rinsed thrice with distilled water. The leaves were blot-dried with tissue paper and shade dried at room temperature for 2 weeks. After complete drying, the leaves were cut into small pieces and powdered in a mixer and sieved using a 20-μm mesh sieve to get a uniform size range for further studies. Twenty grams of the sieved leaf powder was added to 100 mL of sterile distilled water in a 500-mL Erlenmeyer flask and boiled for 5 minutes. The flask was kept under continuous dark conditions at 30°C in a shaker. The extract was filtered and stored in an airtight container and protected from sunlight for further use.37", "The qualitative phytochemical analysis of G. sylvestre extracts were performed following the methods of Parekh and Chanda38 to determine the presence of alkaloids (Mayer, Wagner, Dragendorff), flavonoids (alkaline reagent, Shinoda), phenolics (lead acetate, alkaline reagent test), triterpenes (Liberman-Burchard test), saponins (foam test), and tannins (gelatin).39 The results were qualitatively expressed as positive (+) or negative (−).40 The chemicals used for the study were purchased from Sigma-Aldrich (Chennai, India).\nPhytochemical quantitative analyses are described briefly in our previous paper.13 The total phenolic content was measured using the Folin–Ciocalteu colorimetric method. The flavonoids were estimated using aluminum chloride colorimetric method. Gallic acid was used as standard for the analysis of total antioxidant capacity, and the DPPH radical scavenging activity was done following the methods described by Blios.41", "Silver nitrate (AgNO3) was purchased from Sigma-Aldrich (St Louis, MO, USA), and all solutions were freshly made for the synthesis of SNPs. The aqueous leaf extract of G. sylvestre was used for the bioreduction synthesis of the NPs. The SNPs were synthesized by adding 5 mL of plant extract to 15 mL of 1 mM aqueous AgNO3 solution in a 250-mL Erlenmeyer flask and incubated in a rotary shaker at 150 rpm in dark. The synthesis of NPs was confirmed spectrophotometrically at every 30-minute interval till no reduction was observed. The reduction was observed by the color change in the colloidal solution, which confirmed the formation of SNPs.42,43", "The GSNPs were characterized periodically by measuring the bioreduction of AgNO3 using a UV–vis 3000+ double-beam spectrophotometer (Lab India, Maharashtra, India). The spectrometric range was 200–800 nm, and scanning interval was 0.5 nm.\nThe surface morphology of the biofunctionalized SNPs was characterized by high-resolution SEM analysis (JSM-5600LV; JEOL, Tokyo, Japan) and the elemental compositions were determined by EDAX analysis (S-3400N; Hitachi, Tokyo, Japan). The functional characterization of biomolecules present in the GSNPs from the leaf extract of G. sylvestre was done by FTIR spectrometry (RX1; Perkin-Elmer, Waltham, MA, USA).44\nThe crystal lattice and the size of the synthesized NPs were determined by XRD measurements using an XRD-6000 X-ray diffractometer (Shimadzu, Kyoto, Japan). The crystal-lite domain size was calculated from the width of the XRD peaks, as described in our previous papers.17,45–47", " Cell line and culture medium Vero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\nVero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17\n Cell viability by MTT assay MTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\nMTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48\n Morphological changes The cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49\nThe cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49", "Vero cell line (derived from the normal kidney of adult monkeys) and human adenocarcinoma colon HT29 cells were purchased from the National Center for Cell Sciences, Pune, India. The cells were cultured under standard conditions in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 U/mL of streptomycin in a humidified incubator set at 37°C with 5% CO2.17", "MTT assay was performed to determine the cytotoxic properties of biofunctionalized SNPs against HT29 cell lines by adding 1×105 cells/well in 12-well plates and incubated with various concentrations of biofunctionalized particles (83 μg/mL, 84 μg/mL, and 85 μg/mL). Vero cells were used as a monolayer for culturing the HT29 cells. The cell lines were seeded in 96-well tissue culture plates and the appropriate concentrations of GSNP stock solutions were added to the cultures to obtain the respective concentration of the NPs and incubated for 48 hours at 37°C. The untreated cells were used as control. The incubated cultured cells were subjected to MTT colorimetric assay. All assays were performed in triplicate, and the aqueous leaf extract of the G. sylvestre were also similarly assayed for the anticancer activity for comparison.17,48", "The cytotoxicity effects were observed using an inverted microscope, and the morphological changes were photographed.49", " Phytochemical screening of G. sylvestre leaf extract The preliminary phytochemical screening of aqueous extracts of G. sylvestre revealed the presence of alkaloids, phenols, flavonoids, sterols, tannins, and triterpenes (Table 1). As shown in Table 2, 125.62±26.84 μg/g of total flavonoids, 285.23±1.11 μg/g of total phenols, and 111.53±15.13 μg/g of tannin were present in the aqueous extract of G. sylvestre. The flavonoids and phenolic compounds exhibited a wide range of biological activities, such as antioxidant and lipid peroxidation inhibition.13\nThe estimated total antioxidant activity was 9.13±0.04 μg/g and the DPPH radical scavenging activity was 52.14%±0.32% (Table 2).\nThe preliminary phytochemical screening of aqueous extracts of G. sylvestre revealed the presence of alkaloids, phenols, flavonoids, sterols, tannins, and triterpenes (Table 1). As shown in Table 2, 125.62±26.84 μg/g of total flavonoids, 285.23±1.11 μg/g of total phenols, and 111.53±15.13 μg/g of tannin were present in the aqueous extract of G. sylvestre. The flavonoids and phenolic compounds exhibited a wide range of biological activities, such as antioxidant and lipid peroxidation inhibition.13\nThe estimated total antioxidant activity was 9.13±0.04 μg/g and the DPPH radical scavenging activity was 52.14%±0.32% (Table 2).\n Characterization of biofunctionalized SNPs The color change observed in the aqueous silver nitrate solution showed that the SNPs were formed rapidly within 30 minutes of incubation of the plant extract with aqueous AgNO3 solution. The colorless solution changed to ruby red, confirming the formation of SNPs (Figure 1). The intensity of the red color increased with time because of the excited surface plasmon resonance effect and reduced AgNO3. The control aqueous AgNO3 solution (without leaf extract) showed no change of color with time and was taken as the blank reference.\nUV–vis spectrometry is a reliable and reproducible technique that can be used to accurately characterize the metal NPs though it does not provide direct information regarding the particle sizes. The surface plasmon bands (absorbance spectra) are influenced by the size and shape of the NPs produced, along with the dielectric constant of the surrounding media.\nFigure 2 shows the time-dependent intensity of the absorption band, which reached its maximum peak at 12 hours, after which no further change in the spectrum was observed indicating that the precursors had been consumed. Initially, the UV–vis spectrum did not show evidence of any absorption in the region 350–600 nm, but after the addition of extract a distinct band was observed at 432 nm.\nWhen silver nitrate was added to the aqueous plant extract of G. sylvestre, it was reduced to SNPs by the aldehyde group present in the flavonoids (125.6 μg/g), which was further oxidized to the carboxyl group. Also, the carboxyl groups of the phenols from the G. sylvestre extract (285.23 μg/g) acted as a surfactant to attach the major phytochemicals from the plant extract to the surface of the SNPs. Our previous study on the synthesis of SNPs using aqueous extracts of Memecylon edule,37\nMemecylon umbellatum,47\nChrysopogon zizanioides46 and Indigofera aspalathoides50 showed that the color of the reaction mixture during the formation of GSNPs changed to ruby red color from colorless/straw color. Our results are also comparable with the other available reports for plant-extract-mediated synthesis of SNPs.\nFrom Figure 3, it is clear that the synthesized SNPs were approximately spherical and of different sizes. The SEM images in the figure clearly indicated a thin layer of phytochemicals from the plant extract covering the synthesized SNPs. Mostly the total phenolic content, flavonoids, and tannins were responsible for the bioreduction of the SNPs. In this green synthesis, the phytochemicals from the plant extract acted as a surfactant to prevent the aggregation of the synthesized SNPs. The SEM images of our earlier research had revealed that this biologically eco-friendly synthesis of NPs utilizing the leaf extracts of M. edule,37\nC. zizanioides,46 and M. umbellatum47 showed no aggregation due to the biomolecules from the plant extract. And the mechanism behind this particle formation with no aggregation may be the spontaneous nucleation and isotropic growth of NPs along with the plant extract. As these chains grow in diameter with increasing silver deposition, spherical particles break off from these structures forming nanospherical particles which can be typically observed from this synthesis.51\nThe elemental composition of green-synthesized AgNPs was analyzed through EDAX. These measurements confirmed the presence of the elementary silver signal of the SNPs. The vertical axis displays the number of X-ray counts and the horizontal axis displays the energy in keV.\nThe EDAX spectrum of the biofunctionalized SNPs in Figure 4 clearly shows the strong signals from silver atoms along with the weaker signals from carbon and oxygen present from biomolecules of the plant extract. The elemental silver peak at 2–4 keV, which is the major emission peak specified for metallic silver, with minor peaks of C and O were also seen due to the capping of Ag NPs by the biomolecules of G. sylvestre leaf extract, and the absence of other peaks evidenced the purity of the Ag NPs.\nFTIR analysis in Figure 5 shows that the SNPs produced by G. sylvestre extract were coated by phytocompounds and secondary metabolites such as saponins, terpenoids, and gymnemagenin derivative of gymnemic acid containing the functional groups of amines, aldehydes, carboxylic acids, and alcohols.\nThe presence of the amide linkages seen in Figure 5 suggests that the different functional groups of the proteins present in the plant extracts might be capping the NPs and playing an important role in the stabilization of the green NPs formed. The band at 1,443 cm−1 was assigned to the methylene scissoring vibrations of proteins, and the bands located at 1,318 cm−1 and 1,089 cm−1 are due to the C–N stretching vibration of aromatic and aliphatic amines, respectively, which agrees with earlier reports of Suman et al.52\nThe positions of these bands were comparable to those reported for phytochemicals reported in the G. sylvestre extract as total phenols, flavonoids, and tannins (Table 2). Thus, we can confirm that the nanocapping of the phytochemicals from the G. sylvestre extract is responsible for the reduction and subsequent stabilization of the SNPs. The absorption bands that appear in the IR spectrum of the aqueous extract could also be seen in the IR spectra of phyto-capped Ag NPs, confirming the role of the phyto constituents (mostly gymnemic acid) in protecting the Ag NPs from aggregation.\nAlso, during our repeated experiments there were no batch-to-batch variations in size, regardless of the isotopic composition, and the particles diameters of the SNPs formed were known to a high degree of accuracy. A detailed study on the large-scale synthesis and elemental composition on the synthesized NPs can be carried out using inductively coupled plasma mass spectrometry to obtain reproducible compositions in every batch. In future, the elemental analysis can be carried out as described earlier by other researchers.53,54\nXRD analysis of NPs represented in Figure 6 shows several size-dependent features leading to irregular peak position, height, and width. XRD was mainly carried out to study the crystalline nature of the green-synthesized G. sylvestre SNPs. From the figure, the GSNPs are seen to exhibit monocrystallinity. The XRD peaks at 38.2°, 44.5°, 64.7°, and 77.7° can be indexed to the [111], [200], [220], and [311] planes, indicating that the SNPs are highly crystalline. Similar results were reported for Abelmoschus esculentus, Citrus limon, Citrus reticulate, and Citrus sinensis55,56 and in our previous studies using C. zizanioides.46\nTable 3 shows the characteristic features of the GSNPs using various plant parts of different plant species reported by various researchers along with our previous reports.\nThe color change observed in the aqueous silver nitrate solution showed that the SNPs were formed rapidly within 30 minutes of incubation of the plant extract with aqueous AgNO3 solution. The colorless solution changed to ruby red, confirming the formation of SNPs (Figure 1). The intensity of the red color increased with time because of the excited surface plasmon resonance effect and reduced AgNO3. The control aqueous AgNO3 solution (without leaf extract) showed no change of color with time and was taken as the blank reference.\nUV–vis spectrometry is a reliable and reproducible technique that can be used to accurately characterize the metal NPs though it does not provide direct information regarding the particle sizes. The surface plasmon bands (absorbance spectra) are influenced by the size and shape of the NPs produced, along with the dielectric constant of the surrounding media.\nFigure 2 shows the time-dependent intensity of the absorption band, which reached its maximum peak at 12 hours, after which no further change in the spectrum was observed indicating that the precursors had been consumed. Initially, the UV–vis spectrum did not show evidence of any absorption in the region 350–600 nm, but after the addition of extract a distinct band was observed at 432 nm.\nWhen silver nitrate was added to the aqueous plant extract of G. sylvestre, it was reduced to SNPs by the aldehyde group present in the flavonoids (125.6 μg/g), which was further oxidized to the carboxyl group. Also, the carboxyl groups of the phenols from the G. sylvestre extract (285.23 μg/g) acted as a surfactant to attach the major phytochemicals from the plant extract to the surface of the SNPs. Our previous study on the synthesis of SNPs using aqueous extracts of Memecylon edule,37\nMemecylon umbellatum,47\nChrysopogon zizanioides46 and Indigofera aspalathoides50 showed that the color of the reaction mixture during the formation of GSNPs changed to ruby red color from colorless/straw color. Our results are also comparable with the other available reports for plant-extract-mediated synthesis of SNPs.\nFrom Figure 3, it is clear that the synthesized SNPs were approximately spherical and of different sizes. The SEM images in the figure clearly indicated a thin layer of phytochemicals from the plant extract covering the synthesized SNPs. Mostly the total phenolic content, flavonoids, and tannins were responsible for the bioreduction of the SNPs. In this green synthesis, the phytochemicals from the plant extract acted as a surfactant to prevent the aggregation of the synthesized SNPs. The SEM images of our earlier research had revealed that this biologically eco-friendly synthesis of NPs utilizing the leaf extracts of M. edule,37\nC. zizanioides,46 and M. umbellatum47 showed no aggregation due to the biomolecules from the plant extract. And the mechanism behind this particle formation with no aggregation may be the spontaneous nucleation and isotropic growth of NPs along with the plant extract. As these chains grow in diameter with increasing silver deposition, spherical particles break off from these structures forming nanospherical particles which can be typically observed from this synthesis.51\nThe elemental composition of green-synthesized AgNPs was analyzed through EDAX. These measurements confirmed the presence of the elementary silver signal of the SNPs. The vertical axis displays the number of X-ray counts and the horizontal axis displays the energy in keV.\nThe EDAX spectrum of the biofunctionalized SNPs in Figure 4 clearly shows the strong signals from silver atoms along with the weaker signals from carbon and oxygen present from biomolecules of the plant extract. The elemental silver peak at 2–4 keV, which is the major emission peak specified for metallic silver, with minor peaks of C and O were also seen due to the capping of Ag NPs by the biomolecules of G. sylvestre leaf extract, and the absence of other peaks evidenced the purity of the Ag NPs.\nFTIR analysis in Figure 5 shows that the SNPs produced by G. sylvestre extract were coated by phytocompounds and secondary metabolites such as saponins, terpenoids, and gymnemagenin derivative of gymnemic acid containing the functional groups of amines, aldehydes, carboxylic acids, and alcohols.\nThe presence of the amide linkages seen in Figure 5 suggests that the different functional groups of the proteins present in the plant extracts might be capping the NPs and playing an important role in the stabilization of the green NPs formed. The band at 1,443 cm−1 was assigned to the methylene scissoring vibrations of proteins, and the bands located at 1,318 cm−1 and 1,089 cm−1 are due to the C–N stretching vibration of aromatic and aliphatic amines, respectively, which agrees with earlier reports of Suman et al.52\nThe positions of these bands were comparable to those reported for phytochemicals reported in the G. sylvestre extract as total phenols, flavonoids, and tannins (Table 2). Thus, we can confirm that the nanocapping of the phytochemicals from the G. sylvestre extract is responsible for the reduction and subsequent stabilization of the SNPs. The absorption bands that appear in the IR spectrum of the aqueous extract could also be seen in the IR spectra of phyto-capped Ag NPs, confirming the role of the phyto constituents (mostly gymnemic acid) in protecting the Ag NPs from aggregation.\nAlso, during our repeated experiments there were no batch-to-batch variations in size, regardless of the isotopic composition, and the particles diameters of the SNPs formed were known to a high degree of accuracy. A detailed study on the large-scale synthesis and elemental composition on the synthesized NPs can be carried out using inductively coupled plasma mass spectrometry to obtain reproducible compositions in every batch. In future, the elemental analysis can be carried out as described earlier by other researchers.53,54\nXRD analysis of NPs represented in Figure 6 shows several size-dependent features leading to irregular peak position, height, and width. XRD was mainly carried out to study the crystalline nature of the green-synthesized G. sylvestre SNPs. From the figure, the GSNPs are seen to exhibit monocrystallinity. The XRD peaks at 38.2°, 44.5°, 64.7°, and 77.7° can be indexed to the [111], [200], [220], and [311] planes, indicating that the SNPs are highly crystalline. Similar results were reported for Abelmoschus esculentus, Citrus limon, Citrus reticulate, and Citrus sinensis55,56 and in our previous studies using C. zizanioides.46\nTable 3 shows the characteristic features of the GSNPs using various plant parts of different plant species reported by various researchers along with our previous reports.\n In vitro anticancer activity From Figure 7, it can be observed that, as the concentration of the GSNPs increased, the percentage of viable cells decreased in the cytotoxicity studies by MTT assay. The GSNPs were taken up by mammalian cells through different mechanisms such as pinocytosis, endocytosis, and phagocytosis.75 Once the NPs enter the cells, they interact with the cellular materials and cause DNA damage and cell death.\nThe GSNPs at 85 μg/mL concentration showed 95.23% inhibition of HT29 cell growth. The concentration of the NPs was chosen based on the TC ID50 value (results not shown). Another promising result was that G. sylvestre plant extracts alone at 85 μg/mL concentration showed 30.77% inhibition of HT29 cell lines growth. From our results, it can be concluded that the GSNPs could have induced intracellular reactive oxygen species generation, which can be evaluated using intracellular peroxide-dependent oxidation, and caused cell death. The control cells were clustered, healthy, and viable cells (Figure 8A), whereas the HT29 cells’ proliferation was significantly inhibited by GS (Figure 8B). The SNP-treated cells showed increased apoptotic morphological changes (Figure 8C), also the clearly visible cell debris in Figure 8D is due to cell death by 85 μg/mL SNP treatment.\nThese results indicate that the sensitivity of HT29 human colon cancer cell line for cytotoxic drugs is higher than that of the Vero cell line for the same cytotoxic agents. Sahu et al76 have reported the presence of four new tritepenoid saponins, namely gymnemasins A, B, C, and D, from the leaves of G. sylvestre, while Chan has identified the presence of acylation with diangeloyl groups at the C21–22 positions in triterpenoid saponins, which is essential for cytotoxcity toward tumor cells.77 Tang et al78 have reported that saponin could induce apoptosis of U251 cells, and both BAD-mediated intrinsic apoptotic signaling pathway and caspase-8-mediated extrinsic apoptotic signaling pathway were involved in the apoptosis.\nThe promising saponins were further studied as potential anticancer agents by many researchers. Ai et al79 proposed a qualitative method that can be used to recognize the presence or absence of cancer cells with gold NPs for targeted cancer cell imaging and efficient photodynamic therapy. As reported by Raghavendra et al80 the size effects and multifunctionality are the main characteristics of NPs, so our method of one-step synthesis of SNPs using the aqueous extract of G. sylvestre may serve as a potential anticancer drug for cancer therapy. Further studies have to be carried out to understand the nature of cytotoxicity and the death or proliferation of cells caused by GSNPs from G. sylvestre leaf extract.\nFrom Figure 7, it can be observed that, as the concentration of the GSNPs increased, the percentage of viable cells decreased in the cytotoxicity studies by MTT assay. The GSNPs were taken up by mammalian cells through different mechanisms such as pinocytosis, endocytosis, and phagocytosis.75 Once the NPs enter the cells, they interact with the cellular materials and cause DNA damage and cell death.\nThe GSNPs at 85 μg/mL concentration showed 95.23% inhibition of HT29 cell growth. The concentration of the NPs was chosen based on the TC ID50 value (results not shown). Another promising result was that G. sylvestre plant extracts alone at 85 μg/mL concentration showed 30.77% inhibition of HT29 cell lines growth. From our results, it can be concluded that the GSNPs could have induced intracellular reactive oxygen species generation, which can be evaluated using intracellular peroxide-dependent oxidation, and caused cell death. The control cells were clustered, healthy, and viable cells (Figure 8A), whereas the HT29 cells’ proliferation was significantly inhibited by GS (Figure 8B). The SNP-treated cells showed increased apoptotic morphological changes (Figure 8C), also the clearly visible cell debris in Figure 8D is due to cell death by 85 μg/mL SNP treatment.\nThese results indicate that the sensitivity of HT29 human colon cancer cell line for cytotoxic drugs is higher than that of the Vero cell line for the same cytotoxic agents. Sahu et al76 have reported the presence of four new tritepenoid saponins, namely gymnemasins A, B, C, and D, from the leaves of G. sylvestre, while Chan has identified the presence of acylation with diangeloyl groups at the C21–22 positions in triterpenoid saponins, which is essential for cytotoxcity toward tumor cells.77 Tang et al78 have reported that saponin could induce apoptosis of U251 cells, and both BAD-mediated intrinsic apoptotic signaling pathway and caspase-8-mediated extrinsic apoptotic signaling pathway were involved in the apoptosis.\nThe promising saponins were further studied as potential anticancer agents by many researchers. Ai et al79 proposed a qualitative method that can be used to recognize the presence or absence of cancer cells with gold NPs for targeted cancer cell imaging and efficient photodynamic therapy. As reported by Raghavendra et al80 the size effects and multifunctionality are the main characteristics of NPs, so our method of one-step synthesis of SNPs using the aqueous extract of G. sylvestre may serve as a potential anticancer drug for cancer therapy. Further studies have to be carried out to understand the nature of cytotoxicity and the death or proliferation of cells caused by GSNPs from G. sylvestre leaf extract.", "The preliminary phytochemical screening of aqueous extracts of G. sylvestre revealed the presence of alkaloids, phenols, flavonoids, sterols, tannins, and triterpenes (Table 1). As shown in Table 2, 125.62±26.84 μg/g of total flavonoids, 285.23±1.11 μg/g of total phenols, and 111.53±15.13 μg/g of tannin were present in the aqueous extract of G. sylvestre. The flavonoids and phenolic compounds exhibited a wide range of biological activities, such as antioxidant and lipid peroxidation inhibition.13\nThe estimated total antioxidant activity was 9.13±0.04 μg/g and the DPPH radical scavenging activity was 52.14%±0.32% (Table 2).", "The color change observed in the aqueous silver nitrate solution showed that the SNPs were formed rapidly within 30 minutes of incubation of the plant extract with aqueous AgNO3 solution. The colorless solution changed to ruby red, confirming the formation of SNPs (Figure 1). The intensity of the red color increased with time because of the excited surface plasmon resonance effect and reduced AgNO3. The control aqueous AgNO3 solution (without leaf extract) showed no change of color with time and was taken as the blank reference.\nUV–vis spectrometry is a reliable and reproducible technique that can be used to accurately characterize the metal NPs though it does not provide direct information regarding the particle sizes. The surface plasmon bands (absorbance spectra) are influenced by the size and shape of the NPs produced, along with the dielectric constant of the surrounding media.\nFigure 2 shows the time-dependent intensity of the absorption band, which reached its maximum peak at 12 hours, after which no further change in the spectrum was observed indicating that the precursors had been consumed. Initially, the UV–vis spectrum did not show evidence of any absorption in the region 350–600 nm, but after the addition of extract a distinct band was observed at 432 nm.\nWhen silver nitrate was added to the aqueous plant extract of G. sylvestre, it was reduced to SNPs by the aldehyde group present in the flavonoids (125.6 μg/g), which was further oxidized to the carboxyl group. Also, the carboxyl groups of the phenols from the G. sylvestre extract (285.23 μg/g) acted as a surfactant to attach the major phytochemicals from the plant extract to the surface of the SNPs. Our previous study on the synthesis of SNPs using aqueous extracts of Memecylon edule,37\nMemecylon umbellatum,47\nChrysopogon zizanioides46 and Indigofera aspalathoides50 showed that the color of the reaction mixture during the formation of GSNPs changed to ruby red color from colorless/straw color. Our results are also comparable with the other available reports for plant-extract-mediated synthesis of SNPs.\nFrom Figure 3, it is clear that the synthesized SNPs were approximately spherical and of different sizes. The SEM images in the figure clearly indicated a thin layer of phytochemicals from the plant extract covering the synthesized SNPs. Mostly the total phenolic content, flavonoids, and tannins were responsible for the bioreduction of the SNPs. In this green synthesis, the phytochemicals from the plant extract acted as a surfactant to prevent the aggregation of the synthesized SNPs. The SEM images of our earlier research had revealed that this biologically eco-friendly synthesis of NPs utilizing the leaf extracts of M. edule,37\nC. zizanioides,46 and M. umbellatum47 showed no aggregation due to the biomolecules from the plant extract. And the mechanism behind this particle formation with no aggregation may be the spontaneous nucleation and isotropic growth of NPs along with the plant extract. As these chains grow in diameter with increasing silver deposition, spherical particles break off from these structures forming nanospherical particles which can be typically observed from this synthesis.51\nThe elemental composition of green-synthesized AgNPs was analyzed through EDAX. These measurements confirmed the presence of the elementary silver signal of the SNPs. The vertical axis displays the number of X-ray counts and the horizontal axis displays the energy in keV.\nThe EDAX spectrum of the biofunctionalized SNPs in Figure 4 clearly shows the strong signals from silver atoms along with the weaker signals from carbon and oxygen present from biomolecules of the plant extract. The elemental silver peak at 2–4 keV, which is the major emission peak specified for metallic silver, with minor peaks of C and O were also seen due to the capping of Ag NPs by the biomolecules of G. sylvestre leaf extract, and the absence of other peaks evidenced the purity of the Ag NPs.\nFTIR analysis in Figure 5 shows that the SNPs produced by G. sylvestre extract were coated by phytocompounds and secondary metabolites such as saponins, terpenoids, and gymnemagenin derivative of gymnemic acid containing the functional groups of amines, aldehydes, carboxylic acids, and alcohols.\nThe presence of the amide linkages seen in Figure 5 suggests that the different functional groups of the proteins present in the plant extracts might be capping the NPs and playing an important role in the stabilization of the green NPs formed. The band at 1,443 cm−1 was assigned to the methylene scissoring vibrations of proteins, and the bands located at 1,318 cm−1 and 1,089 cm−1 are due to the C–N stretching vibration of aromatic and aliphatic amines, respectively, which agrees with earlier reports of Suman et al.52\nThe positions of these bands were comparable to those reported for phytochemicals reported in the G. sylvestre extract as total phenols, flavonoids, and tannins (Table 2). Thus, we can confirm that the nanocapping of the phytochemicals from the G. sylvestre extract is responsible for the reduction and subsequent stabilization of the SNPs. The absorption bands that appear in the IR spectrum of the aqueous extract could also be seen in the IR spectra of phyto-capped Ag NPs, confirming the role of the phyto constituents (mostly gymnemic acid) in protecting the Ag NPs from aggregation.\nAlso, during our repeated experiments there were no batch-to-batch variations in size, regardless of the isotopic composition, and the particles diameters of the SNPs formed were known to a high degree of accuracy. A detailed study on the large-scale synthesis and elemental composition on the synthesized NPs can be carried out using inductively coupled plasma mass spectrometry to obtain reproducible compositions in every batch. In future, the elemental analysis can be carried out as described earlier by other researchers.53,54\nXRD analysis of NPs represented in Figure 6 shows several size-dependent features leading to irregular peak position, height, and width. XRD was mainly carried out to study the crystalline nature of the green-synthesized G. sylvestre SNPs. From the figure, the GSNPs are seen to exhibit monocrystallinity. The XRD peaks at 38.2°, 44.5°, 64.7°, and 77.7° can be indexed to the [111], [200], [220], and [311] planes, indicating that the SNPs are highly crystalline. Similar results were reported for Abelmoschus esculentus, Citrus limon, Citrus reticulate, and Citrus sinensis55,56 and in our previous studies using C. zizanioides.46\nTable 3 shows the characteristic features of the GSNPs using various plant parts of different plant species reported by various researchers along with our previous reports.", "From Figure 7, it can be observed that, as the concentration of the GSNPs increased, the percentage of viable cells decreased in the cytotoxicity studies by MTT assay. The GSNPs were taken up by mammalian cells through different mechanisms such as pinocytosis, endocytosis, and phagocytosis.75 Once the NPs enter the cells, they interact with the cellular materials and cause DNA damage and cell death.\nThe GSNPs at 85 μg/mL concentration showed 95.23% inhibition of HT29 cell growth. The concentration of the NPs was chosen based on the TC ID50 value (results not shown). Another promising result was that G. sylvestre plant extracts alone at 85 μg/mL concentration showed 30.77% inhibition of HT29 cell lines growth. From our results, it can be concluded that the GSNPs could have induced intracellular reactive oxygen species generation, which can be evaluated using intracellular peroxide-dependent oxidation, and caused cell death. The control cells were clustered, healthy, and viable cells (Figure 8A), whereas the HT29 cells’ proliferation was significantly inhibited by GS (Figure 8B). The SNP-treated cells showed increased apoptotic morphological changes (Figure 8C), also the clearly visible cell debris in Figure 8D is due to cell death by 85 μg/mL SNP treatment.\nThese results indicate that the sensitivity of HT29 human colon cancer cell line for cytotoxic drugs is higher than that of the Vero cell line for the same cytotoxic agents. Sahu et al76 have reported the presence of four new tritepenoid saponins, namely gymnemasins A, B, C, and D, from the leaves of G. sylvestre, while Chan has identified the presence of acylation with diangeloyl groups at the C21–22 positions in triterpenoid saponins, which is essential for cytotoxcity toward tumor cells.77 Tang et al78 have reported that saponin could induce apoptosis of U251 cells, and both BAD-mediated intrinsic apoptotic signaling pathway and caspase-8-mediated extrinsic apoptotic signaling pathway were involved in the apoptosis.\nThe promising saponins were further studied as potential anticancer agents by many researchers. Ai et al79 proposed a qualitative method that can be used to recognize the presence or absence of cancer cells with gold NPs for targeted cancer cell imaging and efficient photodynamic therapy. As reported by Raghavendra et al80 the size effects and multifunctionality are the main characteristics of NPs, so our method of one-step synthesis of SNPs using the aqueous extract of G. sylvestre may serve as a potential anticancer drug for cancer therapy. Further studies have to be carried out to understand the nature of cytotoxicity and the death or proliferation of cells caused by GSNPs from G. sylvestre leaf extract.", "The green synthesis of biofunctionalized SNPs from the leaves of G. sylvestre was economical, nontoxic, and environmentally benign. Due to the reducing and capping nature of the bioactive phytocompounds present in the aqueous extract of G. sylvestre, a cap was formed around the silver ions of the biofunctionalized SNPs which were stable. The presence of the functional group of the bioactive compounds was confirmed by FTIR spectra. The particle size and the spherical shape of the SNPs were determined by XRD and SEM analyses. Since the plant extract and the biofunctionalized SNPs showed anticancer activity against cancer cells, G. sylvestre may serve as a source for potential anticancer drugs. The present study showed the anticancer activities of both the bioactive compounds of the leaf extract and the biofunctionalized SNPs synthesized against HT29 human adenocarcinoma cells in vitro. Our studies provide an important basis for the application of NPs for in vitro anticancer activity against human colon adenocarcinoma cells. Our earlier reports have also shown the potential antiulcer properties of G. sylvestre in mice.13 So GSS is a good plant candidate for further studies in alternative medicine due its multifunctional medical properties" ]

[ "intro", "materials|methods", null, null, "methods", null, null, null, null, null, null, "results", null, null, null, null ]

[ "Gymnema sylvestre", "gymnemic acid", "biofunctionalized silver nanoparticles", "anticancer activity", "HT29 cell line" ]

[ 90, 144, 126, 175, 543, 91, 154, 16, 115, 1211, 490, 202 ]

[ "extract", "snps", "cells", "sylvestre", "cell", "ml", "nps", "μg", "plant", "aqueous" ]

[ "medicinal plants commonly", "medicinal plant", "phytochemicals reported sylvestre", "botanical surveys medicinal", "sylvestre plant extract" ]

[ "Galectin 3", "Humans", "Male", "Polysaccharides", "Semen", "Spermatozoa", "Tetraspanins" ]

[ "Materials", "Human semen samples", "Isolation of prostasomes from human seminal plasma", "Gel filtration", "SDS-PAGE", "Western blot and dot blot", "Transmission electron microscopy (TEM)", "Prostasomes from human seminal plasma of normozoospermic men: influence of TX-100 treatment", "Prostasomes from human seminal plasma of oligozoospermic men: influence of TX-100 treatment" ]

[ "Monoclonal anti-CD63 antibody (clone TS63) was from Abcam (Cambridge, UK), monoclonal anti-CD81 (clone M38) and monoclonal anti-CD9 (clone MEM-61) were from Invitrogen by Thermo Fisher Scientific (Carlsbad, CA, USA), and biotinylated goat anti-galectin-3 (gal-3) antibodies were from R&D Systems (Minneapolis, USA). 3,3′,5,5′-tetramethylbenzidine (TMB), bovine serum albumin (BSA), and Triton X-100 (TX-100) were from Sigma (St. Louis, MO, USA). Biotinylated goat anti-mouse IgG, biotinylated plant lectins: Con A (Concanavalin A), wheat germ agglutinin (WGA), and the Elite Vectastain ABC kit were from Vector Laboratories (Burlingame, CA, USA). Sephadex G-200 was from Pharmacia AB (Uppsala, Sweden). The silver stain kit and SDS-PAGE molecular mass standards (broad range) were from Bio-Rad (Hercules, CA, USA). Nitrocellulose membrane and Pierce ECL Western Blotting Substrate were from Thermo Scientific (Rockford, IL, USA). Microwell plates were from Thermo Scientific (Roskilde, Denmark).", "This study was performed on the leftover, anonymized specimens of human semen taken for routine analysis, and since existing human specimens were used, it is not considered as research on human subjects. It was approved by the institutional ethics committee according to the guidelines (No. # 02-832/1), which conforms to the Helsinki Declaration, 1975 (revised 2008). Sperm parameters were assessed according to the recommended criteria of the World Health Organization (released in 2010.), concerning numbers, morphology, and motility.\nSperm cells and other debris were removed from the ejaculate by centrifugation at 1,000 × g for 20 min.", "Two pools of human SP of normozoospermic men and two pools of human SP of oligozoospermic men were used for the isolation of prostasomes. Each pool contained 10 individual SP samples. Prostasomes from normozoospermic men (sPro-N) and oligozoospermic men (sPro-O) were isolated from SP according to the modified protocol of Carlsson et al. (12). CD63-, CD9-, and CD81-immunoreactivities were used as the indicator of EVs’ presence. These prostasomal preparations were subjected to detergent treatment by incubation with 1% TX-100 for 1 h at room temperature and then subjected to gel filtration as the method of choice (13, 14). We monitored the redistribution of selected markers during gel filtration as an indicator of release from vesicles using the combined analysis of intact fractions (solid-phase assay with immobilized fractions and microscopy) and methods analyzing denatured fractions (electrophoresis and lectin blot).", "Gel filtration separation profiles of TX-100-treated prostasomes were obtained under conditions where TX-100 was present during elution to ensure maintenance of total solubilization (15). Thus, the detergent-treated seminal prostasome preparation (1 mL) was loaded on a Sephadex G-200 column (bed volume 35 mL) equilibrated and eluted with 0.03 M Tris-HCl, pH 7.6, containing 0.13 M NaCl and 1% TX-100. Fractions of 1 mL were collected. The elution was monitored as described previously (16). Briefly, gel filtration-separated fractions were coated on microwell plates at 4°C overnight. After washing steps (3 × 300 μL with 0.05 M phosphate-buffered saline, PBS), they were blocked with 50 μL 1% BSA for 1.5 h and then washed again. Biotinylated plant lectins: Con A and WGA (50 μL, 0.5 mg/mL) were allowed to react for 30 min at room temperature, washed out, and followed by the addition of 50 μL of avidin/biotin–HRPO complex (Elite, Vectastain ABC Kit, prepared according to the manufacturer’s instructions). After incubation for 30 min, at room temperature, the plates were rinsed and developed using 50 μL TMB substrate solution. The reaction was stopped with 50 μL 2 N sulfuric acid. Absorbance was read at 450 nm using a Wallac 1420 Multilabel counter Victor3V (Perkin Elmer, Waltham, MA, USA). The elution profile of gamma-glutamyl transferase (GGT) was monitored by measuring enzyme activity using GGT colorimetric assay kits (Bioanalytica, Madrid, Spain), according to the manufacturer’s instructions for Biosystems A25 (Barcelona, Spain). The selected fractions were further analyzed by electrophoresis and blotting.\nNative seminal prostasome preparations were analyzed in the same way except that TX-100 was not added to the elution buffer.", "Corresponding samples were resolved on 10% separating gel with 4% stacking gel under denaturing and reducing conditions (17) and stained with silver nitrate, using a silver stain kit (Bio-Rad) according to the manufacturer’s instructions. The gel was calibrated with SDS-PAGE molecular weight standards (broad range).", "Samples were transferred onto nitrocellulose membrane by semi-dry blotting using a Trans-blot SD (Bio-Rad Laboratories). The conditions were as follows: transfer buffer, 0.025 M Tris containing 0.192 M glycine and 20% methanol, pH 8.3 under a constant current of 1.2 mA/cm2 for 1 h. The membrane was blocked with 3% BSA in 0.05 M PBS, pH 7.2, for 2 h at room temperature, and then used for lectin-blotting (1) as described below.\nFor dot blot, 3 μL of each corresponding fraction was applied to the nitrocellulose membrane, dried, blocked as described above, and subjected to immunoblotting (2).\nLectin blotting\nLectin blotting was performed as described earlier (18). The membrane was incubated with the chosen biotinylated plant lectin (0.2 μg/mL in 0.05 M PBS, pH 7.2) for 1 h at room temperature and then washed six times in 0.05 M PBS, pH 7.2. Avidin/biotinylated horseradish peroxidase (HRPO) from Vectastain Elite ABC kit (prepared according to the manufacturer’s instructions) was added and incubated for 30 min at room temperature. The membrane was then rinsed again six times in 0.05 M PBS, pH 7.2, and the proteins were visualized using Pierce ECL substrate solution (Thermo Scientific, Rockford, IL, USA), according to the manufacturer’s instructions.\nImmunoblotting\nImmunodot blot was performed as previously established (18). For immunoblotting, the membrane was incubated with the corresponding antibodies: anti-CD63 antibody (0.5 μg/mL), anti-CD81 antibody (0.25 μg/mL), anti-CD9 antibody (0.5 μg/mL), and biotinylated anti-gal-3 antibodies (0.025 μg/mL), overnight at 4°C. After a washing step, bound antibody was detected by incubation with biotinylated goat anti-mouse IgG for 30 min at room temperature. The membrane was rinsed and the avidin/biotinylated HRPO mixture from the Elite Vectastain ABC kit was added, followed by incubation for 30 min at room temperature. After another washing step, the blots were visualized using Pierce ECL Western blotting substrate according to the manufacturer’s instructions.", "TEM was performed as described previously (19). Samples were applied to the formvar-coated, 200 mesh, Cu grids by grid flotation on 10 μL sample droplets, for 45 min at room temperature. This was followed by steps of fixation (2% paraformaldehyde, 10 min), washing (PBS, 3 × 2 min), post-fixing (2% glutaraldehyde, 5 min), and a final wash with distilled H2O (2 min). Grids were then air-dried, and the images were collected using a Philips CM12 electron microscope (Philips/FEI, Eindhoven, the Netherlands).", "Distributions of distinct surface-associated markers of prostasomes from human SP of normozoospermic men (sPro-N) after solubilization with TX-100 are shown in Figure 1a–d. In general, their gel filtration elution positions differed in terms of a more or less noticeable shift from the void volume where they were co-eluted on native vesicles, revealing new patterns of associations.\nSurface-associated glycoproteins and gamma-glutamyl transferase on the seminal prostasomes of normozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of normozoospermic men (sPro-N) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-N (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. A450: absorbance at 450 nm; GGT: gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3: galectin 3; F: fraction.\nIn eluted fractions, total mannosylated and sialylated glycans, which can reside on both glycoprotein and glycolipids, were monitored by lectin-binding reactivity (Figure 1a, b), and the GGT as an individual protein marker was monitored by enzymatic activity (Figure 1c). Thus, Con A-reactive glycoproteins were solubilized as evidenced by a striking decrease at the initial position (Figure 1a). However, the related redistribution can be rather deduced than clearly shown according to the reactivity of fractions in the included column volume, possibly due to the influence of their structure on immobilization. In contrast to this, WGA-reactive glycoproteins seemed to be partly solubilized and released as aggregated, judging by the corresponding elution profile revealing broad peaks entering the column and trailing down along the entire chromatogram (Figure 1b). Moreover, they produced a small but distinct peak before that of intact vesicles, which suggests formation of larger protein complexes. As for GGT, it was also clearly solubilized from vesicles with TX-100 and exhibited an elution profile distinct from the examined glycans (Figure 1c). The influence of TX-100 on the distribution of TS: CD63, CD9, and CD81, chosen as integral membrane proteins, and gal-3, chosen as a soluble but membrane-associated molecule, was monitored by the immunodot blot as adequate method (in contrast to western blot) for monitoring surface-associated changes (Figure 1d). TS and gal-3 co-localized on native vesicles at a position overlapping the detected Con A- and WGA-reactive glycoproteins and GGT (Figure 1c, data not shown). After TX-100 treatment, CD63 was clearly released and exhibited broad distribution (Figure 1d, fractions 16–30), but also remained close to its initial position. In contrast to this, CD9 (Figure 1d, fractions 16–18) and gal-3 (Figure 1d, fractions 16–18) retained narrow distributions, that is, they were slightly shifted during elution. Moreover, their patterns overlapped completely. As for CD81, it could not be detected after detergent treatment (Figure 1d). To further follow up the influence of TX-100 on prostasomes, changes in their ultrastructure were analyzed (Figure 2). In the region where all examined markers remained more or less co-localized after TX-100 treatment, the microscopic inspection revealed the presence of structures that correspond to reorganized detergent-resistant domains of vesicular membranes. They appeared as broken vesicles surrounded with leaking content or smaller vesicles with disrupted irregular surfaces seemingly shrunken with no associated material. In contrast to this, in the region where released glycoproteins were separated (Figure 1, fractions 20–22), no such structures were visible, only irregular, possibly, protein deposits. To complement the results obtained for detergent-treated samples as such, changes in the patterns of total prostasomal glycoproteins were analyzed under denaturing and reducing conditions by electrophoresis (Figure 3) and lectin blot (Figure 4). Compared to the native vesicles (Figure 3a), in the TX-100-treated ones (Figure 3b), the proteins exhibiting a prostasome-like pattern remained clustered close to the initial position, that is, they were marginally shifted in elution. However, their abundance was noticeably lower. Specifically, discrete changes in terms of the abundance of major bands in the region below 66 kDa (encompass masses of TS and gal-3) were detected. In addition, clear loss of bands in the region corresponding to the masses of prostasomal signature bands (90–150 kDa) was also detected. Consequently, some of them were visible as shifted in a cluster of protein bands included in column volume (Figure 3b, fractions 20–22).\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of normozoospermic men (sPro-N) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 1). Bar 500 nm. F14: rare vesicles; F17: broken vesicles surrounded with leaking content; F19: vesicles with disrupted irregular surface with no associated material; F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a) and TX-100 treated sPro-N (b) were resolved by electrophoresis and stained with silver. Although aggregation is present as judged by intense bands at the border of the stacking and separating gel, the referent protein bands are preserved. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a, c) and TX-100 treated sPro-N (b, d) were subjected to lectin-blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.\nIn contrast to proteins, prostasomal glycoproteins were considerably reorganized after TX-100 treatment. Regarding Con A-reactive glycoproteins, what the lectin-binding assay suggested was confirmed by the lectin blot (Figure 4). Thus, the pattern of Con A-reactive glycoproteins from native vesicles comprised high molecular mass band at the border of the stacking and separating gel and smear band in the stacking gel as well as four distinct lower molecular mass bands (Figure 4 a, fractions 15–17). After TX-100 treatment, a striking loss of high molecular mass components was observed. It can be related to different modes of redistribution of distinct lower molecular mass Con A-reactive bands. Specifically, the major 97 kDa band remained partly close to the initial position (Figure 4b, fraction 17) but was also released, that is, redistributed (Figure 4b, fractions 19–22). In addition, almost complete release of those with molecular masses below 66 kDa was observed (Figure 4a, b, fractions 15–17).\nThe pattern of WGA-reactive glycoproteins of native vesicles was comparable with that of the Con A-reactive ones in high molecular mass region (Figure 4c). However, after TX-100 treatment, their patterns were strikingly different (Figure 4d), as initially observed in the corresponding lectin-binding assay (Figure 1b). Thus, the high molecular mass band was completely lost, and a shift of weak 97 kDa was also detected.\nTaken together, the profiles related to the cluster of Con A- and WGA-binding glycoproteins might be influenced by their presence in different but overlapping complexes. Moreover, it is possible that diverse, but overlapped, bands with matching molecular mass and lectin binding were detected, as indicated by disparate/selective presence/abundance of particular ones in the subsequently eluted fraction.", "In parallel, prostasomes isolated from human seminal plasma of oligozoospermic men (sPro-O) were subjected to TX-100 treatment and analyzed in the same manner. Compared to the native sample, the treated ones exhibited patterns of Con A- (Figure 5a) and WGA-reactive glycans (Figure 5b) as well as GGT (Figure 5c) that indicated decrease/loss and/or redistribution, similarly as found for sPro-N. In addition, similarity with sPro-N was also noticed regarding the effect on the redistribution of TS: CD63 and CD81 (Figure 5d). However, although CD9 (Figure 5d, fraction 14) and gal-3 (Figure 5d, fractions 14–16) both remained close to the initial position as observed for sPro-N, they exhibited partially overlapping profiles. Moreover, the immunoreactivity of both TS (CD63 and CD81) was barely detectable. Observation at the ultrastructural level suggested more general disruption of sPro-O (Figure 6) than sPro-N. In general, vesicular structures were low abundant and their morphology was clearly different from sPro-N. Integrity of the TX-100-treated vesicles reflected on patterns of total proteins (Figure 7) and glycoproteins (Figure 8) and indicated more severe perturbation than for sPro-N (Figure 3a). In comparison with the native sPro-O (Figure 7a), a significant loss of protein in the entire range of molecular masses, which remained mostly in the region below 66 kDa, was observed (Figure 7b). In agreement with this, Con A-reactive glycoproteins of native sPro-O (Figure 8a) were also strikingly decreased, including the major one at 97 kDa (Figure 8b). Moreover, lectin blot failed to detect any WGA-reactive glycoproteins in the TX-100 treated sPro-O (Figure 8b). Compared with those for sPro-N, the profiles of both types of released glycoproteins for sPro-O indicated more intensive aggregation to form complexes which, in general, interfere with or prevent the detection of contributing components.\nSurface-associated glycoproteins and gamma-glutamyl transferase on seminal prostasomes of oligozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of oligozoospermic men (sPro-O) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-O from Sephadex G-200 column (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. Barely detectable CD9- and gal-3-immunoreactivity is indicated by circle. A450, absorbance at 450 nm; GGT, gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3, galectin 3; F, fraction.\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of oligozoospermic men (sPro-O) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 5). Bar 500 nm. F14–F17: rare vesicles; F19–F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a) and TX-100-treated sPro-O (b) were resolved by electrophoresis and stained with silver. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a, c) and TX-100-treated sPro-O (b, d) were subjected to lectin blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel." ]

[ null, null, null, null, null, null, null, null, null ]

[ "Introduction", "Material and methods", "Materials", "Human semen samples", "Isolation of prostasomes from human seminal plasma", "Gel filtration", "SDS-PAGE", "Western blot and dot blot", "Transmission electron microscopy (TEM)", "Results", "Prostasomes from human seminal plasma of normozoospermic men: influence of TX-100 treatment", "Prostasomes from human seminal plasma of oligozoospermic men: influence of TX-100 treatment", "Discussion" ]

[ "Tetraspanin-web and galectin-glycoprotein lattices represent distinct multi/macromolecular complexes assembled at the plasma membrane and are supposed to facilitate different biological activities/functions (1–3). Extracellular vesicles (EVs), membranous structures originating from plasma- or intracellular membranes, are considered enriched in tetraspanins (TS), which are used as canonical markers (4). Regarding the presence of lectins, including galectins, although not widely studied in this context, there are data indicating that galectin-3 (gal-3) is involved in the biogenesis of EVs and can be used as a reliable marker (5). Both TS and gal-3 are thought to shape not only the surface of EVs but also the cargo composition (6).\nProstasomes, EVs originating from the prostate and abundantly present in human seminal plasma (SP), are reported to express TS: CD63, CD9, and CD81, as well as gal-3 (2, 7–9). In addition, gal-3 and mannosylated/sialylated glycans were found to contribute to the prostasomal surface in a specific way in terms of accessibility and native presentation which could be altered in pathological conditions associated with male fertility (2). This study aimed to delineate the positions of selected TS: CD63, CD9, and CD81, that is, to obtain data on their molecular associations and relate them to gal-3 and selected N-glycans, all known to reside on the surface of prostasomes. Although of possible general importance for the identification of distinct vesicle types and their functions in different heterogeneous extracellular landscapes, related data are still missing. Thus, it is presumed that solubilization signature is an all-inclusive distinction factor regarding surface properties of a particular vesicle, since it can reflect the status of the parent cell and the extracellular environment, both of which contribute to the composition of spatial membrane arrangements. By establishing solubilization signature, we aimed at determining a new qualitative data suitable as a reference for the comparison of any type of vesicles.\nThe existence of distinct prostasomal surface molecular complexes was deduced from their detergent resistance (revealing TS-primary ligand association, gal-3-glycoprotein association, and insoluble membranes) or detergent sensitivity (revealing solubilized glycoprotein–glycolipid complexes). Related molecular patterns established from the mode of response to disruption by a non-ionic detergent of high stringency were used as a reference to annotate and/or compare prostasomal preparations from normozoospermic and oligozoospermic men.\nIn general, this approach is readily applicable, and it is not supposed to be significantly affected by different isolation procedures. Getting insight into the distribution patterns of TS on different membrane domains can add new value to their common use (based on presence only) as EVs markers. Moreover, since TS have distinct biological activities involved in cell adhesion, motility, and metastasis, as well as cell activation and signal transduction (10, 11), possible differences in their organization may have biomedical consequences. Thus, solubilization signatures of EVs might relate their structure with functional alterations in distinct pathological conditions.", "Materials Monoclonal anti-CD63 antibody (clone TS63) was from Abcam (Cambridge, UK), monoclonal anti-CD81 (clone M38) and monoclonal anti-CD9 (clone MEM-61) were from Invitrogen by Thermo Fisher Scientific (Carlsbad, CA, USA), and biotinylated goat anti-galectin-3 (gal-3) antibodies were from R&D Systems (Minneapolis, USA). 3,3′,5,5′-tetramethylbenzidine (TMB), bovine serum albumin (BSA), and Triton X-100 (TX-100) were from Sigma (St. Louis, MO, USA). Biotinylated goat anti-mouse IgG, biotinylated plant lectins: Con A (Concanavalin A), wheat germ agglutinin (WGA), and the Elite Vectastain ABC kit were from Vector Laboratories (Burlingame, CA, USA). Sephadex G-200 was from Pharmacia AB (Uppsala, Sweden). The silver stain kit and SDS-PAGE molecular mass standards (broad range) were from Bio-Rad (Hercules, CA, USA). Nitrocellulose membrane and Pierce ECL Western Blotting Substrate were from Thermo Scientific (Rockford, IL, USA). Microwell plates were from Thermo Scientific (Roskilde, Denmark).\nMonoclonal anti-CD63 antibody (clone TS63) was from Abcam (Cambridge, UK), monoclonal anti-CD81 (clone M38) and monoclonal anti-CD9 (clone MEM-61) were from Invitrogen by Thermo Fisher Scientific (Carlsbad, CA, USA), and biotinylated goat anti-galectin-3 (gal-3) antibodies were from R&D Systems (Minneapolis, USA). 3,3′,5,5′-tetramethylbenzidine (TMB), bovine serum albumin (BSA), and Triton X-100 (TX-100) were from Sigma (St. Louis, MO, USA). Biotinylated goat anti-mouse IgG, biotinylated plant lectins: Con A (Concanavalin A), wheat germ agglutinin (WGA), and the Elite Vectastain ABC kit were from Vector Laboratories (Burlingame, CA, USA). Sephadex G-200 was from Pharmacia AB (Uppsala, Sweden). The silver stain kit and SDS-PAGE molecular mass standards (broad range) were from Bio-Rad (Hercules, CA, USA). Nitrocellulose membrane and Pierce ECL Western Blotting Substrate were from Thermo Scientific (Rockford, IL, USA). Microwell plates were from Thermo Scientific (Roskilde, Denmark).\nHuman semen samples This study was performed on the leftover, anonymized specimens of human semen taken for routine analysis, and since existing human specimens were used, it is not considered as research on human subjects. It was approved by the institutional ethics committee according to the guidelines (No. # 02-832/1), which conforms to the Helsinki Declaration, 1975 (revised 2008). Sperm parameters were assessed according to the recommended criteria of the World Health Organization (released in 2010.), concerning numbers, morphology, and motility.\nSperm cells and other debris were removed from the ejaculate by centrifugation at 1,000 × g for 20 min.\nThis study was performed on the leftover, anonymized specimens of human semen taken for routine analysis, and since existing human specimens were used, it is not considered as research on human subjects. It was approved by the institutional ethics committee according to the guidelines (No. # 02-832/1), which conforms to the Helsinki Declaration, 1975 (revised 2008). Sperm parameters were assessed according to the recommended criteria of the World Health Organization (released in 2010.), concerning numbers, morphology, and motility.\nSperm cells and other debris were removed from the ejaculate by centrifugation at 1,000 × g for 20 min.\nIsolation of prostasomes from human seminal plasma Two pools of human SP of normozoospermic men and two pools of human SP of oligozoospermic men were used for the isolation of prostasomes. Each pool contained 10 individual SP samples. Prostasomes from normozoospermic men (sPro-N) and oligozoospermic men (sPro-O) were isolated from SP according to the modified protocol of Carlsson et al. (12). CD63-, CD9-, and CD81-immunoreactivities were used as the indicator of EVs’ presence. These prostasomal preparations were subjected to detergent treatment by incubation with 1% TX-100 for 1 h at room temperature and then subjected to gel filtration as the method of choice (13, 14). We monitored the redistribution of selected markers during gel filtration as an indicator of release from vesicles using the combined analysis of intact fractions (solid-phase assay with immobilized fractions and microscopy) and methods analyzing denatured fractions (electrophoresis and lectin blot).\nTwo pools of human SP of normozoospermic men and two pools of human SP of oligozoospermic men were used for the isolation of prostasomes. Each pool contained 10 individual SP samples. Prostasomes from normozoospermic men (sPro-N) and oligozoospermic men (sPro-O) were isolated from SP according to the modified protocol of Carlsson et al. (12). CD63-, CD9-, and CD81-immunoreactivities were used as the indicator of EVs’ presence. These prostasomal preparations were subjected to detergent treatment by incubation with 1% TX-100 for 1 h at room temperature and then subjected to gel filtration as the method of choice (13, 14). We monitored the redistribution of selected markers during gel filtration as an indicator of release from vesicles using the combined analysis of intact fractions (solid-phase assay with immobilized fractions and microscopy) and methods analyzing denatured fractions (electrophoresis and lectin blot).\nGel filtration Gel filtration separation profiles of TX-100-treated prostasomes were obtained under conditions where TX-100 was present during elution to ensure maintenance of total solubilization (15). Thus, the detergent-treated seminal prostasome preparation (1 mL) was loaded on a Sephadex G-200 column (bed volume 35 mL) equilibrated and eluted with 0.03 M Tris-HCl, pH 7.6, containing 0.13 M NaCl and 1% TX-100. Fractions of 1 mL were collected. The elution was monitored as described previously (16). Briefly, gel filtration-separated fractions were coated on microwell plates at 4°C overnight. After washing steps (3 × 300 μL with 0.05 M phosphate-buffered saline, PBS), they were blocked with 50 μL 1% BSA for 1.5 h and then washed again. Biotinylated plant lectins: Con A and WGA (50 μL, 0.5 mg/mL) were allowed to react for 30 min at room temperature, washed out, and followed by the addition of 50 μL of avidin/biotin–HRPO complex (Elite, Vectastain ABC Kit, prepared according to the manufacturer’s instructions). After incubation for 30 min, at room temperature, the plates were rinsed and developed using 50 μL TMB substrate solution. The reaction was stopped with 50 μL 2 N sulfuric acid. Absorbance was read at 450 nm using a Wallac 1420 Multilabel counter Victor3V (Perkin Elmer, Waltham, MA, USA). The elution profile of gamma-glutamyl transferase (GGT) was monitored by measuring enzyme activity using GGT colorimetric assay kits (Bioanalytica, Madrid, Spain), according to the manufacturer’s instructions for Biosystems A25 (Barcelona, Spain). The selected fractions were further analyzed by electrophoresis and blotting.\nNative seminal prostasome preparations were analyzed in the same way except that TX-100 was not added to the elution buffer.\nGel filtration separation profiles of TX-100-treated prostasomes were obtained under conditions where TX-100 was present during elution to ensure maintenance of total solubilization (15). Thus, the detergent-treated seminal prostasome preparation (1 mL) was loaded on a Sephadex G-200 column (bed volume 35 mL) equilibrated and eluted with 0.03 M Tris-HCl, pH 7.6, containing 0.13 M NaCl and 1% TX-100. Fractions of 1 mL were collected. The elution was monitored as described previously (16). Briefly, gel filtration-separated fractions were coated on microwell plates at 4°C overnight. After washing steps (3 × 300 μL with 0.05 M phosphate-buffered saline, PBS), they were blocked with 50 μL 1% BSA for 1.5 h and then washed again. Biotinylated plant lectins: Con A and WGA (50 μL, 0.5 mg/mL) were allowed to react for 30 min at room temperature, washed out, and followed by the addition of 50 μL of avidin/biotin–HRPO complex (Elite, Vectastain ABC Kit, prepared according to the manufacturer’s instructions). After incubation for 30 min, at room temperature, the plates were rinsed and developed using 50 μL TMB substrate solution. The reaction was stopped with 50 μL 2 N sulfuric acid. Absorbance was read at 450 nm using a Wallac 1420 Multilabel counter Victor3V (Perkin Elmer, Waltham, MA, USA). The elution profile of gamma-glutamyl transferase (GGT) was monitored by measuring enzyme activity using GGT colorimetric assay kits (Bioanalytica, Madrid, Spain), according to the manufacturer’s instructions for Biosystems A25 (Barcelona, Spain). The selected fractions were further analyzed by electrophoresis and blotting.\nNative seminal prostasome preparations were analyzed in the same way except that TX-100 was not added to the elution buffer.\nSDS-PAGE Corresponding samples were resolved on 10% separating gel with 4% stacking gel under denaturing and reducing conditions (17) and stained with silver nitrate, using a silver stain kit (Bio-Rad) according to the manufacturer’s instructions. The gel was calibrated with SDS-PAGE molecular weight standards (broad range).\nCorresponding samples were resolved on 10% separating gel with 4% stacking gel under denaturing and reducing conditions (17) and stained with silver nitrate, using a silver stain kit (Bio-Rad) according to the manufacturer’s instructions. The gel was calibrated with SDS-PAGE molecular weight standards (broad range).\nWestern blot and dot blot Samples were transferred onto nitrocellulose membrane by semi-dry blotting using a Trans-blot SD (Bio-Rad Laboratories). The conditions were as follows: transfer buffer, 0.025 M Tris containing 0.192 M glycine and 20% methanol, pH 8.3 under a constant current of 1.2 mA/cm2 for 1 h. The membrane was blocked with 3% BSA in 0.05 M PBS, pH 7.2, for 2 h at room temperature, and then used for lectin-blotting (1) as described below.\nFor dot blot, 3 μL of each corresponding fraction was applied to the nitrocellulose membrane, dried, blocked as described above, and subjected to immunoblotting (2).\nLectin blotting\nLectin blotting was performed as described earlier (18). The membrane was incubated with the chosen biotinylated plant lectin (0.2 μg/mL in 0.05 M PBS, pH 7.2) for 1 h at room temperature and then washed six times in 0.05 M PBS, pH 7.2. Avidin/biotinylated horseradish peroxidase (HRPO) from Vectastain Elite ABC kit (prepared according to the manufacturer’s instructions) was added and incubated for 30 min at room temperature. The membrane was then rinsed again six times in 0.05 M PBS, pH 7.2, and the proteins were visualized using Pierce ECL substrate solution (Thermo Scientific, Rockford, IL, USA), according to the manufacturer’s instructions.\nImmunoblotting\nImmunodot blot was performed as previously established (18). For immunoblotting, the membrane was incubated with the corresponding antibodies: anti-CD63 antibody (0.5 μg/mL), anti-CD81 antibody (0.25 μg/mL), anti-CD9 antibody (0.5 μg/mL), and biotinylated anti-gal-3 antibodies (0.025 μg/mL), overnight at 4°C. After a washing step, bound antibody was detected by incubation with biotinylated goat anti-mouse IgG for 30 min at room temperature. The membrane was rinsed and the avidin/biotinylated HRPO mixture from the Elite Vectastain ABC kit was added, followed by incubation for 30 min at room temperature. After another washing step, the blots were visualized using Pierce ECL Western blotting substrate according to the manufacturer’s instructions.\nSamples were transferred onto nitrocellulose membrane by semi-dry blotting using a Trans-blot SD (Bio-Rad Laboratories). The conditions were as follows: transfer buffer, 0.025 M Tris containing 0.192 M glycine and 20% methanol, pH 8.3 under a constant current of 1.2 mA/cm2 for 1 h. The membrane was blocked with 3% BSA in 0.05 M PBS, pH 7.2, for 2 h at room temperature, and then used for lectin-blotting (1) as described below.\nFor dot blot, 3 μL of each corresponding fraction was applied to the nitrocellulose membrane, dried, blocked as described above, and subjected to immunoblotting (2).\nLectin blotting\nLectin blotting was performed as described earlier (18). The membrane was incubated with the chosen biotinylated plant lectin (0.2 μg/mL in 0.05 M PBS, pH 7.2) for 1 h at room temperature and then washed six times in 0.05 M PBS, pH 7.2. Avidin/biotinylated horseradish peroxidase (HRPO) from Vectastain Elite ABC kit (prepared according to the manufacturer’s instructions) was added and incubated for 30 min at room temperature. The membrane was then rinsed again six times in 0.05 M PBS, pH 7.2, and the proteins were visualized using Pierce ECL substrate solution (Thermo Scientific, Rockford, IL, USA), according to the manufacturer’s instructions.\nImmunoblotting\nImmunodot blot was performed as previously established (18). For immunoblotting, the membrane was incubated with the corresponding antibodies: anti-CD63 antibody (0.5 μg/mL), anti-CD81 antibody (0.25 μg/mL), anti-CD9 antibody (0.5 μg/mL), and biotinylated anti-gal-3 antibodies (0.025 μg/mL), overnight at 4°C. After a washing step, bound antibody was detected by incubation with biotinylated goat anti-mouse IgG for 30 min at room temperature. The membrane was rinsed and the avidin/biotinylated HRPO mixture from the Elite Vectastain ABC kit was added, followed by incubation for 30 min at room temperature. After another washing step, the blots were visualized using Pierce ECL Western blotting substrate according to the manufacturer’s instructions.\nTransmission electron microscopy (TEM) TEM was performed as described previously (19). Samples were applied to the formvar-coated, 200 mesh, Cu grids by grid flotation on 10 μL sample droplets, for 45 min at room temperature. This was followed by steps of fixation (2% paraformaldehyde, 10 min), washing (PBS, 3 × 2 min), post-fixing (2% glutaraldehyde, 5 min), and a final wash with distilled H2O (2 min). Grids were then air-dried, and the images were collected using a Philips CM12 electron microscope (Philips/FEI, Eindhoven, the Netherlands).\nTEM was performed as described previously (19). Samples were applied to the formvar-coated, 200 mesh, Cu grids by grid flotation on 10 μL sample droplets, for 45 min at room temperature. This was followed by steps of fixation (2% paraformaldehyde, 10 min), washing (PBS, 3 × 2 min), post-fixing (2% glutaraldehyde, 5 min), and a final wash with distilled H2O (2 min). Grids were then air-dried, and the images were collected using a Philips CM12 electron microscope (Philips/FEI, Eindhoven, the Netherlands).", "Monoclonal anti-CD63 antibody (clone TS63) was from Abcam (Cambridge, UK), monoclonal anti-CD81 (clone M38) and monoclonal anti-CD9 (clone MEM-61) were from Invitrogen by Thermo Fisher Scientific (Carlsbad, CA, USA), and biotinylated goat anti-galectin-3 (gal-3) antibodies were from R&D Systems (Minneapolis, USA). 3,3′,5,5′-tetramethylbenzidine (TMB), bovine serum albumin (BSA), and Triton X-100 (TX-100) were from Sigma (St. Louis, MO, USA). Biotinylated goat anti-mouse IgG, biotinylated plant lectins: Con A (Concanavalin A), wheat germ agglutinin (WGA), and the Elite Vectastain ABC kit were from Vector Laboratories (Burlingame, CA, USA). Sephadex G-200 was from Pharmacia AB (Uppsala, Sweden). The silver stain kit and SDS-PAGE molecular mass standards (broad range) were from Bio-Rad (Hercules, CA, USA). Nitrocellulose membrane and Pierce ECL Western Blotting Substrate were from Thermo Scientific (Rockford, IL, USA). Microwell plates were from Thermo Scientific (Roskilde, Denmark).", "This study was performed on the leftover, anonymized specimens of human semen taken for routine analysis, and since existing human specimens were used, it is not considered as research on human subjects. It was approved by the institutional ethics committee according to the guidelines (No. # 02-832/1), which conforms to the Helsinki Declaration, 1975 (revised 2008). Sperm parameters were assessed according to the recommended criteria of the World Health Organization (released in 2010.), concerning numbers, morphology, and motility.\nSperm cells and other debris were removed from the ejaculate by centrifugation at 1,000 × g for 20 min.", "Two pools of human SP of normozoospermic men and two pools of human SP of oligozoospermic men were used for the isolation of prostasomes. Each pool contained 10 individual SP samples. Prostasomes from normozoospermic men (sPro-N) and oligozoospermic men (sPro-O) were isolated from SP according to the modified protocol of Carlsson et al. (12). CD63-, CD9-, and CD81-immunoreactivities were used as the indicator of EVs’ presence. These prostasomal preparations were subjected to detergent treatment by incubation with 1% TX-100 for 1 h at room temperature and then subjected to gel filtration as the method of choice (13, 14). We monitored the redistribution of selected markers during gel filtration as an indicator of release from vesicles using the combined analysis of intact fractions (solid-phase assay with immobilized fractions and microscopy) and methods analyzing denatured fractions (electrophoresis and lectin blot).", "Gel filtration separation profiles of TX-100-treated prostasomes were obtained under conditions where TX-100 was present during elution to ensure maintenance of total solubilization (15). Thus, the detergent-treated seminal prostasome preparation (1 mL) was loaded on a Sephadex G-200 column (bed volume 35 mL) equilibrated and eluted with 0.03 M Tris-HCl, pH 7.6, containing 0.13 M NaCl and 1% TX-100. Fractions of 1 mL were collected. The elution was monitored as described previously (16). Briefly, gel filtration-separated fractions were coated on microwell plates at 4°C overnight. After washing steps (3 × 300 μL with 0.05 M phosphate-buffered saline, PBS), they were blocked with 50 μL 1% BSA for 1.5 h and then washed again. Biotinylated plant lectins: Con A and WGA (50 μL, 0.5 mg/mL) were allowed to react for 30 min at room temperature, washed out, and followed by the addition of 50 μL of avidin/biotin–HRPO complex (Elite, Vectastain ABC Kit, prepared according to the manufacturer’s instructions). After incubation for 30 min, at room temperature, the plates were rinsed and developed using 50 μL TMB substrate solution. The reaction was stopped with 50 μL 2 N sulfuric acid. Absorbance was read at 450 nm using a Wallac 1420 Multilabel counter Victor3V (Perkin Elmer, Waltham, MA, USA). The elution profile of gamma-glutamyl transferase (GGT) was monitored by measuring enzyme activity using GGT colorimetric assay kits (Bioanalytica, Madrid, Spain), according to the manufacturer’s instructions for Biosystems A25 (Barcelona, Spain). The selected fractions were further analyzed by electrophoresis and blotting.\nNative seminal prostasome preparations were analyzed in the same way except that TX-100 was not added to the elution buffer.", "Corresponding samples were resolved on 10% separating gel with 4% stacking gel under denaturing and reducing conditions (17) and stained with silver nitrate, using a silver stain kit (Bio-Rad) according to the manufacturer’s instructions. The gel was calibrated with SDS-PAGE molecular weight standards (broad range).", "Samples were transferred onto nitrocellulose membrane by semi-dry blotting using a Trans-blot SD (Bio-Rad Laboratories). The conditions were as follows: transfer buffer, 0.025 M Tris containing 0.192 M glycine and 20% methanol, pH 8.3 under a constant current of 1.2 mA/cm2 for 1 h. The membrane was blocked with 3% BSA in 0.05 M PBS, pH 7.2, for 2 h at room temperature, and then used for lectin-blotting (1) as described below.\nFor dot blot, 3 μL of each corresponding fraction was applied to the nitrocellulose membrane, dried, blocked as described above, and subjected to immunoblotting (2).\nLectin blotting\nLectin blotting was performed as described earlier (18). The membrane was incubated with the chosen biotinylated plant lectin (0.2 μg/mL in 0.05 M PBS, pH 7.2) for 1 h at room temperature and then washed six times in 0.05 M PBS, pH 7.2. Avidin/biotinylated horseradish peroxidase (HRPO) from Vectastain Elite ABC kit (prepared according to the manufacturer’s instructions) was added and incubated for 30 min at room temperature. The membrane was then rinsed again six times in 0.05 M PBS, pH 7.2, and the proteins were visualized using Pierce ECL substrate solution (Thermo Scientific, Rockford, IL, USA), according to the manufacturer’s instructions.\nImmunoblotting\nImmunodot blot was performed as previously established (18). For immunoblotting, the membrane was incubated with the corresponding antibodies: anti-CD63 antibody (0.5 μg/mL), anti-CD81 antibody (0.25 μg/mL), anti-CD9 antibody (0.5 μg/mL), and biotinylated anti-gal-3 antibodies (0.025 μg/mL), overnight at 4°C. After a washing step, bound antibody was detected by incubation with biotinylated goat anti-mouse IgG for 30 min at room temperature. The membrane was rinsed and the avidin/biotinylated HRPO mixture from the Elite Vectastain ABC kit was added, followed by incubation for 30 min at room temperature. After another washing step, the blots were visualized using Pierce ECL Western blotting substrate according to the manufacturer’s instructions.", "TEM was performed as described previously (19). Samples were applied to the formvar-coated, 200 mesh, Cu grids by grid flotation on 10 μL sample droplets, for 45 min at room temperature. This was followed by steps of fixation (2% paraformaldehyde, 10 min), washing (PBS, 3 × 2 min), post-fixing (2% glutaraldehyde, 5 min), and a final wash with distilled H2O (2 min). Grids were then air-dried, and the images were collected using a Philips CM12 electron microscope (Philips/FEI, Eindhoven, the Netherlands).", "Prostasomes from human seminal plasma of normozoospermic men: influence of TX-100 treatment Distributions of distinct surface-associated markers of prostasomes from human SP of normozoospermic men (sPro-N) after solubilization with TX-100 are shown in Figure 1a–d. In general, their gel filtration elution positions differed in terms of a more or less noticeable shift from the void volume where they were co-eluted on native vesicles, revealing new patterns of associations.\nSurface-associated glycoproteins and gamma-glutamyl transferase on the seminal prostasomes of normozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of normozoospermic men (sPro-N) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-N (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. A450: absorbance at 450 nm; GGT: gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3: galectin 3; F: fraction.\nIn eluted fractions, total mannosylated and sialylated glycans, which can reside on both glycoprotein and glycolipids, were monitored by lectin-binding reactivity (Figure 1a, b), and the GGT as an individual protein marker was monitored by enzymatic activity (Figure 1c). Thus, Con A-reactive glycoproteins were solubilized as evidenced by a striking decrease at the initial position (Figure 1a). However, the related redistribution can be rather deduced than clearly shown according to the reactivity of fractions in the included column volume, possibly due to the influence of their structure on immobilization. In contrast to this, WGA-reactive glycoproteins seemed to be partly solubilized and released as aggregated, judging by the corresponding elution profile revealing broad peaks entering the column and trailing down along the entire chromatogram (Figure 1b). Moreover, they produced a small but distinct peak before that of intact vesicles, which suggests formation of larger protein complexes. As for GGT, it was also clearly solubilized from vesicles with TX-100 and exhibited an elution profile distinct from the examined glycans (Figure 1c). The influence of TX-100 on the distribution of TS: CD63, CD9, and CD81, chosen as integral membrane proteins, and gal-3, chosen as a soluble but membrane-associated molecule, was monitored by the immunodot blot as adequate method (in contrast to western blot) for monitoring surface-associated changes (Figure 1d). TS and gal-3 co-localized on native vesicles at a position overlapping the detected Con A- and WGA-reactive glycoproteins and GGT (Figure 1c, data not shown). After TX-100 treatment, CD63 was clearly released and exhibited broad distribution (Figure 1d, fractions 16–30), but also remained close to its initial position. In contrast to this, CD9 (Figure 1d, fractions 16–18) and gal-3 (Figure 1d, fractions 16–18) retained narrow distributions, that is, they were slightly shifted during elution. Moreover, their patterns overlapped completely. As for CD81, it could not be detected after detergent treatment (Figure 1d). To further follow up the influence of TX-100 on prostasomes, changes in their ultrastructure were analyzed (Figure 2). In the region where all examined markers remained more or less co-localized after TX-100 treatment, the microscopic inspection revealed the presence of structures that correspond to reorganized detergent-resistant domains of vesicular membranes. They appeared as broken vesicles surrounded with leaking content or smaller vesicles with disrupted irregular surfaces seemingly shrunken with no associated material. In contrast to this, in the region where released glycoproteins were separated (Figure 1, fractions 20–22), no such structures were visible, only irregular, possibly, protein deposits. To complement the results obtained for detergent-treated samples as such, changes in the patterns of total prostasomal glycoproteins were analyzed under denaturing and reducing conditions by electrophoresis (Figure 3) and lectin blot (Figure 4). Compared to the native vesicles (Figure 3a), in the TX-100-treated ones (Figure 3b), the proteins exhibiting a prostasome-like pattern remained clustered close to the initial position, that is, they were marginally shifted in elution. However, their abundance was noticeably lower. Specifically, discrete changes in terms of the abundance of major bands in the region below 66 kDa (encompass masses of TS and gal-3) were detected. In addition, clear loss of bands in the region corresponding to the masses of prostasomal signature bands (90–150 kDa) was also detected. Consequently, some of them were visible as shifted in a cluster of protein bands included in column volume (Figure 3b, fractions 20–22).\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of normozoospermic men (sPro-N) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 1). Bar 500 nm. F14: rare vesicles; F17: broken vesicles surrounded with leaking content; F19: vesicles with disrupted irregular surface with no associated material; F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a) and TX-100 treated sPro-N (b) were resolved by electrophoresis and stained with silver. Although aggregation is present as judged by intense bands at the border of the stacking and separating gel, the referent protein bands are preserved. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a, c) and TX-100 treated sPro-N (b, d) were subjected to lectin-blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.\nIn contrast to proteins, prostasomal glycoproteins were considerably reorganized after TX-100 treatment. Regarding Con A-reactive glycoproteins, what the lectin-binding assay suggested was confirmed by the lectin blot (Figure 4). Thus, the pattern of Con A-reactive glycoproteins from native vesicles comprised high molecular mass band at the border of the stacking and separating gel and smear band in the stacking gel as well as four distinct lower molecular mass bands (Figure 4 a, fractions 15–17). After TX-100 treatment, a striking loss of high molecular mass components was observed. It can be related to different modes of redistribution of distinct lower molecular mass Con A-reactive bands. Specifically, the major 97 kDa band remained partly close to the initial position (Figure 4b, fraction 17) but was also released, that is, redistributed (Figure 4b, fractions 19–22). In addition, almost complete release of those with molecular masses below 66 kDa was observed (Figure 4a, b, fractions 15–17).\nThe pattern of WGA-reactive glycoproteins of native vesicles was comparable with that of the Con A-reactive ones in high molecular mass region (Figure 4c). However, after TX-100 treatment, their patterns were strikingly different (Figure 4d), as initially observed in the corresponding lectin-binding assay (Figure 1b). Thus, the high molecular mass band was completely lost, and a shift of weak 97 kDa was also detected.\nTaken together, the profiles related to the cluster of Con A- and WGA-binding glycoproteins might be influenced by their presence in different but overlapping complexes. Moreover, it is possible that diverse, but overlapped, bands with matching molecular mass and lectin binding were detected, as indicated by disparate/selective presence/abundance of particular ones in the subsequently eluted fraction.\nDistributions of distinct surface-associated markers of prostasomes from human SP of normozoospermic men (sPro-N) after solubilization with TX-100 are shown in Figure 1a–d. In general, their gel filtration elution positions differed in terms of a more or less noticeable shift from the void volume where they were co-eluted on native vesicles, revealing new patterns of associations.\nSurface-associated glycoproteins and gamma-glutamyl transferase on the seminal prostasomes of normozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of normozoospermic men (sPro-N) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-N (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. A450: absorbance at 450 nm; GGT: gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3: galectin 3; F: fraction.\nIn eluted fractions, total mannosylated and sialylated glycans, which can reside on both glycoprotein and glycolipids, were monitored by lectin-binding reactivity (Figure 1a, b), and the GGT as an individual protein marker was monitored by enzymatic activity (Figure 1c). Thus, Con A-reactive glycoproteins were solubilized as evidenced by a striking decrease at the initial position (Figure 1a). However, the related redistribution can be rather deduced than clearly shown according to the reactivity of fractions in the included column volume, possibly due to the influence of their structure on immobilization. In contrast to this, WGA-reactive glycoproteins seemed to be partly solubilized and released as aggregated, judging by the corresponding elution profile revealing broad peaks entering the column and trailing down along the entire chromatogram (Figure 1b). Moreover, they produced a small but distinct peak before that of intact vesicles, which suggests formation of larger protein complexes. As for GGT, it was also clearly solubilized from vesicles with TX-100 and exhibited an elution profile distinct from the examined glycans (Figure 1c). The influence of TX-100 on the distribution of TS: CD63, CD9, and CD81, chosen as integral membrane proteins, and gal-3, chosen as a soluble but membrane-associated molecule, was monitored by the immunodot blot as adequate method (in contrast to western blot) for monitoring surface-associated changes (Figure 1d). TS and gal-3 co-localized on native vesicles at a position overlapping the detected Con A- and WGA-reactive glycoproteins and GGT (Figure 1c, data not shown). After TX-100 treatment, CD63 was clearly released and exhibited broad distribution (Figure 1d, fractions 16–30), but also remained close to its initial position. In contrast to this, CD9 (Figure 1d, fractions 16–18) and gal-3 (Figure 1d, fractions 16–18) retained narrow distributions, that is, they were slightly shifted during elution. Moreover, their patterns overlapped completely. As for CD81, it could not be detected after detergent treatment (Figure 1d). To further follow up the influence of TX-100 on prostasomes, changes in their ultrastructure were analyzed (Figure 2). In the region where all examined markers remained more or less co-localized after TX-100 treatment, the microscopic inspection revealed the presence of structures that correspond to reorganized detergent-resistant domains of vesicular membranes. They appeared as broken vesicles surrounded with leaking content or smaller vesicles with disrupted irregular surfaces seemingly shrunken with no associated material. In contrast to this, in the region where released glycoproteins were separated (Figure 1, fractions 20–22), no such structures were visible, only irregular, possibly, protein deposits. To complement the results obtained for detergent-treated samples as such, changes in the patterns of total prostasomal glycoproteins were analyzed under denaturing and reducing conditions by electrophoresis (Figure 3) and lectin blot (Figure 4). Compared to the native vesicles (Figure 3a), in the TX-100-treated ones (Figure 3b), the proteins exhibiting a prostasome-like pattern remained clustered close to the initial position, that is, they were marginally shifted in elution. However, their abundance was noticeably lower. Specifically, discrete changes in terms of the abundance of major bands in the region below 66 kDa (encompass masses of TS and gal-3) were detected. In addition, clear loss of bands in the region corresponding to the masses of prostasomal signature bands (90–150 kDa) was also detected. Consequently, some of them were visible as shifted in a cluster of protein bands included in column volume (Figure 3b, fractions 20–22).\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of normozoospermic men (sPro-N) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 1). Bar 500 nm. F14: rare vesicles; F17: broken vesicles surrounded with leaking content; F19: vesicles with disrupted irregular surface with no associated material; F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a) and TX-100 treated sPro-N (b) were resolved by electrophoresis and stained with silver. Although aggregation is present as judged by intense bands at the border of the stacking and separating gel, the referent protein bands are preserved. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a, c) and TX-100 treated sPro-N (b, d) were subjected to lectin-blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.\nIn contrast to proteins, prostasomal glycoproteins were considerably reorganized after TX-100 treatment. Regarding Con A-reactive glycoproteins, what the lectin-binding assay suggested was confirmed by the lectin blot (Figure 4). Thus, the pattern of Con A-reactive glycoproteins from native vesicles comprised high molecular mass band at the border of the stacking and separating gel and smear band in the stacking gel as well as four distinct lower molecular mass bands (Figure 4 a, fractions 15–17). After TX-100 treatment, a striking loss of high molecular mass components was observed. It can be related to different modes of redistribution of distinct lower molecular mass Con A-reactive bands. Specifically, the major 97 kDa band remained partly close to the initial position (Figure 4b, fraction 17) but was also released, that is, redistributed (Figure 4b, fractions 19–22). In addition, almost complete release of those with molecular masses below 66 kDa was observed (Figure 4a, b, fractions 15–17).\nThe pattern of WGA-reactive glycoproteins of native vesicles was comparable with that of the Con A-reactive ones in high molecular mass region (Figure 4c). However, after TX-100 treatment, their patterns were strikingly different (Figure 4d), as initially observed in the corresponding lectin-binding assay (Figure 1b). Thus, the high molecular mass band was completely lost, and a shift of weak 97 kDa was also detected.\nTaken together, the profiles related to the cluster of Con A- and WGA-binding glycoproteins might be influenced by their presence in different but overlapping complexes. Moreover, it is possible that diverse, but overlapped, bands with matching molecular mass and lectin binding were detected, as indicated by disparate/selective presence/abundance of particular ones in the subsequently eluted fraction.\nProstasomes from human seminal plasma of oligozoospermic men: influence of TX-100 treatment In parallel, prostasomes isolated from human seminal plasma of oligozoospermic men (sPro-O) were subjected to TX-100 treatment and analyzed in the same manner. Compared to the native sample, the treated ones exhibited patterns of Con A- (Figure 5a) and WGA-reactive glycans (Figure 5b) as well as GGT (Figure 5c) that indicated decrease/loss and/or redistribution, similarly as found for sPro-N. In addition, similarity with sPro-N was also noticed regarding the effect on the redistribution of TS: CD63 and CD81 (Figure 5d). However, although CD9 (Figure 5d, fraction 14) and gal-3 (Figure 5d, fractions 14–16) both remained close to the initial position as observed for sPro-N, they exhibited partially overlapping profiles. Moreover, the immunoreactivity of both TS (CD63 and CD81) was barely detectable. Observation at the ultrastructural level suggested more general disruption of sPro-O (Figure 6) than sPro-N. In general, vesicular structures were low abundant and their morphology was clearly different from sPro-N. Integrity of the TX-100-treated vesicles reflected on patterns of total proteins (Figure 7) and glycoproteins (Figure 8) and indicated more severe perturbation than for sPro-N (Figure 3a). In comparison with the native sPro-O (Figure 7a), a significant loss of protein in the entire range of molecular masses, which remained mostly in the region below 66 kDa, was observed (Figure 7b). In agreement with this, Con A-reactive glycoproteins of native sPro-O (Figure 8a) were also strikingly decreased, including the major one at 97 kDa (Figure 8b). Moreover, lectin blot failed to detect any WGA-reactive glycoproteins in the TX-100 treated sPro-O (Figure 8b). Compared with those for sPro-N, the profiles of both types of released glycoproteins for sPro-O indicated more intensive aggregation to form complexes which, in general, interfere with or prevent the detection of contributing components.\nSurface-associated glycoproteins and gamma-glutamyl transferase on seminal prostasomes of oligozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of oligozoospermic men (sPro-O) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-O from Sephadex G-200 column (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. Barely detectable CD9- and gal-3-immunoreactivity is indicated by circle. A450, absorbance at 450 nm; GGT, gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3, galectin 3; F, fraction.\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of oligozoospermic men (sPro-O) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 5). Bar 500 nm. F14–F17: rare vesicles; F19–F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a) and TX-100-treated sPro-O (b) were resolved by electrophoresis and stained with silver. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a, c) and TX-100-treated sPro-O (b, d) were subjected to lectin blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.\nIn parallel, prostasomes isolated from human seminal plasma of oligozoospermic men (sPro-O) were subjected to TX-100 treatment and analyzed in the same manner. Compared to the native sample, the treated ones exhibited patterns of Con A- (Figure 5a) and WGA-reactive glycans (Figure 5b) as well as GGT (Figure 5c) that indicated decrease/loss and/or redistribution, similarly as found for sPro-N. In addition, similarity with sPro-N was also noticed regarding the effect on the redistribution of TS: CD63 and CD81 (Figure 5d). However, although CD9 (Figure 5d, fraction 14) and gal-3 (Figure 5d, fractions 14–16) both remained close to the initial position as observed for sPro-N, they exhibited partially overlapping profiles. Moreover, the immunoreactivity of both TS (CD63 and CD81) was barely detectable. Observation at the ultrastructural level suggested more general disruption of sPro-O (Figure 6) than sPro-N. In general, vesicular structures were low abundant and their morphology was clearly different from sPro-N. Integrity of the TX-100-treated vesicles reflected on patterns of total proteins (Figure 7) and glycoproteins (Figure 8) and indicated more severe perturbation than for sPro-N (Figure 3a). In comparison with the native sPro-O (Figure 7a), a significant loss of protein in the entire range of molecular masses, which remained mostly in the region below 66 kDa, was observed (Figure 7b). In agreement with this, Con A-reactive glycoproteins of native sPro-O (Figure 8a) were also strikingly decreased, including the major one at 97 kDa (Figure 8b). Moreover, lectin blot failed to detect any WGA-reactive glycoproteins in the TX-100 treated sPro-O (Figure 8b). Compared with those for sPro-N, the profiles of both types of released glycoproteins for sPro-O indicated more intensive aggregation to form complexes which, in general, interfere with or prevent the detection of contributing components.\nSurface-associated glycoproteins and gamma-glutamyl transferase on seminal prostasomes of oligozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of oligozoospermic men (sPro-O) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-O from Sephadex G-200 column (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. Barely detectable CD9- and gal-3-immunoreactivity is indicated by circle. A450, absorbance at 450 nm; GGT, gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3, galectin 3; F, fraction.\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of oligozoospermic men (sPro-O) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 5). Bar 500 nm. F14–F17: rare vesicles; F19–F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a) and TX-100-treated sPro-O (b) were resolved by electrophoresis and stained with silver. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a, c) and TX-100-treated sPro-O (b, d) were subjected to lectin blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.", "Distributions of distinct surface-associated markers of prostasomes from human SP of normozoospermic men (sPro-N) after solubilization with TX-100 are shown in Figure 1a–d. In general, their gel filtration elution positions differed in terms of a more or less noticeable shift from the void volume where they were co-eluted on native vesicles, revealing new patterns of associations.\nSurface-associated glycoproteins and gamma-glutamyl transferase on the seminal prostasomes of normozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of normozoospermic men (sPro-N) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-N (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. A450: absorbance at 450 nm; GGT: gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3: galectin 3; F: fraction.\nIn eluted fractions, total mannosylated and sialylated glycans, which can reside on both glycoprotein and glycolipids, were monitored by lectin-binding reactivity (Figure 1a, b), and the GGT as an individual protein marker was monitored by enzymatic activity (Figure 1c). Thus, Con A-reactive glycoproteins were solubilized as evidenced by a striking decrease at the initial position (Figure 1a). However, the related redistribution can be rather deduced than clearly shown according to the reactivity of fractions in the included column volume, possibly due to the influence of their structure on immobilization. In contrast to this, WGA-reactive glycoproteins seemed to be partly solubilized and released as aggregated, judging by the corresponding elution profile revealing broad peaks entering the column and trailing down along the entire chromatogram (Figure 1b). Moreover, they produced a small but distinct peak before that of intact vesicles, which suggests formation of larger protein complexes. As for GGT, it was also clearly solubilized from vesicles with TX-100 and exhibited an elution profile distinct from the examined glycans (Figure 1c). The influence of TX-100 on the distribution of TS: CD63, CD9, and CD81, chosen as integral membrane proteins, and gal-3, chosen as a soluble but membrane-associated molecule, was monitored by the immunodot blot as adequate method (in contrast to western blot) for monitoring surface-associated changes (Figure 1d). TS and gal-3 co-localized on native vesicles at a position overlapping the detected Con A- and WGA-reactive glycoproteins and GGT (Figure 1c, data not shown). After TX-100 treatment, CD63 was clearly released and exhibited broad distribution (Figure 1d, fractions 16–30), but also remained close to its initial position. In contrast to this, CD9 (Figure 1d, fractions 16–18) and gal-3 (Figure 1d, fractions 16–18) retained narrow distributions, that is, they were slightly shifted during elution. Moreover, their patterns overlapped completely. As for CD81, it could not be detected after detergent treatment (Figure 1d). To further follow up the influence of TX-100 on prostasomes, changes in their ultrastructure were analyzed (Figure 2). In the region where all examined markers remained more or less co-localized after TX-100 treatment, the microscopic inspection revealed the presence of structures that correspond to reorganized detergent-resistant domains of vesicular membranes. They appeared as broken vesicles surrounded with leaking content or smaller vesicles with disrupted irregular surfaces seemingly shrunken with no associated material. In contrast to this, in the region where released glycoproteins were separated (Figure 1, fractions 20–22), no such structures were visible, only irregular, possibly, protein deposits. To complement the results obtained for detergent-treated samples as such, changes in the patterns of total prostasomal glycoproteins were analyzed under denaturing and reducing conditions by electrophoresis (Figure 3) and lectin blot (Figure 4). Compared to the native vesicles (Figure 3a), in the TX-100-treated ones (Figure 3b), the proteins exhibiting a prostasome-like pattern remained clustered close to the initial position, that is, they were marginally shifted in elution. However, their abundance was noticeably lower. Specifically, discrete changes in terms of the abundance of major bands in the region below 66 kDa (encompass masses of TS and gal-3) were detected. In addition, clear loss of bands in the region corresponding to the masses of prostasomal signature bands (90–150 kDa) was also detected. Consequently, some of them were visible as shifted in a cluster of protein bands included in column volume (Figure 3b, fractions 20–22).\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of normozoospermic men (sPro-N) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 1). Bar 500 nm. F14: rare vesicles; F17: broken vesicles surrounded with leaking content; F19: vesicles with disrupted irregular surface with no associated material; F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a) and TX-100 treated sPro-N (b) were resolved by electrophoresis and stained with silver. Although aggregation is present as judged by intense bands at the border of the stacking and separating gel, the referent protein bands are preserved. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from normozoospermic men. Selected gel filtration (Figure 1) fractions (F) of native prostasomes from human seminal plasma of normozoospermic men (sPro-N) (a, c) and TX-100 treated sPro-N (b, d) were subjected to lectin-blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.\nIn contrast to proteins, prostasomal glycoproteins were considerably reorganized after TX-100 treatment. Regarding Con A-reactive glycoproteins, what the lectin-binding assay suggested was confirmed by the lectin blot (Figure 4). Thus, the pattern of Con A-reactive glycoproteins from native vesicles comprised high molecular mass band at the border of the stacking and separating gel and smear band in the stacking gel as well as four distinct lower molecular mass bands (Figure 4 a, fractions 15–17). After TX-100 treatment, a striking loss of high molecular mass components was observed. It can be related to different modes of redistribution of distinct lower molecular mass Con A-reactive bands. Specifically, the major 97 kDa band remained partly close to the initial position (Figure 4b, fraction 17) but was also released, that is, redistributed (Figure 4b, fractions 19–22). In addition, almost complete release of those with molecular masses below 66 kDa was observed (Figure 4a, b, fractions 15–17).\nThe pattern of WGA-reactive glycoproteins of native vesicles was comparable with that of the Con A-reactive ones in high molecular mass region (Figure 4c). However, after TX-100 treatment, their patterns were strikingly different (Figure 4d), as initially observed in the corresponding lectin-binding assay (Figure 1b). Thus, the high molecular mass band was completely lost, and a shift of weak 97 kDa was also detected.\nTaken together, the profiles related to the cluster of Con A- and WGA-binding glycoproteins might be influenced by their presence in different but overlapping complexes. Moreover, it is possible that diverse, but overlapped, bands with matching molecular mass and lectin binding were detected, as indicated by disparate/selective presence/abundance of particular ones in the subsequently eluted fraction.", "In parallel, prostasomes isolated from human seminal plasma of oligozoospermic men (sPro-O) were subjected to TX-100 treatment and analyzed in the same manner. Compared to the native sample, the treated ones exhibited patterns of Con A- (Figure 5a) and WGA-reactive glycans (Figure 5b) as well as GGT (Figure 5c) that indicated decrease/loss and/or redistribution, similarly as found for sPro-N. In addition, similarity with sPro-N was also noticed regarding the effect on the redistribution of TS: CD63 and CD81 (Figure 5d). However, although CD9 (Figure 5d, fraction 14) and gal-3 (Figure 5d, fractions 14–16) both remained close to the initial position as observed for sPro-N, they exhibited partially overlapping profiles. Moreover, the immunoreactivity of both TS (CD63 and CD81) was barely detectable. Observation at the ultrastructural level suggested more general disruption of sPro-O (Figure 6) than sPro-N. In general, vesicular structures were low abundant and their morphology was clearly different from sPro-N. Integrity of the TX-100-treated vesicles reflected on patterns of total proteins (Figure 7) and glycoproteins (Figure 8) and indicated more severe perturbation than for sPro-N (Figure 3a). In comparison with the native sPro-O (Figure 7a), a significant loss of protein in the entire range of molecular masses, which remained mostly in the region below 66 kDa, was observed (Figure 7b). In agreement with this, Con A-reactive glycoproteins of native sPro-O (Figure 8a) were also strikingly decreased, including the major one at 97 kDa (Figure 8b). Moreover, lectin blot failed to detect any WGA-reactive glycoproteins in the TX-100 treated sPro-O (Figure 8b). Compared with those for sPro-N, the profiles of both types of released glycoproteins for sPro-O indicated more intensive aggregation to form complexes which, in general, interfere with or prevent the detection of contributing components.\nSurface-associated glycoproteins and gamma-glutamyl transferase on seminal prostasomes of oligozoospermic men: influence of detergent treatment. Prostasomes from human seminal plasma of oligozoospermic men (sPro-O) were subjected to Triton X-100 (TX-100) treatment followed by gel filtration on a Sephadex G-200 column. Reference elution profiles of native sPro-O from Sephadex G-200 column (eluted at void volume) were shown for comparison. Elution of (a) concanavalin A-reactive glycans (Con A-R) and (b) wheat germ agglutinin-reactive glycans (WGA-R). (c) Elution of GGT. (d) Distribution of tetraspanins (CD63, CD9, and CD81) and gal-3 (indicated in panel c) was monitored by measuring the immunoreactivity of dot blot-immobilized fractions. The presence of TX-100 in eluted fractions caused spilled appearance of dots and background staining. Barely detectable CD9- and gal-3-immunoreactivity is indicated by circle. A450, absorbance at 450 nm; GGT, gamma-glutamyl transferase activity expressed in U/L, unit per liter; gal-3, galectin 3; F, fraction.\nTransmission electron microscopy of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Ultrastructural appearance of prostasomes from human seminal plasma of oligozoospermic men (sPro-O) treated with TX-100. Selected gel filtration-resolved fraction (F) was shown (Figure 5). Bar 500 nm. F14–F17: rare vesicles; F19–F21: irregular deposits.\nProtein composition of the detergent-treated prostasomes from human seminal plasma of oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a) and TX-100-treated sPro-O (b) were resolved by electrophoresis and stained with silver. No adjustment of glycoprotein content (equal concentration per lane) was made, that is, the eluted fractions were loaded as such (equal volume) to keep on elution profiles. The numbers (in kDa) indicate the position of molecular mass standards.\nDistribution of Con A-reactive and WGA-reactive glycoproteins of the detergent-treated seminal prostasomes from oligozoospermic men. Selected gel filtration (Figure 5) fractions (F) of native prostasomes from human seminal plasma of oligozoospermic men (sPro-O) (a, c) and TX-100-treated sPro-O (b, d) were subjected to lectin blot using Con A (a, b) and WGA (c, d). Con A-R: concanavalin A-reactive glycoproteins; WGA-R: wheat germ agglutinin-reactive glycoproteins. The numbers (in kDa) indicate the position of molecular mass standards. Arrows indicate the border of stacking and separating gel.", "The results obtained revealed novel patterns of surface-associated prostasomal proteins and related them to the molecular disposition on detergent-sensitive/resistant membrane domains that exist under normal physiology and conditions of low sperm count. In summary, distinct differences were found in the influence of detergent on solubilization of each tetraspanin as well as their relation with the other examined surface-associated molecules. Accordingly, they were grouped into two patterns mainly consisting of overlapped CD9/gal3/WGA-reactive glycoproteins and CD63/Con A-reactive glycoproteins/GGT. When the effect of TX-100 on sPro-N is compared with that on sPro-O, the overall similarity can be seen regarding the redistribution of examined surface-associated glycoproteins including GGT, all presumed to be mainly part of the vesicle coat. In contrast to this, greater difference was found in the redistribution of true integral membrane proteins exemplified by TS as well as gal-3, which could exist as membrane-associated through carbohydrate/protein-binding interactions. More specifically, in sPro-O, perturbation of CD9 and gal-3 was found to be related to engagement in different high molecular mass complexes and mutual segregation rather than co-localization in detergent-resistant membranous structures as could be deduced for sPro-N.\nThe existence of a TS-web on EVs, in general, has not been studied (4). In addition, there are few data on the composition of prostasomal surface glycans and gal-3 (2, 16). TS are a family of integral membrane proteins that may be involved in three levels of interaction with their molecular partners (11, 20, 21). As a result of these interactions, they are grouped into detergent-soluble tetraspanin-enriched membranes (1, 10, 22) that are clearly different from other types of higher order molecular complexes (23). Some detergents used for the investigation of prostasomal proteins (24) may differently affect TS interactions with their molecular partners. Since these interactions were out of the scope of this study, and we actually wanted to disrupt TS–TS interactions, we choose TX-100 treatment as the most commonly used method for the extraction of selected molecules (both TS and GGT) (15, 22). In addition to TS, the recruitment of different molecules into organized complexes may involve galectins (25, 26). Although soluble proteins, galectins, are readily found as membrane-associated through interactions achieved by carbohydrate-binding (cross-links N-glycans as ligands) or other protein- or lipid-binding domains, such as gal-3 as a distinct member of this family of lectins (5, 23, 27).\nThus, TS are expected to be readily solubilized, and since they are medium sized (~250 amino acids), this can cause a broad elution pattern due to the shift to higher molecular masses (depending on the composition of complexes with ligands). Indeed, the observed redistribution of CD63 was in agreement with this, suggesting abundant release in molecular complexes in response to detergent treatment of both sPro-N and sPro-O. However, one part of CD63-immunoreactivity remained at the initial position. In contrast to CD63, the elution of CD9 was only slightly shifted suggesting that it remains in high molecular mass complexes in both sPro-N and sPro-O. However, the complexes in sPro-N and sPro-O seemed to differ judging by the influence of detergent treatment on their structure. Thus, TEM suggested that CD9 in sPro-N remained in detergent-insoluble membranes/vesicular structures, whereas in sPro-O it was rather a part of aggregated protein complexes (both eluted in the void volume). This is supported by gal-3 distribution, which overlapped completely with CD9 in sPro-N but partially in sPro-O. The possibility of glycan-mediated or protein–protein interaction of gal-3 with CD9 can be supported by their detected co-localization, since neither type of interaction is expected to be influenced by TX-100. As for CD81, it could not be detected after TX-100 treatment in either sPro-N or sPro-O. This can be related to the data indicating that different antibodies differentially recognize CD81 if it is associated with the TS-web, or if the web is disrupted using the TX-100 (28). CD81 was previously reported to interact with GGT (29), which was also monitored. In relation to this, our results for the redistribution of prostasomal surface-associated GGT, monitored by measuring the enzymatic activity, clearly indicated its release from vesicles and appearance in molecular complexes (30). However, at this stage, it cannot be confirmed if this GGT pattern is due to its complex with CD81. Differences in the solubilizing properties of TS might be related to the facts that CD9 is a glycosylated proteolipid, CD63 is a glycosylated protein, and CD81 is a non-glycosylated protein (1). Thus, the TS structure itself and the specificities of the prostasomal surface microenvironment (in terms of distribution and presentation of glycans) may also influence the results obtained for detergent sensitivity. So far, it was reported that the examined TS and gal-3 are found co-isolated with prostasomal lipid rafts (9). It is known that lipid rafts contain an unusual lipid composition rich in cholesterol, which renders them insoluble upon detergent treatment (9, 31) and that they may associate with TS by lateral crosstalk between membrane domains. In relation to this, the existence of several prostasomal gal-3 isoelectric variants including a truncated form (carbohydrate recognition domain only) (7) which could reside in a different membrane microenvironment and consequently organize related but distinct molecular complexes may be responsible for specific redistribution profiles of glycoproteins/TS.\nDetergent-soluble glycoproteins as molecules, which, on the one hand, can penetrate the membrane core and anchor hydrophobically, and, on the other hand, constitute a specific coat (32, 33), could also influence the stability and accessibility of the domain that may be intercalated with detergent. In this study, in intact sPro-N and sPro-O, WGA and Con A revealed a cluster of distinct partially overlapped glycoproteins. They were almost completely released from vesicles upon TX-100 treatment. However, the detergent-induced changes were distinct, influencing their detection depending on the experimental conditions used, especially for WGA-reactive ones. Significant shielding in auto-aggregates/heterologous complexes which can interfere with lectin binding, or mixed release of glycolipids/lipoproteins which escape detection by the methods used, is in agreement with the observed behavior, much emphasized in sPro-O. It is interesting that the majority of Con A-reactive glycoproteins were revealed in the region overlapping prostasome signature bands in both intact sPro-N and sPro-O. They are glycoproteins comprising the integral membrane protein CD13 of 150 kDa, transmembrane, and soluble CD26 of 82–110 kDa and soluble CD10 of 94 kDa (34). Regarding TS, all this indicated mixed patterns of different Con A-reactive glycoproteins and their preferential associations with CD63, which exhibited an overlapped solubilization pattern.\nAnalysis of membranous proteins is very difficult, since they usually exhibit anomalous behavior in many standardly used protein techniques (35–37). The possibility that some proteins could aggregate in spite of the critical micelle concentration, due to their abundance or inherent structure as well as that resolved peaks could be a set of peaks from protein, protein complexes, lipid and detergent, must be taken into consideration (38). Thus, the obtained molecular patterns themselves are descriptive and provide qualitative data. As a rule, they comprise numerous differently abundant bands. Some of them could have variable presence and some of them are constitutively present. Similar to the total prostasomal protein pattern exemplified by three prostasome signature bands (34), solubilization signature provided data in terms of annotation of main glycoproteins/TS to distinct detergent-sensitive or insensitive prostasomal patterns. Consequently, they can be used reliably for the comparison of prostasomes/any EVs (after establishing their own solubilization signature) in different physiological conditions. In terms of the presumed role of EVs as a communication tool (39, 40), these initial data could be a base for addressing the place of scaffolding in enabling the membrane functionality of EVs. In addition, it may initiate widening investigations on the basic issues of membrane complexity (41–43) usually deduced from the cell surface of plasma membrane to the field of EVs membrane." ]

[ "intro", "material|methods", null, null, null, null, null, null, null, "results", null, null, "discussion" ]

[ "Extracellular vesicles", "detergent sensitivity", "CD63", "CD9", "gamma-glutamyl transferase", "molecular patterns", "normozoospermia", "oligozoospermia" ]

[ 215, 120, 170, 348, 61, 418, 119, 1659, 914 ]

[ "figure", "spro", "100", "tx 100", "tx", "fractions", "glycoproteins", "prostasomes", "reactive", "men" ]

[ "glycoproteins lectin", "lectins including galectins", "galectins widely studied", "web galectin glycoprotein", "galectin glycoprotein lattices" ]

[ "Aged", "Aged, 80 and over", "Arthroplasty, Replacement, Knee", "Female", "Humans", "Male", "Middle Aged", "Prospective Studies", "Range of Motion, Articular", "Rotation", "Tibia" ]

[ "Methods", "Ethics and consent", "Patient demographics", "Operative procedure", "Statistics", "Results", "Discussion", "Limitations of the study", "Conclusions" ]

[ "A prospective, observational study of 20 consecutive primary posterior stabilized TKAs in 20 patients with fixed-bearing polyethylene inserts (Scorpio Flex PS, Stryker Corporation, Mahwah, NJ USA) was performed by a single surgeon (MvS).\nData collection began with 10 consecutive TKAs to determine whether there was a difference between the alignment techniques and if so to gather data to perform a power analysis. Using the acquired data, we determined that a total of 20 subjects were needed to achieve 90 % power assuming a minimum detectable difference of 5.0 degrees, a standard deviation of 7.7 degrees and a significance level of alpha < 0.05.\nThe mean pre-operative mechanical leg axis was 3.65° ± SD 7.15 of varus. The mean pre-operative mechanical leg axis of the varus knees (N = 15) was 7.0° ± SD 4.05, of the valgus knees (N = 5) was −6.4° ± SD −4.15.\nPositive values indicated varus alignment, negative values indicated valgus alignment.\nThe mean posterior slope was 1.5° ± SD 1.02.\n Ethics and consent The Medical Ethics Committee of the Maastricht University Medical Centre has concluded that the described research does not apply to the Dutch Medical Research involving Human Subjects Act (WMO), therefore the patient was not required to provide consent regarding the use of the material.\nFurthermore, every patient in the Maastricht University Medical Centre is provided with information regarding these kinds of studies. If they do not wish to contribute to these studies, this information will be included in their file. The patient involved in this study did not make an objection against the use of his/her material for research purposes.\nThe Medical Ethics Committee of the Maastricht University Medical Centre has concluded that the described research does not apply to the Dutch Medical Research involving Human Subjects Act (WMO), therefore the patient was not required to provide consent regarding the use of the material.\nFurthermore, every patient in the Maastricht University Medical Centre is provided with information regarding these kinds of studies. If they do not wish to contribute to these studies, this information will be included in their file. The patient involved in this study did not make an objection against the use of his/her material for research purposes.\n Patient demographics The patient demographics are summarized in Table 1.Table 1Patient demographics. Positive values indicated varus alignment, negative values indicated valgus alignmentAge (years)Preoperative Leg axis (degrees varus)Sex (Male/Female)Side (Right/Left)Preoperative ROM (degrees)Preoperative flexion contracture (degrees)Mean ± SD69.8 ± 103.7 ± 7.28/1210/10117 ± 165.6 ± 4.7\nPatient demographics. Positive values indicated varus alignment, negative values indicated valgus alignment\nThe patient demographics are summarized in Table 1.Table 1Patient demographics. Positive values indicated varus alignment, negative values indicated valgus alignmentAge (years)Preoperative Leg axis (degrees varus)Sex (Male/Female)Side (Right/Left)Preoperative ROM (degrees)Preoperative flexion contracture (degrees)Mean ± SD69.8 ± 103.7 ± 7.28/1210/10117 ± 165.6 ± 4.7\nPatient demographics. Positive values indicated varus alignment, negative values indicated valgus alignment\n Operative procedure The Stryker Knee Navigation System (Stryker Navigation System II, version 3.1) was used in this study. The prosthesis (Scorpio PS Stryker Howmedica Osteonics, Allendale, NJ USA) used in these surgeries allows five degrees of rotation between the tibial insert and the femoral component. In all cases, a tourniquet was applied for the entire duration of the surgery. After a standard midline skin incision and a medial parapatellar arthrotomy, the active wireless trackers of the navigation system were fixed to the femur and tibia. The required landmarks were entered into the navigation computer, and the rotation centre of the hip was determined by a special algorithm executed in customized software. The transepicondylar axis of the distal femur and the Whiteside’s line were set in each case exactly perpendicular to each other to improve the accuracy of the positioning the femoral component. The femoral component was aligned parallel to the transepicondylar axis. The AP axis of the proximal tibia was determined by placing the tip of the pointer on the centre of the line between the intercondylar eminences and aligning it to the medial 1/3 of the tibial tubercle . This AP axis was saved in the navigation program as 0 degrees of rotation. The proximal tibial and distal femoral cuts were performed and examined with the navigation system. The tibial posterior slope was set according to the patient’s natural slope. The polyethylene insert (Scorpio-Flex PS fixed bearing tibial insert) had an additional four degrees of posterior down-slope. The rotation of the femoral component was oriented according to the transepicondylar line and the AP axis (Whiteside’s Line) of the distal femur as currently advised in literature [3, 5, 17]. After soft tissue balancing and achievement of the maximal range of motion, the patella was prepared. The patellar button position may affect femoro-tibial kinematics; therefore, all of the trial components, including the patella and the PS tibial trial insert, were placed before the tibial component was subjected to the ROM technique. One navigation tracker was applied to the alignment handle of the trial tibial tray to check the position according to the given 0 degrees of rotation. Flexion and extension were measured intra-operatively after the approach was made and the trackers were placed. Positive values for extension represent hyperextension, while negative values represent flexion contracture.\nThe tibial component was inserted and checked for smooth movement on the tibial cut surface. The knee was then put through five full flexion-extension cycles while the surgeon held the ankle only. During the ROM cycles, no hands were touching the knee to prevent manual manipulation, and no varus/valgus stress was applied. The movement was followed on the navigation computer to confirm that no varus/valgus stress was applied. After performing the ROM cycles, the rotational position of the trial tibial component was recorded as indicated by the navigation computer. Positive values indicated that the trial component was in internal rotation according to the given TTL axis, and negative values indicated that the trial component was in external rotation. While this measurement was being acquired, the patella was lying in the patellar groove to facilitate optimal patellofemoral tracking and to prevent lateral pull on the patella tendon that could cause the tibia to rotate externally. The rotational position was noted (measurement 1). After removing and reinserting the components, the ROM technique was applied two additional times with five full flexion-extension movements and corresponding subsequent measurements from the navigation system (measurement 2 and 3).\nAfter completing the operative procedure, the final tibial tray was cemented up to 1/3 of the medial border of the tibial tubercle.\nThe Stryker Knee Navigation System (Stryker Navigation System II, version 3.1) was used in this study. The prosthesis (Scorpio PS Stryker Howmedica Osteonics, Allendale, NJ USA) used in these surgeries allows five degrees of rotation between the tibial insert and the femoral component. In all cases, a tourniquet was applied for the entire duration of the surgery. After a standard midline skin incision and a medial parapatellar arthrotomy, the active wireless trackers of the navigation system were fixed to the femur and tibia. The required landmarks were entered into the navigation computer, and the rotation centre of the hip was determined by a special algorithm executed in customized software. The transepicondylar axis of the distal femur and the Whiteside’s line were set in each case exactly perpendicular to each other to improve the accuracy of the positioning the femoral component. The femoral component was aligned parallel to the transepicondylar axis. The AP axis of the proximal tibia was determined by placing the tip of the pointer on the centre of the line between the intercondylar eminences and aligning it to the medial 1/3 of the tibial tubercle . This AP axis was saved in the navigation program as 0 degrees of rotation. The proximal tibial and distal femoral cuts were performed and examined with the navigation system. The tibial posterior slope was set according to the patient’s natural slope. The polyethylene insert (Scorpio-Flex PS fixed bearing tibial insert) had an additional four degrees of posterior down-slope. The rotation of the femoral component was oriented according to the transepicondylar line and the AP axis (Whiteside’s Line) of the distal femur as currently advised in literature [3, 5, 17]. After soft tissue balancing and achievement of the maximal range of motion, the patella was prepared. The patellar button position may affect femoro-tibial kinematics; therefore, all of the trial components, including the patella and the PS tibial trial insert, were placed before the tibial component was subjected to the ROM technique. One navigation tracker was applied to the alignment handle of the trial tibial tray to check the position according to the given 0 degrees of rotation. Flexion and extension were measured intra-operatively after the approach was made and the trackers were placed. Positive values for extension represent hyperextension, while negative values represent flexion contracture.\nThe tibial component was inserted and checked for smooth movement on the tibial cut surface. The knee was then put through five full flexion-extension cycles while the surgeon held the ankle only. During the ROM cycles, no hands were touching the knee to prevent manual manipulation, and no varus/valgus stress was applied. The movement was followed on the navigation computer to confirm that no varus/valgus stress was applied. After performing the ROM cycles, the rotational position of the trial tibial component was recorded as indicated by the navigation computer. Positive values indicated that the trial component was in internal rotation according to the given TTL axis, and negative values indicated that the trial component was in external rotation. While this measurement was being acquired, the patella was lying in the patellar groove to facilitate optimal patellofemoral tracking and to prevent lateral pull on the patella tendon that could cause the tibia to rotate externally. The rotational position was noted (measurement 1). After removing and reinserting the components, the ROM technique was applied two additional times with five full flexion-extension movements and corresponding subsequent measurements from the navigation system (measurement 2 and 3).\nAfter completing the operative procedure, the final tibial tray was cemented up to 1/3 of the medial border of the tibial tubercle.\n Statistics The statistical analyses were performed with SPSS statistical software (Version 12, SPSS Inc., Chicago, IL USA). The reproducibility of the ROM-technique was evaluated using the intra-class correlation coefficient (ICC). For each target, there was one ‘rater’(MvS) who performed the three consecutive attempts at positioning the tibial component using the ROM technique. Since the exact same rater made ratings on every patient and it was assumed that both patients and observer were drawn randomly from larger populations, the ICC2 was used [19]. The ICC2 reflects the reliability of this single rater. Means were compared with paired T-tests in cases of normal distributions [20]. A level of p < 0.05 was considered statistically significant. The mean of the 3 ROM measurements was used to evaluate the difference between the ROM and TTL techniques. We evaluated potential factors associated with the difference between the ROM and TTL technique including, leg axis, intra-operative flexion, intra-operative extension and posterior slope. (Table 2) The associations between each variable and the difference between the ROM and TTL were examined with univariable regression analyses. Factors that were associated with the outcome in univariable analyses (p-values < 0.20) were included in multivariable regression analyses. In multivariable regression analyses p-values < 0.05 were considered significant. Regression coefficients with their 95 % confidence intervals are reported.Table 2Outcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contractureVariablesMean ± SD(range)Difference ROM and TTL (°)−4.6 ± 8.6(−27.0 to 11.5)Varus mechanical leg axis (°)3.7 ± 7.2(−13.0 to 15.0)Intra-operative flexion (°)121.9 ± 6.7(108.0 to 134.0)Intra-operative extension (°)−0.1 ± 3.0(−5.5 to 7.0)Posterior slope (°)1.5 ± 1.0(0.0 to 3.5)\nOutcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contracture\nThe statistical analyses were performed with SPSS statistical software (Version 12, SPSS Inc., Chicago, IL USA). The reproducibility of the ROM-technique was evaluated using the intra-class correlation coefficient (ICC). For each target, there was one ‘rater’(MvS) who performed the three consecutive attempts at positioning the tibial component using the ROM technique. Since the exact same rater made ratings on every patient and it was assumed that both patients and observer were drawn randomly from larger populations, the ICC2 was used [19]. The ICC2 reflects the reliability of this single rater. Means were compared with paired T-tests in cases of normal distributions [20]. A level of p < 0.05 was considered statistically significant. The mean of the 3 ROM measurements was used to evaluate the difference between the ROM and TTL techniques. We evaluated potential factors associated with the difference between the ROM and TTL technique including, leg axis, intra-operative flexion, intra-operative extension and posterior slope. (Table 2) The associations between each variable and the difference between the ROM and TTL were examined with univariable regression analyses. Factors that were associated with the outcome in univariable analyses (p-values < 0.20) were included in multivariable regression analyses. In multivariable regression analyses p-values < 0.05 were considered significant. Regression coefficients with their 95 % confidence intervals are reported.Table 2Outcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contractureVariablesMean ± SD(range)Difference ROM and TTL (°)−4.6 ± 8.6(−27.0 to 11.5)Varus mechanical leg axis (°)3.7 ± 7.2(−13.0 to 15.0)Intra-operative flexion (°)121.9 ± 6.7(108.0 to 134.0)Intra-operative extension (°)−0.1 ± 3.0(−5.5 to 7.0)Posterior slope (°)1.5 ± 1.0(0.0 to 3.5)\nOutcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contracture", "The Medical Ethics Committee of the Maastricht University Medical Centre has concluded that the described research does not apply to the Dutch Medical Research involving Human Subjects Act (WMO), therefore the patient was not required to provide consent regarding the use of the material.\nFurthermore, every patient in the Maastricht University Medical Centre is provided with information regarding these kinds of studies. If they do not wish to contribute to these studies, this information will be included in their file. The patient involved in this study did not make an objection against the use of his/her material for research purposes.", "The patient demographics are summarized in Table 1.Table 1Patient demographics. Positive values indicated varus alignment, negative values indicated valgus alignmentAge (years)Preoperative Leg axis (degrees varus)Sex (Male/Female)Side (Right/Left)Preoperative ROM (degrees)Preoperative flexion contracture (degrees)Mean ± SD69.8 ± 103.7 ± 7.28/1210/10117 ± 165.6 ± 4.7\nPatient demographics. Positive values indicated varus alignment, negative values indicated valgus alignment", "The Stryker Knee Navigation System (Stryker Navigation System II, version 3.1) was used in this study. The prosthesis (Scorpio PS Stryker Howmedica Osteonics, Allendale, NJ USA) used in these surgeries allows five degrees of rotation between the tibial insert and the femoral component. In all cases, a tourniquet was applied for the entire duration of the surgery. After a standard midline skin incision and a medial parapatellar arthrotomy, the active wireless trackers of the navigation system were fixed to the femur and tibia. The required landmarks were entered into the navigation computer, and the rotation centre of the hip was determined by a special algorithm executed in customized software. The transepicondylar axis of the distal femur and the Whiteside’s line were set in each case exactly perpendicular to each other to improve the accuracy of the positioning the femoral component. The femoral component was aligned parallel to the transepicondylar axis. The AP axis of the proximal tibia was determined by placing the tip of the pointer on the centre of the line between the intercondylar eminences and aligning it to the medial 1/3 of the tibial tubercle . This AP axis was saved in the navigation program as 0 degrees of rotation. The proximal tibial and distal femoral cuts were performed and examined with the navigation system. The tibial posterior slope was set according to the patient’s natural slope. The polyethylene insert (Scorpio-Flex PS fixed bearing tibial insert) had an additional four degrees of posterior down-slope. The rotation of the femoral component was oriented according to the transepicondylar line and the AP axis (Whiteside’s Line) of the distal femur as currently advised in literature [3, 5, 17]. After soft tissue balancing and achievement of the maximal range of motion, the patella was prepared. The patellar button position may affect femoro-tibial kinematics; therefore, all of the trial components, including the patella and the PS tibial trial insert, were placed before the tibial component was subjected to the ROM technique. One navigation tracker was applied to the alignment handle of the trial tibial tray to check the position according to the given 0 degrees of rotation. Flexion and extension were measured intra-operatively after the approach was made and the trackers were placed. Positive values for extension represent hyperextension, while negative values represent flexion contracture.\nThe tibial component was inserted and checked for smooth movement on the tibial cut surface. The knee was then put through five full flexion-extension cycles while the surgeon held the ankle only. During the ROM cycles, no hands were touching the knee to prevent manual manipulation, and no varus/valgus stress was applied. The movement was followed on the navigation computer to confirm that no varus/valgus stress was applied. After performing the ROM cycles, the rotational position of the trial tibial component was recorded as indicated by the navigation computer. Positive values indicated that the trial component was in internal rotation according to the given TTL axis, and negative values indicated that the trial component was in external rotation. While this measurement was being acquired, the patella was lying in the patellar groove to facilitate optimal patellofemoral tracking and to prevent lateral pull on the patella tendon that could cause the tibia to rotate externally. The rotational position was noted (measurement 1). After removing and reinserting the components, the ROM technique was applied two additional times with five full flexion-extension movements and corresponding subsequent measurements from the navigation system (measurement 2 and 3).\nAfter completing the operative procedure, the final tibial tray was cemented up to 1/3 of the medial border of the tibial tubercle.", "The statistical analyses were performed with SPSS statistical software (Version 12, SPSS Inc., Chicago, IL USA). The reproducibility of the ROM-technique was evaluated using the intra-class correlation coefficient (ICC). For each target, there was one ‘rater’(MvS) who performed the three consecutive attempts at positioning the tibial component using the ROM technique. Since the exact same rater made ratings on every patient and it was assumed that both patients and observer were drawn randomly from larger populations, the ICC2 was used [19]. The ICC2 reflects the reliability of this single rater. Means were compared with paired T-tests in cases of normal distributions [20]. A level of p < 0.05 was considered statistically significant. The mean of the 3 ROM measurements was used to evaluate the difference between the ROM and TTL techniques. We evaluated potential factors associated with the difference between the ROM and TTL technique including, leg axis, intra-operative flexion, intra-operative extension and posterior slope. (Table 2) The associations between each variable and the difference between the ROM and TTL were examined with univariable regression analyses. Factors that were associated with the outcome in univariable analyses (p-values < 0.20) were included in multivariable regression analyses. In multivariable regression analyses p-values < 0.05 were considered significant. Regression coefficients with their 95 % confidence intervals are reported.Table 2Outcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contractureVariablesMean ± SD(range)Difference ROM and TTL (°)−4.6 ± 8.6(−27.0 to 11.5)Varus mechanical leg axis (°)3.7 ± 7.2(−13.0 to 15.0)Intra-operative flexion (°)121.9 ± 6.7(108.0 to 134.0)Intra-operative extension (°)−0.1 ± 3.0(−5.5 to 7.0)Posterior slope (°)1.5 ± 1.0(0.0 to 3.5)\nOutcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contracture", "The tibial component can be reliable positioned in terms of rotation using the ROM technique, as demonstrated by an ICC2 = 0.84 (95 % CI (0.70–0.93); p < 0.001). The ICC2 = 0.84 of tibial component positioning using the ROM technique indicating nearly perfect repeatability. Because the ROM technique was nearly perfectly reliable, the means of the 3 ROM measurements were used to evaluate the difference between the two techniques. With the ROM technique, the tibial component was on average 4.56 (± SD 8.59) degrees externally rotated compared to the tubercle landmark. This difference was statistically significant p = 0.028.\nIt appeared from the multivariable regression analyses that more valgus pre-operative mechanical leg axis (−0.54 (95%CI −0.98 - -0.10); p = 0.019), intra-operative flexion (0.57 (95%CI 0.13 – 1.00); p = 0.014) and intra-operative extension (1.41 (95%CI 0.50 – 2.32); p = 0.005) were associated with a greater difference between tibial component positioning using the ROM and TTL techniques. (Table 3) These results indicate that increasing the pre-operative varus mechanical leg alignment by 1 degree resulted in an increase in the external rotation of the tibial component of 0.54 degrees relative to the tibial tubercle using the ROM technique.Table 3Results of univariable and multivariable regression analysesVariableUnivariable analysisMultivariable analysiscoefficient (95%CI)\np-valuecoefficient (95%CI)\np-valueVarus mechanical leg axis−0.58 (−1.09 to −0.05)0.030−0.54 (−0.98 to −0.10)0.019Intra-operative flexion0.82 (0.33 to 1.31)0.0020.57 (0.13 to 1.00)0.014Intra-operative extension1.19 (−0.09 to 2.48)0.0701.41 (0.50 to 2.32)0.005Posterior slope2.63 (−1.31 to 6.56)0.1800.04 (−3.05 to 3.13)0.979\nResults of univariable and multivariable regression analyses\nIn the varus knees, the tibial component was on average 5.9 (± SD 8.7) degrees externally rotated; in the valgus knees, the mean external rotation was 0.4 (± SD 7.6) degrees relative to the tibial tubercle. The differences between the rotational alignments using the ROM and TTL techniques in both the varus and valgus knees were not statistically significant (p = 0.221).\nThe cut posterior slope (0.04 (95%CI −3.05 – 3.13); p = 0.979) was not significantly related to the difference in the rotational alignment of the tibial component according to the tibial tubercle in either the ROM or TTL techniques.", "This study revealed that the ROM technique is a repeatable method for aligning the tibial component. Using the ROM technique, the tibial component was on average 4.56 (± SD 8.59) degrees externally rotated compared to the tubercle landmark. Our result is in contradiction with Ikeuchi et al. [11] They found that using the ROM technique results in a more internally rotated position of the tibial component en found also widely variable results. However in line with our findings, Berhouet [21] and Chotanaputhi [22] found the ROM technique reproducible and the alignment of the tibial tray was externally rotated in comparison with the medial border of the tibial tubercle and the posterior tibial condyle line respectively. Ikeuchi [11] used cruciate-retaining (CR) TKA components without patellar resurfacing. The mean posterior slope of the cut tibia was 5 degrees and they compared the position of the tibial component related to the Akagi line [23]. The amount of tibial slope, the design of the prosthesis and the patella resurfacing all might have influenced the outcome. Rossi [24] stated that the ROM technique is a reproducible method to establish tibial rotation during TKA, having found that components were positioned in 0.35 external rotation to the Akagi line.\nUsing anatomical landmarks for the rotational alignment of the femoral and tibial components is a widely accepted method. Alignment to the medial 1/3 of the tibial tubercle (Insall’s reference [25]) is based on papers of Nicoll [26], Lawrie [27], Lützner [28] and Yin [29], who found the medial 1/3 of the tibial tubercle the most accurate and reliable anatomical landmark. However, determining the component positions separately can lead to rotational mismatch between the femoral and tibial components [30]. Using the dynamic ROM technique may allow for the tibial tray to align itself according to the femoral component position, ligament balancing and extensor mechanism alignment.\nRetrieval and biomechanical studies have indicated that femoro-tibial rotational mismatches cause increased contact stress on the tibial insert and patellar component that leads to accelerated polyethylene wear [31–33]. Steinbrück et al. [34] recommended the rotational alignment of the tibial component to the medial 1/3 of the tibial tubercle to achieve the lowest retro-patellar pressure. Using the ROM technique the tibial component was externally rotated by a mean 4.56 degrees respect the tibial tubercle which might have resulted in increased retro-patellar peak pressure. Kim et al [35] found the best survival rate when tibial component was aligned between 2 degrees of internal rotation to 5 degrees of external rotation to the medial 1/3 of the tibial tubercle. External rotational errors were not associated with pain in a study of Nicoll [26].\nTo measure the rotational difference between the ROM and TTL techniques in degrees may not be easy during TKAs that are performed without navigation. Computer navigation is an ideal method for measuring the difference in trial tibial tray position between the TTL and ROM techniques given its reported accuracy of one degree [36]. Furthermore, the use of computer navigation can help to optimize the femoral component position, which is crucial for the performance of the ROM technique. [15, 37] Computer navigation has no advantage regarding the identification of the correct positions of the anatomical landmarks, but it does have advantages in comparing the positions of the landmarks to other landmarks (e.g., the transepicondylar axis to Whiteside’s line) and positioning the implants according the identified landmarks.\nHuddleston et al. [16] found that when the ROM technique is applied to varus knees, the antero-posterior axis of the tibial tray is significantly more externally rotated then when this technique is applied to valgus knees. The same result was found in our study, although this difference did not reach statistical significance likely because our study was underpowered regarding this aspect. However, the pre-operative mechanical leg axis was correlated with the difference between the ROM and TTL techniques (p = 0.019). With increasing pre-operative varus alignment, the ROM technique results in increasing external rotation of the tibial component.\nThe maximum degrees of flexion (p = 0.014) and extension (p = 0.005) during surgery were also correlated with the difference between the ROM technique and the tubercle landmark in this study, which indicates that the use of the ROM technique for a patient with great preoperative flexion would result in a more internally rotated tibial component position compared with a patient with less preoperative flexion.\n Limitations of the study The number of patients (observations) in our study is rather low. Various studies have suggested that for each variable studied in multiple regression analysis at least 10 observations are required [38–40] although a recent study showed that this number could be lower in certain circumstances [41]. The results should therefore be interpreted with some caution.\nClinical and radiological data were not collected postoperatively. Therefore, no results are available regarding potential differences in clinical outcomes between the two techniques. It is known that a tourniquet affects the intra-operative patello-femoral tracking [42, 43]. Therefore, it is likely that the tourniquet had some effect on the tibial component rotational alignment in the ROM technique. The use of a tourniquet during all of the operations and keeping it inflated while performing the ROM cycles might have affected our results.\nAlthough tibial rotational alignment is also effected by ligament balancing, we did not measure the gaps intra-operatively.\nThe design of the prosthesis (CR or PS version) and the design of the tibial tray (symmetric or anatomical) may also have influence on the outcome [44].\nThe number of patients (observations) in our study is rather low. Various studies have suggested that for each variable studied in multiple regression analysis at least 10 observations are required [38–40] although a recent study showed that this number could be lower in certain circumstances [41]. The results should therefore be interpreted with some caution.\nClinical and radiological data were not collected postoperatively. Therefore, no results are available regarding potential differences in clinical outcomes between the two techniques. It is known that a tourniquet affects the intra-operative patello-femoral tracking [42, 43]. Therefore, it is likely that the tourniquet had some effect on the tibial component rotational alignment in the ROM technique. The use of a tourniquet during all of the operations and keeping it inflated while performing the ROM cycles might have affected our results.\nAlthough tibial rotational alignment is also effected by ligament balancing, we did not measure the gaps intra-operatively.\nThe design of the prosthesis (CR or PS version) and the design of the tibial tray (symmetric or anatomical) may also have influence on the outcome [44].", "The number of patients (observations) in our study is rather low. Various studies have suggested that for each variable studied in multiple regression analysis at least 10 observations are required [38–40] although a recent study showed that this number could be lower in certain circumstances [41]. The results should therefore be interpreted with some caution.\nClinical and radiological data were not collected postoperatively. Therefore, no results are available regarding potential differences in clinical outcomes between the two techniques. It is known that a tourniquet affects the intra-operative patello-femoral tracking [42, 43]. Therefore, it is likely that the tourniquet had some effect on the tibial component rotational alignment in the ROM technique. The use of a tourniquet during all of the operations and keeping it inflated while performing the ROM cycles might have affected our results.\nAlthough tibial rotational alignment is also effected by ligament balancing, we did not measure the gaps intra-operatively.\nThe design of the prosthesis (CR or PS version) and the design of the tibial tray (symmetric or anatomical) may also have influence on the outcome [44].", "The ROM technique is a repeatable intra-operative method for determining the rotational position of the tibia trial component. Because the best method to determine the intra-operative position of the tibia component is still under debate, TKA surgeons should be aware that there is a difference between the ROM and TTL methods, particularly in patients with high peri-operative ranges of motion and/or high pre-operative varus/valgus alignment." ]

[ null, null, null, null, null, null, null, null, null ]

[ "Background", "Methods", "Ethics and consent", "Patient demographics", "Operative procedure", "Statistics", "Results", "Discussion", "Limitations of the study", "Conclusions" ]

[ "Rotational alignment of the components in total knee arthroplasty (TKA) is an important factor for both survival and the performance of the prostheses [1, 2]. The majority of the attention has focussed on the rotational alignment of the femoral component [3–6], which has resulted in the widespread use of the transepicondylar axis and the antero-posterior axis (Whiteside’s Line) of the distal femur as the reference axes for the rotational alignment of the femoral component [3–6].\nHowever there is more discussion about the rotational alignment of the tibial component in part because of the difficulty of clinically assessing tibial component rotation. Furthermore, a whole range of anatomical landmarks can be used, including the medial border of the tibial tuberosity, the medial third of the tibial tuberosity, the anterior tibial crest, the posterior tibial condylar line, the second ray and the first web space of the foot. Aligning the tibial component to the tibial tubercle is one of the most popular landmark methods [7–9]. The disadvantage of all anatomical landmark techniques is that they do not account for femoro-tibial kinematics [10]. To address this problem, the ROM technique was introduced; in this technique, the rotational alignment of the tibial tray is determined through conformity to the femoral component when the knee is put through a series of full flexion-extension cycles [11]. However, the position of the tibial tray is not exclusively determined by the femoral component but is also influenced by the extensor mechanism, the patellar component, the ligament balancing and the tibial cut [12, 13]. The rationale behind the ROM technique lies in the theoretical advantage of aligning the tibial component in relation to the femoral component while respecting the soft tissue torsion forces to create optimal femoro-tibial kinematics [14]. For this method to work, the femoral component should be positioned accurately. Using computer-assisted surgery may improve the accuracy of positioning [15].\nSeveral studies have demonstrated variability in the relationships between different landmarks and techniques for establishing rotational alignment of tibial components in total knee arthroplasty [11, 16–18]. A review reported that there is no gold standard measurement of tibial component rotation [18]. Whether the ROM technique is a repeatable method, and whether there is a significant difference in tibial component rotational position between the TTL technique and the ROM technique in computer navigated TKA with patella resurfacing remains unanswered questions in the literature. The primary purpose of this study was therefore to intra-operatively evaluate the repeatability of the ROM technique. The secondary outcome was to evaluate the difference in rotational alignment of the trial tibial component with the use of the TTL and ROM techniques during computer-navigated TKA with patella resurfacing . Additionally, the factors that influenced the positioning of the trial tibial component with both techniques were investigated. Postoperative clinical and radiological data were not collected.", "A prospective, observational study of 20 consecutive primary posterior stabilized TKAs in 20 patients with fixed-bearing polyethylene inserts (Scorpio Flex PS, Stryker Corporation, Mahwah, NJ USA) was performed by a single surgeon (MvS).\nData collection began with 10 consecutive TKAs to determine whether there was a difference between the alignment techniques and if so to gather data to perform a power analysis. Using the acquired data, we determined that a total of 20 subjects were needed to achieve 90 % power assuming a minimum detectable difference of 5.0 degrees, a standard deviation of 7.7 degrees and a significance level of alpha < 0.05.\nThe mean pre-operative mechanical leg axis was 3.65° ± SD 7.15 of varus. The mean pre-operative mechanical leg axis of the varus knees (N = 15) was 7.0° ± SD 4.05, of the valgus knees (N = 5) was −6.4° ± SD −4.15.\nPositive values indicated varus alignment, negative values indicated valgus alignment.\nThe mean posterior slope was 1.5° ± SD 1.02.\n Ethics and consent The Medical Ethics Committee of the Maastricht University Medical Centre has concluded that the described research does not apply to the Dutch Medical Research involving Human Subjects Act (WMO), therefore the patient was not required to provide consent regarding the use of the material.\nFurthermore, every patient in the Maastricht University Medical Centre is provided with information regarding these kinds of studies. If they do not wish to contribute to these studies, this information will be included in their file. The patient involved in this study did not make an objection against the use of his/her material for research purposes.\nThe Medical Ethics Committee of the Maastricht University Medical Centre has concluded that the described research does not apply to the Dutch Medical Research involving Human Subjects Act (WMO), therefore the patient was not required to provide consent regarding the use of the material.\nFurthermore, every patient in the Maastricht University Medical Centre is provided with information regarding these kinds of studies. If they do not wish to contribute to these studies, this information will be included in their file. The patient involved in this study did not make an objection against the use of his/her material for research purposes.\n Patient demographics The patient demographics are summarized in Table 1.Table 1Patient demographics. Positive values indicated varus alignment, negative values indicated valgus alignmentAge (years)Preoperative Leg axis (degrees varus)Sex (Male/Female)Side (Right/Left)Preoperative ROM (degrees)Preoperative flexion contracture (degrees)Mean ± SD69.8 ± 103.7 ± 7.28/1210/10117 ± 165.6 ± 4.7\nPatient demographics. Positive values indicated varus alignment, negative values indicated valgus alignment\nThe patient demographics are summarized in Table 1.Table 1Patient demographics. Positive values indicated varus alignment, negative values indicated valgus alignmentAge (years)Preoperative Leg axis (degrees varus)Sex (Male/Female)Side (Right/Left)Preoperative ROM (degrees)Preoperative flexion contracture (degrees)Mean ± SD69.8 ± 103.7 ± 7.28/1210/10117 ± 165.6 ± 4.7\nPatient demographics. Positive values indicated varus alignment, negative values indicated valgus alignment\n Operative procedure The Stryker Knee Navigation System (Stryker Navigation System II, version 3.1) was used in this study. The prosthesis (Scorpio PS Stryker Howmedica Osteonics, Allendale, NJ USA) used in these surgeries allows five degrees of rotation between the tibial insert and the femoral component. In all cases, a tourniquet was applied for the entire duration of the surgery. After a standard midline skin incision and a medial parapatellar arthrotomy, the active wireless trackers of the navigation system were fixed to the femur and tibia. The required landmarks were entered into the navigation computer, and the rotation centre of the hip was determined by a special algorithm executed in customized software. The transepicondylar axis of the distal femur and the Whiteside’s line were set in each case exactly perpendicular to each other to improve the accuracy of the positioning the femoral component. The femoral component was aligned parallel to the transepicondylar axis. The AP axis of the proximal tibia was determined by placing the tip of the pointer on the centre of the line between the intercondylar eminences and aligning it to the medial 1/3 of the tibial tubercle . This AP axis was saved in the navigation program as 0 degrees of rotation. The proximal tibial and distal femoral cuts were performed and examined with the navigation system. The tibial posterior slope was set according to the patient’s natural slope. The polyethylene insert (Scorpio-Flex PS fixed bearing tibial insert) had an additional four degrees of posterior down-slope. The rotation of the femoral component was oriented according to the transepicondylar line and the AP axis (Whiteside’s Line) of the distal femur as currently advised in literature [3, 5, 17]. After soft tissue balancing and achievement of the maximal range of motion, the patella was prepared. The patellar button position may affect femoro-tibial kinematics; therefore, all of the trial components, including the patella and the PS tibial trial insert, were placed before the tibial component was subjected to the ROM technique. One navigation tracker was applied to the alignment handle of the trial tibial tray to check the position according to the given 0 degrees of rotation. Flexion and extension were measured intra-operatively after the approach was made and the trackers were placed. Positive values for extension represent hyperextension, while negative values represent flexion contracture.\nThe tibial component was inserted and checked for smooth movement on the tibial cut surface. The knee was then put through five full flexion-extension cycles while the surgeon held the ankle only. During the ROM cycles, no hands were touching the knee to prevent manual manipulation, and no varus/valgus stress was applied. The movement was followed on the navigation computer to confirm that no varus/valgus stress was applied. After performing the ROM cycles, the rotational position of the trial tibial component was recorded as indicated by the navigation computer. Positive values indicated that the trial component was in internal rotation according to the given TTL axis, and negative values indicated that the trial component was in external rotation. While this measurement was being acquired, the patella was lying in the patellar groove to facilitate optimal patellofemoral tracking and to prevent lateral pull on the patella tendon that could cause the tibia to rotate externally. The rotational position was noted (measurement 1). After removing and reinserting the components, the ROM technique was applied two additional times with five full flexion-extension movements and corresponding subsequent measurements from the navigation system (measurement 2 and 3).\nAfter completing the operative procedure, the final tibial tray was cemented up to 1/3 of the medial border of the tibial tubercle.\nThe Stryker Knee Navigation System (Stryker Navigation System II, version 3.1) was used in this study. The prosthesis (Scorpio PS Stryker Howmedica Osteonics, Allendale, NJ USA) used in these surgeries allows five degrees of rotation between the tibial insert and the femoral component. In all cases, a tourniquet was applied for the entire duration of the surgery. After a standard midline skin incision and a medial parapatellar arthrotomy, the active wireless trackers of the navigation system were fixed to the femur and tibia. The required landmarks were entered into the navigation computer, and the rotation centre of the hip was determined by a special algorithm executed in customized software. The transepicondylar axis of the distal femur and the Whiteside’s line were set in each case exactly perpendicular to each other to improve the accuracy of the positioning the femoral component. The femoral component was aligned parallel to the transepicondylar axis. The AP axis of the proximal tibia was determined by placing the tip of the pointer on the centre of the line between the intercondylar eminences and aligning it to the medial 1/3 of the tibial tubercle . This AP axis was saved in the navigation program as 0 degrees of rotation. The proximal tibial and distal femoral cuts were performed and examined with the navigation system. The tibial posterior slope was set according to the patient’s natural slope. The polyethylene insert (Scorpio-Flex PS fixed bearing tibial insert) had an additional four degrees of posterior down-slope. The rotation of the femoral component was oriented according to the transepicondylar line and the AP axis (Whiteside’s Line) of the distal femur as currently advised in literature [3, 5, 17]. After soft tissue balancing and achievement of the maximal range of motion, the patella was prepared. The patellar button position may affect femoro-tibial kinematics; therefore, all of the trial components, including the patella and the PS tibial trial insert, were placed before the tibial component was subjected to the ROM technique. One navigation tracker was applied to the alignment handle of the trial tibial tray to check the position according to the given 0 degrees of rotation. Flexion and extension were measured intra-operatively after the approach was made and the trackers were placed. Positive values for extension represent hyperextension, while negative values represent flexion contracture.\nThe tibial component was inserted and checked for smooth movement on the tibial cut surface. The knee was then put through five full flexion-extension cycles while the surgeon held the ankle only. During the ROM cycles, no hands were touching the knee to prevent manual manipulation, and no varus/valgus stress was applied. The movement was followed on the navigation computer to confirm that no varus/valgus stress was applied. After performing the ROM cycles, the rotational position of the trial tibial component was recorded as indicated by the navigation computer. Positive values indicated that the trial component was in internal rotation according to the given TTL axis, and negative values indicated that the trial component was in external rotation. While this measurement was being acquired, the patella was lying in the patellar groove to facilitate optimal patellofemoral tracking and to prevent lateral pull on the patella tendon that could cause the tibia to rotate externally. The rotational position was noted (measurement 1). After removing and reinserting the components, the ROM technique was applied two additional times with five full flexion-extension movements and corresponding subsequent measurements from the navigation system (measurement 2 and 3).\nAfter completing the operative procedure, the final tibial tray was cemented up to 1/3 of the medial border of the tibial tubercle.\n Statistics The statistical analyses were performed with SPSS statistical software (Version 12, SPSS Inc., Chicago, IL USA). The reproducibility of the ROM-technique was evaluated using the intra-class correlation coefficient (ICC). For each target, there was one ‘rater’(MvS) who performed the three consecutive attempts at positioning the tibial component using the ROM technique. Since the exact same rater made ratings on every patient and it was assumed that both patients and observer were drawn randomly from larger populations, the ICC2 was used [19]. The ICC2 reflects the reliability of this single rater. Means were compared with paired T-tests in cases of normal distributions [20]. A level of p < 0.05 was considered statistically significant. The mean of the 3 ROM measurements was used to evaluate the difference between the ROM and TTL techniques. We evaluated potential factors associated with the difference between the ROM and TTL technique including, leg axis, intra-operative flexion, intra-operative extension and posterior slope. (Table 2) The associations between each variable and the difference between the ROM and TTL were examined with univariable regression analyses. Factors that were associated with the outcome in univariable analyses (p-values < 0.20) were included in multivariable regression analyses. In multivariable regression analyses p-values < 0.05 were considered significant. Regression coefficients with their 95 % confidence intervals are reported.Table 2Outcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contractureVariablesMean ± SD(range)Difference ROM and TTL (°)−4.6 ± 8.6(−27.0 to 11.5)Varus mechanical leg axis (°)3.7 ± 7.2(−13.0 to 15.0)Intra-operative flexion (°)121.9 ± 6.7(108.0 to 134.0)Intra-operative extension (°)−0.1 ± 3.0(−5.5 to 7.0)Posterior slope (°)1.5 ± 1.0(0.0 to 3.5)\nOutcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contracture\nThe statistical analyses were performed with SPSS statistical software (Version 12, SPSS Inc., Chicago, IL USA). The reproducibility of the ROM-technique was evaluated using the intra-class correlation coefficient (ICC). For each target, there was one ‘rater’(MvS) who performed the three consecutive attempts at positioning the tibial component using the ROM technique. Since the exact same rater made ratings on every patient and it was assumed that both patients and observer were drawn randomly from larger populations, the ICC2 was used [19]. The ICC2 reflects the reliability of this single rater. Means were compared with paired T-tests in cases of normal distributions [20]. A level of p < 0.05 was considered statistically significant. The mean of the 3 ROM measurements was used to evaluate the difference between the ROM and TTL techniques. We evaluated potential factors associated with the difference between the ROM and TTL technique including, leg axis, intra-operative flexion, intra-operative extension and posterior slope. (Table 2) The associations between each variable and the difference between the ROM and TTL were examined with univariable regression analyses. Factors that were associated with the outcome in univariable analyses (p-values < 0.20) were included in multivariable regression analyses. In multivariable regression analyses p-values < 0.05 were considered significant. Regression coefficients with their 95 % confidence intervals are reported.Table 2Outcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contractureVariablesMean ± SD(range)Difference ROM and TTL (°)−4.6 ± 8.6(−27.0 to 11.5)Varus mechanical leg axis (°)3.7 ± 7.2(−13.0 to 15.0)Intra-operative flexion (°)121.9 ± 6.7(108.0 to 134.0)Intra-operative extension (°)−0.1 ± 3.0(−5.5 to 7.0)Posterior slope (°)1.5 ± 1.0(0.0 to 3.5)\nOutcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contracture", "The Medical Ethics Committee of the Maastricht University Medical Centre has concluded that the described research does not apply to the Dutch Medical Research involving Human Subjects Act (WMO), therefore the patient was not required to provide consent regarding the use of the material.\nFurthermore, every patient in the Maastricht University Medical Centre is provided with information regarding these kinds of studies. If they do not wish to contribute to these studies, this information will be included in their file. The patient involved in this study did not make an objection against the use of his/her material for research purposes.", "The patient demographics are summarized in Table 1.Table 1Patient demographics. Positive values indicated varus alignment, negative values indicated valgus alignmentAge (years)Preoperative Leg axis (degrees varus)Sex (Male/Female)Side (Right/Left)Preoperative ROM (degrees)Preoperative flexion contracture (degrees)Mean ± SD69.8 ± 103.7 ± 7.28/1210/10117 ± 165.6 ± 4.7\nPatient demographics. Positive values indicated varus alignment, negative values indicated valgus alignment", "The Stryker Knee Navigation System (Stryker Navigation System II, version 3.1) was used in this study. The prosthesis (Scorpio PS Stryker Howmedica Osteonics, Allendale, NJ USA) used in these surgeries allows five degrees of rotation between the tibial insert and the femoral component. In all cases, a tourniquet was applied for the entire duration of the surgery. After a standard midline skin incision and a medial parapatellar arthrotomy, the active wireless trackers of the navigation system were fixed to the femur and tibia. The required landmarks were entered into the navigation computer, and the rotation centre of the hip was determined by a special algorithm executed in customized software. The transepicondylar axis of the distal femur and the Whiteside’s line were set in each case exactly perpendicular to each other to improve the accuracy of the positioning the femoral component. The femoral component was aligned parallel to the transepicondylar axis. The AP axis of the proximal tibia was determined by placing the tip of the pointer on the centre of the line between the intercondylar eminences and aligning it to the medial 1/3 of the tibial tubercle . This AP axis was saved in the navigation program as 0 degrees of rotation. The proximal tibial and distal femoral cuts were performed and examined with the navigation system. The tibial posterior slope was set according to the patient’s natural slope. The polyethylene insert (Scorpio-Flex PS fixed bearing tibial insert) had an additional four degrees of posterior down-slope. The rotation of the femoral component was oriented according to the transepicondylar line and the AP axis (Whiteside’s Line) of the distal femur as currently advised in literature [3, 5, 17]. After soft tissue balancing and achievement of the maximal range of motion, the patella was prepared. The patellar button position may affect femoro-tibial kinematics; therefore, all of the trial components, including the patella and the PS tibial trial insert, were placed before the tibial component was subjected to the ROM technique. One navigation tracker was applied to the alignment handle of the trial tibial tray to check the position according to the given 0 degrees of rotation. Flexion and extension were measured intra-operatively after the approach was made and the trackers were placed. Positive values for extension represent hyperextension, while negative values represent flexion contracture.\nThe tibial component was inserted and checked for smooth movement on the tibial cut surface. The knee was then put through five full flexion-extension cycles while the surgeon held the ankle only. During the ROM cycles, no hands were touching the knee to prevent manual manipulation, and no varus/valgus stress was applied. The movement was followed on the navigation computer to confirm that no varus/valgus stress was applied. After performing the ROM cycles, the rotational position of the trial tibial component was recorded as indicated by the navigation computer. Positive values indicated that the trial component was in internal rotation according to the given TTL axis, and negative values indicated that the trial component was in external rotation. While this measurement was being acquired, the patella was lying in the patellar groove to facilitate optimal patellofemoral tracking and to prevent lateral pull on the patella tendon that could cause the tibia to rotate externally. The rotational position was noted (measurement 1). After removing and reinserting the components, the ROM technique was applied two additional times with five full flexion-extension movements and corresponding subsequent measurements from the navigation system (measurement 2 and 3).\nAfter completing the operative procedure, the final tibial tray was cemented up to 1/3 of the medial border of the tibial tubercle.", "The statistical analyses were performed with SPSS statistical software (Version 12, SPSS Inc., Chicago, IL USA). The reproducibility of the ROM-technique was evaluated using the intra-class correlation coefficient (ICC). For each target, there was one ‘rater’(MvS) who performed the three consecutive attempts at positioning the tibial component using the ROM technique. Since the exact same rater made ratings on every patient and it was assumed that both patients and observer were drawn randomly from larger populations, the ICC2 was used [19]. The ICC2 reflects the reliability of this single rater. Means were compared with paired T-tests in cases of normal distributions [20]. A level of p < 0.05 was considered statistically significant. The mean of the 3 ROM measurements was used to evaluate the difference between the ROM and TTL techniques. We evaluated potential factors associated with the difference between the ROM and TTL technique including, leg axis, intra-operative flexion, intra-operative extension and posterior slope. (Table 2) The associations between each variable and the difference between the ROM and TTL were examined with univariable regression analyses. Factors that were associated with the outcome in univariable analyses (p-values < 0.20) were included in multivariable regression analyses. In multivariable regression analyses p-values < 0.05 were considered significant. Regression coefficients with their 95 % confidence intervals are reported.Table 2Outcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contractureVariablesMean ± SD(range)Difference ROM and TTL (°)−4.6 ± 8.6(−27.0 to 11.5)Varus mechanical leg axis (°)3.7 ± 7.2(−13.0 to 15.0)Intra-operative flexion (°)121.9 ± 6.7(108.0 to 134.0)Intra-operative extension (°)−0.1 ± 3.0(−5.5 to 7.0)Posterior slope (°)1.5 ± 1.0(0.0 to 3.5)\nOutcome and available covariates assessed for inclusion in the regression model. Positive values for extension represent hyperextension, while negative values indicate flexion contracture", "The tibial component can be reliable positioned in terms of rotation using the ROM technique, as demonstrated by an ICC2 = 0.84 (95 % CI (0.70–0.93); p < 0.001). The ICC2 = 0.84 of tibial component positioning using the ROM technique indicating nearly perfect repeatability. Because the ROM technique was nearly perfectly reliable, the means of the 3 ROM measurements were used to evaluate the difference between the two techniques. With the ROM technique, the tibial component was on average 4.56 (± SD 8.59) degrees externally rotated compared to the tubercle landmark. This difference was statistically significant p = 0.028.\nIt appeared from the multivariable regression analyses that more valgus pre-operative mechanical leg axis (−0.54 (95%CI −0.98 - -0.10); p = 0.019), intra-operative flexion (0.57 (95%CI 0.13 – 1.00); p = 0.014) and intra-operative extension (1.41 (95%CI 0.50 – 2.32); p = 0.005) were associated with a greater difference between tibial component positioning using the ROM and TTL techniques. (Table 3) These results indicate that increasing the pre-operative varus mechanical leg alignment by 1 degree resulted in an increase in the external rotation of the tibial component of 0.54 degrees relative to the tibial tubercle using the ROM technique.Table 3Results of univariable and multivariable regression analysesVariableUnivariable analysisMultivariable analysiscoefficient (95%CI)\np-valuecoefficient (95%CI)\np-valueVarus mechanical leg axis−0.58 (−1.09 to −0.05)0.030−0.54 (−0.98 to −0.10)0.019Intra-operative flexion0.82 (0.33 to 1.31)0.0020.57 (0.13 to 1.00)0.014Intra-operative extension1.19 (−0.09 to 2.48)0.0701.41 (0.50 to 2.32)0.005Posterior slope2.63 (−1.31 to 6.56)0.1800.04 (−3.05 to 3.13)0.979\nResults of univariable and multivariable regression analyses\nIn the varus knees, the tibial component was on average 5.9 (± SD 8.7) degrees externally rotated; in the valgus knees, the mean external rotation was 0.4 (± SD 7.6) degrees relative to the tibial tubercle. The differences between the rotational alignments using the ROM and TTL techniques in both the varus and valgus knees were not statistically significant (p = 0.221).\nThe cut posterior slope (0.04 (95%CI −3.05 – 3.13); p = 0.979) was not significantly related to the difference in the rotational alignment of the tibial component according to the tibial tubercle in either the ROM or TTL techniques.", "This study revealed that the ROM technique is a repeatable method for aligning the tibial component. Using the ROM technique, the tibial component was on average 4.56 (± SD 8.59) degrees externally rotated compared to the tubercle landmark. Our result is in contradiction with Ikeuchi et al. [11] They found that using the ROM technique results in a more internally rotated position of the tibial component en found also widely variable results. However in line with our findings, Berhouet [21] and Chotanaputhi [22] found the ROM technique reproducible and the alignment of the tibial tray was externally rotated in comparison with the medial border of the tibial tubercle and the posterior tibial condyle line respectively. Ikeuchi [11] used cruciate-retaining (CR) TKA components without patellar resurfacing. The mean posterior slope of the cut tibia was 5 degrees and they compared the position of the tibial component related to the Akagi line [23]. The amount of tibial slope, the design of the prosthesis and the patella resurfacing all might have influenced the outcome. Rossi [24] stated that the ROM technique is a reproducible method to establish tibial rotation during TKA, having found that components were positioned in 0.35 external rotation to the Akagi line.\nUsing anatomical landmarks for the rotational alignment of the femoral and tibial components is a widely accepted method. Alignment to the medial 1/3 of the tibial tubercle (Insall’s reference [25]) is based on papers of Nicoll [26], Lawrie [27], Lützner [28] and Yin [29], who found the medial 1/3 of the tibial tubercle the most accurate and reliable anatomical landmark. However, determining the component positions separately can lead to rotational mismatch between the femoral and tibial components [30]. Using the dynamic ROM technique may allow for the tibial tray to align itself according to the femoral component position, ligament balancing and extensor mechanism alignment.\nRetrieval and biomechanical studies have indicated that femoro-tibial rotational mismatches cause increased contact stress on the tibial insert and patellar component that leads to accelerated polyethylene wear [31–33]. Steinbrück et al. [34] recommended the rotational alignment of the tibial component to the medial 1/3 of the tibial tubercle to achieve the lowest retro-patellar pressure. Using the ROM technique the tibial component was externally rotated by a mean 4.56 degrees respect the tibial tubercle which might have resulted in increased retro-patellar peak pressure. Kim et al [35] found the best survival rate when tibial component was aligned between 2 degrees of internal rotation to 5 degrees of external rotation to the medial 1/3 of the tibial tubercle. External rotational errors were not associated with pain in a study of Nicoll [26].\nTo measure the rotational difference between the ROM and TTL techniques in degrees may not be easy during TKAs that are performed without navigation. Computer navigation is an ideal method for measuring the difference in trial tibial tray position between the TTL and ROM techniques given its reported accuracy of one degree [36]. Furthermore, the use of computer navigation can help to optimize the femoral component position, which is crucial for the performance of the ROM technique. [15, 37] Computer navigation has no advantage regarding the identification of the correct positions of the anatomical landmarks, but it does have advantages in comparing the positions of the landmarks to other landmarks (e.g., the transepicondylar axis to Whiteside’s line) and positioning the implants according the identified landmarks.\nHuddleston et al. [16] found that when the ROM technique is applied to varus knees, the antero-posterior axis of the tibial tray is significantly more externally rotated then when this technique is applied to valgus knees. The same result was found in our study, although this difference did not reach statistical significance likely because our study was underpowered regarding this aspect. However, the pre-operative mechanical leg axis was correlated with the difference between the ROM and TTL techniques (p = 0.019). With increasing pre-operative varus alignment, the ROM technique results in increasing external rotation of the tibial component.\nThe maximum degrees of flexion (p = 0.014) and extension (p = 0.005) during surgery were also correlated with the difference between the ROM technique and the tubercle landmark in this study, which indicates that the use of the ROM technique for a patient with great preoperative flexion would result in a more internally rotated tibial component position compared with a patient with less preoperative flexion.\n Limitations of the study The number of patients (observations) in our study is rather low. Various studies have suggested that for each variable studied in multiple regression analysis at least 10 observations are required [38–40] although a recent study showed that this number could be lower in certain circumstances [41]. The results should therefore be interpreted with some caution.\nClinical and radiological data were not collected postoperatively. Therefore, no results are available regarding potential differences in clinical outcomes between the two techniques. It is known that a tourniquet affects the intra-operative patello-femoral tracking [42, 43]. Therefore, it is likely that the tourniquet had some effect on the tibial component rotational alignment in the ROM technique. The use of a tourniquet during all of the operations and keeping it inflated while performing the ROM cycles might have affected our results.\nAlthough tibial rotational alignment is also effected by ligament balancing, we did not measure the gaps intra-operatively.\nThe design of the prosthesis (CR or PS version) and the design of the tibial tray (symmetric or anatomical) may also have influence on the outcome [44].\nThe number of patients (observations) in our study is rather low. Various studies have suggested that for each variable studied in multiple regression analysis at least 10 observations are required [38–40] although a recent study showed that this number could be lower in certain circumstances [41]. The results should therefore be interpreted with some caution.\nClinical and radiological data were not collected postoperatively. Therefore, no results are available regarding potential differences in clinical outcomes between the two techniques. It is known that a tourniquet affects the intra-operative patello-femoral tracking [42, 43]. Therefore, it is likely that the tourniquet had some effect on the tibial component rotational alignment in the ROM technique. The use of a tourniquet during all of the operations and keeping it inflated while performing the ROM cycles might have affected our results.\nAlthough tibial rotational alignment is also effected by ligament balancing, we did not measure the gaps intra-operatively.\nThe design of the prosthesis (CR or PS version) and the design of the tibial tray (symmetric or anatomical) may also have influence on the outcome [44].", "The number of patients (observations) in our study is rather low. Various studies have suggested that for each variable studied in multiple regression analysis at least 10 observations are required [38–40] although a recent study showed that this number could be lower in certain circumstances [41]. The results should therefore be interpreted with some caution.\nClinical and radiological data were not collected postoperatively. Therefore, no results are available regarding potential differences in clinical outcomes between the two techniques. It is known that a tourniquet affects the intra-operative patello-femoral tracking [42, 43]. Therefore, it is likely that the tourniquet had some effect on the tibial component rotational alignment in the ROM technique. The use of a tourniquet during all of the operations and keeping it inflated while performing the ROM cycles might have affected our results.\nAlthough tibial rotational alignment is also effected by ligament balancing, we did not measure the gaps intra-operatively.\nThe design of the prosthesis (CR or PS version) and the design of the tibial tray (symmetric or anatomical) may also have influence on the outcome [44].", "The ROM technique is a repeatable intra-operative method for determining the rotational position of the tibia trial component. Because the best method to determine the intra-operative position of the tibia component is still under debate, TKA surgeons should be aware that there is a difference between the ROM and TTL methods, particularly in patients with high peri-operative ranges of motion and/or high pre-operative varus/valgus alignment." ]

[ "introduction", null, null, null, null, null, null, null, null, null ]

[ "Total knee arthroplasty", "Tibial rotation", "ROM technique", "TTL technique", "Computer navigation" ]

[ 2763, 112, 80, 679, 392, 457, 1291, 216, 79 ]

[ "tibial", "rom", "component", "values", "technique", "tibial component", "rom technique", "alignment", "axis", "navigation" ]

[ "alignment femoral", "rotational alignment tibial", "femoral tibial components", "tibial distal femoral", "tibial rotational alignment" ]

[ "Activities of Daily Living", "Adult", "Body Mass Index", "Cohort Studies", "Cross-Sectional Studies", "Exercise", "Female", "Humans", "Male", "Middle Aged", "Obesity", "Odds Ratio", "Prevalence", "Risk Factors", "Sedentary Behavior", "Sex Factors", "Surveys and Questionnaires", "Thailand", "Time Factors", "Young Adult" ]

[ "Background", "Study population", "Data", "Statistical methods", "Ethical approval", "Results", "Obesity and exercise-related physical activity, housework, and gardening", "Obesity and leisure related screen-time", "Obesity and domestic appliances", "Discussion", "Conclusions" ]

[ "The prevalence of obesity is rising rapidly in most Asian countries, with increases of 46% in Japan and over 400% in China observed from the 1980s to early 2000s [1]. In Thailand, the prevalence of obesity increased by around 19% from 1997 to 2004 alone [2]. There have been accompanying increases in morbidity related to conditions such as diabetes and cardiovascular disease in Asian countries [3,4].\nIt is well established in Western populations that increasing purposeful or leisure-time physical activity (PA) is associated with reduced rates of obesity [5,6]. Recent evidence, also from Western countries, suggests that sedentary activities, such as watching television or using a computer, are associated with increasing obesity, independent of purposeful PA [7-9]. The role of incidental PA and overall energy expenditure, in influencing obesity has been highlighted [10,11]. The interplay between these factors and their combined effects on obesity are not well understood and information relevant to Asian populations is particularly scarce. Furthermore, the relationship between domestic activities and obesity is unclear [12-14]. This is important because physical activity related to patterns of daily activity differs between Asia and Western countries [15] and because many Asian countries are experiencing rapid health and lifestyle transitions [16].\nThis paper examines in detail the relationships between obesity, exercise-related PA, domestic activities and sedentary behaviours in Thailand, with particular emphasis on the interaction between these factors.", "The Sukhothai Thammathirat Open University (STOU) Cohort Study is designed to provide evidence regarding the transition in risk factor profiles, health outcomes and other factors accompanying development and is described in detail elsewhere [17]. In brief, from April to November 2005, enrolled STOU students across Thailand who had completed a least one semester were mailed a 20-page health questionnaire and asked to join the study by completing the questionnaire, providing signed consent for follow-up, and returning these in a reply-paid envelope. A total of 87 134 men and women aged 15-87 years (median 29 years) joined the cohort.", "All of the variables used in this study were derived from cross-sectional self-reported data from the Thai Cohort Study questionnaire [17]. The questionnaire requested information on: socio-demographic factors; ethnicity; past and present residence and domestic environment; income; work-related factors; height; weight; sensory impairment; mental health; medical history; general health; use of health services; social networks; social capital; diet; physical activity; sedentary behaviours; tobacco and alcohol consumption; use of seat belts and motorcycle helmets; drink-driving; and family structure and health (See Additional files 1 and 2 for questionnaires). Where possible, questionnaire items that had been standardised and validated were used.\nSelf-reported weight and height were used to calculate participants' BMI, as their weight in kilograms, divided by the square of their height in metres. Cut-points delineating overweight and obesity were set at BMIs ≥23 and ≥25, respectively, in accordance with International Obesity Taskforce recommendations [18] and studies in other Asian populations [19].\nInformation on exercise-related PA was obtained through a question asking: \"During a typical week (7-day period), how many times on average do you do the following kinds of exercise?\", with responses requested for: \"Strenuous exercise (heart beats rapidly) for more than 20 minutes, e.g. heavy lifting, digging, aerobics or fast bicycling, running, soccer, trakraw\"; \"Moderate exercise (not exhausting but breathe harder than normal) for more than 20 minutes, e.g. carrying light loads, cycling at a regular pace\"; \"Mild exercise (minimal effort) for more than 20 minutes, e.g. yoga, Tai-Chi, bowling\" and; \"Walking for at least 10 minutes e.g. at work, at home, exercise\". This question is a sessions-based measure of physical activity, similar to the sessions component of the International Physical Activity Questionnaire and the Active Australia Survey [20]; these session measures have been shown to provide a reliable index of sufficiency of physical activity in non-Thai populations [21]. It incorporates the three major intensities of activity (strenuous, moderate and walking), included in these measures, as well as an additional \"mild\" category that was created specifically for this study to cover common types of activity in Thailand. The responses to this question were used to derive a weighted measure of overall metabolically-adjusted exercise-related PA, calculated as \"2 × strenuous + moderate + mild + walking\" exercise sessions, in keeping with previous calculations of this quotient [20].\nThe frequency of reported housework and gardening was used as a measure of incidental PA and was classified into 5 groups according to the response to the question \"How often do you do household cleaning or gardening work?\" with options ranging from seldom or never, to most days. Total daily leisure-related screen-time and sitting time were classified according to the participant's response to the question \"How many hours per day do you usually spend: Watching TV or playing computer games? Sitting for any purpose (e.g. reading, resting, working thinking)?\". Sitting time could also include screen-time, as participants were not specifically asked to exclude screen-time from this measure. The availability of domestic appliances was classified according to the response to the question \"Which of the following does your home have now?\", with options including microwave oven, refrigerator, water heater and washing machine. The questions on housework/gardening, screen-time, sitting time and availability of domestic appliances were devised specially for the Thai Cohort Study.\nEducation attainment was classified as: secondary school graduation or less; post-secondary school certificate or diploma; and tertiary graduate. Personal monthly income was in Thai Baht in four categories (≤7,000; 7,001-10,000; 10,001-20,000; >20,000). Respondents recorded the frequency of eating deep fried food and soft drinks and Western-style fast foods such as pizza (known as \"junkfood\") on a five-point Likert scale ranging from never or less than once a month, to once or more a day; this was categorised as consumption <3 times and ≥ 3 times per week for fried food and seldom (never or less than once per month) and regularly (≥ once per month) for \"junkfood\". Fruit and vegetable intakes were noted as serves eaten per day and categorised as <2 and ≥2 serves per day. They were asked if they have ever smoked, when they started and when they quit and were categorised as current smokers or not current smokers, with similar questions and categories for alcohol consumption.\nAnalysis was restricted to the 95% of individuals aged between 20 and 50 years, with BMIs between 11 and 50. Individuals were excluded from the analyses if they were missing data on age or sex (n = 2), height or weight (n = 1030) or physical activity or inactivity (n = 6863), leaving 74,981 participants.", "The relationships between a range of personal characteristics and exercise-related PA, housework/gardening and leisure-related screen-time were examined, as well as the correlation between the individual measures of physical activity and inactivity. Variables were categorised into the groups listed in the various tables.\nThe proportion of the study population classified as obese according to exercise-related PA, housework, leisure-related screen-time and sitting time was examined. Prevalence odds ratios (OR) and 95% CIs for obesity according to PA, housework, screen-time and sitting time were estimated using unconditional logistic regression; crude and adjusted odds ratios were computed. ORs were presented separately for men and women and adjusted for age (as a continuous variable), income and educational attainment, with exploration of the effect of additional adjustment for factors such as marital status, smoking, alcohol consumption and urban/rural residence. We evaluated the significance of interaction terms using a likelihood ratio test, comparing the model with and without the interaction terms.\nWe examined how much of any association of a specific PA or sedentary behaviour with obesity was attributable to differences in total physical activity level by modelling simultaneously the three PA variables and their two-way and three-way interactions. We also examined how much of the association of certain sedentary behaviours could be attributed to the effect of other sedentary behaviours and to consumption of fried foods and soft drinks and Western-style junkfood, using mutual adjustment.\nAll analyses were carried out in STATA version 9.2. All statistical tests were two-sided, using a significance level of p < 0.05. Due to the large sample size, conclusions were based on both significance and the effect size.", "Ethics approval was obtained from Sukhothai Thammathirat Open University Research and Development Institute (protocol 0522/10) and the Australian National University Human Research Ethics Committee (protocol 2004344). Informed written consent was obtained from all participants.", "Of 74 981 participants with appropriate data, 41 351 (55.2%, 95%CI 54.8-55.5%) were classified as being of healthy weight (BMI 18.5-22.9), 10 733 (14.4%, 14.1-14.6%) were underweight (BMI < 18.5), 11 241 (15.0%, 14.7-15.2%) were overweight but not obese (BMI ≥ 23.0-24.9) and 11 616 (15.6%, 15.2-15.7%) were obese (BMI ≥ 25.0).\nMen were far more likely to be overweight (21.7%, 21.3-22.1%) or obese (22.4%, 22.0-22.9%) than women (9.5% and 9.9%, respectively), while women were more likely to be underweight (21.3%, 20.9-21.7%) than men (5.9%, 5.6-6.1%). Compared to other members of the study cohort, obesity prevalence was higher in older participants and urban dwellers and in those with higher consumption of fried food (data not shown) [22].\nPatterns of exercise-related PA varied between men and women, with 12.5% (12.2-12.9%) of men reporting 0-3 sessions and 26.3% (25.8-26.8%) reporting ≥18 sessions of exercise-related PA per week compared to 22.2% (21.8-22.6%) and 12.1% (11.8-12.4%), respectively, for women. The mean number of sessions of exercise-related PA per week was 11.6 [sd 12.1] overall; 13.9 [sd 13.5] for men and 9.7 [sd 10.6] for women. A higher level of exercise-related PA was associated with having less than a tertiary education, being of lower income and eating more fruit and vegetables, but was not strongly related to other factors (Table 1). The pattern of PA making up the total weekly sessions also differed between the sexes, with women much less likely than men to report strenuous or moderate PA (Table 2).\nCharacteristics of study population according to total physical activity, housework/gardening and daily screen-time\naMeasured as top decile from 3 items assessing physical limitations in the past 4 weeks (eg how much bodily pain did you have in the past 4 weeks?)\nbOnly 1% and 0.6%, respectively, of females are current smokers and regular drinkers\nRelationship between being obese and measures of exercise-related physical activity (PA)\n*adjusted for age, income and education\nOverall, 49.4% (48.9-49.9%) of women and 34.4% (33.8-34.8%) of men reported doing household cleaning or gardening on most days of the week, while 3.7% (3.5-3.9%) of women and 8.8% (8.5-9.1%) of men reported that they did these seldom or never. Housework/gardening was more common among those who were married, not tertiary educated, of lower income and with greater fruit and vegetable intake than other cohort members (Table 1).\nLeisure related screen-time did not vary markedly between men and women. 17.8% (17.4-18.2%) of women and 22.2% (21.8-22.7%) of men reported less than two hours of daily screen-time, while 3.4% (3.2-3.6%) of women and 2.8% (2.6-2.9%) of men reported 8 hours or more. Average daily leisure related screen-time was 2.9 hours [sd 1.9]; it was 3.0 hours [sd 1.9] in women and 2.8 hours [sd 1.8] in men. Higher levels of screen-time were more common among cohort members who were younger, unmarried, urban residents and of lower income and who ate fried food daily and soft drinks or Western style junkfood once a month or more often (Table 1).\nWomen tended to have greater levels of sitting time than men, with 46.6% (46.0-46.9%) of women and 36.8% (36.2-37.3%) of men reporting 8 or more hours of daily sitting time. Average daily sitting time was 6.6 hours [sd 3.8] overall; 6.8 hours [sd 3.9] in women and 6.2 hours [sd 1.8] in men.\nThe number of hours of daily screen-time was poorly but significantly inversely correlated with the number of weekly sessions of exercise-related PA (r = -0.016; 95% CI: -0.024 to -0.009) and doing household cleaning or gardening (r = -0.022; -0.029 to -0.014) but was more strongly and positively related to number of hours sitting per day (r = 0.16; 0.15 to 0.16). The number of weekly sessions of exercise-related PA was positively correlated with doing household cleaning or gardening (r = 0.15; 0.14 to 0.16). The correlations between sitting time and number of weekly sessions of exercise-related PA and cleaning/gardening were -0.054 (-0.061 to -0.047) and -0.041 (-0.049 to -0.034) respectively.\n Obesity and exercise-related physical activity, housework, and gardening In men, the OR for being obese decreased steadily and significantly with increasing weighted total weekly sessions of exercise-related PA, such that those reporting 18 or more sessions had a OR of obesity of 0.69 (0.63-0.75) compared to those with 0-3 sessions (p(trend) < 0.0001) and this relationship was observed particularly for moderate and strenuous PA (Table 2). There was no apparent relationship between being obese and moderate and strenuous PA in women and the relationship between strenuous activity and obesity differed significantly between men and women (p(interaction) < 0.0001). However, in women an inverse relationship with being obese was observed mainly for mild PA and walking (Table 2).\nFor both sexes, the risk of being obese was consistently lower with increasing frequency of housework/gardening, with 33% (26-39%) and 33% (21-43%) lower adjusted ORs in men and women, respectively, in those reporting these activities daily versus seldom or never (Table 3). The lower risk of obesity with increasing housework or gardening was independent of the level of exercise-related PA, in that the OR did not change materially (i.e. changed by <10%) following additional adjustment for exercise-related PA (see below) and a similar relationship was observed within separate categories of exercise-related PA (Figure 1). The inverse relationship between housework/gardening and obesity was still present following additional adjustment for screen-time and exercise-related PA. Compared to people who did housework or gardening seldom or never, the ORs (95% CI) for being obese in men were: 0.85 (0.76-0.94) for people who did housework or gardening 1-3 times per month; 0.79 (0.71-0.87) for 1-2 times per week; 0.80 (0.72-0.90) for 3-4 times per week; and 0.73 (0.66-0.80) for housework/gardening on most days, adjusting for age, income, education, screen-time and weighted weekly sessions of exercise-related PA. For women, the ORs for the same categories were: 0.95 (0.79-1.15); 0.76 (0.64-0.90); 0.75 (0.63-0.90); and 0.71 (0.60-0.84), respectively.\nRelationship between being obese and gardening/housework, leisure-related computer or television use (\"screen-time\") and sitting time\n*adjusted for age, income and education\nnumbers do not always sum to total due to missing values\nOdds ratios (OR) for being obese in relation to weighted weekly sessions of exercise-related physical activity (ERPA), hours of daily screen-time and frequency of housework/gardening.\nIn men, the OR for being obese decreased steadily and significantly with increasing weighted total weekly sessions of exercise-related PA, such that those reporting 18 or more sessions had a OR of obesity of 0.69 (0.63-0.75) compared to those with 0-3 sessions (p(trend) < 0.0001) and this relationship was observed particularly for moderate and strenuous PA (Table 2). There was no apparent relationship between being obese and moderate and strenuous PA in women and the relationship between strenuous activity and obesity differed significantly between men and women (p(interaction) < 0.0001). However, in women an inverse relationship with being obese was observed mainly for mild PA and walking (Table 2).\nFor both sexes, the risk of being obese was consistently lower with increasing frequency of housework/gardening, with 33% (26-39%) and 33% (21-43%) lower adjusted ORs in men and women, respectively, in those reporting these activities daily versus seldom or never (Table 3). The lower risk of obesity with increasing housework or gardening was independent of the level of exercise-related PA, in that the OR did not change materially (i.e. changed by <10%) following additional adjustment for exercise-related PA (see below) and a similar relationship was observed within separate categories of exercise-related PA (Figure 1). The inverse relationship between housework/gardening and obesity was still present following additional adjustment for screen-time and exercise-related PA. Compared to people who did housework or gardening seldom or never, the ORs (95% CI) for being obese in men were: 0.85 (0.76-0.94) for people who did housework or gardening 1-3 times per month; 0.79 (0.71-0.87) for 1-2 times per week; 0.80 (0.72-0.90) for 3-4 times per week; and 0.73 (0.66-0.80) for housework/gardening on most days, adjusting for age, income, education, screen-time and weighted weekly sessions of exercise-related PA. For women, the ORs for the same categories were: 0.95 (0.79-1.15); 0.76 (0.64-0.90); 0.75 (0.63-0.90); and 0.71 (0.60-0.84), respectively.\nRelationship between being obese and gardening/housework, leisure-related computer or television use (\"screen-time\") and sitting time\n*adjusted for age, income and education\nnumbers do not always sum to total due to missing values\nOdds ratios (OR) for being obese in relation to weighted weekly sessions of exercise-related physical activity (ERPA), hours of daily screen-time and frequency of housework/gardening.\n Obesity and leisure related screen-time Increasing leisure-related screen-time was associated with significantly and substantially increasing risk of being obese in both men and women, with 85% and 116% increases in risk, respectively, for 8 or more hours of daily screen-time versus <2 hours (Table 3, p(trend) < 0.0001). Overall, sitting-time was not significantly related to the OR of being obese (p(trend) = 0.32), although a significant trend was observed in women (Table 3).\nThe positive relationship between screen-time and being obese was still present following additional adjustment for housework/gardening and exercise-related PA; the ORs (95% CI) for obesity in men were: 1.22 (1.14-1.30); 1.38 (1.27-1.50); 1.58 (1.36-1.83); and 1.80 (1.53-2.13) and for women were: 1.15 (1.05-1.27); 1.50 (1.35-1.67); 1.62 (1.36-1.92) and 2.13 (1.78-2.55), for people with: 2.0-2.9 hours; 3.0-3.9 hours; 4-7.9 hours; and ≥8 hours of daily screen-time versus 0-1.9 hours, respectively, adjusted for age, income, education, housework/gardening and exercise-related PA. Additional adjustment for consumption of fried foods, soft drink and junkfood and smoking and alcohol consumption did not materially alter the OR (data not shown).\nFigure 1 shows the cohort divided into four groups according to their level of exercise-related PA (ERPA in the figure). The ORs for being obese were then presented within each group according to the number of hours of total daily screen-time, with separate lines according to the frequency of housework/gardening. This figure shows increasing risk of being obese with increasing screen-time within each exercise-related PA group and within each housework/gardening group. It also shows that the finding of lower risks of being obese with increasing frequency of housework/gardening persists, even when screen-time and exercise-related PA were accounted for. When the relationships between being obese and exercise-related PA, screen-time and housework/gardening were modelled together, no significant interactions were observed (likelihood ratio χ392 = 38.54, p = 0.49), indicating that they were each independently associated with obesity.\nThe sex, income and education-adjusted OR of obesity per two-hour increase in daily screen-time is shown separately according to a variety of factors, including according to total exercise-related PA and according to housework and gardening, in Figure 2. There was an 18% (15-21%) increase in the risk of being obese with every two additional hours of daily screen-time overall and a significant elevation in the risk of being obese with increasing screen-time was seen in all of the population sub-groups examined (Figure 2). There was a significantly greater increase in the risk of being obese with increasing screen-time in unmarried compared to married individuals (p(heterogeneity) < 0.0001). The relationship between being obese and screen-time was attenuated significantly in older cohort members (p(heterogeneity) = 0.02) and in those with higher incomes (p(heterogeneity) = 0.02). No significant variation in the relationship between screen-time and being obese was seen according to the other factors examined, including: sex; urban/rural residence history; education; smoking status; alcohol, fruit, vegetable, junkfood and fried food intake; disability; level of exercise-related PA; and frequency of housework/gardening.\nOdds ratios (OR) for being obese per 2 hour increase in daily screen-time, in different population sub-groups, adjusted for age, sex, income and education, where appropriate.\nIncreasing leisure-related screen-time was associated with significantly and substantially increasing risk of being obese in both men and women, with 85% and 116% increases in risk, respectively, for 8 or more hours of daily screen-time versus <2 hours (Table 3, p(trend) < 0.0001). Overall, sitting-time was not significantly related to the OR of being obese (p(trend) = 0.32), although a significant trend was observed in women (Table 3).\nThe positive relationship between screen-time and being obese was still present following additional adjustment for housework/gardening and exercise-related PA; the ORs (95% CI) for obesity in men were: 1.22 (1.14-1.30); 1.38 (1.27-1.50); 1.58 (1.36-1.83); and 1.80 (1.53-2.13) and for women were: 1.15 (1.05-1.27); 1.50 (1.35-1.67); 1.62 (1.36-1.92) and 2.13 (1.78-2.55), for people with: 2.0-2.9 hours; 3.0-3.9 hours; 4-7.9 hours; and ≥8 hours of daily screen-time versus 0-1.9 hours, respectively, adjusted for age, income, education, housework/gardening and exercise-related PA. Additional adjustment for consumption of fried foods, soft drink and junkfood and smoking and alcohol consumption did not materially alter the OR (data not shown).\nFigure 1 shows the cohort divided into four groups according to their level of exercise-related PA (ERPA in the figure). The ORs for being obese were then presented within each group according to the number of hours of total daily screen-time, with separate lines according to the frequency of housework/gardening. This figure shows increasing risk of being obese with increasing screen-time within each exercise-related PA group and within each housework/gardening group. It also shows that the finding of lower risks of being obese with increasing frequency of housework/gardening persists, even when screen-time and exercise-related PA were accounted for. When the relationships between being obese and exercise-related PA, screen-time and housework/gardening were modelled together, no significant interactions were observed (likelihood ratio χ392 = 38.54, p = 0.49), indicating that they were each independently associated with obesity.\nThe sex, income and education-adjusted OR of obesity per two-hour increase in daily screen-time is shown separately according to a variety of factors, including according to total exercise-related PA and according to housework and gardening, in Figure 2. There was an 18% (15-21%) increase in the risk of being obese with every two additional hours of daily screen-time overall and a significant elevation in the risk of being obese with increasing screen-time was seen in all of the population sub-groups examined (Figure 2). There was a significantly greater increase in the risk of being obese with increasing screen-time in unmarried compared to married individuals (p(heterogeneity) < 0.0001). The relationship between being obese and screen-time was attenuated significantly in older cohort members (p(heterogeneity) = 0.02) and in those with higher incomes (p(heterogeneity) = 0.02). No significant variation in the relationship between screen-time and being obese was seen according to the other factors examined, including: sex; urban/rural residence history; education; smoking status; alcohol, fruit, vegetable, junkfood and fried food intake; disability; level of exercise-related PA; and frequency of housework/gardening.\nOdds ratios (OR) for being obese per 2 hour increase in daily screen-time, in different population sub-groups, adjusted for age, sex, income and education, where appropriate.\n Obesity and domestic appliances The risk of being obese was significantly higher in men and women from households with a refrigerator, microwave oven or washing machine and in men from households with a water heater (Table 4). The risk of being obese increased significantly with the increasing number of such appliances within a household. These results were not altered materially following additional adjustment for housework/gardening frequency, smoking, alcohol consumption and consumption of fried foods, Western-style junkfood, fruit and vegetables (data not shown).\nRelationship between being obese and ownership of household appliances\n*adjusted for age, income and education\nThe risk of being obese was significantly higher in men and women from households with a refrigerator, microwave oven or washing machine and in men from households with a water heater (Table 4). The risk of being obese increased significantly with the increasing number of such appliances within a household. These results were not altered materially following additional adjustment for housework/gardening frequency, smoking, alcohol consumption and consumption of fried foods, Western-style junkfood, fruit and vegetables (data not shown).\nRelationship between being obese and ownership of household appliances\n*adjusted for age, income and education", "In men, the OR for being obese decreased steadily and significantly with increasing weighted total weekly sessions of exercise-related PA, such that those reporting 18 or more sessions had a OR of obesity of 0.69 (0.63-0.75) compared to those with 0-3 sessions (p(trend) < 0.0001) and this relationship was observed particularly for moderate and strenuous PA (Table 2). There was no apparent relationship between being obese and moderate and strenuous PA in women and the relationship between strenuous activity and obesity differed significantly between men and women (p(interaction) < 0.0001). However, in women an inverse relationship with being obese was observed mainly for mild PA and walking (Table 2).\nFor both sexes, the risk of being obese was consistently lower with increasing frequency of housework/gardening, with 33% (26-39%) and 33% (21-43%) lower adjusted ORs in men and women, respectively, in those reporting these activities daily versus seldom or never (Table 3). The lower risk of obesity with increasing housework or gardening was independent of the level of exercise-related PA, in that the OR did not change materially (i.e. changed by <10%) following additional adjustment for exercise-related PA (see below) and a similar relationship was observed within separate categories of exercise-related PA (Figure 1). The inverse relationship between housework/gardening and obesity was still present following additional adjustment for screen-time and exercise-related PA. Compared to people who did housework or gardening seldom or never, the ORs (95% CI) for being obese in men were: 0.85 (0.76-0.94) for people who did housework or gardening 1-3 times per month; 0.79 (0.71-0.87) for 1-2 times per week; 0.80 (0.72-0.90) for 3-4 times per week; and 0.73 (0.66-0.80) for housework/gardening on most days, adjusting for age, income, education, screen-time and weighted weekly sessions of exercise-related PA. For women, the ORs for the same categories were: 0.95 (0.79-1.15); 0.76 (0.64-0.90); 0.75 (0.63-0.90); and 0.71 (0.60-0.84), respectively.\nRelationship between being obese and gardening/housework, leisure-related computer or television use (\"screen-time\") and sitting time\n*adjusted for age, income and education\nnumbers do not always sum to total due to missing values\nOdds ratios (OR) for being obese in relation to weighted weekly sessions of exercise-related physical activity (ERPA), hours of daily screen-time and frequency of housework/gardening.", "Increasing leisure-related screen-time was associated with significantly and substantially increasing risk of being obese in both men and women, with 85% and 116% increases in risk, respectively, for 8 or more hours of daily screen-time versus <2 hours (Table 3, p(trend) < 0.0001). Overall, sitting-time was not significantly related to the OR of being obese (p(trend) = 0.32), although a significant trend was observed in women (Table 3).\nThe positive relationship between screen-time and being obese was still present following additional adjustment for housework/gardening and exercise-related PA; the ORs (95% CI) for obesity in men were: 1.22 (1.14-1.30); 1.38 (1.27-1.50); 1.58 (1.36-1.83); and 1.80 (1.53-2.13) and for women were: 1.15 (1.05-1.27); 1.50 (1.35-1.67); 1.62 (1.36-1.92) and 2.13 (1.78-2.55), for people with: 2.0-2.9 hours; 3.0-3.9 hours; 4-7.9 hours; and ≥8 hours of daily screen-time versus 0-1.9 hours, respectively, adjusted for age, income, education, housework/gardening and exercise-related PA. Additional adjustment for consumption of fried foods, soft drink and junkfood and smoking and alcohol consumption did not materially alter the OR (data not shown).\nFigure 1 shows the cohort divided into four groups according to their level of exercise-related PA (ERPA in the figure). The ORs for being obese were then presented within each group according to the number of hours of total daily screen-time, with separate lines according to the frequency of housework/gardening. This figure shows increasing risk of being obese with increasing screen-time within each exercise-related PA group and within each housework/gardening group. It also shows that the finding of lower risks of being obese with increasing frequency of housework/gardening persists, even when screen-time and exercise-related PA were accounted for. When the relationships between being obese and exercise-related PA, screen-time and housework/gardening were modelled together, no significant interactions were observed (likelihood ratio χ392 = 38.54, p = 0.49), indicating that they were each independently associated with obesity.\nThe sex, income and education-adjusted OR of obesity per two-hour increase in daily screen-time is shown separately according to a variety of factors, including according to total exercise-related PA and according to housework and gardening, in Figure 2. There was an 18% (15-21%) increase in the risk of being obese with every two additional hours of daily screen-time overall and a significant elevation in the risk of being obese with increasing screen-time was seen in all of the population sub-groups examined (Figure 2). There was a significantly greater increase in the risk of being obese with increasing screen-time in unmarried compared to married individuals (p(heterogeneity) < 0.0001). The relationship between being obese and screen-time was attenuated significantly in older cohort members (p(heterogeneity) = 0.02) and in those with higher incomes (p(heterogeneity) = 0.02). No significant variation in the relationship between screen-time and being obese was seen according to the other factors examined, including: sex; urban/rural residence history; education; smoking status; alcohol, fruit, vegetable, junkfood and fried food intake; disability; level of exercise-related PA; and frequency of housework/gardening.\nOdds ratios (OR) for being obese per 2 hour increase in daily screen-time, in different population sub-groups, adjusted for age, sex, income and education, where appropriate.", "The risk of being obese was significantly higher in men and women from households with a refrigerator, microwave oven or washing machine and in men from households with a water heater (Table 4). The risk of being obese increased significantly with the increasing number of such appliances within a household. These results were not altered materially following additional adjustment for housework/gardening frequency, smoking, alcohol consumption and consumption of fried foods, Western-style junkfood, fruit and vegetables (data not shown).\nRelationship between being obese and ownership of household appliances\n*adjusted for age, income and education", "In this cohort of Thai men and women, the risk of being obese is consistently higher in those with greater time spent in leisure-related television watching and computer games and inversely associated with time spent doing housework or gardening. Inverse associations between obesity and total weekly sessions of exercise-related PA are observed in men with a significantly weaker association seen in women. Exercise-related PA, screen-time and housework/gardening each have independent associations with obesity. The magnitude of the association with obesity relating to these risk factors is substantial. Individuals reporting daily housework/gardening have a 33% lower risk of being obese compared to those reporting these activities seldom or never and there is an 18% increase in the risk of obesity with every two hours of additional daily screen-time.\nThe findings reported here show an inverse relationship between exercise-related PA and being obese that is stronger in men than in women and may be somewhat weaker than that observed in Western populations. The inverse relationship between obesity and exercise, usually leisure-related PA is well established in Western countries [5,6,21]. Although a reduced risk of obesity with increasing PA has been demonstrated in certain Asian populations, including those in China [23] and Korea [24], the specific relationship of leisure-related PA to obesity is less clear, and may be of lesser magnitude. The reason for this is not known. Potential explanations include: the lack of data relevant to Asia; the possibility that the proportion of total energy expenditure to leisure-related PA is lower in the Asian context [15]; differing types and intensities of leisure-related PA compared to the West; and differences in measurement error.\nWe were unable to locate any previous studies in adults of the relationship between being obese and television and computer use in Asia. Studies in Western populations consistently show increases in obesity with increasing time spent in sedentary activities, particularly screen-time [7,8,25-27]. The direct relationship between sedentary behaviours and obesity is observed in both cross-sectional [7,25,26] and prospective studies [8,15,28]. Studies have varied in the way they have measured and categorised screen-time and other sedentary behaviours, as well as obesity related outcomes, so it is difficult to summarise quantitatively the magnitude of the risk involved. However, the 18% increase in obesity risk per 2 hours of additional daily screen-time observed here is consistent with the 23% increase observed in US nurses [8] and older Australian adults [9].\nThe one previous publication we were able to locate examining the relationship between BMI and domestic activity in the Asian context demonstrated a significantly lower BMI in men with increasing time spent in domestic activities and a non-significant relationship in women, in China [29]. Studies in Western populations have generally not found a significant relationship between BMI and domestic activity [12,13,30], even heavy domestic activity, although one study in older US adults found house cleaning, but not gardening, to be associated with decreased BMI on multivariate analysis [14] and another found decreased all-cause mortality with increasing domestic PA [30]. The study presented here is the largest to date investigating the issue and shows a decreasing risk of being obese with increasing frequency of housework and gardening, independent of exercise-related PA and screen-time.\nAlthough the lack of a positive finding in the Western context may reflect measurement error, the play of chance, small sample sizes or other factors, it is also possible that domestic PA in Asian countries differs from that in Western countries, for example, due to use of labour saving devices or differing practices. Increasing use of labour saving devices is part of the transition accompanying industrialisation and is associated with reduced energy expenditure in domestic tasks [31]. Decreasing domestic physical activity over time has been noted in one Chinese study [29]. We found household ownership of domestic appliances to be significantly associated with increasing risk of being obese, with increasing risks of being obese accompanying increasing numbers of appliances within the household. However, the lack of specificity in the relationship of the different household appliances to obesity and the apparently greater effect in men compared to women suggests that this may well not be a causal relationship; it may instead reflect a broader difference in socioeconomic status and lifestyle between households with and without appliances.\nStrengths of the current study include its large size and inclusion of adults from a wide range of social and economic backgrounds. Although the cohort is somewhat younger and more urbanised than the Thai general population, it represents well the geographic regions of Thailand and exhibits substantial heterogeneity in the distribution of other factors [17]. For example, 35% of males and 47% of females had low incomes (<7000 Baht per month or $5.50 US per day). Participants in the Thai Cohort Study in 2005 were very similar to the STOU student body in that year for sex ratio, age distribution, geographic region of residence, income, education and course of study [32]. Much of the health-risk transition underway in middle income countries is mediated by education [33,34] and the cohort is, by definition, ahead of national education trends. It is therefore likely to provide useful early insights into the effects and mediators of the health-risk transition in middle-income countries. Previous relevant studies from the cohort include examination of the broader health-related correlates of obesity [22] and the relationship between gender, socioeconomic status and obesity [35].\nThe proportion of the cohort classified as overweight but not obese is similar to the 18% found in the third Thai National Health Examination Survey (2004), while obesity is much lower among STOU women (10% compared to 36% in the National Health Examination Survey) but similar among men in the two studies (23%) [2]. It should be noted that the Thai Cohort Study, like the vast majority of cohort studies, is not designed to be representative of the general population, but is meant to provide sufficient heterogeneity of exposure to allow reliable estimates of relative risk based on internal comparisons [36]. The \"healthy cohort effect\" and the 44% response rate for this study means that the estimates of relative risk shown here are likely to be conservative, since community members with more extreme behaviours and health conditions may be less likely to be attending an open university or to participate. However, it is important to note that ORs comparing groups within the cohort remain valid and can be generalised more broadly [36,37]. Furthermore, the major comparisons in this paper are between obese and non-obese individuals, rather than obese and \"healthy weight\" individuals, which is also likely to lead to more conservative estimates of association.\nThe limitations of the study should also be borne in mind. The measures used for tobacco smoking and alcohol consumption were brief and the physical activity measure used has, to our knowledge, only been validated in Western populations. BMI was based on self-reported height and weight, which have been shown to provide a valid measure of body size in this population, with correlation coefficients for BMI based on self-reported versus measured height and weight of 0.91 for men and 0.95 for women [38]. However, BMI based on self-reported measures was underestimated by an average of 0.77 kg/m2 for men and 0.62 kg/m2 for women [38]. Cut-points delineating overweight and obesity were set at BMIs ≥23 and ≥25; weight-related disease in Asian populations occurs least when BMI is about 22 or less [39], and significantly increases with BMI ≥23 [40]. The excellent correlation between measured and self-reported values mean that self-reported values are generally reliable for ranking participants according to BMI in epidemiological studies, as was done here. The general underestimation of BMI means that absolute values of BMI from self-reported measures are less reliable.\nSelf-reported leisure-related television and computer use has good test-retest reliability and validity, although respondents have a tendency to under-report the number of hours involved [41]. We were not able to locate any studies validating these measures in Asian populations. Time spent in habitual, incidental physical activity is difficult to measure [42] and domestic activities, screen-time and overall physical activity are all likely to be reported with differing degrees of measurement error. Although both domestic activities and screen-time remain predictive of obesity within categories of physical activity, it is possible that this is the result of greater measurement error in ascertaining overall physical activity than in ascertaining domestic and screen-related activities [25]. However, the lack of strong correlation between screen-time and overall physical activity (r = -0.016) goes against this argument, as does the previous observation that television viewing remains a significant predictor of obesity in women, following adjustment for pedometer measured physical activity [42].\nObesity and overweight are the result of sustained positive energy balance, whereby energy intake exceeds energy expenditure. Although dietary factors are important, there is mounting evidence that insufficient energy expenditure is likely to be a key factor underlying the global obesity epidemic [10]. The main determinant of individual energy expenditure is the basal metabolic rate, which typically accounts for 70% of all kilojoules burned [15]. A further 10% of energy expenditure comes from the thermic effect of food and the remaining 20% comes from PA [15]. PA is often conceptualised as comprised of purposeful and non-purposeful physical activity; the latter is also termed \"incidental\" PA. A recent study from the US found that over half of population-level energy expenditure from PA was from sedentary and low-intensity tasks, 16% was attributed to occupational activity above and beyond sitting at work, 16% was attributable to domestic activities and yard work of at least moderate intensity and less than 5% was attributable to leisure-time PA [43]. This evidence is consistent with the suggestion that differences in incidental physical activity are responsible for the greatest variations in energy expenditure between individuals and populations [10]. Moreover, recent evidence indicates that one of the most potent mechanisms determining cardiovascular risk factors, including obesity and metabolic disorders, is the amount of time spent in high volume daily intermittent low-intensity postural or ambulatory activities, which account for as much of 90% of energy expended in physical activity [11].\nSedentary behaviours generally involve sitting or lying down and are characterised by low energy expenditure (metabolic equivalent intensity <2) [41]. A substantial amount of time spent in sedentary activities is likely to contribute to obesity through reduced overall energy expenditure, mainly resulting from their impact on incidental physical activity, since it may co-exist with relatively high levels of exercise-related physical activity. Screen-time, particularly television watching, is also associated with other health behaviours, such as eating fatty foods. However, the finding of increased obesity among those watching greater amounts of television persisted in this dataset after adjustment for intake of fatty food and in other studies following adjustment for total energy intake [8] and foods eaten while watching television [27], so this is unlikely to explain much of its effects.\nIn lower- and middle-income countries, including Thailand, industrialisation is generally accompanied by increasing urbanisation, a more sedentary lifestyle, with increasing car and computer use and a higher fat diet dominated by more refined foods [16]. It is also characterised by a shift in work patterns for a substantial proportion of the population, from high energy expenditure activities such as farming, mining and forestry to less energy-demanding jobs in the service sector [16]. All of these changes are likely to increase population obesity. There are a number of specific barriers to increasing physical activity in many Asian countries, including environmental factors such as heat, inadequate urban infrastructure, pollution and other hazards. Furthermore, chronic malnutrition has been common in many Asian countries, leading to stunting in significant portions of the population and rendering them vulnerable to obesity as food availability improves.\nThe importance of obesity, the metabolic syndrome and diabetes in Thailand has been highlighted extensively [44-46]. In Thailand, and in many other countries, social factors are key upstream determinants of the major influences on obesity. For example, domestic duties are often divided along gender lines and many wealthier households have servants, particularly to do the heavier work. In this cohort, higher socioeconomic status was accompanied by increasing risk of being obese in men and decreasing risk of being obese in women [35]. This pattern is believed to represent an intermediate stage in the health-risk transition between less-developed countries such as China, which demonstrate high socioeconomic status to be associated with increased obesity in both men and women [47], and Western populations where high socioeconomic status is associated with reduced obesity in both men and women [2,35].\nThe study was able to investigate simultaneously a number of activity-related measures and the large numbers allowed quantification of the association of these factors with obesity within a range of population subgroups. However, the analyses presented here are cross-sectional so it is not possible to directly attribute causality to the relationships observed or to exclude reverse causality. Reverse causality occurs when an exposure varies because of the specific condition under investigation. In this case, reverse causality would mean that obesity might result in reduced exercise-related PA, increased sedentary behaviour and decreased domestic PA. There are a priori reasons why it is likely that certain elements of the PA-BMI relationship are causal i.e. that reduced energy expenditure due to reduced PA results in increased BMI. However, it is also possible that people with high BMI may change their level of PA. Intuitively, this might apply more to exercise-related PA than to screen-time or domestic activities; people with a high BMI may do more exercise-related PA in order to lose weight or may reduce their exercise-related PA, due to the extra exertion required because of their weight or obesity related health issues (e.g. joint problems). In Thai society, women in particular are under pressure to be thin and the increased walking among women of higher BMI may reflect this. Going against a large role for reverse causality is the fact that increasing inactivity has been shown to result in increased obesity in longitudinal data [8,48] and experimental studies show that increasing BMI by overfeeding of lean individuals does not result in increased sedentary behaviour [49]. This issue is not resolved entirely by using longitudinal data, since the major risk factor for incident obesity is having a high BMI at baseline [49]. We propose that the relationship between sedentary behaviour and obesity is likely to be complex, with a causal relationship between inactivity and obesity predominating. There is likely to be some contribution of obesity leading to inactivity [48], or indeed a \"spiral\" relationship, whereby inactivity leads to obesity, which further exacerbates inactivity, leading to further increases in obesity [50].", "In common with many middle to low income countries, the prevalence of overweight and obesity in Thailand is lower than that seen in many Western nations, but is increasing rapidly. Avoiding the transition to the obesity patterns seen in the West is a key priority. The data presented here suggest that habitual, high volume, low intensity PA is likely to be important for maintaining a healthy weight and are in keeping with other data that show that increasing exercise-related leisure-time PA alone is unlikely to be sufficient to prevent population obesity [15]. Leisure-related television and computer use were strongly related to the risk of being obese. Research focusing on habitual activities and sedentary behaviours is relatively new. Effective interventions to reduce sedentary time and increase incidental activity are being developed; innovative interventions applicable to the Asian context are needed urgently." ]

[ null, null, null, null, null, null, null, null, null, null, null ]

[ "Background", "Methods", "Study population", "Data", "Statistical methods", "Ethical approval", "Results", "Obesity and exercise-related physical activity, housework, and gardening", "Obesity and leisure related screen-time", "Obesity and domestic appliances", "Discussion", "Conclusions", "Supplementary Material" ]

[ "The prevalence of obesity is rising rapidly in most Asian countries, with increases of 46% in Japan and over 400% in China observed from the 1980s to early 2000s [1]. In Thailand, the prevalence of obesity increased by around 19% from 1997 to 2004 alone [2]. There have been accompanying increases in morbidity related to conditions such as diabetes and cardiovascular disease in Asian countries [3,4].\nIt is well established in Western populations that increasing purposeful or leisure-time physical activity (PA) is associated with reduced rates of obesity [5,6]. Recent evidence, also from Western countries, suggests that sedentary activities, such as watching television or using a computer, are associated with increasing obesity, independent of purposeful PA [7-9]. The role of incidental PA and overall energy expenditure, in influencing obesity has been highlighted [10,11]. The interplay between these factors and their combined effects on obesity are not well understood and information relevant to Asian populations is particularly scarce. Furthermore, the relationship between domestic activities and obesity is unclear [12-14]. This is important because physical activity related to patterns of daily activity differs between Asia and Western countries [15] and because many Asian countries are experiencing rapid health and lifestyle transitions [16].\nThis paper examines in detail the relationships between obesity, exercise-related PA, domestic activities and sedentary behaviours in Thailand, with particular emphasis on the interaction between these factors.", " Study population The Sukhothai Thammathirat Open University (STOU) Cohort Study is designed to provide evidence regarding the transition in risk factor profiles, health outcomes and other factors accompanying development and is described in detail elsewhere [17]. In brief, from April to November 2005, enrolled STOU students across Thailand who had completed a least one semester were mailed a 20-page health questionnaire and asked to join the study by completing the questionnaire, providing signed consent for follow-up, and returning these in a reply-paid envelope. A total of 87 134 men and women aged 15-87 years (median 29 years) joined the cohort.\nThe Sukhothai Thammathirat Open University (STOU) Cohort Study is designed to provide evidence regarding the transition in risk factor profiles, health outcomes and other factors accompanying development and is described in detail elsewhere [17]. In brief, from April to November 2005, enrolled STOU students across Thailand who had completed a least one semester were mailed a 20-page health questionnaire and asked to join the study by completing the questionnaire, providing signed consent for follow-up, and returning these in a reply-paid envelope. A total of 87 134 men and women aged 15-87 years (median 29 years) joined the cohort.\n Data All of the variables used in this study were derived from cross-sectional self-reported data from the Thai Cohort Study questionnaire [17]. The questionnaire requested information on: socio-demographic factors; ethnicity; past and present residence and domestic environment; income; work-related factors; height; weight; sensory impairment; mental health; medical history; general health; use of health services; social networks; social capital; diet; physical activity; sedentary behaviours; tobacco and alcohol consumption; use of seat belts and motorcycle helmets; drink-driving; and family structure and health (See Additional files 1 and 2 for questionnaires). Where possible, questionnaire items that had been standardised and validated were used.\nSelf-reported weight and height were used to calculate participants' BMI, as their weight in kilograms, divided by the square of their height in metres. Cut-points delineating overweight and obesity were set at BMIs ≥23 and ≥25, respectively, in accordance with International Obesity Taskforce recommendations [18] and studies in other Asian populations [19].\nInformation on exercise-related PA was obtained through a question asking: \"During a typical week (7-day period), how many times on average do you do the following kinds of exercise?\", with responses requested for: \"Strenuous exercise (heart beats rapidly) for more than 20 minutes, e.g. heavy lifting, digging, aerobics or fast bicycling, running, soccer, trakraw\"; \"Moderate exercise (not exhausting but breathe harder than normal) for more than 20 minutes, e.g. carrying light loads, cycling at a regular pace\"; \"Mild exercise (minimal effort) for more than 20 minutes, e.g. yoga, Tai-Chi, bowling\" and; \"Walking for at least 10 minutes e.g. at work, at home, exercise\". This question is a sessions-based measure of physical activity, similar to the sessions component of the International Physical Activity Questionnaire and the Active Australia Survey [20]; these session measures have been shown to provide a reliable index of sufficiency of physical activity in non-Thai populations [21]. It incorporates the three major intensities of activity (strenuous, moderate and walking), included in these measures, as well as an additional \"mild\" category that was created specifically for this study to cover common types of activity in Thailand. The responses to this question were used to derive a weighted measure of overall metabolically-adjusted exercise-related PA, calculated as \"2 × strenuous + moderate + mild + walking\" exercise sessions, in keeping with previous calculations of this quotient [20].\nThe frequency of reported housework and gardening was used as a measure of incidental PA and was classified into 5 groups according to the response to the question \"How often do you do household cleaning or gardening work?\" with options ranging from seldom or never, to most days. Total daily leisure-related screen-time and sitting time were classified according to the participant's response to the question \"How many hours per day do you usually spend: Watching TV or playing computer games? Sitting for any purpose (e.g. reading, resting, working thinking)?\". Sitting time could also include screen-time, as participants were not specifically asked to exclude screen-time from this measure. The availability of domestic appliances was classified according to the response to the question \"Which of the following does your home have now?\", with options including microwave oven, refrigerator, water heater and washing machine. The questions on housework/gardening, screen-time, sitting time and availability of domestic appliances were devised specially for the Thai Cohort Study.\nEducation attainment was classified as: secondary school graduation or less; post-secondary school certificate or diploma; and tertiary graduate. Personal monthly income was in Thai Baht in four categories (≤7,000; 7,001-10,000; 10,001-20,000; >20,000). Respondents recorded the frequency of eating deep fried food and soft drinks and Western-style fast foods such as pizza (known as \"junkfood\") on a five-point Likert scale ranging from never or less than once a month, to once or more a day; this was categorised as consumption <3 times and ≥ 3 times per week for fried food and seldom (never or less than once per month) and regularly (≥ once per month) for \"junkfood\". Fruit and vegetable intakes were noted as serves eaten per day and categorised as <2 and ≥2 serves per day. They were asked if they have ever smoked, when they started and when they quit and were categorised as current smokers or not current smokers, with similar questions and categories for alcohol consumption.\nAnalysis was restricted to the 95% of individuals aged between 20 and 50 years, with BMIs between 11 and 50. Individuals were excluded from the analyses if they were missing data on age or sex (n = 2), height or weight (n = 1030) or physical activity or inactivity (n = 6863), leaving 74,981 participants.\nAll of the variables used in this study were derived from cross-sectional self-reported data from the Thai Cohort Study questionnaire [17]. The questionnaire requested information on: socio-demographic factors; ethnicity; past and present residence and domestic environment; income; work-related factors; height; weight; sensory impairment; mental health; medical history; general health; use of health services; social networks; social capital; diet; physical activity; sedentary behaviours; tobacco and alcohol consumption; use of seat belts and motorcycle helmets; drink-driving; and family structure and health (See Additional files 1 and 2 for questionnaires). Where possible, questionnaire items that had been standardised and validated were used.\nSelf-reported weight and height were used to calculate participants' BMI, as their weight in kilograms, divided by the square of their height in metres. Cut-points delineating overweight and obesity were set at BMIs ≥23 and ≥25, respectively, in accordance with International Obesity Taskforce recommendations [18] and studies in other Asian populations [19].\nInformation on exercise-related PA was obtained through a question asking: \"During a typical week (7-day period), how many times on average do you do the following kinds of exercise?\", with responses requested for: \"Strenuous exercise (heart beats rapidly) for more than 20 minutes, e.g. heavy lifting, digging, aerobics or fast bicycling, running, soccer, trakraw\"; \"Moderate exercise (not exhausting but breathe harder than normal) for more than 20 minutes, e.g. carrying light loads, cycling at a regular pace\"; \"Mild exercise (minimal effort) for more than 20 minutes, e.g. yoga, Tai-Chi, bowling\" and; \"Walking for at least 10 minutes e.g. at work, at home, exercise\". This question is a sessions-based measure of physical activity, similar to the sessions component of the International Physical Activity Questionnaire and the Active Australia Survey [20]; these session measures have been shown to provide a reliable index of sufficiency of physical activity in non-Thai populations [21]. It incorporates the three major intensities of activity (strenuous, moderate and walking), included in these measures, as well as an additional \"mild\" category that was created specifically for this study to cover common types of activity in Thailand. The responses to this question were used to derive a weighted measure of overall metabolically-adjusted exercise-related PA, calculated as \"2 × strenuous + moderate + mild + walking\" exercise sessions, in keeping with previous calculations of this quotient [20].\nThe frequency of reported housework and gardening was used as a measure of incidental PA and was classified into 5 groups according to the response to the question \"How often do you do household cleaning or gardening work?\" with options ranging from seldom or never, to most days. Total daily leisure-related screen-time and sitting time were classified according to the participant's response to the question \"How many hours per day do you usually spend: Watching TV or playing computer games? Sitting for any purpose (e.g. reading, resting, working thinking)?\". Sitting time could also include screen-time, as participants were not specifically asked to exclude screen-time from this measure. The availability of domestic appliances was classified according to the response to the question \"Which of the following does your home have now?\", with options including microwave oven, refrigerator, water heater and washing machine. The questions on housework/gardening, screen-time, sitting time and availability of domestic appliances were devised specially for the Thai Cohort Study.\nEducation attainment was classified as: secondary school graduation or less; post-secondary school certificate or diploma; and tertiary graduate. Personal monthly income was in Thai Baht in four categories (≤7,000; 7,001-10,000; 10,001-20,000; >20,000). Respondents recorded the frequency of eating deep fried food and soft drinks and Western-style fast foods such as pizza (known as \"junkfood\") on a five-point Likert scale ranging from never or less than once a month, to once or more a day; this was categorised as consumption <3 times and ≥ 3 times per week for fried food and seldom (never or less than once per month) and regularly (≥ once per month) for \"junkfood\". Fruit and vegetable intakes were noted as serves eaten per day and categorised as <2 and ≥2 serves per day. They were asked if they have ever smoked, when they started and when they quit and were categorised as current smokers or not current smokers, with similar questions and categories for alcohol consumption.\nAnalysis was restricted to the 95% of individuals aged between 20 and 50 years, with BMIs between 11 and 50. Individuals were excluded from the analyses if they were missing data on age or sex (n = 2), height or weight (n = 1030) or physical activity or inactivity (n = 6863), leaving 74,981 participants.\n Statistical methods The relationships between a range of personal characteristics and exercise-related PA, housework/gardening and leisure-related screen-time were examined, as well as the correlation between the individual measures of physical activity and inactivity. Variables were categorised into the groups listed in the various tables.\nThe proportion of the study population classified as obese according to exercise-related PA, housework, leisure-related screen-time and sitting time was examined. Prevalence odds ratios (OR) and 95% CIs for obesity according to PA, housework, screen-time and sitting time were estimated using unconditional logistic regression; crude and adjusted odds ratios were computed. ORs were presented separately for men and women and adjusted for age (as a continuous variable), income and educational attainment, with exploration of the effect of additional adjustment for factors such as marital status, smoking, alcohol consumption and urban/rural residence. We evaluated the significance of interaction terms using a likelihood ratio test, comparing the model with and without the interaction terms.\nWe examined how much of any association of a specific PA or sedentary behaviour with obesity was attributable to differences in total physical activity level by modelling simultaneously the three PA variables and their two-way and three-way interactions. We also examined how much of the association of certain sedentary behaviours could be attributed to the effect of other sedentary behaviours and to consumption of fried foods and soft drinks and Western-style junkfood, using mutual adjustment.\nAll analyses were carried out in STATA version 9.2. All statistical tests were two-sided, using a significance level of p < 0.05. Due to the large sample size, conclusions were based on both significance and the effect size.\nThe relationships between a range of personal characteristics and exercise-related PA, housework/gardening and leisure-related screen-time were examined, as well as the correlation between the individual measures of physical activity and inactivity. Variables were categorised into the groups listed in the various tables.\nThe proportion of the study population classified as obese according to exercise-related PA, housework, leisure-related screen-time and sitting time was examined. Prevalence odds ratios (OR) and 95% CIs for obesity according to PA, housework, screen-time and sitting time were estimated using unconditional logistic regression; crude and adjusted odds ratios were computed. ORs were presented separately for men and women and adjusted for age (as a continuous variable), income and educational attainment, with exploration of the effect of additional adjustment for factors such as marital status, smoking, alcohol consumption and urban/rural residence. We evaluated the significance of interaction terms using a likelihood ratio test, comparing the model with and without the interaction terms.\nWe examined how much of any association of a specific PA or sedentary behaviour with obesity was attributable to differences in total physical activity level by modelling simultaneously the three PA variables and their two-way and three-way interactions. We also examined how much of the association of certain sedentary behaviours could be attributed to the effect of other sedentary behaviours and to consumption of fried foods and soft drinks and Western-style junkfood, using mutual adjustment.\nAll analyses were carried out in STATA version 9.2. All statistical tests were two-sided, using a significance level of p < 0.05. Due to the large sample size, conclusions were based on both significance and the effect size.\n Ethical approval Ethics approval was obtained from Sukhothai Thammathirat Open University Research and Development Institute (protocol 0522/10) and the Australian National University Human Research Ethics Committee (protocol 2004344). Informed written consent was obtained from all participants.\nEthics approval was obtained from Sukhothai Thammathirat Open University Research and Development Institute (protocol 0522/10) and the Australian National University Human Research Ethics Committee (protocol 2004344). Informed written consent was obtained from all participants.", "The Sukhothai Thammathirat Open University (STOU) Cohort Study is designed to provide evidence regarding the transition in risk factor profiles, health outcomes and other factors accompanying development and is described in detail elsewhere [17]. In brief, from April to November 2005, enrolled STOU students across Thailand who had completed a least one semester were mailed a 20-page health questionnaire and asked to join the study by completing the questionnaire, providing signed consent for follow-up, and returning these in a reply-paid envelope. A total of 87 134 men and women aged 15-87 years (median 29 years) joined the cohort.", "All of the variables used in this study were derived from cross-sectional self-reported data from the Thai Cohort Study questionnaire [17]. The questionnaire requested information on: socio-demographic factors; ethnicity; past and present residence and domestic environment; income; work-related factors; height; weight; sensory impairment; mental health; medical history; general health; use of health services; social networks; social capital; diet; physical activity; sedentary behaviours; tobacco and alcohol consumption; use of seat belts and motorcycle helmets; drink-driving; and family structure and health (See Additional files 1 and 2 for questionnaires). Where possible, questionnaire items that had been standardised and validated were used.\nSelf-reported weight and height were used to calculate participants' BMI, as their weight in kilograms, divided by the square of their height in metres. Cut-points delineating overweight and obesity were set at BMIs ≥23 and ≥25, respectively, in accordance with International Obesity Taskforce recommendations [18] and studies in other Asian populations [19].\nInformation on exercise-related PA was obtained through a question asking: \"During a typical week (7-day period), how many times on average do you do the following kinds of exercise?\", with responses requested for: \"Strenuous exercise (heart beats rapidly) for more than 20 minutes, e.g. heavy lifting, digging, aerobics or fast bicycling, running, soccer, trakraw\"; \"Moderate exercise (not exhausting but breathe harder than normal) for more than 20 minutes, e.g. carrying light loads, cycling at a regular pace\"; \"Mild exercise (minimal effort) for more than 20 minutes, e.g. yoga, Tai-Chi, bowling\" and; \"Walking for at least 10 minutes e.g. at work, at home, exercise\". This question is a sessions-based measure of physical activity, similar to the sessions component of the International Physical Activity Questionnaire and the Active Australia Survey [20]; these session measures have been shown to provide a reliable index of sufficiency of physical activity in non-Thai populations [21]. It incorporates the three major intensities of activity (strenuous, moderate and walking), included in these measures, as well as an additional \"mild\" category that was created specifically for this study to cover common types of activity in Thailand. The responses to this question were used to derive a weighted measure of overall metabolically-adjusted exercise-related PA, calculated as \"2 × strenuous + moderate + mild + walking\" exercise sessions, in keeping with previous calculations of this quotient [20].\nThe frequency of reported housework and gardening was used as a measure of incidental PA and was classified into 5 groups according to the response to the question \"How often do you do household cleaning or gardening work?\" with options ranging from seldom or never, to most days. Total daily leisure-related screen-time and sitting time were classified according to the participant's response to the question \"How many hours per day do you usually spend: Watching TV or playing computer games? Sitting for any purpose (e.g. reading, resting, working thinking)?\". Sitting time could also include screen-time, as participants were not specifically asked to exclude screen-time from this measure. The availability of domestic appliances was classified according to the response to the question \"Which of the following does your home have now?\", with options including microwave oven, refrigerator, water heater and washing machine. The questions on housework/gardening, screen-time, sitting time and availability of domestic appliances were devised specially for the Thai Cohort Study.\nEducation attainment was classified as: secondary school graduation or less; post-secondary school certificate or diploma; and tertiary graduate. Personal monthly income was in Thai Baht in four categories (≤7,000; 7,001-10,000; 10,001-20,000; >20,000). Respondents recorded the frequency of eating deep fried food and soft drinks and Western-style fast foods such as pizza (known as \"junkfood\") on a five-point Likert scale ranging from never or less than once a month, to once or more a day; this was categorised as consumption <3 times and ≥ 3 times per week for fried food and seldom (never or less than once per month) and regularly (≥ once per month) for \"junkfood\". Fruit and vegetable intakes were noted as serves eaten per day and categorised as <2 and ≥2 serves per day. They were asked if they have ever smoked, when they started and when they quit and were categorised as current smokers or not current smokers, with similar questions and categories for alcohol consumption.\nAnalysis was restricted to the 95% of individuals aged between 20 and 50 years, with BMIs between 11 and 50. Individuals were excluded from the analyses if they were missing data on age or sex (n = 2), height or weight (n = 1030) or physical activity or inactivity (n = 6863), leaving 74,981 participants.", "The relationships between a range of personal characteristics and exercise-related PA, housework/gardening and leisure-related screen-time were examined, as well as the correlation between the individual measures of physical activity and inactivity. Variables were categorised into the groups listed in the various tables.\nThe proportion of the study population classified as obese according to exercise-related PA, housework, leisure-related screen-time and sitting time was examined. Prevalence odds ratios (OR) and 95% CIs for obesity according to PA, housework, screen-time and sitting time were estimated using unconditional logistic regression; crude and adjusted odds ratios were computed. ORs were presented separately for men and women and adjusted for age (as a continuous variable), income and educational attainment, with exploration of the effect of additional adjustment for factors such as marital status, smoking, alcohol consumption and urban/rural residence. We evaluated the significance of interaction terms using a likelihood ratio test, comparing the model with and without the interaction terms.\nWe examined how much of any association of a specific PA or sedentary behaviour with obesity was attributable to differences in total physical activity level by modelling simultaneously the three PA variables and their two-way and three-way interactions. We also examined how much of the association of certain sedentary behaviours could be attributed to the effect of other sedentary behaviours and to consumption of fried foods and soft drinks and Western-style junkfood, using mutual adjustment.\nAll analyses were carried out in STATA version 9.2. All statistical tests were two-sided, using a significance level of p < 0.05. Due to the large sample size, conclusions were based on both significance and the effect size.", "Ethics approval was obtained from Sukhothai Thammathirat Open University Research and Development Institute (protocol 0522/10) and the Australian National University Human Research Ethics Committee (protocol 2004344). Informed written consent was obtained from all participants.", "Of 74 981 participants with appropriate data, 41 351 (55.2%, 95%CI 54.8-55.5%) were classified as being of healthy weight (BMI 18.5-22.9), 10 733 (14.4%, 14.1-14.6%) were underweight (BMI < 18.5), 11 241 (15.0%, 14.7-15.2%) were overweight but not obese (BMI ≥ 23.0-24.9) and 11 616 (15.6%, 15.2-15.7%) were obese (BMI ≥ 25.0).\nMen were far more likely to be overweight (21.7%, 21.3-22.1%) or obese (22.4%, 22.0-22.9%) than women (9.5% and 9.9%, respectively), while women were more likely to be underweight (21.3%, 20.9-21.7%) than men (5.9%, 5.6-6.1%). Compared to other members of the study cohort, obesity prevalence was higher in older participants and urban dwellers and in those with higher consumption of fried food (data not shown) [22].\nPatterns of exercise-related PA varied between men and women, with 12.5% (12.2-12.9%) of men reporting 0-3 sessions and 26.3% (25.8-26.8%) reporting ≥18 sessions of exercise-related PA per week compared to 22.2% (21.8-22.6%) and 12.1% (11.8-12.4%), respectively, for women. The mean number of sessions of exercise-related PA per week was 11.6 [sd 12.1] overall; 13.9 [sd 13.5] for men and 9.7 [sd 10.6] for women. A higher level of exercise-related PA was associated with having less than a tertiary education, being of lower income and eating more fruit and vegetables, but was not strongly related to other factors (Table 1). The pattern of PA making up the total weekly sessions also differed between the sexes, with women much less likely than men to report strenuous or moderate PA (Table 2).\nCharacteristics of study population according to total physical activity, housework/gardening and daily screen-time\naMeasured as top decile from 3 items assessing physical limitations in the past 4 weeks (eg how much bodily pain did you have in the past 4 weeks?)\nbOnly 1% and 0.6%, respectively, of females are current smokers and regular drinkers\nRelationship between being obese and measures of exercise-related physical activity (PA)\n*adjusted for age, income and education\nOverall, 49.4% (48.9-49.9%) of women and 34.4% (33.8-34.8%) of men reported doing household cleaning or gardening on most days of the week, while 3.7% (3.5-3.9%) of women and 8.8% (8.5-9.1%) of men reported that they did these seldom or never. Housework/gardening was more common among those who were married, not tertiary educated, of lower income and with greater fruit and vegetable intake than other cohort members (Table 1).\nLeisure related screen-time did not vary markedly between men and women. 17.8% (17.4-18.2%) of women and 22.2% (21.8-22.7%) of men reported less than two hours of daily screen-time, while 3.4% (3.2-3.6%) of women and 2.8% (2.6-2.9%) of men reported 8 hours or more. Average daily leisure related screen-time was 2.9 hours [sd 1.9]; it was 3.0 hours [sd 1.9] in women and 2.8 hours [sd 1.8] in men. Higher levels of screen-time were more common among cohort members who were younger, unmarried, urban residents and of lower income and who ate fried food daily and soft drinks or Western style junkfood once a month or more often (Table 1).\nWomen tended to have greater levels of sitting time than men, with 46.6% (46.0-46.9%) of women and 36.8% (36.2-37.3%) of men reporting 8 or more hours of daily sitting time. Average daily sitting time was 6.6 hours [sd 3.8] overall; 6.8 hours [sd 3.9] in women and 6.2 hours [sd 1.8] in men.\nThe number of hours of daily screen-time was poorly but significantly inversely correlated with the number of weekly sessions of exercise-related PA (r = -0.016; 95% CI: -0.024 to -0.009) and doing household cleaning or gardening (r = -0.022; -0.029 to -0.014) but was more strongly and positively related to number of hours sitting per day (r = 0.16; 0.15 to 0.16). The number of weekly sessions of exercise-related PA was positively correlated with doing household cleaning or gardening (r = 0.15; 0.14 to 0.16). The correlations between sitting time and number of weekly sessions of exercise-related PA and cleaning/gardening were -0.054 (-0.061 to -0.047) and -0.041 (-0.049 to -0.034) respectively.\n Obesity and exercise-related physical activity, housework, and gardening In men, the OR for being obese decreased steadily and significantly with increasing weighted total weekly sessions of exercise-related PA, such that those reporting 18 or more sessions had a OR of obesity of 0.69 (0.63-0.75) compared to those with 0-3 sessions (p(trend) < 0.0001) and this relationship was observed particularly for moderate and strenuous PA (Table 2). There was no apparent relationship between being obese and moderate and strenuous PA in women and the relationship between strenuous activity and obesity differed significantly between men and women (p(interaction) < 0.0001). However, in women an inverse relationship with being obese was observed mainly for mild PA and walking (Table 2).\nFor both sexes, the risk of being obese was consistently lower with increasing frequency of housework/gardening, with 33% (26-39%) and 33% (21-43%) lower adjusted ORs in men and women, respectively, in those reporting these activities daily versus seldom or never (Table 3). The lower risk of obesity with increasing housework or gardening was independent of the level of exercise-related PA, in that the OR did not change materially (i.e. changed by <10%) following additional adjustment for exercise-related PA (see below) and a similar relationship was observed within separate categories of exercise-related PA (Figure 1). The inverse relationship between housework/gardening and obesity was still present following additional adjustment for screen-time and exercise-related PA. Compared to people who did housework or gardening seldom or never, the ORs (95% CI) for being obese in men were: 0.85 (0.76-0.94) for people who did housework or gardening 1-3 times per month; 0.79 (0.71-0.87) for 1-2 times per week; 0.80 (0.72-0.90) for 3-4 times per week; and 0.73 (0.66-0.80) for housework/gardening on most days, adjusting for age, income, education, screen-time and weighted weekly sessions of exercise-related PA. For women, the ORs for the same categories were: 0.95 (0.79-1.15); 0.76 (0.64-0.90); 0.75 (0.63-0.90); and 0.71 (0.60-0.84), respectively.\nRelationship between being obese and gardening/housework, leisure-related computer or television use (\"screen-time\") and sitting time\n*adjusted for age, income and education\nnumbers do not always sum to total due to missing values\nOdds ratios (OR) for being obese in relation to weighted weekly sessions of exercise-related physical activity (ERPA), hours of daily screen-time and frequency of housework/gardening.\nIn men, the OR for being obese decreased steadily and significantly with increasing weighted total weekly sessions of exercise-related PA, such that those reporting 18 or more sessions had a OR of obesity of 0.69 (0.63-0.75) compared to those with 0-3 sessions (p(trend) < 0.0001) and this relationship was observed particularly for moderate and strenuous PA (Table 2). There was no apparent relationship between being obese and moderate and strenuous PA in women and the relationship between strenuous activity and obesity differed significantly between men and women (p(interaction) < 0.0001). However, in women an inverse relationship with being obese was observed mainly for mild PA and walking (Table 2).\nFor both sexes, the risk of being obese was consistently lower with increasing frequency of housework/gardening, with 33% (26-39%) and 33% (21-43%) lower adjusted ORs in men and women, respectively, in those reporting these activities daily versus seldom or never (Table 3). The lower risk of obesity with increasing housework or gardening was independent of the level of exercise-related PA, in that the OR did not change materially (i.e. changed by <10%) following additional adjustment for exercise-related PA (see below) and a similar relationship was observed within separate categories of exercise-related PA (Figure 1). The inverse relationship between housework/gardening and obesity was still present following additional adjustment for screen-time and exercise-related PA. Compared to people who did housework or gardening seldom or never, the ORs (95% CI) for being obese in men were: 0.85 (0.76-0.94) for people who did housework or gardening 1-3 times per month; 0.79 (0.71-0.87) for 1-2 times per week; 0.80 (0.72-0.90) for 3-4 times per week; and 0.73 (0.66-0.80) for housework/gardening on most days, adjusting for age, income, education, screen-time and weighted weekly sessions of exercise-related PA. For women, the ORs for the same categories were: 0.95 (0.79-1.15); 0.76 (0.64-0.90); 0.75 (0.63-0.90); and 0.71 (0.60-0.84), respectively.\nRelationship between being obese and gardening/housework, leisure-related computer or television use (\"screen-time\") and sitting time\n*adjusted for age, income and education\nnumbers do not always sum to total due to missing values\nOdds ratios (OR) for being obese in relation to weighted weekly sessions of exercise-related physical activity (ERPA), hours of daily screen-time and frequency of housework/gardening.\n Obesity and leisure related screen-time Increasing leisure-related screen-time was associated with significantly and substantially increasing risk of being obese in both men and women, with 85% and 116% increases in risk, respectively, for 8 or more hours of daily screen-time versus <2 hours (Table 3, p(trend) < 0.0001). Overall, sitting-time was not significantly related to the OR of being obese (p(trend) = 0.32), although a significant trend was observed in women (Table 3).\nThe positive relationship between screen-time and being obese was still present following additional adjustment for housework/gardening and exercise-related PA; the ORs (95% CI) for obesity in men were: 1.22 (1.14-1.30); 1.38 (1.27-1.50); 1.58 (1.36-1.83); and 1.80 (1.53-2.13) and for women were: 1.15 (1.05-1.27); 1.50 (1.35-1.67); 1.62 (1.36-1.92) and 2.13 (1.78-2.55), for people with: 2.0-2.9 hours; 3.0-3.9 hours; 4-7.9 hours; and ≥8 hours of daily screen-time versus 0-1.9 hours, respectively, adjusted for age, income, education, housework/gardening and exercise-related PA. Additional adjustment for consumption of fried foods, soft drink and junkfood and smoking and alcohol consumption did not materially alter the OR (data not shown).\nFigure 1 shows the cohort divided into four groups according to their level of exercise-related PA (ERPA in the figure). The ORs for being obese were then presented within each group according to the number of hours of total daily screen-time, with separate lines according to the frequency of housework/gardening. This figure shows increasing risk of being obese with increasing screen-time within each exercise-related PA group and within each housework/gardening group. It also shows that the finding of lower risks of being obese with increasing frequency of housework/gardening persists, even when screen-time and exercise-related PA were accounted for. When the relationships between being obese and exercise-related PA, screen-time and housework/gardening were modelled together, no significant interactions were observed (likelihood ratio χ392 = 38.54, p = 0.49), indicating that they were each independently associated with obesity.\nThe sex, income and education-adjusted OR of obesity per two-hour increase in daily screen-time is shown separately according to a variety of factors, including according to total exercise-related PA and according to housework and gardening, in Figure 2. There was an 18% (15-21%) increase in the risk of being obese with every two additional hours of daily screen-time overall and a significant elevation in the risk of being obese with increasing screen-time was seen in all of the population sub-groups examined (Figure 2). There was a significantly greater increase in the risk of being obese with increasing screen-time in unmarried compared to married individuals (p(heterogeneity) < 0.0001). The relationship between being obese and screen-time was attenuated significantly in older cohort members (p(heterogeneity) = 0.02) and in those with higher incomes (p(heterogeneity) = 0.02). No significant variation in the relationship between screen-time and being obese was seen according to the other factors examined, including: sex; urban/rural residence history; education; smoking status; alcohol, fruit, vegetable, junkfood and fried food intake; disability; level of exercise-related PA; and frequency of housework/gardening.\nOdds ratios (OR) for being obese per 2 hour increase in daily screen-time, in different population sub-groups, adjusted for age, sex, income and education, where appropriate.\nIncreasing leisure-related screen-time was associated with significantly and substantially increasing risk of being obese in both men and women, with 85% and 116% increases in risk, respectively, for 8 or more hours of daily screen-time versus <2 hours (Table 3, p(trend) < 0.0001). Overall, sitting-time was not significantly related to the OR of being obese (p(trend) = 0.32), although a significant trend was observed in women (Table 3).\nThe positive relationship between screen-time and being obese was still present following additional adjustment for housework/gardening and exercise-related PA; the ORs (95% CI) for obesity in men were: 1.22 (1.14-1.30); 1.38 (1.27-1.50); 1.58 (1.36-1.83); and 1.80 (1.53-2.13) and for women were: 1.15 (1.05-1.27); 1.50 (1.35-1.67); 1.62 (1.36-1.92) and 2.13 (1.78-2.55), for people with: 2.0-2.9 hours; 3.0-3.9 hours; 4-7.9 hours; and ≥8 hours of daily screen-time versus 0-1.9 hours, respectively, adjusted for age, income, education, housework/gardening and exercise-related PA. Additional adjustment for consumption of fried foods, soft drink and junkfood and smoking and alcohol consumption did not materially alter the OR (data not shown).\nFigure 1 shows the cohort divided into four groups according to their level of exercise-related PA (ERPA in the figure). The ORs for being obese were then presented within each group according to the number of hours of total daily screen-time, with separate lines according to the frequency of housework/gardening. This figure shows increasing risk of being obese with increasing screen-time within each exercise-related PA group and within each housework/gardening group. It also shows that the finding of lower risks of being obese with increasing frequency of housework/gardening persists, even when screen-time and exercise-related PA were accounted for. When the relationships between being obese and exercise-related PA, screen-time and housework/gardening were modelled together, no significant interactions were observed (likelihood ratio χ392 = 38.54, p = 0.49), indicating that they were each independently associated with obesity.\nThe sex, income and education-adjusted OR of obesity per two-hour increase in daily screen-time is shown separately according to a variety of factors, including according to total exercise-related PA and according to housework and gardening, in Figure 2. There was an 18% (15-21%) increase in the risk of being obese with every two additional hours of daily screen-time overall and a significant elevation in the risk of being obese with increasing screen-time was seen in all of the population sub-groups examined (Figure 2). There was a significantly greater increase in the risk of being obese with increasing screen-time in unmarried compared to married individuals (p(heterogeneity) < 0.0001). The relationship between being obese and screen-time was attenuated significantly in older cohort members (p(heterogeneity) = 0.02) and in those with higher incomes (p(heterogeneity) = 0.02). No significant variation in the relationship between screen-time and being obese was seen according to the other factors examined, including: sex; urban/rural residence history; education; smoking status; alcohol, fruit, vegetable, junkfood and fried food intake; disability; level of exercise-related PA; and frequency of housework/gardening.\nOdds ratios (OR) for being obese per 2 hour increase in daily screen-time, in different population sub-groups, adjusted for age, sex, income and education, where appropriate.\n Obesity and domestic appliances The risk of being obese was significantly higher in men and women from households with a refrigerator, microwave oven or washing machine and in men from households with a water heater (Table 4). The risk of being obese increased significantly with the increasing number of such appliances within a household. These results were not altered materially following additional adjustment for housework/gardening frequency, smoking, alcohol consumption and consumption of fried foods, Western-style junkfood, fruit and vegetables (data not shown).\nRelationship between being obese and ownership of household appliances\n*adjusted for age, income and education\nThe risk of being obese was significantly higher in men and women from households with a refrigerator, microwave oven or washing machine and in men from households with a water heater (Table 4). The risk of being obese increased significantly with the increasing number of such appliances within a household. These results were not altered materially following additional adjustment for housework/gardening frequency, smoking, alcohol consumption and consumption of fried foods, Western-style junkfood, fruit and vegetables (data not shown).\nRelationship between being obese and ownership of household appliances\n*adjusted for age, income and education", "In men, the OR for being obese decreased steadily and significantly with increasing weighted total weekly sessions of exercise-related PA, such that those reporting 18 or more sessions had a OR of obesity of 0.69 (0.63-0.75) compared to those with 0-3 sessions (p(trend) < 0.0001) and this relationship was observed particularly for moderate and strenuous PA (Table 2). There was no apparent relationship between being obese and moderate and strenuous PA in women and the relationship between strenuous activity and obesity differed significantly between men and women (p(interaction) < 0.0001). However, in women an inverse relationship with being obese was observed mainly for mild PA and walking (Table 2).\nFor both sexes, the risk of being obese was consistently lower with increasing frequency of housework/gardening, with 33% (26-39%) and 33% (21-43%) lower adjusted ORs in men and women, respectively, in those reporting these activities daily versus seldom or never (Table 3). The lower risk of obesity with increasing housework or gardening was independent of the level of exercise-related PA, in that the OR did not change materially (i.e. changed by <10%) following additional adjustment for exercise-related PA (see below) and a similar relationship was observed within separate categories of exercise-related PA (Figure 1). The inverse relationship between housework/gardening and obesity was still present following additional adjustment for screen-time and exercise-related PA. Compared to people who did housework or gardening seldom or never, the ORs (95% CI) for being obese in men were: 0.85 (0.76-0.94) for people who did housework or gardening 1-3 times per month; 0.79 (0.71-0.87) for 1-2 times per week; 0.80 (0.72-0.90) for 3-4 times per week; and 0.73 (0.66-0.80) for housework/gardening on most days, adjusting for age, income, education, screen-time and weighted weekly sessions of exercise-related PA. For women, the ORs for the same categories were: 0.95 (0.79-1.15); 0.76 (0.64-0.90); 0.75 (0.63-0.90); and 0.71 (0.60-0.84), respectively.\nRelationship between being obese and gardening/housework, leisure-related computer or television use (\"screen-time\") and sitting time\n*adjusted for age, income and education\nnumbers do not always sum to total due to missing values\nOdds ratios (OR) for being obese in relation to weighted weekly sessions of exercise-related physical activity (ERPA), hours of daily screen-time and frequency of housework/gardening.", "Increasing leisure-related screen-time was associated with significantly and substantially increasing risk of being obese in both men and women, with 85% and 116% increases in risk, respectively, for 8 or more hours of daily screen-time versus <2 hours (Table 3, p(trend) < 0.0001). Overall, sitting-time was not significantly related to the OR of being obese (p(trend) = 0.32), although a significant trend was observed in women (Table 3).\nThe positive relationship between screen-time and being obese was still present following additional adjustment for housework/gardening and exercise-related PA; the ORs (95% CI) for obesity in men were: 1.22 (1.14-1.30); 1.38 (1.27-1.50); 1.58 (1.36-1.83); and 1.80 (1.53-2.13) and for women were: 1.15 (1.05-1.27); 1.50 (1.35-1.67); 1.62 (1.36-1.92) and 2.13 (1.78-2.55), for people with: 2.0-2.9 hours; 3.0-3.9 hours; 4-7.9 hours; and ≥8 hours of daily screen-time versus 0-1.9 hours, respectively, adjusted for age, income, education, housework/gardening and exercise-related PA. Additional adjustment for consumption of fried foods, soft drink and junkfood and smoking and alcohol consumption did not materially alter the OR (data not shown).\nFigure 1 shows the cohort divided into four groups according to their level of exercise-related PA (ERPA in the figure). The ORs for being obese were then presented within each group according to the number of hours of total daily screen-time, with separate lines according to the frequency of housework/gardening. This figure shows increasing risk of being obese with increasing screen-time within each exercise-related PA group and within each housework/gardening group. It also shows that the finding of lower risks of being obese with increasing frequency of housework/gardening persists, even when screen-time and exercise-related PA were accounted for. When the relationships between being obese and exercise-related PA, screen-time and housework/gardening were modelled together, no significant interactions were observed (likelihood ratio χ392 = 38.54, p = 0.49), indicating that they were each independently associated with obesity.\nThe sex, income and education-adjusted OR of obesity per two-hour increase in daily screen-time is shown separately according to a variety of factors, including according to total exercise-related PA and according to housework and gardening, in Figure 2. There was an 18% (15-21%) increase in the risk of being obese with every two additional hours of daily screen-time overall and a significant elevation in the risk of being obese with increasing screen-time was seen in all of the population sub-groups examined (Figure 2). There was a significantly greater increase in the risk of being obese with increasing screen-time in unmarried compared to married individuals (p(heterogeneity) < 0.0001). The relationship between being obese and screen-time was attenuated significantly in older cohort members (p(heterogeneity) = 0.02) and in those with higher incomes (p(heterogeneity) = 0.02). No significant variation in the relationship between screen-time and being obese was seen according to the other factors examined, including: sex; urban/rural residence history; education; smoking status; alcohol, fruit, vegetable, junkfood and fried food intake; disability; level of exercise-related PA; and frequency of housework/gardening.\nOdds ratios (OR) for being obese per 2 hour increase in daily screen-time, in different population sub-groups, adjusted for age, sex, income and education, where appropriate.", "The risk of being obese was significantly higher in men and women from households with a refrigerator, microwave oven or washing machine and in men from households with a water heater (Table 4). The risk of being obese increased significantly with the increasing number of such appliances within a household. These results were not altered materially following additional adjustment for housework/gardening frequency, smoking, alcohol consumption and consumption of fried foods, Western-style junkfood, fruit and vegetables (data not shown).\nRelationship between being obese and ownership of household appliances\n*adjusted for age, income and education", "In this cohort of Thai men and women, the risk of being obese is consistently higher in those with greater time spent in leisure-related television watching and computer games and inversely associated with time spent doing housework or gardening. Inverse associations between obesity and total weekly sessions of exercise-related PA are observed in men with a significantly weaker association seen in women. Exercise-related PA, screen-time and housework/gardening each have independent associations with obesity. The magnitude of the association with obesity relating to these risk factors is substantial. Individuals reporting daily housework/gardening have a 33% lower risk of being obese compared to those reporting these activities seldom or never and there is an 18% increase in the risk of obesity with every two hours of additional daily screen-time.\nThe findings reported here show an inverse relationship between exercise-related PA and being obese that is stronger in men than in women and may be somewhat weaker than that observed in Western populations. The inverse relationship between obesity and exercise, usually leisure-related PA is well established in Western countries [5,6,21]. Although a reduced risk of obesity with increasing PA has been demonstrated in certain Asian populations, including those in China [23] and Korea [24], the specific relationship of leisure-related PA to obesity is less clear, and may be of lesser magnitude. The reason for this is not known. Potential explanations include: the lack of data relevant to Asia; the possibility that the proportion of total energy expenditure to leisure-related PA is lower in the Asian context [15]; differing types and intensities of leisure-related PA compared to the West; and differences in measurement error.\nWe were unable to locate any previous studies in adults of the relationship between being obese and television and computer use in Asia. Studies in Western populations consistently show increases in obesity with increasing time spent in sedentary activities, particularly screen-time [7,8,25-27]. The direct relationship between sedentary behaviours and obesity is observed in both cross-sectional [7,25,26] and prospective studies [8,15,28]. Studies have varied in the way they have measured and categorised screen-time and other sedentary behaviours, as well as obesity related outcomes, so it is difficult to summarise quantitatively the magnitude of the risk involved. However, the 18% increase in obesity risk per 2 hours of additional daily screen-time observed here is consistent with the 23% increase observed in US nurses [8] and older Australian adults [9].\nThe one previous publication we were able to locate examining the relationship between BMI and domestic activity in the Asian context demonstrated a significantly lower BMI in men with increasing time spent in domestic activities and a non-significant relationship in women, in China [29]. Studies in Western populations have generally not found a significant relationship between BMI and domestic activity [12,13,30], even heavy domestic activity, although one study in older US adults found house cleaning, but not gardening, to be associated with decreased BMI on multivariate analysis [14] and another found decreased all-cause mortality with increasing domestic PA [30]. The study presented here is the largest to date investigating the issue and shows a decreasing risk of being obese with increasing frequency of housework and gardening, independent of exercise-related PA and screen-time.\nAlthough the lack of a positive finding in the Western context may reflect measurement error, the play of chance, small sample sizes or other factors, it is also possible that domestic PA in Asian countries differs from that in Western countries, for example, due to use of labour saving devices or differing practices. Increasing use of labour saving devices is part of the transition accompanying industrialisation and is associated with reduced energy expenditure in domestic tasks [31]. Decreasing domestic physical activity over time has been noted in one Chinese study [29]. We found household ownership of domestic appliances to be significantly associated with increasing risk of being obese, with increasing risks of being obese accompanying increasing numbers of appliances within the household. However, the lack of specificity in the relationship of the different household appliances to obesity and the apparently greater effect in men compared to women suggests that this may well not be a causal relationship; it may instead reflect a broader difference in socioeconomic status and lifestyle between households with and without appliances.\nStrengths of the current study include its large size and inclusion of adults from a wide range of social and economic backgrounds. Although the cohort is somewhat younger and more urbanised than the Thai general population, it represents well the geographic regions of Thailand and exhibits substantial heterogeneity in the distribution of other factors [17]. For example, 35% of males and 47% of females had low incomes (<7000 Baht per month or $5.50 US per day). Participants in the Thai Cohort Study in 2005 were very similar to the STOU student body in that year for sex ratio, age distribution, geographic region of residence, income, education and course of study [32]. Much of the health-risk transition underway in middle income countries is mediated by education [33,34] and the cohort is, by definition, ahead of national education trends. It is therefore likely to provide useful early insights into the effects and mediators of the health-risk transition in middle-income countries. Previous relevant studies from the cohort include examination of the broader health-related correlates of obesity [22] and the relationship between gender, socioeconomic status and obesity [35].\nThe proportion of the cohort classified as overweight but not obese is similar to the 18% found in the third Thai National Health Examination Survey (2004), while obesity is much lower among STOU women (10% compared to 36% in the National Health Examination Survey) but similar among men in the two studies (23%) [2]. It should be noted that the Thai Cohort Study, like the vast majority of cohort studies, is not designed to be representative of the general population, but is meant to provide sufficient heterogeneity of exposure to allow reliable estimates of relative risk based on internal comparisons [36]. The \"healthy cohort effect\" and the 44% response rate for this study means that the estimates of relative risk shown here are likely to be conservative, since community members with more extreme behaviours and health conditions may be less likely to be attending an open university or to participate. However, it is important to note that ORs comparing groups within the cohort remain valid and can be generalised more broadly [36,37]. Furthermore, the major comparisons in this paper are between obese and non-obese individuals, rather than obese and \"healthy weight\" individuals, which is also likely to lead to more conservative estimates of association.\nThe limitations of the study should also be borne in mind. The measures used for tobacco smoking and alcohol consumption were brief and the physical activity measure used has, to our knowledge, only been validated in Western populations. BMI was based on self-reported height and weight, which have been shown to provide a valid measure of body size in this population, with correlation coefficients for BMI based on self-reported versus measured height and weight of 0.91 for men and 0.95 for women [38]. However, BMI based on self-reported measures was underestimated by an average of 0.77 kg/m2 for men and 0.62 kg/m2 for women [38]. Cut-points delineating overweight and obesity were set at BMIs ≥23 and ≥25; weight-related disease in Asian populations occurs least when BMI is about 22 or less [39], and significantly increases with BMI ≥23 [40]. The excellent correlation between measured and self-reported values mean that self-reported values are generally reliable for ranking participants according to BMI in epidemiological studies, as was done here. The general underestimation of BMI means that absolute values of BMI from self-reported measures are less reliable.\nSelf-reported leisure-related television and computer use has good test-retest reliability and validity, although respondents have a tendency to under-report the number of hours involved [41]. We were not able to locate any studies validating these measures in Asian populations. Time spent in habitual, incidental physical activity is difficult to measure [42] and domestic activities, screen-time and overall physical activity are all likely to be reported with differing degrees of measurement error. Although both domestic activities and screen-time remain predictive of obesity within categories of physical activity, it is possible that this is the result of greater measurement error in ascertaining overall physical activity than in ascertaining domestic and screen-related activities [25]. However, the lack of strong correlation between screen-time and overall physical activity (r = -0.016) goes against this argument, as does the previous observation that television viewing remains a significant predictor of obesity in women, following adjustment for pedometer measured physical activity [42].\nObesity and overweight are the result of sustained positive energy balance, whereby energy intake exceeds energy expenditure. Although dietary factors are important, there is mounting evidence that insufficient energy expenditure is likely to be a key factor underlying the global obesity epidemic [10]. The main determinant of individual energy expenditure is the basal metabolic rate, which typically accounts for 70% of all kilojoules burned [15]. A further 10% of energy expenditure comes from the thermic effect of food and the remaining 20% comes from PA [15]. PA is often conceptualised as comprised of purposeful and non-purposeful physical activity; the latter is also termed \"incidental\" PA. A recent study from the US found that over half of population-level energy expenditure from PA was from sedentary and low-intensity tasks, 16% was attributed to occupational activity above and beyond sitting at work, 16% was attributable to domestic activities and yard work of at least moderate intensity and less than 5% was attributable to leisure-time PA [43]. This evidence is consistent with the suggestion that differences in incidental physical activity are responsible for the greatest variations in energy expenditure between individuals and populations [10]. Moreover, recent evidence indicates that one of the most potent mechanisms determining cardiovascular risk factors, including obesity and metabolic disorders, is the amount of time spent in high volume daily intermittent low-intensity postural or ambulatory activities, which account for as much of 90% of energy expended in physical activity [11].\nSedentary behaviours generally involve sitting or lying down and are characterised by low energy expenditure (metabolic equivalent intensity <2) [41]. A substantial amount of time spent in sedentary activities is likely to contribute to obesity through reduced overall energy expenditure, mainly resulting from their impact on incidental physical activity, since it may co-exist with relatively high levels of exercise-related physical activity. Screen-time, particularly television watching, is also associated with other health behaviours, such as eating fatty foods. However, the finding of increased obesity among those watching greater amounts of television persisted in this dataset after adjustment for intake of fatty food and in other studies following adjustment for total energy intake [8] and foods eaten while watching television [27], so this is unlikely to explain much of its effects.\nIn lower- and middle-income countries, including Thailand, industrialisation is generally accompanied by increasing urbanisation, a more sedentary lifestyle, with increasing car and computer use and a higher fat diet dominated by more refined foods [16]. It is also characterised by a shift in work patterns for a substantial proportion of the population, from high energy expenditure activities such as farming, mining and forestry to less energy-demanding jobs in the service sector [16]. All of these changes are likely to increase population obesity. There are a number of specific barriers to increasing physical activity in many Asian countries, including environmental factors such as heat, inadequate urban infrastructure, pollution and other hazards. Furthermore, chronic malnutrition has been common in many Asian countries, leading to stunting in significant portions of the population and rendering them vulnerable to obesity as food availability improves.\nThe importance of obesity, the metabolic syndrome and diabetes in Thailand has been highlighted extensively [44-46]. In Thailand, and in many other countries, social factors are key upstream determinants of the major influences on obesity. For example, domestic duties are often divided along gender lines and many wealthier households have servants, particularly to do the heavier work. In this cohort, higher socioeconomic status was accompanied by increasing risk of being obese in men and decreasing risk of being obese in women [35]. This pattern is believed to represent an intermediate stage in the health-risk transition between less-developed countries such as China, which demonstrate high socioeconomic status to be associated with increased obesity in both men and women [47], and Western populations where high socioeconomic status is associated with reduced obesity in both men and women [2,35].\nThe study was able to investigate simultaneously a number of activity-related measures and the large numbers allowed quantification of the association of these factors with obesity within a range of population subgroups. However, the analyses presented here are cross-sectional so it is not possible to directly attribute causality to the relationships observed or to exclude reverse causality. Reverse causality occurs when an exposure varies because of the specific condition under investigation. In this case, reverse causality would mean that obesity might result in reduced exercise-related PA, increased sedentary behaviour and decreased domestic PA. There are a priori reasons why it is likely that certain elements of the PA-BMI relationship are causal i.e. that reduced energy expenditure due to reduced PA results in increased BMI. However, it is also possible that people with high BMI may change their level of PA. Intuitively, this might apply more to exercise-related PA than to screen-time or domestic activities; people with a high BMI may do more exercise-related PA in order to lose weight or may reduce their exercise-related PA, due to the extra exertion required because of their weight or obesity related health issues (e.g. joint problems). In Thai society, women in particular are under pressure to be thin and the increased walking among women of higher BMI may reflect this. Going against a large role for reverse causality is the fact that increasing inactivity has been shown to result in increased obesity in longitudinal data [8,48] and experimental studies show that increasing BMI by overfeeding of lean individuals does not result in increased sedentary behaviour [49]. This issue is not resolved entirely by using longitudinal data, since the major risk factor for incident obesity is having a high BMI at baseline [49]. We propose that the relationship between sedentary behaviour and obesity is likely to be complex, with a causal relationship between inactivity and obesity predominating. There is likely to be some contribution of obesity leading to inactivity [48], or indeed a \"spiral\" relationship, whereby inactivity leads to obesity, which further exacerbates inactivity, leading to further increases in obesity [50].", "In common with many middle to low income countries, the prevalence of overweight and obesity in Thailand is lower than that seen in many Western nations, but is increasing rapidly. Avoiding the transition to the obesity patterns seen in the West is a key priority. The data presented here suggest that habitual, high volume, low intensity PA is likely to be important for maintaining a healthy weight and are in keeping with other data that show that increasing exercise-related leisure-time PA alone is unlikely to be sufficient to prevent population obesity [15]. Leisure-related television and computer use were strongly related to the risk of being obese. Research focusing on habitual activities and sedentary behaviours is relatively new. Effective interventions to reduce sedentary time and increase incidental activity are being developed; innovative interventions applicable to the Asian context are needed urgently.", "Thai Cohort Study baseline questionnaire (English). An English language translation of a questionnaire administered to students of Sukhothai Thammathirat Open University in 2005.\nClick here for file\nThai Cohort Study baseline questionnaire (Thai). The Thai language original questionnaire administered to students of Sukhothai Thammathirat Open University in 2005.\nClick here for file" ]

[ null, "methods", null, null, null, null, null, null, null, null, null, null, "supplementary-material" ]

[ "Obesity", "Thailand", "physical activity", "inactivity", "domestic activity", "sedentary behaviours" ]

[ 282, 120, 979, 327, 40, 3740, 528, 732, 113, 2901, 159 ]

[ "time", "related", "pa", "screen", "exercise", "screen time", "obesity", "obese", "exercise related", "gardening" ]

[ "sedentary behaviours thailand", "obesity leisure related", "domestic activities obesity", "physical activity asian", "thailand prevalence obesity" ]

[ "Administration, Inhalation", "Bronchodilator Agents", "Dry Powder Inhalers", "Equipment Design", "Expert Testimony", "Humans", "Lung", "Metered Dose Inhalers", "Pulmonary Disease, Chronic Obstructive" ]

[ "Methods", "Experts’ Selection", "Systematic Literature Review", "Narrative Review", "Nominal Group Meeting", "Results", "Lung Deposition", "Inspiratory Flow Rate", "General Conclusions and Recommendations" ]

[ "This project consisted of an SLR, a narrative review, and an expert opinion based on a nominal group meeting. A nominal group meeting is a structured method for brainstorming that encourages contributions from everyone and facilitates quick agreement on the relative importance of issues, problems, or solutions.\nExperts’ Selection We first established a group of 10 pneumologists (two of us were project coordinators). We are all specialized in COPD with demonstrated clinical experience (a minimum of 8 years and ≥5 publications and members of the Sociedad Española de Neumología y Cirugía Torácica (SEPAR). Besides, we are located in different parts of Spain. Then, we defined the project’s objectives, established the protocol of the SLR, and decided that this would be complemented by a narrative review.\nWe first established a group of 10 pneumologists (two of us were project coordinators). We are all specialized in COPD with demonstrated clinical experience (a minimum of 8 years and ≥5 publications and members of the Sociedad Española de Neumología y Cirugía Torácica (SEPAR). Besides, we are located in different parts of Spain. Then, we defined the project’s objectives, established the protocol of the SLR, and decided that this would be complemented by a narrative review.\nSystematic Literature Review The SLR was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The objective of the SLR was to analyze lung deposition, inspiratory flow, and other characteristics of different inhaler devices (pMDIs, DPIs, and SMI) in both COPD patients and healthy subjects. Studies were identified using sensitive search strategies in the main medical databases. For this purpose, an expert librarian checked the search strategies (Tables 1–7 of the Supplementary material). Disease- and inhaler device-related terms were used as search keywords, which employed a controlled vocabulary, specific MeSH headings, and additional keywords. The following bibliographic databases were screened up to April 2019: Medline (PubMed) and Embase from 1961 to April 2019, and the Cochrane Library up to April 2019. Retrieved references were managed in Endnote X5 (Thomson Reuters). Finally, a manual search was performed by reviewing the references of the included studies and all the publications, as well as other information provided by the authors. Retrieved studies were included if they met the following pre-established criteria: Patients had to be diagnosed with COPD, aged 18 or older, and treated with an inhaler device, and studies had to include outcomes related to lung deposition and inspiratory flow, including the rate of lung deposition, the particles’ mass median aerodynamic diameter (MMAD) expressed as µm (micrometer), the aerosol exit velocity (AEV) in meter per second (m/s), the lung distribution pattern, the inspiratory flow rate expressed as liter per minute (L/min), or the device’s intrinsic resistance. Other variables, such as safety, were also considered. Only SLRs, meta-analyses, randomized controlled trials (RCTs), observational studies, and in vitro studies in English, French, or Spanish were included. Animal studies were excluded. The screening of studies, data collection (including the evidence tables), and analysis were independently performed by two reviewers. In the case of a discrepancy between the reviewers, a consensus was reached by including a third reviewer. The 2011 levels of evidence from the Oxford Center for Evidence-Based Medicine (OCEBM)18 were used to grade the quality of the studies.\nThe SLR was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The objective of the SLR was to analyze lung deposition, inspiratory flow, and other characteristics of different inhaler devices (pMDIs, DPIs, and SMI) in both COPD patients and healthy subjects. Studies were identified using sensitive search strategies in the main medical databases. For this purpose, an expert librarian checked the search strategies (Tables 1–7 of the Supplementary material). Disease- and inhaler device-related terms were used as search keywords, which employed a controlled vocabulary, specific MeSH headings, and additional keywords. The following bibliographic databases were screened up to April 2019: Medline (PubMed) and Embase from 1961 to April 2019, and the Cochrane Library up to April 2019. Retrieved references were managed in Endnote X5 (Thomson Reuters). Finally, a manual search was performed by reviewing the references of the included studies and all the publications, as well as other information provided by the authors. Retrieved studies were included if they met the following pre-established criteria: Patients had to be diagnosed with COPD, aged 18 or older, and treated with an inhaler device, and studies had to include outcomes related to lung deposition and inspiratory flow, including the rate of lung deposition, the particles’ mass median aerodynamic diameter (MMAD) expressed as µm (micrometer), the aerosol exit velocity (AEV) in meter per second (m/s), the lung distribution pattern, the inspiratory flow rate expressed as liter per minute (L/min), or the device’s intrinsic resistance. Other variables, such as safety, were also considered. Only SLRs, meta-analyses, randomized controlled trials (RCTs), observational studies, and in vitro studies in English, French, or Spanish were included. Animal studies were excluded. The screening of studies, data collection (including the evidence tables), and analysis were independently performed by two reviewers. In the case of a discrepancy between the reviewers, a consensus was reached by including a third reviewer. The 2011 levels of evidence from the Oxford Center for Evidence-Based Medicine (OCEBM)18 were used to grade the quality of the studies.\nNarrative Review To supplement the SLR, additional searches were performed specifically to explore the basis of lung deposition and inspiratory flow, including their determinants and the effect of COPD on these aspects. For this purpose, apart from the results of the SLR, we performed different searches in Medline using PubMed’s Clinical Queries tool and small search strategies using MeSH and text–word terms (Table 8 of the Supplementary material).\nTo supplement the SLR, additional searches were performed specifically to explore the basis of lung deposition and inspiratory flow, including their determinants and the effect of COPD on these aspects. For this purpose, apart from the results of the SLR, we performed different searches in Medline using PubMed’s Clinical Queries tool and small search strategies using MeSH and text–word terms (Table 8 of the Supplementary material).\nNominal Group Meeting The results of the SLR and narrative searches were presented and discussed in a guided nominal group meeting. In this meeting, we agreed on a series of general conclusions and clinical recommendations.\nThe results of the SLR and narrative searches were presented and discussed in a guided nominal group meeting. In this meeting, we agreed on a series of general conclusions and clinical recommendations.", "We first established a group of 10 pneumologists (two of us were project coordinators). We are all specialized in COPD with demonstrated clinical experience (a minimum of 8 years and ≥5 publications and members of the Sociedad Española de Neumología y Cirugía Torácica (SEPAR). Besides, we are located in different parts of Spain. Then, we defined the project’s objectives, established the protocol of the SLR, and decided that this would be complemented by a narrative review.", "The SLR was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The objective of the SLR was to analyze lung deposition, inspiratory flow, and other characteristics of different inhaler devices (pMDIs, DPIs, and SMI) in both COPD patients and healthy subjects. Studies were identified using sensitive search strategies in the main medical databases. For this purpose, an expert librarian checked the search strategies (Tables 1–7 of the Supplementary material). Disease- and inhaler device-related terms were used as search keywords, which employed a controlled vocabulary, specific MeSH headings, and additional keywords. The following bibliographic databases were screened up to April 2019: Medline (PubMed) and Embase from 1961 to April 2019, and the Cochrane Library up to April 2019. Retrieved references were managed in Endnote X5 (Thomson Reuters). Finally, a manual search was performed by reviewing the references of the included studies and all the publications, as well as other information provided by the authors. Retrieved studies were included if they met the following pre-established criteria: Patients had to be diagnosed with COPD, aged 18 or older, and treated with an inhaler device, and studies had to include outcomes related to lung deposition and inspiratory flow, including the rate of lung deposition, the particles’ mass median aerodynamic diameter (MMAD) expressed as µm (micrometer), the aerosol exit velocity (AEV) in meter per second (m/s), the lung distribution pattern, the inspiratory flow rate expressed as liter per minute (L/min), or the device’s intrinsic resistance. Other variables, such as safety, were also considered. Only SLRs, meta-analyses, randomized controlled trials (RCTs), observational studies, and in vitro studies in English, French, or Spanish were included. Animal studies were excluded. The screening of studies, data collection (including the evidence tables), and analysis were independently performed by two reviewers. In the case of a discrepancy between the reviewers, a consensus was reached by including a third reviewer. The 2011 levels of evidence from the Oxford Center for Evidence-Based Medicine (OCEBM)18 were used to grade the quality of the studies.", "To supplement the SLR, additional searches were performed specifically to explore the basis of lung deposition and inspiratory flow, including their determinants and the effect of COPD on these aspects. For this purpose, apart from the results of the SLR, we performed different searches in Medline using PubMed’s Clinical Queries tool and small search strategies using MeSH and text–word terms (Table 8 of the Supplementary material).", "The results of the SLR and narrative searches were presented and discussed in a guided nominal group meeting. In this meeting, we agreed on a series of general conclusions and clinical recommendations.", "The SLR retrieved 3064 articles, of which 979 were duplicates. A total of 120 articles were reviewed in detail, as well as a further 20 articles that were retrieved using the manual search. Eventually, 75 articles were excluded (Table 9 of the Supplementary material), most of them due to lack of relevant data, and 71 were included, 24 were in vitro studies. Some of the included articles were of low–moderate quality (due to the study design, and poor description of the methodology, especially for the articles published before the 1990s). We found great variability regarding study designs, populations, outcomes, and measures. There were 24 in vitro studies,16,17,19–40 and the rest of the articles comprised one SLR41 and several RCTs and cross-sectional studies. The studies analyzed more than 1600 COPD patients, most of whom were men, with age ranges from 27 to 89 years, and with forced expiratory volume in 1 second from 25% to 80%. Many of these studies assessed one type of inhalation device, but others compared pMDIs and DPIs,19,20,30,33,37,40–46 pMDIs and SMI,47–49 or DPIs and SMI.17,27,28 One study also evaluated the three inhalation devices.17 The narrative searches found almost 1000 articles.\nHere, we summarize the main results of the SLR and narrative review, according to the project’s objectives (lung deposition, inspiratory flow rate, and data regarding these aspects for different inhaler devices). We also present the general conclusions and recommendations. Tables 1–3 show the main characteristics of the inhalation devices.Table 1Main Characteristics of Pressurized Metered-Dose InhalersFormulationDrug Suspended or Dissolved in Propellant (With Surfactant and Cosolvent)Metering systemMetering valve and reservoirPropellantHFA or CFCDose counterSometimesPrimingVariable priming requirementsTemperature dependenceLowHumidity dependenceLowActuator orificeThe design and size of the actuator significantly influences the performance of pMDIsLung deposition8%-53%MMDA1.22 μm-8 μmAerosol exit velocityHigh (more than 3 m/s)Lung distributionCentral and peripheral regionsIntrinsic resistanceLowInspiratory flow rate~ 20 L/minAdvantagesCompact and portable, consistent dosing, and rapid deliveryDisadvantagesNot breath-actuated, require coordinationAbbreviations: pMDI, pressurized metered-dose inhaler; HFA, hydrofluoroalkane; CFC, chlorofluorocarbon; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nTable 2Main Characteristics of Dry Powder InhalersFormulationDrug/Lactose Blend, Drug Alone, Drug/Excipient ParticlesMetering systemCapsules, blisters, multi-dose blister packs, reservoirsPropellantNoDose counterYesPrimingVariable priming requirementsTemperature dependenceYesHumidity dependenceYesActuator orificeDoes not applyLung deposition~ 20%MMDA1.8 µm–4.8 µmAerosol exit velocityDepends on inspiratory flow rateLung distributionCentral and peripheral regionsIntrinsic resistanceLow/medium/highInspiratory flow rateMinimum of 30 L/min to > 100 L/minAdvantagesCompact and portable Some are multi-dose devices. Do not require coordination of inhalation with activation or hand strengthDisadvantagesRequire a minimum inspiratory flowPatients with cognitive or debilitating conditions might not generate sufficiently high inspiratory flowsMost are moisture-sensitiveAbbreviations: DPI, dry powder inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nTable 3Main Characteristics of the Soft Mist InhalerFormulationAqueous Solution or SuspensionMetering systemReservoirsPropellantNoDose counterYesPrimingActuate the inhaler toward the ground until an aerosol cloud is visible and then to repeat the process three more timesTemperature dependenceNoHumidity dependenceNoActuator orifice–Lung deposition39.2%–67%MMDA~ 3.7 μmAerosol exit velocity0.72–0.84 m/sLung distributionCentral and peripheral regionsIntrinsic resistanceLow/noneInspiratory flow rateIndependentAdvantagesPortable and compact. Multi-dose device. Reusable. Compared with dry powder inhalers, a considerably smaller dose of a combination bronchodilator results in the same level of efficacy and safetyDisadvantagesNeeds to be primed if not in use for over 21 daysAbbreviations: SMI, soft mist inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\n\nMain Characteristics of Pressurized Metered-Dose Inhalers\nAbbreviations: pMDI, pressurized metered-dose inhaler; HFA, hydrofluoroalkane; CFC, chlorofluorocarbon; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nMain Characteristics of Dry Powder Inhalers\nAbbreviations: DPI, dry powder inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nMain Characteristics of the Soft Mist Inhaler\nAbbreviations: SMI, soft mist inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nLung Deposition Different factors have been associated with lung deposition, some of which relate to the patient’s features (eg, airway geometry, inspiratory capacity, inhalation technique, breath–hold time, etc.) and to COPD (eg, exacerbations or hyperinflation).10–12,50–52 In fact, it has been shown during COPD exacerbations patients present decreased lung function and respiratory muscle strength that eventually influence on lung deposition.53 However, other factors are connected to the inhaler device (eg, the aerosol-generating system, speed of the aerosol plume, intrinsic resistance, inhaled carrier gas, oral/nasal inhalation, etc.), formulation (eg, the particle charge, lipophilicity, hygroscopicity, etc.), inhaled particle (eg, MMDA, its effect on lung distribution, etc.), and inhalation pattern (eg, the inspiration flow rate, volume, breath–hold time, etc.).52,54\nWith regards to the lung deposition (in relation to the emitted dose) across inhaler devices, data from in vitro and in vivo studies have estimated that 10%–20% of the delivered dose reaches the airways.54–56\nLung deposition rates (from individual studies) ranging from 8% to 53% have been reported for pMDIs.49,54,56–59 However, this rate increased to 11%–68% with the addition of a valved holding chamber or spacer31,35,46,59–63 and to 50%–60% with press-and-breathe actuators.64 More specifically, when Modulite® was used, lung deposition could reach up to 31%–34%.65,66 The K–haler® has a reported lung deposit of 39%.67 As exposed before, different factors might be contributing to these rate variability.\nThe studies included that analyzed DPIs have shown that the lung deposition rate is low, at around 20%,68 which is negatively influenced by a suboptimal inspiratory flow rate, humidity, and changes in temperature.69 Furthermore, clear differences in lung deposition were not observed when patients performed inhalation correctly.68 For the main DPI devices, the published lung deposition rates from individual studies (without direct comparisons) are as follows: Accuhaler® 7.6%,70 Aerolizer® 13%–20%,34,71 Breezhaler® 26.8%–39%,24,29 Easyhaler® 18.5%–31%,71,72 Genuair® 30.1%–51.1%,27,73,74 Handihaler® 9.8%–46.7%,19,24,71 Ingelheim inhaler® 16%–59%,75 NEXThaler® 39.4%–56%,11,76 Spinhaler® 11.5%,75 Turbuhaler® 14.2%–69.3%,21,42,77–79 and Twisthaler® 36%–37%.80 Similarly to all inhaler devices, other factors are probably influencing the lung deposition rate.81 Although some studies have compared lung deposition in pMDIs and DPIs, their results are contradictory.19,33\nRespimat® (SMI) has largely exhibited high lung deposition rates that range from 39.2% to 67%,27,38,48,49,74,82–84 with different inspiratory flow rates (high and low) and irrespective of humidity.85 Compared with other devices, SMI showed higher lung deposition than pMDIs (including those with a chamber or spacer) or DPIs.27,48,74,83,86\nWe also evaluated the AEV. Inhalation devices with a high AEV might have a short spray duration and vice versa. With pMDIs, the aerosol exits through a nozzle at a very high rate of more than 3 m/s.87 However, the AEV of the SMI is much slower, at 0.84–0.72 m/s, and the aerosol cloud lasts longer.88–90\nIt has also been observed that the distribution of the deposition sites of inhaled particles is strongly dependent on their aerodynamic diameters.69 This SLR found that pMDIs generally produce at least medium-sized particles, with a significant rate of extrafine particles. The observed MMAD of conventional pMDIs varies from 1.22 to 8 μm,35,91,92 from 1.19 to 3.57 μm when a valved holding chamber or spacer is used,31,35,93 and from 0.72 to 2.0 μm with Modulite®.65,66 Regarding particle size data for DPIs, depending on the device and drug, MMDAs vary from 1.40 to 4.8 µm.11,19,21,24,27–29,36,37,74,76 Conversely, SMI generates a cloud that contains an aerosol with a fine particle fraction of around 3.7 μm.74 It is estimated that 60% of the particles reach a MMAD <5 μm with SMI.85 The reported rate with pMDIs and DPIs (indirect comparison) is not that high.27,28,74,94\nAnother relevant outcome when using inhalation devices is the lung distribution pattern (through the central and peripheral regions). All inhalation devices have been shown to reach both central and peripheral areas. SMI data suggest that lung distribution pattern might be better than pMDIs, with a higher distribution in bronchial trees and peripheral regions.11,28,49,60,65,66,73,74,82,95,96 More specifically, a comparative study found mean peripheral, intermediate and central lung deposition, and peripheral zone/central zone ratio of 5.0%–9.4%, 4.8%–11.3%, 4.5%–10.4%, 1.01–1.16 with Respimat® vs 3.8%, 4.9%, 5.6%, 1.36 with pMDIs, respectively.49 Comparative data between pMDIs and DPIs are conflicting.33,46\nDifferent factors have been associated with lung deposition, some of which relate to the patient’s features (eg, airway geometry, inspiratory capacity, inhalation technique, breath–hold time, etc.) and to COPD (eg, exacerbations or hyperinflation).10–12,50–52 In fact, it has been shown during COPD exacerbations patients present decreased lung function and respiratory muscle strength that eventually influence on lung deposition.53 However, other factors are connected to the inhaler device (eg, the aerosol-generating system, speed of the aerosol plume, intrinsic resistance, inhaled carrier gas, oral/nasal inhalation, etc.), formulation (eg, the particle charge, lipophilicity, hygroscopicity, etc.), inhaled particle (eg, MMDA, its effect on lung distribution, etc.), and inhalation pattern (eg, the inspiration flow rate, volume, breath–hold time, etc.).52,54\nWith regards to the lung deposition (in relation to the emitted dose) across inhaler devices, data from in vitro and in vivo studies have estimated that 10%–20% of the delivered dose reaches the airways.54–56\nLung deposition rates (from individual studies) ranging from 8% to 53% have been reported for pMDIs.49,54,56–59 However, this rate increased to 11%–68% with the addition of a valved holding chamber or spacer31,35,46,59–63 and to 50%–60% with press-and-breathe actuators.64 More specifically, when Modulite® was used, lung deposition could reach up to 31%–34%.65,66 The K–haler® has a reported lung deposit of 39%.67 As exposed before, different factors might be contributing to these rate variability.\nThe studies included that analyzed DPIs have shown that the lung deposition rate is low, at around 20%,68 which is negatively influenced by a suboptimal inspiratory flow rate, humidity, and changes in temperature.69 Furthermore, clear differences in lung deposition were not observed when patients performed inhalation correctly.68 For the main DPI devices, the published lung deposition rates from individual studies (without direct comparisons) are as follows: Accuhaler® 7.6%,70 Aerolizer® 13%–20%,34,71 Breezhaler® 26.8%–39%,24,29 Easyhaler® 18.5%–31%,71,72 Genuair® 30.1%–51.1%,27,73,74 Handihaler® 9.8%–46.7%,19,24,71 Ingelheim inhaler® 16%–59%,75 NEXThaler® 39.4%–56%,11,76 Spinhaler® 11.5%,75 Turbuhaler® 14.2%–69.3%,21,42,77–79 and Twisthaler® 36%–37%.80 Similarly to all inhaler devices, other factors are probably influencing the lung deposition rate.81 Although some studies have compared lung deposition in pMDIs and DPIs, their results are contradictory.19,33\nRespimat® (SMI) has largely exhibited high lung deposition rates that range from 39.2% to 67%,27,38,48,49,74,82–84 with different inspiratory flow rates (high and low) and irrespective of humidity.85 Compared with other devices, SMI showed higher lung deposition than pMDIs (including those with a chamber or spacer) or DPIs.27,48,74,83,86\nWe also evaluated the AEV. Inhalation devices with a high AEV might have a short spray duration and vice versa. With pMDIs, the aerosol exits through a nozzle at a very high rate of more than 3 m/s.87 However, the AEV of the SMI is much slower, at 0.84–0.72 m/s, and the aerosol cloud lasts longer.88–90\nIt has also been observed that the distribution of the deposition sites of inhaled particles is strongly dependent on their aerodynamic diameters.69 This SLR found that pMDIs generally produce at least medium-sized particles, with a significant rate of extrafine particles. The observed MMAD of conventional pMDIs varies from 1.22 to 8 μm,35,91,92 from 1.19 to 3.57 μm when a valved holding chamber or spacer is used,31,35,93 and from 0.72 to 2.0 μm with Modulite®.65,66 Regarding particle size data for DPIs, depending on the device and drug, MMDAs vary from 1.40 to 4.8 µm.11,19,21,24,27–29,36,37,74,76 Conversely, SMI generates a cloud that contains an aerosol with a fine particle fraction of around 3.7 μm.74 It is estimated that 60% of the particles reach a MMAD <5 μm with SMI.85 The reported rate with pMDIs and DPIs (indirect comparison) is not that high.27,28,74,94\nAnother relevant outcome when using inhalation devices is the lung distribution pattern (through the central and peripheral regions). All inhalation devices have been shown to reach both central and peripheral areas. SMI data suggest that lung distribution pattern might be better than pMDIs, with a higher distribution in bronchial trees and peripheral regions.11,28,49,60,65,66,73,74,82,95,96 More specifically, a comparative study found mean peripheral, intermediate and central lung deposition, and peripheral zone/central zone ratio of 5.0%–9.4%, 4.8%–11.3%, 4.5%–10.4%, 1.01–1.16 with Respimat® vs 3.8%, 4.9%, 5.6%, 1.36 with pMDIs, respectively.49 Comparative data between pMDIs and DPIs are conflicting.33,46\nInspiratory Flow Rate The other main focus of this project was the inspiratory flow rate. First, it is important to consider the factors associated with inspiratory flow rate (Table 4). Similar to lung deposition, some of these factors relate to the patient’s and COPD’s characteristics, while other factors relate to the inhaler device, such as the intrinsic resistance.6,10,13–17,43,45,97,98Table 4Main Factors Associated to Inspiratory Flow RatePatient-related Inspiratory capacity Inspiratory effort Comorbidities Inhalation techniqueCOPD-related Severity Hyperinflation Exacerbations Respiratory muscle alterationsInhalation device-related Internal resistance Disaggregation of the powdered drug dose (DPIs)Abbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\n\nMain Factors Associated to Inspiratory Flow Rate\nAbbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\nOverall, two main driving forces can affect the performance of DPIs: the inspiratory flow generated by the patient and the turbulence produced inside the device, the latter of which solely depends on the original technical characteristics of the device, including the intrinsic resistance. These two parameters affect the disaggregation of the drug dose, the diameter of the particles to inhale, the lung distribution of the dose, and eventually, the efficacy of the delivered drug. Essentially, a higher intrinsic resistance results in the patient needing to generate a higher inspiratory flow.\nIn general, although variable, DPIs’ intrinsic resistance is higher than that of pMDIs or SMI, which are relatively similar and low. Therefore, pMDIs and SMI do not require the patient to generate a high inspiratory flow (and inspiratory effort).\nAccording to the results of the SLR, pMDIs require low inspiratory flow rates of around 20 L/min (59, 70, 132) to achieve an adequate lung deposition.10,17,43,45,57,82,99–101 There were no major differences between the use of one propellant and another.57 In order to generate the correct inspiratory airflow and lung deposition with this type of inhalation device, it is recommended the patients start breathing from their functional residual capacity, then they should activate the inhalation device and start inhalation using an inspiratory flow rate that is below 60 L/min. Then, at the end of inspiration, patients should hold their breath for around 10 seconds.100 Consequently, patients need a correct inhalation technique and coordination. The K-haler® is triggered by an inspiratory flow rate of approximately 30 L/min.67\nInhaler devices are many times classified as low- (30 L/min or below), medium– (~30–60 L/min), and high-resistance (>60 L/min) devices.10,17 DPIs with low intrinsic resistance include Aerolizer®, Spinhaler®, and Breezhaler®; DPIs with medium resistance include Accuhaler®/Diskhaler®, Genuair®/Novolizer®, and NEXThaler®; DPIs with medium/high resistance include Turbuhaler®; and DPIs with high resistance include Easyhaler®, Handihaler®, and Twisthaler®. The estimated inspiratory flow rates required thus vary across devices, from a minimum of 30 L/min to more than 100 L/min.6,26,32,43,45,101–108\nBased on the information presented above, when using a high-resistance DPI, the disaggregation and micro-dispersion of the powdered drug are relatively independent of the patient’s inspiratory effort because the driving force depends on the intrinsic resistance of the DPI itself, which is able to produce the turbulence required for effective drug micro-dispersion. However, when a low-resistance device is used, the only force that can generate turbulence is the patient’s inspiratory airflow, which should be high.\nFinally, the studies showed that the SMI inhalation device uses mechanical energy (from a spring) to generate a fine, slow–moving mist from an aqueous solution, which is independent of the patient’s inspiratory effort. Therefore, the required inspiratory flow rate and/or effort are less relevant than with DPIs.83,88,89,109 Moreover, the inhalation maneuver with SMI is more similar to physiological inhalation. One study observed that drug delivery to the lungs with SMI was more efficient than with pMDIs, even with poor inhalation technique.82\nThe other main focus of this project was the inspiratory flow rate. First, it is important to consider the factors associated with inspiratory flow rate (Table 4). Similar to lung deposition, some of these factors relate to the patient’s and COPD’s characteristics, while other factors relate to the inhaler device, such as the intrinsic resistance.6,10,13–17,43,45,97,98Table 4Main Factors Associated to Inspiratory Flow RatePatient-related Inspiratory capacity Inspiratory effort Comorbidities Inhalation techniqueCOPD-related Severity Hyperinflation Exacerbations Respiratory muscle alterationsInhalation device-related Internal resistance Disaggregation of the powdered drug dose (DPIs)Abbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\n\nMain Factors Associated to Inspiratory Flow Rate\nAbbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\nOverall, two main driving forces can affect the performance of DPIs: the inspiratory flow generated by the patient and the turbulence produced inside the device, the latter of which solely depends on the original technical characteristics of the device, including the intrinsic resistance. These two parameters affect the disaggregation of the drug dose, the diameter of the particles to inhale, the lung distribution of the dose, and eventually, the efficacy of the delivered drug. Essentially, a higher intrinsic resistance results in the patient needing to generate a higher inspiratory flow.\nIn general, although variable, DPIs’ intrinsic resistance is higher than that of pMDIs or SMI, which are relatively similar and low. Therefore, pMDIs and SMI do not require the patient to generate a high inspiratory flow (and inspiratory effort).\nAccording to the results of the SLR, pMDIs require low inspiratory flow rates of around 20 L/min (59, 70, 132) to achieve an adequate lung deposition.10,17,43,45,57,82,99–101 There were no major differences between the use of one propellant and another.57 In order to generate the correct inspiratory airflow and lung deposition with this type of inhalation device, it is recommended the patients start breathing from their functional residual capacity, then they should activate the inhalation device and start inhalation using an inspiratory flow rate that is below 60 L/min. Then, at the end of inspiration, patients should hold their breath for around 10 seconds.100 Consequently, patients need a correct inhalation technique and coordination. The K-haler® is triggered by an inspiratory flow rate of approximately 30 L/min.67\nInhaler devices are many times classified as low- (30 L/min or below), medium– (~30–60 L/min), and high-resistance (>60 L/min) devices.10,17 DPIs with low intrinsic resistance include Aerolizer®, Spinhaler®, and Breezhaler®; DPIs with medium resistance include Accuhaler®/Diskhaler®, Genuair®/Novolizer®, and NEXThaler®; DPIs with medium/high resistance include Turbuhaler®; and DPIs with high resistance include Easyhaler®, Handihaler®, and Twisthaler®. The estimated inspiratory flow rates required thus vary across devices, from a minimum of 30 L/min to more than 100 L/min.6,26,32,43,45,101–108\nBased on the information presented above, when using a high-resistance DPI, the disaggregation and micro-dispersion of the powdered drug are relatively independent of the patient’s inspiratory effort because the driving force depends on the intrinsic resistance of the DPI itself, which is able to produce the turbulence required for effective drug micro-dispersion. However, when a low-resistance device is used, the only force that can generate turbulence is the patient’s inspiratory airflow, which should be high.\nFinally, the studies showed that the SMI inhalation device uses mechanical energy (from a spring) to generate a fine, slow–moving mist from an aqueous solution, which is independent of the patient’s inspiratory effort. Therefore, the required inspiratory flow rate and/or effort are less relevant than with DPIs.83,88,89,109 Moreover, the inhalation maneuver with SMI is more similar to physiological inhalation. One study observed that drug delivery to the lungs with SMI was more efficient than with pMDIs, even with poor inhalation technique.82\nGeneral Conclusions and Recommendations The experts discussed the results of the reviews, and, based on the evidence, they formulated a series of general conclusions and recommendations that are outlined in Tables 5 and 6. In summary, health professionals involved in the management of COPD patients should be aware of all factors involved in adequate drug distribution when using inhalation devices. Two main objective factors emerged at this point: lung deposition and the required inspiratory flow rate. Both of these factors are highly influenced by patient, COPD, and inhaler device characteristics. Moreover, COPD is a heterogeneous and dynamic chronic disease, in which lung deposition and inspiratory flow rates vary across patients and also within the same patient.Table 5General Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease#Conclusion1The lung deposition profile and required inspiratory flow rate are key factors to be considered when selecting an inhalation device2COPD is a progressive disease with specific pathophysiological features that impact patients’ lung deposition and inspiratory flow rate3In COPD patients, obstruction severity and especially hyperinflation are decisive pathophysiological factors4During the course of COPD, some situations, notably exacerbations, impact the inspiratory flow rate5An homogeneous drug distribution through the airways is essential, not only because of the COPD pathophysiology but also because of the different distribution of cholinergic and β2 receptors6COPD treatment requires inhalation devices capable of delivering particles with a MMAD comprised between 0.5 and 5 µm to achieve high lung deposition7The patients’ ability to perform a correct inhalation maneuver (inspiratory effort, coordination, etc.) is decisive to achieve an adequate inspiratory flow rate and lung deposition8Inhalation maneuvers that are similar to physiological/standard inspiratory flow are more likely associated with reduced oropharyngeal deposition and therefore increased lung deposition9Inhalation devices present different characteristics that define the required inspiratory flow rate and influence lung deposition10The inspiratory flow rate required for drug dispersion with a given DPI is inversely proportional to the intrinsic resistance of the DPI11The faster the exit speed of the drug delivered from the device (initial acceleration of the inhalation maneuver by the patient or directly by the device), the greater the risk of oropharyngeal deposition and the lesser the lung deposition12The SMI requires a low inspiratory flow rate. Therefore, compared with other inhaler devices, when performing a correct maneuver, oropharyngeal deposition is lower and lung deposition is higherAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nTable 6Experts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease#It is Strongly Recommended to …1Consider COPD pathophysiological aspects as well as patients’ clinical status and disease severity/evolution when selecting an inhalation device2Take into account the specific characteristics of each inhalation device3Assess patients’ ability to perform a correct inhalation maneuver and the specific requirements for each inhalation device4Evaluate patients’ inspiratory flow rate or inspiratory capacity before selecting an inhalation device5Take into account patients’ history of exacerbations or other events that may affect their ability to perform adequate inhalation6Regularly review patients’ inhalation maneuver and check whether the inhalation device meets their needs7Use an active inhalation device, such as pMDI or SMI, in patients with reduced inspiratory capacity8Consider using a valved holding chamber with SMI or pMDI devices in fragile patients with inspiratory and/or coordination difficulties9Use inhalation devices that generate a low oropharyngeal and high lung deposition10Check patients’ inhalation maneuver during every visit and, where necessary, resolve errors or even change the inhalerAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\n\nGeneral Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nExperts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\nThus, it is strongly recommended that, in addition to the standard variables for COPD, inspiratory flow rate and the patient’s inspiratory capacity are evaluated (on a regular basis), and the selection of an inhaler device should be based on the COPD patient’s features, needs, and clinical situation. This selection should consider the different characteristics of the devices to ensure physicians choose the device that best matches that patient’s needs.\nFinally, we considered it important to systematically review the patient’s inhalation maneuver,110 see Tables 3 and 6. This should be checked during every visit, so that errors can be resolved, and inhalers can be checked and even changed, where necessary. The same way, before considering a change in the patient’s treatment, possible errors with the inhalation maneuver should be evaluated.\nThe experts discussed the results of the reviews, and, based on the evidence, they formulated a series of general conclusions and recommendations that are outlined in Tables 5 and 6. In summary, health professionals involved in the management of COPD patients should be aware of all factors involved in adequate drug distribution when using inhalation devices. Two main objective factors emerged at this point: lung deposition and the required inspiratory flow rate. Both of these factors are highly influenced by patient, COPD, and inhaler device characteristics. Moreover, COPD is a heterogeneous and dynamic chronic disease, in which lung deposition and inspiratory flow rates vary across patients and also within the same patient.Table 5General Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease#Conclusion1The lung deposition profile and required inspiratory flow rate are key factors to be considered when selecting an inhalation device2COPD is a progressive disease with specific pathophysiological features that impact patients’ lung deposition and inspiratory flow rate3In COPD patients, obstruction severity and especially hyperinflation are decisive pathophysiological factors4During the course of COPD, some situations, notably exacerbations, impact the inspiratory flow rate5An homogeneous drug distribution through the airways is essential, not only because of the COPD pathophysiology but also because of the different distribution of cholinergic and β2 receptors6COPD treatment requires inhalation devices capable of delivering particles with a MMAD comprised between 0.5 and 5 µm to achieve high lung deposition7The patients’ ability to perform a correct inhalation maneuver (inspiratory effort, coordination, etc.) is decisive to achieve an adequate inspiratory flow rate and lung deposition8Inhalation maneuvers that are similar to physiological/standard inspiratory flow are more likely associated with reduced oropharyngeal deposition and therefore increased lung deposition9Inhalation devices present different characteristics that define the required inspiratory flow rate and influence lung deposition10The inspiratory flow rate required for drug dispersion with a given DPI is inversely proportional to the intrinsic resistance of the DPI11The faster the exit speed of the drug delivered from the device (initial acceleration of the inhalation maneuver by the patient or directly by the device), the greater the risk of oropharyngeal deposition and the lesser the lung deposition12The SMI requires a low inspiratory flow rate. Therefore, compared with other inhaler devices, when performing a correct maneuver, oropharyngeal deposition is lower and lung deposition is higherAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nTable 6Experts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease#It is Strongly Recommended to …1Consider COPD pathophysiological aspects as well as patients’ clinical status and disease severity/evolution when selecting an inhalation device2Take into account the specific characteristics of each inhalation device3Assess patients’ ability to perform a correct inhalation maneuver and the specific requirements for each inhalation device4Evaluate patients’ inspiratory flow rate or inspiratory capacity before selecting an inhalation device5Take into account patients’ history of exacerbations or other events that may affect their ability to perform adequate inhalation6Regularly review patients’ inhalation maneuver and check whether the inhalation device meets their needs7Use an active inhalation device, such as pMDI or SMI, in patients with reduced inspiratory capacity8Consider using a valved holding chamber with SMI or pMDI devices in fragile patients with inspiratory and/or coordination difficulties9Use inhalation devices that generate a low oropharyngeal and high lung deposition10Check patients’ inhalation maneuver during every visit and, where necessary, resolve errors or even change the inhalerAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\n\nGeneral Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nExperts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\nThus, it is strongly recommended that, in addition to the standard variables for COPD, inspiratory flow rate and the patient’s inspiratory capacity are evaluated (on a regular basis), and the selection of an inhaler device should be based on the COPD patient’s features, needs, and clinical situation. This selection should consider the different characteristics of the devices to ensure physicians choose the device that best matches that patient’s needs.\nFinally, we considered it important to systematically review the patient’s inhalation maneuver,110 see Tables 3 and 6. This should be checked during every visit, so that errors can be resolved, and inhalers can be checked and even changed, where necessary. The same way, before considering a change in the patient’s treatment, possible errors with the inhalation maneuver should be evaluated.", "Different factors have been associated with lung deposition, some of which relate to the patient’s features (eg, airway geometry, inspiratory capacity, inhalation technique, breath–hold time, etc.) and to COPD (eg, exacerbations or hyperinflation).10–12,50–52 In fact, it has been shown during COPD exacerbations patients present decreased lung function and respiratory muscle strength that eventually influence on lung deposition.53 However, other factors are connected to the inhaler device (eg, the aerosol-generating system, speed of the aerosol plume, intrinsic resistance, inhaled carrier gas, oral/nasal inhalation, etc.), formulation (eg, the particle charge, lipophilicity, hygroscopicity, etc.), inhaled particle (eg, MMDA, its effect on lung distribution, etc.), and inhalation pattern (eg, the inspiration flow rate, volume, breath–hold time, etc.).52,54\nWith regards to the lung deposition (in relation to the emitted dose) across inhaler devices, data from in vitro and in vivo studies have estimated that 10%–20% of the delivered dose reaches the airways.54–56\nLung deposition rates (from individual studies) ranging from 8% to 53% have been reported for pMDIs.49,54,56–59 However, this rate increased to 11%–68% with the addition of a valved holding chamber or spacer31,35,46,59–63 and to 50%–60% with press-and-breathe actuators.64 More specifically, when Modulite® was used, lung deposition could reach up to 31%–34%.65,66 The K–haler® has a reported lung deposit of 39%.67 As exposed before, different factors might be contributing to these rate variability.\nThe studies included that analyzed DPIs have shown that the lung deposition rate is low, at around 20%,68 which is negatively influenced by a suboptimal inspiratory flow rate, humidity, and changes in temperature.69 Furthermore, clear differences in lung deposition were not observed when patients performed inhalation correctly.68 For the main DPI devices, the published lung deposition rates from individual studies (without direct comparisons) are as follows: Accuhaler® 7.6%,70 Aerolizer® 13%–20%,34,71 Breezhaler® 26.8%–39%,24,29 Easyhaler® 18.5%–31%,71,72 Genuair® 30.1%–51.1%,27,73,74 Handihaler® 9.8%–46.7%,19,24,71 Ingelheim inhaler® 16%–59%,75 NEXThaler® 39.4%–56%,11,76 Spinhaler® 11.5%,75 Turbuhaler® 14.2%–69.3%,21,42,77–79 and Twisthaler® 36%–37%.80 Similarly to all inhaler devices, other factors are probably influencing the lung deposition rate.81 Although some studies have compared lung deposition in pMDIs and DPIs, their results are contradictory.19,33\nRespimat® (SMI) has largely exhibited high lung deposition rates that range from 39.2% to 67%,27,38,48,49,74,82–84 with different inspiratory flow rates (high and low) and irrespective of humidity.85 Compared with other devices, SMI showed higher lung deposition than pMDIs (including those with a chamber or spacer) or DPIs.27,48,74,83,86\nWe also evaluated the AEV. Inhalation devices with a high AEV might have a short spray duration and vice versa. With pMDIs, the aerosol exits through a nozzle at a very high rate of more than 3 m/s.87 However, the AEV of the SMI is much slower, at 0.84–0.72 m/s, and the aerosol cloud lasts longer.88–90\nIt has also been observed that the distribution of the deposition sites of inhaled particles is strongly dependent on their aerodynamic diameters.69 This SLR found that pMDIs generally produce at least medium-sized particles, with a significant rate of extrafine particles. The observed MMAD of conventional pMDIs varies from 1.22 to 8 μm,35,91,92 from 1.19 to 3.57 μm when a valved holding chamber or spacer is used,31,35,93 and from 0.72 to 2.0 μm with Modulite®.65,66 Regarding particle size data for DPIs, depending on the device and drug, MMDAs vary from 1.40 to 4.8 µm.11,19,21,24,27–29,36,37,74,76 Conversely, SMI generates a cloud that contains an aerosol with a fine particle fraction of around 3.7 μm.74 It is estimated that 60% of the particles reach a MMAD <5 μm with SMI.85 The reported rate with pMDIs and DPIs (indirect comparison) is not that high.27,28,74,94\nAnother relevant outcome when using inhalation devices is the lung distribution pattern (through the central and peripheral regions). All inhalation devices have been shown to reach both central and peripheral areas. SMI data suggest that lung distribution pattern might be better than pMDIs, with a higher distribution in bronchial trees and peripheral regions.11,28,49,60,65,66,73,74,82,95,96 More specifically, a comparative study found mean peripheral, intermediate and central lung deposition, and peripheral zone/central zone ratio of 5.0%–9.4%, 4.8%–11.3%, 4.5%–10.4%, 1.01–1.16 with Respimat® vs 3.8%, 4.9%, 5.6%, 1.36 with pMDIs, respectively.49 Comparative data between pMDIs and DPIs are conflicting.33,46", "The other main focus of this project was the inspiratory flow rate. First, it is important to consider the factors associated with inspiratory flow rate (Table 4). Similar to lung deposition, some of these factors relate to the patient’s and COPD’s characteristics, while other factors relate to the inhaler device, such as the intrinsic resistance.6,10,13–17,43,45,97,98Table 4Main Factors Associated to Inspiratory Flow RatePatient-related Inspiratory capacity Inspiratory effort Comorbidities Inhalation techniqueCOPD-related Severity Hyperinflation Exacerbations Respiratory muscle alterationsInhalation device-related Internal resistance Disaggregation of the powdered drug dose (DPIs)Abbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\n\nMain Factors Associated to Inspiratory Flow Rate\nAbbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\nOverall, two main driving forces can affect the performance of DPIs: the inspiratory flow generated by the patient and the turbulence produced inside the device, the latter of which solely depends on the original technical characteristics of the device, including the intrinsic resistance. These two parameters affect the disaggregation of the drug dose, the diameter of the particles to inhale, the lung distribution of the dose, and eventually, the efficacy of the delivered drug. Essentially, a higher intrinsic resistance results in the patient needing to generate a higher inspiratory flow.\nIn general, although variable, DPIs’ intrinsic resistance is higher than that of pMDIs or SMI, which are relatively similar and low. Therefore, pMDIs and SMI do not require the patient to generate a high inspiratory flow (and inspiratory effort).\nAccording to the results of the SLR, pMDIs require low inspiratory flow rates of around 20 L/min (59, 70, 132) to achieve an adequate lung deposition.10,17,43,45,57,82,99–101 There were no major differences between the use of one propellant and another.57 In order to generate the correct inspiratory airflow and lung deposition with this type of inhalation device, it is recommended the patients start breathing from their functional residual capacity, then they should activate the inhalation device and start inhalation using an inspiratory flow rate that is below 60 L/min. Then, at the end of inspiration, patients should hold their breath for around 10 seconds.100 Consequently, patients need a correct inhalation technique and coordination. The K-haler® is triggered by an inspiratory flow rate of approximately 30 L/min.67\nInhaler devices are many times classified as low- (30 L/min or below), medium– (~30–60 L/min), and high-resistance (>60 L/min) devices.10,17 DPIs with low intrinsic resistance include Aerolizer®, Spinhaler®, and Breezhaler®; DPIs with medium resistance include Accuhaler®/Diskhaler®, Genuair®/Novolizer®, and NEXThaler®; DPIs with medium/high resistance include Turbuhaler®; and DPIs with high resistance include Easyhaler®, Handihaler®, and Twisthaler®. The estimated inspiratory flow rates required thus vary across devices, from a minimum of 30 L/min to more than 100 L/min.6,26,32,43,45,101–108\nBased on the information presented above, when using a high-resistance DPI, the disaggregation and micro-dispersion of the powdered drug are relatively independent of the patient’s inspiratory effort because the driving force depends on the intrinsic resistance of the DPI itself, which is able to produce the turbulence required for effective drug micro-dispersion. However, when a low-resistance device is used, the only force that can generate turbulence is the patient’s inspiratory airflow, which should be high.\nFinally, the studies showed that the SMI inhalation device uses mechanical energy (from a spring) to generate a fine, slow–moving mist from an aqueous solution, which is independent of the patient’s inspiratory effort. Therefore, the required inspiratory flow rate and/or effort are less relevant than with DPIs.83,88,89,109 Moreover, the inhalation maneuver with SMI is more similar to physiological inhalation. One study observed that drug delivery to the lungs with SMI was more efficient than with pMDIs, even with poor inhalation technique.82", "The experts discussed the results of the reviews, and, based on the evidence, they formulated a series of general conclusions and recommendations that are outlined in Tables 5 and 6. In summary, health professionals involved in the management of COPD patients should be aware of all factors involved in adequate drug distribution when using inhalation devices. Two main objective factors emerged at this point: lung deposition and the required inspiratory flow rate. Both of these factors are highly influenced by patient, COPD, and inhaler device characteristics. Moreover, COPD is a heterogeneous and dynamic chronic disease, in which lung deposition and inspiratory flow rates vary across patients and also within the same patient.Table 5General Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease#Conclusion1The lung deposition profile and required inspiratory flow rate are key factors to be considered when selecting an inhalation device2COPD is a progressive disease with specific pathophysiological features that impact patients’ lung deposition and inspiratory flow rate3In COPD patients, obstruction severity and especially hyperinflation are decisive pathophysiological factors4During the course of COPD, some situations, notably exacerbations, impact the inspiratory flow rate5An homogeneous drug distribution through the airways is essential, not only because of the COPD pathophysiology but also because of the different distribution of cholinergic and β2 receptors6COPD treatment requires inhalation devices capable of delivering particles with a MMAD comprised between 0.5 and 5 µm to achieve high lung deposition7The patients’ ability to perform a correct inhalation maneuver (inspiratory effort, coordination, etc.) is decisive to achieve an adequate inspiratory flow rate and lung deposition8Inhalation maneuvers that are similar to physiological/standard inspiratory flow are more likely associated with reduced oropharyngeal deposition and therefore increased lung deposition9Inhalation devices present different characteristics that define the required inspiratory flow rate and influence lung deposition10The inspiratory flow rate required for drug dispersion with a given DPI is inversely proportional to the intrinsic resistance of the DPI11The faster the exit speed of the drug delivered from the device (initial acceleration of the inhalation maneuver by the patient or directly by the device), the greater the risk of oropharyngeal deposition and the lesser the lung deposition12The SMI requires a low inspiratory flow rate. Therefore, compared with other inhaler devices, when performing a correct maneuver, oropharyngeal deposition is lower and lung deposition is higherAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nTable 6Experts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease#It is Strongly Recommended to …1Consider COPD pathophysiological aspects as well as patients’ clinical status and disease severity/evolution when selecting an inhalation device2Take into account the specific characteristics of each inhalation device3Assess patients’ ability to perform a correct inhalation maneuver and the specific requirements for each inhalation device4Evaluate patients’ inspiratory flow rate or inspiratory capacity before selecting an inhalation device5Take into account patients’ history of exacerbations or other events that may affect their ability to perform adequate inhalation6Regularly review patients’ inhalation maneuver and check whether the inhalation device meets their needs7Use an active inhalation device, such as pMDI or SMI, in patients with reduced inspiratory capacity8Consider using a valved holding chamber with SMI or pMDI devices in fragile patients with inspiratory and/or coordination difficulties9Use inhalation devices that generate a low oropharyngeal and high lung deposition10Check patients’ inhalation maneuver during every visit and, where necessary, resolve errors or even change the inhalerAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\n\nGeneral Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nExperts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\nThus, it is strongly recommended that, in addition to the standard variables for COPD, inspiratory flow rate and the patient’s inspiratory capacity are evaluated (on a regular basis), and the selection of an inhaler device should be based on the COPD patient’s features, needs, and clinical situation. This selection should consider the different characteristics of the devices to ensure physicians choose the device that best matches that patient’s needs.\nFinally, we considered it important to systematically review the patient’s inhalation maneuver,110 see Tables 3 and 6. This should be checked during every visit, so that errors can be resolved, and inhalers can be checked and even changed, where necessary. The same way, before considering a change in the patient’s treatment, possible errors with the inhalation maneuver should be evaluated." ]

[ null, null, null, null, null, null, null, null, null ]

[ "Introduction", "Methods", "Experts’ Selection", "Systematic Literature Review", "Narrative Review", "Nominal Group Meeting", "Results", "Lung Deposition", "Inspiratory Flow Rate", "General Conclusions and Recommendations" ]

[ "Chronic obstructive pulmonary disease (COPD) is characterized by a persistent airflow limitation that is usually progressive, according to guidelines from the Global Initiative for Chronic Obstructive Lung Disease (GOLD).1 In recent years, the prevalence of COPD has dramatically increased, growing by 44.2% from 1990 to 2015.2 The impact on patients, society, and health systems is correspondingly huge. More than 3 million people die of COPD worldwide each year, accounting for 6% of all deaths worldwide.3 In 2010, the cost of COPD in the USA was projected to be approximately US $50 billion.4\nOne of the primary treatment modalities for COPD is medications that are delivered via inhalation devices. Currently, in clinical practice, a variety of devices are available for the treatment of these patients, including pressurized metered-dose inhalers (pMDIs), which are used with or without a valved holding chamber or spacer, as well as dry powder inhalers (DPIs) and the soft mist inhaler (SMI). Inhaler devices vary in several ways, including how the inhaler dispenses the drug, whether the treatment is passively or actively generated (using propellant, mechanical, or compressed air), and the drug’s formulation (solution, dry powder, or mist).\nThe selection of an inhalation device is a key point in COPD because it impacts patient adherence, the drug’s effectiveness, and long–term outcomes.5 A range of studies have assessed which factors/characteristics should be considered when selecting the most appropriate device.6–8 Interestingly, according to many expert opinions, the most important factors involved in achieving optimal disease outcomes are the generation of high lung deposition and correct dispensation with low inspiratory flow rates.9 Other relevant factors include inhalation technique, potential difficulties with the device, and patient preferences.\nOn the other hand, data regarding lung deposition and inspiratory flow rates across inhalation devices in COPD patients are usually described and evaluated as absolute, static numbers. However, a theoretical framework and pathophysiological and clinical evidence all suggest that both are influenced by several factors that relate to the patients and their COPD, all of which can change over time.6,10–17 Therefore, analyzing lung deposition and inspiratory flow rates in COPD patients who use inhalation devices requires a more careful, holistic, and dynamic approach.\nConsidering all the aspects described above, we performed a systematic literature review (SLR) and a narrative review to assess lung deposition and inspiratory flow rates, as well as data related to these inhalation devices in COPD patients. Using this information, we propose related conclusions and recommendations that can contribute to the selection of inhalation devices. We are confident that this information will be very useful for health professionals who are involved in the care of patients with COPD.", "This project consisted of an SLR, a narrative review, and an expert opinion based on a nominal group meeting. A nominal group meeting is a structured method for brainstorming that encourages contributions from everyone and facilitates quick agreement on the relative importance of issues, problems, or solutions.\nExperts’ Selection We first established a group of 10 pneumologists (two of us were project coordinators). We are all specialized in COPD with demonstrated clinical experience (a minimum of 8 years and ≥5 publications and members of the Sociedad Española de Neumología y Cirugía Torácica (SEPAR). Besides, we are located in different parts of Spain. Then, we defined the project’s objectives, established the protocol of the SLR, and decided that this would be complemented by a narrative review.\nWe first established a group of 10 pneumologists (two of us were project coordinators). We are all specialized in COPD with demonstrated clinical experience (a minimum of 8 years and ≥5 publications and members of the Sociedad Española de Neumología y Cirugía Torácica (SEPAR). Besides, we are located in different parts of Spain. Then, we defined the project’s objectives, established the protocol of the SLR, and decided that this would be complemented by a narrative review.\nSystematic Literature Review The SLR was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The objective of the SLR was to analyze lung deposition, inspiratory flow, and other characteristics of different inhaler devices (pMDIs, DPIs, and SMI) in both COPD patients and healthy subjects. Studies were identified using sensitive search strategies in the main medical databases. For this purpose, an expert librarian checked the search strategies (Tables 1–7 of the Supplementary material). Disease- and inhaler device-related terms were used as search keywords, which employed a controlled vocabulary, specific MeSH headings, and additional keywords. The following bibliographic databases were screened up to April 2019: Medline (PubMed) and Embase from 1961 to April 2019, and the Cochrane Library up to April 2019. Retrieved references were managed in Endnote X5 (Thomson Reuters). Finally, a manual search was performed by reviewing the references of the included studies and all the publications, as well as other information provided by the authors. Retrieved studies were included if they met the following pre-established criteria: Patients had to be diagnosed with COPD, aged 18 or older, and treated with an inhaler device, and studies had to include outcomes related to lung deposition and inspiratory flow, including the rate of lung deposition, the particles’ mass median aerodynamic diameter (MMAD) expressed as µm (micrometer), the aerosol exit velocity (AEV) in meter per second (m/s), the lung distribution pattern, the inspiratory flow rate expressed as liter per minute (L/min), or the device’s intrinsic resistance. Other variables, such as safety, were also considered. Only SLRs, meta-analyses, randomized controlled trials (RCTs), observational studies, and in vitro studies in English, French, or Spanish were included. Animal studies were excluded. The screening of studies, data collection (including the evidence tables), and analysis were independently performed by two reviewers. In the case of a discrepancy between the reviewers, a consensus was reached by including a third reviewer. The 2011 levels of evidence from the Oxford Center for Evidence-Based Medicine (OCEBM)18 were used to grade the quality of the studies.\nThe SLR was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The objective of the SLR was to analyze lung deposition, inspiratory flow, and other characteristics of different inhaler devices (pMDIs, DPIs, and SMI) in both COPD patients and healthy subjects. Studies were identified using sensitive search strategies in the main medical databases. For this purpose, an expert librarian checked the search strategies (Tables 1–7 of the Supplementary material). Disease- and inhaler device-related terms were used as search keywords, which employed a controlled vocabulary, specific MeSH headings, and additional keywords. The following bibliographic databases were screened up to April 2019: Medline (PubMed) and Embase from 1961 to April 2019, and the Cochrane Library up to April 2019. Retrieved references were managed in Endnote X5 (Thomson Reuters). Finally, a manual search was performed by reviewing the references of the included studies and all the publications, as well as other information provided by the authors. Retrieved studies were included if they met the following pre-established criteria: Patients had to be diagnosed with COPD, aged 18 or older, and treated with an inhaler device, and studies had to include outcomes related to lung deposition and inspiratory flow, including the rate of lung deposition, the particles’ mass median aerodynamic diameter (MMAD) expressed as µm (micrometer), the aerosol exit velocity (AEV) in meter per second (m/s), the lung distribution pattern, the inspiratory flow rate expressed as liter per minute (L/min), or the device’s intrinsic resistance. Other variables, such as safety, were also considered. Only SLRs, meta-analyses, randomized controlled trials (RCTs), observational studies, and in vitro studies in English, French, or Spanish were included. Animal studies were excluded. The screening of studies, data collection (including the evidence tables), and analysis were independently performed by two reviewers. In the case of a discrepancy between the reviewers, a consensus was reached by including a third reviewer. The 2011 levels of evidence from the Oxford Center for Evidence-Based Medicine (OCEBM)18 were used to grade the quality of the studies.\nNarrative Review To supplement the SLR, additional searches were performed specifically to explore the basis of lung deposition and inspiratory flow, including their determinants and the effect of COPD on these aspects. For this purpose, apart from the results of the SLR, we performed different searches in Medline using PubMed’s Clinical Queries tool and small search strategies using MeSH and text–word terms (Table 8 of the Supplementary material).\nTo supplement the SLR, additional searches were performed specifically to explore the basis of lung deposition and inspiratory flow, including their determinants and the effect of COPD on these aspects. For this purpose, apart from the results of the SLR, we performed different searches in Medline using PubMed’s Clinical Queries tool and small search strategies using MeSH and text–word terms (Table 8 of the Supplementary material).\nNominal Group Meeting The results of the SLR and narrative searches were presented and discussed in a guided nominal group meeting. In this meeting, we agreed on a series of general conclusions and clinical recommendations.\nThe results of the SLR and narrative searches were presented and discussed in a guided nominal group meeting. In this meeting, we agreed on a series of general conclusions and clinical recommendations.", "We first established a group of 10 pneumologists (two of us were project coordinators). We are all specialized in COPD with demonstrated clinical experience (a minimum of 8 years and ≥5 publications and members of the Sociedad Española de Neumología y Cirugía Torácica (SEPAR). Besides, we are located in different parts of Spain. Then, we defined the project’s objectives, established the protocol of the SLR, and decided that this would be complemented by a narrative review.", "The SLR was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The objective of the SLR was to analyze lung deposition, inspiratory flow, and other characteristics of different inhaler devices (pMDIs, DPIs, and SMI) in both COPD patients and healthy subjects. Studies were identified using sensitive search strategies in the main medical databases. For this purpose, an expert librarian checked the search strategies (Tables 1–7 of the Supplementary material). Disease- and inhaler device-related terms were used as search keywords, which employed a controlled vocabulary, specific MeSH headings, and additional keywords. The following bibliographic databases were screened up to April 2019: Medline (PubMed) and Embase from 1961 to April 2019, and the Cochrane Library up to April 2019. Retrieved references were managed in Endnote X5 (Thomson Reuters). Finally, a manual search was performed by reviewing the references of the included studies and all the publications, as well as other information provided by the authors. Retrieved studies were included if they met the following pre-established criteria: Patients had to be diagnosed with COPD, aged 18 or older, and treated with an inhaler device, and studies had to include outcomes related to lung deposition and inspiratory flow, including the rate of lung deposition, the particles’ mass median aerodynamic diameter (MMAD) expressed as µm (micrometer), the aerosol exit velocity (AEV) in meter per second (m/s), the lung distribution pattern, the inspiratory flow rate expressed as liter per minute (L/min), or the device’s intrinsic resistance. Other variables, such as safety, were also considered. Only SLRs, meta-analyses, randomized controlled trials (RCTs), observational studies, and in vitro studies in English, French, or Spanish were included. Animal studies were excluded. The screening of studies, data collection (including the evidence tables), and analysis were independently performed by two reviewers. In the case of a discrepancy between the reviewers, a consensus was reached by including a third reviewer. The 2011 levels of evidence from the Oxford Center for Evidence-Based Medicine (OCEBM)18 were used to grade the quality of the studies.", "To supplement the SLR, additional searches were performed specifically to explore the basis of lung deposition and inspiratory flow, including their determinants and the effect of COPD on these aspects. For this purpose, apart from the results of the SLR, we performed different searches in Medline using PubMed’s Clinical Queries tool and small search strategies using MeSH and text–word terms (Table 8 of the Supplementary material).", "The results of the SLR and narrative searches were presented and discussed in a guided nominal group meeting. In this meeting, we agreed on a series of general conclusions and clinical recommendations.", "The SLR retrieved 3064 articles, of which 979 were duplicates. A total of 120 articles were reviewed in detail, as well as a further 20 articles that were retrieved using the manual search. Eventually, 75 articles were excluded (Table 9 of the Supplementary material), most of them due to lack of relevant data, and 71 were included, 24 were in vitro studies. Some of the included articles were of low–moderate quality (due to the study design, and poor description of the methodology, especially for the articles published before the 1990s). We found great variability regarding study designs, populations, outcomes, and measures. There were 24 in vitro studies,16,17,19–40 and the rest of the articles comprised one SLR41 and several RCTs and cross-sectional studies. The studies analyzed more than 1600 COPD patients, most of whom were men, with age ranges from 27 to 89 years, and with forced expiratory volume in 1 second from 25% to 80%. Many of these studies assessed one type of inhalation device, but others compared pMDIs and DPIs,19,20,30,33,37,40–46 pMDIs and SMI,47–49 or DPIs and SMI.17,27,28 One study also evaluated the three inhalation devices.17 The narrative searches found almost 1000 articles.\nHere, we summarize the main results of the SLR and narrative review, according to the project’s objectives (lung deposition, inspiratory flow rate, and data regarding these aspects for different inhaler devices). We also present the general conclusions and recommendations. Tables 1–3 show the main characteristics of the inhalation devices.Table 1Main Characteristics of Pressurized Metered-Dose InhalersFormulationDrug Suspended or Dissolved in Propellant (With Surfactant and Cosolvent)Metering systemMetering valve and reservoirPropellantHFA or CFCDose counterSometimesPrimingVariable priming requirementsTemperature dependenceLowHumidity dependenceLowActuator orificeThe design and size of the actuator significantly influences the performance of pMDIsLung deposition8%-53%MMDA1.22 μm-8 μmAerosol exit velocityHigh (more than 3 m/s)Lung distributionCentral and peripheral regionsIntrinsic resistanceLowInspiratory flow rate~ 20 L/minAdvantagesCompact and portable, consistent dosing, and rapid deliveryDisadvantagesNot breath-actuated, require coordinationAbbreviations: pMDI, pressurized metered-dose inhaler; HFA, hydrofluoroalkane; CFC, chlorofluorocarbon; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nTable 2Main Characteristics of Dry Powder InhalersFormulationDrug/Lactose Blend, Drug Alone, Drug/Excipient ParticlesMetering systemCapsules, blisters, multi-dose blister packs, reservoirsPropellantNoDose counterYesPrimingVariable priming requirementsTemperature dependenceYesHumidity dependenceYesActuator orificeDoes not applyLung deposition~ 20%MMDA1.8 µm–4.8 µmAerosol exit velocityDepends on inspiratory flow rateLung distributionCentral and peripheral regionsIntrinsic resistanceLow/medium/highInspiratory flow rateMinimum of 30 L/min to > 100 L/minAdvantagesCompact and portable Some are multi-dose devices. Do not require coordination of inhalation with activation or hand strengthDisadvantagesRequire a minimum inspiratory flowPatients with cognitive or debilitating conditions might not generate sufficiently high inspiratory flowsMost are moisture-sensitiveAbbreviations: DPI, dry powder inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nTable 3Main Characteristics of the Soft Mist InhalerFormulationAqueous Solution or SuspensionMetering systemReservoirsPropellantNoDose counterYesPrimingActuate the inhaler toward the ground until an aerosol cloud is visible and then to repeat the process three more timesTemperature dependenceNoHumidity dependenceNoActuator orifice–Lung deposition39.2%–67%MMDA~ 3.7 μmAerosol exit velocity0.72–0.84 m/sLung distributionCentral and peripheral regionsIntrinsic resistanceLow/noneInspiratory flow rateIndependentAdvantagesPortable and compact. Multi-dose device. Reusable. Compared with dry powder inhalers, a considerably smaller dose of a combination bronchodilator results in the same level of efficacy and safetyDisadvantagesNeeds to be primed if not in use for over 21 daysAbbreviations: SMI, soft mist inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\n\nMain Characteristics of Pressurized Metered-Dose Inhalers\nAbbreviations: pMDI, pressurized metered-dose inhaler; HFA, hydrofluoroalkane; CFC, chlorofluorocarbon; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nMain Characteristics of Dry Powder Inhalers\nAbbreviations: DPI, dry powder inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nMain Characteristics of the Soft Mist Inhaler\nAbbreviations: SMI, soft mist inhaler; MMAD, mass median aerodynamic diameter; m/s, meter per second; μm, micrometer; L/min, liter per minute.\nLung Deposition Different factors have been associated with lung deposition, some of which relate to the patient’s features (eg, airway geometry, inspiratory capacity, inhalation technique, breath–hold time, etc.) and to COPD (eg, exacerbations or hyperinflation).10–12,50–52 In fact, it has been shown during COPD exacerbations patients present decreased lung function and respiratory muscle strength that eventually influence on lung deposition.53 However, other factors are connected to the inhaler device (eg, the aerosol-generating system, speed of the aerosol plume, intrinsic resistance, inhaled carrier gas, oral/nasal inhalation, etc.), formulation (eg, the particle charge, lipophilicity, hygroscopicity, etc.), inhaled particle (eg, MMDA, its effect on lung distribution, etc.), and inhalation pattern (eg, the inspiration flow rate, volume, breath–hold time, etc.).52,54\nWith regards to the lung deposition (in relation to the emitted dose) across inhaler devices, data from in vitro and in vivo studies have estimated that 10%–20% of the delivered dose reaches the airways.54–56\nLung deposition rates (from individual studies) ranging from 8% to 53% have been reported for pMDIs.49,54,56–59 However, this rate increased to 11%–68% with the addition of a valved holding chamber or spacer31,35,46,59–63 and to 50%–60% with press-and-breathe actuators.64 More specifically, when Modulite® was used, lung deposition could reach up to 31%–34%.65,66 The K–haler® has a reported lung deposit of 39%.67 As exposed before, different factors might be contributing to these rate variability.\nThe studies included that analyzed DPIs have shown that the lung deposition rate is low, at around 20%,68 which is negatively influenced by a suboptimal inspiratory flow rate, humidity, and changes in temperature.69 Furthermore, clear differences in lung deposition were not observed when patients performed inhalation correctly.68 For the main DPI devices, the published lung deposition rates from individual studies (without direct comparisons) are as follows: Accuhaler® 7.6%,70 Aerolizer® 13%–20%,34,71 Breezhaler® 26.8%–39%,24,29 Easyhaler® 18.5%–31%,71,72 Genuair® 30.1%–51.1%,27,73,74 Handihaler® 9.8%–46.7%,19,24,71 Ingelheim inhaler® 16%–59%,75 NEXThaler® 39.4%–56%,11,76 Spinhaler® 11.5%,75 Turbuhaler® 14.2%–69.3%,21,42,77–79 and Twisthaler® 36%–37%.80 Similarly to all inhaler devices, other factors are probably influencing the lung deposition rate.81 Although some studies have compared lung deposition in pMDIs and DPIs, their results are contradictory.19,33\nRespimat® (SMI) has largely exhibited high lung deposition rates that range from 39.2% to 67%,27,38,48,49,74,82–84 with different inspiratory flow rates (high and low) and irrespective of humidity.85 Compared with other devices, SMI showed higher lung deposition than pMDIs (including those with a chamber or spacer) or DPIs.27,48,74,83,86\nWe also evaluated the AEV. Inhalation devices with a high AEV might have a short spray duration and vice versa. With pMDIs, the aerosol exits through a nozzle at a very high rate of more than 3 m/s.87 However, the AEV of the SMI is much slower, at 0.84–0.72 m/s, and the aerosol cloud lasts longer.88–90\nIt has also been observed that the distribution of the deposition sites of inhaled particles is strongly dependent on their aerodynamic diameters.69 This SLR found that pMDIs generally produce at least medium-sized particles, with a significant rate of extrafine particles. The observed MMAD of conventional pMDIs varies from 1.22 to 8 μm,35,91,92 from 1.19 to 3.57 μm when a valved holding chamber or spacer is used,31,35,93 and from 0.72 to 2.0 μm with Modulite®.65,66 Regarding particle size data for DPIs, depending on the device and drug, MMDAs vary from 1.40 to 4.8 µm.11,19,21,24,27–29,36,37,74,76 Conversely, SMI generates a cloud that contains an aerosol with a fine particle fraction of around 3.7 μm.74 It is estimated that 60% of the particles reach a MMAD <5 μm with SMI.85 The reported rate with pMDIs and DPIs (indirect comparison) is not that high.27,28,74,94\nAnother relevant outcome when using inhalation devices is the lung distribution pattern (through the central and peripheral regions). All inhalation devices have been shown to reach both central and peripheral areas. SMI data suggest that lung distribution pattern might be better than pMDIs, with a higher distribution in bronchial trees and peripheral regions.11,28,49,60,65,66,73,74,82,95,96 More specifically, a comparative study found mean peripheral, intermediate and central lung deposition, and peripheral zone/central zone ratio of 5.0%–9.4%, 4.8%–11.3%, 4.5%–10.4%, 1.01–1.16 with Respimat® vs 3.8%, 4.9%, 5.6%, 1.36 with pMDIs, respectively.49 Comparative data between pMDIs and DPIs are conflicting.33,46\nDifferent factors have been associated with lung deposition, some of which relate to the patient’s features (eg, airway geometry, inspiratory capacity, inhalation technique, breath–hold time, etc.) and to COPD (eg, exacerbations or hyperinflation).10–12,50–52 In fact, it has been shown during COPD exacerbations patients present decreased lung function and respiratory muscle strength that eventually influence on lung deposition.53 However, other factors are connected to the inhaler device (eg, the aerosol-generating system, speed of the aerosol plume, intrinsic resistance, inhaled carrier gas, oral/nasal inhalation, etc.), formulation (eg, the particle charge, lipophilicity, hygroscopicity, etc.), inhaled particle (eg, MMDA, its effect on lung distribution, etc.), and inhalation pattern (eg, the inspiration flow rate, volume, breath–hold time, etc.).52,54\nWith regards to the lung deposition (in relation to the emitted dose) across inhaler devices, data from in vitro and in vivo studies have estimated that 10%–20% of the delivered dose reaches the airways.54–56\nLung deposition rates (from individual studies) ranging from 8% to 53% have been reported for pMDIs.49,54,56–59 However, this rate increased to 11%–68% with the addition of a valved holding chamber or spacer31,35,46,59–63 and to 50%–60% with press-and-breathe actuators.64 More specifically, when Modulite® was used, lung deposition could reach up to 31%–34%.65,66 The K–haler® has a reported lung deposit of 39%.67 As exposed before, different factors might be contributing to these rate variability.\nThe studies included that analyzed DPIs have shown that the lung deposition rate is low, at around 20%,68 which is negatively influenced by a suboptimal inspiratory flow rate, humidity, and changes in temperature.69 Furthermore, clear differences in lung deposition were not observed when patients performed inhalation correctly.68 For the main DPI devices, the published lung deposition rates from individual studies (without direct comparisons) are as follows: Accuhaler® 7.6%,70 Aerolizer® 13%–20%,34,71 Breezhaler® 26.8%–39%,24,29 Easyhaler® 18.5%–31%,71,72 Genuair® 30.1%–51.1%,27,73,74 Handihaler® 9.8%–46.7%,19,24,71 Ingelheim inhaler® 16%–59%,75 NEXThaler® 39.4%–56%,11,76 Spinhaler® 11.5%,75 Turbuhaler® 14.2%–69.3%,21,42,77–79 and Twisthaler® 36%–37%.80 Similarly to all inhaler devices, other factors are probably influencing the lung deposition rate.81 Although some studies have compared lung deposition in pMDIs and DPIs, their results are contradictory.19,33\nRespimat® (SMI) has largely exhibited high lung deposition rates that range from 39.2% to 67%,27,38,48,49,74,82–84 with different inspiratory flow rates (high and low) and irrespective of humidity.85 Compared with other devices, SMI showed higher lung deposition than pMDIs (including those with a chamber or spacer) or DPIs.27,48,74,83,86\nWe also evaluated the AEV. Inhalation devices with a high AEV might have a short spray duration and vice versa. With pMDIs, the aerosol exits through a nozzle at a very high rate of more than 3 m/s.87 However, the AEV of the SMI is much slower, at 0.84–0.72 m/s, and the aerosol cloud lasts longer.88–90\nIt has also been observed that the distribution of the deposition sites of inhaled particles is strongly dependent on their aerodynamic diameters.69 This SLR found that pMDIs generally produce at least medium-sized particles, with a significant rate of extrafine particles. The observed MMAD of conventional pMDIs varies from 1.22 to 8 μm,35,91,92 from 1.19 to 3.57 μm when a valved holding chamber or spacer is used,31,35,93 and from 0.72 to 2.0 μm with Modulite®.65,66 Regarding particle size data for DPIs, depending on the device and drug, MMDAs vary from 1.40 to 4.8 µm.11,19,21,24,27–29,36,37,74,76 Conversely, SMI generates a cloud that contains an aerosol with a fine particle fraction of around 3.7 μm.74 It is estimated that 60% of the particles reach a MMAD <5 μm with SMI.85 The reported rate with pMDIs and DPIs (indirect comparison) is not that high.27,28,74,94\nAnother relevant outcome when using inhalation devices is the lung distribution pattern (through the central and peripheral regions). All inhalation devices have been shown to reach both central and peripheral areas. SMI data suggest that lung distribution pattern might be better than pMDIs, with a higher distribution in bronchial trees and peripheral regions.11,28,49,60,65,66,73,74,82,95,96 More specifically, a comparative study found mean peripheral, intermediate and central lung deposition, and peripheral zone/central zone ratio of 5.0%–9.4%, 4.8%–11.3%, 4.5%–10.4%, 1.01–1.16 with Respimat® vs 3.8%, 4.9%, 5.6%, 1.36 with pMDIs, respectively.49 Comparative data between pMDIs and DPIs are conflicting.33,46\nInspiratory Flow Rate The other main focus of this project was the inspiratory flow rate. First, it is important to consider the factors associated with inspiratory flow rate (Table 4). Similar to lung deposition, some of these factors relate to the patient’s and COPD’s characteristics, while other factors relate to the inhaler device, such as the intrinsic resistance.6,10,13–17,43,45,97,98Table 4Main Factors Associated to Inspiratory Flow RatePatient-related Inspiratory capacity Inspiratory effort Comorbidities Inhalation techniqueCOPD-related Severity Hyperinflation Exacerbations Respiratory muscle alterationsInhalation device-related Internal resistance Disaggregation of the powdered drug dose (DPIs)Abbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\n\nMain Factors Associated to Inspiratory Flow Rate\nAbbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\nOverall, two main driving forces can affect the performance of DPIs: the inspiratory flow generated by the patient and the turbulence produced inside the device, the latter of which solely depends on the original technical characteristics of the device, including the intrinsic resistance. These two parameters affect the disaggregation of the drug dose, the diameter of the particles to inhale, the lung distribution of the dose, and eventually, the efficacy of the delivered drug. Essentially, a higher intrinsic resistance results in the patient needing to generate a higher inspiratory flow.\nIn general, although variable, DPIs’ intrinsic resistance is higher than that of pMDIs or SMI, which are relatively similar and low. Therefore, pMDIs and SMI do not require the patient to generate a high inspiratory flow (and inspiratory effort).\nAccording to the results of the SLR, pMDIs require low inspiratory flow rates of around 20 L/min (59, 70, 132) to achieve an adequate lung deposition.10,17,43,45,57,82,99–101 There were no major differences between the use of one propellant and another.57 In order to generate the correct inspiratory airflow and lung deposition with this type of inhalation device, it is recommended the patients start breathing from their functional residual capacity, then they should activate the inhalation device and start inhalation using an inspiratory flow rate that is below 60 L/min. Then, at the end of inspiration, patients should hold their breath for around 10 seconds.100 Consequently, patients need a correct inhalation technique and coordination. The K-haler® is triggered by an inspiratory flow rate of approximately 30 L/min.67\nInhaler devices are many times classified as low- (30 L/min or below), medium– (~30–60 L/min), and high-resistance (>60 L/min) devices.10,17 DPIs with low intrinsic resistance include Aerolizer®, Spinhaler®, and Breezhaler®; DPIs with medium resistance include Accuhaler®/Diskhaler®, Genuair®/Novolizer®, and NEXThaler®; DPIs with medium/high resistance include Turbuhaler®; and DPIs with high resistance include Easyhaler®, Handihaler®, and Twisthaler®. The estimated inspiratory flow rates required thus vary across devices, from a minimum of 30 L/min to more than 100 L/min.6,26,32,43,45,101–108\nBased on the information presented above, when using a high-resistance DPI, the disaggregation and micro-dispersion of the powdered drug are relatively independent of the patient’s inspiratory effort because the driving force depends on the intrinsic resistance of the DPI itself, which is able to produce the turbulence required for effective drug micro-dispersion. However, when a low-resistance device is used, the only force that can generate turbulence is the patient’s inspiratory airflow, which should be high.\nFinally, the studies showed that the SMI inhalation device uses mechanical energy (from a spring) to generate a fine, slow–moving mist from an aqueous solution, which is independent of the patient’s inspiratory effort. Therefore, the required inspiratory flow rate and/or effort are less relevant than with DPIs.83,88,89,109 Moreover, the inhalation maneuver with SMI is more similar to physiological inhalation. One study observed that drug delivery to the lungs with SMI was more efficient than with pMDIs, even with poor inhalation technique.82\nThe other main focus of this project was the inspiratory flow rate. First, it is important to consider the factors associated with inspiratory flow rate (Table 4). Similar to lung deposition, some of these factors relate to the patient’s and COPD’s characteristics, while other factors relate to the inhaler device, such as the intrinsic resistance.6,10,13–17,43,45,97,98Table 4Main Factors Associated to Inspiratory Flow RatePatient-related Inspiratory capacity Inspiratory effort Comorbidities Inhalation techniqueCOPD-related Severity Hyperinflation Exacerbations Respiratory muscle alterationsInhalation device-related Internal resistance Disaggregation of the powdered drug dose (DPIs)Abbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\n\nMain Factors Associated to Inspiratory Flow Rate\nAbbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\nOverall, two main driving forces can affect the performance of DPIs: the inspiratory flow generated by the patient and the turbulence produced inside the device, the latter of which solely depends on the original technical characteristics of the device, including the intrinsic resistance. These two parameters affect the disaggregation of the drug dose, the diameter of the particles to inhale, the lung distribution of the dose, and eventually, the efficacy of the delivered drug. Essentially, a higher intrinsic resistance results in the patient needing to generate a higher inspiratory flow.\nIn general, although variable, DPIs’ intrinsic resistance is higher than that of pMDIs or SMI, which are relatively similar and low. Therefore, pMDIs and SMI do not require the patient to generate a high inspiratory flow (and inspiratory effort).\nAccording to the results of the SLR, pMDIs require low inspiratory flow rates of around 20 L/min (59, 70, 132) to achieve an adequate lung deposition.10,17,43,45,57,82,99–101 There were no major differences between the use of one propellant and another.57 In order to generate the correct inspiratory airflow and lung deposition with this type of inhalation device, it is recommended the patients start breathing from their functional residual capacity, then they should activate the inhalation device and start inhalation using an inspiratory flow rate that is below 60 L/min. Then, at the end of inspiration, patients should hold their breath for around 10 seconds.100 Consequently, patients need a correct inhalation technique and coordination. The K-haler® is triggered by an inspiratory flow rate of approximately 30 L/min.67\nInhaler devices are many times classified as low- (30 L/min or below), medium– (~30–60 L/min), and high-resistance (>60 L/min) devices.10,17 DPIs with low intrinsic resistance include Aerolizer®, Spinhaler®, and Breezhaler®; DPIs with medium resistance include Accuhaler®/Diskhaler®, Genuair®/Novolizer®, and NEXThaler®; DPIs with medium/high resistance include Turbuhaler®; and DPIs with high resistance include Easyhaler®, Handihaler®, and Twisthaler®. The estimated inspiratory flow rates required thus vary across devices, from a minimum of 30 L/min to more than 100 L/min.6,26,32,43,45,101–108\nBased on the information presented above, when using a high-resistance DPI, the disaggregation and micro-dispersion of the powdered drug are relatively independent of the patient’s inspiratory effort because the driving force depends on the intrinsic resistance of the DPI itself, which is able to produce the turbulence required for effective drug micro-dispersion. However, when a low-resistance device is used, the only force that can generate turbulence is the patient’s inspiratory airflow, which should be high.\nFinally, the studies showed that the SMI inhalation device uses mechanical energy (from a spring) to generate a fine, slow–moving mist from an aqueous solution, which is independent of the patient’s inspiratory effort. Therefore, the required inspiratory flow rate and/or effort are less relevant than with DPIs.83,88,89,109 Moreover, the inhalation maneuver with SMI is more similar to physiological inhalation. One study observed that drug delivery to the lungs with SMI was more efficient than with pMDIs, even with poor inhalation technique.82\nGeneral Conclusions and Recommendations The experts discussed the results of the reviews, and, based on the evidence, they formulated a series of general conclusions and recommendations that are outlined in Tables 5 and 6. In summary, health professionals involved in the management of COPD patients should be aware of all factors involved in adequate drug distribution when using inhalation devices. Two main objective factors emerged at this point: lung deposition and the required inspiratory flow rate. Both of these factors are highly influenced by patient, COPD, and inhaler device characteristics. Moreover, COPD is a heterogeneous and dynamic chronic disease, in which lung deposition and inspiratory flow rates vary across patients and also within the same patient.Table 5General Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease#Conclusion1The lung deposition profile and required inspiratory flow rate are key factors to be considered when selecting an inhalation device2COPD is a progressive disease with specific pathophysiological features that impact patients’ lung deposition and inspiratory flow rate3In COPD patients, obstruction severity and especially hyperinflation are decisive pathophysiological factors4During the course of COPD, some situations, notably exacerbations, impact the inspiratory flow rate5An homogeneous drug distribution through the airways is essential, not only because of the COPD pathophysiology but also because of the different distribution of cholinergic and β2 receptors6COPD treatment requires inhalation devices capable of delivering particles with a MMAD comprised between 0.5 and 5 µm to achieve high lung deposition7The patients’ ability to perform a correct inhalation maneuver (inspiratory effort, coordination, etc.) is decisive to achieve an adequate inspiratory flow rate and lung deposition8Inhalation maneuvers that are similar to physiological/standard inspiratory flow are more likely associated with reduced oropharyngeal deposition and therefore increased lung deposition9Inhalation devices present different characteristics that define the required inspiratory flow rate and influence lung deposition10The inspiratory flow rate required for drug dispersion with a given DPI is inversely proportional to the intrinsic resistance of the DPI11The faster the exit speed of the drug delivered from the device (initial acceleration of the inhalation maneuver by the patient or directly by the device), the greater the risk of oropharyngeal deposition and the lesser the lung deposition12The SMI requires a low inspiratory flow rate. Therefore, compared with other inhaler devices, when performing a correct maneuver, oropharyngeal deposition is lower and lung deposition is higherAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nTable 6Experts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease#It is Strongly Recommended to …1Consider COPD pathophysiological aspects as well as patients’ clinical status and disease severity/evolution when selecting an inhalation device2Take into account the specific characteristics of each inhalation device3Assess patients’ ability to perform a correct inhalation maneuver and the specific requirements for each inhalation device4Evaluate patients’ inspiratory flow rate or inspiratory capacity before selecting an inhalation device5Take into account patients’ history of exacerbations or other events that may affect their ability to perform adequate inhalation6Regularly review patients’ inhalation maneuver and check whether the inhalation device meets their needs7Use an active inhalation device, such as pMDI or SMI, in patients with reduced inspiratory capacity8Consider using a valved holding chamber with SMI or pMDI devices in fragile patients with inspiratory and/or coordination difficulties9Use inhalation devices that generate a low oropharyngeal and high lung deposition10Check patients’ inhalation maneuver during every visit and, where necessary, resolve errors or even change the inhalerAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\n\nGeneral Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nExperts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\nThus, it is strongly recommended that, in addition to the standard variables for COPD, inspiratory flow rate and the patient’s inspiratory capacity are evaluated (on a regular basis), and the selection of an inhaler device should be based on the COPD patient’s features, needs, and clinical situation. This selection should consider the different characteristics of the devices to ensure physicians choose the device that best matches that patient’s needs.\nFinally, we considered it important to systematically review the patient’s inhalation maneuver,110 see Tables 3 and 6. This should be checked during every visit, so that errors can be resolved, and inhalers can be checked and even changed, where necessary. The same way, before considering a change in the patient’s treatment, possible errors with the inhalation maneuver should be evaluated.\nThe experts discussed the results of the reviews, and, based on the evidence, they formulated a series of general conclusions and recommendations that are outlined in Tables 5 and 6. In summary, health professionals involved in the management of COPD patients should be aware of all factors involved in adequate drug distribution when using inhalation devices. Two main objective factors emerged at this point: lung deposition and the required inspiratory flow rate. Both of these factors are highly influenced by patient, COPD, and inhaler device characteristics. Moreover, COPD is a heterogeneous and dynamic chronic disease, in which lung deposition and inspiratory flow rates vary across patients and also within the same patient.Table 5General Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease#Conclusion1The lung deposition profile and required inspiratory flow rate are key factors to be considered when selecting an inhalation device2COPD is a progressive disease with specific pathophysiological features that impact patients’ lung deposition and inspiratory flow rate3In COPD patients, obstruction severity and especially hyperinflation are decisive pathophysiological factors4During the course of COPD, some situations, notably exacerbations, impact the inspiratory flow rate5An homogeneous drug distribution through the airways is essential, not only because of the COPD pathophysiology but also because of the different distribution of cholinergic and β2 receptors6COPD treatment requires inhalation devices capable of delivering particles with a MMAD comprised between 0.5 and 5 µm to achieve high lung deposition7The patients’ ability to perform a correct inhalation maneuver (inspiratory effort, coordination, etc.) is decisive to achieve an adequate inspiratory flow rate and lung deposition8Inhalation maneuvers that are similar to physiological/standard inspiratory flow are more likely associated with reduced oropharyngeal deposition and therefore increased lung deposition9Inhalation devices present different characteristics that define the required inspiratory flow rate and influence lung deposition10The inspiratory flow rate required for drug dispersion with a given DPI is inversely proportional to the intrinsic resistance of the DPI11The faster the exit speed of the drug delivered from the device (initial acceleration of the inhalation maneuver by the patient or directly by the device), the greater the risk of oropharyngeal deposition and the lesser the lung deposition12The SMI requires a low inspiratory flow rate. Therefore, compared with other inhaler devices, when performing a correct maneuver, oropharyngeal deposition is lower and lung deposition is higherAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nTable 6Experts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease#It is Strongly Recommended to …1Consider COPD pathophysiological aspects as well as patients’ clinical status and disease severity/evolution when selecting an inhalation device2Take into account the specific characteristics of each inhalation device3Assess patients’ ability to perform a correct inhalation maneuver and the specific requirements for each inhalation device4Evaluate patients’ inspiratory flow rate or inspiratory capacity before selecting an inhalation device5Take into account patients’ history of exacerbations or other events that may affect their ability to perform adequate inhalation6Regularly review patients’ inhalation maneuver and check whether the inhalation device meets their needs7Use an active inhalation device, such as pMDI or SMI, in patients with reduced inspiratory capacity8Consider using a valved holding chamber with SMI or pMDI devices in fragile patients with inspiratory and/or coordination difficulties9Use inhalation devices that generate a low oropharyngeal and high lung deposition10Check patients’ inhalation maneuver during every visit and, where necessary, resolve errors or even change the inhalerAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\n\nGeneral Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nExperts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\nThus, it is strongly recommended that, in addition to the standard variables for COPD, inspiratory flow rate and the patient’s inspiratory capacity are evaluated (on a regular basis), and the selection of an inhaler device should be based on the COPD patient’s features, needs, and clinical situation. This selection should consider the different characteristics of the devices to ensure physicians choose the device that best matches that patient’s needs.\nFinally, we considered it important to systematically review the patient’s inhalation maneuver,110 see Tables 3 and 6. This should be checked during every visit, so that errors can be resolved, and inhalers can be checked and even changed, where necessary. The same way, before considering a change in the patient’s treatment, possible errors with the inhalation maneuver should be evaluated.", "Different factors have been associated with lung deposition, some of which relate to the patient’s features (eg, airway geometry, inspiratory capacity, inhalation technique, breath–hold time, etc.) and to COPD (eg, exacerbations or hyperinflation).10–12,50–52 In fact, it has been shown during COPD exacerbations patients present decreased lung function and respiratory muscle strength that eventually influence on lung deposition.53 However, other factors are connected to the inhaler device (eg, the aerosol-generating system, speed of the aerosol plume, intrinsic resistance, inhaled carrier gas, oral/nasal inhalation, etc.), formulation (eg, the particle charge, lipophilicity, hygroscopicity, etc.), inhaled particle (eg, MMDA, its effect on lung distribution, etc.), and inhalation pattern (eg, the inspiration flow rate, volume, breath–hold time, etc.).52,54\nWith regards to the lung deposition (in relation to the emitted dose) across inhaler devices, data from in vitro and in vivo studies have estimated that 10%–20% of the delivered dose reaches the airways.54–56\nLung deposition rates (from individual studies) ranging from 8% to 53% have been reported for pMDIs.49,54,56–59 However, this rate increased to 11%–68% with the addition of a valved holding chamber or spacer31,35,46,59–63 and to 50%–60% with press-and-breathe actuators.64 More specifically, when Modulite® was used, lung deposition could reach up to 31%–34%.65,66 The K–haler® has a reported lung deposit of 39%.67 As exposed before, different factors might be contributing to these rate variability.\nThe studies included that analyzed DPIs have shown that the lung deposition rate is low, at around 20%,68 which is negatively influenced by a suboptimal inspiratory flow rate, humidity, and changes in temperature.69 Furthermore, clear differences in lung deposition were not observed when patients performed inhalation correctly.68 For the main DPI devices, the published lung deposition rates from individual studies (without direct comparisons) are as follows: Accuhaler® 7.6%,70 Aerolizer® 13%–20%,34,71 Breezhaler® 26.8%–39%,24,29 Easyhaler® 18.5%–31%,71,72 Genuair® 30.1%–51.1%,27,73,74 Handihaler® 9.8%–46.7%,19,24,71 Ingelheim inhaler® 16%–59%,75 NEXThaler® 39.4%–56%,11,76 Spinhaler® 11.5%,75 Turbuhaler® 14.2%–69.3%,21,42,77–79 and Twisthaler® 36%–37%.80 Similarly to all inhaler devices, other factors are probably influencing the lung deposition rate.81 Although some studies have compared lung deposition in pMDIs and DPIs, their results are contradictory.19,33\nRespimat® (SMI) has largely exhibited high lung deposition rates that range from 39.2% to 67%,27,38,48,49,74,82–84 with different inspiratory flow rates (high and low) and irrespective of humidity.85 Compared with other devices, SMI showed higher lung deposition than pMDIs (including those with a chamber or spacer) or DPIs.27,48,74,83,86\nWe also evaluated the AEV. Inhalation devices with a high AEV might have a short spray duration and vice versa. With pMDIs, the aerosol exits through a nozzle at a very high rate of more than 3 m/s.87 However, the AEV of the SMI is much slower, at 0.84–0.72 m/s, and the aerosol cloud lasts longer.88–90\nIt has also been observed that the distribution of the deposition sites of inhaled particles is strongly dependent on their aerodynamic diameters.69 This SLR found that pMDIs generally produce at least medium-sized particles, with a significant rate of extrafine particles. The observed MMAD of conventional pMDIs varies from 1.22 to 8 μm,35,91,92 from 1.19 to 3.57 μm when a valved holding chamber or spacer is used,31,35,93 and from 0.72 to 2.0 μm with Modulite®.65,66 Regarding particle size data for DPIs, depending on the device and drug, MMDAs vary from 1.40 to 4.8 µm.11,19,21,24,27–29,36,37,74,76 Conversely, SMI generates a cloud that contains an aerosol with a fine particle fraction of around 3.7 μm.74 It is estimated that 60% of the particles reach a MMAD <5 μm with SMI.85 The reported rate with pMDIs and DPIs (indirect comparison) is not that high.27,28,74,94\nAnother relevant outcome when using inhalation devices is the lung distribution pattern (through the central and peripheral regions). All inhalation devices have been shown to reach both central and peripheral areas. SMI data suggest that lung distribution pattern might be better than pMDIs, with a higher distribution in bronchial trees and peripheral regions.11,28,49,60,65,66,73,74,82,95,96 More specifically, a comparative study found mean peripheral, intermediate and central lung deposition, and peripheral zone/central zone ratio of 5.0%–9.4%, 4.8%–11.3%, 4.5%–10.4%, 1.01–1.16 with Respimat® vs 3.8%, 4.9%, 5.6%, 1.36 with pMDIs, respectively.49 Comparative data between pMDIs and DPIs are conflicting.33,46", "The other main focus of this project was the inspiratory flow rate. First, it is important to consider the factors associated with inspiratory flow rate (Table 4). Similar to lung deposition, some of these factors relate to the patient’s and COPD’s characteristics, while other factors relate to the inhaler device, such as the intrinsic resistance.6,10,13–17,43,45,97,98Table 4Main Factors Associated to Inspiratory Flow RatePatient-related Inspiratory capacity Inspiratory effort Comorbidities Inhalation techniqueCOPD-related Severity Hyperinflation Exacerbations Respiratory muscle alterationsInhalation device-related Internal resistance Disaggregation of the powdered drug dose (DPIs)Abbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\n\nMain Factors Associated to Inspiratory Flow Rate\nAbbreviations: COPD, chronic obstructive pulmonary disease; DPIs, dry powder inhalers.\nOverall, two main driving forces can affect the performance of DPIs: the inspiratory flow generated by the patient and the turbulence produced inside the device, the latter of which solely depends on the original technical characteristics of the device, including the intrinsic resistance. These two parameters affect the disaggregation of the drug dose, the diameter of the particles to inhale, the lung distribution of the dose, and eventually, the efficacy of the delivered drug. Essentially, a higher intrinsic resistance results in the patient needing to generate a higher inspiratory flow.\nIn general, although variable, DPIs’ intrinsic resistance is higher than that of pMDIs or SMI, which are relatively similar and low. Therefore, pMDIs and SMI do not require the patient to generate a high inspiratory flow (and inspiratory effort).\nAccording to the results of the SLR, pMDIs require low inspiratory flow rates of around 20 L/min (59, 70, 132) to achieve an adequate lung deposition.10,17,43,45,57,82,99–101 There were no major differences between the use of one propellant and another.57 In order to generate the correct inspiratory airflow and lung deposition with this type of inhalation device, it is recommended the patients start breathing from their functional residual capacity, then they should activate the inhalation device and start inhalation using an inspiratory flow rate that is below 60 L/min. Then, at the end of inspiration, patients should hold their breath for around 10 seconds.100 Consequently, patients need a correct inhalation technique and coordination. The K-haler® is triggered by an inspiratory flow rate of approximately 30 L/min.67\nInhaler devices are many times classified as low- (30 L/min or below), medium– (~30–60 L/min), and high-resistance (>60 L/min) devices.10,17 DPIs with low intrinsic resistance include Aerolizer®, Spinhaler®, and Breezhaler®; DPIs with medium resistance include Accuhaler®/Diskhaler®, Genuair®/Novolizer®, and NEXThaler®; DPIs with medium/high resistance include Turbuhaler®; and DPIs with high resistance include Easyhaler®, Handihaler®, and Twisthaler®. The estimated inspiratory flow rates required thus vary across devices, from a minimum of 30 L/min to more than 100 L/min.6,26,32,43,45,101–108\nBased on the information presented above, when using a high-resistance DPI, the disaggregation and micro-dispersion of the powdered drug are relatively independent of the patient’s inspiratory effort because the driving force depends on the intrinsic resistance of the DPI itself, which is able to produce the turbulence required for effective drug micro-dispersion. However, when a low-resistance device is used, the only force that can generate turbulence is the patient’s inspiratory airflow, which should be high.\nFinally, the studies showed that the SMI inhalation device uses mechanical energy (from a spring) to generate a fine, slow–moving mist from an aqueous solution, which is independent of the patient’s inspiratory effort. Therefore, the required inspiratory flow rate and/or effort are less relevant than with DPIs.83,88,89,109 Moreover, the inhalation maneuver with SMI is more similar to physiological inhalation. One study observed that drug delivery to the lungs with SMI was more efficient than with pMDIs, even with poor inhalation technique.82", "The experts discussed the results of the reviews, and, based on the evidence, they formulated a series of general conclusions and recommendations that are outlined in Tables 5 and 6. In summary, health professionals involved in the management of COPD patients should be aware of all factors involved in adequate drug distribution when using inhalation devices. Two main objective factors emerged at this point: lung deposition and the required inspiratory flow rate. Both of these factors are highly influenced by patient, COPD, and inhaler device characteristics. Moreover, COPD is a heterogeneous and dynamic chronic disease, in which lung deposition and inspiratory flow rates vary across patients and also within the same patient.Table 5General Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease#Conclusion1The lung deposition profile and required inspiratory flow rate are key factors to be considered when selecting an inhalation device2COPD is a progressive disease with specific pathophysiological features that impact patients’ lung deposition and inspiratory flow rate3In COPD patients, obstruction severity and especially hyperinflation are decisive pathophysiological factors4During the course of COPD, some situations, notably exacerbations, impact the inspiratory flow rate5An homogeneous drug distribution through the airways is essential, not only because of the COPD pathophysiology but also because of the different distribution of cholinergic and β2 receptors6COPD treatment requires inhalation devices capable of delivering particles with a MMAD comprised between 0.5 and 5 µm to achieve high lung deposition7The patients’ ability to perform a correct inhalation maneuver (inspiratory effort, coordination, etc.) is decisive to achieve an adequate inspiratory flow rate and lung deposition8Inhalation maneuvers that are similar to physiological/standard inspiratory flow are more likely associated with reduced oropharyngeal deposition and therefore increased lung deposition9Inhalation devices present different characteristics that define the required inspiratory flow rate and influence lung deposition10The inspiratory flow rate required for drug dispersion with a given DPI is inversely proportional to the intrinsic resistance of the DPI11The faster the exit speed of the drug delivered from the device (initial acceleration of the inhalation maneuver by the patient or directly by the device), the greater the risk of oropharyngeal deposition and the lesser the lung deposition12The SMI requires a low inspiratory flow rate. Therefore, compared with other inhaler devices, when performing a correct maneuver, oropharyngeal deposition is lower and lung deposition is higherAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nTable 6Experts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease#It is Strongly Recommended to …1Consider COPD pathophysiological aspects as well as patients’ clinical status and disease severity/evolution when selecting an inhalation device2Take into account the specific characteristics of each inhalation device3Assess patients’ ability to perform a correct inhalation maneuver and the specific requirements for each inhalation device4Evaluate patients’ inspiratory flow rate or inspiratory capacity before selecting an inhalation device5Take into account patients’ history of exacerbations or other events that may affect their ability to perform adequate inhalation6Regularly review patients’ inhalation maneuver and check whether the inhalation device meets their needs7Use an active inhalation device, such as pMDI or SMI, in patients with reduced inspiratory capacity8Consider using a valved holding chamber with SMI or pMDI devices in fragile patients with inspiratory and/or coordination difficulties9Use inhalation devices that generate a low oropharyngeal and high lung deposition10Check patients’ inhalation maneuver during every visit and, where necessary, resolve errors or even change the inhalerAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\n\nGeneral Conclusions Regarding Lung Deposition and Inspiratory Flow Rate in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; MMAD, mass median aerodynamic diameter; µm, micrometer; DPI, dry powder inhaler; SMI, soft mist inhaler.\nExperts’ Recommendations for the Selection of the Appropriate Inhalation Device in Chronic Obstructive Pulmonary Disease\nAbbreviations: COPD, chronic obstructive pulmonary disease; pMDI, pressurized metered-dose inhaler; SMI, soft mist inhaler.\nThus, it is strongly recommended that, in addition to the standard variables for COPD, inspiratory flow rate and the patient’s inspiratory capacity are evaluated (on a regular basis), and the selection of an inhaler device should be based on the COPD patient’s features, needs, and clinical situation. This selection should consider the different characteristics of the devices to ensure physicians choose the device that best matches that patient’s needs.\nFinally, we considered it important to systematically review the patient’s inhalation maneuver,110 see Tables 3 and 6. This should be checked during every visit, so that errors can be resolved, and inhalers can be checked and even changed, where necessary. The same way, before considering a change in the patient’s treatment, possible errors with the inhalation maneuver should be evaluated." ]

[ "intro", null, null, null, null, null, null, null, null, null ]

[ "COPD", "lung deposition", "inspiratory flow", "inhalation devices", "systematic literature review" ]

[ 1328, 90, 426, 77, 35, 5830, 833, 764, 895 ]

[ "inspiratory", "lung", "inhalation", "flow", "inspiratory flow", "deposition", "lung deposition", "rate", "copd", "inhaler" ]

[ "modalities copd medications", "inhalerabbreviations copd chronic", "patients copd methods", "copd inhaler device", "inhalation devices copd" ]

[ "Aged", "Cross-Sectional Studies", "Female", "Humans", "Male", "Prevalence", "Tertiary Care Centers", "Vitamin D", "Vitamin D Deficiency" ]

[]

[]

[]

[ "INTRODUCTION", "METHODS", "RESULTS", "DISCUSSION", "CONCLUSIONS" ]

[ "Vitamin D is a fat-soluble prohormone, which is involved in the regulation of the physiological processes.1 It is found in two forms; ergocalciferol (Vitamin D2) found in plants and fungi, and cholecalciferol (Vitamin D3) from the sun.2 Vitamin D deficiency is defined as “25-hydroxyvitamin D level of less than 20ng per millimeter (50nmol per liter)”.3,4\nIt has been estimated that around one billion people have Vitamin D deficiency or insufficiency.5 Vitamin D deficiency shows its high prevalence in the developed countries and the regions of Asia, the Middle East, and India mostly in women.6 According to several studies, 40-100% of the US and European population are deficient in Vitamin D.7,8 The factors causing Vitamin D deficiency could be due to changes in the lifestyle based on the socio-cultural practice, inadequate sun exposure and the food consumed that are rarely fortified with Vitamin D.9 Its deficiency has been linked to different musculoskeletal and non-skeletal complications like congestive heart failure, peripheral vascular disease, hypertension, diabetes mellitus.10 So, it is important to know the burden of Vitamin D deficiency for the better patient management.\nThe present study is done to find out the occurrence of vitamin D deficiency and the frequency of clinical features of vitamin D deficient patients.", "This descriptive cross-sectional study was done among patients attending the outpatient department (OPD) and general health checkup of Kathmandu Medical College and Teaching Hospital, Kathmandu, Nepal. The study was conducted from May 2019 to July 2019. The ethical approval was taken from the Institutional Review Committee of the Kathmandu Medical College and Teaching Hospital (ref no. 310520113). Patients visiting the OPDs were included in the study. Patients under the age of 15 years, those with chronic kidney disease and on medication that affects bone metabolism like phenobarbital, anti-tubercular drugs, thiazide, antiretroviral, glucocorticoids, and Vitamin D treatment for Vitamin D deficiency were excluded from the study. Informed written consent was taken from the participants. Convenient sampling was done. The sample size was calculated by using the formula,\nWhere,\nn = required sample size,Z = 1.96 at 95% Confidence Interval,p = population proportion, 50%e = margin of error, 7%\nn = required sample size,\nZ = 1.96 at 95% Confidence Interval,\np = population proportion, 50%\ne = margin of error, 7%\nAs patients were enrolled using the convenient sampling, we doubled the size and considering 20% non-respondent rate, the total sample of 481 patients was taken for measurement of vitamin D.\nData collected in semi-structured questionnaire regarding demographics, clinical features like fatigue, body ache, muscle cramps, joint pain, low backache, and medical history of diabetes, hypertension, chronic kidney disease, and Ischemic heart diseases (IHDs). Body mass index was used to define the weight status. Serum Vitamin D3, which is 25 hydroxyvitamin D [25(OH) D], was estimated by a fully-automated chemiluminescence immunoassay.\nVitamin D deficiency was defined as 25(OH) D less than 20ng/ml, Vitamin D insufficiency as 20-29ng/ml, and Vitamin D sufficiency as ≥30ng/ml, and Vitamin D toxicity as more than 100ng/ml. Vitamin D levels less than 10ng/ml were regarded as a severe deficiency.2,11\nThe data collected was entered in Microsoft Excel and was analyzed in the IBM Statistical Package of the Social Sciences (SPSS) version 26. Demographic data and clinical variables were analyzed by descriptive analysis. Results are expressed as mean ± standard deviation for quantitative variables and percentage for qualitative variables like symptoms.", "A total of 481 participants were included in the study. Overall, vitamin D deficiency was found in 335 (69.6%) (65.49-73.71 at 95% Confidence Interval). Insufficiency was seen in 77 (16%) patients. Among the participants, 69 (14.3%) had the sufficient vitamin D levels (Table 1) The total mean age of the participants was 40.5±14.4 years (39.64±14.10 for females and 43.59±15.13 for males). The majority were females with a female: male ratio of 3.3:1. The study included 111 (23.1%) males and 370 (76.1 %) females.\nThe total mean serum vitamin D was 19.69±13.68ng/ ml. The mean serum vitamin D concentration by gender was 22.38±17.07ng/ml in males and 18.89±15.25ng/ ml in females.\nIn the study, out of 481 participants, 78 (16.2%) of the participants had severe vitamin D deficiency. Among severely vitamin D deficient patients, 59 (75.6%) were symptomatic. The most common symptoms among them were fatigability 44 (56.4%), generalized myalgia 41 (52.6%), bone and joint pain 35 (44.9%), and muscle cramps 37 (47.4%). Among 257 mild vitamin D deficient patients, 169 (65.8%) participants had symptoms. The symptoms among them were fatigability 143 (55.6%), muscle cramps 94 (36.6%), generalized myalgia 84 (32.7%), bone and joint pain in 76 (29.6%). Overall, 227(68.05%) of vitamin D deficient patients were symptomatic. Vitamin D deficient patient includes mild and severe vitamin D deficiency. The symptoms among vitamin D deficient were fatigability 187 (55.8%), muscle cramps 131 (39.1%), generalized myalgia 125 (37.31%), bone and joint pain 111 (33.13%). The symptoms were predominantly seen in patients with severe deficiency. Some patients with severe deficiency also have a history of hair fall (Table 2).\nA total of 263 (54.6%) females and 72 (14.97%) males had vitamin D deficiency (Table 3).\nSeventy-six (22.7%) of patients with vitamin D deficiency were between the 66-75 aged group followed by 36-45 aged groups with 68 (20.3%) patients, 26-35 aged groups with 63 (18.8%) patients, and 46-55 aged groups with 57 (17%) patients. The age group with the least number of patients with vitamin D deficiency was between 15-25 aged groups with 9 (1.87%).", "The results of this cross-sectional study done in a tertiary care hospital of Kathmandu, Nepal showed the prevalence of Vitamin D deficiency as 69.6%, of insufficiency as 16%, and sufficient Vitamin D in 14.3%. The prevalence was higher among older ages and females. A severe deficiency was seen in 16.2% of the studied population. The rates of Vitamin D deficiency found in this study are markedly higher than in many western countries like in Germany, Austria, and the Netherlands, in North Europe (Denmark, Finland, Ireland, and Poland), Canada, and the United Kingdom which have shown the prevalence of vitamin D deficiency from 10-55.5%.11,12\nMariam Omar et al. reported a deficiency of 76.1% and insufficiency of 15.2% among the population of Benghazi, a sunny second-largest city in the east of Libya.2 Our results share similar vitamin D deficiency status with some parts of Africa, Asia, and the Middle East. The prevalence of vitamin D deficiency in Egypt was 77%, insufficiency was 15%, and 9% of the population has sufficient Vitamin D levels. In Qatar, 83-91% of the population is deficient in Vitamin D.2,13\nVitamin D deficiency is considered to be a public health problem worldwide. Female gender is one of the most important predictors of vitamin D deficiency.2 In this study, 23.1% of the participants were males and 76.1% were females. Out of the studied population, 54.7% of the females and 15% of the males had vitamin D deficiency. This finding of increased prevalence seen in females is comparable to other studies and can be due to a sedentary lifestyle and aggressive sun protection. The greater participation of females in the studies may be due to the greater willingness of females to use health services.2 Babita Ghai et al. reported 73% of the female to be vitamin D deficient.14 In contrast, Manoharan et al. studied the vitamin D status among people of Tamil Nadu and reported that 46% of the males and 37% of the females had a vitamin D deficiency.15\nVitamin D deficiency was seen in 22.7% of patients between the 66-75 aged group and 20.3% in the 36-45 age group and 17% in 46-55 aged group patients. Various studies report a similar observation by demonstrating lower vitamin D levels with increasing ages and higher vitamin D deficiency states in the older age group, mandating early investigating and thus helping them to prevent falls and fractures.2,16\nIn the study, it was found that among the 335 vitamin D deficient patients, 228 (68.05%) of the participants had symptoms. The most common symptoms that led the participant to seek health services were fatigue, generalized myalgia, and bone pain. Fatigability was seen in 55.8%, muscle cramps in 39.1%, generalized myalgia in 39.1%, bone and joint pain in 33.13% of the vitamin D deficient patients. The symptoms were predominantly seen in patients with severe deficiency. Lubna M et al, in their study, showed that the most common reason for requesting vitamin D level included generalized myalgia and bone pain in 51% of the patients.17 Satyajeet Roy et al. showed the prevalence of low vitamin in inpatients as 77.2% with fatigue and fatigability was normalized after correction of vitamin D level.18\nOur study has demonstrated a high prevalence of vitamin D deficiency among patients visiting in our center. A larger multicentric or community based study with a diverse sample population should be conducted in the future to find out a more accurate prevalence. Similarly, other studies that further look into the association between gender and age and other comorbidities with vitamin D levels in Nepalese are warranted.", "Vitamin D deficiency was prevalent especially in females and elderly people. Fatigability was present in more than half of the vitamin D deficient patients. Muscle cramps and generalized myalgia were present in more than one third and bone and joint pain in almost one third of the vitamin D deficient patients." ]

[ "intro", "methods", "results", "discussion", "conclusions" ]

[ "\nNepal\n", "\nprevalence\n", "\nvitamin D deficiency\n" ]

[]

[ "vitamin", "deficiency", "vitamin deficiency", "patients", "study", "females", "deficient", "vitamin deficient", "participants", "population" ]

[ "vitamin deficient fatigability", "deficient vitamin factors", "mild vitamin deficient", "prevalence vitamin deficiency", "vitamin deficiency prevalent" ]

[ "Adult", "Biomarkers", "Case-Control Studies", "Cytokines", "Down-Regulation", "Female", "Humans", "Interleukins", "Leukocytes, Mononuclear", "Male", "Middle Aged", "Periodontitis", "Retrospective Studies" ]

[ "INTRODUCTION", "Patients", "Inclusion and exclusion criteria", "Inclusion", "Exclusion", "Periodontitis severity criteria", "RNA isolation", "RT‐qPCR", "Determination of cytokines", "Statistical and datasets analysis", "Clinical characteristics", "Discovery of IL36RN expression in periodontitis", "Validation of IL36RN in PBMC and plasma of periodontitis", "Three different cytokines expression in PBMC of periodontitis", "Significance of IL36RN in mild, moderate, and severe periodontitis" ]

[ "Periodontitis, common but largely preventable, is a chronic and multifactorial inflammatory disease that damages the supporting soft tissue and bone of teeth.1, 2 Patients with periodontitis disease may last for a duration of several months or years. The interaction between periodontal pathogens and host inflammatory and immune responses is involved in the pathogenesis of periodontitis.2 Certain diseases, such as Crohn's disease,3 asthma,4 rheumatoid arthritis,5 and diabetes mellitus,6 were reported to increase the risk of periodontitis. Complicated immune responses in the body might be playing a critical role in the progression of tissue damagement in periodontitis.7, 8\n\nInterleukin‐36 (IL‐36), one member of the interleukin‐1 (IL‐1) superfamily, has subfamily members known as three agonists (IL‐36α, IL‐36β, and IL‐36γ) and two antagonists (interleukin‐36 receptor antagonist (IL‐36Ra and IL‐38)).9 IL‐36Ra is an anti‐inflammatory mediator which takes responsibility for the tight regulation of IL‐36 signaling.9 The IL36RN gene encodes IL‐36Ra. Various inflammatory diseases, such as inflammatory skin disorders, Crohn's disease, and rheumatoid arthritis have increasingly connected with IL‐36 related cytokines.10, 11, 12\n\nIn periodontitis, IL‐1, IL‐6, IL‐17A, and tumor necrosis factor‐α (TNF‐α) known as pro‐inflammatory cytokines cause body immune responses to oral bacteria specifically called Porphyromonas gingivalis.13 Kübra et al. reported that active periodontal disease may cause downregulation of inflammasome regulators and they may increase the activity of IL‐1β in periodontal disease including periodontitis.14 Alexandra et al. found that IL‐36γ could be a key inflammatory player in periodontitis and its associated alveolar bone resorption and could be a therapeutic target.2 Patrick R. et al. checked the serum, saliva, gingival cervical fluid (GCF), and gingival biopsies of patients who suffer from inflammatory periodontal disease and found the presence of elevated levels of IL‐35.15 In this context, several interleukins might be acting as mutated genes in periodontitis disease and may be playing an important role in occurring and progression of periodontitis.\nIL‐36 has been evaluated in diverse inflammatory diseases.16 However, the role of IL‐36RN, a mutated gene expression of IL‐36 in periodontitis patients with peripheral blood mononuclear cells (PBMC) and plasma remains unknown. Our study aims to find IL36RN in PBMC and plasma of the periodontitis patients and its clinical significance.", "A total of 194 cases of periodontitis and healthy control samples with PBMC and plasma were retrospectively accumulated from GEO‐based Affiliated Hospital of Beihua University. The patients were recruited from August 2018 to January 2020. All patients signed informed consent during their hospital stay, and the study was authorized by the ethics committee of Affiliated Hospital of Beihua University and was conducted following the Declaration of Helsinki guidelines (2018080375).", "Inclusion Periodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nPeriodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nExclusion Patients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.\nPatients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.", "Periodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.", "Patients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.", "Mild periodontitis: ≥2 interproximal sites with clinical attachment loss ≥3 mm, and ≥2 interproximal sites with probing depth ≥4 mm (not on same tooth) or one site with probing depth ≥5 mm.\nModerate periodontitis: ≥2 interproximal sites with clinical attachment loss ≥4 mm (not on same tooth), or ≥2 interproximal sites with probing depth ≥5 mm (not on same tooth).\nSevere periodontitis: ≥2 interproximal sites with clinical attachment loss ≥6 mm (not on same tooth) and ≥1 interproximal site with probing depth ≥5 mm.", "Total RNA was extracted by using the solutions of phenol‐chloroform afterward managing the homogenization by guanidine isothiocyanate (Trizol RNA Preparation kit). RNA concentration evaluated by NanoDrop spectrophotometer ND1000 (NanoDrop Technologies Inc.).", "The total RNA in the PBMC and plasma samples after transfection was extracted using Trizol reagent according to instructions. Thereafter, the total RNA was reverse‐transcribed into cDNA by the reverse transcription kit (provided by Shanghai Sangon Biological Engineering Co., LTD). The primers used are as follows: IL36RN 5′‐F: AGGCGCCAGAGGCACCATGGAC‐3′, R: 5′‐CATCCTGTGCGTTGGCTGCC‐3′, U6 F: 5′‐GAAGGTGAAGGTCGGAGTC‐3′, R: 5′‐GAAGATGGTGATGGGATTT‐3′. PCR reaction conditions were as follows: A: Pre‐denaturation at 95℃ for 10 min; B: Denaturation 95℃ 15 s; Annealing at 60℃ for 15 s, elongation at 72℃ for 20 s, a total of 40 cycles. C: 72℃ for 15 min. The reaction is terminated at 4℃. Three replicates were set for each sample, and 2−△△Ct was used for relative quantitative analysis of the data.", "The levels of IL‐6, TNF‐α and IL‐1β were detected with corresponding Enzyme Linked Immunosorbent Assay (Elisa) kits (ThermoFisher Scientific) according to the instruction of the kit.", "SPSS 20.0 version (SPSS Inc.) software was utilized for all the statistical analysis of the study and data were expressed as mean ± SD. Bioinformatics tools were used to analyze heatmap, volcano map, Gene Ontology (GO) and Kyoto Encylopedia of Genes and Genomes (KEGG) enrichment pathways from the GEO database. T‐test was performed for comparing the two groups. One‐way ANOVA analysis was used to compare multiple groups. Pearson correlation was used for correlation analysis. The clinical significance of IL36RN was evaluated in PBMC and plasma by the receiver operating curve (ROC) using the area under the curve (AUC). p < 0.05 was considered to be representing statistically significant.", "A total of 194 participants were enrolled to evaluate IL36RN expression through PBMC and plasma samples of periodontitis (n = 97) and healthy controls (n = 97). Further, the patients and healthy controls were characterized by clinical parameters such as age, gender, bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level. Among both groups, the parameters of bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level were statistically significant (Table 1).\nClinical characteristics of the periodontitis patients and healthy controls", "Bioinformatics tools were used to discover IL36RN mutated gene in between periodontitis patients and healthy control of GEO dataset (GSE23586) via heatmap, volcano and box plot analyses (Figure 1A‐C). These heatmap and volcano plot results demonstrated that the IL36RN mutated gene was significantly down‐regulated, which was further validated by the GSE23586 dataset of periodontitis and healthy controls as per box plot (Figure 1C). In the box plot, the IL36RN expressions were lowered in periodontitis patients compared to healthy controls significantly (Figure 1C, p < 0.05).\nDiscovery of IL36RN in periodontitis patients and healthy controls using GEO database analysis. (A) Volcano map showed significant up‐ and down‐regulated mRNA gene expression through log2‐fold change and log10 p‐values. (B) Heatmap clustering represented up‐ and down‐regulated expressed genes between 2 groups using fold change. (C) The comparison of IL36RN expression between 2 groups. G1: Healthy control G2: Periodontitis\nFurthermore, the GO database analysis represented the top‐20 significant up‐ and down‐regulated genes associated to GO enriched pathways of periodontitis and healthy control groups (Figure 2A,B, p < 0.05). Likewise, similar up‐ and down‐regulated genes related top‐20 significant KEGG pathways were observed through the KEGG pathway database (Figure 3A,B, p < 0.05).\nThe top‐20 GO enrichment pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated GO enrichment pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot\nThe top‐20 KEGG pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated KEGG enriched pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot", "To validate between PBMC and plasma of IL36RN expressions were shown by scatter plots in 97 periodontitis patients and 97 healthy controls. Herein, IL36RN expressions were notably down‐regulated in PBMC and plasma of periodontitis patients compared to the healthy control group (Figure 4A,B, p < 0.05). Further, a positive correlation of IL36RN expression was significantly observed between PBMC and plasma of periodontitis patients in Figure 4C, (r = 0.409, p < 0.001) Therefore, the expression level of IL36RN in PBMC was directly correlated to plasma of periodontitis patients.\nValidation of IL‐36RN mRNA expression between healthy control (n = 97) and periodontitis (n = 97) groups. (A) PBMC, (B) Plasma, (C) Correlation‐based scatter plot between PBMC and plasma", "Serum‐based IL‐6, TNF‐α and IL‐1β, three different cytokines expression were demonstrated in PBMC of periodontitis and healthy controls. Overall, these three different cytokines were highly expressed in periodontitis patients compared to healthy controls (Figure 5A‐C, p < 0.05). Meanwhile, IL36RN expression in PBMC was negatively correlated to these serum‐based three different cytokines of periodontitis patients (Figure 6A‐C, p < 0.05). Thus, IL‐6, TNF‐α, and IL‐1β were inversely correlated and up‐regulated expressions, which are in contrast to IL36RN.\nExpression of three different cytokines in serum of healthy control (n = 97) and periodontitis (n = 97) groups. (A) IL‐6, (B) TNF‐α, (C) IL‐1β\nCorrelation between IL‐36RN expression and serum levels of three cytokines among periodontitis patients. (A) IL‐6, (B) TNF‐α, (C) IL‐1β", "Besides, IL36RN expression and significance were observed in mild‐to‐severe periodontitis patients with PBMC and plasma samples. Herein, the mild periodontitis showed significantly higher expression of IL36RN in PBMC and plasma compared to moderate and severe periodontitis (Figure 7A,B, p < 0.05). Similarly, moderate periodontitis showed higher expression of IL36RN than severe periodontitis whereas lower expression than mild periodontitis patients (Figure 7A,B, p < 0.05). While severe periodontitis represented the lowest expression of IL36RN among PBMC and plasma of mild and moderate periodontitis patients (Figure 7A,B, p < 0.05).\nIL36RN mRNA expression in mild (n = 40) moderate (n = 32) and severe (n = 25) periodontitis patients. (A) PBMC, (B) Plasma\nThe ROC‐AUC achieved a significantly higher of 0.875 (95% confidence interval(CI) = 0.7882‐0.9618, p < 0.05) in mild vs severe periodontitis with PBMC whereas moderate vs severe periodontitis with PBMC achieved AUC of 0.805 (95% CI = 0.6847‐0.9253, p < 0.05) (Figure 8A,B). Subsequently, in plasma, mild vs severe periodontitis patients yielded AUC of 0.839 (95% CI = 0.7451‐0.9329, p < 0.05) while moderate to severe periodontitis patients obtained a significant AUC of 0.731 (95% CI = 0.6014‐0.8611, p < 0.05) (Figure 8C,D). Thus, the diagnostic value of IL36RN can accurately distinguish between mild‐to‐severe or moderate‐to‐severe periodontitis patients with PBMC and plasma, and further may provide potential significance in diagnosing periodontitis.\nDiagnostic value of IL36RN for distinguishing mild or moderate patients from severe periodontitis patients. (A) PBMC of mild vs severe, (B) PBMC of moderate vs severe, (C) Plasma of mild vs severe, (D) Plasma of moderate vs severe" ]

[ null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "MATERIALS AND METHODS", "Patients", "Inclusion and exclusion criteria", "Inclusion", "Exclusion", "Periodontitis severity criteria", "RNA isolation", "RT‐qPCR", "Determination of cytokines", "Statistical and datasets analysis", "RESULTS", "Clinical characteristics", "Discovery of IL36RN expression in periodontitis", "Validation of IL36RN in PBMC and plasma of periodontitis", "Three different cytokines expression in PBMC of periodontitis", "Significance of IL36RN in mild, moderate, and severe periodontitis", "DISCUSSION", "CONCLUSION", "CONFLICTS OF INTERESTS" ]

[ "Periodontitis, common but largely preventable, is a chronic and multifactorial inflammatory disease that damages the supporting soft tissue and bone of teeth.1, 2 Patients with periodontitis disease may last for a duration of several months or years. The interaction between periodontal pathogens and host inflammatory and immune responses is involved in the pathogenesis of periodontitis.2 Certain diseases, such as Crohn's disease,3 asthma,4 rheumatoid arthritis,5 and diabetes mellitus,6 were reported to increase the risk of periodontitis. Complicated immune responses in the body might be playing a critical role in the progression of tissue damagement in periodontitis.7, 8\n\nInterleukin‐36 (IL‐36), one member of the interleukin‐1 (IL‐1) superfamily, has subfamily members known as three agonists (IL‐36α, IL‐36β, and IL‐36γ) and two antagonists (interleukin‐36 receptor antagonist (IL‐36Ra and IL‐38)).9 IL‐36Ra is an anti‐inflammatory mediator which takes responsibility for the tight regulation of IL‐36 signaling.9 The IL36RN gene encodes IL‐36Ra. Various inflammatory diseases, such as inflammatory skin disorders, Crohn's disease, and rheumatoid arthritis have increasingly connected with IL‐36 related cytokines.10, 11, 12\n\nIn periodontitis, IL‐1, IL‐6, IL‐17A, and tumor necrosis factor‐α (TNF‐α) known as pro‐inflammatory cytokines cause body immune responses to oral bacteria specifically called Porphyromonas gingivalis.13 Kübra et al. reported that active periodontal disease may cause downregulation of inflammasome regulators and they may increase the activity of IL‐1β in periodontal disease including periodontitis.14 Alexandra et al. found that IL‐36γ could be a key inflammatory player in periodontitis and its associated alveolar bone resorption and could be a therapeutic target.2 Patrick R. et al. checked the serum, saliva, gingival cervical fluid (GCF), and gingival biopsies of patients who suffer from inflammatory periodontal disease and found the presence of elevated levels of IL‐35.15 In this context, several interleukins might be acting as mutated genes in periodontitis disease and may be playing an important role in occurring and progression of periodontitis.\nIL‐36 has been evaluated in diverse inflammatory diseases.16 However, the role of IL‐36RN, a mutated gene expression of IL‐36 in periodontitis patients with peripheral blood mononuclear cells (PBMC) and plasma remains unknown. Our study aims to find IL36RN in PBMC and plasma of the periodontitis patients and its clinical significance.", "Patients A total of 194 cases of periodontitis and healthy control samples with PBMC and plasma were retrospectively accumulated from GEO‐based Affiliated Hospital of Beihua University. The patients were recruited from August 2018 to January 2020. All patients signed informed consent during their hospital stay, and the study was authorized by the ethics committee of Affiliated Hospital of Beihua University and was conducted following the Declaration of Helsinki guidelines (2018080375).\nA total of 194 cases of periodontitis and healthy control samples with PBMC and plasma were retrospectively accumulated from GEO‐based Affiliated Hospital of Beihua University. The patients were recruited from August 2018 to January 2020. All patients signed informed consent during their hospital stay, and the study was authorized by the ethics committee of Affiliated Hospital of Beihua University and was conducted following the Declaration of Helsinki guidelines (2018080375).\nInclusion and exclusion criteria Inclusion Periodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nPeriodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nExclusion Patients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.\nPatients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.\nInclusion Periodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nPeriodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nExclusion Patients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.\nPatients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.\nPeriodontitis severity criteria Mild periodontitis: ≥2 interproximal sites with clinical attachment loss ≥3 mm, and ≥2 interproximal sites with probing depth ≥4 mm (not on same tooth) or one site with probing depth ≥5 mm.\nModerate periodontitis: ≥2 interproximal sites with clinical attachment loss ≥4 mm (not on same tooth), or ≥2 interproximal sites with probing depth ≥5 mm (not on same tooth).\nSevere periodontitis: ≥2 interproximal sites with clinical attachment loss ≥6 mm (not on same tooth) and ≥1 interproximal site with probing depth ≥5 mm.\nMild periodontitis: ≥2 interproximal sites with clinical attachment loss ≥3 mm, and ≥2 interproximal sites with probing depth ≥4 mm (not on same tooth) or one site with probing depth ≥5 mm.\nModerate periodontitis: ≥2 interproximal sites with clinical attachment loss ≥4 mm (not on same tooth), or ≥2 interproximal sites with probing depth ≥5 mm (not on same tooth).\nSevere periodontitis: ≥2 interproximal sites with clinical attachment loss ≥6 mm (not on same tooth) and ≥1 interproximal site with probing depth ≥5 mm.\nRNA isolation Total RNA was extracted by using the solutions of phenol‐chloroform afterward managing the homogenization by guanidine isothiocyanate (Trizol RNA Preparation kit). RNA concentration evaluated by NanoDrop spectrophotometer ND1000 (NanoDrop Technologies Inc.).\nTotal RNA was extracted by using the solutions of phenol‐chloroform afterward managing the homogenization by guanidine isothiocyanate (Trizol RNA Preparation kit). RNA concentration evaluated by NanoDrop spectrophotometer ND1000 (NanoDrop Technologies Inc.).\nRT‐qPCR The total RNA in the PBMC and plasma samples after transfection was extracted using Trizol reagent according to instructions. Thereafter, the total RNA was reverse‐transcribed into cDNA by the reverse transcription kit (provided by Shanghai Sangon Biological Engineering Co., LTD). The primers used are as follows: IL36RN 5′‐F: AGGCGCCAGAGGCACCATGGAC‐3′, R: 5′‐CATCCTGTGCGTTGGCTGCC‐3′, U6 F: 5′‐GAAGGTGAAGGTCGGAGTC‐3′, R: 5′‐GAAGATGGTGATGGGATTT‐3′. PCR reaction conditions were as follows: A: Pre‐denaturation at 95℃ for 10 min; B: Denaturation 95℃ 15 s; Annealing at 60℃ for 15 s, elongation at 72℃ for 20 s, a total of 40 cycles. C: 72℃ for 15 min. The reaction is terminated at 4℃. Three replicates were set for each sample, and 2−△△Ct was used for relative quantitative analysis of the data.\nThe total RNA in the PBMC and plasma samples after transfection was extracted using Trizol reagent according to instructions. Thereafter, the total RNA was reverse‐transcribed into cDNA by the reverse transcription kit (provided by Shanghai Sangon Biological Engineering Co., LTD). The primers used are as follows: IL36RN 5′‐F: AGGCGCCAGAGGCACCATGGAC‐3′, R: 5′‐CATCCTGTGCGTTGGCTGCC‐3′, U6 F: 5′‐GAAGGTGAAGGTCGGAGTC‐3′, R: 5′‐GAAGATGGTGATGGGATTT‐3′. PCR reaction conditions were as follows: A: Pre‐denaturation at 95℃ for 10 min; B: Denaturation 95℃ 15 s; Annealing at 60℃ for 15 s, elongation at 72℃ for 20 s, a total of 40 cycles. C: 72℃ for 15 min. The reaction is terminated at 4℃. Three replicates were set for each sample, and 2−△△Ct was used for relative quantitative analysis of the data.\nDetermination of cytokines The levels of IL‐6, TNF‐α and IL‐1β were detected with corresponding Enzyme Linked Immunosorbent Assay (Elisa) kits (ThermoFisher Scientific) according to the instruction of the kit.\nThe levels of IL‐6, TNF‐α and IL‐1β were detected with corresponding Enzyme Linked Immunosorbent Assay (Elisa) kits (ThermoFisher Scientific) according to the instruction of the kit.\nStatistical and datasets analysis SPSS 20.0 version (SPSS Inc.) software was utilized for all the statistical analysis of the study and data were expressed as mean ± SD. Bioinformatics tools were used to analyze heatmap, volcano map, Gene Ontology (GO) and Kyoto Encylopedia of Genes and Genomes (KEGG) enrichment pathways from the GEO database. T‐test was performed for comparing the two groups. One‐way ANOVA analysis was used to compare multiple groups. Pearson correlation was used for correlation analysis. The clinical significance of IL36RN was evaluated in PBMC and plasma by the receiver operating curve (ROC) using the area under the curve (AUC). p < 0.05 was considered to be representing statistically significant.\nSPSS 20.0 version (SPSS Inc.) software was utilized for all the statistical analysis of the study and data were expressed as mean ± SD. Bioinformatics tools were used to analyze heatmap, volcano map, Gene Ontology (GO) and Kyoto Encylopedia of Genes and Genomes (KEGG) enrichment pathways from the GEO database. T‐test was performed for comparing the two groups. One‐way ANOVA analysis was used to compare multiple groups. Pearson correlation was used for correlation analysis. The clinical significance of IL36RN was evaluated in PBMC and plasma by the receiver operating curve (ROC) using the area under the curve (AUC). p < 0.05 was considered to be representing statistically significant.", "A total of 194 cases of periodontitis and healthy control samples with PBMC and plasma were retrospectively accumulated from GEO‐based Affiliated Hospital of Beihua University. The patients were recruited from August 2018 to January 2020. All patients signed informed consent during their hospital stay, and the study was authorized by the ethics committee of Affiliated Hospital of Beihua University and was conducted following the Declaration of Helsinki guidelines (2018080375).", "Inclusion Periodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nPeriodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.\nExclusion Patients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.\nPatients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.", "Periodontitis patients: Age ≥35 years old; residual teeth ≥20 (2 teeth in each quadrant); probing depth ≥6 mm; clinical attachment loss ≥5 mm; absorption of Alveolar bone≥Ⅰdegree. Healthy control: age >18 years old; No history of periodontal disease and missing teeth; no gingival swelling, spontaneous bleeding, bleeding on probing and probing depth <3 mm.", "Patients suffered from systemic diseases such as diabetes and immune dysfunction. Patients who took anti‐inflammatory drugs and anti‐tumor drugs three months before treatment; Patients with oral local radiotherapy; Smoking and excessive drinking; Female in pregnancy or lactation.", "Mild periodontitis: ≥2 interproximal sites with clinical attachment loss ≥3 mm, and ≥2 interproximal sites with probing depth ≥4 mm (not on same tooth) or one site with probing depth ≥5 mm.\nModerate periodontitis: ≥2 interproximal sites with clinical attachment loss ≥4 mm (not on same tooth), or ≥2 interproximal sites with probing depth ≥5 mm (not on same tooth).\nSevere periodontitis: ≥2 interproximal sites with clinical attachment loss ≥6 mm (not on same tooth) and ≥1 interproximal site with probing depth ≥5 mm.", "Total RNA was extracted by using the solutions of phenol‐chloroform afterward managing the homogenization by guanidine isothiocyanate (Trizol RNA Preparation kit). RNA concentration evaluated by NanoDrop spectrophotometer ND1000 (NanoDrop Technologies Inc.).", "The total RNA in the PBMC and plasma samples after transfection was extracted using Trizol reagent according to instructions. Thereafter, the total RNA was reverse‐transcribed into cDNA by the reverse transcription kit (provided by Shanghai Sangon Biological Engineering Co., LTD). The primers used are as follows: IL36RN 5′‐F: AGGCGCCAGAGGCACCATGGAC‐3′, R: 5′‐CATCCTGTGCGTTGGCTGCC‐3′, U6 F: 5′‐GAAGGTGAAGGTCGGAGTC‐3′, R: 5′‐GAAGATGGTGATGGGATTT‐3′. PCR reaction conditions were as follows: A: Pre‐denaturation at 95℃ for 10 min; B: Denaturation 95℃ 15 s; Annealing at 60℃ for 15 s, elongation at 72℃ for 20 s, a total of 40 cycles. C: 72℃ for 15 min. The reaction is terminated at 4℃. Three replicates were set for each sample, and 2−△△Ct was used for relative quantitative analysis of the data.", "The levels of IL‐6, TNF‐α and IL‐1β were detected with corresponding Enzyme Linked Immunosorbent Assay (Elisa) kits (ThermoFisher Scientific) according to the instruction of the kit.", "SPSS 20.0 version (SPSS Inc.) software was utilized for all the statistical analysis of the study and data were expressed as mean ± SD. Bioinformatics tools were used to analyze heatmap, volcano map, Gene Ontology (GO) and Kyoto Encylopedia of Genes and Genomes (KEGG) enrichment pathways from the GEO database. T‐test was performed for comparing the two groups. One‐way ANOVA analysis was used to compare multiple groups. Pearson correlation was used for correlation analysis. The clinical significance of IL36RN was evaluated in PBMC and plasma by the receiver operating curve (ROC) using the area under the curve (AUC). p < 0.05 was considered to be representing statistically significant.", "Clinical characteristics A total of 194 participants were enrolled to evaluate IL36RN expression through PBMC and plasma samples of periodontitis (n = 97) and healthy controls (n = 97). Further, the patients and healthy controls were characterized by clinical parameters such as age, gender, bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level. Among both groups, the parameters of bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level were statistically significant (Table 1).\nClinical characteristics of the periodontitis patients and healthy controls\nA total of 194 participants were enrolled to evaluate IL36RN expression through PBMC and plasma samples of periodontitis (n = 97) and healthy controls (n = 97). Further, the patients and healthy controls were characterized by clinical parameters such as age, gender, bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level. Among both groups, the parameters of bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level were statistically significant (Table 1).\nClinical characteristics of the periodontitis patients and healthy controls\nDiscovery of IL36RN expression in periodontitis Bioinformatics tools were used to discover IL36RN mutated gene in between periodontitis patients and healthy control of GEO dataset (GSE23586) via heatmap, volcano and box plot analyses (Figure 1A‐C). These heatmap and volcano plot results demonstrated that the IL36RN mutated gene was significantly down‐regulated, which was further validated by the GSE23586 dataset of periodontitis and healthy controls as per box plot (Figure 1C). In the box plot, the IL36RN expressions were lowered in periodontitis patients compared to healthy controls significantly (Figure 1C, p < 0.05).\nDiscovery of IL36RN in periodontitis patients and healthy controls using GEO database analysis. (A) Volcano map showed significant up‐ and down‐regulated mRNA gene expression through log2‐fold change and log10 p‐values. (B) Heatmap clustering represented up‐ and down‐regulated expressed genes between 2 groups using fold change. (C) The comparison of IL36RN expression between 2 groups. G1: Healthy control G2: Periodontitis\nFurthermore, the GO database analysis represented the top‐20 significant up‐ and down‐regulated genes associated to GO enriched pathways of periodontitis and healthy control groups (Figure 2A,B, p < 0.05). Likewise, similar up‐ and down‐regulated genes related top‐20 significant KEGG pathways were observed through the KEGG pathway database (Figure 3A,B, p < 0.05).\nThe top‐20 GO enrichment pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated GO enrichment pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot\nThe top‐20 KEGG pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated KEGG enriched pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot\nBioinformatics tools were used to discover IL36RN mutated gene in between periodontitis patients and healthy control of GEO dataset (GSE23586) via heatmap, volcano and box plot analyses (Figure 1A‐C). These heatmap and volcano plot results demonstrated that the IL36RN mutated gene was significantly down‐regulated, which was further validated by the GSE23586 dataset of periodontitis and healthy controls as per box plot (Figure 1C). In the box plot, the IL36RN expressions were lowered in periodontitis patients compared to healthy controls significantly (Figure 1C, p < 0.05).\nDiscovery of IL36RN in periodontitis patients and healthy controls using GEO database analysis. (A) Volcano map showed significant up‐ and down‐regulated mRNA gene expression through log2‐fold change and log10 p‐values. (B) Heatmap clustering represented up‐ and down‐regulated expressed genes between 2 groups using fold change. (C) The comparison of IL36RN expression between 2 groups. G1: Healthy control G2: Periodontitis\nFurthermore, the GO database analysis represented the top‐20 significant up‐ and down‐regulated genes associated to GO enriched pathways of periodontitis and healthy control groups (Figure 2A,B, p < 0.05). Likewise, similar up‐ and down‐regulated genes related top‐20 significant KEGG pathways were observed through the KEGG pathway database (Figure 3A,B, p < 0.05).\nThe top‐20 GO enrichment pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated GO enrichment pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot\nThe top‐20 KEGG pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated KEGG enriched pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot\nValidation of IL36RN in PBMC and plasma of periodontitis To validate between PBMC and plasma of IL36RN expressions were shown by scatter plots in 97 periodontitis patients and 97 healthy controls. Herein, IL36RN expressions were notably down‐regulated in PBMC and plasma of periodontitis patients compared to the healthy control group (Figure 4A,B, p < 0.05). Further, a positive correlation of IL36RN expression was significantly observed between PBMC and plasma of periodontitis patients in Figure 4C, (r = 0.409, p < 0.001) Therefore, the expression level of IL36RN in PBMC was directly correlated to plasma of periodontitis patients.\nValidation of IL‐36RN mRNA expression between healthy control (n = 97) and periodontitis (n = 97) groups. (A) PBMC, (B) Plasma, (C) Correlation‐based scatter plot between PBMC and plasma\nTo validate between PBMC and plasma of IL36RN expressions were shown by scatter plots in 97 periodontitis patients and 97 healthy controls. Herein, IL36RN expressions were notably down‐regulated in PBMC and plasma of periodontitis patients compared to the healthy control group (Figure 4A,B, p < 0.05). Further, a positive correlation of IL36RN expression was significantly observed between PBMC and plasma of periodontitis patients in Figure 4C, (r = 0.409, p < 0.001) Therefore, the expression level of IL36RN in PBMC was directly correlated to plasma of periodontitis patients.\nValidation of IL‐36RN mRNA expression between healthy control (n = 97) and periodontitis (n = 97) groups. (A) PBMC, (B) Plasma, (C) Correlation‐based scatter plot between PBMC and plasma\nThree different cytokines expression in PBMC of periodontitis Serum‐based IL‐6, TNF‐α and IL‐1β, three different cytokines expression were demonstrated in PBMC of periodontitis and healthy controls. Overall, these three different cytokines were highly expressed in periodontitis patients compared to healthy controls (Figure 5A‐C, p < 0.05). Meanwhile, IL36RN expression in PBMC was negatively correlated to these serum‐based three different cytokines of periodontitis patients (Figure 6A‐C, p < 0.05). Thus, IL‐6, TNF‐α, and IL‐1β were inversely correlated and up‐regulated expressions, which are in contrast to IL36RN.\nExpression of three different cytokines in serum of healthy control (n = 97) and periodontitis (n = 97) groups. (A) IL‐6, (B) TNF‐α, (C) IL‐1β\nCorrelation between IL‐36RN expression and serum levels of three cytokines among periodontitis patients. (A) IL‐6, (B) TNF‐α, (C) IL‐1β\nSerum‐based IL‐6, TNF‐α and IL‐1β, three different cytokines expression were demonstrated in PBMC of periodontitis and healthy controls. Overall, these three different cytokines were highly expressed in periodontitis patients compared to healthy controls (Figure 5A‐C, p < 0.05). Meanwhile, IL36RN expression in PBMC was negatively correlated to these serum‐based three different cytokines of periodontitis patients (Figure 6A‐C, p < 0.05). Thus, IL‐6, TNF‐α, and IL‐1β were inversely correlated and up‐regulated expressions, which are in contrast to IL36RN.\nExpression of three different cytokines in serum of healthy control (n = 97) and periodontitis (n = 97) groups. (A) IL‐6, (B) TNF‐α, (C) IL‐1β\nCorrelation between IL‐36RN expression and serum levels of three cytokines among periodontitis patients. (A) IL‐6, (B) TNF‐α, (C) IL‐1β\nSignificance of IL36RN in mild, moderate, and severe periodontitis Besides, IL36RN expression and significance were observed in mild‐to‐severe periodontitis patients with PBMC and plasma samples. Herein, the mild periodontitis showed significantly higher expression of IL36RN in PBMC and plasma compared to moderate and severe periodontitis (Figure 7A,B, p < 0.05). Similarly, moderate periodontitis showed higher expression of IL36RN than severe periodontitis whereas lower expression than mild periodontitis patients (Figure 7A,B, p < 0.05). While severe periodontitis represented the lowest expression of IL36RN among PBMC and plasma of mild and moderate periodontitis patients (Figure 7A,B, p < 0.05).\nIL36RN mRNA expression in mild (n = 40) moderate (n = 32) and severe (n = 25) periodontitis patients. (A) PBMC, (B) Plasma\nThe ROC‐AUC achieved a significantly higher of 0.875 (95% confidence interval(CI) = 0.7882‐0.9618, p < 0.05) in mild vs severe periodontitis with PBMC whereas moderate vs severe periodontitis with PBMC achieved AUC of 0.805 (95% CI = 0.6847‐0.9253, p < 0.05) (Figure 8A,B). Subsequently, in plasma, mild vs severe periodontitis patients yielded AUC of 0.839 (95% CI = 0.7451‐0.9329, p < 0.05) while moderate to severe periodontitis patients obtained a significant AUC of 0.731 (95% CI = 0.6014‐0.8611, p < 0.05) (Figure 8C,D). Thus, the diagnostic value of IL36RN can accurately distinguish between mild‐to‐severe or moderate‐to‐severe periodontitis patients with PBMC and plasma, and further may provide potential significance in diagnosing periodontitis.\nDiagnostic value of IL36RN for distinguishing mild or moderate patients from severe periodontitis patients. (A) PBMC of mild vs severe, (B) PBMC of moderate vs severe, (C) Plasma of mild vs severe, (D) Plasma of moderate vs severe\nBesides, IL36RN expression and significance were observed in mild‐to‐severe periodontitis patients with PBMC and plasma samples. Herein, the mild periodontitis showed significantly higher expression of IL36RN in PBMC and plasma compared to moderate and severe periodontitis (Figure 7A,B, p < 0.05). Similarly, moderate periodontitis showed higher expression of IL36RN than severe periodontitis whereas lower expression than mild periodontitis patients (Figure 7A,B, p < 0.05). While severe periodontitis represented the lowest expression of IL36RN among PBMC and plasma of mild and moderate periodontitis patients (Figure 7A,B, p < 0.05).\nIL36RN mRNA expression in mild (n = 40) moderate (n = 32) and severe (n = 25) periodontitis patients. (A) PBMC, (B) Plasma\nThe ROC‐AUC achieved a significantly higher of 0.875 (95% confidence interval(CI) = 0.7882‐0.9618, p < 0.05) in mild vs severe periodontitis with PBMC whereas moderate vs severe periodontitis with PBMC achieved AUC of 0.805 (95% CI = 0.6847‐0.9253, p < 0.05) (Figure 8A,B). Subsequently, in plasma, mild vs severe periodontitis patients yielded AUC of 0.839 (95% CI = 0.7451‐0.9329, p < 0.05) while moderate to severe periodontitis patients obtained a significant AUC of 0.731 (95% CI = 0.6014‐0.8611, p < 0.05) (Figure 8C,D). Thus, the diagnostic value of IL36RN can accurately distinguish between mild‐to‐severe or moderate‐to‐severe periodontitis patients with PBMC and plasma, and further may provide potential significance in diagnosing periodontitis.\nDiagnostic value of IL36RN for distinguishing mild or moderate patients from severe periodontitis patients. (A) PBMC of mild vs severe, (B) PBMC of moderate vs severe, (C) Plasma of mild vs severe, (D) Plasma of moderate vs severe", "A total of 194 participants were enrolled to evaluate IL36RN expression through PBMC and plasma samples of periodontitis (n = 97) and healthy controls (n = 97). Further, the patients and healthy controls were characterized by clinical parameters such as age, gender, bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level. Among both groups, the parameters of bleeding on probing, oral hygiene index, pocket depth, and clinical achievement level were statistically significant (Table 1).\nClinical characteristics of the periodontitis patients and healthy controls", "Bioinformatics tools were used to discover IL36RN mutated gene in between periodontitis patients and healthy control of GEO dataset (GSE23586) via heatmap, volcano and box plot analyses (Figure 1A‐C). These heatmap and volcano plot results demonstrated that the IL36RN mutated gene was significantly down‐regulated, which was further validated by the GSE23586 dataset of periodontitis and healthy controls as per box plot (Figure 1C). In the box plot, the IL36RN expressions were lowered in periodontitis patients compared to healthy controls significantly (Figure 1C, p < 0.05).\nDiscovery of IL36RN in periodontitis patients and healthy controls using GEO database analysis. (A) Volcano map showed significant up‐ and down‐regulated mRNA gene expression through log2‐fold change and log10 p‐values. (B) Heatmap clustering represented up‐ and down‐regulated expressed genes between 2 groups using fold change. (C) The comparison of IL36RN expression between 2 groups. G1: Healthy control G2: Periodontitis\nFurthermore, the GO database analysis represented the top‐20 significant up‐ and down‐regulated genes associated to GO enriched pathways of periodontitis and healthy control groups (Figure 2A,B, p < 0.05). Likewise, similar up‐ and down‐regulated genes related top‐20 significant KEGG pathways were observed through the KEGG pathway database (Figure 3A,B, p < 0.05).\nThe top‐20 GO enrichment pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated GO enrichment pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot\nThe top‐20 KEGG pathway analysis of up‐ and down‐regulated genes. (A) Up‐regulated KEGG enriched pathways using bubble plot. (B) Down‐regulated GO enrichment pathways using bubble plot", "To validate between PBMC and plasma of IL36RN expressions were shown by scatter plots in 97 periodontitis patients and 97 healthy controls. Herein, IL36RN expressions were notably down‐regulated in PBMC and plasma of periodontitis patients compared to the healthy control group (Figure 4A,B, p < 0.05). Further, a positive correlation of IL36RN expression was significantly observed between PBMC and plasma of periodontitis patients in Figure 4C, (r = 0.409, p < 0.001) Therefore, the expression level of IL36RN in PBMC was directly correlated to plasma of periodontitis patients.\nValidation of IL‐36RN mRNA expression between healthy control (n = 97) and periodontitis (n = 97) groups. (A) PBMC, (B) Plasma, (C) Correlation‐based scatter plot between PBMC and plasma", "Serum‐based IL‐6, TNF‐α and IL‐1β, three different cytokines expression were demonstrated in PBMC of periodontitis and healthy controls. Overall, these three different cytokines were highly expressed in periodontitis patients compared to healthy controls (Figure 5A‐C, p < 0.05). Meanwhile, IL36RN expression in PBMC was negatively correlated to these serum‐based three different cytokines of periodontitis patients (Figure 6A‐C, p < 0.05). Thus, IL‐6, TNF‐α, and IL‐1β were inversely correlated and up‐regulated expressions, which are in contrast to IL36RN.\nExpression of three different cytokines in serum of healthy control (n = 97) and periodontitis (n = 97) groups. (A) IL‐6, (B) TNF‐α, (C) IL‐1β\nCorrelation between IL‐36RN expression and serum levels of three cytokines among periodontitis patients. (A) IL‐6, (B) TNF‐α, (C) IL‐1β", "Besides, IL36RN expression and significance were observed in mild‐to‐severe periodontitis patients with PBMC and plasma samples. Herein, the mild periodontitis showed significantly higher expression of IL36RN in PBMC and plasma compared to moderate and severe periodontitis (Figure 7A,B, p < 0.05). Similarly, moderate periodontitis showed higher expression of IL36RN than severe periodontitis whereas lower expression than mild periodontitis patients (Figure 7A,B, p < 0.05). While severe periodontitis represented the lowest expression of IL36RN among PBMC and plasma of mild and moderate periodontitis patients (Figure 7A,B, p < 0.05).\nIL36RN mRNA expression in mild (n = 40) moderate (n = 32) and severe (n = 25) periodontitis patients. (A) PBMC, (B) Plasma\nThe ROC‐AUC achieved a significantly higher of 0.875 (95% confidence interval(CI) = 0.7882‐0.9618, p < 0.05) in mild vs severe periodontitis with PBMC whereas moderate vs severe periodontitis with PBMC achieved AUC of 0.805 (95% CI = 0.6847‐0.9253, p < 0.05) (Figure 8A,B). Subsequently, in plasma, mild vs severe periodontitis patients yielded AUC of 0.839 (95% CI = 0.7451‐0.9329, p < 0.05) while moderate to severe periodontitis patients obtained a significant AUC of 0.731 (95% CI = 0.6014‐0.8611, p < 0.05) (Figure 8C,D). Thus, the diagnostic value of IL36RN can accurately distinguish between mild‐to‐severe or moderate‐to‐severe periodontitis patients with PBMC and plasma, and further may provide potential significance in diagnosing periodontitis.\nDiagnostic value of IL36RN for distinguishing mild or moderate patients from severe periodontitis patients. (A) PBMC of mild vs severe, (B) PBMC of moderate vs severe, (C) Plasma of mild vs severe, (D) Plasma of moderate vs severe", "Periodontitis is a numerous factorial disease initially due to consisting of microorganisms based on various colonies. It is expected that occurring periodontitis is caused by environmental, genetic, and bacterial complex actions in which host factors and bacterial play a crucial role.17, 18, 19, 20 Periodontitis is linked to bleeding on probing, increased probing depth and plaque index, bone loos and clinical attachment level reduction clinically.18, 19 Bacteria of periodontal activate the host immune response that leads to the release of inflammatory cytokines and mediators in the tissues of periodontal and inducing the breakdown of periodontal.20 Previously, it was reported that cytokines with substantial networks play a crucial role in periodontitis pathogenesis, destroying soft tissue and resorption of bone.21 Besides, the existence of elevated cytokines expression comprising pro‐inflammatory and regulatory cytokines such as IL‐1β, interferon (IFN)‐γ, IL‐1 receptor antagonist (RA), IL‐4, IL‐6, IL‐10, IL‐12, TNF‐α, and induced protein (IP)‐10, lead the way to periodontitis’ inflammatory process.22 Thus, cytokines may involve in the pathogenesis of periodontitis.\nThe present study has discovered and validated the down‐regulated expression of IL36RN in periodontitis and healthy controls with PBMC and plasma samples, similar to previous studies.19, 23 Meanwhile, PBMC based IL36RN expression was positively correlated to plasma‐based IL36RN whereas the serum base three different cytokines were inversely correlated to PBMC based IL36RN. Here, the serum‐based three different cytokines (IL‐1β, IL‐6, TNF‐α) showed up‐regulated expression in periodontitis, which were consistent with previous studies.19, 23, 24 Moreover, previous researches mentioned that IL36RN mutation may promote general pustular psoriasis (GPP), a rare type of life‐threatening disease.25, 26, 27, 28, 29 Meanwhile, studies have discovered IL36RN mutations resulted in IL36‐Ra misfolded protein due to the introduction of a premature stop‐codon, frameshift mutation, or an amino acid substitution and founded that IL36‐Ra protein was poorly expressed and less stable.25, 27, 28 Furthermore, in the current study significance of IL36RN mutated gene was significantly distinguishing mild vs severe periodontitis and moderate vs severe periodontitis of PBMC and plasma samples with a potential AUC range of 0.73 to 0.85. Taken together, IL36RN mutation may not only affects the pathogenesis of periodontitis but also may accurately differentiate mild‐to‐severe and moderate‐to‐severe periodontitis.\nIn our study, closure of periodontal inflammation was obtained by removal of mechanical dental plaque, which leads to the expected betterment of periodontal infections. For few decades, most researchers have reported that non‐invasive or non‐surgical therapeutics may be a validated substitute to invasive or surgical therapeutics.30, 31 It appears that therapeutic outcomes mostly rely on the depth of probs. The periodontal pockets with 1‐3mm sizes in non‐surgical therapeutics led to 0.3mm lower losses of clinical attachment than that surgical therapeutics and reduced 0.1mm lesser depth of probes. The 4‐6mm ranging of pockets in non‐surgical therapeutics led to 0.3mm gain of more clinical attachment but reduced 0.3mm lesser depth of probes than surgical therapies. With more than 6mm pockets, surgical therapeutics represented to lead the reduction of probes depths.32, 33 Unfortunately, no efforts were made to compare the potency of different therapeutics approaches because the current study was only targeted to discover and evaluate the clinical significance of IL36RN mutated gene.\nHowever, the study has few limitations. Firstly, the discovery of IL36RN expression was conducted by an online GEO‐based database, which might represent biased samples or findings. Secondly, the validation of IL36RN was conducted with fewer samples, thus further studies need to validate it by a larger cohort of multicenters. Thirdly, the three different cytokines were evaluated and compared using serum samples, which were not explored using PBMC or plasma‐based samples. Therefore, further studies are needed to diversely detect and evaluate IL36RN with various cytokines, which may play role in the occurrence and progression of periodontitis.", "IL36RN can distinctively be detectable in periodontitis patients with PBMC and plasma, which can act as a down‐regulated mutated gene that might play an effective role in causing periodontitis. IL36RN may involve by other inflammatory cytokines in the pathogenesis of periodontitis.", "The authors declared that they have no potential conflicts of interest." ]

[ null, "materials-and-methods", null, null, null, null, null, null, null, null, null, "results", null, null, null, null, null, "discussion", "conclusions", "COI-statement" ]

[ "cytokines", "IL36RN", "PBMC", "periodontitis", "plasma" ]

[ 407, 75, 237, 74, 42, 109, 37, 161, 32, 131, 111, 318, 158, 173, 377 ]

[ "periodontitis", "patients", "il36rn", "pbmc", "periodontitis patients", "il", "plasma", "expression", "severe", "healthy" ]

[ "il36rn expression periodontitis", "cytokines pathogenesis periodontitis", "il 36 periodontitis", "damagement periodontitis interleukin", "inflammatory periodontal disease" ]

[ "Cost of Illness", "Eswatini", "Financial Stress", "Health Care Costs", "Humans", "Male", "Prostatic Neoplasms" ]

[ "Background", "Study area", "Methods of costing", "Study population", "Management of prostate cancer in Eswatini", "Costs", "Direct medical costs", "Direct non-medical costs", "Indirect costs", "Morbidity costs", "Mortality costs", "Cancer mortality and years of potential productive life lost (YPLL)", "Estimation of annual costs", "Sensitivity analysis", "Directs costs", "Direct non-medical costs", "Indirect costs", "Total annual costs", "" ]

[ "Among cancers, prostate cancer is the third commonest cancer after breast and lung cancer and the fifth cause of cancer mortality among men [1, 2]. In 2018, the number of new cases increased from 1.1 million in 2012 to 1.3 million in 2018 accounting for about 7.1% of the total cancer cases globally and 15% among men [2]. The causes of prostate cancer is attributable to genetic and environmental factors [2]. However, the incidence and mortality rate vary substantially within and across regions. Notably, high-income countries (HICs) reports high incidence rate compared to low- and -middle income countries (LMICs) [2]. In contrast, mortality rate is higher in developing countries particularly in sub-Saharan Africa regions [3]. The inequalities observed across regions with respect to prostate cancer incidence and mortality are in part linked to availability of effective screening and improved treatment modalities which are directly linked to resources availability [3, 4]. In Eswatini, compared to other common cancers, prostate cancer is ranked third accounting for 7.6% of total new cases 1074 in 2018 [5].\nProstate cancer causes clinical and economic burden to patients and governments. Screening tests include prostate-specific antigen (PSA) and digital rectal examination (DRG) [6, 7]. A positive screening tests results indicate further investigation [6]. Whilst PSA is the frequent screening test, it has been argued that PSA could potentially cause harm by over diagnosing low risk cancers that otherwise would have remained without clinical consequences for life time if left untreated [8]. In turn, this increases costs for prostate cancer [9]. In Sweden, annual costs associated with prostate cancer (screening, diagnosis and treatment) was estimated at €281 million [9]. In Ontario, the mean per patient cost for prostate cancer–related medication was $1211 [10]. In Iran, the total annual cost of prostate cancer was estimated at $2900 million [11]. Other studies estimated the economic burden of prostate cancer along with other cancer type. A study focusing on European countries, ranked prostate cancer the fourth cancer disease to cause health care costs compared to lung (€18.8billion), breast cancer (€15 billion), colorectal cancer (€13.1 billion) [12]. Similarly, in Korea, prostate cancer was among the top four cancers attributing to economic burden of disease [13].\nThere is limited evidence on the economic burden of prostate cancer from LMICs. Estimation of the economic burden of disease provide insight on treatment modalities and associated costs. The study aims to investigate the societal cost of prostate cancer in Eswatini during 2018.", "Eswatini formerly known as Swaziland is a country in Southern African bordering South Africa and Mozambique with an estimated population of 1.2 million [14]. The country’s economy is tied to South Africa and Eswatini’s domestic currency (Lilangeni=SZL) is pegged at parity with South African currency (Rand=ZAR) such that Eswatini cannot conduct its own monetary policy [15]. Eswatini fiscal revenue largely depend on Southern African Customs Union (SACU) revenues and remittance flowing mainly from South Africa [16, 17]. SACU receipts account for about a third of Eswatini’s total revenue and grants. However, over the past decades, SACU revenues have consistently declined leaving Eswatini’s economy constrained. The country records high national level poverty rate and income inequality which does not commensurate with its middle-income status. The national poverty rate is 58.9% percent at the international $1.90 poverty line and Gini index- a measure of inequality is 49.3 [17]. Eswatini ranks near the bottom of the World Bank’s Human Capital Index, with a score of 0.37 in 2020. Eswatini health spending as a share of the total budget is estimated at 10.1% and health per capita is estimated at $ 248 per annum [16]. Whilst Eswatini’s health expenditure is comparatively higher to some other countries in the Southern African region, the country’s health outcomes do not reflect its spending levels on health and its middle-income status. The health care service delivery is made up of public and private health care. Compared to the public, the private health care systems is better equipped both infrastructural and human resources however, at high health care costs. As such, private health care is accessed by less than 10% of the population, mainly those who owns health insurance [18].\nDiagnostic and treatment capacity of conditions including cancer remains limited in the country mostly in the public health system. Through a government funded scheme namely Phalala, the Eswatini citizens are supported to access specialized health care services from neighboring countries mainly South Africa.", "This is a Cost of Illness (CoI) study investigating costs of prostate cancer from the societal perspective [19]. CoI studies estimate disease specific costs [20]. The prevalence based approach, was used employing both top down and bottom up costing approaches [19, 21]. The cost estimation involved identification, quantification and valuation of resources used. The total costs for prostate cancer was calculated by multiplying identified resources quantities and the respective unit costs. All costs were presented in US$ adjusted for 2018 ($1= SZL14.5).\nStudy population Data on prostate cancer prevalence and mortality in 2018 was obtained from the National cancer registry [14]. The National Cancer Control Unit is led by the Ministry of Health. To estimate direct non-medical costs and annual gross earnings, estimates were obtained from a previous study that collected data using a direct non-medical costs patient questionnaire from a previous study on women diagnosed with breast cancer and receiving follow-up care at Mbabane Government chemotherapy unit (outpatient) in 2018 [22].\nData on prostate cancer prevalence and mortality in 2018 was obtained from the National cancer registry [14]. The National Cancer Control Unit is led by the Ministry of Health. To estimate direct non-medical costs and annual gross earnings, estimates were obtained from a previous study that collected data using a direct non-medical costs patient questionnaire from a previous study on women diagnosed with breast cancer and receiving follow-up care at Mbabane Government chemotherapy unit (outpatient) in 2018 [22].", "Data on prostate cancer prevalence and mortality in 2018 was obtained from the National cancer registry [14]. The National Cancer Control Unit is led by the Ministry of Health. To estimate direct non-medical costs and annual gross earnings, estimates were obtained from a previous study that collected data using a direct non-medical costs patient questionnaire from a previous study on women diagnosed with breast cancer and receiving follow-up care at Mbabane Government chemotherapy unit (outpatient) in 2018 [22].", "In Eswatini, routine prostate cancer screening is only recommended for men above age 50 every after two years [23]. The referral pathway shown in Fig. 1, simplifies the treatment pathway which begins by a man presenting with symptoms or eligible for screening at outpatient. Patient will be referred to urologist for screening tests including PSA and digital rectal examination (DRE) [6, 23]. These tests are not confirmatory however, they indicate changes in the prostate. Abnormal findings by either of the tests warrant further evaluation of patient and subsequent diagnostic test. These include biopsy (transrectal/perineal ultrasound guided biopsy (TRUS)). Patient with no cancer but presenting with symptom would receive management of lower urinary tract symptoms (LUTS). If cancer is confirmed further evaluation is conducted for cancer staging purposes in order to inform cancer management plan (metastasis screening). The evaluation includes radiology tests (bone scan, CT-scan and MRI pelvis). Staging is based on the tumor size (T) extent of lymph nodes involvement (N) and evidence of distant metastasis (M) [23, 24]. Depending on the risk score and prostate cancer stage, treatment include watchful waiting (cancer is monitored but not treated), surgery, radiation, chemotherapy and hormonal therapy (Androgen Deprivation Therapy) [23].\n\nFig. 1Simplified diagnosis and treatment pathway of patients diagnosed with prostate cancer. PSA Prostate specific antigen, DRE Digital rectal examination, TURP transurethral resection of prostate, TURB transurethral resection of bladder, TRUS Transrectal ultrasound, LUTS Lower Urinary Tract Symptoms\nSimplified diagnosis and treatment pathway of patients diagnosed with prostate cancer. PSA Prostate specific antigen, DRE Digital rectal examination, TURP transurethral resection of prostate, TURB transurethral resection of bladder, TRUS Transrectal ultrasound, LUTS Lower Urinary Tract Symptoms\nMost treatment modalities can be administered in various stages however for different intent [6, 23]. Radical prostatectomy, radiation and hormonal therapy can be applied for localised high risk prostate cancer (stage I and stage II) whilst for metastatic prostate cancer hormonal therapy will be first line in addition to radiotherapy, chemotherapy and hormonal therapy for palliation purposes. Radiation is not available in Eswatini and patient are referred to private hospitals in South Africa. Other surgical interventions for relieving symptoms such as transurethral resection of prostate (TURP) or bladder (TURB) can be conducted locally.\nWe used expert opinion from Mbabane Government Hospital - Chemotherapy Unit, Mbabane clinic -private hospital and information from Phalala Fund to establish patient referral pathway. Phalala Fund is a government funded scheme established to fund provision of specialized health care services to people of Eswatini that could not afford payment of specialized care that is not available in country [25]. The Eswatini standardized cancer care guidelines were used to establish screening, diagnosis and treatment variables. Costs were estimated based on market price. Radiotherapy is currently not available in Eswatini. As such, patients who require radiation are managed in South Africa through Phalala Fund. Chemotherapy is available locally through a government chemotherapy unit and local private clinic. However, it was established that most patients were still receiving chemotherapy from South Africa.", "From a societal perspective, costs associated with prostate cancer were estimated to assess economic burden of prostate cancer in Eswatini. Direct medical costs were divided into recurrent and capital costs [19]. Recurrent costs included personnel, travel, consumables including medical supplies, administration, utilities and overheads. Capital costs consistent mainly of equipment, building, vehicle and everything that have a useful life of more than one year. Costs for prostate cancer were determined based on the data source presented in Table 1. All costs were presented in US Dollars using 2018 average exchange rate (1 USD ($) = 14.5 SZL).\n\nTable 1Data variables and source for cost regarding screening, management and treatment of prostate cancerDataData sourcePrice sourceEstimated number of cases in 2018 = 90Swaziland National Cancer Unit, Eswatini Prostate cancer cases in 2018\n N/A\n\nScreening\n  Consultation feeMbabane ClinicPrivate hospital  Prostate Specific Antigen (PSA)Eswatini Health Laboratory ServicesPrivate hospital  Digital rectal examination (DRE)Interview with expertPrivate hospital\nDiagnosis\n  TRUS guided BiopsyMbabane ClinicPrivate hospital  Computed Tomography (CT scan)Mbabane ClinicPrivate hospital  MRI scanPhalala fundPrivate hospital  X-rayMbabane ClinicPrivate hospital  Bone scanMbabane ClinicPrivate hospital\nIntervention/Treatment\n  Watchful waiting (WW)Interview with expertPrivate hospital  SurgeryMbabane clinicPrivate hospital  RadiotherapyPhalala Fund based on SA hospitals feesPrivate hospital  ChemotherapyPhalala Fund based on SA hospitals feesPrivate hospital  Androgen deprivationPhalala Fund based on SA hospitals feesMarket price  Hospitalization (local)Phalala Fund based on SA hospitals feesPrivate hospital\nOther direct costs\n  Transport and lodging costs in South AfricaPhalala Fund based on SA hospitals feesMarket price  Follow-up care (Year 1 following completion of treatment) Follow-up involves PSA testing, symptomology and clinical examination for metastatic cancer twice in a yearBased on reported prevalencePrivate hospital\nData variables and source for cost regarding screening, management and treatment of prostate cancer\nDirect medical costs Direct costs in this study include resource utilization for diagnosis, treatment (surgery, chemotherapy, radiotherapy and androgen deprivation therapy) and follow-up care. To estimate the directs costs, we estimated average cost of each intervention from screening, staging and treatment and multiplied by the number of corresponding patients who received the intervention. The number of men diagnosed with prostate cancer were obtained from the national cancer registry [26]. All diagnosed cases were assumed to have undergone screening test using PSA. Screening and diagnosis costs were obtained from private hospital and market pricing. Treatment costs mainly radiation, chemotherapy and androgen deprivation therapy were received from Phalala fund based on South African private hospitals fees. In Eswatini, a majority of the management costs are borne by the Eswatini Government through Phalala fund.\nAs per the standardized cancer care guidelines, we assumed that all the men with confirmed prostate cancer in 2018 underwent screening and diagnosis tests, treatment and incurred other direct costs including transport and accommodation. Follow-up care costs was estimated for one year for those reported alive in 2018.\nDirect costs in this study include resource utilization for diagnosis, treatment (surgery, chemotherapy, radiotherapy and androgen deprivation therapy) and follow-up care. To estimate the directs costs, we estimated average cost of each intervention from screening, staging and treatment and multiplied by the number of corresponding patients who received the intervention. The number of men diagnosed with prostate cancer were obtained from the national cancer registry [26]. All diagnosed cases were assumed to have undergone screening test using PSA. Screening and diagnosis costs were obtained from private hospital and market pricing. Treatment costs mainly radiation, chemotherapy and androgen deprivation therapy were received from Phalala fund based on South African private hospitals fees. In Eswatini, a majority of the management costs are borne by the Eswatini Government through Phalala fund.\nAs per the standardized cancer care guidelines, we assumed that all the men with confirmed prostate cancer in 2018 underwent screening and diagnosis tests, treatment and incurred other direct costs including transport and accommodation. Follow-up care costs was estimated for one year for those reported alive in 2018.\nDirect non-medical costs Transport cost including return was estimated based on required patient follow-up visits based on the Eswatini Standardized Cancer Care Guidelines which state that follow-up visit should be every six months for the first two years and annually for up to five years following surgery [23]. Transport cost was estimated based on data from a previous study on breast cancer women receiving follow-up care at Mbabane Government Cancer Unit [22]. We assumed that all men completed treatment in 2018 had follow-up visits as per the Eswatini Standardized Cancer Guidelines. This study estimated one-year follow-up costs.\nTransport cost including return was estimated based on required patient follow-up visits based on the Eswatini Standardized Cancer Care Guidelines which state that follow-up visit should be every six months for the first two years and annually for up to five years following surgery [23]. Transport cost was estimated based on data from a previous study on breast cancer women receiving follow-up care at Mbabane Government Cancer Unit [22]. We assumed that all men completed treatment in 2018 had follow-up visits as per the Eswatini Standardized Cancer Guidelines. This study estimated one-year follow-up costs.\nIndirect costs We estimated the monitory value of prostate cancer related productivity loss due to morbidity (patient sick leave days incurred as a result of seeking health care) and pre-mature mortality).\nThe human capital method was used to estimate indirect costs related to productivity loss due to morbidity (sick leave as a result of seeking prostate cancer care) and pre-mature mortality [20]. We used average annual gross earnings computed from our previous study on breast cancer women receiving follow-up care in the chemotherapy unit, Mbabane Government hospital in Eswatini [22].\nMorbidity costs We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nWe estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nMortality costs To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nTo estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nWe estimated the monitory value of prostate cancer related productivity loss due to morbidity (patient sick leave days incurred as a result of seeking health care) and pre-mature mortality).\nThe human capital method was used to estimate indirect costs related to productivity loss due to morbidity (sick leave as a result of seeking prostate cancer care) and pre-mature mortality [20]. We used average annual gross earnings computed from our previous study on breast cancer women receiving follow-up care in the chemotherapy unit, Mbabane Government hospital in Eswatini [22].\nMorbidity costs We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nWe estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nMortality costs To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nTo estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].", "Direct costs in this study include resource utilization for diagnosis, treatment (surgery, chemotherapy, radiotherapy and androgen deprivation therapy) and follow-up care. To estimate the directs costs, we estimated average cost of each intervention from screening, staging and treatment and multiplied by the number of corresponding patients who received the intervention. The number of men diagnosed with prostate cancer were obtained from the national cancer registry [26]. All diagnosed cases were assumed to have undergone screening test using PSA. Screening and diagnosis costs were obtained from private hospital and market pricing. Treatment costs mainly radiation, chemotherapy and androgen deprivation therapy were received from Phalala fund based on South African private hospitals fees. In Eswatini, a majority of the management costs are borne by the Eswatini Government through Phalala fund.\nAs per the standardized cancer care guidelines, we assumed that all the men with confirmed prostate cancer in 2018 underwent screening and diagnosis tests, treatment and incurred other direct costs including transport and accommodation. Follow-up care costs was estimated for one year for those reported alive in 2018.", "Transport cost including return was estimated based on required patient follow-up visits based on the Eswatini Standardized Cancer Care Guidelines which state that follow-up visit should be every six months for the first two years and annually for up to five years following surgery [23]. Transport cost was estimated based on data from a previous study on breast cancer women receiving follow-up care at Mbabane Government Cancer Unit [22]. We assumed that all men completed treatment in 2018 had follow-up visits as per the Eswatini Standardized Cancer Guidelines. This study estimated one-year follow-up costs.", "We estimated the monitory value of prostate cancer related productivity loss due to morbidity (patient sick leave days incurred as a result of seeking health care) and pre-mature mortality).\nThe human capital method was used to estimate indirect costs related to productivity loss due to morbidity (sick leave as a result of seeking prostate cancer care) and pre-mature mortality [20]. We used average annual gross earnings computed from our previous study on breast cancer women receiving follow-up care in the chemotherapy unit, Mbabane Government hospital in Eswatini [22].\nMorbidity costs We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nWe estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nMortality costs To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nTo estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].", "We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].", "To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].", "The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry from which the years of productive life lost was calculated. In 2018, there were 31 prostate cancer related mortality out of which 4 occurred within the labor participating ages of Eswatini (18-60) years [28].", "We computed the aggregate total costs of screening, diagnosis and treatment of prostate cancer in 2018 as below:\n\n\\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$$Cost\\;of\\;disease\\;=\\sum\\begin{pmatrix}Direct\\;medical\\;\\cos ts\\\\+\\\\Direct\\;non-medical\\;\\cos ts\\\\Direct\\;\\cos ts\\end{pmatrix}+\\begin{pmatrix}Morbidity\\\\+\\\\Mortality\\\\Indirect\\;\\cos ts\\end{pmatrix}$$\\end{document}Costofdisease=∑Directmedicalcosts+Directnon-medicalcostsDirectcosts+Morbidity+MortalityIndirectcosts\nDirect medical costs = Consisting of direct non-medical costs and direct medical costs.\nIndirect costs = Consisting of morbidity costs and mortality costs (Patient time lost as a result of the condition and costs associated with premature mortality as a result).\nAll costs were reported in 2018 US dollars ($1=SZL14.5).", "Sensitivity analysis was performed using ± 25% to account for the cost of follow-up prevalent cancer cases and to account for unrecorded cases by the facilities.", "In 2018, there were 90 prostate cancer cases of which 89% aged 60 years an above. The average age was 73 years. Table 2, shows unit average costs for treating prostate cancer cases including other direct costs such as transportation and accommodation.\n\nTable 2Costs for screening, diagnosis and treatment of prostate cancerParameterVariables included in the costAverage (2018) USD\nScreening\nConsultation fee41Prostate Specific Antigen (PSA)16Digital rectal examination (DRE)32\nDiagnosis\nPathologyTRUS guided Biopsy147RadiologyComputed Tomography (CT scan)- to rule out chest, abdomen and pelvis metastasis862Magnetic resonance imaging scan (MRI)1,034X-ray to rule out effusion28Bone scan in locally advanced prostate cancer607Ultrasound scan103\nTreatment\nWatchful Waiting (WW) cost include PSA test every three months and follow up consultation feePSA plus follow-up consultation fee58SurgeryRadical prostatectomy5,726Orchiectomy5,726RadiotherapyAdministered at 5 function of a 5-week period16,647Chemotherapy (Brachytherapy or external beam radiationAdministered in 5 cycles over 5-week period7,498Androgen Deprivation Therapy (ADT)Mostly Zoladex o.8 mg intramuscular (IM) for every 3 months1,268Symptoms relieving procedures (TURP/TURB)Transurethral resection of the prostate or bladder (TURP/TURB)5,872\nOther direct costs\nHospitalization costs (local)Admitted for symptoms management procedures including transurethral resection of the prostate (TURP) and orchidectomy5,872Hospital admission in step down facility for late stage treatment (In South Africa)Patient who require close monitoring following radiotherapy or surgery in hospital outside Eswatini1,206Transport and lodging cost in South AfricaAll patients who received treatment in South Africa5,959Follow-up care (Year 1 following completing treatment) Follow-up is done using PSA testing, symptomology and clinical examination for metastatic cancer twice in a yearFollow up consultation, PSA tests.94\nTotal\n\n58,796\n\nCosts for screening, diagnosis and treatment of prostate cancer\nCost distribution by disease stage is shown in Table 3. Following the Eswatini Standard Cancer Care Guidelines we assumed that all confirmed cases underwent similar screening, diagnosis and treatment pathway shown in Table 2, and simplified referral pathway shown in Fig. 1. The average costs for the different pathway including treatment intervention differed with the prostate cancer stage. Radical prostatectomy was more frequent with early stages of prostate cancer whilst interventions like chemotherapy were common with prostate cancer stages III and IV. Table 3 shows the prostate cancer costs distribution by stage.\n\nTable 3Costs for staging, management, and treatment of Prostate cancer stage I-IVStaging and treatment variablesUnit cost ($)I (T1)II (T2)III (T3)1 V (T4)Consultation for assessment4141414141\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)1648484848  Digital rectal examination (DRE)  TRUS guided Biopsy147147147147147  MRI scan1,0341,0341,0341,0341,034  Chest x-ray2827.627.627.627.6  Bone scan607607607607607  Ultrasound103103103103103  CT scan abdomen862862862862862\nTreatment (Prostate Cancer prevalence in 2018=91 patient)\n  Watchful waiting (WW). Costs include PSA test every three months and follow up consultation fee5858000  Radical prostatectomy5,7265,7265,72600  Orchiectomy (surgical castration)5,7265,7265,7265,7265,726  Radiotherapy16,64816,64816,64816,64816,648  Chemotherapy7,498007,4987,498  Symptoms relieving procedures (TURP/TURB)5,872005,8725,872  Other supportive drugs: Pain killers6060606060  Hormonal therapy (ADT) Zoladex 0.8 mg injectables1,2681,2681,2681,2681,268\nOther costs\n  Hospitalization costs (local)5,8725,8725,8725,8725,872  Hospital admission in step down facility for late stage treatment1,2061,2061,2061,2061,206  Transport and lodging cost (in RSA)5,9595,9595,9595,9595,959  Follow-up care (Year 1 following completing treatment)9494949494\nTotal\n\n58,824\n\n45,486\n\n45,428\n\n53,072\n\n53,072\n\nCosts for staging, management, and treatment of Prostate cancer stage I-IV\nRadiation is not available in Eswatini and patients are referred to private hospitals in South Africa. On average, radiotherapy treatment is administered for a period of 5-weeks [25]. The estimated unit costs for radiotherapy was $16,648 whilst chemotherapy was $7,498. In addition to treatment costs, all patients referred for radiotherapy also incurred other direct costs including transport, lodging and allowance for accompanying staff (nurse and driver) at a unit costs $5,959, Table 3.\nDirect non-medical costs Using estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).\nUsing estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).", "Using estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).", "Productive loss due to sick leave as a result of patient seeking health care for prostate cancer was estimated at $58,320, Table 4. Out of the 90 patients diagnosed with prostate cancer, there were 13 men within the labor participating ages which were assumed to be on average sick leave of 54 days per person excluding short term sick leave of 14 days that is usually covered by employers. A total of 31 men died of prostate cancer in 2018 out of which 4 were less than 60 years. Costs due to prostate cancer premature mortality was estimated at $113,760, Table 5.\n\nTable 4Costs due to sick leave days associated with prostate cancer costsNumbers of sick leave daysNumber of patients alive in 2018Cost per workday ($)Total productivity loss due to costs due to prostate cancer in 2018 ($) for all patientTotal patient545812$37,584\nCosts due to sick leave days associated with prostate cancer costs\n\nTable 5Mortality for prostate cancerMortality cost for Prostate cancerAge groupsLost YPPLL (Average YPPLL for 1 patient in each age group)Number of premature deaths before age 60Average annual incomeMortality cost ($) with 3% Discount rate multiplied with the number of patients in this age groupMortality cost ($) with 5% Discount rate multiplied with the number of patients in each age group46-51491269029,63210,67652-56543269084,12827,311Totals10342690113,76037,987YPPLL211Average annual gross income = $2,690\nMortality for prostate cancer", "The total annual costs for prostate cancer was estimated at $ 6.2 million (between $4.7 million and 7.8 million estimated with lower and upper bounds), Table 6. Fourth 4% (40) of the cases were diagnoses with stage IV whilst only 11% (10) were diagnosed with stages I. Management of prostate cancer stages III and IV formed the greatest share of the costs for prostate cancer contributing about $1.2 and 2.1 million respectively. The total costs of stages I and II was estimated at $0.5 and $0.8 million. Transport and accommodation costs (cost incurred by those transferred to South Africa) were highest under other direct costs contributing about $0.5million. In 2018, there were 31 prostate cancer related deaths with only 4 occurred within the labor participating ages of Eswatini (18-60) years. The total year of productive life lost (YPPL) was 221 years. Indirect costs were estimated at $0.24 million and a majority (96%, $0.2 million) were productive loss from premature mortality, Table 6.\n\nTable 6Total Annual costs estimation for Prostate cancer (direct and indirect costs)Prevalence 2018Cost per item ($)Base case cost ($)Range ($)\nParameter\n\nNumber\n\nAverage cost (2018)\n\nBase costs (2018)\n\n(Lower (-25%)\n\nHigher (+25)\nDirect costs (Health care costs) consultation fee9041369027684613\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)9016144810861810  Digital rectal examination (DRE)80000  TRUS guided Biopsy9014713,213991016,516  MRI scan90103493,06069,795116,325  Chest x-ray9028248418633105  Bone scan9060754,63040,97368,288  Ultra sound901039270695311,588  CT scan abdomen9086277,58058,18596,975\nTreatment\n  Stage I1045,486454,861341,146568,577  Stage II1745,428772,278579,209965,348  Stage III2353,0721,220,659915,4941,525,824  Stage IV4053,0722,122,8861,592,1642,653,607\nOther direct costs\n  Hospitalization costs (local)9021018,90014,17523,625  Hospital admission in step down facility for late stage treatment901206108,54081,405135,675  Transport and lodging cost (in RSA)905959536,310402,233670,388  Follow-up care (Year 1 following completing treatment)602662159,720119,790199,650\nTotal direct\n209,8925,645,8394,234,3797,057,299\nDirect non-medical cost\n  Transport costs for follow-up visits ,patient592513148,267111,200185,334  Transport costs for follow-up visits, accompanying relative592513148,267111,200185,334\nTotal Direct non-medical costs\n5026296,534222,401370,668\nIndirect costs\n  Morbidity costs due to sick leave136488424631810,530  Premature mortality costs457,675230,700173,025288,375\nTotal indirect costs\n58,323239,124179,343298,905\nTotal\n\n268,215\n\n6,181,497\n\n4,636,123\n\n7,726,871\n\nTotal Annual costs estimation for Prostate cancer (direct and indirect costs)", "\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf" ]

[ null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "Background", "Materials and methods", "Study area", "Methods of costing", "Study population", "Management of prostate cancer in Eswatini", "Costs", "Direct medical costs", "Direct non-medical costs", "Indirect costs", "Morbidity costs", "Mortality costs", "Cancer mortality and years of potential productive life lost (YPLL)", "Estimation of annual costs", "Sensitivity analysis", "Results", "Directs costs", "Direct non-medical costs", "Indirect costs", "Total annual costs", "Discussion", "Conclusions", "Supplementary Information", "" ]

[ "Among cancers, prostate cancer is the third commonest cancer after breast and lung cancer and the fifth cause of cancer mortality among men [1, 2]. In 2018, the number of new cases increased from 1.1 million in 2012 to 1.3 million in 2018 accounting for about 7.1% of the total cancer cases globally and 15% among men [2]. The causes of prostate cancer is attributable to genetic and environmental factors [2]. However, the incidence and mortality rate vary substantially within and across regions. Notably, high-income countries (HICs) reports high incidence rate compared to low- and -middle income countries (LMICs) [2]. In contrast, mortality rate is higher in developing countries particularly in sub-Saharan Africa regions [3]. The inequalities observed across regions with respect to prostate cancer incidence and mortality are in part linked to availability of effective screening and improved treatment modalities which are directly linked to resources availability [3, 4]. In Eswatini, compared to other common cancers, prostate cancer is ranked third accounting for 7.6% of total new cases 1074 in 2018 [5].\nProstate cancer causes clinical and economic burden to patients and governments. Screening tests include prostate-specific antigen (PSA) and digital rectal examination (DRG) [6, 7]. A positive screening tests results indicate further investigation [6]. Whilst PSA is the frequent screening test, it has been argued that PSA could potentially cause harm by over diagnosing low risk cancers that otherwise would have remained without clinical consequences for life time if left untreated [8]. In turn, this increases costs for prostate cancer [9]. In Sweden, annual costs associated with prostate cancer (screening, diagnosis and treatment) was estimated at €281 million [9]. In Ontario, the mean per patient cost for prostate cancer–related medication was $1211 [10]. In Iran, the total annual cost of prostate cancer was estimated at $2900 million [11]. Other studies estimated the economic burden of prostate cancer along with other cancer type. A study focusing on European countries, ranked prostate cancer the fourth cancer disease to cause health care costs compared to lung (€18.8billion), breast cancer (€15 billion), colorectal cancer (€13.1 billion) [12]. Similarly, in Korea, prostate cancer was among the top four cancers attributing to economic burden of disease [13].\nThere is limited evidence on the economic burden of prostate cancer from LMICs. Estimation of the economic burden of disease provide insight on treatment modalities and associated costs. The study aims to investigate the societal cost of prostate cancer in Eswatini during 2018.", "Study area Eswatini formerly known as Swaziland is a country in Southern African bordering South Africa and Mozambique with an estimated population of 1.2 million [14]. The country’s economy is tied to South Africa and Eswatini’s domestic currency (Lilangeni=SZL) is pegged at parity with South African currency (Rand=ZAR) such that Eswatini cannot conduct its own monetary policy [15]. Eswatini fiscal revenue largely depend on Southern African Customs Union (SACU) revenues and remittance flowing mainly from South Africa [16, 17]. SACU receipts account for about a third of Eswatini’s total revenue and grants. However, over the past decades, SACU revenues have consistently declined leaving Eswatini’s economy constrained. The country records high national level poverty rate and income inequality which does not commensurate with its middle-income status. The national poverty rate is 58.9% percent at the international $1.90 poverty line and Gini index- a measure of inequality is 49.3 [17]. Eswatini ranks near the bottom of the World Bank’s Human Capital Index, with a score of 0.37 in 2020. Eswatini health spending as a share of the total budget is estimated at 10.1% and health per capita is estimated at $ 248 per annum [16]. Whilst Eswatini’s health expenditure is comparatively higher to some other countries in the Southern African region, the country’s health outcomes do not reflect its spending levels on health and its middle-income status. The health care service delivery is made up of public and private health care. Compared to the public, the private health care systems is better equipped both infrastructural and human resources however, at high health care costs. As such, private health care is accessed by less than 10% of the population, mainly those who owns health insurance [18].\nDiagnostic and treatment capacity of conditions including cancer remains limited in the country mostly in the public health system. Through a government funded scheme namely Phalala, the Eswatini citizens are supported to access specialized health care services from neighboring countries mainly South Africa.\nEswatini formerly known as Swaziland is a country in Southern African bordering South Africa and Mozambique with an estimated population of 1.2 million [14]. The country’s economy is tied to South Africa and Eswatini’s domestic currency (Lilangeni=SZL) is pegged at parity with South African currency (Rand=ZAR) such that Eswatini cannot conduct its own monetary policy [15]. Eswatini fiscal revenue largely depend on Southern African Customs Union (SACU) revenues and remittance flowing mainly from South Africa [16, 17]. SACU receipts account for about a third of Eswatini’s total revenue and grants. However, over the past decades, SACU revenues have consistently declined leaving Eswatini’s economy constrained. The country records high national level poverty rate and income inequality which does not commensurate with its middle-income status. The national poverty rate is 58.9% percent at the international $1.90 poverty line and Gini index- a measure of inequality is 49.3 [17]. Eswatini ranks near the bottom of the World Bank’s Human Capital Index, with a score of 0.37 in 2020. Eswatini health spending as a share of the total budget is estimated at 10.1% and health per capita is estimated at $ 248 per annum [16]. Whilst Eswatini’s health expenditure is comparatively higher to some other countries in the Southern African region, the country’s health outcomes do not reflect its spending levels on health and its middle-income status. The health care service delivery is made up of public and private health care. Compared to the public, the private health care systems is better equipped both infrastructural and human resources however, at high health care costs. As such, private health care is accessed by less than 10% of the population, mainly those who owns health insurance [18].\nDiagnostic and treatment capacity of conditions including cancer remains limited in the country mostly in the public health system. Through a government funded scheme namely Phalala, the Eswatini citizens are supported to access specialized health care services from neighboring countries mainly South Africa.", "Eswatini formerly known as Swaziland is a country in Southern African bordering South Africa and Mozambique with an estimated population of 1.2 million [14]. The country’s economy is tied to South Africa and Eswatini’s domestic currency (Lilangeni=SZL) is pegged at parity with South African currency (Rand=ZAR) such that Eswatini cannot conduct its own monetary policy [15]. Eswatini fiscal revenue largely depend on Southern African Customs Union (SACU) revenues and remittance flowing mainly from South Africa [16, 17]. SACU receipts account for about a third of Eswatini’s total revenue and grants. However, over the past decades, SACU revenues have consistently declined leaving Eswatini’s economy constrained. The country records high national level poverty rate and income inequality which does not commensurate with its middle-income status. The national poverty rate is 58.9% percent at the international $1.90 poverty line and Gini index- a measure of inequality is 49.3 [17]. Eswatini ranks near the bottom of the World Bank’s Human Capital Index, with a score of 0.37 in 2020. Eswatini health spending as a share of the total budget is estimated at 10.1% and health per capita is estimated at $ 248 per annum [16]. Whilst Eswatini’s health expenditure is comparatively higher to some other countries in the Southern African region, the country’s health outcomes do not reflect its spending levels on health and its middle-income status. The health care service delivery is made up of public and private health care. Compared to the public, the private health care systems is better equipped both infrastructural and human resources however, at high health care costs. As such, private health care is accessed by less than 10% of the population, mainly those who owns health insurance [18].\nDiagnostic and treatment capacity of conditions including cancer remains limited in the country mostly in the public health system. Through a government funded scheme namely Phalala, the Eswatini citizens are supported to access specialized health care services from neighboring countries mainly South Africa.", "This is a Cost of Illness (CoI) study investigating costs of prostate cancer from the societal perspective [19]. CoI studies estimate disease specific costs [20]. The prevalence based approach, was used employing both top down and bottom up costing approaches [19, 21]. The cost estimation involved identification, quantification and valuation of resources used. The total costs for prostate cancer was calculated by multiplying identified resources quantities and the respective unit costs. All costs were presented in US$ adjusted for 2018 ($1= SZL14.5).\nStudy population Data on prostate cancer prevalence and mortality in 2018 was obtained from the National cancer registry [14]. The National Cancer Control Unit is led by the Ministry of Health. To estimate direct non-medical costs and annual gross earnings, estimates were obtained from a previous study that collected data using a direct non-medical costs patient questionnaire from a previous study on women diagnosed with breast cancer and receiving follow-up care at Mbabane Government chemotherapy unit (outpatient) in 2018 [22].\nData on prostate cancer prevalence and mortality in 2018 was obtained from the National cancer registry [14]. The National Cancer Control Unit is led by the Ministry of Health. To estimate direct non-medical costs and annual gross earnings, estimates were obtained from a previous study that collected data using a direct non-medical costs patient questionnaire from a previous study on women diagnosed with breast cancer and receiving follow-up care at Mbabane Government chemotherapy unit (outpatient) in 2018 [22].", "Data on prostate cancer prevalence and mortality in 2018 was obtained from the National cancer registry [14]. The National Cancer Control Unit is led by the Ministry of Health. To estimate direct non-medical costs and annual gross earnings, estimates were obtained from a previous study that collected data using a direct non-medical costs patient questionnaire from a previous study on women diagnosed with breast cancer and receiving follow-up care at Mbabane Government chemotherapy unit (outpatient) in 2018 [22].", "In Eswatini, routine prostate cancer screening is only recommended for men above age 50 every after two years [23]. The referral pathway shown in Fig. 1, simplifies the treatment pathway which begins by a man presenting with symptoms or eligible for screening at outpatient. Patient will be referred to urologist for screening tests including PSA and digital rectal examination (DRE) [6, 23]. These tests are not confirmatory however, they indicate changes in the prostate. Abnormal findings by either of the tests warrant further evaluation of patient and subsequent diagnostic test. These include biopsy (transrectal/perineal ultrasound guided biopsy (TRUS)). Patient with no cancer but presenting with symptom would receive management of lower urinary tract symptoms (LUTS). If cancer is confirmed further evaluation is conducted for cancer staging purposes in order to inform cancer management plan (metastasis screening). The evaluation includes radiology tests (bone scan, CT-scan and MRI pelvis). Staging is based on the tumor size (T) extent of lymph nodes involvement (N) and evidence of distant metastasis (M) [23, 24]. Depending on the risk score and prostate cancer stage, treatment include watchful waiting (cancer is monitored but not treated), surgery, radiation, chemotherapy and hormonal therapy (Androgen Deprivation Therapy) [23].\n\nFig. 1Simplified diagnosis and treatment pathway of patients diagnosed with prostate cancer. PSA Prostate specific antigen, DRE Digital rectal examination, TURP transurethral resection of prostate, TURB transurethral resection of bladder, TRUS Transrectal ultrasound, LUTS Lower Urinary Tract Symptoms\nSimplified diagnosis and treatment pathway of patients diagnosed with prostate cancer. PSA Prostate specific antigen, DRE Digital rectal examination, TURP transurethral resection of prostate, TURB transurethral resection of bladder, TRUS Transrectal ultrasound, LUTS Lower Urinary Tract Symptoms\nMost treatment modalities can be administered in various stages however for different intent [6, 23]. Radical prostatectomy, radiation and hormonal therapy can be applied for localised high risk prostate cancer (stage I and stage II) whilst for metastatic prostate cancer hormonal therapy will be first line in addition to radiotherapy, chemotherapy and hormonal therapy for palliation purposes. Radiation is not available in Eswatini and patient are referred to private hospitals in South Africa. Other surgical interventions for relieving symptoms such as transurethral resection of prostate (TURP) or bladder (TURB) can be conducted locally.\nWe used expert opinion from Mbabane Government Hospital - Chemotherapy Unit, Mbabane clinic -private hospital and information from Phalala Fund to establish patient referral pathway. Phalala Fund is a government funded scheme established to fund provision of specialized health care services to people of Eswatini that could not afford payment of specialized care that is not available in country [25]. The Eswatini standardized cancer care guidelines were used to establish screening, diagnosis and treatment variables. Costs were estimated based on market price. Radiotherapy is currently not available in Eswatini. As such, patients who require radiation are managed in South Africa through Phalala Fund. Chemotherapy is available locally through a government chemotherapy unit and local private clinic. However, it was established that most patients were still receiving chemotherapy from South Africa.", "From a societal perspective, costs associated with prostate cancer were estimated to assess economic burden of prostate cancer in Eswatini. Direct medical costs were divided into recurrent and capital costs [19]. Recurrent costs included personnel, travel, consumables including medical supplies, administration, utilities and overheads. Capital costs consistent mainly of equipment, building, vehicle and everything that have a useful life of more than one year. Costs for prostate cancer were determined based on the data source presented in Table 1. All costs were presented in US Dollars using 2018 average exchange rate (1 USD ($) = 14.5 SZL).\n\nTable 1Data variables and source for cost regarding screening, management and treatment of prostate cancerDataData sourcePrice sourceEstimated number of cases in 2018 = 90Swaziland National Cancer Unit, Eswatini Prostate cancer cases in 2018\n N/A\n\nScreening\n  Consultation feeMbabane ClinicPrivate hospital  Prostate Specific Antigen (PSA)Eswatini Health Laboratory ServicesPrivate hospital  Digital rectal examination (DRE)Interview with expertPrivate hospital\nDiagnosis\n  TRUS guided BiopsyMbabane ClinicPrivate hospital  Computed Tomography (CT scan)Mbabane ClinicPrivate hospital  MRI scanPhalala fundPrivate hospital  X-rayMbabane ClinicPrivate hospital  Bone scanMbabane ClinicPrivate hospital\nIntervention/Treatment\n  Watchful waiting (WW)Interview with expertPrivate hospital  SurgeryMbabane clinicPrivate hospital  RadiotherapyPhalala Fund based on SA hospitals feesPrivate hospital  ChemotherapyPhalala Fund based on SA hospitals feesPrivate hospital  Androgen deprivationPhalala Fund based on SA hospitals feesMarket price  Hospitalization (local)Phalala Fund based on SA hospitals feesPrivate hospital\nOther direct costs\n  Transport and lodging costs in South AfricaPhalala Fund based on SA hospitals feesMarket price  Follow-up care (Year 1 following completion of treatment) Follow-up involves PSA testing, symptomology and clinical examination for metastatic cancer twice in a yearBased on reported prevalencePrivate hospital\nData variables and source for cost regarding screening, management and treatment of prostate cancer\nDirect medical costs Direct costs in this study include resource utilization for diagnosis, treatment (surgery, chemotherapy, radiotherapy and androgen deprivation therapy) and follow-up care. To estimate the directs costs, we estimated average cost of each intervention from screening, staging and treatment and multiplied by the number of corresponding patients who received the intervention. The number of men diagnosed with prostate cancer were obtained from the national cancer registry [26]. All diagnosed cases were assumed to have undergone screening test using PSA. Screening and diagnosis costs were obtained from private hospital and market pricing. Treatment costs mainly radiation, chemotherapy and androgen deprivation therapy were received from Phalala fund based on South African private hospitals fees. In Eswatini, a majority of the management costs are borne by the Eswatini Government through Phalala fund.\nAs per the standardized cancer care guidelines, we assumed that all the men with confirmed prostate cancer in 2018 underwent screening and diagnosis tests, treatment and incurred other direct costs including transport and accommodation. Follow-up care costs was estimated for one year for those reported alive in 2018.\nDirect costs in this study include resource utilization for diagnosis, treatment (surgery, chemotherapy, radiotherapy and androgen deprivation therapy) and follow-up care. To estimate the directs costs, we estimated average cost of each intervention from screening, staging and treatment and multiplied by the number of corresponding patients who received the intervention. The number of men diagnosed with prostate cancer were obtained from the national cancer registry [26]. All diagnosed cases were assumed to have undergone screening test using PSA. Screening and diagnosis costs were obtained from private hospital and market pricing. Treatment costs mainly radiation, chemotherapy and androgen deprivation therapy were received from Phalala fund based on South African private hospitals fees. In Eswatini, a majority of the management costs are borne by the Eswatini Government through Phalala fund.\nAs per the standardized cancer care guidelines, we assumed that all the men with confirmed prostate cancer in 2018 underwent screening and diagnosis tests, treatment and incurred other direct costs including transport and accommodation. Follow-up care costs was estimated for one year for those reported alive in 2018.\nDirect non-medical costs Transport cost including return was estimated based on required patient follow-up visits based on the Eswatini Standardized Cancer Care Guidelines which state that follow-up visit should be every six months for the first two years and annually for up to five years following surgery [23]. Transport cost was estimated based on data from a previous study on breast cancer women receiving follow-up care at Mbabane Government Cancer Unit [22]. We assumed that all men completed treatment in 2018 had follow-up visits as per the Eswatini Standardized Cancer Guidelines. This study estimated one-year follow-up costs.\nTransport cost including return was estimated based on required patient follow-up visits based on the Eswatini Standardized Cancer Care Guidelines which state that follow-up visit should be every six months for the first two years and annually for up to five years following surgery [23]. Transport cost was estimated based on data from a previous study on breast cancer women receiving follow-up care at Mbabane Government Cancer Unit [22]. We assumed that all men completed treatment in 2018 had follow-up visits as per the Eswatini Standardized Cancer Guidelines. This study estimated one-year follow-up costs.\nIndirect costs We estimated the monitory value of prostate cancer related productivity loss due to morbidity (patient sick leave days incurred as a result of seeking health care) and pre-mature mortality).\nThe human capital method was used to estimate indirect costs related to productivity loss due to morbidity (sick leave as a result of seeking prostate cancer care) and pre-mature mortality [20]. We used average annual gross earnings computed from our previous study on breast cancer women receiving follow-up care in the chemotherapy unit, Mbabane Government hospital in Eswatini [22].\nMorbidity costs We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nWe estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nMortality costs To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nTo estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nWe estimated the monitory value of prostate cancer related productivity loss due to morbidity (patient sick leave days incurred as a result of seeking health care) and pre-mature mortality).\nThe human capital method was used to estimate indirect costs related to productivity loss due to morbidity (sick leave as a result of seeking prostate cancer care) and pre-mature mortality [20]. We used average annual gross earnings computed from our previous study on breast cancer women receiving follow-up care in the chemotherapy unit, Mbabane Government hospital in Eswatini [22].\nMorbidity costs We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nWe estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nMortality costs To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nTo estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].", "Direct costs in this study include resource utilization for diagnosis, treatment (surgery, chemotherapy, radiotherapy and androgen deprivation therapy) and follow-up care. To estimate the directs costs, we estimated average cost of each intervention from screening, staging and treatment and multiplied by the number of corresponding patients who received the intervention. The number of men diagnosed with prostate cancer were obtained from the national cancer registry [26]. All diagnosed cases were assumed to have undergone screening test using PSA. Screening and diagnosis costs were obtained from private hospital and market pricing. Treatment costs mainly radiation, chemotherapy and androgen deprivation therapy were received from Phalala fund based on South African private hospitals fees. In Eswatini, a majority of the management costs are borne by the Eswatini Government through Phalala fund.\nAs per the standardized cancer care guidelines, we assumed that all the men with confirmed prostate cancer in 2018 underwent screening and diagnosis tests, treatment and incurred other direct costs including transport and accommodation. Follow-up care costs was estimated for one year for those reported alive in 2018.", "Transport cost including return was estimated based on required patient follow-up visits based on the Eswatini Standardized Cancer Care Guidelines which state that follow-up visit should be every six months for the first two years and annually for up to five years following surgery [23]. Transport cost was estimated based on data from a previous study on breast cancer women receiving follow-up care at Mbabane Government Cancer Unit [22]. We assumed that all men completed treatment in 2018 had follow-up visits as per the Eswatini Standardized Cancer Guidelines. This study estimated one-year follow-up costs.", "We estimated the monitory value of prostate cancer related productivity loss due to morbidity (patient sick leave days incurred as a result of seeking health care) and pre-mature mortality).\nThe human capital method was used to estimate indirect costs related to productivity loss due to morbidity (sick leave as a result of seeking prostate cancer care) and pre-mature mortality [20]. We used average annual gross earnings computed from our previous study on breast cancer women receiving follow-up care in the chemotherapy unit, Mbabane Government hospital in Eswatini [22].\nMorbidity costs We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nWe estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].\nMortality costs To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].\nTo estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].", "We estimated the number of sick leave days for men diagnosed with prostate cancer who are in the labor participation ages (18-60 years). Using findings from a previously published study [27], we assumed sick leave for an average of 54 days per person. The sick leave days included days for staging, treatment and follow-up care. Using findings from a previous study on breast cancer conducted in Eswatini [22], we assumed 20 working days per month and a full-time working day of 8 h with estimated costs per workday ($12) translating ($1.5) per work hour [22].", "To estimate the cost of lost productivity due to premature death related to prostate cancer, years of potential productive life lost (YPPLL) were calculated by subtracting age at death from the local retirement age of 60 years [28]. Prostate cancer age groups specific deaths were estimated assuming labor participation ages of Eswatini (18-60 years). We used full employment rate and annual average earnings obtained from a previous study. Average YPPLL was multiplied by average annual earnings. According to health economic recommendations, future costs were discounted at 3% and 5% [19, 29]. The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry. In 2018, there were 31 prostate cancer related mortality with 4 that occurred within the labor participating ages of Eswatini (18-60) years [28].", "The number of prostate cancer related deaths was obtained from Eswatini Cancer Registry from which the years of productive life lost was calculated. In 2018, there were 31 prostate cancer related mortality out of which 4 occurred within the labor participating ages of Eswatini (18-60) years [28].", "We computed the aggregate total costs of screening, diagnosis and treatment of prostate cancer in 2018 as below:\n\n\\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$$Cost\\;of\\;disease\\;=\\sum\\begin{pmatrix}Direct\\;medical\\;\\cos ts\\\\+\\\\Direct\\;non-medical\\;\\cos ts\\\\Direct\\;\\cos ts\\end{pmatrix}+\\begin{pmatrix}Morbidity\\\\+\\\\Mortality\\\\Indirect\\;\\cos ts\\end{pmatrix}$$\\end{document}Costofdisease=∑Directmedicalcosts+Directnon-medicalcostsDirectcosts+Morbidity+MortalityIndirectcosts\nDirect medical costs = Consisting of direct non-medical costs and direct medical costs.\nIndirect costs = Consisting of morbidity costs and mortality costs (Patient time lost as a result of the condition and costs associated with premature mortality as a result).\nAll costs were reported in 2018 US dollars ($1=SZL14.5).", "Sensitivity analysis was performed using ± 25% to account for the cost of follow-up prevalent cancer cases and to account for unrecorded cases by the facilities.", "Directs costs In 2018, there were 90 prostate cancer cases of which 89% aged 60 years an above. The average age was 73 years. Table 2, shows unit average costs for treating prostate cancer cases including other direct costs such as transportation and accommodation.\n\nTable 2Costs for screening, diagnosis and treatment of prostate cancerParameterVariables included in the costAverage (2018) USD\nScreening\nConsultation fee41Prostate Specific Antigen (PSA)16Digital rectal examination (DRE)32\nDiagnosis\nPathologyTRUS guided Biopsy147RadiologyComputed Tomography (CT scan)- to rule out chest, abdomen and pelvis metastasis862Magnetic resonance imaging scan (MRI)1,034X-ray to rule out effusion28Bone scan in locally advanced prostate cancer607Ultrasound scan103\nTreatment\nWatchful Waiting (WW) cost include PSA test every three months and follow up consultation feePSA plus follow-up consultation fee58SurgeryRadical prostatectomy5,726Orchiectomy5,726RadiotherapyAdministered at 5 function of a 5-week period16,647Chemotherapy (Brachytherapy or external beam radiationAdministered in 5 cycles over 5-week period7,498Androgen Deprivation Therapy (ADT)Mostly Zoladex o.8 mg intramuscular (IM) for every 3 months1,268Symptoms relieving procedures (TURP/TURB)Transurethral resection of the prostate or bladder (TURP/TURB)5,872\nOther direct costs\nHospitalization costs (local)Admitted for symptoms management procedures including transurethral resection of the prostate (TURP) and orchidectomy5,872Hospital admission in step down facility for late stage treatment (In South Africa)Patient who require close monitoring following radiotherapy or surgery in hospital outside Eswatini1,206Transport and lodging cost in South AfricaAll patients who received treatment in South Africa5,959Follow-up care (Year 1 following completing treatment) Follow-up is done using PSA testing, symptomology and clinical examination for metastatic cancer twice in a yearFollow up consultation, PSA tests.94\nTotal\n\n58,796\n\nCosts for screening, diagnosis and treatment of prostate cancer\nCost distribution by disease stage is shown in Table 3. Following the Eswatini Standard Cancer Care Guidelines we assumed that all confirmed cases underwent similar screening, diagnosis and treatment pathway shown in Table 2, and simplified referral pathway shown in Fig. 1. The average costs for the different pathway including treatment intervention differed with the prostate cancer stage. Radical prostatectomy was more frequent with early stages of prostate cancer whilst interventions like chemotherapy were common with prostate cancer stages III and IV. Table 3 shows the prostate cancer costs distribution by stage.\n\nTable 3Costs for staging, management, and treatment of Prostate cancer stage I-IVStaging and treatment variablesUnit cost ($)I (T1)II (T2)III (T3)1 V (T4)Consultation for assessment4141414141\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)1648484848  Digital rectal examination (DRE)  TRUS guided Biopsy147147147147147  MRI scan1,0341,0341,0341,0341,034  Chest x-ray2827.627.627.627.6  Bone scan607607607607607  Ultrasound103103103103103  CT scan abdomen862862862862862\nTreatment (Prostate Cancer prevalence in 2018=91 patient)\n  Watchful waiting (WW). Costs include PSA test every three months and follow up consultation fee5858000  Radical prostatectomy5,7265,7265,72600  Orchiectomy (surgical castration)5,7265,7265,7265,7265,726  Radiotherapy16,64816,64816,64816,64816,648  Chemotherapy7,498007,4987,498  Symptoms relieving procedures (TURP/TURB)5,872005,8725,872  Other supportive drugs: Pain killers6060606060  Hormonal therapy (ADT) Zoladex 0.8 mg injectables1,2681,2681,2681,2681,268\nOther costs\n  Hospitalization costs (local)5,8725,8725,8725,8725,872  Hospital admission in step down facility for late stage treatment1,2061,2061,2061,2061,206  Transport and lodging cost (in RSA)5,9595,9595,9595,9595,959  Follow-up care (Year 1 following completing treatment)9494949494\nTotal\n\n58,824\n\n45,486\n\n45,428\n\n53,072\n\n53,072\n\nCosts for staging, management, and treatment of Prostate cancer stage I-IV\nRadiation is not available in Eswatini and patients are referred to private hospitals in South Africa. On average, radiotherapy treatment is administered for a period of 5-weeks [25]. The estimated unit costs for radiotherapy was $16,648 whilst chemotherapy was $7,498. In addition to treatment costs, all patients referred for radiotherapy also incurred other direct costs including transport, lodging and allowance for accompanying staff (nurse and driver) at a unit costs $5,959, Table 3.\nDirect non-medical costs Using estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).\nUsing estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).\nIn 2018, there were 90 prostate cancer cases of which 89% aged 60 years an above. The average age was 73 years. Table 2, shows unit average costs for treating prostate cancer cases including other direct costs such as transportation and accommodation.\n\nTable 2Costs for screening, diagnosis and treatment of prostate cancerParameterVariables included in the costAverage (2018) USD\nScreening\nConsultation fee41Prostate Specific Antigen (PSA)16Digital rectal examination (DRE)32\nDiagnosis\nPathologyTRUS guided Biopsy147RadiologyComputed Tomography (CT scan)- to rule out chest, abdomen and pelvis metastasis862Magnetic resonance imaging scan (MRI)1,034X-ray to rule out effusion28Bone scan in locally advanced prostate cancer607Ultrasound scan103\nTreatment\nWatchful Waiting (WW) cost include PSA test every three months and follow up consultation feePSA plus follow-up consultation fee58SurgeryRadical prostatectomy5,726Orchiectomy5,726RadiotherapyAdministered at 5 function of a 5-week period16,647Chemotherapy (Brachytherapy or external beam radiationAdministered in 5 cycles over 5-week period7,498Androgen Deprivation Therapy (ADT)Mostly Zoladex o.8 mg intramuscular (IM) for every 3 months1,268Symptoms relieving procedures (TURP/TURB)Transurethral resection of the prostate or bladder (TURP/TURB)5,872\nOther direct costs\nHospitalization costs (local)Admitted for symptoms management procedures including transurethral resection of the prostate (TURP) and orchidectomy5,872Hospital admission in step down facility for late stage treatment (In South Africa)Patient who require close monitoring following radiotherapy or surgery in hospital outside Eswatini1,206Transport and lodging cost in South AfricaAll patients who received treatment in South Africa5,959Follow-up care (Year 1 following completing treatment) Follow-up is done using PSA testing, symptomology and clinical examination for metastatic cancer twice in a yearFollow up consultation, PSA tests.94\nTotal\n\n58,796\n\nCosts for screening, diagnosis and treatment of prostate cancer\nCost distribution by disease stage is shown in Table 3. Following the Eswatini Standard Cancer Care Guidelines we assumed that all confirmed cases underwent similar screening, diagnosis and treatment pathway shown in Table 2, and simplified referral pathway shown in Fig. 1. The average costs for the different pathway including treatment intervention differed with the prostate cancer stage. Radical prostatectomy was more frequent with early stages of prostate cancer whilst interventions like chemotherapy were common with prostate cancer stages III and IV. Table 3 shows the prostate cancer costs distribution by stage.\n\nTable 3Costs for staging, management, and treatment of Prostate cancer stage I-IVStaging and treatment variablesUnit cost ($)I (T1)II (T2)III (T3)1 V (T4)Consultation for assessment4141414141\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)1648484848  Digital rectal examination (DRE)  TRUS guided Biopsy147147147147147  MRI scan1,0341,0341,0341,0341,034  Chest x-ray2827.627.627.627.6  Bone scan607607607607607  Ultrasound103103103103103  CT scan abdomen862862862862862\nTreatment (Prostate Cancer prevalence in 2018=91 patient)\n  Watchful waiting (WW). Costs include PSA test every three months and follow up consultation fee5858000  Radical prostatectomy5,7265,7265,72600  Orchiectomy (surgical castration)5,7265,7265,7265,7265,726  Radiotherapy16,64816,64816,64816,64816,648  Chemotherapy7,498007,4987,498  Symptoms relieving procedures (TURP/TURB)5,872005,8725,872  Other supportive drugs: Pain killers6060606060  Hormonal therapy (ADT) Zoladex 0.8 mg injectables1,2681,2681,2681,2681,268\nOther costs\n  Hospitalization costs (local)5,8725,8725,8725,8725,872  Hospital admission in step down facility for late stage treatment1,2061,2061,2061,2061,206  Transport and lodging cost (in RSA)5,9595,9595,9595,9595,959  Follow-up care (Year 1 following completing treatment)9494949494\nTotal\n\n58,824\n\n45,486\n\n45,428\n\n53,072\n\n53,072\n\nCosts for staging, management, and treatment of Prostate cancer stage I-IV\nRadiation is not available in Eswatini and patients are referred to private hospitals in South Africa. On average, radiotherapy treatment is administered for a period of 5-weeks [25]. The estimated unit costs for radiotherapy was $16,648 whilst chemotherapy was $7,498. In addition to treatment costs, all patients referred for radiotherapy also incurred other direct costs including transport, lodging and allowance for accompanying staff (nurse and driver) at a unit costs $5,959, Table 3.\nDirect non-medical costs Using estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).\nUsing estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).\nIndirect costs Productive loss due to sick leave as a result of patient seeking health care for prostate cancer was estimated at $58,320, Table 4. Out of the 90 patients diagnosed with prostate cancer, there were 13 men within the labor participating ages which were assumed to be on average sick leave of 54 days per person excluding short term sick leave of 14 days that is usually covered by employers. A total of 31 men died of prostate cancer in 2018 out of which 4 were less than 60 years. Costs due to prostate cancer premature mortality was estimated at $113,760, Table 5.\n\nTable 4Costs due to sick leave days associated with prostate cancer costsNumbers of sick leave daysNumber of patients alive in 2018Cost per workday ($)Total productivity loss due to costs due to prostate cancer in 2018 ($) for all patientTotal patient545812$37,584\nCosts due to sick leave days associated with prostate cancer costs\n\nTable 5Mortality for prostate cancerMortality cost for Prostate cancerAge groupsLost YPPLL (Average YPPLL for 1 patient in each age group)Number of premature deaths before age 60Average annual incomeMortality cost ($) with 3% Discount rate multiplied with the number of patients in this age groupMortality cost ($) with 5% Discount rate multiplied with the number of patients in each age group46-51491269029,63210,67652-56543269084,12827,311Totals10342690113,76037,987YPPLL211Average annual gross income = $2,690\nMortality for prostate cancer\nProductive loss due to sick leave as a result of patient seeking health care for prostate cancer was estimated at $58,320, Table 4. Out of the 90 patients diagnosed with prostate cancer, there were 13 men within the labor participating ages which were assumed to be on average sick leave of 54 days per person excluding short term sick leave of 14 days that is usually covered by employers. A total of 31 men died of prostate cancer in 2018 out of which 4 were less than 60 years. Costs due to prostate cancer premature mortality was estimated at $113,760, Table 5.\n\nTable 4Costs due to sick leave days associated with prostate cancer costsNumbers of sick leave daysNumber of patients alive in 2018Cost per workday ($)Total productivity loss due to costs due to prostate cancer in 2018 ($) for all patientTotal patient545812$37,584\nCosts due to sick leave days associated with prostate cancer costs\n\nTable 5Mortality for prostate cancerMortality cost for Prostate cancerAge groupsLost YPPLL (Average YPPLL for 1 patient in each age group)Number of premature deaths before age 60Average annual incomeMortality cost ($) with 3% Discount rate multiplied with the number of patients in this age groupMortality cost ($) with 5% Discount rate multiplied with the number of patients in each age group46-51491269029,63210,67652-56543269084,12827,311Totals10342690113,76037,987YPPLL211Average annual gross income = $2,690\nMortality for prostate cancer\nTotal annual costs The total annual costs for prostate cancer was estimated at $ 6.2 million (between $4.7 million and 7.8 million estimated with lower and upper bounds), Table 6. Fourth 4% (40) of the cases were diagnoses with stage IV whilst only 11% (10) were diagnosed with stages I. Management of prostate cancer stages III and IV formed the greatest share of the costs for prostate cancer contributing about $1.2 and 2.1 million respectively. The total costs of stages I and II was estimated at $0.5 and $0.8 million. Transport and accommodation costs (cost incurred by those transferred to South Africa) were highest under other direct costs contributing about $0.5million. In 2018, there were 31 prostate cancer related deaths with only 4 occurred within the labor participating ages of Eswatini (18-60) years. The total year of productive life lost (YPPL) was 221 years. Indirect costs were estimated at $0.24 million and a majority (96%, $0.2 million) were productive loss from premature mortality, Table 6.\n\nTable 6Total Annual costs estimation for Prostate cancer (direct and indirect costs)Prevalence 2018Cost per item ($)Base case cost ($)Range ($)\nParameter\n\nNumber\n\nAverage cost (2018)\n\nBase costs (2018)\n\n(Lower (-25%)\n\nHigher (+25)\nDirect costs (Health care costs) consultation fee9041369027684613\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)9016144810861810  Digital rectal examination (DRE)80000  TRUS guided Biopsy9014713,213991016,516  MRI scan90103493,06069,795116,325  Chest x-ray9028248418633105  Bone scan9060754,63040,97368,288  Ultra sound901039270695311,588  CT scan abdomen9086277,58058,18596,975\nTreatment\n  Stage I1045,486454,861341,146568,577  Stage II1745,428772,278579,209965,348  Stage III2353,0721,220,659915,4941,525,824  Stage IV4053,0722,122,8861,592,1642,653,607\nOther direct costs\n  Hospitalization costs (local)9021018,90014,17523,625  Hospital admission in step down facility for late stage treatment901206108,54081,405135,675  Transport and lodging cost (in RSA)905959536,310402,233670,388  Follow-up care (Year 1 following completing treatment)602662159,720119,790199,650\nTotal direct\n209,8925,645,8394,234,3797,057,299\nDirect non-medical cost\n  Transport costs for follow-up visits ,patient592513148,267111,200185,334  Transport costs for follow-up visits, accompanying relative592513148,267111,200185,334\nTotal Direct non-medical costs\n5026296,534222,401370,668\nIndirect costs\n  Morbidity costs due to sick leave136488424631810,530  Premature mortality costs457,675230,700173,025288,375\nTotal indirect costs\n58,323239,124179,343298,905\nTotal\n\n268,215\n\n6,181,497\n\n4,636,123\n\n7,726,871\n\nTotal Annual costs estimation for Prostate cancer (direct and indirect costs)\nThe total annual costs for prostate cancer was estimated at $ 6.2 million (between $4.7 million and 7.8 million estimated with lower and upper bounds), Table 6. Fourth 4% (40) of the cases were diagnoses with stage IV whilst only 11% (10) were diagnosed with stages I. Management of prostate cancer stages III and IV formed the greatest share of the costs for prostate cancer contributing about $1.2 and 2.1 million respectively. The total costs of stages I and II was estimated at $0.5 and $0.8 million. Transport and accommodation costs (cost incurred by those transferred to South Africa) were highest under other direct costs contributing about $0.5million. In 2018, there were 31 prostate cancer related deaths with only 4 occurred within the labor participating ages of Eswatini (18-60) years. The total year of productive life lost (YPPL) was 221 years. Indirect costs were estimated at $0.24 million and a majority (96%, $0.2 million) were productive loss from premature mortality, Table 6.\n\nTable 6Total Annual costs estimation for Prostate cancer (direct and indirect costs)Prevalence 2018Cost per item ($)Base case cost ($)Range ($)\nParameter\n\nNumber\n\nAverage cost (2018)\n\nBase costs (2018)\n\n(Lower (-25%)\n\nHigher (+25)\nDirect costs (Health care costs) consultation fee9041369027684613\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)9016144810861810  Digital rectal examination (DRE)80000  TRUS guided Biopsy9014713,213991016,516  MRI scan90103493,06069,795116,325  Chest x-ray9028248418633105  Bone scan9060754,63040,97368,288  Ultra sound901039270695311,588  CT scan abdomen9086277,58058,18596,975\nTreatment\n  Stage I1045,486454,861341,146568,577  Stage II1745,428772,278579,209965,348  Stage III2353,0721,220,659915,4941,525,824  Stage IV4053,0722,122,8861,592,1642,653,607\nOther direct costs\n  Hospitalization costs (local)9021018,90014,17523,625  Hospital admission in step down facility for late stage treatment901206108,54081,405135,675  Transport and lodging cost (in RSA)905959536,310402,233670,388  Follow-up care (Year 1 following completing treatment)602662159,720119,790199,650\nTotal direct\n209,8925,645,8394,234,3797,057,299\nDirect non-medical cost\n  Transport costs for follow-up visits ,patient592513148,267111,200185,334  Transport costs for follow-up visits, accompanying relative592513148,267111,200185,334\nTotal Direct non-medical costs\n5026296,534222,401370,668\nIndirect costs\n  Morbidity costs due to sick leave136488424631810,530  Premature mortality costs457,675230,700173,025288,375\nTotal indirect costs\n58,323239,124179,343298,905\nTotal\n\n268,215\n\n6,181,497\n\n4,636,123\n\n7,726,871\n\nTotal Annual costs estimation for Prostate cancer (direct and indirect costs)", "In 2018, there were 90 prostate cancer cases of which 89% aged 60 years an above. The average age was 73 years. Table 2, shows unit average costs for treating prostate cancer cases including other direct costs such as transportation and accommodation.\n\nTable 2Costs for screening, diagnosis and treatment of prostate cancerParameterVariables included in the costAverage (2018) USD\nScreening\nConsultation fee41Prostate Specific Antigen (PSA)16Digital rectal examination (DRE)32\nDiagnosis\nPathologyTRUS guided Biopsy147RadiologyComputed Tomography (CT scan)- to rule out chest, abdomen and pelvis metastasis862Magnetic resonance imaging scan (MRI)1,034X-ray to rule out effusion28Bone scan in locally advanced prostate cancer607Ultrasound scan103\nTreatment\nWatchful Waiting (WW) cost include PSA test every three months and follow up consultation feePSA plus follow-up consultation fee58SurgeryRadical prostatectomy5,726Orchiectomy5,726RadiotherapyAdministered at 5 function of a 5-week period16,647Chemotherapy (Brachytherapy or external beam radiationAdministered in 5 cycles over 5-week period7,498Androgen Deprivation Therapy (ADT)Mostly Zoladex o.8 mg intramuscular (IM) for every 3 months1,268Symptoms relieving procedures (TURP/TURB)Transurethral resection of the prostate or bladder (TURP/TURB)5,872\nOther direct costs\nHospitalization costs (local)Admitted for symptoms management procedures including transurethral resection of the prostate (TURP) and orchidectomy5,872Hospital admission in step down facility for late stage treatment (In South Africa)Patient who require close monitoring following radiotherapy or surgery in hospital outside Eswatini1,206Transport and lodging cost in South AfricaAll patients who received treatment in South Africa5,959Follow-up care (Year 1 following completing treatment) Follow-up is done using PSA testing, symptomology and clinical examination for metastatic cancer twice in a yearFollow up consultation, PSA tests.94\nTotal\n\n58,796\n\nCosts for screening, diagnosis and treatment of prostate cancer\nCost distribution by disease stage is shown in Table 3. Following the Eswatini Standard Cancer Care Guidelines we assumed that all confirmed cases underwent similar screening, diagnosis and treatment pathway shown in Table 2, and simplified referral pathway shown in Fig. 1. The average costs for the different pathway including treatment intervention differed with the prostate cancer stage. Radical prostatectomy was more frequent with early stages of prostate cancer whilst interventions like chemotherapy were common with prostate cancer stages III and IV. Table 3 shows the prostate cancer costs distribution by stage.\n\nTable 3Costs for staging, management, and treatment of Prostate cancer stage I-IVStaging and treatment variablesUnit cost ($)I (T1)II (T2)III (T3)1 V (T4)Consultation for assessment4141414141\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)1648484848  Digital rectal examination (DRE)  TRUS guided Biopsy147147147147147  MRI scan1,0341,0341,0341,0341,034  Chest x-ray2827.627.627.627.6  Bone scan607607607607607  Ultrasound103103103103103  CT scan abdomen862862862862862\nTreatment (Prostate Cancer prevalence in 2018=91 patient)\n  Watchful waiting (WW). Costs include PSA test every three months and follow up consultation fee5858000  Radical prostatectomy5,7265,7265,72600  Orchiectomy (surgical castration)5,7265,7265,7265,7265,726  Radiotherapy16,64816,64816,64816,64816,648  Chemotherapy7,498007,4987,498  Symptoms relieving procedures (TURP/TURB)5,872005,8725,872  Other supportive drugs: Pain killers6060606060  Hormonal therapy (ADT) Zoladex 0.8 mg injectables1,2681,2681,2681,2681,268\nOther costs\n  Hospitalization costs (local)5,8725,8725,8725,8725,872  Hospital admission in step down facility for late stage treatment1,2061,2061,2061,2061,206  Transport and lodging cost (in RSA)5,9595,9595,9595,9595,959  Follow-up care (Year 1 following completing treatment)9494949494\nTotal\n\n58,824\n\n45,486\n\n45,428\n\n53,072\n\n53,072\n\nCosts for staging, management, and treatment of Prostate cancer stage I-IV\nRadiation is not available in Eswatini and patients are referred to private hospitals in South Africa. On average, radiotherapy treatment is administered for a period of 5-weeks [25]. The estimated unit costs for radiotherapy was $16,648 whilst chemotherapy was $7,498. In addition to treatment costs, all patients referred for radiotherapy also incurred other direct costs including transport, lodging and allowance for accompanying staff (nurse and driver) at a unit costs $5,959, Table 3.\nDirect non-medical costs Using estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).\nUsing estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).", "Using estimate from a previous study [22], the average transport cost per follow-up visit including return was $11 (inter quartile range (IQR)$4-46). On average, post treatment follow-up visits should be every 6 months resulting to four visits in a year including return. We assumed that all patients visited the hospital in the company of a relative. The total average transport costs including return was estimated at $5,029 (between $3,771 and 6,287 estimated with lower and upper bounds).", "Productive loss due to sick leave as a result of patient seeking health care for prostate cancer was estimated at $58,320, Table 4. Out of the 90 patients diagnosed with prostate cancer, there were 13 men within the labor participating ages which were assumed to be on average sick leave of 54 days per person excluding short term sick leave of 14 days that is usually covered by employers. A total of 31 men died of prostate cancer in 2018 out of which 4 were less than 60 years. Costs due to prostate cancer premature mortality was estimated at $113,760, Table 5.\n\nTable 4Costs due to sick leave days associated with prostate cancer costsNumbers of sick leave daysNumber of patients alive in 2018Cost per workday ($)Total productivity loss due to costs due to prostate cancer in 2018 ($) for all patientTotal patient545812$37,584\nCosts due to sick leave days associated with prostate cancer costs\n\nTable 5Mortality for prostate cancerMortality cost for Prostate cancerAge groupsLost YPPLL (Average YPPLL for 1 patient in each age group)Number of premature deaths before age 60Average annual incomeMortality cost ($) with 3% Discount rate multiplied with the number of patients in this age groupMortality cost ($) with 5% Discount rate multiplied with the number of patients in each age group46-51491269029,63210,67652-56543269084,12827,311Totals10342690113,76037,987YPPLL211Average annual gross income = $2,690\nMortality for prostate cancer", "The total annual costs for prostate cancer was estimated at $ 6.2 million (between $4.7 million and 7.8 million estimated with lower and upper bounds), Table 6. Fourth 4% (40) of the cases were diagnoses with stage IV whilst only 11% (10) were diagnosed with stages I. Management of prostate cancer stages III and IV formed the greatest share of the costs for prostate cancer contributing about $1.2 and 2.1 million respectively. The total costs of stages I and II was estimated at $0.5 and $0.8 million. Transport and accommodation costs (cost incurred by those transferred to South Africa) were highest under other direct costs contributing about $0.5million. In 2018, there were 31 prostate cancer related deaths with only 4 occurred within the labor participating ages of Eswatini (18-60) years. The total year of productive life lost (YPPL) was 221 years. Indirect costs were estimated at $0.24 million and a majority (96%, $0.2 million) were productive loss from premature mortality, Table 6.\n\nTable 6Total Annual costs estimation for Prostate cancer (direct and indirect costs)Prevalence 2018Cost per item ($)Base case cost ($)Range ($)\nParameter\n\nNumber\n\nAverage cost (2018)\n\nBase costs (2018)\n\n(Lower (-25%)\n\nHigher (+25)\nDirect costs (Health care costs) consultation fee9041369027684613\nScreening and diagnosis\n  Prostate Specific Antigen (PSA)9016144810861810  Digital rectal examination (DRE)80000  TRUS guided Biopsy9014713,213991016,516  MRI scan90103493,06069,795116,325  Chest x-ray9028248418633105  Bone scan9060754,63040,97368,288  Ultra sound901039270695311,588  CT scan abdomen9086277,58058,18596,975\nTreatment\n  Stage I1045,486454,861341,146568,577  Stage II1745,428772,278579,209965,348  Stage III2353,0721,220,659915,4941,525,824  Stage IV4053,0722,122,8861,592,1642,653,607\nOther direct costs\n  Hospitalization costs (local)9021018,90014,17523,625  Hospital admission in step down facility for late stage treatment901206108,54081,405135,675  Transport and lodging cost (in RSA)905959536,310402,233670,388  Follow-up care (Year 1 following completing treatment)602662159,720119,790199,650\nTotal direct\n209,8925,645,8394,234,3797,057,299\nDirect non-medical cost\n  Transport costs for follow-up visits ,patient592513148,267111,200185,334  Transport costs for follow-up visits, accompanying relative592513148,267111,200185,334\nTotal Direct non-medical costs\n5026296,534222,401370,668\nIndirect costs\n  Morbidity costs due to sick leave136488424631810,530  Premature mortality costs457,675230,700173,025288,375\nTotal indirect costs\n58,323239,124179,343298,905\nTotal\n\n268,215\n\n6,181,497\n\n4,636,123\n\n7,726,871\n\nTotal Annual costs estimation for Prostate cancer (direct and indirect costs)", "The current study assessed the costs associated with prostate cancer in Eswatini, that is, screening, diagnosis, treatment and follow-up care. The study considered direct costs including follow-up care costs within one year of diagnosis. To our knowledge this is the first study to estimate the economic burden of prostate cancer in Eswatini. The estimated annual prostate cancer burden was $ 6.1 million in 2018. About 89% of the patient aged 60 years and above. Given the Eswatini Standardized Cancer Care and Guidelines [21], we assumed that all patients diagnosed in 2018 underwent the screening and diagnostic procedures. Treatment costs varied by cancer stage reflecting the utilization of treatment modalities per stage hence high costs observed in stages III ($1.2million) and IV (2.1million) versus Stage I and II with $0.5 and $0.8 million respectively. The findings indicate that managing advanced stages of the disease increases health care costs.\nThe study findings were in accordance with findings from other studies. A study assessing health care costs associated with prostate cancer in Canada reported increasing costs per stage I ($1,297), II ($3,289), III ($1,495), IV ($5,629) and V ($16,020) [30]. Similarly, a study conducted in Iran concluded that health care costs for metastatic stages were the highest compared to treatment costs for localized prostate cancer [11]. More studies had similar conclusions [31, 32]. Slightly different findings were from the United State of America who reported high treatment costs for initial diagnosis and metastatic phase with radical prostatectomy being the main cost driver [33]. Whilst in this study we found lesser cost with early stage cancer, however, both studies observed increasing costs with advanced cancer stages. Also, the differences could be partly explained by the men (20%) diagnosed with early stages of prostate cancer in our study. A systematic review of registry-based studies assessing economic burden of prostate cancer in Europe found that cost distribution across prostate cancer stages varied across countries [34]. This can be attributed to differences in prostate cancer detection and country specific management practice [34]. The authors also acknowledged the difference in methodologies applied in the studies as possible explanation to the varying outcome observed.\nThere seems to be lack of global consensus on prevention strategies particularly age of screening. The United State Preventive Service Task Force (USPSTF) recommend against routine screening for men 70 years and older for prostate cancer particularly using prostate specific antigen screening [35]. The Eswatini Standardized Cancer Care and Guidelines also discourages routine prostate cancer screening with an exception for men 50 years and above or symptomatic [23]. Other studies argue that increased screening lead to increased detection of low-grade cancers resulting to patient with indolent tumors receiving aggressive treatment [36].\nIn LICs such as Eswatini, the challenge is likely to be on a different direction than over diagnosing and consequently overt treatment. Lack of screening and comprehensive treatment remains the greatest challenge for most LMICs and LICs. Eswatini is not different from other low middle income countries from whom late diagnosis coupled with limited treatment options remains a challenge. In Eswatini, in 2018, more than 80% of the patients were diagnosed with advanced cancer (stages III and IV), yet major treatment is not available in country. These include radiotherapy and androgen deprivation therapy (ADT). Accessing care outside the country comes with additional costs, mainly accommodation, transportation and meals for patients referred to South Africa.\nLack of specialized and costly care have been reported in other countries particularly in Africa and mortality from prostate cancer is the highest in these countries and there is lack of cancer treatment guidelines [4, 37].\nThere is an urgent need to strengthen health systems enablers [38]. These include investments in the establishment of local cancer treatment centers, optimizing health workforce competencies throughout the continuum of care and ensuring availability of medical products and diagnostics technologies to facilitate local diagnosis, staging and management.\nDespite the evidence that prostate cancer is a major public health challenge, literature on the economic burden of prostate cancer is however limited and severely so in low income countries particularly in the sub-Saharan region. Findings from a systematic review on the costs of prostate cancer studies indicated a need not only for harmonized methodologies but also to expand research in this field [39]. Similarly, another systematic literature review of registry-based studies reached similar conclusion on the need for further research in cost of illness studies focusing on prostate cancer [40].\nIn the study we assessed indirect costs by estimating the costs associated with unpaid sick leave days and productive loss due to premature mortality from prostate cancer. Of the total costs, indirect costs accounted for 4.2% ($0.24 million). Comparing these findings to previous cost analysis studies for prostate cancer, most of the studies did not consider assessing indirect costs, however a study from Sweden reported low proportion of productivity loss associated with prostater cancer [9]. Further comparison of the findings with studies from other cancer types conducted in Eswatini [22, 41], the indirect costs from this study accounted for a lesser share of the total cost. This could partly be explained by the fact that most participants (89%) were above the labor participating ages (18-60 years) and few deaths occurred below age 60 years. A similar pattern was observed in Sweden, again the finding were attributed to low number of prostate cancer cases and deaths among labor participation groups [9].\nThe key strength of our study was that this is the first study to estimate cost associated with prostate cancer in Eswatini. The study considered both direct and indirect costs of prostate cancer. Our study has notable findings that has implications on health care systems strengthening and resources allocation in Eswatini. Our study present description of resource utilization and associated health care costs in managing prostate cancer in Eswatini.\nAn important limitation is the absence of index cost in Eswatini. We considered private and market prices for best possible price estimates.\nThe estimates presented were based on available data however, estimates could be conservative due to several reasons, First, due to limited data availability we used information from literature and interview with experts for some treatment variables, as such, some information can be subject to context and preferences. Secondly, we only considered costs in the first year of diagnosis yet cost for follow-up care can be even beyond five years [6, 42]. Lastly, we employed human capital approach to estimate the costs related to productivity loss associated with prostate cancer. Whilst this is a commonly applied approach, it is mostly criticized for excluding individuals above the labor participation age group yet there is argument that some of those people can still be involved in labor activities that gives meaningful income. Another author argues that this has severe implication when valuing productivity loss for prostate cancer given that a majority of the patients are diagnosed after they have past the retirement age.", "The findings of the study indicated that costs attributed to prostate cancer were substantial and they are a public health concern. The findings were consistent with those of other countries, a majority of which were conducted in developed countries. The study demonstrated the interventions and associated costs. Radiotherapy was the most expensive treatment intervention in Eswatini, yet other studies cited surgery related intervention as the major costs driver. This is a reasonable finding in the context of Eswatini given that radiotherapy treatment is not available locally, patients are referred to private hospitals outside the country. The findings point areas for policy makers to perform cost containment regarding therapeutic procedures for prostate cancer. Also, the study findings demonstrate that prostate cancer costs are likely to increase in future and there is a need for strengthening adherence to the Eswatini Standardized Cancer Care and Guidelines in order to ensure that resources are invested to diagnosing the most at risk groups.", " \nAdditional file 1. Direct non-medical costs patient questionnaires.pdf\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf\n\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf", "\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf\nAdditional file 1. Direct non-medical costs patient questionnaires.pdf" ]

[ null, "materials|methods", null, null, null, null, null, null, null, null, null, null, null, null, null, "results", null, null, null, null, "discussion", "conclusion", "supplementary-material", null ]

[ "Prostate cancer", "Cost-of-illness", "Eswatini", "Premature mortality", "Prostate antigen test" ]

[ 516, 388, 294, 94, 600, 2342, 203, 115, 674, 123, 156, 56, 122, 30, 923, 99, 255, 445, 24 ]

[ "costs", "cancer", "prostate", "prostate cancer", "treatment", "eswatini", "estimated", "care", "cost", "follow" ]

[ "costs prostate cancer", "countries ranked prostate", "prostate cancer societal", "prostate cancer costs", "africa mortality prostate" ]

[ "Adolescent", "Adult", "Age Distribution", "Brazil", "Child", "Child, Preschool", "Disease Notification", "Female", "Heart Defects, Congenital", "Humans", "Infant", "Infant, Newborn", "Male", "Prevalence", "Registries", "Young Adult" ]

[ "Objective", "Study limitations" ]

[ "The aim of this study was to estimate underreporting in the prevalence of\ncongenital heart disease in Brazil and its most frequent subtypes.", "The calculation of the prevalence of congenital heart disease and their most\nfrequent subtypes was anchored in study review and meta-analysis that proposed\nto estimate the prevalence of this disease in the world[18]. One of the\nlimitations of this meta-analysis is not cover the entire world population, in\naddition to using only studies with summaries in English and make use of\ngovernment records available online, a fact that leads to underreporting error,\nas demonstrated in this study. In this study we found differences in prevalence\nrates between the continents, ranging from 1.9 to 9.3/1000 births in Africa and\nAsia, respectively. The author states that data from developing countries were\nscarce, and studies often did not include indigenous peoples and tribes.\nRecords to consider the entire population of births are needed to determine the\ntrue prevalence of congenital heart disease." ]

[ null, null ]

[ "INTRODUCTION", "Objective", "METHODS", "RESULTS", "DISCUSSION", "Study limitations", "CONCLUSION" ]

[ "Congenital Heart Disease (CHD) is an abnormality in the structure or\ncardiocirculatory function that occurs from birth, even if subsequently\ndiagnosed[1]. It varies in severity, occurring from communications\nbetween cavities that spontaneously regress up to major malformations that even\nrequire several procedures, surgical or catheterization. It can result in\nintrauterine, childhood or adulthood death[2].\nGlobally, 130 million children are born each year. Of these, four million die in the\nneonatal period, or that is, in the first 30 days of life[3] and 7% of the fatalities\nare related to CHD[4].\nIn 2007, in Brazil, 6% of deaths in children under one year of age were by\nCHD[5].\nAmong the congenital malformations, cardiovascular abnormalities are the most common\ncause of infant mortality, 40% under study in São\nPaulo/Brazil[6] and 26.6% and 48.1% in the US[7,8]. Delays in the development and cognitive deficits are\nassociated with a congenital heart disease of 20% to 30%[9-11].\nHoffman & Kaplan reported a variation in prevalence rate of 4:1000 to 50:1000\nbirths. The highest one is related to the occurrence of low severity injuries that\nare solved without medical intervention[12].\nIn Brazil, studies on the epidemiology of congenital heart disease with different\ncuts, express coefficients ranging from 5.494[13] to 7.17 per 1,000 births[14]. For a group with low\nbirth weight, the prevalence rate ranged from 10.7 to 40.7:1,000\nbirths[15].\nAmorim, in Minas Gerais, Brazil, from 1990 to 2003, analyzing data on 29,770\nnewborns, found prevalence rate of congenital heart defects corresponding to\n9.58:1,000 births and equal to 87.72:1,000 between stillbirths[16]. Rivera, in Alagoas,\nBrazil, for the same age group, found prevalence in 13.2:1,000\nbirths[17].\nStudy review and meta-analysis on the global prevalence of congenital heart disease\nincluded 114 studies, with a study population of 24,091,867 births. The prevalence\nrate estimated at 9.1 per 1,000 births remains stable over the last 15 years. This\ncorresponds to 1.35 million newborns with CHD each year[18].\nIn this study, prevalence is the greatness of the event at any given\ntime[19],\nadopting the coefficient of 9:1000 births as the basis for calculation of CHD in\nBrazil and in each federal unit.\nThe scarcity of specific bibliography and reliable statistics on the Brazilian\npopulation with congenital heart disease forces the approximation to the\ninternational literature, in order to estimate the prevalence of CHD in Brazil and\ncompare it to the official notifications, serving therefore as basis for formulation\nof public policies, based on more realistic data.\n Objective The aim of this study was to estimate underreporting in the prevalence of\ncongenital heart disease in Brazil and its most frequent subtypes.\nThe aim of this study was to estimate underreporting in the prevalence of\ncongenital heart disease in Brazil and its most frequent subtypes.", "The aim of this study was to estimate underreporting in the prevalence of\ncongenital heart disease in Brazil and its most frequent subtypes.", "We adopted for the test under report, the prevalence rate of congenital heart disease\nequal to 9:1000 births, defined in a review and meta-analysis study for births\nworldwide [18].\nPopulation and birth registries in Brazil, regions and federated units, were obtained\nby consulting the Demographic Census of 2010, published in 2012, and made available\non the DATASUS/Ministry of Health (MOH) website[20].\nSecondary data relating to the distribution by age group, the Brazilian population of\n2009, published by the Demographic Census of 2010[20], were divided into two groups: the first\nwith children under 18 years of age and the second formed by adults, aged 18 and\nmore.\nRates for the prevalence of congenital heart disease by age group, were defined in\nthe study on the population of Canada. For children under 18, 11.89 CHD per 1,000\nindividuals and 4.09 CHD per 1,000 adults[21].\nThe prevalence of congenital heart disease in 2010, recorded in SINASC (System of\nLive Birth Information), was obtained by consulting the DATASUS/MOH website.\nThe estimated prevalence of congenital heart disease in Brazil, was generated when\nthe prevalence rate equal to 9: 1000 births was applied to quantitative births.\nEstimated prevalence of congenital heart disease was compared with notifications from\nSINASC/MOH, revealing the disease registration percentage in Brazil and the federal\nunits.\nThe estimated prevalence of the eight most frequent subtypes of CHD was achieved by\napplying to the quantitative of birth the prevalence rates per 1,000 births of each\nsubtype, namely: Ventricular septal defect (VSD) 2.62; Atrial septal defect (ASD)\n1.64; Persistent ductus arteriosus (PDA) 0.87; Pulmonary stenosis 0.5; Tetralogy of\nFallot (T4F) 0.34; Aortic Coarctation (AoCo) 0.34; Transposition of the great\narteries (TGA) 0.31 and Aortic Stenosis, 0.22[18].\nThe CHD prevalence rates among age groups were estimated when applied to population\ngroups their respective relative rates of prevalence[21].\nThe data were evaluated by descriptive methods using rates and ratios represented in\ntables.", "In 2010, in Brazil, 2,861,868 births were reported. When applied the prevalence rate\nof congenital heart disease of 9:1,000 births, an estimate of 25,757 new cases for\nthe year under study was found. The occurrence of CHD in the Brazilian regions, for\nthe same year, was as follows: North 2758; Northeast 7,570; Southeast 10,112; South\n3329; and Midwest 1,987 new cases Table\n1.\nDistribution of the number of births, prevalence of Congenital Heart Disease\n(CHD), birth notification with (CHD) - SINASC/Ministry of Health (MOH) and\nnotification percentage for Brazil, regions and federated units in 2010.\nSource: MoH/SVS/DASIS - Live Births Information System - SINASC -\n2010.\nIn the same period, 1,377 cases of births with CHD were reported to the Ministry of\nHealth/SINASC, representing 5.3% of estimated for Brazil. The distribution by\nfederal unit is visualized in Table 1.\nIn this study, the prevalence for the year 2010, from the eight most frequent\nsubtypes of CHD were: Ventricular septal defect (VSD) 7498; Atrial septal defect\n(ASD) 4693; Persistent ductus arteriosus (PDA) 2490; Pulmonary stenosis 1,431;\nTetralogy of Fallot (T4F) 973; Aortic coarctation (CoA) 973; Transposition of the\ngreat arteries (TGA) 887 and Aortic Stenosis 630 Table 2.\nDistribution of the prevalence of the eight CHD subtypes in Brazil and in the\nregions for the year 2010.\nSource: MoH/SVS/DASIS - Live Births Information System - SINASC -\n2010.\nPrevalence of types of CHD per 1,000 births. CHD=congenital heart\ndeseases; VSD=ventricular septal defect; ASD=atrial septal defect;\nPDA=persistent ductus arteriosus; Pulm Stenosis=pulmonary stenosis;\nT4F=tetralogy of Fallot; AoCo=aortic coarctation; TGA=transposition of\nthe great arteries; Ao Stenosis=aortic stenosis\nIn 2009, to a Brazilian population of 191,795,000, divided into 56,809,000 under 18\nand 134 986 000 adults was estimated a prevalence of 675,495 children and\nadolescents and 552,092 adults with congenital heart disease.", "Pinto Jr et al.[22]\npropose, in a study on regionalization of Brazilian pediatric cardiovascular\nsurgery, the implementation of a support network for patients with congenital heart\ndisease, of fair range for all regions of Brazil. Therefore, it becomes important to\ndefine the prevalence and distribution of the disease and its subtypes for each\nterritory.\nThe lack of national studies forces the approximation of the numbers with specific\ninternational literature and thus, through estimates, it reveals a scenario that\nbest describes the reality.\nIt is common to find in the scientific literature that large differences in\nepidemiological calculations, which stems in part of the variation in sample\nselection in which the studies are performed[12,15,16]. Studies on the prevalence\nof CHD after the first year of life underestimate the occurrence of the disease in\nthe fetus and newborn, considering that 20% of children die in their first year of\nlife[23].\nAnother aspect that implies inaccuracies is related to the fact that 30% of CHD can\nnot be diagnosed in the first weeks of life[24].\nCHD prevalence rate equal to 9:1000 births, defined in the study review and\nmeta-analysis to births worldwide[18], was defined as basis for calculation of CHD\nestimates for this study.\nThus, estimates for Brazil point to 25,757 new cases of CHD/year, distributed by\nregions North 2,758; Northeast 7,570; Southeast 10,112; South 3329; and Midwest\n1,987.\nThe notifications published by DATASUS/MS have shown 1,377 births with CHD in 2010,\ncorresponding to 5.3% of the estimate of 9:1,000 births used for this study.\nTherefore, the public policies in this segment are supported by a reality of\nunderreporting. Thus, assumptions of the Unified Health System; as universality,\ncomprehensiveness and equity, principles of health-inducing public policies with\nquality[25],\nremain outside of care to this group of patients.\nKnowing that 25% of births with CHD require invasive treatment in the first year of\nlife[26], in\norder to meet the demand, it would be needed 6,439 procedures per year in Brazil. In\n2008, however, 1919 procedures were performed[5]. There is, therefore, for this age group,\ndeficit of procedures is about 70%.\nA quantitative explanation of congenital heart disease, its territorial distribution\nand classification by subtypes associated with the determination of risk for\ndisease, allows establishing planning for the health care of this population.\nThus, considering all the variables, it is possible to direct investments equally to\nthis group that, in 2009 amounted to 675,495 children and adolescents and 552,092\nadults with CHD, with expected annual growth rate of 1% to 5%, depending on age and\nthe distribution of[21,27] injuries.\nTransposition of the gap between standards, Ordinances 1169/GM and\n210/SAS-MS[28,29] and the assistance\nrequires political will and planning aimed at improving access to pediatric\ncardiovascular surgery centers, financing of Cardiology and Cardiovascular Surgery\nPediatric; database feeding; promote management for quality and establish continuing\neducation programs[5,6].\nFailure to observe these points, which are fundamental in the design and\nimplementation of health care policy for CHD patients, blames the Brazilian system\nof health care, public and supplementary, to leave outside the surgical treatment of\n62% of infants with congenital heart disease, reaching in some regions of Brazil to\n76 and 91%[5].\nGomes[30], in an\neditorial, \"the debt to the nation's health: the case of congenital heart disease,\"\ntranslates numbers into words and says:\n[...] became untenable the acceptance of the quality of health care of\nthe Brazilians. Felt by the population, but mainly affecting patients, their\nfamilies, doctors and all other professionals involved, and even more so when it\ninvolves children with congenital heart disease, excluded from the basic right of\nadequate treatment and the chance to be alive.\nFacing such problem requires the participation of civil society in the development of\nsocial policies and it is mandatory for the elaboration of issues in the social\narea, the intervention of agents who experience difficulties, either as carriers of\ndisease, either as family components, either as professionals[31].\n Study limitations The calculation of the prevalence of congenital heart disease and their most\nfrequent subtypes was anchored in study review and meta-analysis that proposed\nto estimate the prevalence of this disease in the world[18]. One of the\nlimitations of this meta-analysis is not cover the entire world population, in\naddition to using only studies with summaries in English and make use of\ngovernment records available online, a fact that leads to underreporting error,\nas demonstrated in this study. In this study we found differences in prevalence\nrates between the continents, ranging from 1.9 to 9.3/1000 births in Africa and\nAsia, respectively. The author states that data from developing countries were\nscarce, and studies often did not include indigenous peoples and tribes.\nRecords to consider the entire population of births are needed to determine the\ntrue prevalence of congenital heart disease.\nThe calculation of the prevalence of congenital heart disease and their most\nfrequent subtypes was anchored in study review and meta-analysis that proposed\nto estimate the prevalence of this disease in the world[18]. One of the\nlimitations of this meta-analysis is not cover the entire world population, in\naddition to using only studies with summaries in English and make use of\ngovernment records available online, a fact that leads to underreporting error,\nas demonstrated in this study. In this study we found differences in prevalence\nrates between the continents, ranging from 1.9 to 9.3/1000 births in Africa and\nAsia, respectively. The author states that data from developing countries were\nscarce, and studies often did not include indigenous peoples and tribes.\nRecords to consider the entire population of births are needed to determine the\ntrue prevalence of congenital heart disease.", "The calculation of the prevalence of congenital heart disease and their most\nfrequent subtypes was anchored in study review and meta-analysis that proposed\nto estimate the prevalence of this disease in the world[18]. One of the\nlimitations of this meta-analysis is not cover the entire world population, in\naddition to using only studies with summaries in English and make use of\ngovernment records available online, a fact that leads to underreporting error,\nas demonstrated in this study. In this study we found differences in prevalence\nrates between the continents, ranging from 1.9 to 9.3/1000 births in Africa and\nAsia, respectively. The author states that data from developing countries were\nscarce, and studies often did not include indigenous peoples and tribes.\nRecords to consider the entire population of births are needed to determine the\ntrue prevalence of congenital heart disease.", "In Brazil, there is underreporting in the prevalence of congenital heart disease,\nsignaling the need for adjustments in the methodology of registration." ]

[ "intro", null, "methods", "results", "discussion", null, "conclusions" ]

[ "Heart Defects", "Congenital", "Epidemiology", "Health Policy", "Brazil" ]

[ 25, 166 ]

[ "prevalence", "disease", "births", "congenital", "heart", "congenital heart", "heart disease", "congenital heart disease", "chd", "study" ]

[ "congenital malformations cardiovascular", "children congenital heart", "population congenital heart", "rate congenital heart", "epidemiology congenital heart" ]

[ "Adult", "Aged", "Graft Survival", "Humans", "Hydroxymethylglutaryl-CoA Reductase Inhibitors", "Liver Transplantation", "Male", "Middle Aged", "Retrospective Studies", "Risk Factors", "Treatment Outcome" ]

[ "INTRODUCTION", "Study design", "Study population", "Study outcomes and definitions", "Statistical analysis", "General characteristics of the study population", "Donors' general characteristics", "Mortality, re‐transplant and vascular and biliary complication", "Multistate model approach", "\nHCC recurrence and de novo/recurrence of cancer other than HCC\n", "AUTHOR CONTRIBUTIONS", "FUNDING INFORMATION" ]

[ "Liver transplantation (LT) is considered the ultimate curative option for end‐stage liver disease and for non‐resectable hepatocellular carcinoma (HCC). Although survival rates after LT have progressively improved over the years, the first year post‐LT remains the critical period, summing 46% of the total deaths and 67% of re‐LT.\n1\n Initial outcomes are mainly determined by surgical or peri‐operative problems leading to primary non‐function or delayed graft function and ultimately to re‐LT. In contrast to this, long‐term outcomes are mainly affected by de novo or recurrent malignant tumours and cardiovascular disease.\n2\n\n\nStatins are inhibitors of 3‐hydroxy‐3‐methyl‐glutaryl‐coenzyme A reductase (HMG‐CoA reductase) widely used in the treatment of dyslipidemia and prophylaxis of cardiovascular events.\n2\n, \n3\n It has long been recognised that part of the benefits attributed to statins in cardiovascular disease are due to their pleiotropic effects that influence vascular remodelling and reverse endothelial dysfunction, among others.\n4\n These pleiotropic effects may likely explain the beneficial effects of statins in other conditions, such as sepsis\n5\n and cancer.\n6\n, \n7\n Recent studies reported beneficial effects of statins on chronic liver diseases, both in pre‐clinical models \n8\n, \n9\n, \n10\n and in clinical studies.\n11\n, \n12\n, \n13\n These range from improvement of hepatic sinusoidal endothelial function, leading to a reduction in intrahepatic vascular tone and portal pressure, to a decreased fibrogenesis that may translate into preventing disease progression and facilitating its regression.\n14\n Statins have also been shown to protect from lipopolysaccharide‐induced acute‐on‐chronic liver failure (ACLF) in cirrhotic rats\n15\n and to prevent liver function impairment after hypovolemic shock.\n16\n, \n17\n Interestingly, in preclinical models statins protect against ischemia/reperfusion injury in young and aged animals\n18\n and prolong liver graft preservation both in normal and liver grafts with steatosis considered at high‐risk of ischemia/reperfusion injury.\n19\n Furthermore, epidemiological studies in large cohorts of patients with chronic liver disease suggest a protective effect of statins reducing the rate of progression to cirrhosis, liver decompensation, development of HCC and death.\n20\n, \n21\n Classical indications for statins, including the treatment and prevention of cardiovascular diseases, may be relevant for the long‐term outcome after LT.\n22\n Moreover, the effects of statins protecting from ischemia/reperfusion injury could be beneficial in the early phase after LT, by reducing the incidence and severity of biliary and vascular complications. Therefore, we hypothesize that statin use in LT recipients may favourably influence the transition to adverse outcomes, including re‐LT, severe and recurrent biliary‐vascular complications, and death.", "We conducted a cohort study in a nationwide database, including all adult patients who underwent LT from May 2008 to December 2019 registered in the Swiss Transplant Cohort Study (STCS). The STCS is a prospective open cohort study including data from transplanted patients starting in 2008 from the three Swiss liver transplant centres: Bern, Zurich and Geneva. Data from the liver donors were obtained from the Swiss Organ Allocation System (SOAS) records, with permission from Swisstransplant.\nThe study was conducted in accordance with the Declaration of Helsinki and Good Clinical Practice. All the patients included in the present study had given their informed consent to be included in the STCS. In addition, the Bern Cantonal Ethics Committee (KEK‐ID 2020–02122) approved the present study, as well as the STCS (FUP 149).", "We included all consecutive adult LT candidates who received a liver from a deceased donor and agreed to participate in the STCS. We collected data regarding liver disease aetiology, severity, comorbidities, use of statins and duration of exposure to these drugs. Regarding donor characteristics, we recorded demographic data, comorbidities, type of deceased donor, cause of death, biochemical characteristics and use of statins.", "We studied LT outcome according to statin exposure in the first 3 years after LT. The primary outcome was post‐LT mortality, while re‐LT and/or development of biliary‐vascular complications were secondary outcomes. Yet, we consider cancer and major cardiovascular events as secondary endpoint as well, arising in an ancillary analysis aimed primarily to better control for possible confounding factors. Patients who dropped out were considered alive until last follow‐up and then censored.\nRe‐LT was defined as a new LT due to all types of graft loss. Biliary‐vascular complications included biliary leaks, stones and strictures and vascular thrombosis, vascular stenosis and ischemic cholangiopathy.\n23\n Because not all vascular thrombotic complications necessarily lead to a biliary event, the two types of complications were considered separately. Systemic cardiovascular complications included occurrence of a major cardiovascular event (documented myocardial infarction or stroke), thromboembolic event (pulmonary embolism) and peripheral arterial ischemic disease. Concerning cancers other than HCC, we considered all solid and haematological cancers excluding non‐melanoma skin cancers.\nStatin exposure was assessed in both donors and recipients. For donors, statin use was assessed as a dichotomous variable at the time of donation, whereas for recipients, statin use was defined as concurrent use of statins for a given time t during follow‐up. In order to reduce the immortal time bias, exposure was considered as person‐time between prescription and end of follow‐up.\n24\n LT was considered time 0. The observation time after LT was 3 years.", "For descriptive aims, we report the general characteristics of the study cohort across the study period. Quantitative and categorical variables were expressed as mean and standard deviation or median and interquartile range (25%–75%) and percentages, respectively. As supplementary analysis, we divided the recipients into statin non‐user and statin user groups through the study period and compared these using Welch's t‐test for continuous variables and Wilcoxon's rank‐sum test for rank data, respectively. Categorical variables were compared using Chi2, where appropriate.\nBecause only three patients had missing covariate data, we adopted a complete‐cases analysis for all models. We conducted the statistical analysis by adopting a multistate modelling approach in order to examine the effect of statin exposure (either as recipient currently under statin treatment or receiving a donor liver exposed to statins) on the transition hazards between transplant, biliary‐vascular complications and death, while allowing for recurring events such as re‐transplant and recurrent biliary‐vascular complications (Figure 1). Death was considered a terminal outcome, while re‐LT and biliary‐vascular complications were considered the main surrogate of graft loss and dysfunction, respectively. Therefore, the multistate modelling approach considered three main states of transition for the time‐dependent model: death, re‐LT and biliary‐vascular complications. Additional transitions are possible between each state, including recurrent events. The only exception is death, which represents a sinking state. Follow‐up for every patient started at the time of their first LT. The model was fitted using a Cox‐proportional hazards model (see more data in the Supplementary materials).\nGraphical representation of the possible transitions. The numbers in the arrows indicate the observed transitions. The number of transitions from biliary‐vascular complications to re‐LT and death is given globally, including those coming from first or recurrent biliary‐vascular complications.\nAdministrative censoring was applied at 3 years because the primary interest of the study was the time immediately following LT. Effects might be different in the long‐term follow‐up since long‐term effects would progressively be more based on patients transplanted at an earlier date, which might therefore not generalise well to current standards.\nFurthermore, we did not include HCC or other cancers in the model because of indications that statins could influence the risk of developing HCC\n25\n, \n26\n as well as a potential protective role of statins in other cancers.\n27\n, \n28\n Including these variables would therefore constitute post‐treatment conditioning and might bias the estimates. However, we additionally explored this possibility using a Cox regression model with HCC‐free survival and non‐HCC cancer‐free survival as outcomes.\nAll tests were two‐sided. Significance was accepted at p < 0.05. R version 4.1.0 (Development Core Team, 2021) was used for statistical calculations. The package survival (Therneau, T. M. [2020]. A Package for Survival Analysis in R. https://CRAN.R‐project.org/package=survival) was used to estimate the model.", "Overall, 998 LT adult recipients were included in the study, with a total of 1038 grafts transplanted. Male was the prevalent gender (696 patients, 70%) with a mean age of 55 ± 11 years. Hepatocellular carcinoma (HCC) was present in 452 (45%) of the patients. The mean calculated MELD score at LT was 14 [IQR 8–24]. Demographic and clinical information regarding LT and comorbidities are summarised in Table 1. 72 (7%) of LT recipients were on statin therapy at time of LT. The total number of patients exposed to statins increased thereafter up to 19% and the time of statin use for 13.52/100 patient‐days. New cardiovascular complications onset in patients without previous cardiovascular events, new type of cardiovascular events, as well as newly diagnosed T2DM and arterial hypertension after LT occurred in 150 (15%), 257 (27%), 96 (10%) and 155 (16%), respectively, suggesting an underuse of statins in this setting as previously observed (22). Thirty‐five (3.5%) patients had recurrence of HCC, whereas de novo/recurrent extrahepatic cancers occurred in 111 (11.1%).\nGeneral baseline pre‐transplant characteristics of the LT recipients and recipients characteristics stratified into statin non‐user and statin user groups throughout the study period\n\nNote: Exposure and no exposure to statins relate to the whole follow‐up period of 3 years. Significances determined by chi‐squared or Fisher's exact test for categorical variables, Welch's T‐Test for variables summarised by mean ± sd and the Wilcoxon test where median [IQR] is reported.\nAbbreviations: BMI, body mass index; CAD, coronary artery disease; CKD, chronic kidney disease; GI gastrointestinal; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HCV, hepatitis C virus; HTN, arterial hypertension; LT, liver transplantation; MELD, Model End‐Stage Liver Disease; NAFLD, non‐alcoholic fatty liver disease; NASH, non‐alcoholic steatohepatitis; PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; T2DM, diabetes mellitus type 2.\n\np ≤ 0.05\n\np ≤ 0.01.\nRecipients on statins were older (59 ± 7 vs. 53 ± 12‐year‐old), more frequently male (84% vs. 66%) had higher BMI (BMI 27.8 ± 4.7 vs. 26.2 ± 5.1) and more frequently cardiovascular disease (58% vs. 41%) (all p ≤ 0.001). Additionally, statin recipients were more frequently transplanted for alcohol‐related liver disease (44% vs. 32% in non‐exposed to statins, p = 0.002), non‐alcoholic steatohepatitis (NASH) (14% vs. 9%, p = 0.04) and HCC (61% vs. 44%) (Table 1).\nThe main characteristics of the study population 3‐year after LT are reported in Table 2.\nEvents observed in LT recipients within 3 years after transplant\nAbbreviations: HCC, hepatocellular carcinoma; GI, gastrointestinal; LT, liver transplantation.", "A total of 1038 deceased donors were included in the study. Male was the prevalent sex (608, 57%), mean age was 56.18 ± 16.86 years. DCD accounted for 122 (12%) livers, alcohol use was reported in almost half of the donors (482, 46%) and 127 (12%) were obese (Table 3). One hundred forty‐three donors (14%) were on statins at the time of donation. Donors receiving statins were older (68 vs. 54 years, p < 0.001) and had higher BMI (26.9 vs. 25.3, p < 0.001). Donors with T2DM were had 3.39 times more likely to receive statins (p < 0.001).\nGeneral characteristics of the donor population\n\nNote: Donor statin use was only recorded in 592 cases.\nAbbreviations: BMI, body mass index; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.", "During the follow‐up, 141 (14%) patients died. Median time to death from first LT was 241 days (IQR, 66–548 days). Causes of death included infections (n = 42, 30%), liver failure (n = 34, 24%), terminal cancer (n = 27, 19%), haemorrhage (n = 15, 11%) and cardiovascular disease (n = 10, 7%). Among patients who died 16 (11%) were exposed to statins. No statistically significant differences were shown for causes of death and statin exposure, however, none of recipients on statins died from cardiovascular event compared to 10 deaths from cardiovascular events in patients who never used statins (Figure 3). There were 40 re‐LT in 38 patients (4%) and 363 biliary‐vascular complications in 287 patients (29%).", "In the multistate model (Table 4), any patient can migrate from one state to another with the only terminal state being death; migrations observed in the present study are summarised in Figure 1. Recipient statin use was associated with lower mortality after LT (HR = 0.35; 95% CI = 0.12–0.99; p = 0.047) (Figure 2). Statin use was also associated with lower hazard of re‐LT (p = 0.004), where the HR could not be reliably estimated because no statin users had re‐LT. Recipient statins' use was not associated with occurrence of biliary‐vascular complications (HR = 1.25; 95% CI = 0.85–1.83; p = 0.266). Regarding the transition from B‐V complications to other states, statin use was significantly associated with reduced likelihood of death (HR = 0.10; 95% CI = 0.01–0.81; p = 0.031), and of recurrent biliary‐vascular complications (HR = 0.43; 95% CI = 0.20–0.93; p = 0.033) (Figure 2). There was no significant effect of statin use on the likelihood of re‐LT after biliary‐vascular complications (HR = 1.12; 95% CI = 0.32–3.90, p = 0.858).\nMultistate model considering survival in the different transition according to Cox regression analysis\nAbbreviations: BMI, body mass index; B‐V, biliary‐vascular; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.\nCumulative transition hazards with significant effects of recipient statin use: Transplant to transplant; transplant to death; biliary‐vascular complication to biliary‐vascular complication; and biliary‐vascular complication to death.\nDifferent causes of death among recipients expose or not to statins.\nConsidering donor statin use, there was no effect on any of the six transitions. Donors' statin use showed a trend for a similar association to occurrence of biliary‐vascular complications as recipient statin use: HR = 0.47; 95% CI = 0.22–1.02, but it did not reach statistical significance (p = 0.056).", "In order to better understand the impact of statins on survival, we built Cox models considering HCC recurrence and de novo/recurrence of non‐liver cancer, with death as a competing risk. While there was no association between HCC recurrence and statin use (Table S1), statin use was associated with a significant reduction of the risk of developing cancers other than HCC (HR = 0.48; 95% CI = 0.29–0.80; p = 0.005; Table S2).", "\nChiara Becchetti: Conceptualization (equal); data curation (equal); investigation (equal); methodology (equal); writing – original draft (lead); writing – review and editing (equal). Melisa Dirchwolf: Conceptualization (equal); data curation (equal); investigation (equal); methodology (equal); writing – original draft (equal); writing – review and editing (equal). Jonas Schropp: Data curation (equal); formal analysis (equal); validation (equal). Giulia Magini: Data curation (equal); writing – review and editing (equal). Beat Mullhaupt: Data curation (equal); writing – review and editing (equal). Immer Franz: Data curation (equal); writing – review and editing (equal). Jean‐Francois Dufour: Data curation (equal); writing – review and editing (equal). Vanessa Banz: Funding acquisition (equal); writing – review and editing (equal). Annalisa Berzigotti: Conceptualization (equal); supervision (equal); writing – review and editing (equal). Jaime Bosch: Conceptualization (equal); funding acquisition (equal); methodology (equal); project administration (equal); supervision (equal); writing – review and editing (equal).", "C.B. and J.B. were supported by the Stiftung für Leberkrankheiten Bern. The study was supported by the Swiss Transplant Cohort Study (FUP 149)." ]

[ null, null, null, null, null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "METHODS", "Study design", "Study population", "Study outcomes and definitions", "Statistical analysis", "RESULTS", "General characteristics of the study population", "Donors' general characteristics", "Mortality, re‐transplant and vascular and biliary complication", "Multistate model approach", "\nHCC recurrence and de novo/recurrence of cancer other than HCC\n", "DISCUSSION", "AUTHOR CONTRIBUTIONS", "FUNDING INFORMATION", "CONFLICT OF INTEREST", "Supporting information" ]

[ "Liver transplantation (LT) is considered the ultimate curative option for end‐stage liver disease and for non‐resectable hepatocellular carcinoma (HCC). Although survival rates after LT have progressively improved over the years, the first year post‐LT remains the critical period, summing 46% of the total deaths and 67% of re‐LT.\n1\n Initial outcomes are mainly determined by surgical or peri‐operative problems leading to primary non‐function or delayed graft function and ultimately to re‐LT. In contrast to this, long‐term outcomes are mainly affected by de novo or recurrent malignant tumours and cardiovascular disease.\n2\n\n\nStatins are inhibitors of 3‐hydroxy‐3‐methyl‐glutaryl‐coenzyme A reductase (HMG‐CoA reductase) widely used in the treatment of dyslipidemia and prophylaxis of cardiovascular events.\n2\n, \n3\n It has long been recognised that part of the benefits attributed to statins in cardiovascular disease are due to their pleiotropic effects that influence vascular remodelling and reverse endothelial dysfunction, among others.\n4\n These pleiotropic effects may likely explain the beneficial effects of statins in other conditions, such as sepsis\n5\n and cancer.\n6\n, \n7\n Recent studies reported beneficial effects of statins on chronic liver diseases, both in pre‐clinical models \n8\n, \n9\n, \n10\n and in clinical studies.\n11\n, \n12\n, \n13\n These range from improvement of hepatic sinusoidal endothelial function, leading to a reduction in intrahepatic vascular tone and portal pressure, to a decreased fibrogenesis that may translate into preventing disease progression and facilitating its regression.\n14\n Statins have also been shown to protect from lipopolysaccharide‐induced acute‐on‐chronic liver failure (ACLF) in cirrhotic rats\n15\n and to prevent liver function impairment after hypovolemic shock.\n16\n, \n17\n Interestingly, in preclinical models statins protect against ischemia/reperfusion injury in young and aged animals\n18\n and prolong liver graft preservation both in normal and liver grafts with steatosis considered at high‐risk of ischemia/reperfusion injury.\n19\n Furthermore, epidemiological studies in large cohorts of patients with chronic liver disease suggest a protective effect of statins reducing the rate of progression to cirrhosis, liver decompensation, development of HCC and death.\n20\n, \n21\n Classical indications for statins, including the treatment and prevention of cardiovascular diseases, may be relevant for the long‐term outcome after LT.\n22\n Moreover, the effects of statins protecting from ischemia/reperfusion injury could be beneficial in the early phase after LT, by reducing the incidence and severity of biliary and vascular complications. Therefore, we hypothesize that statin use in LT recipients may favourably influence the transition to adverse outcomes, including re‐LT, severe and recurrent biliary‐vascular complications, and death.", " Study design We conducted a cohort study in a nationwide database, including all adult patients who underwent LT from May 2008 to December 2019 registered in the Swiss Transplant Cohort Study (STCS). The STCS is a prospective open cohort study including data from transplanted patients starting in 2008 from the three Swiss liver transplant centres: Bern, Zurich and Geneva. Data from the liver donors were obtained from the Swiss Organ Allocation System (SOAS) records, with permission from Swisstransplant.\nThe study was conducted in accordance with the Declaration of Helsinki and Good Clinical Practice. All the patients included in the present study had given their informed consent to be included in the STCS. In addition, the Bern Cantonal Ethics Committee (KEK‐ID 2020–02122) approved the present study, as well as the STCS (FUP 149).\nWe conducted a cohort study in a nationwide database, including all adult patients who underwent LT from May 2008 to December 2019 registered in the Swiss Transplant Cohort Study (STCS). The STCS is a prospective open cohort study including data from transplanted patients starting in 2008 from the three Swiss liver transplant centres: Bern, Zurich and Geneva. Data from the liver donors were obtained from the Swiss Organ Allocation System (SOAS) records, with permission from Swisstransplant.\nThe study was conducted in accordance with the Declaration of Helsinki and Good Clinical Practice. All the patients included in the present study had given their informed consent to be included in the STCS. In addition, the Bern Cantonal Ethics Committee (KEK‐ID 2020–02122) approved the present study, as well as the STCS (FUP 149).\n Study population We included all consecutive adult LT candidates who received a liver from a deceased donor and agreed to participate in the STCS. We collected data regarding liver disease aetiology, severity, comorbidities, use of statins and duration of exposure to these drugs. Regarding donor characteristics, we recorded demographic data, comorbidities, type of deceased donor, cause of death, biochemical characteristics and use of statins.\nWe included all consecutive adult LT candidates who received a liver from a deceased donor and agreed to participate in the STCS. We collected data regarding liver disease aetiology, severity, comorbidities, use of statins and duration of exposure to these drugs. Regarding donor characteristics, we recorded demographic data, comorbidities, type of deceased donor, cause of death, biochemical characteristics and use of statins.\n Study outcomes and definitions We studied LT outcome according to statin exposure in the first 3 years after LT. The primary outcome was post‐LT mortality, while re‐LT and/or development of biliary‐vascular complications were secondary outcomes. Yet, we consider cancer and major cardiovascular events as secondary endpoint as well, arising in an ancillary analysis aimed primarily to better control for possible confounding factors. Patients who dropped out were considered alive until last follow‐up and then censored.\nRe‐LT was defined as a new LT due to all types of graft loss. Biliary‐vascular complications included biliary leaks, stones and strictures and vascular thrombosis, vascular stenosis and ischemic cholangiopathy.\n23\n Because not all vascular thrombotic complications necessarily lead to a biliary event, the two types of complications were considered separately. Systemic cardiovascular complications included occurrence of a major cardiovascular event (documented myocardial infarction or stroke), thromboembolic event (pulmonary embolism) and peripheral arterial ischemic disease. Concerning cancers other than HCC, we considered all solid and haematological cancers excluding non‐melanoma skin cancers.\nStatin exposure was assessed in both donors and recipients. For donors, statin use was assessed as a dichotomous variable at the time of donation, whereas for recipients, statin use was defined as concurrent use of statins for a given time t during follow‐up. In order to reduce the immortal time bias, exposure was considered as person‐time between prescription and end of follow‐up.\n24\n LT was considered time 0. The observation time after LT was 3 years.\nWe studied LT outcome according to statin exposure in the first 3 years after LT. The primary outcome was post‐LT mortality, while re‐LT and/or development of biliary‐vascular complications were secondary outcomes. Yet, we consider cancer and major cardiovascular events as secondary endpoint as well, arising in an ancillary analysis aimed primarily to better control for possible confounding factors. Patients who dropped out were considered alive until last follow‐up and then censored.\nRe‐LT was defined as a new LT due to all types of graft loss. Biliary‐vascular complications included biliary leaks, stones and strictures and vascular thrombosis, vascular stenosis and ischemic cholangiopathy.\n23\n Because not all vascular thrombotic complications necessarily lead to a biliary event, the two types of complications were considered separately. Systemic cardiovascular complications included occurrence of a major cardiovascular event (documented myocardial infarction or stroke), thromboembolic event (pulmonary embolism) and peripheral arterial ischemic disease. Concerning cancers other than HCC, we considered all solid and haematological cancers excluding non‐melanoma skin cancers.\nStatin exposure was assessed in both donors and recipients. For donors, statin use was assessed as a dichotomous variable at the time of donation, whereas for recipients, statin use was defined as concurrent use of statins for a given time t during follow‐up. In order to reduce the immortal time bias, exposure was considered as person‐time between prescription and end of follow‐up.\n24\n LT was considered time 0. The observation time after LT was 3 years.\n Statistical analysis For descriptive aims, we report the general characteristics of the study cohort across the study period. Quantitative and categorical variables were expressed as mean and standard deviation or median and interquartile range (25%–75%) and percentages, respectively. As supplementary analysis, we divided the recipients into statin non‐user and statin user groups through the study period and compared these using Welch's t‐test for continuous variables and Wilcoxon's rank‐sum test for rank data, respectively. Categorical variables were compared using Chi2, where appropriate.\nBecause only three patients had missing covariate data, we adopted a complete‐cases analysis for all models. We conducted the statistical analysis by adopting a multistate modelling approach in order to examine the effect of statin exposure (either as recipient currently under statin treatment or receiving a donor liver exposed to statins) on the transition hazards between transplant, biliary‐vascular complications and death, while allowing for recurring events such as re‐transplant and recurrent biliary‐vascular complications (Figure 1). Death was considered a terminal outcome, while re‐LT and biliary‐vascular complications were considered the main surrogate of graft loss and dysfunction, respectively. Therefore, the multistate modelling approach considered three main states of transition for the time‐dependent model: death, re‐LT and biliary‐vascular complications. Additional transitions are possible between each state, including recurrent events. The only exception is death, which represents a sinking state. Follow‐up for every patient started at the time of their first LT. The model was fitted using a Cox‐proportional hazards model (see more data in the Supplementary materials).\nGraphical representation of the possible transitions. The numbers in the arrows indicate the observed transitions. The number of transitions from biliary‐vascular complications to re‐LT and death is given globally, including those coming from first or recurrent biliary‐vascular complications.\nAdministrative censoring was applied at 3 years because the primary interest of the study was the time immediately following LT. Effects might be different in the long‐term follow‐up since long‐term effects would progressively be more based on patients transplanted at an earlier date, which might therefore not generalise well to current standards.\nFurthermore, we did not include HCC or other cancers in the model because of indications that statins could influence the risk of developing HCC\n25\n, \n26\n as well as a potential protective role of statins in other cancers.\n27\n, \n28\n Including these variables would therefore constitute post‐treatment conditioning and might bias the estimates. However, we additionally explored this possibility using a Cox regression model with HCC‐free survival and non‐HCC cancer‐free survival as outcomes.\nAll tests were two‐sided. Significance was accepted at p < 0.05. R version 4.1.0 (Development Core Team, 2021) was used for statistical calculations. The package survival (Therneau, T. M. [2020]. A Package for Survival Analysis in R. https://CRAN.R‐project.org/package=survival) was used to estimate the model.\nFor descriptive aims, we report the general characteristics of the study cohort across the study period. Quantitative and categorical variables were expressed as mean and standard deviation or median and interquartile range (25%–75%) and percentages, respectively. As supplementary analysis, we divided the recipients into statin non‐user and statin user groups through the study period and compared these using Welch's t‐test for continuous variables and Wilcoxon's rank‐sum test for rank data, respectively. Categorical variables were compared using Chi2, where appropriate.\nBecause only three patients had missing covariate data, we adopted a complete‐cases analysis for all models. We conducted the statistical analysis by adopting a multistate modelling approach in order to examine the effect of statin exposure (either as recipient currently under statin treatment or receiving a donor liver exposed to statins) on the transition hazards between transplant, biliary‐vascular complications and death, while allowing for recurring events such as re‐transplant and recurrent biliary‐vascular complications (Figure 1). Death was considered a terminal outcome, while re‐LT and biliary‐vascular complications were considered the main surrogate of graft loss and dysfunction, respectively. Therefore, the multistate modelling approach considered three main states of transition for the time‐dependent model: death, re‐LT and biliary‐vascular complications. Additional transitions are possible between each state, including recurrent events. The only exception is death, which represents a sinking state. Follow‐up for every patient started at the time of their first LT. The model was fitted using a Cox‐proportional hazards model (see more data in the Supplementary materials).\nGraphical representation of the possible transitions. The numbers in the arrows indicate the observed transitions. The number of transitions from biliary‐vascular complications to re‐LT and death is given globally, including those coming from first or recurrent biliary‐vascular complications.\nAdministrative censoring was applied at 3 years because the primary interest of the study was the time immediately following LT. Effects might be different in the long‐term follow‐up since long‐term effects would progressively be more based on patients transplanted at an earlier date, which might therefore not generalise well to current standards.\nFurthermore, we did not include HCC or other cancers in the model because of indications that statins could influence the risk of developing HCC\n25\n, \n26\n as well as a potential protective role of statins in other cancers.\n27\n, \n28\n Including these variables would therefore constitute post‐treatment conditioning and might bias the estimates. However, we additionally explored this possibility using a Cox regression model with HCC‐free survival and non‐HCC cancer‐free survival as outcomes.\nAll tests were two‐sided. Significance was accepted at p < 0.05. R version 4.1.0 (Development Core Team, 2021) was used for statistical calculations. The package survival (Therneau, T. M. [2020]. A Package for Survival Analysis in R. https://CRAN.R‐project.org/package=survival) was used to estimate the model.", "We conducted a cohort study in a nationwide database, including all adult patients who underwent LT from May 2008 to December 2019 registered in the Swiss Transplant Cohort Study (STCS). The STCS is a prospective open cohort study including data from transplanted patients starting in 2008 from the three Swiss liver transplant centres: Bern, Zurich and Geneva. Data from the liver donors were obtained from the Swiss Organ Allocation System (SOAS) records, with permission from Swisstransplant.\nThe study was conducted in accordance with the Declaration of Helsinki and Good Clinical Practice. All the patients included in the present study had given their informed consent to be included in the STCS. In addition, the Bern Cantonal Ethics Committee (KEK‐ID 2020–02122) approved the present study, as well as the STCS (FUP 149).", "We included all consecutive adult LT candidates who received a liver from a deceased donor and agreed to participate in the STCS. We collected data regarding liver disease aetiology, severity, comorbidities, use of statins and duration of exposure to these drugs. Regarding donor characteristics, we recorded demographic data, comorbidities, type of deceased donor, cause of death, biochemical characteristics and use of statins.", "We studied LT outcome according to statin exposure in the first 3 years after LT. The primary outcome was post‐LT mortality, while re‐LT and/or development of biliary‐vascular complications were secondary outcomes. Yet, we consider cancer and major cardiovascular events as secondary endpoint as well, arising in an ancillary analysis aimed primarily to better control for possible confounding factors. Patients who dropped out were considered alive until last follow‐up and then censored.\nRe‐LT was defined as a new LT due to all types of graft loss. Biliary‐vascular complications included biliary leaks, stones and strictures and vascular thrombosis, vascular stenosis and ischemic cholangiopathy.\n23\n Because not all vascular thrombotic complications necessarily lead to a biliary event, the two types of complications were considered separately. Systemic cardiovascular complications included occurrence of a major cardiovascular event (documented myocardial infarction or stroke), thromboembolic event (pulmonary embolism) and peripheral arterial ischemic disease. Concerning cancers other than HCC, we considered all solid and haematological cancers excluding non‐melanoma skin cancers.\nStatin exposure was assessed in both donors and recipients. For donors, statin use was assessed as a dichotomous variable at the time of donation, whereas for recipients, statin use was defined as concurrent use of statins for a given time t during follow‐up. In order to reduce the immortal time bias, exposure was considered as person‐time between prescription and end of follow‐up.\n24\n LT was considered time 0. The observation time after LT was 3 years.", "For descriptive aims, we report the general characteristics of the study cohort across the study period. Quantitative and categorical variables were expressed as mean and standard deviation or median and interquartile range (25%–75%) and percentages, respectively. As supplementary analysis, we divided the recipients into statin non‐user and statin user groups through the study period and compared these using Welch's t‐test for continuous variables and Wilcoxon's rank‐sum test for rank data, respectively. Categorical variables were compared using Chi2, where appropriate.\nBecause only three patients had missing covariate data, we adopted a complete‐cases analysis for all models. We conducted the statistical analysis by adopting a multistate modelling approach in order to examine the effect of statin exposure (either as recipient currently under statin treatment or receiving a donor liver exposed to statins) on the transition hazards between transplant, biliary‐vascular complications and death, while allowing for recurring events such as re‐transplant and recurrent biliary‐vascular complications (Figure 1). Death was considered a terminal outcome, while re‐LT and biliary‐vascular complications were considered the main surrogate of graft loss and dysfunction, respectively. Therefore, the multistate modelling approach considered three main states of transition for the time‐dependent model: death, re‐LT and biliary‐vascular complications. Additional transitions are possible between each state, including recurrent events. The only exception is death, which represents a sinking state. Follow‐up for every patient started at the time of their first LT. The model was fitted using a Cox‐proportional hazards model (see more data in the Supplementary materials).\nGraphical representation of the possible transitions. The numbers in the arrows indicate the observed transitions. The number of transitions from biliary‐vascular complications to re‐LT and death is given globally, including those coming from first or recurrent biliary‐vascular complications.\nAdministrative censoring was applied at 3 years because the primary interest of the study was the time immediately following LT. Effects might be different in the long‐term follow‐up since long‐term effects would progressively be more based on patients transplanted at an earlier date, which might therefore not generalise well to current standards.\nFurthermore, we did not include HCC or other cancers in the model because of indications that statins could influence the risk of developing HCC\n25\n, \n26\n as well as a potential protective role of statins in other cancers.\n27\n, \n28\n Including these variables would therefore constitute post‐treatment conditioning and might bias the estimates. However, we additionally explored this possibility using a Cox regression model with HCC‐free survival and non‐HCC cancer‐free survival as outcomes.\nAll tests were two‐sided. Significance was accepted at p < 0.05. R version 4.1.0 (Development Core Team, 2021) was used for statistical calculations. The package survival (Therneau, T. M. [2020]. A Package for Survival Analysis in R. https://CRAN.R‐project.org/package=survival) was used to estimate the model.", " General characteristics of the study population Overall, 998 LT adult recipients were included in the study, with a total of 1038 grafts transplanted. Male was the prevalent gender (696 patients, 70%) with a mean age of 55 ± 11 years. Hepatocellular carcinoma (HCC) was present in 452 (45%) of the patients. The mean calculated MELD score at LT was 14 [IQR 8–24]. Demographic and clinical information regarding LT and comorbidities are summarised in Table 1. 72 (7%) of LT recipients were on statin therapy at time of LT. The total number of patients exposed to statins increased thereafter up to 19% and the time of statin use for 13.52/100 patient‐days. New cardiovascular complications onset in patients without previous cardiovascular events, new type of cardiovascular events, as well as newly diagnosed T2DM and arterial hypertension after LT occurred in 150 (15%), 257 (27%), 96 (10%) and 155 (16%), respectively, suggesting an underuse of statins in this setting as previously observed (22). Thirty‐five (3.5%) patients had recurrence of HCC, whereas de novo/recurrent extrahepatic cancers occurred in 111 (11.1%).\nGeneral baseline pre‐transplant characteristics of the LT recipients and recipients characteristics stratified into statin non‐user and statin user groups throughout the study period\n\nNote: Exposure and no exposure to statins relate to the whole follow‐up period of 3 years. Significances determined by chi‐squared or Fisher's exact test for categorical variables, Welch's T‐Test for variables summarised by mean ± sd and the Wilcoxon test where median [IQR] is reported.\nAbbreviations: BMI, body mass index; CAD, coronary artery disease; CKD, chronic kidney disease; GI gastrointestinal; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HCV, hepatitis C virus; HTN, arterial hypertension; LT, liver transplantation; MELD, Model End‐Stage Liver Disease; NAFLD, non‐alcoholic fatty liver disease; NASH, non‐alcoholic steatohepatitis; PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; T2DM, diabetes mellitus type 2.\n\np ≤ 0.05\n\np ≤ 0.01.\nRecipients on statins were older (59 ± 7 vs. 53 ± 12‐year‐old), more frequently male (84% vs. 66%) had higher BMI (BMI 27.8 ± 4.7 vs. 26.2 ± 5.1) and more frequently cardiovascular disease (58% vs. 41%) (all p ≤ 0.001). Additionally, statin recipients were more frequently transplanted for alcohol‐related liver disease (44% vs. 32% in non‐exposed to statins, p = 0.002), non‐alcoholic steatohepatitis (NASH) (14% vs. 9%, p = 0.04) and HCC (61% vs. 44%) (Table 1).\nThe main characteristics of the study population 3‐year after LT are reported in Table 2.\nEvents observed in LT recipients within 3 years after transplant\nAbbreviations: HCC, hepatocellular carcinoma; GI, gastrointestinal; LT, liver transplantation.\nOverall, 998 LT adult recipients were included in the study, with a total of 1038 grafts transplanted. Male was the prevalent gender (696 patients, 70%) with a mean age of 55 ± 11 years. Hepatocellular carcinoma (HCC) was present in 452 (45%) of the patients. The mean calculated MELD score at LT was 14 [IQR 8–24]. Demographic and clinical information regarding LT and comorbidities are summarised in Table 1. 72 (7%) of LT recipients were on statin therapy at time of LT. The total number of patients exposed to statins increased thereafter up to 19% and the time of statin use for 13.52/100 patient‐days. New cardiovascular complications onset in patients without previous cardiovascular events, new type of cardiovascular events, as well as newly diagnosed T2DM and arterial hypertension after LT occurred in 150 (15%), 257 (27%), 96 (10%) and 155 (16%), respectively, suggesting an underuse of statins in this setting as previously observed (22). Thirty‐five (3.5%) patients had recurrence of HCC, whereas de novo/recurrent extrahepatic cancers occurred in 111 (11.1%).\nGeneral baseline pre‐transplant characteristics of the LT recipients and recipients characteristics stratified into statin non‐user and statin user groups throughout the study period\n\nNote: Exposure and no exposure to statins relate to the whole follow‐up period of 3 years. Significances determined by chi‐squared or Fisher's exact test for categorical variables, Welch's T‐Test for variables summarised by mean ± sd and the Wilcoxon test where median [IQR] is reported.\nAbbreviations: BMI, body mass index; CAD, coronary artery disease; CKD, chronic kidney disease; GI gastrointestinal; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HCV, hepatitis C virus; HTN, arterial hypertension; LT, liver transplantation; MELD, Model End‐Stage Liver Disease; NAFLD, non‐alcoholic fatty liver disease; NASH, non‐alcoholic steatohepatitis; PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; T2DM, diabetes mellitus type 2.\n\np ≤ 0.05\n\np ≤ 0.01.\nRecipients on statins were older (59 ± 7 vs. 53 ± 12‐year‐old), more frequently male (84% vs. 66%) had higher BMI (BMI 27.8 ± 4.7 vs. 26.2 ± 5.1) and more frequently cardiovascular disease (58% vs. 41%) (all p ≤ 0.001). Additionally, statin recipients were more frequently transplanted for alcohol‐related liver disease (44% vs. 32% in non‐exposed to statins, p = 0.002), non‐alcoholic steatohepatitis (NASH) (14% vs. 9%, p = 0.04) and HCC (61% vs. 44%) (Table 1).\nThe main characteristics of the study population 3‐year after LT are reported in Table 2.\nEvents observed in LT recipients within 3 years after transplant\nAbbreviations: HCC, hepatocellular carcinoma; GI, gastrointestinal; LT, liver transplantation.\n Donors' general characteristics A total of 1038 deceased donors were included in the study. Male was the prevalent sex (608, 57%), mean age was 56.18 ± 16.86 years. DCD accounted for 122 (12%) livers, alcohol use was reported in almost half of the donors (482, 46%) and 127 (12%) were obese (Table 3). One hundred forty‐three donors (14%) were on statins at the time of donation. Donors receiving statins were older (68 vs. 54 years, p < 0.001) and had higher BMI (26.9 vs. 25.3, p < 0.001). Donors with T2DM were had 3.39 times more likely to receive statins (p < 0.001).\nGeneral characteristics of the donor population\n\nNote: Donor statin use was only recorded in 592 cases.\nAbbreviations: BMI, body mass index; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.\nA total of 1038 deceased donors were included in the study. Male was the prevalent sex (608, 57%), mean age was 56.18 ± 16.86 years. DCD accounted for 122 (12%) livers, alcohol use was reported in almost half of the donors (482, 46%) and 127 (12%) were obese (Table 3). One hundred forty‐three donors (14%) were on statins at the time of donation. Donors receiving statins were older (68 vs. 54 years, p < 0.001) and had higher BMI (26.9 vs. 25.3, p < 0.001). Donors with T2DM were had 3.39 times more likely to receive statins (p < 0.001).\nGeneral characteristics of the donor population\n\nNote: Donor statin use was only recorded in 592 cases.\nAbbreviations: BMI, body mass index; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.\n Mortality, re‐transplant and vascular and biliary complication During the follow‐up, 141 (14%) patients died. Median time to death from first LT was 241 days (IQR, 66–548 days). Causes of death included infections (n = 42, 30%), liver failure (n = 34, 24%), terminal cancer (n = 27, 19%), haemorrhage (n = 15, 11%) and cardiovascular disease (n = 10, 7%). Among patients who died 16 (11%) were exposed to statins. No statistically significant differences were shown for causes of death and statin exposure, however, none of recipients on statins died from cardiovascular event compared to 10 deaths from cardiovascular events in patients who never used statins (Figure 3). There were 40 re‐LT in 38 patients (4%) and 363 biliary‐vascular complications in 287 patients (29%).\nDuring the follow‐up, 141 (14%) patients died. Median time to death from first LT was 241 days (IQR, 66–548 days). Causes of death included infections (n = 42, 30%), liver failure (n = 34, 24%), terminal cancer (n = 27, 19%), haemorrhage (n = 15, 11%) and cardiovascular disease (n = 10, 7%). Among patients who died 16 (11%) were exposed to statins. No statistically significant differences were shown for causes of death and statin exposure, however, none of recipients on statins died from cardiovascular event compared to 10 deaths from cardiovascular events in patients who never used statins (Figure 3). There were 40 re‐LT in 38 patients (4%) and 363 biliary‐vascular complications in 287 patients (29%).\n Multistate model approach In the multistate model (Table 4), any patient can migrate from one state to another with the only terminal state being death; migrations observed in the present study are summarised in Figure 1. Recipient statin use was associated with lower mortality after LT (HR = 0.35; 95% CI = 0.12–0.99; p = 0.047) (Figure 2). Statin use was also associated with lower hazard of re‐LT (p = 0.004), where the HR could not be reliably estimated because no statin users had re‐LT. Recipient statins' use was not associated with occurrence of biliary‐vascular complications (HR = 1.25; 95% CI = 0.85–1.83; p = 0.266). Regarding the transition from B‐V complications to other states, statin use was significantly associated with reduced likelihood of death (HR = 0.10; 95% CI = 0.01–0.81; p = 0.031), and of recurrent biliary‐vascular complications (HR = 0.43; 95% CI = 0.20–0.93; p = 0.033) (Figure 2). There was no significant effect of statin use on the likelihood of re‐LT after biliary‐vascular complications (HR = 1.12; 95% CI = 0.32–3.90, p = 0.858).\nMultistate model considering survival in the different transition according to Cox regression analysis\nAbbreviations: BMI, body mass index; B‐V, biliary‐vascular; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.\nCumulative transition hazards with significant effects of recipient statin use: Transplant to transplant; transplant to death; biliary‐vascular complication to biliary‐vascular complication; and biliary‐vascular complication to death.\nDifferent causes of death among recipients expose or not to statins.\nConsidering donor statin use, there was no effect on any of the six transitions. Donors' statin use showed a trend for a similar association to occurrence of biliary‐vascular complications as recipient statin use: HR = 0.47; 95% CI = 0.22–1.02, but it did not reach statistical significance (p = 0.056).\nIn the multistate model (Table 4), any patient can migrate from one state to another with the only terminal state being death; migrations observed in the present study are summarised in Figure 1. Recipient statin use was associated with lower mortality after LT (HR = 0.35; 95% CI = 0.12–0.99; p = 0.047) (Figure 2). Statin use was also associated with lower hazard of re‐LT (p = 0.004), where the HR could not be reliably estimated because no statin users had re‐LT. Recipient statins' use was not associated with occurrence of biliary‐vascular complications (HR = 1.25; 95% CI = 0.85–1.83; p = 0.266). Regarding the transition from B‐V complications to other states, statin use was significantly associated with reduced likelihood of death (HR = 0.10; 95% CI = 0.01–0.81; p = 0.031), and of recurrent biliary‐vascular complications (HR = 0.43; 95% CI = 0.20–0.93; p = 0.033) (Figure 2). There was no significant effect of statin use on the likelihood of re‐LT after biliary‐vascular complications (HR = 1.12; 95% CI = 0.32–3.90, p = 0.858).\nMultistate model considering survival in the different transition according to Cox regression analysis\nAbbreviations: BMI, body mass index; B‐V, biliary‐vascular; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.\nCumulative transition hazards with significant effects of recipient statin use: Transplant to transplant; transplant to death; biliary‐vascular complication to biliary‐vascular complication; and biliary‐vascular complication to death.\nDifferent causes of death among recipients expose or not to statins.\nConsidering donor statin use, there was no effect on any of the six transitions. Donors' statin use showed a trend for a similar association to occurrence of biliary‐vascular complications as recipient statin use: HR = 0.47; 95% CI = 0.22–1.02, but it did not reach statistical significance (p = 0.056).\n \nHCC recurrence and de novo/recurrence of cancer other than HCC\n In order to better understand the impact of statins on survival, we built Cox models considering HCC recurrence and de novo/recurrence of non‐liver cancer, with death as a competing risk. While there was no association between HCC recurrence and statin use (Table S1), statin use was associated with a significant reduction of the risk of developing cancers other than HCC (HR = 0.48; 95% CI = 0.29–0.80; p = 0.005; Table S2).\nIn order to better understand the impact of statins on survival, we built Cox models considering HCC recurrence and de novo/recurrence of non‐liver cancer, with death as a competing risk. While there was no association between HCC recurrence and statin use (Table S1), statin use was associated with a significant reduction of the risk of developing cancers other than HCC (HR = 0.48; 95% CI = 0.29–0.80; p = 0.005; Table S2).", "Overall, 998 LT adult recipients were included in the study, with a total of 1038 grafts transplanted. Male was the prevalent gender (696 patients, 70%) with a mean age of 55 ± 11 years. Hepatocellular carcinoma (HCC) was present in 452 (45%) of the patients. The mean calculated MELD score at LT was 14 [IQR 8–24]. Demographic and clinical information regarding LT and comorbidities are summarised in Table 1. 72 (7%) of LT recipients were on statin therapy at time of LT. The total number of patients exposed to statins increased thereafter up to 19% and the time of statin use for 13.52/100 patient‐days. New cardiovascular complications onset in patients without previous cardiovascular events, new type of cardiovascular events, as well as newly diagnosed T2DM and arterial hypertension after LT occurred in 150 (15%), 257 (27%), 96 (10%) and 155 (16%), respectively, suggesting an underuse of statins in this setting as previously observed (22). Thirty‐five (3.5%) patients had recurrence of HCC, whereas de novo/recurrent extrahepatic cancers occurred in 111 (11.1%).\nGeneral baseline pre‐transplant characteristics of the LT recipients and recipients characteristics stratified into statin non‐user and statin user groups throughout the study period\n\nNote: Exposure and no exposure to statins relate to the whole follow‐up period of 3 years. Significances determined by chi‐squared or Fisher's exact test for categorical variables, Welch's T‐Test for variables summarised by mean ± sd and the Wilcoxon test where median [IQR] is reported.\nAbbreviations: BMI, body mass index; CAD, coronary artery disease; CKD, chronic kidney disease; GI gastrointestinal; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HCV, hepatitis C virus; HTN, arterial hypertension; LT, liver transplantation; MELD, Model End‐Stage Liver Disease; NAFLD, non‐alcoholic fatty liver disease; NASH, non‐alcoholic steatohepatitis; PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; T2DM, diabetes mellitus type 2.\n\np ≤ 0.05\n\np ≤ 0.01.\nRecipients on statins were older (59 ± 7 vs. 53 ± 12‐year‐old), more frequently male (84% vs. 66%) had higher BMI (BMI 27.8 ± 4.7 vs. 26.2 ± 5.1) and more frequently cardiovascular disease (58% vs. 41%) (all p ≤ 0.001). Additionally, statin recipients were more frequently transplanted for alcohol‐related liver disease (44% vs. 32% in non‐exposed to statins, p = 0.002), non‐alcoholic steatohepatitis (NASH) (14% vs. 9%, p = 0.04) and HCC (61% vs. 44%) (Table 1).\nThe main characteristics of the study population 3‐year after LT are reported in Table 2.\nEvents observed in LT recipients within 3 years after transplant\nAbbreviations: HCC, hepatocellular carcinoma; GI, gastrointestinal; LT, liver transplantation.", "A total of 1038 deceased donors were included in the study. Male was the prevalent sex (608, 57%), mean age was 56.18 ± 16.86 years. DCD accounted for 122 (12%) livers, alcohol use was reported in almost half of the donors (482, 46%) and 127 (12%) were obese (Table 3). One hundred forty‐three donors (14%) were on statins at the time of donation. Donors receiving statins were older (68 vs. 54 years, p < 0.001) and had higher BMI (26.9 vs. 25.3, p < 0.001). Donors with T2DM were had 3.39 times more likely to receive statins (p < 0.001).\nGeneral characteristics of the donor population\n\nNote: Donor statin use was only recorded in 592 cases.\nAbbreviations: BMI, body mass index; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.", "During the follow‐up, 141 (14%) patients died. Median time to death from first LT was 241 days (IQR, 66–548 days). Causes of death included infections (n = 42, 30%), liver failure (n = 34, 24%), terminal cancer (n = 27, 19%), haemorrhage (n = 15, 11%) and cardiovascular disease (n = 10, 7%). Among patients who died 16 (11%) were exposed to statins. No statistically significant differences were shown for causes of death and statin exposure, however, none of recipients on statins died from cardiovascular event compared to 10 deaths from cardiovascular events in patients who never used statins (Figure 3). There were 40 re‐LT in 38 patients (4%) and 363 biliary‐vascular complications in 287 patients (29%).", "In the multistate model (Table 4), any patient can migrate from one state to another with the only terminal state being death; migrations observed in the present study are summarised in Figure 1. Recipient statin use was associated with lower mortality after LT (HR = 0.35; 95% CI = 0.12–0.99; p = 0.047) (Figure 2). Statin use was also associated with lower hazard of re‐LT (p = 0.004), where the HR could not be reliably estimated because no statin users had re‐LT. Recipient statins' use was not associated with occurrence of biliary‐vascular complications (HR = 1.25; 95% CI = 0.85–1.83; p = 0.266). Regarding the transition from B‐V complications to other states, statin use was significantly associated with reduced likelihood of death (HR = 0.10; 95% CI = 0.01–0.81; p = 0.031), and of recurrent biliary‐vascular complications (HR = 0.43; 95% CI = 0.20–0.93; p = 0.033) (Figure 2). There was no significant effect of statin use on the likelihood of re‐LT after biliary‐vascular complications (HR = 1.12; 95% CI = 0.32–3.90, p = 0.858).\nMultistate model considering survival in the different transition according to Cox regression analysis\nAbbreviations: BMI, body mass index; B‐V, biliary‐vascular; DCD, donor after circulatory death; LT, liver transplantation; T2DM, diabetes mellitus type 2.\nCumulative transition hazards with significant effects of recipient statin use: Transplant to transplant; transplant to death; biliary‐vascular complication to biliary‐vascular complication; and biliary‐vascular complication to death.\nDifferent causes of death among recipients expose or not to statins.\nConsidering donor statin use, there was no effect on any of the six transitions. Donors' statin use showed a trend for a similar association to occurrence of biliary‐vascular complications as recipient statin use: HR = 0.47; 95% CI = 0.22–1.02, but it did not reach statistical significance (p = 0.056).", "In order to better understand the impact of statins on survival, we built Cox models considering HCC recurrence and de novo/recurrence of non‐liver cancer, with death as a competing risk. While there was no association between HCC recurrence and statin use (Table S1), statin use was associated with a significant reduction of the risk of developing cancers other than HCC (HR = 0.48; 95% CI = 0.29–0.80; p = 0.005; Table S2).", "The present study aimed at evaluating the effect of statin exposure of both recipients and donors on LT outcomes. Specifically, we wanted to investigate whether statin exposure could influence adverse outcomes, including death, re‐LT, severe biliary‐vascular complications, and recurrent biliary‐vascular complications.\nThe most significant result of our study is that statin use by LT recipients is associated with improved survival, both in patients with and without biliary‐vascular complications.\nThe study design was set up bearing in mind the main limitations affecting epidemiological studies, particularly in the LT setting. Therefore, we constructed a multistate model for the main analysis of the study, taking into account that each subject can transition to other state(s) in the course of the observation period and that this can happen several times (Figure 1). This approach ensures greater internal consistency than conventional approaches\n22\n and weights the accumulated risk for each transition. Statin use in the recipients was associated with a lower risk of transition from LT to death, and from biliary‐vascular complications to death. Recipients with concurrent statin use were never subject to re‐LT without prior biliary‐vascular complication in our cohort, which equates a significantly lower log‐likelihood (p = 0.004). In addition, recipient exposure to statins was associated with lower hazards of recurrent biliary‐vascular complications. This finding is particularly relevant considering that patients experiencing a first biliary‐vascular complication are more likely to develop a second one.\nTo our knowledge, this study is the first specifically designed to examine the pleiotropic protective effects of statins in LT. Recently, a study from the NailNASH Consortium analysed the outcome of 938 patients receiving LT for NASH cirrhosis. They concluded that statin use after LT favourably impacted survival (HR = 0.38; 95% CI = 0.19–0.75; p = 0.005), which is in accordance with our study. However, the protective effect of statins was not the main aim of the study and the results relate to a population known for higher risk of cardiovascular disease and likelihood of statin use compared to other LT indications.\n25\n A previous study by Patel et al.\n22\n examined the impact of coronary artery disease (CAD) and dyslipidemia on clinical outcomes after LT, and reported that in this context, statin exposure was associated with improved survival. Our findings in the present cohort are in line with this previous data, since among patients who died after LT being exposed to statins, none died from cardiovascular diseases. Additionally, they showed a considerable underuse of statins in LT recipients, even when clinically indicated, without observing side effects that could justify this underuse.\n22\n Statin underuse is also observed in the general population: only around 25% of subjects with an indication for statins are actually on statin therapy. Globally, up to 12.6% of annual cardiovascular deaths could be avoided if all patients eligible were on statins.\n29\n This could be estimated also in our cohort, where approximately 19% of recipients were exposed to statins, while circa 30% would have an indication for statins based on comorbidities. Under‐prescription of statins might partly reflect that attending physicians feel uncomfortable taking therapeutic decisions in LT recipients. On the other hand, the known interaction between cyclosporine and statins with potential increase in statins bioavailability may have led to the use of low potency hydrophilic statins (not metabolised through the cytochrome P‐450 3A4) or under‐use and under‐dosing of statins.\n30\n However, most LT recipients at present are under immunosuppressive regimens based on tacrolimus, whose interaction with statins is almost negligible.\n30\n There is thus no contraindication to the use of statins post‐LT, although slowly increasing the dose and monitoring immunosuppression trough levels is advisable.\nEven if post‐LT cancer outcomes were not the primary objective of our study,\n26\n, \n27\n our findings confirmed a strong association between statin exposure and reduced incidence of development/recurrence of extrahepatic tumours. However, in contrast with other recent studies, it failed to demonstrate a significant association with decreased HCC recurrence.\n26\n, \n31\n This might be partly due to the short post‐LT observation period (3 years) not being able to capture all HCC recurrences,\n32\n as well as the coding of statins use as a concurrent covariate, which might not be appropriate for long‐term outcomes.\nOn the other hand, even within a limited number of events, we observed a trend for a protective effect of donor statin exposure against post‐LT biliary‐vascular complications, analogous to that observed for recipient statin exposure. From a mechanistic point of view, this data is in line with preclinical data in experimental models of ischemia/reperfusion injury and cold liver preservation,\n16\n, \n17\n and with the preliminary results of a recent randomised controlled trial.\n33\n Interestingly, the biologic effect of statins on vascular function and liver grafts is quite similar to that exerted by pulsatile flow perfusion \n17\n, \n34\n which successfully minimises biliary‐vascular complications after LT.\n35\n\n\nThis study has some limitations, the main one being the applicability of the results of cohort studies to clinical practice, which usually require confirmation in ad hoc prospective studies. To minimise this limitation, we adopted a statistical strategy that is more process‐oriented than conventional regression analysis and that provides higher generalizability to real‐life scenarios. The total number of patients exposed to statins increased from 7% at the time of LT to 19% thereafter. It appears possible that clinicians were more confident to prescribe statins after LT rather to stable patients than to patients suffering from surgical complications or relevant liver dysfunction. However, we minimised selection bias inherent to cohort studies by including all adult patients receiving LT in the period of this nationwide study. Another potential limitation is that the short number of events early after liver transplantation and of donor statin users may have precluded observing and association between statin exposure and biliary/vascular complications very early after liver transplantation that perhaps would have been shown in a larger study. Unfortunately, fully modelling the time‐varying nature of the different effects of donor and recipient statin exposure would have required a significantly larger number of events than were available in our study.\nIn summary, our results suggest that the use of statins in LT recipients confers a survival advantage. Our data also confirm that statins are underused in LT recipients qualifying for statins, and further add to the body of evidence in favour of using statins in this population when there is a clinical indication. Considering that statins are cheap, safe and widely used and that current strategies for reducing graft loss and improving survival after LT are costly and still limited, our data suggest that statins may represent a new effective approach with relevant clinical impact in the post‐LT setting.", "\nChiara Becchetti: Conceptualization (equal); data curation (equal); investigation (equal); methodology (equal); writing – original draft (lead); writing – review and editing (equal). Melisa Dirchwolf: Conceptualization (equal); data curation (equal); investigation (equal); methodology (equal); writing – original draft (equal); writing – review and editing (equal). Jonas Schropp: Data curation (equal); formal analysis (equal); validation (equal). Giulia Magini: Data curation (equal); writing – review and editing (equal). Beat Mullhaupt: Data curation (equal); writing – review and editing (equal). Immer Franz: Data curation (equal); writing – review and editing (equal). Jean‐Francois Dufour: Data curation (equal); writing – review and editing (equal). Vanessa Banz: Funding acquisition (equal); writing – review and editing (equal). Annalisa Berzigotti: Conceptualization (equal); supervision (equal); writing – review and editing (equal). Jaime Bosch: Conceptualization (equal); funding acquisition (equal); methodology (equal); project administration (equal); supervision (equal); writing – review and editing (equal).", "C.B. and J.B. were supported by the Stiftung für Leberkrankheiten Bern. The study was supported by the Swiss Transplant Cohort Study (FUP 149).", "None.", "\nData S1 Supporting Information.\nClick here for additional data file." ]

[ null, "methods", null, null, null, null, "results", null, null, null, null, null, "discussion", null, null, "COI-statement", "supplementary-material" ]

[ "cardiovascular disease", "dyslipidemia", "solid organ transplantation", "survival" ]

[ 509, 151, 73, 276, 533, 590, 194, 179, 414, 95, 254, 27 ]

[ "lt", "statin", "statins", "vascular", "biliary", "study", "use", "complications", "biliary vascular", "patients" ]

[ "effect statins vascular", "cardiovascular disease statins", "transplantation donor statin", "statins survival", "statins chronic liver" ]

[ "Adult", "Aged", "Aged, 80 and over", "Breast Neoplasms", "Female", "Fluorodeoxyglucose F18", "Humans", "Male", "Middle Aged", "Multimodal Imaging", "Neoplasm Recurrence, Local", "Positron-Emission Tomography", "Prognosis", "Radiopharmaceuticals", "Tomography, X-Ray Computed" ]

[ "Background", "Patients", "PET/CT acquisition and processing", "Image interpretation and classification", "Assessment of impact", "Follow-up", "Statistical analysis", "Diagnostic performance", "Impact on management", "Prediction of survival by CI and PET/CT", "Competing interests", "Authors’ contributions" ]

[ "Breast cancer (BC) is the most commonly diagnosed cancer in women, and is the leading cause of death by cancer for women in the western world. Depending on the initial extent of the disease, approximately 30% of patients diagnosed with BC are at risk of developing loco-regional recurrence or secondary tumor dissemination to distant organs\n[1]. Moreover, the survival of patients who develop an isolated loco-regional recurrence differs from patients who have distant relapse. As a consequence, determination of both the locations and extent of the recurrent disease is essential to guide therapeutic decisions and estimate prognosis.\nTraditionally, routine evaluation of suspected recurrent BC involves physical examination and a multi-modality Conventional Imaging (CI) approach which may include mammography, CT, MRI, and bone scintigraphy. However, this CI approach is often time-intensive and potential false-negative findings may delay appropriate therapy. Positron Emission Tomography/Computed Tomography (PET/CT) with 18 F-Fluorodeoxyglucose (18 F-FDG) is also often used in this indication, given that 18 F-FDG has affinity for both primary and secondary breast tumors, depending on size and aggressiveness\n[2-4]. Several authors have suggested that 18 F-FDG PET and PET/CT are more sensitive than CI for detection of recurrent BC\n[5-15] and can have a significant impact on the therapeutic management\n[5,7-9,12,16]. However, information concerning the utility of 18 F-FDG PET/CT for long-term prognostic stratification, when compared with CI, is limited.\nThus, the objectives of our study were to:\n[1] assess the incremental diagnostic performance and the impact on therapeutic management of 18 F-FDG PET/CT in a group of patients with a history of BC who had already been restaged by CI for identification of suspected disease relapse;\n[2] compare the long-term prognostic stratification of CI alone and 18 F-FDG PET/CT.", "A retrospective analysis was performed on consecutive patients with a history of BC and suspicion of recurrence who were referred for 18 F-FDG PET/CT at our institution from January 2002 to September 2008. BC was not a funded indication of 18 F-FDG PET/CT during this period in Australia; therefore, clinicians usually referred patients with high suspicion of recurrence for PET/CT.\nThe inclusion criteria of the study were as follows: (a) a history of confirmed histologic diagnosis of primary BC treated as per local protocol; (b) CI performed no longer than 4 months prior to PET/CT and where the CI included at least a CT scan of the area of interest; (c) availability of follow-up data for a minimum of 6 months following PET/CT; (d) unequivocal determination of clinical status at the time of the last clinical follow-up.\nSixty-three patients (62 women and one man; mean age = 57 years; range = 29-86 years) were included. The median time interval from initial diagnosis to 18 F-FDG PET/CT was 39 months (range 5-431 months). The median time interval between CT and PET/CT was 25 days (first-third quartile: 1-52 days). Indications for PET/CT were: equivocal or suspicious CI findings (n = 28); clinical suspicion of recurrence (n = 21); restaging after completion of therapy (n = 5); routine surveillance (n = 5); and increasing levels of tumor markers (n = 4). All patients provided permission to review medical records at the time of PET/CT imaging according to our institution’s investigational review board guidelines for informed consent (protocol number 09/78).", "Whole-body PET was acquired sequentially using a dedicated PET/CT system (Discovery LS PET/ 4-slice helical CT or Discovery STE/ 8-slice helical CT, General Electric Medical Systems, Milwaukee, WI) combining a multidetector CT scanner with a dedicated, full-ring PET scanner with bismuth germanate crystals. Patients were instructed to fast except for glucose-free oral hydration for at least 6 hours before injection of 300-400 MBq of 18 F-FDG. PET was performed 60 min following 18 F-FDG injection. Blood glucose levels were measured before the injection of the tracer to ensure levels below 10 mmol/l. Transmission data used for attenuation correction were obtained from a low-dose non diagnostic CT acquisition (140 kVp and 40-120 mA), without contrast enhancement. Attenuation corrected PET images were reconstructed with an iterative reconstruction (ordered-subset expectation maximization algorithm). Orthogonal CT, PET, and fused PET/CT images were displayed simultaneously on a GE Xeleris Workstation. The PET data were also displayed in a rotating maximum-intensity projection.\nAn experienced nuclear medicine physician generated a clinical report after reviewing PET images, low-dose CT images, fused PET/CT images, previous imaging results and clinical information. Standard uptake values were not routinely measured. Once issued, the PET/CT report was not reinterpreted in the light of subsequent clinical information.", "A total of 188 clinical, imaging and pathological procedures were performed (3 ± 1.4 per patients), including chest CT (n = 59), abdominopelvic CT (n = 44), whole-body bone scan (n = 30), clinical examination (n = 17), pathology (n = 9), abdominal ultrasound (US) (n = 7), MRI (n = 7), mammogram or breast US (n = 6), chest radiography (n = 5), other (n = 5).\nWritten clinical reports of conventional images and PET/CT were reviewed and classified as (a) negative if imaging tests were negative for disease; (b) equivocal, when abnormal findings were present on any imaging test but were not interpreted as suspicious for malignancy; (c) positive, if any result was clearly described as suspicious or consistent with malignancy. Negative and equivocal findings were combined as negative for the analysis.\nIn cases where recurrence was reported on CI or PET/CT, the location of relapse was also determined, and classified as loco-regional (ipsilateral breast, ipsilateral axillary, internal mammary or supraclavicular node station) or systemic (contralateral node station or distant metastasis). The final diagnosis of disease recurrence and location of disease was confirmed by histologic examination in 13 patients (21%). For the remaining patients, evidence of progression within 6 months of clinical and/or imaging follow-up was considered to indicate a site of disease relapse, whereas no evidence of progression after at least 6 months of follow-up was considered to confirm absence of active disease at that site.", "Referring physicians were asked to record a pre-PET/CT management plan before PET/CT results on our routine clinical request form. The actual post-PET/CT management plan and treatment intent were determined from the medical record or by contacting the referring clinician.\nThe impact of PET/CT on management was considered “high” when the treatment intent or modality was changed (e.g. from palliative to curative treatment or from surgery to radiotherapy)\n[17]. The impact was considered as “medium” when the method of treatment delivery was changed (e.g. radiation treatment volume and/or dose fractionation)\n[17]. When the PET/CT results did not indicate a need for change, the impact was considered to be “low”. PET/CT was considered to have had “no impact” when the management chosen conflicted with post-PET/CT disease extent on the basis of a synthesis of all available information.", "After PET/CT, progress updates were obtained from the medical record, family physician, or treating oncologist. When relevant, details of the date and cause of death were obtained. The disease status at the time of death was recorded.", "Estimates of OS at 2 and 5 years were computed using the Kaplan Meier method, a log-rank test was used to analyze the effect of CI and PET/CT results on OS. Two Cox regression analyses were performed to assess the impact of PET/CT and CI on OS controlling for clinical variables and using a backward elimination process. Triple negative status of the primary tumor was not included in the multivariate model because this information was available for only 38 patients. For percentages such as PPV, NPV, sensitivity and specificity, a Blyth-Still-Casella 95% confidence interval (CI) was calculated. Diagnosis performance results were compared using McNemar tests, Fisher exact tests and a likelihood ratio, which summarizes how many times more likely patients with the disease are to have that particular result than patients without the disease. According to the fact that patients were selected on the basis of CI, many patients with unequivocal systemic relapse on CI would likely not have been referred for PET/CT. Given the likely pre-test selection bias, positive and negative predictive values were considered as more relevant comparators of diagnostic performance when compared with sensitivity and specificity.", "Relapse involving at least one site was confirmed in 42 of the 63 patients (67%). CI was positive for disease in 37 of these patients, yielding a patient sensitivity of 88%, whereas PET/CT was positive for disease in 40, corresponding to a patient sensitivity of 95%.\nTable \n2 shows comparison of extent of suspected relapse as assessed before and after PET/CT. Downstaging by PET/CT was confirmed to be correct in 12/14 patients (one patient had a suspicious bony lesion on bone scan that was non 18 F-FDG-avid, but confirmed to be malignant; one patient showed suspicious mediastinal lymph nodes on CT that were non 18 F-FDG-avid but confirmed to be metastasis of breast cancer by pathology), while upstaging with PET/CT was confirmed in 5/5 patients.\nComparison of extent of suspected relapse as assessed before and after PET/CT\nLR = Loco-Regional; PET/CT = Positron Emission Tomography/Computerized Tomography.\nOn final diagnosis, 20 patients (32%) had a loco-regional recurrence and 36 (57%) had a systemic recurrence (14 patients had both loco-regional and systemic recurrence). CI was truly positive for loco-regional recurrence in 8/20 patients (40%) and systemic recurrence in 30/36 patients (83%). PET/CT was truly positive for loco-regional recurrence in 20/20 patients (100%) and systemic disease in 32/36 patients (89%). Among the 20 patients experiencing loco-regional recurrence, only 3 had local relapse only, for whom both PET/CT and CI were positive. PET/CT detected regional relapse non-detected by CI in 12 patients (3 in axillary nodes only, 9 in extra-axillary nodes). PET/CT had significantly higher positive predictive values when compared with CI for determination of loco-regional, systemic and global recurrence, and higher negative predictive value for loco-regional and global recurrence (Table \n3). 18 F-FDG PET/CT found incidental malignancies in 2 patients (one patient had a primary esophageal cancer and one patient had a gastrointestinal stromal tumor).\nDiagnostic accuracy of conventional imaging (CI) and PET/CT in detecting relapse of disease in all patients, according to the histological type, and for locoregional and systemic recurrence\nCI = Confidence Interval; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.\n*likelihood ratio = sensitivity/ (1-specificity).", "The PET/CT results had a high impact on management in 30 patients (48%) of whom the treatment intent was modified in 24 patients (including from invasive diagnosis to observation for 11 patients, according to negative PE/CT results despite suspicious CI findings). For the 6 remaining patients, the treatment intent was not modified after PET/CT (palliative for 5 patients, curative for 1 patient), but the modalities of therapy were changed.\nPET/CT had a medium impact on management in 6/63 patients (9%). Management changes in these patients primarily included changes in radiation treatment volume as a result of more extensive disease detected by PET/CT. All these patients had a palliative treatment intent, which was not modified by PET/CT.\nPET/CT had a low impact (i.e. did not change the planned management) in 27/63 patients (43%) for whom the relapse extent was concordant with that found on CI (19 patients) or the documentation of a different distribution of disease did not alter the planned treatment (2 patients), or both PET/CT and CI findings were negative (6 patients). In no case was the PET/CT result apparently ignored.", "Survival data were analyzed with a close-out date of September, 4th 2010. The median follow-up time was 5.1 years (range 0.8-8.6 years). All 63 patients entered into the study had a known status at the close-out date. All patients with negative PET/CT findings were followed for a minimum of 2 years after the scan (except one patient who died 2 months after the scan, because of complications of an esophageal primary tumor discovered on PET/CT).\nThirty-eight patients (60%) were deceased with a median survival of 3.4 years (95% CI 2.5 to 5.0 years) (Figure \n1). The estimated 2-year OS was 66.4% (95% CI 53.2% to 76.6%) and the estimated 5-year OS was 37.3% (95% CI 24.3% to 50.3%).\nEstimated overall survival (+/- 95% confidence interval) for all 63 patients.\nOn univariate analysis, PET/CT status (negative, positive LR or positive systemic) was strongly associated with survival (log-rank test: p = 0.0003 for the entire model; p = 0.0001 for comparison of negative results and positive for systemic disease; p > 0.05 for other single comparisons) (Figure \n2). Patients with systemic disease according to PET/CT had a 4.7-fold in the risk of death when compared with patients with negative PET/CT findings, while patients with only loco-regional recurrence had a 2-fold increase in the risk of death (Table \n4). In contrast, CI status (negative, positive LR or positive systemic) did not significantly predict OS (log-rank test: p = 0.07 for the entire model; p > 0.05 for all single comparisons) (Figure \n2). Moreover, patients with positive CI findings but negative PET/CT findings had similar estimated survival to patients in whom both tests were negative, whereas patients with negative CI findings but positive PET/CT results had comparable estimated survival to patients in whom both procedures were positive for recurrence (Figure \n3). \nOverall survival by staging technique. (A) Kaplan-Meier estimate of overall survival (OS) stratified by pre-PET/CT (Conventional imaging) status. (B) Kaplan-Meier estimate of OS stratified by post-PET/CT status. CI = Conventional Imaging; LR = loco-regional recurrence only; Syst = systemic recurrence.\nUnivariate predictors of overall survival\n*The information is available for only 38 patients.\nCI = Confidence Interval; ER = Estrogen Receptor; HER-2 = Human Epidermal Growth Factor Receptor-2; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography; PR = Progesterone Receptor. Significant p values in bold.\nKaplan-Meier estimate of overall survival (OS) stratified by combination of Conventional imaging (CI) and PET/CT results.\nInitial stage of the disease at the time of diagnosis, histological type of cancer and triple negative status (hormone receptor and HER-2 negativity) were also predictors of survival on the univariate analysis (Table \n4). Time between initial diagnosis and the restaging PET/CT, initial histological grade, estrogen receptor status, progesterone receptor status and overexpression of Human Epidermal Growth Factor Receptor-2 (HER-2) were not significant predictors of survival. On multivariate analysis, positive PET/CT findings (for loco-regional and/or systemic recurrence) remained an independent predictor of OS when adjusting for age, histological subtype and initial stage (model 1, Table \n5). In contrast, positive CI findings did not independently predict OS (model 2, Table \n5).\nMultivariate predictors of overall survival\nCI = Confidence Interval; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.", "The authors declare that they have no competing interests.", "AC, SD, KM and RJH were involved in the concept and design of the study. AC SD, and ED were involved in data collection, history review and follow-up. KM was the imaging lead on the study and with RJH verified classification of scan results. GT was the study statistician and contributed to analysis of the primary data. SD, MM and BC were the clinical leads for assessing the impact criteria and verifying classifications of PET/CT impact. All authors read and approved the final manuscript." ]

[ null, null, null, null, null, null, null, null, null, null, null, null ]

[ "Background", "Methods", "Patients", "PET/CT acquisition and processing", "Image interpretation and classification", "Assessment of impact", "Follow-up", "Statistical analysis", "Results", "Diagnostic performance", "Impact on management", "Prediction of survival by CI and PET/CT", "Discussion", "Conclusion", "Competing interests", "Authors’ contributions" ]

[ "Breast cancer (BC) is the most commonly diagnosed cancer in women, and is the leading cause of death by cancer for women in the western world. Depending on the initial extent of the disease, approximately 30% of patients diagnosed with BC are at risk of developing loco-regional recurrence or secondary tumor dissemination to distant organs\n[1]. Moreover, the survival of patients who develop an isolated loco-regional recurrence differs from patients who have distant relapse. As a consequence, determination of both the locations and extent of the recurrent disease is essential to guide therapeutic decisions and estimate prognosis.\nTraditionally, routine evaluation of suspected recurrent BC involves physical examination and a multi-modality Conventional Imaging (CI) approach which may include mammography, CT, MRI, and bone scintigraphy. However, this CI approach is often time-intensive and potential false-negative findings may delay appropriate therapy. Positron Emission Tomography/Computed Tomography (PET/CT) with 18 F-Fluorodeoxyglucose (18 F-FDG) is also often used in this indication, given that 18 F-FDG has affinity for both primary and secondary breast tumors, depending on size and aggressiveness\n[2-4]. Several authors have suggested that 18 F-FDG PET and PET/CT are more sensitive than CI for detection of recurrent BC\n[5-15] and can have a significant impact on the therapeutic management\n[5,7-9,12,16]. However, information concerning the utility of 18 F-FDG PET/CT for long-term prognostic stratification, when compared with CI, is limited.\nThus, the objectives of our study were to:\n[1] assess the incremental diagnostic performance and the impact on therapeutic management of 18 F-FDG PET/CT in a group of patients with a history of BC who had already been restaged by CI for identification of suspected disease relapse;\n[2] compare the long-term prognostic stratification of CI alone and 18 F-FDG PET/CT.", " Patients A retrospective analysis was performed on consecutive patients with a history of BC and suspicion of recurrence who were referred for 18 F-FDG PET/CT at our institution from January 2002 to September 2008. BC was not a funded indication of 18 F-FDG PET/CT during this period in Australia; therefore, clinicians usually referred patients with high suspicion of recurrence for PET/CT.\nThe inclusion criteria of the study were as follows: (a) a history of confirmed histologic diagnosis of primary BC treated as per local protocol; (b) CI performed no longer than 4 months prior to PET/CT and where the CI included at least a CT scan of the area of interest; (c) availability of follow-up data for a minimum of 6 months following PET/CT; (d) unequivocal determination of clinical status at the time of the last clinical follow-up.\nSixty-three patients (62 women and one man; mean age = 57 years; range = 29-86 years) were included. The median time interval from initial diagnosis to 18 F-FDG PET/CT was 39 months (range 5-431 months). The median time interval between CT and PET/CT was 25 days (first-third quartile: 1-52 days). Indications for PET/CT were: equivocal or suspicious CI findings (n = 28); clinical suspicion of recurrence (n = 21); restaging after completion of therapy (n = 5); routine surveillance (n = 5); and increasing levels of tumor markers (n = 4). All patients provided permission to review medical records at the time of PET/CT imaging according to our institution’s investigational review board guidelines for informed consent (protocol number 09/78).\nA retrospective analysis was performed on consecutive patients with a history of BC and suspicion of recurrence who were referred for 18 F-FDG PET/CT at our institution from January 2002 to September 2008. BC was not a funded indication of 18 F-FDG PET/CT during this period in Australia; therefore, clinicians usually referred patients with high suspicion of recurrence for PET/CT.\nThe inclusion criteria of the study were as follows: (a) a history of confirmed histologic diagnosis of primary BC treated as per local protocol; (b) CI performed no longer than 4 months prior to PET/CT and where the CI included at least a CT scan of the area of interest; (c) availability of follow-up data for a minimum of 6 months following PET/CT; (d) unequivocal determination of clinical status at the time of the last clinical follow-up.\nSixty-three patients (62 women and one man; mean age = 57 years; range = 29-86 years) were included. The median time interval from initial diagnosis to 18 F-FDG PET/CT was 39 months (range 5-431 months). The median time interval between CT and PET/CT was 25 days (first-third quartile: 1-52 days). Indications for PET/CT were: equivocal or suspicious CI findings (n = 28); clinical suspicion of recurrence (n = 21); restaging after completion of therapy (n = 5); routine surveillance (n = 5); and increasing levels of tumor markers (n = 4). All patients provided permission to review medical records at the time of PET/CT imaging according to our institution’s investigational review board guidelines for informed consent (protocol number 09/78).\n PET/CT acquisition and processing Whole-body PET was acquired sequentially using a dedicated PET/CT system (Discovery LS PET/ 4-slice helical CT or Discovery STE/ 8-slice helical CT, General Electric Medical Systems, Milwaukee, WI) combining a multidetector CT scanner with a dedicated, full-ring PET scanner with bismuth germanate crystals. Patients were instructed to fast except for glucose-free oral hydration for at least 6 hours before injection of 300-400 MBq of 18 F-FDG. PET was performed 60 min following 18 F-FDG injection. Blood glucose levels were measured before the injection of the tracer to ensure levels below 10 mmol/l. Transmission data used for attenuation correction were obtained from a low-dose non diagnostic CT acquisition (140 kVp and 40-120 mA), without contrast enhancement. Attenuation corrected PET images were reconstructed with an iterative reconstruction (ordered-subset expectation maximization algorithm). Orthogonal CT, PET, and fused PET/CT images were displayed simultaneously on a GE Xeleris Workstation. The PET data were also displayed in a rotating maximum-intensity projection.\nAn experienced nuclear medicine physician generated a clinical report after reviewing PET images, low-dose CT images, fused PET/CT images, previous imaging results and clinical information. Standard uptake values were not routinely measured. Once issued, the PET/CT report was not reinterpreted in the light of subsequent clinical information.\nWhole-body PET was acquired sequentially using a dedicated PET/CT system (Discovery LS PET/ 4-slice helical CT or Discovery STE/ 8-slice helical CT, General Electric Medical Systems, Milwaukee, WI) combining a multidetector CT scanner with a dedicated, full-ring PET scanner with bismuth germanate crystals. Patients were instructed to fast except for glucose-free oral hydration for at least 6 hours before injection of 300-400 MBq of 18 F-FDG. PET was performed 60 min following 18 F-FDG injection. Blood glucose levels were measured before the injection of the tracer to ensure levels below 10 mmol/l. Transmission data used for attenuation correction were obtained from a low-dose non diagnostic CT acquisition (140 kVp and 40-120 mA), without contrast enhancement. Attenuation corrected PET images were reconstructed with an iterative reconstruction (ordered-subset expectation maximization algorithm). Orthogonal CT, PET, and fused PET/CT images were displayed simultaneously on a GE Xeleris Workstation. The PET data were also displayed in a rotating maximum-intensity projection.\nAn experienced nuclear medicine physician generated a clinical report after reviewing PET images, low-dose CT images, fused PET/CT images, previous imaging results and clinical information. Standard uptake values were not routinely measured. Once issued, the PET/CT report was not reinterpreted in the light of subsequent clinical information.\n Image interpretation and classification A total of 188 clinical, imaging and pathological procedures were performed (3 ± 1.4 per patients), including chest CT (n = 59), abdominopelvic CT (n = 44), whole-body bone scan (n = 30), clinical examination (n = 17), pathology (n = 9), abdominal ultrasound (US) (n = 7), MRI (n = 7), mammogram or breast US (n = 6), chest radiography (n = 5), other (n = 5).\nWritten clinical reports of conventional images and PET/CT were reviewed and classified as (a) negative if imaging tests were negative for disease; (b) equivocal, when abnormal findings were present on any imaging test but were not interpreted as suspicious for malignancy; (c) positive, if any result was clearly described as suspicious or consistent with malignancy. Negative and equivocal findings were combined as negative for the analysis.\nIn cases where recurrence was reported on CI or PET/CT, the location of relapse was also determined, and classified as loco-regional (ipsilateral breast, ipsilateral axillary, internal mammary or supraclavicular node station) or systemic (contralateral node station or distant metastasis). The final diagnosis of disease recurrence and location of disease was confirmed by histologic examination in 13 patients (21%). For the remaining patients, evidence of progression within 6 months of clinical and/or imaging follow-up was considered to indicate a site of disease relapse, whereas no evidence of progression after at least 6 months of follow-up was considered to confirm absence of active disease at that site.\nA total of 188 clinical, imaging and pathological procedures were performed (3 ± 1.4 per patients), including chest CT (n = 59), abdominopelvic CT (n = 44), whole-body bone scan (n = 30), clinical examination (n = 17), pathology (n = 9), abdominal ultrasound (US) (n = 7), MRI (n = 7), mammogram or breast US (n = 6), chest radiography (n = 5), other (n = 5).\nWritten clinical reports of conventional images and PET/CT were reviewed and classified as (a) negative if imaging tests were negative for disease; (b) equivocal, when abnormal findings were present on any imaging test but were not interpreted as suspicious for malignancy; (c) positive, if any result was clearly described as suspicious or consistent with malignancy. Negative and equivocal findings were combined as negative for the analysis.\nIn cases where recurrence was reported on CI or PET/CT, the location of relapse was also determined, and classified as loco-regional (ipsilateral breast, ipsilateral axillary, internal mammary or supraclavicular node station) or systemic (contralateral node station or distant metastasis). The final diagnosis of disease recurrence and location of disease was confirmed by histologic examination in 13 patients (21%). For the remaining patients, evidence of progression within 6 months of clinical and/or imaging follow-up was considered to indicate a site of disease relapse, whereas no evidence of progression after at least 6 months of follow-up was considered to confirm absence of active disease at that site.\n Assessment of impact Referring physicians were asked to record a pre-PET/CT management plan before PET/CT results on our routine clinical request form. The actual post-PET/CT management plan and treatment intent were determined from the medical record or by contacting the referring clinician.\nThe impact of PET/CT on management was considered “high” when the treatment intent or modality was changed (e.g. from palliative to curative treatment or from surgery to radiotherapy)\n[17]. The impact was considered as “medium” when the method of treatment delivery was changed (e.g. radiation treatment volume and/or dose fractionation)\n[17]. When the PET/CT results did not indicate a need for change, the impact was considered to be “low”. PET/CT was considered to have had “no impact” when the management chosen conflicted with post-PET/CT disease extent on the basis of a synthesis of all available information.\nReferring physicians were asked to record a pre-PET/CT management plan before PET/CT results on our routine clinical request form. The actual post-PET/CT management plan and treatment intent were determined from the medical record or by contacting the referring clinician.\nThe impact of PET/CT on management was considered “high” when the treatment intent or modality was changed (e.g. from palliative to curative treatment or from surgery to radiotherapy)\n[17]. The impact was considered as “medium” when the method of treatment delivery was changed (e.g. radiation treatment volume and/or dose fractionation)\n[17]. When the PET/CT results did not indicate a need for change, the impact was considered to be “low”. PET/CT was considered to have had “no impact” when the management chosen conflicted with post-PET/CT disease extent on the basis of a synthesis of all available information.\n Follow-up After PET/CT, progress updates were obtained from the medical record, family physician, or treating oncologist. When relevant, details of the date and cause of death were obtained. The disease status at the time of death was recorded.\nAfter PET/CT, progress updates were obtained from the medical record, family physician, or treating oncologist. When relevant, details of the date and cause of death were obtained. The disease status at the time of death was recorded.\n Statistical analysis Estimates of OS at 2 and 5 years were computed using the Kaplan Meier method, a log-rank test was used to analyze the effect of CI and PET/CT results on OS. Two Cox regression analyses were performed to assess the impact of PET/CT and CI on OS controlling for clinical variables and using a backward elimination process. Triple negative status of the primary tumor was not included in the multivariate model because this information was available for only 38 patients. For percentages such as PPV, NPV, sensitivity and specificity, a Blyth-Still-Casella 95% confidence interval (CI) was calculated. Diagnosis performance results were compared using McNemar tests, Fisher exact tests and a likelihood ratio, which summarizes how many times more likely patients with the disease are to have that particular result than patients without the disease. According to the fact that patients were selected on the basis of CI, many patients with unequivocal systemic relapse on CI would likely not have been referred for PET/CT. Given the likely pre-test selection bias, positive and negative predictive values were considered as more relevant comparators of diagnostic performance when compared with sensitivity and specificity.\nEstimates of OS at 2 and 5 years were computed using the Kaplan Meier method, a log-rank test was used to analyze the effect of CI and PET/CT results on OS. Two Cox regression analyses were performed to assess the impact of PET/CT and CI on OS controlling for clinical variables and using a backward elimination process. Triple negative status of the primary tumor was not included in the multivariate model because this information was available for only 38 patients. For percentages such as PPV, NPV, sensitivity and specificity, a Blyth-Still-Casella 95% confidence interval (CI) was calculated. Diagnosis performance results were compared using McNemar tests, Fisher exact tests and a likelihood ratio, which summarizes how many times more likely patients with the disease are to have that particular result than patients without the disease. According to the fact that patients were selected on the basis of CI, many patients with unequivocal systemic relapse on CI would likely not have been referred for PET/CT. Given the likely pre-test selection bias, positive and negative predictive values were considered as more relevant comparators of diagnostic performance when compared with sensitivity and specificity.", "A retrospective analysis was performed on consecutive patients with a history of BC and suspicion of recurrence who were referred for 18 F-FDG PET/CT at our institution from January 2002 to September 2008. BC was not a funded indication of 18 F-FDG PET/CT during this period in Australia; therefore, clinicians usually referred patients with high suspicion of recurrence for PET/CT.\nThe inclusion criteria of the study were as follows: (a) a history of confirmed histologic diagnosis of primary BC treated as per local protocol; (b) CI performed no longer than 4 months prior to PET/CT and where the CI included at least a CT scan of the area of interest; (c) availability of follow-up data for a minimum of 6 months following PET/CT; (d) unequivocal determination of clinical status at the time of the last clinical follow-up.\nSixty-three patients (62 women and one man; mean age = 57 years; range = 29-86 years) were included. The median time interval from initial diagnosis to 18 F-FDG PET/CT was 39 months (range 5-431 months). The median time interval between CT and PET/CT was 25 days (first-third quartile: 1-52 days). Indications for PET/CT were: equivocal or suspicious CI findings (n = 28); clinical suspicion of recurrence (n = 21); restaging after completion of therapy (n = 5); routine surveillance (n = 5); and increasing levels of tumor markers (n = 4). All patients provided permission to review medical records at the time of PET/CT imaging according to our institution’s investigational review board guidelines for informed consent (protocol number 09/78).", "Whole-body PET was acquired sequentially using a dedicated PET/CT system (Discovery LS PET/ 4-slice helical CT or Discovery STE/ 8-slice helical CT, General Electric Medical Systems, Milwaukee, WI) combining a multidetector CT scanner with a dedicated, full-ring PET scanner with bismuth germanate crystals. Patients were instructed to fast except for glucose-free oral hydration for at least 6 hours before injection of 300-400 MBq of 18 F-FDG. PET was performed 60 min following 18 F-FDG injection. Blood glucose levels were measured before the injection of the tracer to ensure levels below 10 mmol/l. Transmission data used for attenuation correction were obtained from a low-dose non diagnostic CT acquisition (140 kVp and 40-120 mA), without contrast enhancement. Attenuation corrected PET images were reconstructed with an iterative reconstruction (ordered-subset expectation maximization algorithm). Orthogonal CT, PET, and fused PET/CT images were displayed simultaneously on a GE Xeleris Workstation. The PET data were also displayed in a rotating maximum-intensity projection.\nAn experienced nuclear medicine physician generated a clinical report after reviewing PET images, low-dose CT images, fused PET/CT images, previous imaging results and clinical information. Standard uptake values were not routinely measured. Once issued, the PET/CT report was not reinterpreted in the light of subsequent clinical information.", "A total of 188 clinical, imaging and pathological procedures were performed (3 ± 1.4 per patients), including chest CT (n = 59), abdominopelvic CT (n = 44), whole-body bone scan (n = 30), clinical examination (n = 17), pathology (n = 9), abdominal ultrasound (US) (n = 7), MRI (n = 7), mammogram or breast US (n = 6), chest radiography (n = 5), other (n = 5).\nWritten clinical reports of conventional images and PET/CT were reviewed and classified as (a) negative if imaging tests were negative for disease; (b) equivocal, when abnormal findings were present on any imaging test but were not interpreted as suspicious for malignancy; (c) positive, if any result was clearly described as suspicious or consistent with malignancy. Negative and equivocal findings were combined as negative for the analysis.\nIn cases where recurrence was reported on CI or PET/CT, the location of relapse was also determined, and classified as loco-regional (ipsilateral breast, ipsilateral axillary, internal mammary or supraclavicular node station) or systemic (contralateral node station or distant metastasis). The final diagnosis of disease recurrence and location of disease was confirmed by histologic examination in 13 patients (21%). For the remaining patients, evidence of progression within 6 months of clinical and/or imaging follow-up was considered to indicate a site of disease relapse, whereas no evidence of progression after at least 6 months of follow-up was considered to confirm absence of active disease at that site.", "Referring physicians were asked to record a pre-PET/CT management plan before PET/CT results on our routine clinical request form. The actual post-PET/CT management plan and treatment intent were determined from the medical record or by contacting the referring clinician.\nThe impact of PET/CT on management was considered “high” when the treatment intent or modality was changed (e.g. from palliative to curative treatment or from surgery to radiotherapy)\n[17]. The impact was considered as “medium” when the method of treatment delivery was changed (e.g. radiation treatment volume and/or dose fractionation)\n[17]. When the PET/CT results did not indicate a need for change, the impact was considered to be “low”. PET/CT was considered to have had “no impact” when the management chosen conflicted with post-PET/CT disease extent on the basis of a synthesis of all available information.", "After PET/CT, progress updates were obtained from the medical record, family physician, or treating oncologist. When relevant, details of the date and cause of death were obtained. The disease status at the time of death was recorded.", "Estimates of OS at 2 and 5 years were computed using the Kaplan Meier method, a log-rank test was used to analyze the effect of CI and PET/CT results on OS. Two Cox regression analyses were performed to assess the impact of PET/CT and CI on OS controlling for clinical variables and using a backward elimination process. Triple negative status of the primary tumor was not included in the multivariate model because this information was available for only 38 patients. For percentages such as PPV, NPV, sensitivity and specificity, a Blyth-Still-Casella 95% confidence interval (CI) was calculated. Diagnosis performance results were compared using McNemar tests, Fisher exact tests and a likelihood ratio, which summarizes how many times more likely patients with the disease are to have that particular result than patients without the disease. According to the fact that patients were selected on the basis of CI, many patients with unequivocal systemic relapse on CI would likely not have been referred for PET/CT. Given the likely pre-test selection bias, positive and negative predictive values were considered as more relevant comparators of diagnostic performance when compared with sensitivity and specificity.", "Patient characteristics at the time of initial diagnosis are summarized in Table \n1.\nPatient characteristics at the time of initial diagnosis\nHER-2 = Human Epidermal Growth Factor Receptor-2.\n Diagnostic performance Relapse involving at least one site was confirmed in 42 of the 63 patients (67%). CI was positive for disease in 37 of these patients, yielding a patient sensitivity of 88%, whereas PET/CT was positive for disease in 40, corresponding to a patient sensitivity of 95%.\nTable \n2 shows comparison of extent of suspected relapse as assessed before and after PET/CT. Downstaging by PET/CT was confirmed to be correct in 12/14 patients (one patient had a suspicious bony lesion on bone scan that was non 18 F-FDG-avid, but confirmed to be malignant; one patient showed suspicious mediastinal lymph nodes on CT that were non 18 F-FDG-avid but confirmed to be metastasis of breast cancer by pathology), while upstaging with PET/CT was confirmed in 5/5 patients.\nComparison of extent of suspected relapse as assessed before and after PET/CT\nLR = Loco-Regional; PET/CT = Positron Emission Tomography/Computerized Tomography.\nOn final diagnosis, 20 patients (32%) had a loco-regional recurrence and 36 (57%) had a systemic recurrence (14 patients had both loco-regional and systemic recurrence). CI was truly positive for loco-regional recurrence in 8/20 patients (40%) and systemic recurrence in 30/36 patients (83%). PET/CT was truly positive for loco-regional recurrence in 20/20 patients (100%) and systemic disease in 32/36 patients (89%). Among the 20 patients experiencing loco-regional recurrence, only 3 had local relapse only, for whom both PET/CT and CI were positive. PET/CT detected regional relapse non-detected by CI in 12 patients (3 in axillary nodes only, 9 in extra-axillary nodes). PET/CT had significantly higher positive predictive values when compared with CI for determination of loco-regional, systemic and global recurrence, and higher negative predictive value for loco-regional and global recurrence (Table \n3). 18 F-FDG PET/CT found incidental malignancies in 2 patients (one patient had a primary esophageal cancer and one patient had a gastrointestinal stromal tumor).\nDiagnostic accuracy of conventional imaging (CI) and PET/CT in detecting relapse of disease in all patients, according to the histological type, and for locoregional and systemic recurrence\nCI = Confidence Interval; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.\n*likelihood ratio = sensitivity/ (1-specificity).\nRelapse involving at least one site was confirmed in 42 of the 63 patients (67%). CI was positive for disease in 37 of these patients, yielding a patient sensitivity of 88%, whereas PET/CT was positive for disease in 40, corresponding to a patient sensitivity of 95%.\nTable \n2 shows comparison of extent of suspected relapse as assessed before and after PET/CT. Downstaging by PET/CT was confirmed to be correct in 12/14 patients (one patient had a suspicious bony lesion on bone scan that was non 18 F-FDG-avid, but confirmed to be malignant; one patient showed suspicious mediastinal lymph nodes on CT that were non 18 F-FDG-avid but confirmed to be metastasis of breast cancer by pathology), while upstaging with PET/CT was confirmed in 5/5 patients.\nComparison of extent of suspected relapse as assessed before and after PET/CT\nLR = Loco-Regional; PET/CT = Positron Emission Tomography/Computerized Tomography.\nOn final diagnosis, 20 patients (32%) had a loco-regional recurrence and 36 (57%) had a systemic recurrence (14 patients had both loco-regional and systemic recurrence). CI was truly positive for loco-regional recurrence in 8/20 patients (40%) and systemic recurrence in 30/36 patients (83%). PET/CT was truly positive for loco-regional recurrence in 20/20 patients (100%) and systemic disease in 32/36 patients (89%). Among the 20 patients experiencing loco-regional recurrence, only 3 had local relapse only, for whom both PET/CT and CI were positive. PET/CT detected regional relapse non-detected by CI in 12 patients (3 in axillary nodes only, 9 in extra-axillary nodes). PET/CT had significantly higher positive predictive values when compared with CI for determination of loco-regional, systemic and global recurrence, and higher negative predictive value for loco-regional and global recurrence (Table \n3). 18 F-FDG PET/CT found incidental malignancies in 2 patients (one patient had a primary esophageal cancer and one patient had a gastrointestinal stromal tumor).\nDiagnostic accuracy of conventional imaging (CI) and PET/CT in detecting relapse of disease in all patients, according to the histological type, and for locoregional and systemic recurrence\nCI = Confidence Interval; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.\n*likelihood ratio = sensitivity/ (1-specificity).\n Impact on management The PET/CT results had a high impact on management in 30 patients (48%) of whom the treatment intent was modified in 24 patients (including from invasive diagnosis to observation for 11 patients, according to negative PE/CT results despite suspicious CI findings). For the 6 remaining patients, the treatment intent was not modified after PET/CT (palliative for 5 patients, curative for 1 patient), but the modalities of therapy were changed.\nPET/CT had a medium impact on management in 6/63 patients (9%). Management changes in these patients primarily included changes in radiation treatment volume as a result of more extensive disease detected by PET/CT. All these patients had a palliative treatment intent, which was not modified by PET/CT.\nPET/CT had a low impact (i.e. did not change the planned management) in 27/63 patients (43%) for whom the relapse extent was concordant with that found on CI (19 patients) or the documentation of a different distribution of disease did not alter the planned treatment (2 patients), or both PET/CT and CI findings were negative (6 patients). In no case was the PET/CT result apparently ignored.\nThe PET/CT results had a high impact on management in 30 patients (48%) of whom the treatment intent was modified in 24 patients (including from invasive diagnosis to observation for 11 patients, according to negative PE/CT results despite suspicious CI findings). For the 6 remaining patients, the treatment intent was not modified after PET/CT (palliative for 5 patients, curative for 1 patient), but the modalities of therapy were changed.\nPET/CT had a medium impact on management in 6/63 patients (9%). Management changes in these patients primarily included changes in radiation treatment volume as a result of more extensive disease detected by PET/CT. All these patients had a palliative treatment intent, which was not modified by PET/CT.\nPET/CT had a low impact (i.e. did not change the planned management) in 27/63 patients (43%) for whom the relapse extent was concordant with that found on CI (19 patients) or the documentation of a different distribution of disease did not alter the planned treatment (2 patients), or both PET/CT and CI findings were negative (6 patients). In no case was the PET/CT result apparently ignored.\n Prediction of survival by CI and PET/CT Survival data were analyzed with a close-out date of September, 4th 2010. The median follow-up time was 5.1 years (range 0.8-8.6 years). All 63 patients entered into the study had a known status at the close-out date. All patients with negative PET/CT findings were followed for a minimum of 2 years after the scan (except one patient who died 2 months after the scan, because of complications of an esophageal primary tumor discovered on PET/CT).\nThirty-eight patients (60%) were deceased with a median survival of 3.4 years (95% CI 2.5 to 5.0 years) (Figure \n1). The estimated 2-year OS was 66.4% (95% CI 53.2% to 76.6%) and the estimated 5-year OS was 37.3% (95% CI 24.3% to 50.3%).\nEstimated overall survival (+/- 95% confidence interval) for all 63 patients.\nOn univariate analysis, PET/CT status (negative, positive LR or positive systemic) was strongly associated with survival (log-rank test: p = 0.0003 for the entire model; p = 0.0001 for comparison of negative results and positive for systemic disease; p > 0.05 for other single comparisons) (Figure \n2). Patients with systemic disease according to PET/CT had a 4.7-fold in the risk of death when compared with patients with negative PET/CT findings, while patients with only loco-regional recurrence had a 2-fold increase in the risk of death (Table \n4). In contrast, CI status (negative, positive LR or positive systemic) did not significantly predict OS (log-rank test: p = 0.07 for the entire model; p > 0.05 for all single comparisons) (Figure \n2). Moreover, patients with positive CI findings but negative PET/CT findings had similar estimated survival to patients in whom both tests were negative, whereas patients with negative CI findings but positive PET/CT results had comparable estimated survival to patients in whom both procedures were positive for recurrence (Figure \n3). \nOverall survival by staging technique. (A) Kaplan-Meier estimate of overall survival (OS) stratified by pre-PET/CT (Conventional imaging) status. (B) Kaplan-Meier estimate of OS stratified by post-PET/CT status. CI = Conventional Imaging; LR = loco-regional recurrence only; Syst = systemic recurrence.\nUnivariate predictors of overall survival\n*The information is available for only 38 patients.\nCI = Confidence Interval; ER = Estrogen Receptor; HER-2 = Human Epidermal Growth Factor Receptor-2; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography; PR = Progesterone Receptor. Significant p values in bold.\nKaplan-Meier estimate of overall survival (OS) stratified by combination of Conventional imaging (CI) and PET/CT results.\nInitial stage of the disease at the time of diagnosis, histological type of cancer and triple negative status (hormone receptor and HER-2 negativity) were also predictors of survival on the univariate analysis (Table \n4). Time between initial diagnosis and the restaging PET/CT, initial histological grade, estrogen receptor status, progesterone receptor status and overexpression of Human Epidermal Growth Factor Receptor-2 (HER-2) were not significant predictors of survival. On multivariate analysis, positive PET/CT findings (for loco-regional and/or systemic recurrence) remained an independent predictor of OS when adjusting for age, histological subtype and initial stage (model 1, Table \n5). In contrast, positive CI findings did not independently predict OS (model 2, Table \n5).\nMultivariate predictors of overall survival\nCI = Confidence Interval; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.\nSurvival data were analyzed with a close-out date of September, 4th 2010. The median follow-up time was 5.1 years (range 0.8-8.6 years). All 63 patients entered into the study had a known status at the close-out date. All patients with negative PET/CT findings were followed for a minimum of 2 years after the scan (except one patient who died 2 months after the scan, because of complications of an esophageal primary tumor discovered on PET/CT).\nThirty-eight patients (60%) were deceased with a median survival of 3.4 years (95% CI 2.5 to 5.0 years) (Figure \n1). The estimated 2-year OS was 66.4% (95% CI 53.2% to 76.6%) and the estimated 5-year OS was 37.3% (95% CI 24.3% to 50.3%).\nEstimated overall survival (+/- 95% confidence interval) for all 63 patients.\nOn univariate analysis, PET/CT status (negative, positive LR or positive systemic) was strongly associated with survival (log-rank test: p = 0.0003 for the entire model; p = 0.0001 for comparison of negative results and positive for systemic disease; p > 0.05 for other single comparisons) (Figure \n2). Patients with systemic disease according to PET/CT had a 4.7-fold in the risk of death when compared with patients with negative PET/CT findings, while patients with only loco-regional recurrence had a 2-fold increase in the risk of death (Table \n4). In contrast, CI status (negative, positive LR or positive systemic) did not significantly predict OS (log-rank test: p = 0.07 for the entire model; p > 0.05 for all single comparisons) (Figure \n2). Moreover, patients with positive CI findings but negative PET/CT findings had similar estimated survival to patients in whom both tests were negative, whereas patients with negative CI findings but positive PET/CT results had comparable estimated survival to patients in whom both procedures were positive for recurrence (Figure \n3). \nOverall survival by staging technique. (A) Kaplan-Meier estimate of overall survival (OS) stratified by pre-PET/CT (Conventional imaging) status. (B) Kaplan-Meier estimate of OS stratified by post-PET/CT status. CI = Conventional Imaging; LR = loco-regional recurrence only; Syst = systemic recurrence.\nUnivariate predictors of overall survival\n*The information is available for only 38 patients.\nCI = Confidence Interval; ER = Estrogen Receptor; HER-2 = Human Epidermal Growth Factor Receptor-2; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography; PR = Progesterone Receptor. Significant p values in bold.\nKaplan-Meier estimate of overall survival (OS) stratified by combination of Conventional imaging (CI) and PET/CT results.\nInitial stage of the disease at the time of diagnosis, histological type of cancer and triple negative status (hormone receptor and HER-2 negativity) were also predictors of survival on the univariate analysis (Table \n4). Time between initial diagnosis and the restaging PET/CT, initial histological grade, estrogen receptor status, progesterone receptor status and overexpression of Human Epidermal Growth Factor Receptor-2 (HER-2) were not significant predictors of survival. On multivariate analysis, positive PET/CT findings (for loco-regional and/or systemic recurrence) remained an independent predictor of OS when adjusting for age, histological subtype and initial stage (model 1, Table \n5). In contrast, positive CI findings did not independently predict OS (model 2, Table \n5).\nMultivariate predictors of overall survival\nCI = Confidence Interval; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.", "Relapse involving at least one site was confirmed in 42 of the 63 patients (67%). CI was positive for disease in 37 of these patients, yielding a patient sensitivity of 88%, whereas PET/CT was positive for disease in 40, corresponding to a patient sensitivity of 95%.\nTable \n2 shows comparison of extent of suspected relapse as assessed before and after PET/CT. Downstaging by PET/CT was confirmed to be correct in 12/14 patients (one patient had a suspicious bony lesion on bone scan that was non 18 F-FDG-avid, but confirmed to be malignant; one patient showed suspicious mediastinal lymph nodes on CT that were non 18 F-FDG-avid but confirmed to be metastasis of breast cancer by pathology), while upstaging with PET/CT was confirmed in 5/5 patients.\nComparison of extent of suspected relapse as assessed before and after PET/CT\nLR = Loco-Regional; PET/CT = Positron Emission Tomography/Computerized Tomography.\nOn final diagnosis, 20 patients (32%) had a loco-regional recurrence and 36 (57%) had a systemic recurrence (14 patients had both loco-regional and systemic recurrence). CI was truly positive for loco-regional recurrence in 8/20 patients (40%) and systemic recurrence in 30/36 patients (83%). PET/CT was truly positive for loco-regional recurrence in 20/20 patients (100%) and systemic disease in 32/36 patients (89%). Among the 20 patients experiencing loco-regional recurrence, only 3 had local relapse only, for whom both PET/CT and CI were positive. PET/CT detected regional relapse non-detected by CI in 12 patients (3 in axillary nodes only, 9 in extra-axillary nodes). PET/CT had significantly higher positive predictive values when compared with CI for determination of loco-regional, systemic and global recurrence, and higher negative predictive value for loco-regional and global recurrence (Table \n3). 18 F-FDG PET/CT found incidental malignancies in 2 patients (one patient had a primary esophageal cancer and one patient had a gastrointestinal stromal tumor).\nDiagnostic accuracy of conventional imaging (CI) and PET/CT in detecting relapse of disease in all patients, according to the histological type, and for locoregional and systemic recurrence\nCI = Confidence Interval; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.\n*likelihood ratio = sensitivity/ (1-specificity).", "The PET/CT results had a high impact on management in 30 patients (48%) of whom the treatment intent was modified in 24 patients (including from invasive diagnosis to observation for 11 patients, according to negative PE/CT results despite suspicious CI findings). For the 6 remaining patients, the treatment intent was not modified after PET/CT (palliative for 5 patients, curative for 1 patient), but the modalities of therapy were changed.\nPET/CT had a medium impact on management in 6/63 patients (9%). Management changes in these patients primarily included changes in radiation treatment volume as a result of more extensive disease detected by PET/CT. All these patients had a palliative treatment intent, which was not modified by PET/CT.\nPET/CT had a low impact (i.e. did not change the planned management) in 27/63 patients (43%) for whom the relapse extent was concordant with that found on CI (19 patients) or the documentation of a different distribution of disease did not alter the planned treatment (2 patients), or both PET/CT and CI findings were negative (6 patients). In no case was the PET/CT result apparently ignored.", "Survival data were analyzed with a close-out date of September, 4th 2010. The median follow-up time was 5.1 years (range 0.8-8.6 years). All 63 patients entered into the study had a known status at the close-out date. All patients with negative PET/CT findings were followed for a minimum of 2 years after the scan (except one patient who died 2 months after the scan, because of complications of an esophageal primary tumor discovered on PET/CT).\nThirty-eight patients (60%) were deceased with a median survival of 3.4 years (95% CI 2.5 to 5.0 years) (Figure \n1). The estimated 2-year OS was 66.4% (95% CI 53.2% to 76.6%) and the estimated 5-year OS was 37.3% (95% CI 24.3% to 50.3%).\nEstimated overall survival (+/- 95% confidence interval) for all 63 patients.\nOn univariate analysis, PET/CT status (negative, positive LR or positive systemic) was strongly associated with survival (log-rank test: p = 0.0003 for the entire model; p = 0.0001 for comparison of negative results and positive for systemic disease; p > 0.05 for other single comparisons) (Figure \n2). Patients with systemic disease according to PET/CT had a 4.7-fold in the risk of death when compared with patients with negative PET/CT findings, while patients with only loco-regional recurrence had a 2-fold increase in the risk of death (Table \n4). In contrast, CI status (negative, positive LR or positive systemic) did not significantly predict OS (log-rank test: p = 0.07 for the entire model; p > 0.05 for all single comparisons) (Figure \n2). Moreover, patients with positive CI findings but negative PET/CT findings had similar estimated survival to patients in whom both tests were negative, whereas patients with negative CI findings but positive PET/CT results had comparable estimated survival to patients in whom both procedures were positive for recurrence (Figure \n3). \nOverall survival by staging technique. (A) Kaplan-Meier estimate of overall survival (OS) stratified by pre-PET/CT (Conventional imaging) status. (B) Kaplan-Meier estimate of OS stratified by post-PET/CT status. CI = Conventional Imaging; LR = loco-regional recurrence only; Syst = systemic recurrence.\nUnivariate predictors of overall survival\n*The information is available for only 38 patients.\nCI = Confidence Interval; ER = Estrogen Receptor; HER-2 = Human Epidermal Growth Factor Receptor-2; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography; PR = Progesterone Receptor. Significant p values in bold.\nKaplan-Meier estimate of overall survival (OS) stratified by combination of Conventional imaging (CI) and PET/CT results.\nInitial stage of the disease at the time of diagnosis, histological type of cancer and triple negative status (hormone receptor and HER-2 negativity) were also predictors of survival on the univariate analysis (Table \n4). Time between initial diagnosis and the restaging PET/CT, initial histological grade, estrogen receptor status, progesterone receptor status and overexpression of Human Epidermal Growth Factor Receptor-2 (HER-2) were not significant predictors of survival. On multivariate analysis, positive PET/CT findings (for loco-regional and/or systemic recurrence) remained an independent predictor of OS when adjusting for age, histological subtype and initial stage (model 1, Table \n5). In contrast, positive CI findings did not independently predict OS (model 2, Table \n5).\nMultivariate predictors of overall survival\nCI = Confidence Interval; HR = Hazard Ratio; PET/CT = Positron Emission Tomography/Computerized Tomography. Significant p values in bold.", "For patients with possible recurrent breast cancer (BC), early detection and adequate localization of recurrent disease are essential for guiding optimal therapy and prognostication. Patients with isolated loco-regional recurrence are able to benefit from curative salvage therapy, whereas palliative treatment is generally indicated for patients with distant relapse.\nSeveral studies have shown the relevance of 18 F-FDG PET/CT in detecting distant metastasis in patients with clinical suspicion of recurrence\n[6,8,12,13,18-20], and in patients with documented loco-regional recurrence\n[5]. Our study confirmed that 18 F-FDG PET/CT is an accurate technique for the appropriate detection of relapse, when compared with CI alone. Of particular economic and clinical importance was the observation that 12 patients (19%) in this series who were suspected to have relapsed by conventional evaluation subsequently received no active treatment after a negative 18 F-FDG PET/CT evaluation and demonstrated an excellent prognosis. In contrast, of the 8 patients with negative CI findings, 1 patient was found to have locoregional relapse and 3 patients were found to have systemic recurrence on 18 F-FDG PET/CT. In the current study, 18 F-FDG PET/CT had an impact on therapeutic management in 57% of patients; in particular, the treatment intent was changed in 38% of patients. This result is consistent with other studies which showed the important impact of 18 F-FDG PET/CT on therapeutic management in patients with suspicion of recurrent BC\n[5,8,12,18,19]. Most of these previous studies reported that 18 F-FDG PET/CT was highly accurate for detecting recurrent disease in patients with negative or inconclusive CI findings\n[5,18,19]. In contrast, in our study, CI findings were consistent with relapse in the majority of patients (51/63) but 18 F-FDG PET/CT downstaged 12 of them, providing a better negative predictive value when compared to CI alone (Table \n3). These findings suggested that 18 F-FDG PET/CT was not only effective for early detection of relapse in patients with negative CI findings, but also yielded a better characterization of CI findings in patients with a high suspicion of relapse.\nAs BC was not a funded indication of 18 F-FDG PET/CT in Australia during the study period, referring clinicians were likely to use PET/CT in patients for whom there was clinical uncertainty with respect to the appropriate management. Although this patient selection could have introduced biases in the evaluation of the impact of PET/CT findings on patient management, it also showed the value of 18 F-FDG PET/CT in patients whose disease status could not be adequately determined using CI alone.\nThe more accurate prognostic information derived from PET/CT results when compared with CI findings underpinned the value of PET/CT in the management of patients with recurrent BC. Both 18F-FDG PET/CT and CT are not optimal modalities for detection of local recurrence, when compared with mammography, ultrasound or MRI. However, detection of additional distant metastases in patients with documented loco-regional recurrence is essential in order to optimize management and stratify prognosis. Of note was the favourable survival of patients with isolated loco-regional recurrence according to PET/CT, when compared with patients with systemic relapse.\nIn our study, CT performed with PET was not of diagnostic quality. However, all patients included in this study had diagnostic CT before undergoing FDG PET/CT.\nWhile Dirisamer et al. showed in a retrospective study that the association of FDG PET and contrast-enhanced (ce) CT could improve restaging of breast cancer when compared with ceCT or FDG PET alone\n[6], there is no evidence in the literature of the superiority of FDG PET/ceCT for restaging of breast cancer when compared with FDG PET associated to non-diagnostic, low dose CT. In our study, the outcome data validate our approach in that FDG PET/CT results were more often correct than conventional imaging (including diagnostic CT) when discordant, and stratified prognosis whereas conventional imaging did not (Figure \n2). If we hadn’t ignored the conventional imaging findings (including diagnostic CT) when discordant with FDG PET/CT, the accuracy wouldn’t have been enhanced and the prognostic value of FDG PET/CT incorporating a low dose, non-contrast CT wouldn’t have been superior to that of conventional imaging. These results have implications for the reporting of FDG PET combined with ceCT, which is performed by some facilities as a routine procedure and suggest that significant clinical weight should be placed on the PET findings even when discordant with the ceCT appearances.\nOne of the limitations of our study was that the CI procedures were not standardized and were selected on the basis of clinical findings. However, this represented routine clinical practice and did not detract from the results. Although comparison of a masked reading of PET/CT with a masked reading of CI techniques might be appropriate if PET/CT were to be suggested as a replacement for CI, the main purpose of this study was to evaluate the incremental diagnostic and prognostic value of PET/CT in routine practice. The results of this retrospective study would, however, justify a randomized trial in which patients with clinical risk or suspicion of relapse would be stratified to have either CI or FDG PET/CT as the initial restaging procedure\n[21]. Finally, we did not compare PET/CT and CI findings with histopathological findings in most patients. For 50 patients (79%), the final disease status was determined clinically and/or with follow-up imaging. Nevertheless, since most of the patients were followed up for a long period of time, the survival analysis would be the best validation of diagnostic accuracy.", "Our findings support the value of 18 F-FDG PET/CT in providing incremental information that influence patient management and refine prognostic stratification in the setting of suspected recurrent breast cancer. The prognostic stratification provided by this technique emphasizes the crucial role of 18 F-FDG PET/CT in optimizing treatment choices in this setting. Further multicentric studies are needed to confirm this role in particular in patients with high suspicion of relapse.", "The authors declare that they have no competing interests.", "AC, SD, KM and RJH were involved in the concept and design of the study. AC SD, and ED were involved in data collection, history review and follow-up. KM was the imaging lead on the study and with RJH verified classification of scan results. GT was the study statistician and contributed to analysis of the primary data. SD, MM and BC were the clinical leads for assessing the impact criteria and verifying classifications of PET/CT impact. All authors read and approved the final manuscript." ]

[ null, "methods", null, null, null, null, null, null, "results", null, null, null, "discussion", "conclusions", null, null ]

[ "Breast cancer", "18 F-FDG PET/CT", "Restaging", "Prognosis" ]

[ 394, 349, 273, 341, 181, 46, 222, 496, 236, 765, 10, 99 ]

[ "ct", "pet", "pet ct", "patients", "ci", "recurrence", "disease", "negative", "positive", "fdg" ]

[ "ct 18 fluorodeoxyglucose", "fdg pet ct", "recurrent bc 18f", "prognosis conventional imaging", "breast cancer prognostic" ]