Datasets:

---

acmc

/

beamit-annotated_full_texts_dataset

like 0

[ "COVID-19", "Cohort Studies", "Extracorporeal Membrane Oxygenation", "Female", "Humans", "Internationality", "Male", "Middle Aged", "Respiratory Distress Syndrome", "Retrospective Studies" ]

[ "Statistical Analysis", "COVID-19 Patients on ECMO", "Non-COVID-19 ARDS" ]

[ "Statistical analysis was performed using R statistics (version 3.6.1) with the R Studio interface (The R Foundation, Lucent Technologies, Inc., Murray Hill, NJ, USA, www.r-project.org). Baseline and outcome parameters were summarized using simple descriptive statistics. Non-normal distributed continuous variables were presented as a median (with interquartile range (IQR)). Categorical variables were presented as percentages and frequencies. Data were compared between groups of COVID-19 patients and non-COVID-19 ARDS patients using the Mann-Whitney U test for numerical data and Chi square test for categorical data. Survival rates of COVID-19 and non-COVID-19 patients were compared using Kaplan-Meier analyses and the log-rank test for equality of survival curves using the R survival package. A P value <.05 was considered significant.", "During the study period, a total of 71 patients received ECMO due to refractory respiratory failure related to COVID-19. The majority of 57 patients (80%) were male and median age was 52 years (IQR 46-57). The patients were predominantly overweight with a median body mass index (BMI) of 29.2 kg/m2 (IQR 26.1-32.1). A minority of 29 patients (40%) had a medical history of cardiovascular or pulmonary disease, of which most frequently scored comorbidities consisted of hypertension (n = 15, 21%), asthma (n = 7, 10%) and diabetes (n = 6, 8%).\nAn overview of the patient baseline characteristics prior to the initiation of ECMO is shown in Table 1. The arterial blood gas (ABG) values prior to initiation of ECMO reported a pH of 7.35 (IQR 7.22-7.42), PaCO2 of 8.0 kPa (IQR 6.6-10.1), bicarbonate of 32 mmol/L (IQR 26-37) and PaO2 of 8.0 kPa (IQR 6.8-9.3). Controlled ventilation mode was mostly used: pressure-controlled ventilation in 31 patients (44%) and volume-controlled ventilation in 31 patients (44%). Median ventilation parameters consisted of PEEP of 12 cm H2O (IQR 8-16), FiO2 of 100% (IQR 80-100), resulting in a median PaO2/FiO2 of 58 mmHg (IQR 46-76). In a large part of the patients, prone positioning (79%) and muscle paralysis (77%) had been applied prior to initiation of ECMO. Acute kidney injury (AKI) was already present in 17 patients (24%), of which 12 (17%) were also receiving renal replacement therapy (RRT).\nPatient Baseline Characteristics.\nAbbreviations: COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation; SOFA, sequential organ failure assessment; CRP, C-reactive protein; PaO2, partial oxygen pressure; PCO2, partial carbon dioxide pressure; FiO2, fraction inspired oxygen; PEEP, positive end expiratory pressure.\n\na Values prior to initiation of ECMO include worst values within 12 hours prior to initiation.\nAfter the first occurrence of symptoms, hospital admission followed at a median of 13 days (IQR 7-16), and ICU admission 1 day later. ECMO was started at a median of 18 days (IQR 15-25) after disease onset and at a median of 5 days (IQR 3-10) after start of invasive mechanical ventilation. Almost all patients received veno-venous ECMO (VV-ECMO: 93%, n = 66), 3 patients received veno-arterial ECMO (VA-ECMO), one veno-veno-arterial ECMO (VVA-ECMO) and one extracorporeal CO2-removal (ECCO2R). The main indication for VV-ECMO was combined refractory hypoxemia and hypercapnia, which occurred in 34 patients (52%), followed by refractory hypoxemia in 32 patients (49%). To be able to offer hemodynamic support in the presence of right ventricular failure, 3 patients received VA-ECMO and one VVA-ECMO. The median duration of ECMO was 13 days (IQR 7-20); 3 patients were in need of a second run of ECMO. Muscle paralysis was the most commonly applied rescue therapy, which was applied in 51 patients (72%), followed by prone positioning (n = 27, 38%). The variance in pharmacotherapeutic drugs was high; hydroxychloroquine (n = 47, 66%) and lopinavir/ritonavir (n = 14, 20%) were most frequent (Table 2: ECMO Characteristics).\nECMO Characteristics.\nAbbreviations: ECMO, extracorporeal membrane oxygenation; CO2, carbondioxide; ICU, Intensive Care Unit; IL, interleukine.\nDuring ECMO, 60 patients (85%) suffered one or more complications, mostly a new infection (n = 40, 56%), AKI (n = 39, 55%) and hemorrhagic event (n = 38, 54%) as shown in Table 3. From the 39 patients with AKI, 22 out of 39 developed during ECMO, and 37 out of 39 patients (55%) received RRT. More than half of the patients (n = 37, 52%) were successfully weaned from ECMO. The 3 patients who received a second run were successfully weaned and survived. Within 28 days after ECMO initiation, 26 patients had died (37%). In those non-survivors a lower median pH and higher median PCO2 was shown in comparison to survivors (respectively: 7.28 versus 7.38 [P = .04] and 9.82 versus 7.33 [P = .002]). Moreover, muscle paralysis had been applied in fewer non-survivors (non-survivors 68% versus survivors 97%, P = .002). The median ECMO run was 6 days shorter in non-survivors (non-survivors 8 days [IQR 5-17] versus survivors 14 days [IQR 10-23]). A table showing survivors versus non-survivors can be found in the Additional File (E3. Survivors versus non-survivors).\nECMO Outcome and Complications.\nAbbreviations: ECMO, Extracorporeal Membrane Oxygenation; ICU, Intensive Care Unit.\n\na 28-day mortality: death within 28 days after initiation ECMO.\n\nb Causes of death are described in the Additional File (E4. Unanticipated Death).", "A total of 48 out of 440 patients received ECMO due to ARDS unrelated to COVID-19. In this consecutive subgroup, median age was 55 years (IQR 40-61), sex was equally distributed, and median BMI was 28.3 kg/m2 (IQR 24.7-33). When compared to the patients with COVID-19 related respiratory failure, the COVID-19 group had a significantly higher proportion of males (80% versus 50%; P = .001). No other significant differences were found in patient baseline characteristics, comorbidities, and disease severity-related variables including sequential organ failure assessment (SOFA)-score and PaO2/FiO2-ratio. Also, complication rate and ECMO support duration did not differ significantly (Table 4). 28-day mortality was 37% in COVID-19 patients and 27% in non-COVID-19 patients. However, this difference was not significant, as shown in the Kaplan-Meier curves in Figure 1 (Hazard Ratio 1.01 [95% CI 0.60-1.69]; P = .98). In this figure it is apparent that this non-significant difference in mortality resolves after a prolonged 100-day follow-up.\nComparison COVID-19 on ECMO and Non-COVID-19 on ECMO.\nAbbreviations: COPD, chronic obstructive pulmonary disease; SOFA, sequential organ failure assessment; COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation.\n\na 28-day mortality, mortality 28 days after initiation of ECMO.\nKaplan-Meier estimates for patients with COVID-19 on ECMO and patients with ARDS not due to COVID-19 on ECMO. Unadjusted hazard ratio and 95% confidence interval calculated from a Cox proportional hazard model is presented." ]

[ null, null, null ]

[ "Introduction", "Methods", "Statistical Analysis", "Results", "COVID-19 Patients on ECMO", "Non-COVID-19 ARDS", "Discussion", "Conclusions", "Supplemental Material" ]

[ "After in December 2019 the first case of pneumonia caused by the novel severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) was reported, it has since spread and became a pandemic of Coronavirus Disease-2019 (COVID-19).\n1\n On September 22nd 2020, over 31 million infected cases and over 965,000 SARS-CoV-2 related deaths have been confirmed.\n2\n Infected individuals can differ in presentation from asymptomatic carriers to severe respiratory failure and acute respiratory distress syndrome (ARDS). Up to 35% of the hospitalized patients with COVID-19 have to be treated in an intensive care unit (ICU).\n3\n In these cases, the cornerstones of supportive therapy include high flow nasal oxygen, as well as non-invasive and invasive mechanical ventilation.\nExtracorporeal membrane oxygenation (ECMO) is recommended as a “last resource” supportive therapy in case of cardiac and/or respiratory failure, including ARDS, refractory to other conventional therapies. As the extracorporeal circuit provides both oxygenation and carbon dioxide clearance, it can facilitate protective mechanical ventilation.\n4,5\n Following the influenza A (H1N1) pandemic in 2009, worldwide application, expertise and experience with the use of ECMO as a supportive treatment in severe ARDS increased.\n6,7\n During the Middle East respiratory syndrome (MERS) outbreak, an association with improved outcome in patients with ARDS on ECMO was demonstrated.\n8\n However, in COVID-19 the first results from small Chinese cohorts were disappointing, showing a very high mortality.\n9\n Recently, more promising results were presented, including a French study reporting an estimated probability of day-60 mortality of 31%.\n10\n\n\nThe WHO interim guidelines recommends the administration of ECMO to eligible patients with COVID-19 related ARDS in expert centers.\n11\n The Society of Critical Care Medicine (SCCM) has agreed with this statement and released guidelines regarding the management of COVID-19 patients in the ICU, providing criteria regarding the use of ECMO in COVID-19.\n12\n Although some research has been carried out on ECMO in COVID-19, these studies are limited due to small sample sizes, single-center design or the lack of control group.\n13\n–15\n As a result, no robust conclusion can be drawn about the added value of ECMO in patients with severe respiratory failure due to COVID-19.\nTherefore, this study aimed to provide additional insight on the role of ECMO in refractory ARDS due to COVID-19 by describing patient and ECMO characteristics of COVID-19 patients on ECMO, and comparing their outcomes with patients with non-COVID-19 ARDS on ECMO.", "This retrospective observational study was performed in 13 ICUs providing ECMO: 8 from the Netherlands, 3 from Belgium, 1 from Sweden and 1 from Spain. This study was approved by the institutional review board (IRB) of the Amsterdam University Medical Centers (Amsterdam UMC; W20_199#20.230), and, thereafter, from local Ethics Committees. Data were collected retrospectively from electronic patient records of all consecutive COVID-19 patients receiving ECMO admitted to the ICU from March 1 to April 30, 2020, which corresponds with the timing of the first COVID-19 peak in most European countries. Patients were included if they were aged 18 years and older and received ECMO during their ICU admission due to RT-PCR confirmed COVID-19. As comparative non-COVID-19 group, data were collected of patients with who received ECMO for ARDS between January 1, 2018, and July 31, 2019 from the same ICUs. Patients were eligible for ECMO according to applicable guidelines provided by the extracorporeal life support organization (ELSO).\n16\n ECMO is considered a last resource, in case of reversible cardiac and/or pulmonary failure, refractory to other therapies. Therefore, for example, in case of ARDS, it is encouraged to have applied several interventions such as prone positioning and neuromuscular blockage prior initiation of ECMO.\n17,18\n During ECMO, standard care included systemic anticoagulation using unfractionated heparin in all 13 centers. More details on the anticoagulation practices can be found in the Additional File (E1. Anticoagulation practices). Data collection included demographics, comorbidities, laboratory values, ECMO characteristics, complications and 28-day mortality (Additional File: E2. Definitions used). The primary outcome was the complication rate and 28-day mortality of patients on ECMO due to COVID-19. The secondary outcome consisted of a comparison of patient and ECMO characteristics between patients with COVID-19 on ECMO to patients with non-COVID-19 ARDS on ECMO.\nStatistical Analysis Statistical analysis was performed using R statistics (version 3.6.1) with the R Studio interface (The R Foundation, Lucent Technologies, Inc., Murray Hill, NJ, USA, www.r-project.org). Baseline and outcome parameters were summarized using simple descriptive statistics. Non-normal distributed continuous variables were presented as a median (with interquartile range (IQR)). Categorical variables were presented as percentages and frequencies. Data were compared between groups of COVID-19 patients and non-COVID-19 ARDS patients using the Mann-Whitney U test for numerical data and Chi square test for categorical data. Survival rates of COVID-19 and non-COVID-19 patients were compared using Kaplan-Meier analyses and the log-rank test for equality of survival curves using the R survival package. A P value <.05 was considered significant.\nStatistical analysis was performed using R statistics (version 3.6.1) with the R Studio interface (The R Foundation, Lucent Technologies, Inc., Murray Hill, NJ, USA, www.r-project.org). Baseline and outcome parameters were summarized using simple descriptive statistics. Non-normal distributed continuous variables were presented as a median (with interquartile range (IQR)). Categorical variables were presented as percentages and frequencies. Data were compared between groups of COVID-19 patients and non-COVID-19 ARDS patients using the Mann-Whitney U test for numerical data and Chi square test for categorical data. Survival rates of COVID-19 and non-COVID-19 patients were compared using Kaplan-Meier analyses and the log-rank test for equality of survival curves using the R survival package. A P value <.05 was considered significant.", "Statistical analysis was performed using R statistics (version 3.6.1) with the R Studio interface (The R Foundation, Lucent Technologies, Inc., Murray Hill, NJ, USA, www.r-project.org). Baseline and outcome parameters were summarized using simple descriptive statistics. Non-normal distributed continuous variables were presented as a median (with interquartile range (IQR)). Categorical variables were presented as percentages and frequencies. Data were compared between groups of COVID-19 patients and non-COVID-19 ARDS patients using the Mann-Whitney U test for numerical data and Chi square test for categorical data. Survival rates of COVID-19 and non-COVID-19 patients were compared using Kaplan-Meier analyses and the log-rank test for equality of survival curves using the R survival package. A P value <.05 was considered significant.", "COVID-19 Patients on ECMO During the study period, a total of 71 patients received ECMO due to refractory respiratory failure related to COVID-19. The majority of 57 patients (80%) were male and median age was 52 years (IQR 46-57). The patients were predominantly overweight with a median body mass index (BMI) of 29.2 kg/m2 (IQR 26.1-32.1). A minority of 29 patients (40%) had a medical history of cardiovascular or pulmonary disease, of which most frequently scored comorbidities consisted of hypertension (n = 15, 21%), asthma (n = 7, 10%) and diabetes (n = 6, 8%).\nAn overview of the patient baseline characteristics prior to the initiation of ECMO is shown in Table 1. The arterial blood gas (ABG) values prior to initiation of ECMO reported a pH of 7.35 (IQR 7.22-7.42), PaCO2 of 8.0 kPa (IQR 6.6-10.1), bicarbonate of 32 mmol/L (IQR 26-37) and PaO2 of 8.0 kPa (IQR 6.8-9.3). Controlled ventilation mode was mostly used: pressure-controlled ventilation in 31 patients (44%) and volume-controlled ventilation in 31 patients (44%). Median ventilation parameters consisted of PEEP of 12 cm H2O (IQR 8-16), FiO2 of 100% (IQR 80-100), resulting in a median PaO2/FiO2 of 58 mmHg (IQR 46-76). In a large part of the patients, prone positioning (79%) and muscle paralysis (77%) had been applied prior to initiation of ECMO. Acute kidney injury (AKI) was already present in 17 patients (24%), of which 12 (17%) were also receiving renal replacement therapy (RRT).\nPatient Baseline Characteristics.\nAbbreviations: COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation; SOFA, sequential organ failure assessment; CRP, C-reactive protein; PaO2, partial oxygen pressure; PCO2, partial carbon dioxide pressure; FiO2, fraction inspired oxygen; PEEP, positive end expiratory pressure.\n\na Values prior to initiation of ECMO include worst values within 12 hours prior to initiation.\nAfter the first occurrence of symptoms, hospital admission followed at a median of 13 days (IQR 7-16), and ICU admission 1 day later. ECMO was started at a median of 18 days (IQR 15-25) after disease onset and at a median of 5 days (IQR 3-10) after start of invasive mechanical ventilation. Almost all patients received veno-venous ECMO (VV-ECMO: 93%, n = 66), 3 patients received veno-arterial ECMO (VA-ECMO), one veno-veno-arterial ECMO (VVA-ECMO) and one extracorporeal CO2-removal (ECCO2R). The main indication for VV-ECMO was combined refractory hypoxemia and hypercapnia, which occurred in 34 patients (52%), followed by refractory hypoxemia in 32 patients (49%). To be able to offer hemodynamic support in the presence of right ventricular failure, 3 patients received VA-ECMO and one VVA-ECMO. The median duration of ECMO was 13 days (IQR 7-20); 3 patients were in need of a second run of ECMO. Muscle paralysis was the most commonly applied rescue therapy, which was applied in 51 patients (72%), followed by prone positioning (n = 27, 38%). The variance in pharmacotherapeutic drugs was high; hydroxychloroquine (n = 47, 66%) and lopinavir/ritonavir (n = 14, 20%) were most frequent (Table 2: ECMO Characteristics).\nECMO Characteristics.\nAbbreviations: ECMO, extracorporeal membrane oxygenation; CO2, carbondioxide; ICU, Intensive Care Unit; IL, interleukine.\nDuring ECMO, 60 patients (85%) suffered one or more complications, mostly a new infection (n = 40, 56%), AKI (n = 39, 55%) and hemorrhagic event (n = 38, 54%) as shown in Table 3. From the 39 patients with AKI, 22 out of 39 developed during ECMO, and 37 out of 39 patients (55%) received RRT. More than half of the patients (n = 37, 52%) were successfully weaned from ECMO. The 3 patients who received a second run were successfully weaned and survived. Within 28 days after ECMO initiation, 26 patients had died (37%). In those non-survivors a lower median pH and higher median PCO2 was shown in comparison to survivors (respectively: 7.28 versus 7.38 [P = .04] and 9.82 versus 7.33 [P = .002]). Moreover, muscle paralysis had been applied in fewer non-survivors (non-survivors 68% versus survivors 97%, P = .002). The median ECMO run was 6 days shorter in non-survivors (non-survivors 8 days [IQR 5-17] versus survivors 14 days [IQR 10-23]). A table showing survivors versus non-survivors can be found in the Additional File (E3. Survivors versus non-survivors).\nECMO Outcome and Complications.\nAbbreviations: ECMO, Extracorporeal Membrane Oxygenation; ICU, Intensive Care Unit.\n\na 28-day mortality: death within 28 days after initiation ECMO.\n\nb Causes of death are described in the Additional File (E4. Unanticipated Death).\nDuring the study period, a total of 71 patients received ECMO due to refractory respiratory failure related to COVID-19. The majority of 57 patients (80%) were male and median age was 52 years (IQR 46-57). The patients were predominantly overweight with a median body mass index (BMI) of 29.2 kg/m2 (IQR 26.1-32.1). A minority of 29 patients (40%) had a medical history of cardiovascular or pulmonary disease, of which most frequently scored comorbidities consisted of hypertension (n = 15, 21%), asthma (n = 7, 10%) and diabetes (n = 6, 8%).\nAn overview of the patient baseline characteristics prior to the initiation of ECMO is shown in Table 1. The arterial blood gas (ABG) values prior to initiation of ECMO reported a pH of 7.35 (IQR 7.22-7.42), PaCO2 of 8.0 kPa (IQR 6.6-10.1), bicarbonate of 32 mmol/L (IQR 26-37) and PaO2 of 8.0 kPa (IQR 6.8-9.3). Controlled ventilation mode was mostly used: pressure-controlled ventilation in 31 patients (44%) and volume-controlled ventilation in 31 patients (44%). Median ventilation parameters consisted of PEEP of 12 cm H2O (IQR 8-16), FiO2 of 100% (IQR 80-100), resulting in a median PaO2/FiO2 of 58 mmHg (IQR 46-76). In a large part of the patients, prone positioning (79%) and muscle paralysis (77%) had been applied prior to initiation of ECMO. Acute kidney injury (AKI) was already present in 17 patients (24%), of which 12 (17%) were also receiving renal replacement therapy (RRT).\nPatient Baseline Characteristics.\nAbbreviations: COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation; SOFA, sequential organ failure assessment; CRP, C-reactive protein; PaO2, partial oxygen pressure; PCO2, partial carbon dioxide pressure; FiO2, fraction inspired oxygen; PEEP, positive end expiratory pressure.\n\na Values prior to initiation of ECMO include worst values within 12 hours prior to initiation.\nAfter the first occurrence of symptoms, hospital admission followed at a median of 13 days (IQR 7-16), and ICU admission 1 day later. ECMO was started at a median of 18 days (IQR 15-25) after disease onset and at a median of 5 days (IQR 3-10) after start of invasive mechanical ventilation. Almost all patients received veno-venous ECMO (VV-ECMO: 93%, n = 66), 3 patients received veno-arterial ECMO (VA-ECMO), one veno-veno-arterial ECMO (VVA-ECMO) and one extracorporeal CO2-removal (ECCO2R). The main indication for VV-ECMO was combined refractory hypoxemia and hypercapnia, which occurred in 34 patients (52%), followed by refractory hypoxemia in 32 patients (49%). To be able to offer hemodynamic support in the presence of right ventricular failure, 3 patients received VA-ECMO and one VVA-ECMO. The median duration of ECMO was 13 days (IQR 7-20); 3 patients were in need of a second run of ECMO. Muscle paralysis was the most commonly applied rescue therapy, which was applied in 51 patients (72%), followed by prone positioning (n = 27, 38%). The variance in pharmacotherapeutic drugs was high; hydroxychloroquine (n = 47, 66%) and lopinavir/ritonavir (n = 14, 20%) were most frequent (Table 2: ECMO Characteristics).\nECMO Characteristics.\nAbbreviations: ECMO, extracorporeal membrane oxygenation; CO2, carbondioxide; ICU, Intensive Care Unit; IL, interleukine.\nDuring ECMO, 60 patients (85%) suffered one or more complications, mostly a new infection (n = 40, 56%), AKI (n = 39, 55%) and hemorrhagic event (n = 38, 54%) as shown in Table 3. From the 39 patients with AKI, 22 out of 39 developed during ECMO, and 37 out of 39 patients (55%) received RRT. More than half of the patients (n = 37, 52%) were successfully weaned from ECMO. The 3 patients who received a second run were successfully weaned and survived. Within 28 days after ECMO initiation, 26 patients had died (37%). In those non-survivors a lower median pH and higher median PCO2 was shown in comparison to survivors (respectively: 7.28 versus 7.38 [P = .04] and 9.82 versus 7.33 [P = .002]). Moreover, muscle paralysis had been applied in fewer non-survivors (non-survivors 68% versus survivors 97%, P = .002). The median ECMO run was 6 days shorter in non-survivors (non-survivors 8 days [IQR 5-17] versus survivors 14 days [IQR 10-23]). A table showing survivors versus non-survivors can be found in the Additional File (E3. Survivors versus non-survivors).\nECMO Outcome and Complications.\nAbbreviations: ECMO, Extracorporeal Membrane Oxygenation; ICU, Intensive Care Unit.\n\na 28-day mortality: death within 28 days after initiation ECMO.\n\nb Causes of death are described in the Additional File (E4. Unanticipated Death).\nNon-COVID-19 ARDS A total of 48 out of 440 patients received ECMO due to ARDS unrelated to COVID-19. In this consecutive subgroup, median age was 55 years (IQR 40-61), sex was equally distributed, and median BMI was 28.3 kg/m2 (IQR 24.7-33). When compared to the patients with COVID-19 related respiratory failure, the COVID-19 group had a significantly higher proportion of males (80% versus 50%; P = .001). No other significant differences were found in patient baseline characteristics, comorbidities, and disease severity-related variables including sequential organ failure assessment (SOFA)-score and PaO2/FiO2-ratio. Also, complication rate and ECMO support duration did not differ significantly (Table 4). 28-day mortality was 37% in COVID-19 patients and 27% in non-COVID-19 patients. However, this difference was not significant, as shown in the Kaplan-Meier curves in Figure 1 (Hazard Ratio 1.01 [95% CI 0.60-1.69]; P = .98). In this figure it is apparent that this non-significant difference in mortality resolves after a prolonged 100-day follow-up.\nComparison COVID-19 on ECMO and Non-COVID-19 on ECMO.\nAbbreviations: COPD, chronic obstructive pulmonary disease; SOFA, sequential organ failure assessment; COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation.\n\na 28-day mortality, mortality 28 days after initiation of ECMO.\nKaplan-Meier estimates for patients with COVID-19 on ECMO and patients with ARDS not due to COVID-19 on ECMO. Unadjusted hazard ratio and 95% confidence interval calculated from a Cox proportional hazard model is presented.\nA total of 48 out of 440 patients received ECMO due to ARDS unrelated to COVID-19. In this consecutive subgroup, median age was 55 years (IQR 40-61), sex was equally distributed, and median BMI was 28.3 kg/m2 (IQR 24.7-33). When compared to the patients with COVID-19 related respiratory failure, the COVID-19 group had a significantly higher proportion of males (80% versus 50%; P = .001). No other significant differences were found in patient baseline characteristics, comorbidities, and disease severity-related variables including sequential organ failure assessment (SOFA)-score and PaO2/FiO2-ratio. Also, complication rate and ECMO support duration did not differ significantly (Table 4). 28-day mortality was 37% in COVID-19 patients and 27% in non-COVID-19 patients. However, this difference was not significant, as shown in the Kaplan-Meier curves in Figure 1 (Hazard Ratio 1.01 [95% CI 0.60-1.69]; P = .98). In this figure it is apparent that this non-significant difference in mortality resolves after a prolonged 100-day follow-up.\nComparison COVID-19 on ECMO and Non-COVID-19 on ECMO.\nAbbreviations: COPD, chronic obstructive pulmonary disease; SOFA, sequential organ failure assessment; COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation.\n\na 28-day mortality, mortality 28 days after initiation of ECMO.\nKaplan-Meier estimates for patients with COVID-19 on ECMO and patients with ARDS not due to COVID-19 on ECMO. Unadjusted hazard ratio and 95% confidence interval calculated from a Cox proportional hazard model is presented.", "During the study period, a total of 71 patients received ECMO due to refractory respiratory failure related to COVID-19. The majority of 57 patients (80%) were male and median age was 52 years (IQR 46-57). The patients were predominantly overweight with a median body mass index (BMI) of 29.2 kg/m2 (IQR 26.1-32.1). A minority of 29 patients (40%) had a medical history of cardiovascular or pulmonary disease, of which most frequently scored comorbidities consisted of hypertension (n = 15, 21%), asthma (n = 7, 10%) and diabetes (n = 6, 8%).\nAn overview of the patient baseline characteristics prior to the initiation of ECMO is shown in Table 1. The arterial blood gas (ABG) values prior to initiation of ECMO reported a pH of 7.35 (IQR 7.22-7.42), PaCO2 of 8.0 kPa (IQR 6.6-10.1), bicarbonate of 32 mmol/L (IQR 26-37) and PaO2 of 8.0 kPa (IQR 6.8-9.3). Controlled ventilation mode was mostly used: pressure-controlled ventilation in 31 patients (44%) and volume-controlled ventilation in 31 patients (44%). Median ventilation parameters consisted of PEEP of 12 cm H2O (IQR 8-16), FiO2 of 100% (IQR 80-100), resulting in a median PaO2/FiO2 of 58 mmHg (IQR 46-76). In a large part of the patients, prone positioning (79%) and muscle paralysis (77%) had been applied prior to initiation of ECMO. Acute kidney injury (AKI) was already present in 17 patients (24%), of which 12 (17%) were also receiving renal replacement therapy (RRT).\nPatient Baseline Characteristics.\nAbbreviations: COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation; SOFA, sequential organ failure assessment; CRP, C-reactive protein; PaO2, partial oxygen pressure; PCO2, partial carbon dioxide pressure; FiO2, fraction inspired oxygen; PEEP, positive end expiratory pressure.\n\na Values prior to initiation of ECMO include worst values within 12 hours prior to initiation.\nAfter the first occurrence of symptoms, hospital admission followed at a median of 13 days (IQR 7-16), and ICU admission 1 day later. ECMO was started at a median of 18 days (IQR 15-25) after disease onset and at a median of 5 days (IQR 3-10) after start of invasive mechanical ventilation. Almost all patients received veno-venous ECMO (VV-ECMO: 93%, n = 66), 3 patients received veno-arterial ECMO (VA-ECMO), one veno-veno-arterial ECMO (VVA-ECMO) and one extracorporeal CO2-removal (ECCO2R). The main indication for VV-ECMO was combined refractory hypoxemia and hypercapnia, which occurred in 34 patients (52%), followed by refractory hypoxemia in 32 patients (49%). To be able to offer hemodynamic support in the presence of right ventricular failure, 3 patients received VA-ECMO and one VVA-ECMO. The median duration of ECMO was 13 days (IQR 7-20); 3 patients were in need of a second run of ECMO. Muscle paralysis was the most commonly applied rescue therapy, which was applied in 51 patients (72%), followed by prone positioning (n = 27, 38%). The variance in pharmacotherapeutic drugs was high; hydroxychloroquine (n = 47, 66%) and lopinavir/ritonavir (n = 14, 20%) were most frequent (Table 2: ECMO Characteristics).\nECMO Characteristics.\nAbbreviations: ECMO, extracorporeal membrane oxygenation; CO2, carbondioxide; ICU, Intensive Care Unit; IL, interleukine.\nDuring ECMO, 60 patients (85%) suffered one or more complications, mostly a new infection (n = 40, 56%), AKI (n = 39, 55%) and hemorrhagic event (n = 38, 54%) as shown in Table 3. From the 39 patients with AKI, 22 out of 39 developed during ECMO, and 37 out of 39 patients (55%) received RRT. More than half of the patients (n = 37, 52%) were successfully weaned from ECMO. The 3 patients who received a second run were successfully weaned and survived. Within 28 days after ECMO initiation, 26 patients had died (37%). In those non-survivors a lower median pH and higher median PCO2 was shown in comparison to survivors (respectively: 7.28 versus 7.38 [P = .04] and 9.82 versus 7.33 [P = .002]). Moreover, muscle paralysis had been applied in fewer non-survivors (non-survivors 68% versus survivors 97%, P = .002). The median ECMO run was 6 days shorter in non-survivors (non-survivors 8 days [IQR 5-17] versus survivors 14 days [IQR 10-23]). A table showing survivors versus non-survivors can be found in the Additional File (E3. Survivors versus non-survivors).\nECMO Outcome and Complications.\nAbbreviations: ECMO, Extracorporeal Membrane Oxygenation; ICU, Intensive Care Unit.\n\na 28-day mortality: death within 28 days after initiation ECMO.\n\nb Causes of death are described in the Additional File (E4. Unanticipated Death).", "A total of 48 out of 440 patients received ECMO due to ARDS unrelated to COVID-19. In this consecutive subgroup, median age was 55 years (IQR 40-61), sex was equally distributed, and median BMI was 28.3 kg/m2 (IQR 24.7-33). When compared to the patients with COVID-19 related respiratory failure, the COVID-19 group had a significantly higher proportion of males (80% versus 50%; P = .001). No other significant differences were found in patient baseline characteristics, comorbidities, and disease severity-related variables including sequential organ failure assessment (SOFA)-score and PaO2/FiO2-ratio. Also, complication rate and ECMO support duration did not differ significantly (Table 4). 28-day mortality was 37% in COVID-19 patients and 27% in non-COVID-19 patients. However, this difference was not significant, as shown in the Kaplan-Meier curves in Figure 1 (Hazard Ratio 1.01 [95% CI 0.60-1.69]; P = .98). In this figure it is apparent that this non-significant difference in mortality resolves after a prolonged 100-day follow-up.\nComparison COVID-19 on ECMO and Non-COVID-19 on ECMO.\nAbbreviations: COPD, chronic obstructive pulmonary disease; SOFA, sequential organ failure assessment; COPD, chronic obstructive pulmonary disease; ECMO, extracorporeal membrane oxygenation.\n\na 28-day mortality, mortality 28 days after initiation of ECMO.\nKaplan-Meier estimates for patients with COVID-19 on ECMO and patients with ARDS not due to COVID-19 on ECMO. Unadjusted hazard ratio and 95% confidence interval calculated from a Cox proportional hazard model is presented.", "To date, this study is one of the first multi-center observational studies of COVID-19 patients on ECMO. We reported a 28-day mortality of 37% in patients with COVID-19 on ECMO. This survival rate and the complication rate did not significantly differ from our non-COVID-19 patients on ECMO. Moreover, patient characteristics of our COVID-19 and non-COVID-19 patients were complementary prior to initiation of ECMO, except for gender.\nThe past decades, ECMO is considered a life-saving therapy. However, its overall beneficial effect in ARDS is not beyond any doubt, resulting in the current role of ECMO as a final resort therapy.\n5,19\n The rise of the COVID-19 pandemic has reignited the discussion if ECMO should or should not be offered in patients with severe ARDS,\n20\n and whether such therapy would be associated with acceptable complication and mortality rates. This debate was amplified by a Chinese cohort study where 5 out of 6 patients on ECMO died,\n21\n after which concerns were expressed.\n22\n In our study, complication rate and 28-day mortality did not significantly differ in COVID-19 and non-COVID-19 patients. Moreover, our mortality rates were in line with a recent observational study showing an estimated probability of day-60 mortality of 31%.\n10\n Also, comparable survival rates were found in ICU patients with ARDS due to COVID-19 not on ECMO.\n23\n This suggests that in case of severe, refractory ARDS due to COVID-19, ECMO could be considered as supportive therapy in case conventional therapies prove insufficient.\nOne of the questions remains if selection and triage of COVID-19 patients for ECMO differed from other non-COVID-19 ARDS patients. Several respiratory variables emphasize the severity of the respiratory insufficiency in our study population. Rescue therapies to improve oxygenation including prone positioning and muscle paralysis were applied in most patients in our study. Moreover, almost 9 out 10 patients were ventilated using controlled modes. In ARDS, the Surviving Sepsis Campaign has made several recommendations, including (ultra)protective ventilation. Although both ventilation modes have advantages and disadvantages, such as high peek pressure in volume-controlled ventilation, no mode has consistently shown to be advantageous.\n12\n In general, prior to initiation of ECMO, it is advised to apply best conventional intensive care as possible, including above described rescue therapies. In spite of these attempts, oxygen delivery was compromised, as shown by the low median PaO2/FiO2 ratio of 58 mmHg (IQR 46-76) and the need of a high FiO2 (median 100% [IQR 80%-100%]). When compared to previous ARDS groups on ECMO these values confirm the severity in the COVID-19 ECMO population.\n19,24,25\n Not only the characteristics prior to initiation of ECMO were in line with previous ECMO non-COVID-19 ARDS groups, but also the ECMO characteristics themselves.\n5\n This could suggest that no large differences in patient selection have occurred, e.g. no different timing of cannulation and no earlier discontinuation of treatment.\nIn comparison with general COVID-19 patients in the ICU, our group on ECMO support appears relatively young.\n24\n This can be explained by the selection criteria used for initiation of ECMO: among others the interim guideline of ELSO advises to apply age above 65 years old as a relative contraindication.\n26\n Given the expected rise in COVID-19 of patients administered to the hospital with COVID-19, discussions arose which patients had to be selected in case capacity was insufficient, in which age was a common topic.\n27\n Although triage with a limit on age was not applied in all participating hospitals of this study during the first peak, it is possible that age discrimination has occurred unwittingly. The sex discrepancy (more males) has been described in large Italian and German groups of patients with COVID-19 as well.\n23,24\n In contrast to general hospitalized COVID-19 patients, where an incidence of up to 90% has been described, this study population was relatively healthy prior to COVID-19 as only 40% had comorbidities.\n3\n No differences in comorbidities were found between survivors and non-survivors in our COVID-19 group on ECMO. However, interestingly, the arterial blood gas of non-survivors reported a significantly lower pH and higher PCO2. This finding is confirmed by the descriptive study of Yang et al.\n28\n\n\nAt last, one main consideration should remain the availabilities of sufficient resources, including personnel and equipment. Concerns are still raised whether ECMO is justifiable in times of a pandemic, or if saving few lives would decrease the quality of care in other patients.\n20\n As stated by the SSCM and WHO, this is not the time to start with implementing ECMO in centers who do not yet have the experience and resources for ECMO. However, in case personnel, equipment, facilities and systems apply, our results suggest that ECMO could be considered as a supportive therapy in case conventional therapies are insufficient.\nThis study has several strengths. It is one of the largest multicenter observational studies presenting data on the use of ECMO from multiple countries during the first peek of the COVID-19 pandemic. Moreover, it is the first multicenter study comparing COVID-19 patient characteristics with a previous non-COVID-19 ARDS group from the same participating centers. It gives an extensive overview of COVID-19 ECMO characteristics including applied therapies. Some limitations should however be recognized. Due to its observational design, some biases cannot be excluded. Hence, it is unknown what the outcome would be in the absence of ECMO support. Furthermore, the time frames of patients with and without COVID-19 on ECMO were different. It cannot be excluded that the level of care for patients on ECMO prior COVID-19 was different compared with the period during COVID-19. Finally, no data were collected regarding functional outcomes.", "To conclude, we found an acceptable survival rate in ECMO patients with COVID-19, not differing significantly from our non-COVID-19 ARDS patients on ECMO. ECMO could be considered as a supportive therapy in case of COVID-19 related respiratory failure, in case conventional therapies are insufficient.", "Click here for additional data file.\nSupplemental Material, sj-docx-1-jic-10.1177_08850666211007063 for Extracorporeal Membrane Oxygenation in Patients With COVID-19: An International Multicenter Cohort Study by Senta Jorinde Raasveld, Thijs S. R. Delnoij, Lars M. Broman, Annemieke Oude Lansink-Hartgring, Greet Hermans, Erwin De Troy, Fabio S. Taccone, Manuel Quintana Diaz, Franciska van der Velde, Dinis Dos Reis Miranda, Erik Scholten, ETALON Study Group and Alexander P. J. Vlaar in Journal of Intensive Care Medicine\nClick here for additional data file.\nSupplemental Material, sj-docx-2-jic-10.1177_08850666211007063 for Extracorporeal Membrane Oxygenation in Patients With COVID-19: An International Multicenter Cohort Study by Senta Jorinde Raasveld, Thijs S. R. Delnoij, Lars M. Broman, Annemieke Oude Lansink-Hartgring, Greet Hermans, Erwin De Troy, Fabio S. Taccone, Manuel Quintana Diaz, Franciska van der Velde, Dinis Dos Reis Miranda, Erik Scholten, ETALON Study Group and Alexander P. J. Vlaar in Journal of Intensive Care Medicine" ]

[ "intro", "methods", null, "results", null, null, "discussion", "conclusions", "supplementary-material" ]

[ "survival", "ECMO", "COVID-19", "ARDS" ]

[ 150, 1063, 316 ]

[ "ecmo", "patients", "19", "covid", "covid 19", "iqr", "non", "median", "survivors", "ards" ]

[ "failure acute respiratory", "ventilation extracorporeal membrane", "coronavirus sars cov", "mechanical ventilation extracorporeal", "respiratory syndrome coronavirus" ]

[ "Adolescent", "Anesthesia", "Anesthesia, Conduction", "Anesthesia, General", "Child", "Child, Preschool", "Cleft Lip", "Developing Countries", "Female", "Humans", "Infant", "Intubation, Intratracheal", "Ketamine", "Male", "Retrospective Studies", "Socioeconomic Factors", "Treatment Outcome", "Young Adult" ]

[ "What is known about this topic", "What this study adds" ]

[ "That most African countries are lacking in adequate infrastructure needed for the repair of cleft lip and palate;\nThat regional and general anaesthesia with endotracheal intubation are the two safe modes of anaesthesia for the repair of cleft lip.", "That with extra caution and care, cleft lip can be safely repaired in a resource poor setting using ketamine anaesthesia;\nThat peri-incisional infilteration alone, if properly done, can be used for cleft lip repair in adult." ]

[ null, null ]

[ "Introduction", "Methods", "Results", "Discussion", "Conclusion", "What is known about this topic", "What this study adds", "Competing interests" ]

[ "Cleft lip and palate has a huge impact on the life of an individual and their family. It is one of the more common congenital malformation and the most common craniofacial anomalies in children [1]. A child is born with a cleft somewhere in the world every 2 minutes according to a WHO study published in 2001 [2]. The prevalence of cleft lip, with or without an associated cleft palate, is 0.1% in the general population [3]. The treatment of orofacial cleft anomaly is expensive and requires years of specialized care [3, 4]. Though successful treatment of the cosmetic and functional aspects of orofacial cleft anomalies is now possible, presentation for surgery is late in low and middle income countries due to low socioeconomic status of patients and their relation [4]. This is further compounded by the inadequacy of expertise in the surgical procedure, competent anaesthetists, and non-availability of necessary equipment [5]. The civil war that ravaged Sierra Leone from 1991 to 2002 destroyed the country's infrastructure including its health systems. Anaesthesia for cleft lip and palate surgery is challenging to the anaesthetist [6]. Two safe modes of anaesthesia described are general anaesthesia with endotracheal intubation and regional anaesthesia [3, 7]. General anaesthesia is mostly used for patients in the paediatric age group and endotracheal intubation is necessary to secure and protect the airway because the surgeon shares the same field with the anaesthetist. Regional anaesthesia is mostly used in patients in whom cooperation could be sought. It could be by infraorbital nerve block, dorsal nasal block or peri-incisional infiltration [3, 8]. Bearing in mind the challenges involved in the anaesthesia for cleft lip surgery which include difficult airway, inadvertent extubation, kinking of endotracheal tube, aspiration of blood and secretions, laryngospasm, etc [7, 9, 10], this study intend to review a number of cases done in a resource poor setting enumerating the mode of anaesthesia, safety, complications, and recovery profile of the patients.", "This is a retrospective study of anaesthesia for the surgical repair of cleft lip in the country of Sierra Leone by a team of Nigerian surgeons and anaesthetist on a smile train international mission. The information is as recorded in the patients' case notes. A total of seventy-nine (79) patients presented during the mission. The patients were evaluated clinically for fitness for surgery and any coexisting congenital malformations. Information regarding patient's weight, written consent, preoperative fasting guideline, mode of anaesthesia, excessive bleeding, adverse events during surgical procedure, intra and postoperative complications like fever, excessive secretion, hypoxia, vomiting, bleeding, and need for intubation were retrieved. The need for additional anaesthetic or analgesic, conversion to general anaesthesia from regional technique was also retrieved. No routine pre-operative laboratory test was done. Standard preoperative fasting guidelines were observed based on records. Three modes of anaesthesia were recorded: regional anaesthesia for patients above the age of 9 years (Group A), a modified general anaesthesia with supplemental peri-incisional infiltration for patients aged 9years and below with unilateral cleft lip (Group B), and general anaesthesia with endotracheal intubation (Group C) for patient with bilateral cleft lip. Dental preparation of lidocaine hydrochloride with adrenaline (36mg + 18µg) in 1.8ml cartridges were used in all the modes of anaesthesia. In both groups A and B, patients were left to breathe in room air. All patients had intravenous access with infusion of 4.3% Dextrose in 0.18 Saline or 0.9% Saline as applicable. Monitoring was with the aid of precordial stethoscope, and lifebox pulse oximeter.\n\nGroup A: Patients had peri-incisional infiltration of the dental preparation of lidocaine with adrenaline. Surgeries were done with the patients in the sitting position, awake and breathing room air.\n\nGroup B: Patients had intramuscular ketamine at a dose of 10-12.5 mg/kg mixed with atropine at a dose of 0.01-0.03mg/kg. Supplemental peri-incisional infiltration of the dental preparation of lidocaine with adrenaline was instituted after induction. Saline wet gauze was placed in the buccal pouch. Surgery was in the supine position with a shoulder roll and head ring in place.\n\nGroup C: Patients had general anaesthesia with endotracheal intubation. Induction was inhalational with halothane in oxygen at 6L/min to achieve hypnosis. Intubation was facilitated with suxamethonium 1.5mg/kg given intravenously. Maintenance of anaesthesia was with halothane at 1% concentration in oxygen at 6L/min. Patient also had peri-incisional infiltration of the dental preparation of lidocaine with adrenaline. The surgery was also performed in the supine position with shoulder roll and head ring in place. Patients were allowed to breathe spontaneously. Fever was defined as temperature of more than 38.5°C, hypoxia as percentage saturation of oxygen of less than 90%, and excessive bleeding and secretion as those that required the use of suction machine. Duration of surgery was defined as the time from knife on skin to the end of last stitch.", "A total of 79 patients presented for surgery during the mission which lasted 10 days. Sixty-two patients comprising 34 males (54.8%) and 28 females (45.2%) were operated and hence studied. The remaining 17 patients had isolated palatal cleft which could not be repaired because of limited facility to guaranty safe surgery and anaesthesia. The age distribution of the patients is presented in Table 1. Of the 62 operated patients, 37(59.7%) had left unilateral cleft lip with 25(40.3%) left incomplete and 12(19.4%) left complete cleft lip. 11(17.7%) had right complete cleft lip and 12 (19.4%) with right incomplete cleft lip while only 2(3.2%) had bilateral cleft lip (Figure 1). Forty six (46) patients (74.2%) were anaesthetized with ketamine at a dose of 10-12.5mg/kg combined with atropine 0.01-0.03mg/kg given intramuscularly without endotracheal intubation, while 14 (22.6%) had regional anaesthesia and only 2 patients (3.2%) had general anaesthesia with endotracheal intubation. The mean duration of surgery was 34.2minutes (median 34.0minutes). The only complication recorded is fever which occurred in 6 patients (9.7%) who had ketamine anaesthesia (Table 2).\nAge of patient\nRange 3months-43years SD= Standard Deviation\nMode of anaesthesia and complication\nType of cleft", "Modern anaesthetic techniques in cleft surgeries involve the use of expensive anaesthetic agents, bulky machines, and continuous flow of anaesthetic gases [11]. This is largely because of the shared field situation in which the surgeon and the anaesthetist work in the same region of the body i.e. the oral cavity. All the patients operated had their surgery for the first time (primary repair). Majority of the patients (34(54.8%)) were males while there were 28(45.2%) females. This finding is in agreement with the work done by Jindal et al and Kulkarni et al [12, 13]. Studies have also shown the predominance of left unilateral cleft lip [3, 5, 6]. This correlates well with the finding of 37(59.7%) unilateral cleft lip in this study. Ketamine with atropine, given intramuscularly, was the main technique of Anaesthesia recorded. This technique was employed because of the non-availability of sophisticated gadgets and also the limitation of the supply of oxygen. In this study, this technique was used for all patients aged 3 months to 9 years with unilateral cleft lip (both complete and incomplete). This is in contrast to the study of Hodges et al on “A protocol for Safe Anaesthesia for cleft lip and palate surgery in developing countries” where similar technique was used only for patients from 1-10years old [10]. This study shows that the technique was tolerated well down to the age of 3 month. Ketamine and atropine, without intubation, were the only drugs used to anaesthetise 46(74.2%) patients who had cleft lip repair from the age of 3 month to 9 years and it proved to be efficient and safe. Regional anaesthesia was used for 14(22.6%) patients above the age of 9 years. Peri-incisional infiltration using cartridges of the dental preparation of lidocaine with adrenaline in 1.8ml was used. There was no form of sedation given to the patients unlike in the work of Hodges et al [10]. Most studies on regional anaesthesia for cleft lip repair used different combinations of infraorbital block, dorsal-nasal block, septal block, and peri-incisional infiltration [3, 8]. Only peri-incisional infiltration was used during this mission and patients tolerated it well and with good postoperative analgesia up to 6 hours. There were no complications recorded with this technique. This agrees with the findings of other studies [3, 8, 9, 10]. The acceptance level was high as there was no need to convert to general anaesthesia in any of the patients. General anaesthesia is the safest and preferred mode of anaesthesia for cleft surgeries because of the need to prevent aspiration while ensuring a good oxygenation of the patient [11, 12]. During this mission, general anaesthesia with endotracheal intubation could be performed in one patient at a time due to the availability of only one anaesthesia machine.\nIn addition, the continuous supply of oxygen could not be guaranteed. Hence, this technique was reserved for patients with bilateral cleft lip where more bleeding is expected, and to conserve oxygen for patients with complication that may require oxygen. There was adequate provision of the volatile anaesthetic agent, halothane, by the team but the agent could not be used due to the inadequate supply of oxygen and other equipment. There were no complications recorded in these patients. Studies on the use of general anaesthesia for cleft lip surgeries recorded some complications among which are hypoxia, laryngospasm, difficult intubation, failed intubation, temperature variation, tube disconnection, pulmonary oedema etc [12, 13]. The finding of no complication from this study could be due to the smaller number of patients who had this form of anaesthesia. Lower concentration of halothane (1% halothane in oxygen at 6L/min) was used while allowing the patients to breathe spontaneously because the anaesthesia was supplemented with peri-incisional infiltration of the dental preparation of lidocaine in adrenaline. Hence, the patients recorded faster recovery time. The mean duration of surgery was 34.2 minutes (median = 34.0mins). This duration is relatively shorter when compared to the work done by Jindal et al where the duration for cleft lip repair was one (1) hour and that of Eipe et al of between 45minutes to 60 minutes [8, 12]. This could be due to the fact that the team of surgeons and anaesthetist have been working together for more than 5 years on cleft surgeries and the experience gained over the years would have been contributory. Another factor could be the fact that every member of the team is a specialist including the anaesthetist with improvement in skill over time. Sierra Leone depends largely on the support of international organizations in their healthcare especially for surgical procedures [13]. Until 2008, there had not been any opportunity for postgraduate training in surgery in a country with only ten (10) trained surgeons to serve the whole population. The country also has shortages in infrastructure and supplies required for delivering surgical care [14]. Unlike other studies that recorded multiple complications with cleft lip surgeries, the only complication encountered during this mission is fever (Temperature > 37.5°C) which occurred in 6 (9.7%) patients [1, 5, 9, 12, 15]. Ironically, all 6 patients had ketamine anaesthesia. Similarly, the fever started in the intraoperative period and extended into the postoperative period. The fever was managed with acetaminophen syrup and patients were also treated for malaria since the country is a malaria endemic area. This study supports the findings of Fillies et al in their study on perioperative complications in infant cleft repair where temperature variation particularly hyperthermia accounted for most of the complications observed [13]. Quershi et al have reported hypothermia as an important complication found most commonly in children with a bilateral cleft lip repair citing prolonged duration of surgery as the cause [6]. However, in our study neither hypothermia nor hyperthermia was observed in the 2 (two) patients who had bilateral cleft lip repair under general anaesthesia.", "Most patients for cleft lip repair presents in the paediatric age group. This contributes to the challenge faced by anaesthetist apart from those presented by the pathology. Hence, general anaesthesia with endotracheal intubation is considered as the safest mode of anaesthesia. But our study has demonstrated that these surgeries can be performed with careful planning and with the required expertise in low resource setting.\n What is known about this topic That most African countries are lacking in adequate infrastructure needed for the repair of cleft lip and palate;\nThat regional and general anaesthesia with endotracheal intubation are the two safe modes of anaesthesia for the repair of cleft lip.\nThat most African countries are lacking in adequate infrastructure needed for the repair of cleft lip and palate;\nThat regional and general anaesthesia with endotracheal intubation are the two safe modes of anaesthesia for the repair of cleft lip.\n What this study adds That with extra caution and care, cleft lip can be safely repaired in a resource poor setting using ketamine anaesthesia;\nThat peri-incisional infilteration alone, if properly done, can be used for cleft lip repair in adult.\nThat with extra caution and care, cleft lip can be safely repaired in a resource poor setting using ketamine anaesthesia;\nThat peri-incisional infilteration alone, if properly done, can be used for cleft lip repair in adult.", "That most African countries are lacking in adequate infrastructure needed for the repair of cleft lip and palate;\nThat regional and general anaesthesia with endotracheal intubation are the two safe modes of anaesthesia for the repair of cleft lip.", "That with extra caution and care, cleft lip can be safely repaired in a resource poor setting using ketamine anaesthesia;\nThat peri-incisional infilteration alone, if properly done, can be used for cleft lip repair in adult.", "The author declare no competing interest." ]

[ "intro", "methods", "results", "discussion", "conclusions", null, null, "COI-statement" ]

[ "Anaesthesia", "cleft lip", "techniques", "setting" ]

[ 42, 44 ]

[ "anaesthesia", "cleft", "patients", "lip", "cleft lip", "repair", "general", "intubation", "general anaesthesia", "surgery" ]

[ "complications cleft lip", "prevalence cleft lip", "anaesthesia cleft surgeries", "cleft surgeries need", "treatment orofacial cleft" ]

[ "Bone Wires", "Female", "Fracture Fixation, Internal", "Fractures, Bone", "Humans", "Knee Injuries", "Male", "Patella", "Retrospective Studies" ]

[ "General information", "Surgical techniques", "Postoperative care and follow-up", "Statistical analysis" ]

[ "Inclusion criteria: (1) unilateral IPFP diagnosed by imaging, (2) age ≥ 18 years, (3) normal bone mineral density, and 4) ≥ 12 months of follow-up. Exclusion criteria: (1) pathological fracture, (2) fracture of the femur, tibia, or fibula on the affected side, (3) popliteal blood vessel or nerve injury, (4) other acute or chronic diseases affecting knee function, and (5) multiple injuries or intolerance to surgery due to underlying diseases.\nSix males and five females aged 39.0 ± 12.8 years (range 18–53 years) were included in the study. IPFP was caused by traffic accidents in five cases and falls in six cases. All cases had unilateral closed injuries, including four injuries to the left knee and seven to the right knee. The preoperative range of motion of the knee was 22.0 ± 7.5° (10–30°). The time from injury to operation was 4.5 ± 1.3 d (3–7 d).\nThe same surgical team performed all the surgeries in this study. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of the 920 Hospital of Chinese People’s Liberation Army Joint Logistics Support Force. We obtained informed consent from all subjects and/or their legal guardian(s).", "The tension-free external immobilization device was mainly composed of Kirschner wire, threaded needle, external immobilization ring (including and 1/2 ring and a 2/3 ring), threaded rod, plain bolt, needle-passing bolt, threaded needle pad, joint hinge, and vertical linker (Fig. 1).\nAfter general anesthesia in the supine position, routine disinfection, and draping, a sterile tourniquet was put on the root of the thigh on the affected side and inflated. An anterior median longitudinal incision of the patella was made to expose the IPFP end (Fig. 1A). The fracture ends were handled under direct vision. If the avulsion fracture blocks were large, fracture immobilization and reduction were performed using olive-tipped needles or Kirschner wires with a blocking head. One-gauge absorbable sutures were used for suture immobilization (Fig. 1B). Two 1.5-mm Kirschner wires were cross-inserted percutaneously in the vertical direction of the waist segment of the patella, and the Kirschner wires and the 1/2 ring were fixed with needle-passing bolts (Fig. 1C). One 2.0-mm Kirschner wire was inserted below the tibial tubercle horizontally through the tibia, one 4.0-mm threaded needle was inserted vertically in front of the tibia on this plane, and the Kirschner wire, threaded needle, and 2/3 ring were connected and fixed with needle-passing bolts and threaded needle pads. One 4.0-mm threaded needle was inserted vertically in front of the tibia about 12 cm away from the distal end of the 2/3 ring, and the two 2/3 rings were bridged and fixed with threaded needles, needle-passing bolts, and threaded needle pads (Fig. 1D). Then the devices at both ends of the fracture were connected using the joint hinge, and the joint hinge was adjusted to allow for the good knee motion and no tension of the suture at the fracture end (Fig. 1E). Finally, the tourniquet was loosened, the incision was washed, the bleeding was stopped, and the surgical incision was closed.", "Within 24 h after surgery, we gave antibiotics to prevent infection and nonsteroidal anti-inflammatory drugs to control pain. The knee could be passively moved on the bed after surgery. The patients were encouraged to actively move the knee 1 d after surgery, they strengthened the knee function and walked on crutches with partial weight at 2 d, and they walked with no crutches at full weight at 1 week.\nThe anteroposterior and lateral X-rays of the knee on the affected side were reviewed within 3 d after surgery first, once a month until fracture healing and removal of external immobilization devices, and then once every 6 months. The operation duration, intraoperative blood loss, length of hospital stay, and surgical complications were recorded, and the fracture healing time, removal time of external immobilization device, and postoperative complications were recorded during the follow-up. Before surgery, 1 month after surgery, and at the last follow-up, the range of motion of the knee was measured. At the last follow-up, the range of motion was compared between the affected knee and unaffected knee, and the function of the affected knee was assessed by the Böstman score.", "SPSS 24.0 software (SPSS, USA) was used for analysis. Measurement data are expressed as (\\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$$\\overline {\\text{x}}$$\\end{document}x¯ ± s). The range of motion of the knee was compared at different time points through the paired t-test. The test level was set as α = 0.05." ]

[ null, null, null, null ]

[ "Introduction", "Materials and methods", "General information", "Surgical techniques", "Postoperative care and follow-up", "Statistical analysis", "Results", "Discussion" ]

[ "As a common intra-articular fracture, patellar fracture accounts for about 1% of systemic fractures [1]. Inferior pole fracture of the patella (IPFP) is a special type of patellar fracture occurring in the distal 1/4 of the patella, i.e., the point of attachment of the patellar tendon, made up mainly of cancellous bone with no articular surface coverage and not involved in the composition of the patellofemoral joint. As an extra-articular fracture [2], IPFP makes up 9.3–22.4% of patellar fractures [3].\nIPFP has small and comminuted fracture blocks that are hard to immobilize, and it is also prone to displacement due to patellar tendon traction, so conservative treatment usually has unsatisfactory effects, necessitating surgical intervention. Currently, IPFP is primarily treated with two surgical methods. The first method is inferior patellar pole resection and patellar ligament repair and reconstruction, but this shortens the patellar ligament, leads to patellar lowering, and increases the pressure on the patellofemoral joint surface, resulting in complications such as limited knee flexion and anterior patellar pain [4]. The second method is reduction, and immobilization with steel wires, steel plates and sutures, aiming to preserve the anatomical integrity of the patella [5–9], but it has limited stability in the immobilization of smaller IPFPs, and early mobilization may lead to loss of fracture reduction and immobilization failure [9, 10, 11, 12]. Therefore, how to restore the knee function through early rehabilitation exercise at the same time as effective immobilization remains a clinical problem demanding a prompt solution.\nThis study describes the characteristics of the new tension-free external immobilization device and retrospectively assesses its clinical effect in the treatment of IPFP.", "General information Inclusion criteria: (1) unilateral IPFP diagnosed by imaging, (2) age ≥ 18 years, (3) normal bone mineral density, and 4) ≥ 12 months of follow-up. Exclusion criteria: (1) pathological fracture, (2) fracture of the femur, tibia, or fibula on the affected side, (3) popliteal blood vessel or nerve injury, (4) other acute or chronic diseases affecting knee function, and (5) multiple injuries or intolerance to surgery due to underlying diseases.\nSix males and five females aged 39.0 ± 12.8 years (range 18–53 years) were included in the study. IPFP was caused by traffic accidents in five cases and falls in six cases. All cases had unilateral closed injuries, including four injuries to the left knee and seven to the right knee. The preoperative range of motion of the knee was 22.0 ± 7.5° (10–30°). The time from injury to operation was 4.5 ± 1.3 d (3–7 d).\nThe same surgical team performed all the surgeries in this study. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of the 920 Hospital of Chinese People’s Liberation Army Joint Logistics Support Force. We obtained informed consent from all subjects and/or their legal guardian(s).\nInclusion criteria: (1) unilateral IPFP diagnosed by imaging, (2) age ≥ 18 years, (3) normal bone mineral density, and 4) ≥ 12 months of follow-up. Exclusion criteria: (1) pathological fracture, (2) fracture of the femur, tibia, or fibula on the affected side, (3) popliteal blood vessel or nerve injury, (4) other acute or chronic diseases affecting knee function, and (5) multiple injuries or intolerance to surgery due to underlying diseases.\nSix males and five females aged 39.0 ± 12.8 years (range 18–53 years) were included in the study. IPFP was caused by traffic accidents in five cases and falls in six cases. All cases had unilateral closed injuries, including four injuries to the left knee and seven to the right knee. The preoperative range of motion of the knee was 22.0 ± 7.5° (10–30°). The time from injury to operation was 4.5 ± 1.3 d (3–7 d).\nThe same surgical team performed all the surgeries in this study. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of the 920 Hospital of Chinese People’s Liberation Army Joint Logistics Support Force. We obtained informed consent from all subjects and/or their legal guardian(s).\nSurgical techniques The tension-free external immobilization device was mainly composed of Kirschner wire, threaded needle, external immobilization ring (including and 1/2 ring and a 2/3 ring), threaded rod, plain bolt, needle-passing bolt, threaded needle pad, joint hinge, and vertical linker (Fig. 1).\nAfter general anesthesia in the supine position, routine disinfection, and draping, a sterile tourniquet was put on the root of the thigh on the affected side and inflated. An anterior median longitudinal incision of the patella was made to expose the IPFP end (Fig. 1A). The fracture ends were handled under direct vision. If the avulsion fracture blocks were large, fracture immobilization and reduction were performed using olive-tipped needles or Kirschner wires with a blocking head. One-gauge absorbable sutures were used for suture immobilization (Fig. 1B). Two 1.5-mm Kirschner wires were cross-inserted percutaneously in the vertical direction of the waist segment of the patella, and the Kirschner wires and the 1/2 ring were fixed with needle-passing bolts (Fig. 1C). One 2.0-mm Kirschner wire was inserted below the tibial tubercle horizontally through the tibia, one 4.0-mm threaded needle was inserted vertically in front of the tibia on this plane, and the Kirschner wire, threaded needle, and 2/3 ring were connected and fixed with needle-passing bolts and threaded needle pads. One 4.0-mm threaded needle was inserted vertically in front of the tibia about 12 cm away from the distal end of the 2/3 ring, and the two 2/3 rings were bridged and fixed with threaded needles, needle-passing bolts, and threaded needle pads (Fig. 1D). Then the devices at both ends of the fracture were connected using the joint hinge, and the joint hinge was adjusted to allow for the good knee motion and no tension of the suture at the fracture end (Fig. 1E). Finally, the tourniquet was loosened, the incision was washed, the bleeding was stopped, and the surgical incision was closed.\nThe tension-free external immobilization device was mainly composed of Kirschner wire, threaded needle, external immobilization ring (including and 1/2 ring and a 2/3 ring), threaded rod, plain bolt, needle-passing bolt, threaded needle pad, joint hinge, and vertical linker (Fig. 1).\nAfter general anesthesia in the supine position, routine disinfection, and draping, a sterile tourniquet was put on the root of the thigh on the affected side and inflated. An anterior median longitudinal incision of the patella was made to expose the IPFP end (Fig. 1A). The fracture ends were handled under direct vision. If the avulsion fracture blocks were large, fracture immobilization and reduction were performed using olive-tipped needles or Kirschner wires with a blocking head. One-gauge absorbable sutures were used for suture immobilization (Fig. 1B). Two 1.5-mm Kirschner wires were cross-inserted percutaneously in the vertical direction of the waist segment of the patella, and the Kirschner wires and the 1/2 ring were fixed with needle-passing bolts (Fig. 1C). One 2.0-mm Kirschner wire was inserted below the tibial tubercle horizontally through the tibia, one 4.0-mm threaded needle was inserted vertically in front of the tibia on this plane, and the Kirschner wire, threaded needle, and 2/3 ring were connected and fixed with needle-passing bolts and threaded needle pads. One 4.0-mm threaded needle was inserted vertically in front of the tibia about 12 cm away from the distal end of the 2/3 ring, and the two 2/3 rings were bridged and fixed with threaded needles, needle-passing bolts, and threaded needle pads (Fig. 1D). Then the devices at both ends of the fracture were connected using the joint hinge, and the joint hinge was adjusted to allow for the good knee motion and no tension of the suture at the fracture end (Fig. 1E). Finally, the tourniquet was loosened, the incision was washed, the bleeding was stopped, and the surgical incision was closed.\nPostoperative care and follow-up Within 24 h after surgery, we gave antibiotics to prevent infection and nonsteroidal anti-inflammatory drugs to control pain. The knee could be passively moved on the bed after surgery. The patients were encouraged to actively move the knee 1 d after surgery, they strengthened the knee function and walked on crutches with partial weight at 2 d, and they walked with no crutches at full weight at 1 week.\nThe anteroposterior and lateral X-rays of the knee on the affected side were reviewed within 3 d after surgery first, once a month until fracture healing and removal of external immobilization devices, and then once every 6 months. The operation duration, intraoperative blood loss, length of hospital stay, and surgical complications were recorded, and the fracture healing time, removal time of external immobilization device, and postoperative complications were recorded during the follow-up. Before surgery, 1 month after surgery, and at the last follow-up, the range of motion of the knee was measured. At the last follow-up, the range of motion was compared between the affected knee and unaffected knee, and the function of the affected knee was assessed by the Böstman score.\nWithin 24 h after surgery, we gave antibiotics to prevent infection and nonsteroidal anti-inflammatory drugs to control pain. The knee could be passively moved on the bed after surgery. The patients were encouraged to actively move the knee 1 d after surgery, they strengthened the knee function and walked on crutches with partial weight at 2 d, and they walked with no crutches at full weight at 1 week.\nThe anteroposterior and lateral X-rays of the knee on the affected side were reviewed within 3 d after surgery first, once a month until fracture healing and removal of external immobilization devices, and then once every 6 months. The operation duration, intraoperative blood loss, length of hospital stay, and surgical complications were recorded, and the fracture healing time, removal time of external immobilization device, and postoperative complications were recorded during the follow-up. Before surgery, 1 month after surgery, and at the last follow-up, the range of motion of the knee was measured. At the last follow-up, the range of motion was compared between the affected knee and unaffected knee, and the function of the affected knee was assessed by the Böstman score.\nStatistical analysis SPSS 24.0 software (SPSS, USA) was used for analysis. Measurement data are expressed as (\\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$$\\overline {\\text{x}}$$\\end{document}x¯ ± s). The range of motion of the knee was compared at different time points through the paired t-test. The test level was set as α = 0.05.\nSPSS 24.0 software (SPSS, USA) was used for analysis. Measurement data are expressed as (\\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$$\\overline {\\text{x}}$$\\end{document}x¯ ± s). The range of motion of the knee was compared at different time points through the paired t-test. The test level was set as α = 0.05.", "Inclusion criteria: (1) unilateral IPFP diagnosed by imaging, (2) age ≥ 18 years, (3) normal bone mineral density, and 4) ≥ 12 months of follow-up. Exclusion criteria: (1) pathological fracture, (2) fracture of the femur, tibia, or fibula on the affected side, (3) popliteal blood vessel or nerve injury, (4) other acute or chronic diseases affecting knee function, and (5) multiple injuries or intolerance to surgery due to underlying diseases.\nSix males and five females aged 39.0 ± 12.8 years (range 18–53 years) were included in the study. IPFP was caused by traffic accidents in five cases and falls in six cases. All cases had unilateral closed injuries, including four injuries to the left knee and seven to the right knee. The preoperative range of motion of the knee was 22.0 ± 7.5° (10–30°). The time from injury to operation was 4.5 ± 1.3 d (3–7 d).\nThe same surgical team performed all the surgeries in this study. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of the 920 Hospital of Chinese People’s Liberation Army Joint Logistics Support Force. We obtained informed consent from all subjects and/or their legal guardian(s).", "The tension-free external immobilization device was mainly composed of Kirschner wire, threaded needle, external immobilization ring (including and 1/2 ring and a 2/3 ring), threaded rod, plain bolt, needle-passing bolt, threaded needle pad, joint hinge, and vertical linker (Fig. 1).\nAfter general anesthesia in the supine position, routine disinfection, and draping, a sterile tourniquet was put on the root of the thigh on the affected side and inflated. An anterior median longitudinal incision of the patella was made to expose the IPFP end (Fig. 1A). The fracture ends were handled under direct vision. If the avulsion fracture blocks were large, fracture immobilization and reduction were performed using olive-tipped needles or Kirschner wires with a blocking head. One-gauge absorbable sutures were used for suture immobilization (Fig. 1B). Two 1.5-mm Kirschner wires were cross-inserted percutaneously in the vertical direction of the waist segment of the patella, and the Kirschner wires and the 1/2 ring were fixed with needle-passing bolts (Fig. 1C). One 2.0-mm Kirschner wire was inserted below the tibial tubercle horizontally through the tibia, one 4.0-mm threaded needle was inserted vertically in front of the tibia on this plane, and the Kirschner wire, threaded needle, and 2/3 ring were connected and fixed with needle-passing bolts and threaded needle pads. One 4.0-mm threaded needle was inserted vertically in front of the tibia about 12 cm away from the distal end of the 2/3 ring, and the two 2/3 rings were bridged and fixed with threaded needles, needle-passing bolts, and threaded needle pads (Fig. 1D). Then the devices at both ends of the fracture were connected using the joint hinge, and the joint hinge was adjusted to allow for the good knee motion and no tension of the suture at the fracture end (Fig. 1E). Finally, the tourniquet was loosened, the incision was washed, the bleeding was stopped, and the surgical incision was closed.", "Within 24 h after surgery, we gave antibiotics to prevent infection and nonsteroidal anti-inflammatory drugs to control pain. The knee could be passively moved on the bed after surgery. The patients were encouraged to actively move the knee 1 d after surgery, they strengthened the knee function and walked on crutches with partial weight at 2 d, and they walked with no crutches at full weight at 1 week.\nThe anteroposterior and lateral X-rays of the knee on the affected side were reviewed within 3 d after surgery first, once a month until fracture healing and removal of external immobilization devices, and then once every 6 months. The operation duration, intraoperative blood loss, length of hospital stay, and surgical complications were recorded, and the fracture healing time, removal time of external immobilization device, and postoperative complications were recorded during the follow-up. Before surgery, 1 month after surgery, and at the last follow-up, the range of motion of the knee was measured. At the last follow-up, the range of motion was compared between the affected knee and unaffected knee, and the function of the affected knee was assessed by the Böstman score.", "SPSS 24.0 software (SPSS, USA) was used for analysis. Measurement data are expressed as (\\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$$\\overline {\\text{x}}$$\\end{document}x¯ ± s). The range of motion of the knee was compared at different time points through the paired t-test. The test level was set as α = 0.05.", "All operations were successful. The operation time was 56.4 ± 8.4 min (45–70 min), the intraoperative blood loss was (54.1 ± 14.6) mL (40–80 mL), and the length of hospital stay was 7.5 ± 1.9 d (5–11 d). Redness and swelling occurred in the needle tract in three cases during the postoperative frame-carrying period, and it was handled by dressing changes and wet dressing with alcohol. Good needle tract healing was achieved within 1 week after removal of the external immobilization frame. The patients were followed up for 20.4 ± 7.6 months (12–36 months) and had fracture healing after 8.9 ± 1.5 weeks (7–12 weeks). The external immobilization device was removed at 10.4 ± 0.9 weeks (9–12 weeks).\nThe range of motion of the knee was greatly improved at 1 month after surgery [88.6 ± 11.4° (70–105°)] compared with before surgery [22.0 ± 7.5° (10–30°)] (t = 16.187, p < 0.05). At the last follow-up, the range of motion of the knee [129.7 ± 3.3° (125–135°)] was further improved compared with that at 1 month after surgery (t = 11.474, p < 0.05) and had no significant difference from that on the unaffected side [130.8 ± 3.8° (126–137°)] (t = 0.718, p < 0.05). At the last follow-up, the Böstman score of the knee was 29.2 ± 1.0 points (27–30 points), including 10 excellent cases (90.9%) and one good case (9.1%). During the follow-up period, no complications, such as loss of fracture reduction, internal immobilization failure, or joint stiffness, occurred (Fig. 2).", "IPFP has small and severely comminuted fracture blocks that are hard to immobilize. No consensus has been reached on the treatment of IPFP, and there are pros and cons for each treatment method reported in the literature [13]. Most treatments entail resection or reduction of fracture blocks. Most scholars believe that reduction of fracture blocks can restore the normal anatomical structure of the patella to the greatest extent, while resection of fracture blocks will result in patellar defect, patellofemoral joint dislocation, high tension of the patellar tendon, and difficulty with tendon-bone healing [4]. Fracture blocks are preserved and reduced mostly by internal immobilization using steel plates, steel wires, and sutures. Patellar concentrators are a commonly used immobilization device in the clinic that can concentrically gather the displaced patellar fracture blocks [6], but they are less effective in the immobilization of smaller IPFPs. Basket plates can effectively gather the fracture blocks and restore the knee extension function [5, 14], but they cause great damage to the structure and function of the patellar ligament, such as shortening of the patellar ligament, destruction of blood supply of the patellar ligament, and internal immobilization irritation during knee flexion [14, 15, 16]. Due to dispersed cohesion, traditional steel wire or suture cerclage fails to create synergy in immobilization and causes unstable immobilization, and fracture block separation and rotational displacement occur easily during knee flexion and extension [17]. Postoperative auxiliary plaster immobilization is prone to cause knee stiffness and knee functional limitation. Silk thread or suture anchors can be used to suture the patellar fracture blocks, but they fail to provide enough strength for early functional exercise [18]. Tension bands with Kirschner wires or cannulated screws can effectively immobilize the fracture blocks and antagonize the tension of anterior patellar ligament, facilitating postoperative early functional exercise and yielding good prognoses [19]. However, they behave poorly in the immobilization of IPFP and are prone to loosening after surgery, leading to internal immobilization failure [19, 20]. At present, rigid immobilization with early functional exercise following IPFP reduction remains a difficulty [21, 22].\nIn view of the difficulty treating IPFP and the limitations of the above surgical methods, we put forward a new treatment method tension-free external immobilization. The external immobilization device includes a patellar immobilization part and a tibial immobilization part, as well as a joint hinge connecting the two parts. This method can achieve the stable immobilization in 3D space, and the sutured fracture end can be in a tension-free state (by adjusting the joint hinge during surgery) while ensuring the good range of motion of the knee. In this study, good fracture healing was achieved in all 11 patients after tension-free external immobilization. Redness and swelling occurred in the needle tract in three cases during the postoperative frame-carrying period, and it was healed by symptomatic treatment within 1 week after removal of the external immobilization frame. No other surgical complications occurred. At the last follow-up, the Böstman score of the knee was 29.2 ± 1.0 points, including 10 excellent cases and one good case, suggesting satisfactory clinical efficacy.\nAs can be seen from the technical characteristics, the advantages of the tension-free external immobilization are as follows: (1) Tension-free immobilization. With the upper end fixed at the waist segment of the patella and the lower end fixed at the upper segment of the tibia, the fracture end can be reduced and immobilized in a tension-free state. By adjusting the joint hinge, the knee motion of the fracture end can be kept in a tension-free state, thereby avoiding fracture displacement or loss of immobilization due to high tension. (2) Early functional exercise. The external immobilization device achieves overall stability through 3D-space immobilization. Since there is no tension at the fracture end, the patient can move the knee on the bed immediately after surgery, then ambulate with a walker or crutches the day after surgery, avoiding immobilization-related complications and joint stiffness. (3) Small surgical trauma. No excessive periostea or soft tissues are stripped off during open reduction, and the Kirschner wires used to immobilize the patella are thin and far away from the fracture end, so fracture healing can be facilitated to the greatest extent. (4) Easy removal of the external immobilization device. The external immobilization device can be completely removed in the outpatient clinic after fracture healing. First, the external immobilization ring and the threaded needle are removed, one end of the Kirschner wire is cut off and sterilized, and then the wire is withdrawn through the other end, avoiding re-operation under anesthesia.\nPrecautions for surgery: (1) When the fracture end is cut and exposed, no excessive periostea and soft tissues can be stripped off. The fracture end is sutured in a tension-free state and in a knee-extension position. If the avulsion fracture blocks are large, the fracture immobilization and reduction can be performed using olive-tipped needles or Kirschner wires with a blocking head. The wire can be fixed with the patellar 1/2 ring using the vertical linker. (2) To immobilize the patellar end, the waist segment of the patella is most often selected because it is the most “hypertrophic” part of the patella. Two Kirschner wires are cross-inserted percutaneously on the cross-section of the waist, in a medial upper-lateral lower and lateral upper-medial lower direction, respectively. The two Kirschner wires should be on the same cross-section and not damage the articular surface, and the skin at the entry point should be free of tension. (3) To immobilize the tibial end, one 2.0-mm Kirschner wire is usually inserted horizontally below the tibial tubercle, and one threaded needle is inserted vertically in front of the tibia on this plane to fix the 1/2 ring. This plane is more conducive to the installation of the joint hinge. (4) When installing the joint hinge, make the knee joint of the patient in the straight position, and install the joint hinge on the lower sides of the patella at the height of the middle axial plane of the patella. During the operation, appropriate adjustments should be made according to the movement of the knee joint to ensure that the movement of the knee joint is consistent with that of the hinge and that the fracture end is in a tension-free state.\nIn conclusion, tension-free external immobilization is a safe and feasible surgical treatment method for IPFP, and it can benefit the early functional exercise with a satisfactory clinical effect. Even so, there are some deficiencies in this technique. For example, the external immobilization device can bring inconvenience to the patient’s life, especially in winter. Skin pinholes increase the risk of infection. Although the tension-free state can enhance the patellar fracture healing, the tension of the proximal patellar tendon may be increased. The sample of this study was small, and there may be a certain bias in the assessment of clinical efficacy, so larger studies are needed.\n\nFig. 1Procedures of tension-free external immobilization. A An anterior median incision of the patella was made to expose the fracture end. B The fracture end was sutured in a knee-extension position. C Kirschner wires were cross-inserted in the vertical direction of the waist segment of the patella and fixed with the 1/2 ring. D The two 2/3 rings were bridged and fixed with Kirschner wires and threaded needles on the plane of tibial tubercle and two distal planes. E The devices at the patellar end and the tibial end were connected and fixed using the joint hinge, and the joint motion and tension-free state of the fracture end were maintained\nProcedures of tension-free external immobilization. A An anterior median incision of the patella was made to expose the fracture end. B The fracture end was sutured in a knee-extension position. C Kirschner wires were cross-inserted in the vertical direction of the waist segment of the patella and fixed with the 1/2 ring. D The two 2/3 rings were bridged and fixed with Kirschner wires and threaded needles on the plane of tibial tubercle and two distal planes. E The devices at the patellar end and the tibial end were connected and fixed using the joint hinge, and the joint motion and tension-free state of the fracture end were maintained\n\nFig. 2 A 18-year-old male patient with right IPFP due to a fall. A Anteroposterior and lateral X-rays of the right knee before surgery. B After avulsion fracture reduction, the fracture block was immobilized using Kirschner wires with a blocking head, and 1-gauge absorbable sutures were used for suture immobilization. C Postoperative tension-free external immobilization device. D Anteroposterior and lateral X-rays of the right knee after surgery. E Postoperative frame-carrying conditions. F The knee function was good after removal of the external immobilization frame. G Anteroposterior and lateral X-rays of the right knee after removal of the external immobilization frame\n A 18-year-old male patient with right IPFP due to a fall. A Anteroposterior and lateral X-rays of the right knee before surgery. B After avulsion fracture reduction, the fracture block was immobilized using Kirschner wires with a blocking head, and 1-gauge absorbable sutures were used for suture immobilization. C Postoperative tension-free external immobilization device. D Anteroposterior and lateral X-rays of the right knee after surgery. E Postoperative frame-carrying conditions. F The knee function was good after removal of the external immobilization frame. G Anteroposterior and lateral X-rays of the right knee after removal of the external immobilization frame" ]

[ "introduction", "materials|methods", null, null, null, null, "results", "discussion" ]

[ "External immobilization", "Inferior pole fracture of patella", "Knee" ]

[ 260, 399, 226, 87 ]

[ "fracture", "knee", "immobilization", "needle", "end", "external immobilization", "external", "surgery", "threaded", "tension" ]

[ "articular fracture patellar", "inferior patellar pole", "pole resection patellar", "enhance patellar fracture", "patellar fractures ipfp" ]

[ "Aged", "Biomarkers", "Female", "Hospital Mortality", "Humans", "Male", "Middle Aged", "Plasminogen Activator Inhibitor 1", "Prognosis", "Receptors, Urokinase Plasminogen Activator", "Respiratory Rate", "Sepsis" ]

[ "Aim of the study", "Patient and methods", "Patients with sepsis were diagnosed based on both of the following criteria", "All subjects were selected according to inclusion and exclusion criteria", "Inclusion criteria", "Exclusion criteria", "Methods", "Statistical analysis", "The sample size calculation", "Limitations" ]

[ "This study aimed to identify the blood level of plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR) in sepsis and its association with mortality.", "This is an observational prospective study that included 60 adult patients with sepsis admitted to Menoufia and Zagazig university hospitals during the period from December 2019 till October 2020.\nAll participants were volunteers, and all of them signed written informed consent with explaining the aim of this study before the study initiation.\nApproval of the study protocol was obtained by the local Ethical Scientific Committee of Menoufia University’s institutional review board under number (MNF112/2019).\nPatients with sepsis were diagnosed based on both of the following criteria Patients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n\nPatients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n", "Patients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n", "Inclusion criteria Adult patients with sepsis, both sexes, and age more than 30 years.\nAdult patients with sepsis, both sexes, and age more than 30 years.\nExclusion criteria Pregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nPregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nMethods 3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n\n3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n", "Adult patients with sepsis, both sexes, and age more than 30 years.", "Pregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).", "3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n", "Method of calculation and justification for sample size", "Sample size was calculated using G*power version 3.1.9.2 based on previous studies and our experience, we expected to find large effect size (d = 0.8) between group I/group II. With a power of 80% (using t-test and alpha of 0.05). The allocation ratio N2/N1 is 2/1. The sample needed for the study was estimated to be 48 patients taking in our consideration 25% drop off. Finally, the \ntotal sample size\n was estimated \n60 patients\n (\n40 patients for group I, 20 patients for group II\n).\n10\n\nN = 60 patients.\nConfidence interval = 95%\nAlpha = 0.05\nPower = 80%\nThe clinical data were recorded on a report form. These data were tabulated and analyzed using the computer program SPSS (Statistical package for social science) version 21((SPSS Inc, Chicago, IL, USA). The variables were tested using Chi-Squared (χ2) test for qualitative data, Mann Whitney U test for testing quantitative data, correlation coefficient test (Pearson test), multivariate logistic regression analysis, and the ROC (receiver operating characteristic) curves to detect validity of different markers for prediction of early hospital mortality. When p value was less than 0.05, it was considered significant.", "One limitation of this study is the limited number of patients as a developing country we have not simply had a registry for all patients and due to environmental and cultural reasons, many critically ill patients from old age not seeking hospital consultation.\nAnother limitation is the PAI-1 and SuPAR serum levels had been studied a lot in critically ill patients and not a novel hypothesis but to our knowledge, it is the first Egyptian study to elicit its level with early mortality of sepsis and we consider it a trial to use these markers as prognostic predictors not only a diagnostic." ]

[ null, null, null, null, null, null, null, null, null, null ]

[ "Introduction", "Aim of the study", "Patient and methods", "Patients with sepsis were diagnosed based on both of the following criteria", "All subjects were selected according to inclusion and exclusion criteria", "Inclusion criteria", "Exclusion criteria", "Methods", "Statistical analysis", "The sample size calculation", "Results", "Discussion", "Limitations", "Conclusion" ]

[ "In 1992, sepsis was defined as a systemic inflammatory response syndrome (SIRS) to infection that results from an activation of the innate immune response, regardless of the cause.\n1\n Sepsis has been redefined again as life-threatening organ dysfunction caused by dysregulated host responses to infection and septic shock as a subset of sepsis in which particularly profound circulatory, cellular, and metabolic abnormalities are associated with a greater risk of mortality than with sepsis alone.\n2\n Globally, sepsis is common, with an estimated population incidence of 270 cases per-100,000 person yearly and acute mortality of 26.0%. Many reasons suggest even this underestimate the magnitude of sepsis-associated mortality and morbidity.\n3\n\nThe biomarkers of sepsis can be classified as markers of acute-phase protein (C-reactive protein [CRP], procalcitonin [PCT], and lipopolysaccharide-binding protein), cytokine/chemokine biomarkers (IL-6, IL-8), and markers of other pathophysiologic processes (coagulation factors and soluble cell surface receptors). Also, complement factors (C3a, C5a, and the soluble form of the C5a receptor, sC5aR) have been defined as early markers of sepsis and sepsis severity. CRP and PCT are the most practically used for the detection of bloodstream infections.\n4\n\nPlasminogen activator inhibitor-1(PAI-1) is a protein that in humans is encoded by the SERPINE 1 gene, elevated PAI-1 is a risk factor for thrombosis and atherosclerosis.\n5\n Soluble urokinase plasminogen activator receptor (SuPAR) is a soluble protein form; SuPAR concentration positively correlates to the activation level of the immune system and is present in plasma, urine, blood, serum, and CSF. SuPAR is an indicator of disease severity and aggressiveness.\n6\n The use of plasma suPAR level enhanced the efficiency of sepsis diagnosis, and the combination of plasma suPAR and APACHE II score improved mortality prediction.\n7\n Studying long-term outcomes of sepsis is that poor functional status is a risk factor for becoming critically ill as well as a frequent consequence. Many co-morbidities, age, and chronic diseases are risk factors both for sepsis and for impaired quality of life. Therefore, studies work to distinguish between the potentially causal effects of sepsis and that simply describe morbidity and mortality events.\n8\n\nAim of the study This study aimed to identify the blood level of plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR) in sepsis and its association with mortality.\nThis study aimed to identify the blood level of plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR) in sepsis and its association with mortality.\nPatient and methods This is an observational prospective study that included 60 adult patients with sepsis admitted to Menoufia and Zagazig university hospitals during the period from December 2019 till October 2020.\nAll participants were volunteers, and all of them signed written informed consent with explaining the aim of this study before the study initiation.\nApproval of the study protocol was obtained by the local Ethical Scientific Committee of Menoufia University’s institutional review board under number (MNF112/2019).\nPatients with sepsis were diagnosed based on both of the following criteria Patients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n\nPatients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n\nThis is an observational prospective study that included 60 adult patients with sepsis admitted to Menoufia and Zagazig university hospitals during the period from December 2019 till October 2020.\nAll participants were volunteers, and all of them signed written informed consent with explaining the aim of this study before the study initiation.\nApproval of the study protocol was obtained by the local Ethical Scientific Committee of Menoufia University’s institutional review board under number (MNF112/2019).\nPatients with sepsis were diagnosed based on both of the following criteria Patients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n\nPatients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n\nAll subjects were selected according to inclusion and exclusion criteria Inclusion criteria Adult patients with sepsis, both sexes, and age more than 30 years.\nAdult patients with sepsis, both sexes, and age more than 30 years.\nExclusion criteria Pregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nPregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nMethods 3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n\n3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n\nInclusion criteria Adult patients with sepsis, both sexes, and age more than 30 years.\nAdult patients with sepsis, both sexes, and age more than 30 years.\nExclusion criteria Pregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nPregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nMethods 3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n\n3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n\nStatistical analysis Method of calculation and justification for sample size\nMethod of calculation and justification for sample size\nThe sample size calculation Sample size was calculated using G*power version 3.1.9.2 based on previous studies and our experience, we expected to find large effect size (d = 0.8) between group I/group II. With a power of 80% (using t-test and alpha of 0.05). The allocation ratio N2/N1 is 2/1. The sample needed for the study was estimated to be 48 patients taking in our consideration 25% drop off. Finally, the \ntotal sample size\n was estimated \n60 patients\n (\n40 patients for group I, 20 patients for group II\n).\n10\n\nN = 60 patients.\nConfidence interval = 95%\nAlpha = 0.05\nPower = 80%\nThe clinical data were recorded on a report form. These data were tabulated and analyzed using the computer program SPSS (Statistical package for social science) version 21((SPSS Inc, Chicago, IL, USA). The variables were tested using Chi-Squared (χ2) test for qualitative data, Mann Whitney U test for testing quantitative data, correlation coefficient test (Pearson test), multivariate logistic regression analysis, and the ROC (receiver operating characteristic) curves to detect validity of different markers for prediction of early hospital mortality. When p value was less than 0.05, it was considered significant.\nSample size was calculated using G*power version 3.1.9.2 based on previous studies and our experience, we expected to find large effect size (d = 0.8) between group I/group II. With a power of 80% (using t-test and alpha of 0.05). The allocation ratio N2/N1 is 2/1. The sample needed for the study was estimated to be 48 patients taking in our consideration 25% drop off. Finally, the \ntotal sample size\n was estimated \n60 patients\n (\n40 patients for group I, 20 patients for group II\n).\n10\n\nN = 60 patients.\nConfidence interval = 95%\nAlpha = 0.05\nPower = 80%\nThe clinical data were recorded on a report form. These data were tabulated and analyzed using the computer program SPSS (Statistical package for social science) version 21((SPSS Inc, Chicago, IL, USA). The variables were tested using Chi-Squared (χ2) test for qualitative data, Mann Whitney U test for testing quantitative data, correlation coefficient test (Pearson test), multivariate logistic regression analysis, and the ROC (receiver operating characteristic) curves to detect validity of different markers for prediction of early hospital mortality. When p value was less than 0.05, it was considered significant.", "This study aimed to identify the blood level of plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR) in sepsis and its association with mortality.", "This is an observational prospective study that included 60 adult patients with sepsis admitted to Menoufia and Zagazig university hospitals during the period from December 2019 till October 2020.\nAll participants were volunteers, and all of them signed written informed consent with explaining the aim of this study before the study initiation.\nApproval of the study protocol was obtained by the local Ethical Scientific Committee of Menoufia University’s institutional review board under number (MNF112/2019).\nPatients with sepsis were diagnosed based on both of the following criteria Patients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n\nPatients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n", "Patients with suspected infection (thorough history taking with clinical status, routine laboratory tests, blood or urine cultures if possible, and radiological images as by (pelvi-abdominal ultrasound, plain chest X-ray, and CT or MRI if possible) who are likely to have a prolonged ICU stay or to die in the hospital identified SOFA score.\n2\n", "Inclusion criteria Adult patients with sepsis, both sexes, and age more than 30 years.\nAdult patients with sepsis, both sexes, and age more than 30 years.\nExclusion criteria Pregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nPregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).\nMethods 3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n\n3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n", "Adult patients with sepsis, both sexes, and age more than 30 years.", "Pregnant women, cardiac patients, and chronic renal disease.\nFor all subjects, the following procedures were performed: personal history, past history, present history, and family history. Also, thorough clinical examination: complete general and local examination. In addition, laboratory examination including: Complete blood picture, Kidney functions, and Liver function test.\nSpecific investigations including: Plasminogen activator inhibitor-1 (PAI-1) and soluble urokinase plasminogen activator receptor (SuPAR).", "3 mL of blood were collected from all patients and a small quantity of plasma (0.2 mL) was isolated within 30 min and stored at −80°C for measurement of SuPAR and PAI-1 levels. Human PAI-1 ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 156 pg/ml-10,000 pg/mL and sensitivity < 10 pg/mL.\n9\n. Human SuPAR ELISA Kit (Chongqing Biospes Co, Ltd, China) with a range of 30 pg/mL—360 pg/mL and Sensitivity of 3 pg/mL.\n9\n", "Method of calculation and justification for sample size", "Sample size was calculated using G*power version 3.1.9.2 based on previous studies and our experience, we expected to find large effect size (d = 0.8) between group I/group II. With a power of 80% (using t-test and alpha of 0.05). The allocation ratio N2/N1 is 2/1. The sample needed for the study was estimated to be 48 patients taking in our consideration 25% drop off. Finally, the \ntotal sample size\n was estimated \n60 patients\n (\n40 patients for group I, 20 patients for group II\n).\n10\n\nN = 60 patients.\nConfidence interval = 95%\nAlpha = 0.05\nPower = 80%\nThe clinical data were recorded on a report form. These data were tabulated and analyzed using the computer program SPSS (Statistical package for social science) version 21((SPSS Inc, Chicago, IL, USA). The variables were tested using Chi-Squared (χ2) test for qualitative data, Mann Whitney U test for testing quantitative data, correlation coefficient test (Pearson test), multivariate logistic regression analysis, and the ROC (receiver operating characteristic) curves to detect validity of different markers for prediction of early hospital mortality. When p value was less than 0.05, it was considered significant.", "The mean age of the included patients was 62.1±10.7 years with 51.7% of them were females. Diabetes mellitus was reported in 30.0% of the included patients. The pulmonary primary site of infection was found in 56.7%. Also, the mean BMI of the studied patients was 24.9 ± 2.9 Kg/m2. The mean CRP, hemoglobin, and WBCs count were (105.8 ± 70.7, 10.3 ± 0.6, and 17.32 ± 9.6) respectively. The mean creatinine and urea levels were 3.4 ± 2.3 and 158.3 ± 124.9, respectively. Additionally, mean AST, ALT, PT, PAI-1, and SuPAR were 65.7 ± 32.4, 62.4 ± 24.5, 13.6 ± 7.9, 74.9± 6 1.3, and 11.3 ± 5.7, respectively, as shown in Table 1.Table 1.Baseline characteristics of studied patients (n=60).ItemPatients (n = 60)N%Sex: no, %MaleFemale293148.351.7Mean ± SDMin-MaxAge/Years64.90 ± 7.4030–74BMI (kg/m2)24.91 ± 2.9221–34No%Comorbidities:Diabetes mellitusHypertension181430.023.3Primary site of infection:PulmonaryCutaneousDigestiveUrinaryArticular3411104156.718.316.76.71.7Mean ± SDMin-MaxVital signs:MABP (mmhg)HR (beats/minutes)Temp. (oC)RR (cycles/minutes)79.1 ± 5.5107.5 ± 8.537.3 ± 1.422.3 ± 2.667–9895–12027.8–38.419–28SOFA score7.2 ± 2.254–12CRP (mg/L)105.8 ± 70.72–454Hemoglobin (g/dl)10.3 ± 0.69.3–11.5WBCs (*103)/ml17.3 ± 9.62.8–43.8Creatinine (mg/dl)3.42 ± 2.300.2–8.5Urea (mg/dl)158.30 ± 124.938.3–434AST (u/l)65.72 ± 32.3828–239ALT (u/l)62.37 ± 24.4635–186PT (second)13.60 ± 1.2912–16PAI-1 (pg/ml)80.75 ± 61.8626–412SuPAR (pg/ml)11.29 ± 5.843.2–45MABP: Mean arterial blood pressure is defined as the average pressure in the patients arteries during one cardiac cycle, MABP= SBP + 2 (DBP)/3; HR: heart rate; Temp.: temperature; RR: respiratory rate.\nBaseline characteristics of studied patients (n=60).\nMABP: Mean arterial blood pressure is defined as the average pressure in the patients arteries during one cardiac cycle, MABP= SBP + 2 (DBP)/3; HR: heart rate; Temp.: temperature; RR: respiratory rate.\nRespirator rate, SuPAR, PAI-1, and SOFA score were significantly higher among the non-survivor group than the survivor one (p < 0.05), all other variables were insignificant between the two groups as shown in Table 2.Table 2.Comparison between survivors and non-survivors regarding baseline characteristics.VariableSurvivors (n = 49)Non - survivors (n = 11)U Testp ValueMean ± SDMean ± SDAge/year64.24 ± 7.8167.81 ± 4.311.570.12N%N%SexMaleFemale252451.049.04736.463.6X20.770.38BMI (kg/m2)25.03 ± 3.1424.37 ± 1.660.260.80Blood pressure78.97 ± 5.8279.63 ± 3.960.490.63Heart rate106.73 ± 8.42110.64 ± 8.421.400.16Respiratory rate21.90 ± 2.4623.91 ± 2.882.190.03*Temperature37.29 ± 1.4837.49 ± 0.510.050.96SOFA score6.49 ± 1.7210.36 ± 1.504.66<0.001*CRP (mg/L)103.39 ± 73.47116.64 ± 58.420.340.35HB (g/dl)10.33 ± 0.5510.18 ± 0.760.720.47WBCs (*103)/ml17.22 ± 10.3917.74 ± 4.860.720.47Creatinine (mg/dl)3.49 ± 2.473.14 ± 1.320.170.86Urea (mg/dl)159.64 ± 135.82152.35 ± 59.110.650.52AST (U/L)65.94 ± 35.0864.73 ± 16.710.600.55ALT (U/L)62.57 ± 26.6461.45 ± 11.070.590.55PT (second)13.47 ± 1.2614.18 ± 1.331.660.10SuPAR (pg/ml)9.60 ± 3.1318.8 ± 8.854.950.001*PAI-1 (pg/ml)59.55 ± 28.98175.18 ± 80.844.98<0.001*U = Mann Whitney U test, (*) significant.BMI: body mass index; CRP: C-reactive protein; HB: hemoglobin; WBC: white blood cells; AST: Aspartate transaminase; ALT: Alanine transaminase; PT: prothrombin time; PAI-1: Plasminogen activator inhibitor-1; SuPAR: Soluble urokinase plasminogen activator receptor.\nComparison between survivors and non-survivors regarding baseline characteristics.\nU = Mann Whitney U test, (*) significant.\nBMI: body mass index; CRP: C-reactive protein; HB: hemoglobin; WBC: white blood cells; AST: Aspartate transaminase; ALT: Alanine transaminase; PT: prothrombin time; PAI-1: Plasminogen activator inhibitor-1; SuPAR: Soluble urokinase plasminogen activator receptor.\nThe SOFA score had a sensitivity of 90.9%, specificity of 87.8%, and accuracy of 0.90 at a cutoff value of ≥8.5 for predicting mortality (Figure 1). suPAR had a sensitivity of 100%, specificity of 95.9%, and accuracy of 0.94 at a cutoff value of ≥13.4 for predicting mortality (Figure 2). Finally, PAI-1 had a sensitivity of 100%, specificity of 93.9%, and accuracy of 0.95 at a cutoff value of ≥122.5 for predicting mortality (Figure 3), as shown in Table 3.Figure 1.ROC curve analysis of SOFA score for prediction of mortality.Figure 2.ROC curve analysis of suPAR for prediction of mortality.Figure 3.ROC curve analysis of PAI-1 for prediction of mortality.Table 3.Cutoff levels of SOFA score, SuPAR, and PAI-1 for predicting early sepsis mortality/7 days.VariableAUCCutoff value95% CISensitivity, %Specificity, %PPV, %NPV, %Accuracy, %SOFA score0.947≥8.50.89–1.090.987.862.597.788.3SuPAR (pg/ml)0.981≥13.40.94–1.010095.984.610094PAI-1 (pg/ml)0.983≥122.50.95–1.010093.978.610095Sens: sensitivity; Spec.: specificity; PPV: positive predictive value; NPV: negative predictive value.\nROC curve analysis of SOFA score for prediction of mortality.\nROC curve analysis of suPAR for prediction of mortality.\nROC curve analysis of PAI-1 for prediction of mortality.\nCutoff levels of SOFA score, SuPAR, and PAI-1 for predicting early sepsis mortality/7 days.\nSens: sensitivity; Spec.: specificity; PPV: positive predictive value; NPV: negative predictive value.\nThe correlation coefficient between PAI-1 and other parameters, as shown in Table 4. There was a significant correlation according to PT (as shown also in Figure 4) and also there were significant positive correlations between PAI-1 and each of SOFA score and SuPAR level (as shown in Figure 5). Other parameters’ correlations to PAI-1 were insignificant.Table 4.Pearson’s correlation coefficient between PAI-1, SuPAR, and other parameters.VariablePAI-1 (pg/ml)suPAR (pg/ml)(r)\np value\n(r)\np value\nAge/year0.0040.970−0.0860.417BMI (kg/m2)0.1400.1840.0510.630CRP (mg/L)0.1910.070−0.0330.756Hemoglobin (g/dl)0.01230.246−0.1710.104WBCs (103)/ml\na\n0.0740.4860.0220.836Creatinine (mg/dl)−0.1450.169−0.0050.959Urea (mg/dl)−0.0630.5520.0470.655AST (U/L)0.0010.992−0.0610.564ALT (UL)0.1370.194−0.0310.771PT (second)0.3460.001\na\n0.483<0.001\na\nSOFA score0.400<0.001\na\n0.389<0.001\na\nSuPAR (pg/ml)0.3270.002\na\n------PAI-1 (pg/ml)--------0.3270.002\na\nasignificant.BMI: body mass index CRP: C-reactive protein WBC: white blood cells; AST: Aspartate transaminase ALT: Alanine transaminase PT: prothrombin time PAI-1: Plasminogen activator inhibitor-1 SuPAR: Soluble urokinase plasminogen activator receptor.Figure 4.Correlation between PAI-1 and PT.Figure 5.Correlation between PAI-1and SuPAR.\nPearson’s correlation coefficient between PAI-1, SuPAR, and other parameters.\nasignificant.\nBMI: body mass index CRP: C-reactive protein WBC: white blood cells; AST: Aspartate transaminase ALT: Alanine transaminase PT: prothrombin time PAI-1: Plasminogen activator inhibitor-1 SuPAR: Soluble urokinase plasminogen activator receptor.\nCorrelation between PAI-1 and PT.\nCorrelation between PAI-1and SuPAR.\nSuPAR level had a significant correlation with each of PT (Figure 6) and SOFA score. Other parameters’ correlations to SuPAR were insignificant, as shown in Table 4.Figure 6.Correlation between SuPAR and PT.\nCorrelation between SuPAR and PT.\nFinally Table 5 shows the logistic regression for risk, and from that table PAI-1 and SuPAR blood levels had a significant statistical prediction for early sepsis mortality/7 days.Table 5.Logistic regression analysis for independent risk of early sepsis mortality/7 days.VariableWald X2p ValueOR95% CISOFA score1.120.331.190.67–3.91SuPAR (pg/ml)2.660.009\na\n2.101.05–12.8PAI-1 (pg/ml)2.30.02\na\n1.920.72–8.68asignificant.PAI-1: Plasminogen activator inhibitor-1; SuPAR: Soluble urokinase plasminogen activator receptor.\nLogistic regression analysis for independent risk of early sepsis mortality/7 days.\nasignificant.\nPAI-1: Plasminogen activator inhibitor-1; SuPAR: Soluble urokinase plasminogen activator receptor.", "Plasminogen activator inhibitor type 1 (PAI-1) is a 50-kDa glycoprotein of the serine protease inhibitor family. The primary role of PAI-1 in vivo is the inhibition of both tissue- and urokinase-type plasminogen activators. In addition to this function, PAI-1 acts as an acute-phase protein during acute inflammation. PAI1 is a pivotal player in the pathogenesis of sepsis, a complex clinical syndrome that results from a systemic inflammatory response.\n11\n\nThe present study showed the mean age of the included patients was 62.1 ± 1 0.7 years and this agreed with the study by Mohamed et al.,\n12\n who found (71.25%) of patients were males and (28.75%) were females. Maximum patients had belonged to the age group of 50–80 years of age. The mean age of the study population by Ref. 12 was 60.97 years. The study by Kim et al.,\n13\n found the mean SOFA score was 8.0 ± 2.8. In addition, mean MPV was 8.64 fL at baseline and 8.96 fL at 72 h after ED admission. The main infection sites were the urinary tract (25.2%) and lung (24.1%) followed by the intra-abdominal cavity (22.0%). But, we found the pulmonary primary site of infection was in 56.7%, followed by the cutaneous site in 18.3%, and while the digestive site was reported in 16.7%. The mean BMI of the studied patients was 24.9 ± 2.9 Kg/m2.\nMohamed and his colleagues\n12\n found that type 2 diabetes mellitus and systemic hypertension were the major comorbidities present in the study population, both being present in 37 patients each (46.25%). Respiratory comorbidities, chronic liver, and kidney diseases along with heart diseases were also present in a significant number of patients. Fever was the most common presenting feature (72.50%) followed by breathlessness (43.75%), cough (32.50%), abdominal, and neurologic symptoms. Based on the presenting symptoms and clinical examination findings, the majority of the patients (66.25%) had respiratory tract as the suspected source of sepsis. For us, we had found diabetes mellitus was 30.0% of the included patients while 23.3% of them had hypertension.\nAccording to the inflammatory labs’ assessment (mean CRP, hemoglobin, and WBCs count), mean creatinine and urea levels, mean AST, ALT, and PT showed that we are similar also to Mohamed et al.,\n12\n who found that, 67.5% mortality among the patients with severe sepsis. Low platelet count, high CRP, and elevated levels of serum lactate along with need for invasive mechanical ventilation were found to be a clear predictor of mortality in severely septic patients. SOFA score of more than 8.5, at the time of admission to the ICU. Also, with Ghany et al.,\n14\n found that, forty-four (19%) of 232 patients with baseline AST/ALT ratio >0.8 experienced clinical decompensation compared to 16 (6.7%) of 238 with baseline AST/ALT ratio ≤0.8. Within each stratum of baseline AST/ALT ratio, patients who had severe worsening (>15% increase between month 24 and baseline) had a higher rate of clinical decompensation.\nOur study showed that respiratory rate, SuPAR, PAI-1, and SOFA score were significantly higher among the non-survivor group than the survivor one. While there was no significant difference between the two groups regarding age, sex, heart rate, temperature, SOFA score, CRP, HB, WBCs, creatinine, urea, AST, ALT, and PT. These results agreed with that reported by Kim et al.,\n13\n as the non-survivors exhibited significantly higher SOFA score than did the survivors. Also according to they there were no significant differences in age, mean arterial pressure, WBC, Hb, serum creatinine, total bilirubin, RBC transfusion, and heparin use between the two groups. Also, Mohamed et al.,\n12\n found that, none of the difference in mean values of liver enzymes, serum bilirubin, serum albumin, and international normalized ratio between the mortality and survivor groups was statistically significant.\nWhile, the current findings disagreed with the study by Li et al.,\n15\n who had found the patients who survived were more likely to have higher baseline levels of hemoglobin and serum albumin and lower breathing rates, lactate levels, platelet (PLT) counts, urea nitrogen, creatinine, eGFR, and cystatin-C (Cys-C) values than the patients who died. Also, Kim et al.,\n13\n revealed that non-survivors exhibited significantly higher C-reactive protein (CRP) and lactate levels than did survivors, whereas body mass index (BMI); platelet count; estimated glomerular filtration rate (eGFR); and albumin, total cholesterol, and pH levels in non-survivors were significantly lower than those in survivors.\nThe current study revealed that the sensitivity of SOFA score for predicting early sepsis mortality was 90.9%, specificity of 87.8%, and accuracy of 0.90 at a cutoff value of ≥8.5. Also, the sensitivity of SuPAR for predicting mortality was 100%, specificity of 95.9%, and accuracy of 0.94 at a cutoff value of ≥13.4. While the sensitivity of PAI.1 was 100%, specificity of 93.9%, and accuracy of 0.95 at a cutoff value of ≥122.5. In this line, two studies by Koch et al.\n16\n\nand Loonen et al.\n17\n evaluated diagnostic accuracy of suPAR have shown specificity from 64–77%. Also, the current findings agreed with the study by López-Izquierdo et al.\n18\n found that for 28-day mortality, the qSOFA presented a cut-off of two points, with a sensitivity of 74.3 and specificity of 73.1. The SOFA score presented a cut-off of three points for 30-day mortality, with a sensitivity of 81.6 and a specificity of 76.5.\nThe current study revealed that, there was a significant positive correlation between SOFA score and each of suPAR and PAI-1. Also, there was a significant positive correlation between SuPAR level with PT, PAI-1. In addition, PAI-1 level significantly positively correlated with PT. This agreed with the study by Jalkanen et al.,\n19\n found that the SuPAR and PAI-1 concentrations were higher in critically ill patients compared to healthy volunteers. SuPAR and PAI-1 concentrations were higher in critically ill patients compared to healthy volunteers. Another study by Silvestre et al.,\n20\n found that, SOFA was independently associated with a higher risk of in-hospital mortality, 28-day mortality and 90-day mortality.\nAs mentioned above our study showed that SuPAR, PAI-1, and SOFA score were significant predictors to hospital mortality. This agreed with the study by Wingeyer et al.,\n21\n found that in total, 76.4% of deaths but only 55.6% of surviving patients could be predicted with a SOFA score greater than 4 at time 0, with a global prediction of 65.4%. However, when they combined a SOFA of ≥ 4 and the presence of the PAI-1, in combination with plasma levels of PAI-1 ≥ 16 (UA/l), the global prediction rose to 71.9%, with a prediction of survival of 74.1% and a prediction of death of 69.4%. Another study by Vincent,\n22\n found that, invasive mechanical ventilation in patients with severe sepsis was identified to be an independent predictor of mortality. Previously, Prabhakaran et al.,\n23\n\nand Sapru et al.,\n24\n reported PAI-1 has been considered valuable in prognostication in patients with ARF. Previous reports indicate that PAI-1 levels are elevated in sepsis and VAP, and predict mortality and MOF.\nOn the other hand, Jalkanen et al.,\n19\n reported that like other biomarkers, suPAR as a single biomarker is not strong enough for clinical decision-making. Also, PAI-1 was a poor prognostic marker for mortality or development of sepsis. The highest quartile of PAI-1 concentrations did not have predictive value for 90-day mortality or association with ALI/ARDS. There was a marked variation in suPAR in the healthy volunteers, Koch et al.,\n16\n found the highest suPAR concentrations in healthy volunteers were lower than the concentrations of patients with an increased risk of poor outcome. PAI-1 levels in healthy volunteers were stable and low. Varied results may be due to different inclusion and exclusion criteria and different study samples.\nLimitations One limitation of this study is the limited number of patients as a developing country we have not simply had a registry for all patients and due to environmental and cultural reasons, many critically ill patients from old age not seeking hospital consultation.\nAnother limitation is the PAI-1 and SuPAR serum levels had been studied a lot in critically ill patients and not a novel hypothesis but to our knowledge, it is the first Egyptian study to elicit its level with early mortality of sepsis and we consider it a trial to use these markers as prognostic predictors not only a diagnostic.\nOne limitation of this study is the limited number of patients as a developing country we have not simply had a registry for all patients and due to environmental and cultural reasons, many critically ill patients from old age not seeking hospital consultation.\nAnother limitation is the PAI-1 and SuPAR serum levels had been studied a lot in critically ill patients and not a novel hypothesis but to our knowledge, it is the first Egyptian study to elicit its level with early mortality of sepsis and we consider it a trial to use these markers as prognostic predictors not only a diagnostic.", "One limitation of this study is the limited number of patients as a developing country we have not simply had a registry for all patients and due to environmental and cultural reasons, many critically ill patients from old age not seeking hospital consultation.\nAnother limitation is the PAI-1 and SuPAR serum levels had been studied a lot in critically ill patients and not a novel hypothesis but to our knowledge, it is the first Egyptian study to elicit its level with early mortality of sepsis and we consider it a trial to use these markers as prognostic predictors not only a diagnostic.", "Our study concluded that SuPAR and PAI-1 both can be used for predicting early mortality. Also, SOFA score, PAI-1, and suPAR were significant predictors of hospital morbidity and mortality. The sample size was relatively small, which may have decreased the statistical power of the results of the present study. Hence, additional studies with large sample sizes are required for further validation of the present results." ]

[ "intro", null, null, null, null, null, null, null, null, null, "results", "discussion", null, "conclusion" ]

[ "plasminogen activator inhibitor-1", "soluble urokinase plasminogen activator receptor", "sepsis" ]

[ 32, 234, 69, 445, 16, 87, 115, 8, 248, 107 ]

[ "patients", "pai", "supar", "ml", "pg ml", "pg", "mortality", "sepsis", "study", "plasminogen" ]

[ "markers sepsis sepsis", "sepsis severity", "sepsis associated mortality", "pathogenesis sepsis complex", "biomarkers sepsis classified" ]

[ "Adolescent", "Adult", "Aged", "Alcohol-Related Disorders", "Antidepressive Agents", "Depressive Disorder, Major", "Depressive Disorder, Treatment-Resistant", "Double-Blind Method", "Excitatory Amino Acid Antagonists", "Family", "Genetic Predisposition to Disease", "Humans", "Kaplan-Meier Estimate", "Ketamine", "Middle Aged", "Riluzole", "Treatment Outcome", "Young Adult" ]

[ "Introduction", "Patient Selection", "Study Design and Medications", "Outcome Measures and Statistical Analyses", "Results", "Discussion" ]

[ "Major depressive disorder (MDD) has one of the highest morbidities worldwide (Kessler et al., 2003; Ustun et al., 2004; Ormel et al., 2008), and, as demonstrated in large real-world effectiveness trials (Rush et al., 2006, 2011), standard antidepressants are effective in only a proportion of patients. Additionally, there is a substantial time lag in response: 2–4 weeks for initial effect and 6–12 weeks for maximal efficacy. Treatment-resistant MDD (TRD) is associated with substantial psychosocial dysfunction, morbidity, and mortality, due in part to suicide and undertreated medical comorbidities. As a result, there is a critical need for better and more rapid-acting antidepressants to quickly alleviate the burden of depression for patients, their families and friends, and society at large.\nThe noncompetitive N-methyl-D-aspartate (NMDA) receptor antagonist ketamine, a US Food and Drug Administration–approved dissociative anesthetic, acted as a rapid-acting antidepressant in several randomized, double-blind, placebo-controlled (Berman et al., 2000; Zarate et al., 2006, 2012; Diazgranados et al., 2010; Valentine et al., 2011; Murrough, Iosifescu, et al., 2013) and open-label (Ibrahim et al., 2012; Murrough, Perez, et al., 2013) studies. Unlike monoaminergic antidepressants, which often require weeks to months to achieve maximal efficacy, a single subanesthetic dose of ketamine has rapid (within hours) and potent (at least one week) antidepressant efficacy. As a result, there have been numerous efforts to maintain ketamine’s antidepressant efficacy beyond this one-week window. In several case reports (Liebrenz et al., 2009; Murrough et al., 2011; Blier et al., 2012) and an open-labeled trial (Murrough, Perez, et al., 2013), repeated-dose ketamine prolonged the initial antidepressant response. However, there are as yet no controlled long-term studies demonstrating that repeated-dose ketamine is safe and tolerable. Based on preliminary antidepressant efficacy in MDD (Sanacora et al., 2004, 2007; Zarate et al., 2004), the glutamatergic modulator riluzole has been investigated as an oral means of prolonging ketamine’s antidepressant response. Mathew et al. (2010) administered double-blind flexible dose (100–200mg/day) riluzole to 17 TRD ketamine responders in a randomized, placebo-controlled, 32-day extension trial. In an interim analysis, riluzole did not delay time to relapse and, as a result, the trial was stopped for futility. Next, our group designed and recently reported a four-week, randomized, double-blind, placebo-controlled riluzole extension trial following open-label subanesthetic dose ketamine infusion in 42 TRD patients (Zarate et al., 2012). In that report, there was also no improvement in depression between riluzole and placebo groups.\nWe have explored demographic and clinical factors to identify subgroups associated with better response in order to maximize ketamine’s antidepressant effects. In both treatment-resistant MDD (Phelps et al., 2009) and bipolar depression (Luckenbaugh et al., 2012), subjects with a family history of alcohol dependence in a first-degree relative had a more robust and sustained antidepressant response to ketamine. Also, in a recent pooled correlative analysis of all our reported ketamine trials at the National Institute of Mental Health, at one week post-infusion, family history of an alcohol use disorder in a first-degree relative was the strongest studied demographic and clinical predictor of ketamine response, alone accounting for up to 22% of the variance in percent change in the 17-item Hamilton Depression Rating Scale (HDRS17) scores (Niciu, Luckenbaugh, et al., 2014). Finally, in an independent sample of 42 patients with treatment-resistant bipolar depression, a family history of alcoholism also correlated with improved antidepressant response to ketamine: 17 of 22 responders vs. 4 of 20 non-responders had a positive family history (Permoda-Osip et al., 2014). And, in two bipolar depression samples (Luckenbaugh et al., 2012; Permoda-Osip et al., 2014) but not in our unipolar depressed sample (Phelps et al., 2009), a lifetime personal history of an alcohol use disorder also predicted improved antidepressant efficacy.\nAfter our initial ketamine riluzole extension trial report (Ibrahim et al., 2012), enrollment continued with the aim of identifying biomarkers and clinical predictors of treatment response. Here, we report the effect of family history of an alcohol use disorder in a first-degree relative over the full 28-day trial, and include 10 additional patients. We hypothesized that improvement in depressive symptoms resulting from a single ketamine infusion would be prolonged beyond one week in subjects with a family history of an alcohol use disorder in a first-degree relative (Family History Positive [FHP]) compared to those without an alcohol use disorder in an immediate relative (Family History Negative [FHN]). We also hypothesized that riluzole would augment and/or extend ketamine’s antidepressant efficacy in FHP but not FHN subjects. Finally, as in our initial report (Phelps et al., 2009), we hypothesized that a lifetime personal history of an alcohol use disorder would not predict ketamine’s antidepressant efficacy in this larger TRD sample.", "All subjects (18–65 years old) had a diagnosis of MDD without psychotic features as assessed by face-to-face evaluation with a licensed independent psychiatric practitioner and Structured Clinical Interview for Axis I DSM-IV Disorders-Patient Version. They were admitted to the Clinical Research Center of the National Institute of Mental Health in Bethesda, Maryland, between January 2006 and September 2013 and had a Montgomery Asberg Depression Rating Scale (MADRS) severity score of ≥22 both at screening and on the day of ketamine infusion (with no greater than a 25% decrease between screening and infusion). Additionally, participants were in a major depressive episode of at least four weeks duration at the time of screening. Treatment resistance was confirmed by prior failure of at least 2 adequate antidepressant trials using a modified version of the antidepressant treatment history form (Sackeim, 2001).\nStable physical health was assessed by medical history, physical examination, standard laboratory measures, electrocardiogram, and urine toxicology. All subjects could not meet criteria for an active substance use disorder (excluding nicotine or caffeine) for at least 3 months prior to enrollment. Comorbid axis I anxiety disorders were permitted if they were not the primary focus of treatment within 12 months prior to screening. Exclusion criteria included serious unstable medical conditions (e.g. uncontrolled asthma or hypertension), previous use of ketamine, riluzole, or phencyclidine, and concomitant treatment with psychotropic medications or electroconvulsive therapy in the 2 weeks prior to infusion (at least 5 weeks for fluoxetine). Female subjects could not be pregnant or nursing and agreed to use approved methods of birth control or complete abstinence during the entirety of the protocol.\nThe written protocol was approved by the Combined Neuroscience Institutional Review Board of the National Institutes of Health (NIH). All subjects provided written informed consent for screening and this specific protocol, and were assigned an independent clinical research advocate to impartially monitor the consent process and ensure ethical research participation.", "As previously described (Ibrahim et al., 2012), this was a double-blind, randomized, parallel-group, placebo-controlled, flexible-dose, inpatient study conducted to determine the antidepressant efficacy of an intravenous ketamine infusion followed by oral riluzole. Following a 2-week drug-free period (5 weeks for fluoxetine), 52 subjects received a single open-label infusion of 0.5mg/kg ketamine hydrochloride over 40 minutes. Four to six hours post-infusion, subjects were randomized to either flexible-dose (100–200mg/day) riluzole or placebo twice daily for 4 weeks. Dose escalations occurred on a weekly basis until the appearance of treatment-limiting side effects or study completion. Dose reductions were permitted by one capsule (50mg/week to a minimum of 100mg/day) in the case of intolerable side effects. Nursing staff monitored medication adherence. No concomitant medications with central nervous system effects were permitted throughout the 4-week trial.", "As in our prior studies (Phelps et al., 2009; Luckenbaugh et al., 2012; Niciu, Luckenbaugh, et al., 2014), family history was assessed pre-infusion with the Family Interview for Genetic Studies. FHP was defined as having at least one first-degree relative with an alcohol use disorder, and, as corollary, FHN was defined as an absence of a first-degree relative with an alcohol use disorder. Subjects were rated with a battery of neuropsychiatric measures at 60 minutes prior to infusion, at several post-infusion time points on infusion day (+40, +80, +120, and +230 minutes) and throughout the following 28 days. The following measures were rated daily: the MADRS (Montgomery and Asberg, 1979), HDRS17 (Hamilton, 1960), the Beck Depression Inventory (Beck and Beamesderfer, 1974), the Scale of Suicide Ideation (Beck et al., 1979), and the Young Mania Rating Scale (YMRS; Young et al., 1978). The Hamilton Anxiety Rating Scale (Hamilton, 1959) was obtained at days 1, 3, 7, 14, 21, and 28. Change in MADRS was primary and the remaining measures were secondary outcomes. All assessments were administered by research nurses, licensed independent practitioners (including psychiatrists), and psychologists who often evaluated the same patients concurrently to maximize reliability: for the MADRS, the inter-class correlation coefficient (ICC) = 0.94; HDRS17: ICC = 0.92; and YMRS: ICC = 0.92. Whenever possible, the same blinded rater conducted the clinician-administered ratings for an individual patient. As all subjects were inpatients, daily ratings were obtained for the entirety of the 28-day trial, even if the subjects relapsed post-ketamine infusion (see Results for additional information on treatment retention).\nFactorial linear mixed models with restricted maximum likelihood estimation and an autoregressive moving average covariance structure were used to examine the change in clinical ratings over the treatment course with study day as the within-subjects factor and family history of an alcohol use disorder and medication (riluzole vs. placebo) extension as between-subjects factors. Baseline rating scale scores were included as covariates. All potential interactions between time, family history of an alcohol use disorder, and drug were included in the model. The fixed intercept was included, but the random intercept and random subject effect were not included because they did not contribute significantly to the model. The primary analysis used the intent-to-treat sample, where all participants had at least one post-baseline measure.\nKaplan-Meier survival analyses were performed using patients who responded (≥50% MADRS improvement from baseline) to ketamine at ≤230 minutes post-infusion. Relapse was defined by 2 consecutive days where the patient had ≤25% improvement from baseline MADRS. A log-rank test was used to compare drug effects, and family history of an alcohol use disorder was examined within each drug group.\nAdditional models examined a lifetime personal history of an alcohol use disorder in the same fashion as described above.\nAll analyses used two-tailed significance criteria of p < .05 and were performed with SPSS 21 (IBM).", "A total of 142 subjects were assessed under our screening protocol, 59 subjects were enrolled, and 52 subjects received ketamine followed by randomization to riluzole or placebo (Supplemental Figure S1). The demographics and clinical characteristics of the sample are reported in Supplemental Table S1. Family history and drug groups resulting from randomization were in the following proportions: FHN placebo (n = 17), FHP placebo (n = 9), FHN riluzole (n = 16), and FHP riluzole (n = 10).\nOn controlling for baseline MADRS, we first observed a main effect of group [MADRS: FHN (n = 33) < FHP (n = 19); F(1,49) = 5.25, p = .03] over the course of 4 weeks but no main effect of drug [F(1,50) = 0.07, p = .79]. Yet, there was a significant group-by-drug interaction [F(1,49) = 5.18, p = .03], such that FHP subjects had less depression than FHN subjects [F(1,50) = 9.69, p = .003] when randomized to placebo (Figure 1A). An analogous effect was not evident with riluzole [F(1,48) = 0.003, p = .95; Figure 1B]. Although potentially underpowered, the three-way interaction (group-by-drug-by-time) did not reach statistical significance [F(27,403) = 1.50, p = .053].\nKetamine’s antidepressant efficacy is improved for at least four weeks in treatment-resistant unipolar depressed subjects with a family history of an alcohol use disorder. (A) When randomized to placebo 4–6 hours after a single subanesthetic intravenous ketamine infusion, treatment-resistant unipolar depressed subjects with a family history of an alcohol use disorder displayed a greater antidepressant response over the next four weeks [group x time interaction: F(1,50) = 9.69, p = .003]. (B) When randomized to flexible-dose riluzole (100–200mg/day) 4–6 hours after a single subanesthetic intravenous infusion of ketamine, there was no statistically significant difference in antidepressant response based on family history status [group x time interaction: F(1,68) = .003, p = .95]. Abbreviations: FHP: family history positive; FHN: family history negative.\nA similar group-by-drug interaction was observed for the HDRS17 [F(1,48) = 9.82, p = .003]. There were no significant group-by-drug effects, however, observed for the Beck Depression Inventory [F(1,49) = 1.95, p = .17], Hamilton Anxiety Rating Scale [F(1,44) = 3.41, p = .09], Scale of Suicide Ideation [F(1,30) = 0.09, p = .77] or YMRS [F(1,48) = 1.83, p = .18]. There were no statistically-significant three-way interactions on any of these secondary measures.\nWe next performed time-to-relapse survival analyses in ketamine responders (placebo: n = 17; riluzole: n = 15; Figure 2). Riluzole did not significantly delay time-to-relapse (χ2 = 3.73, p = .053; again, the analysis may be underpowered to detect this effect as the effect size was large [Cohen’s d = 0.78]; Figure 2A). The group-by-drug responder breakdown was as follows: FHN placebo responders: n = 9; FHP placebo responders, n = 8; FHN riluzole responders: n = 9; and FHP riluzole responders, n = 6. The FHN group relapsed more quickly than the FHP group on randomization to placebo (χ2 = 7.38, p = .007; FHN placebo responders [3.6 days, SE = 1.0] vs. FHP placebo responders [17.0 days, SE = 3.9]; Figure 2B). Five of the nine FHN placebo responders dropped out, on average, 14±3.9 days into the 28-day trial due to worsening mood and anxiety. Only 1 of the 8 FHP placebo responders dropped out before study completion: at day 18, again due to worsening depression. There was no significant difference between FHP and FHN subjects randomized to riluzole post-ketamine infusion (χ2 = 0.16, p = .69; FHN riluzole responders [19.6 days, SE = 3.3] vs. FHP riluzole responders [15.8 days, SE = 3.6]; data not shown).\nKetamine’s antidepressant efficacy is maintained in treatment-resistant unipolar depressed subjects with a family history of an alcohol use disorder. (A) Prior to stratification by family history status, in a Kaplan-Meier survival analysis, riluzole did not delay time-to-relapse in treatment-resistant MDD antidepressant responders (χ2 = 3.73, p = .053). Response was defined as ≥50% MADRS improvement from baseline at any time point before 230 minute post-infusion, and relapse was defined as two consecutive days where patients had <25% improvement from baseline MADRS. (B) In the subgroup analysis, ketamine’s antidepressant response was extended in FHP patients randomized to placebo post–ketamine infusion. Abbreviations: FHP: family history positive; FHN: family history negative.\nSimilar predictor analyses were performed with a lifetime personal history of an alcohol use disorder (see Supplemental Materials).", "Ketamine has rapid-acting antidepressant effects in both treatment-resistant unipolar (Berman et al., 2000; Zarate et al., 2006; Valentine et al., 2011; Murrough, Iosifescu, et al., 2013) and bipolar (Diazgranados et al., 2010; Zarate et al., 2012) depression. Although the effect size is large to very large, even in refractory populations (Aan Het Rot et al., 2012), not all patients have an antidepressant (or even a positive) response (Niciu, Grunschel, et al., 2013; Szymkowicz et al., 2014). In order to better predict response, our group has extensively investigated treatment response biomarkers (Zarate et al., 2013; Niciu, Mathews, et al., 2014), and one of the strongest positive predictors is a family history of an alcohol use disorder in a first-degree relative (Phelps et al., 2009; Luckenbaugh et al., 2012; Niciu, Luckenbaugh, et al., 2014). In our combined dataset, the strength of this association increased over time, such that it was the strongest identified predictor at one week, alone explaining up to 22% of the antidepressant variance (Niciu, Luckenbaugh, et al., 2014). Yet, this mediating effect in both unipolar and bipolar depression has only been studied up to one week after ketamine infusion. In the present report, ketamine’s antidepressant efficacy was extended for four weeks (and potentially even longer, as the study completed at this time) in FHP subjects. Additionally, FHP extended the duration of antidepressant response by, on average, 13.4 days. These differences, however, were not due to poorer tolerability of ketamine in the FHN group, as the 5 FHN placebo patients who dropped out discontinued their participation, on average, two weeks into the trial due to worsening mood and anxiety.\nNext, the lack of antidepressant efficacy in the FHP riluzole group was contrary to our initial hypothesis. As a potential explanation, we hypothesize that the acute “glutamate surge” is greater in the FHP group, which increases AMPA-to-NMDA receptor throughput and intracellular second messenger/signal transduction cascades critical for ketamine’s antidepressant response (Niciu, Ionescu, et al., 2013). The acute post-infusion administration of riluzole may decrease this synaptic glutamate release by antagonizing presynaptic ionotropic sodium channels, thereby preferentially attenuating ketamine’s antidepressant efficacy. Although too rapid to explain the acute effects, increased riluzole-induced astrocytic GLT-1/EAAT-2 expression also may abrogate the extended antidepressant efficacy of ketamine in the FHP group.\nWe view a family history of an alcohol use disorder as a proxy for genetic or epigenetic risk. As alcohol use disorders are estimated to be at least 50% heritable (Enoch, 2013), we hypothesize that at least a portion of the increased antidepressant efficacy in FHP TRD is attributable to common genetic variation: e.g., single nucleotide polymorphisms and variable number of tandem repeats. Differential glutamate receptor sensitivity may be based on such variation in NMDA receptor subunits (Schumann et al., 2008) and other downstream effectors proteins (Niciu, Ionescu, et al., 2013). However, a family history of an alcohol use disorder also predisposes to other factors, (e.g., an increased risk of physical abuse which, of note, was the only investigated demographic factor significantly increased in the FHP group) that may have long-lasting epigenetic effects (e.g., differential methylation, acetylation and microRNA expression), contributing to this enhanced antidepressant efficacy. Differential methylation (Ressler et al., 2011) and microRNA expression (Zhou et al., 2014) have been observed in post-traumatic stress disorder. Future research should be aimed at identifying the genetic and neural substrates of this differential sensitivity, which may ultimately allow patient stratification based on more objective, continuous measures than the subjective, categorical domain of family history.\nContrary to family history, a lifetime personal history of an alcohol use disorder did not predict ketamine’s antidepressant efficacy in this (potentially underpowered) sample. In post hoc analyses from our ketamine bipolar depression studies (Diazgranados et al., 2010; Zarate et al., 2012), however, a lifetime personal history of an alcohol use disorder moderated improved antidepressant response (Luckenbaugh et al., 2012), a finding which has been replicated in an independent Polish bipolar depression ketamine cohort (Permoda-Osip et al., 2014). In addition to its γ-aminobutyric acid effects, alcohol is also a weak NMDA receptor antagonist (Lovinger, 1995; Fink and Gothert, 1996; Kash et al., 2008). We hypothesize that, due to lingering NMDA receptor blockade, chronic alcohol exposure produces long-term glutamatergic dysfunction—i.e., differential expression of ionotropic (postsynaptic) and/or metabotropic (both pre- and postsynaptic) receptors—that persists even after prolonged abstinence. In support of this hypothesis, central glutamate perturbations have been reported in alcohol use disorders alone and in combination with bipolar disorder, even after ≥1 year abstinence (Thoma et al., 2011). Decreased dorsolateral prefrontal cortical “Glx” (magnetic resonance-detectable glutamate + glutamine) has also been observed in (primarily male) alcohol-dependent bipolar patients compared to non-alcohol dependent bipolar and healthy control subjects (Nery et al., 2010). Taken together, ketamine’s differential effects in PHP treatment-resistant unipolar vs. bipolar depression may represent a critical avenue for future neurobiological and pharmacological investigations.\nIn conclusion, we again present compelling evidence that FHP treatment-resistant unipolar depressed subjects have a more robust antidepressant response to ketamine. Due to the length of this study, we report for the first time that the antidepressant effect of a single infusion is sustained over an entire for at least four weeks. FHP also delayed time-to-relapse in ketamine responders. Finally, although potentially underpowered, total MADRS change was not predicted by personal history status. Due to the strength and longevity of ketamine’s antidepressant efficacy in FHP patients, we encourage all future ketamine depression studies to assess, report, and potentially co-vary based on this variable." ]

[ null, null, null, null, null, null ]

[ "Introduction", "Methods", "Patient Selection", "Study Design and Medications", "Outcome Measures and Statistical Analyses", "Results", "Discussion", "Supplementary Material" ]

[ "Major depressive disorder (MDD) has one of the highest morbidities worldwide (Kessler et al., 2003; Ustun et al., 2004; Ormel et al., 2008), and, as demonstrated in large real-world effectiveness trials (Rush et al., 2006, 2011), standard antidepressants are effective in only a proportion of patients. Additionally, there is a substantial time lag in response: 2–4 weeks for initial effect and 6–12 weeks for maximal efficacy. Treatment-resistant MDD (TRD) is associated with substantial psychosocial dysfunction, morbidity, and mortality, due in part to suicide and undertreated medical comorbidities. As a result, there is a critical need for better and more rapid-acting antidepressants to quickly alleviate the burden of depression for patients, their families and friends, and society at large.\nThe noncompetitive N-methyl-D-aspartate (NMDA) receptor antagonist ketamine, a US Food and Drug Administration–approved dissociative anesthetic, acted as a rapid-acting antidepressant in several randomized, double-blind, placebo-controlled (Berman et al., 2000; Zarate et al., 2006, 2012; Diazgranados et al., 2010; Valentine et al., 2011; Murrough, Iosifescu, et al., 2013) and open-label (Ibrahim et al., 2012; Murrough, Perez, et al., 2013) studies. Unlike monoaminergic antidepressants, which often require weeks to months to achieve maximal efficacy, a single subanesthetic dose of ketamine has rapid (within hours) and potent (at least one week) antidepressant efficacy. As a result, there have been numerous efforts to maintain ketamine’s antidepressant efficacy beyond this one-week window. In several case reports (Liebrenz et al., 2009; Murrough et al., 2011; Blier et al., 2012) and an open-labeled trial (Murrough, Perez, et al., 2013), repeated-dose ketamine prolonged the initial antidepressant response. However, there are as yet no controlled long-term studies demonstrating that repeated-dose ketamine is safe and tolerable. Based on preliminary antidepressant efficacy in MDD (Sanacora et al., 2004, 2007; Zarate et al., 2004), the glutamatergic modulator riluzole has been investigated as an oral means of prolonging ketamine’s antidepressant response. Mathew et al. (2010) administered double-blind flexible dose (100–200mg/day) riluzole to 17 TRD ketamine responders in a randomized, placebo-controlled, 32-day extension trial. In an interim analysis, riluzole did not delay time to relapse and, as a result, the trial was stopped for futility. Next, our group designed and recently reported a four-week, randomized, double-blind, placebo-controlled riluzole extension trial following open-label subanesthetic dose ketamine infusion in 42 TRD patients (Zarate et al., 2012). In that report, there was also no improvement in depression between riluzole and placebo groups.\nWe have explored demographic and clinical factors to identify subgroups associated with better response in order to maximize ketamine’s antidepressant effects. In both treatment-resistant MDD (Phelps et al., 2009) and bipolar depression (Luckenbaugh et al., 2012), subjects with a family history of alcohol dependence in a first-degree relative had a more robust and sustained antidepressant response to ketamine. Also, in a recent pooled correlative analysis of all our reported ketamine trials at the National Institute of Mental Health, at one week post-infusion, family history of an alcohol use disorder in a first-degree relative was the strongest studied demographic and clinical predictor of ketamine response, alone accounting for up to 22% of the variance in percent change in the 17-item Hamilton Depression Rating Scale (HDRS17) scores (Niciu, Luckenbaugh, et al., 2014). Finally, in an independent sample of 42 patients with treatment-resistant bipolar depression, a family history of alcoholism also correlated with improved antidepressant response to ketamine: 17 of 22 responders vs. 4 of 20 non-responders had a positive family history (Permoda-Osip et al., 2014). And, in two bipolar depression samples (Luckenbaugh et al., 2012; Permoda-Osip et al., 2014) but not in our unipolar depressed sample (Phelps et al., 2009), a lifetime personal history of an alcohol use disorder also predicted improved antidepressant efficacy.\nAfter our initial ketamine riluzole extension trial report (Ibrahim et al., 2012), enrollment continued with the aim of identifying biomarkers and clinical predictors of treatment response. Here, we report the effect of family history of an alcohol use disorder in a first-degree relative over the full 28-day trial, and include 10 additional patients. We hypothesized that improvement in depressive symptoms resulting from a single ketamine infusion would be prolonged beyond one week in subjects with a family history of an alcohol use disorder in a first-degree relative (Family History Positive [FHP]) compared to those without an alcohol use disorder in an immediate relative (Family History Negative [FHN]). We also hypothesized that riluzole would augment and/or extend ketamine’s antidepressant efficacy in FHP but not FHN subjects. Finally, as in our initial report (Phelps et al., 2009), we hypothesized that a lifetime personal history of an alcohol use disorder would not predict ketamine’s antidepressant efficacy in this larger TRD sample.", " Patient Selection All subjects (18–65 years old) had a diagnosis of MDD without psychotic features as assessed by face-to-face evaluation with a licensed independent psychiatric practitioner and Structured Clinical Interview for Axis I DSM-IV Disorders-Patient Version. They were admitted to the Clinical Research Center of the National Institute of Mental Health in Bethesda, Maryland, between January 2006 and September 2013 and had a Montgomery Asberg Depression Rating Scale (MADRS) severity score of ≥22 both at screening and on the day of ketamine infusion (with no greater than a 25% decrease between screening and infusion). Additionally, participants were in a major depressive episode of at least four weeks duration at the time of screening. Treatment resistance was confirmed by prior failure of at least 2 adequate antidepressant trials using a modified version of the antidepressant treatment history form (Sackeim, 2001).\nStable physical health was assessed by medical history, physical examination, standard laboratory measures, electrocardiogram, and urine toxicology. All subjects could not meet criteria for an active substance use disorder (excluding nicotine or caffeine) for at least 3 months prior to enrollment. Comorbid axis I anxiety disorders were permitted if they were not the primary focus of treatment within 12 months prior to screening. Exclusion criteria included serious unstable medical conditions (e.g. uncontrolled asthma or hypertension), previous use of ketamine, riluzole, or phencyclidine, and concomitant treatment with psychotropic medications or electroconvulsive therapy in the 2 weeks prior to infusion (at least 5 weeks for fluoxetine). Female subjects could not be pregnant or nursing and agreed to use approved methods of birth control or complete abstinence during the entirety of the protocol.\nThe written protocol was approved by the Combined Neuroscience Institutional Review Board of the National Institutes of Health (NIH). All subjects provided written informed consent for screening and this specific protocol, and were assigned an independent clinical research advocate to impartially monitor the consent process and ensure ethical research participation.\nAll subjects (18–65 years old) had a diagnosis of MDD without psychotic features as assessed by face-to-face evaluation with a licensed independent psychiatric practitioner and Structured Clinical Interview for Axis I DSM-IV Disorders-Patient Version. They were admitted to the Clinical Research Center of the National Institute of Mental Health in Bethesda, Maryland, between January 2006 and September 2013 and had a Montgomery Asberg Depression Rating Scale (MADRS) severity score of ≥22 both at screening and on the day of ketamine infusion (with no greater than a 25% decrease between screening and infusion). Additionally, participants were in a major depressive episode of at least four weeks duration at the time of screening. Treatment resistance was confirmed by prior failure of at least 2 adequate antidepressant trials using a modified version of the antidepressant treatment history form (Sackeim, 2001).\nStable physical health was assessed by medical history, physical examination, standard laboratory measures, electrocardiogram, and urine toxicology. All subjects could not meet criteria for an active substance use disorder (excluding nicotine or caffeine) for at least 3 months prior to enrollment. Comorbid axis I anxiety disorders were permitted if they were not the primary focus of treatment within 12 months prior to screening. Exclusion criteria included serious unstable medical conditions (e.g. uncontrolled asthma or hypertension), previous use of ketamine, riluzole, or phencyclidine, and concomitant treatment with psychotropic medications or electroconvulsive therapy in the 2 weeks prior to infusion (at least 5 weeks for fluoxetine). Female subjects could not be pregnant or nursing and agreed to use approved methods of birth control or complete abstinence during the entirety of the protocol.\nThe written protocol was approved by the Combined Neuroscience Institutional Review Board of the National Institutes of Health (NIH). All subjects provided written informed consent for screening and this specific protocol, and were assigned an independent clinical research advocate to impartially monitor the consent process and ensure ethical research participation.\n Study Design and Medications As previously described (Ibrahim et al., 2012), this was a double-blind, randomized, parallel-group, placebo-controlled, flexible-dose, inpatient study conducted to determine the antidepressant efficacy of an intravenous ketamine infusion followed by oral riluzole. Following a 2-week drug-free period (5 weeks for fluoxetine), 52 subjects received a single open-label infusion of 0.5mg/kg ketamine hydrochloride over 40 minutes. Four to six hours post-infusion, subjects were randomized to either flexible-dose (100–200mg/day) riluzole or placebo twice daily for 4 weeks. Dose escalations occurred on a weekly basis until the appearance of treatment-limiting side effects or study completion. Dose reductions were permitted by one capsule (50mg/week to a minimum of 100mg/day) in the case of intolerable side effects. Nursing staff monitored medication adherence. No concomitant medications with central nervous system effects were permitted throughout the 4-week trial.\nAs previously described (Ibrahim et al., 2012), this was a double-blind, randomized, parallel-group, placebo-controlled, flexible-dose, inpatient study conducted to determine the antidepressant efficacy of an intravenous ketamine infusion followed by oral riluzole. Following a 2-week drug-free period (5 weeks for fluoxetine), 52 subjects received a single open-label infusion of 0.5mg/kg ketamine hydrochloride over 40 minutes. Four to six hours post-infusion, subjects were randomized to either flexible-dose (100–200mg/day) riluzole or placebo twice daily for 4 weeks. Dose escalations occurred on a weekly basis until the appearance of treatment-limiting side effects or study completion. Dose reductions were permitted by one capsule (50mg/week to a minimum of 100mg/day) in the case of intolerable side effects. Nursing staff monitored medication adherence. No concomitant medications with central nervous system effects were permitted throughout the 4-week trial.\n Outcome Measures and Statistical Analyses As in our prior studies (Phelps et al., 2009; Luckenbaugh et al., 2012; Niciu, Luckenbaugh, et al., 2014), family history was assessed pre-infusion with the Family Interview for Genetic Studies. FHP was defined as having at least one first-degree relative with an alcohol use disorder, and, as corollary, FHN was defined as an absence of a first-degree relative with an alcohol use disorder. Subjects were rated with a battery of neuropsychiatric measures at 60 minutes prior to infusion, at several post-infusion time points on infusion day (+40, +80, +120, and +230 minutes) and throughout the following 28 days. The following measures were rated daily: the MADRS (Montgomery and Asberg, 1979), HDRS17 (Hamilton, 1960), the Beck Depression Inventory (Beck and Beamesderfer, 1974), the Scale of Suicide Ideation (Beck et al., 1979), and the Young Mania Rating Scale (YMRS; Young et al., 1978). The Hamilton Anxiety Rating Scale (Hamilton, 1959) was obtained at days 1, 3, 7, 14, 21, and 28. Change in MADRS was primary and the remaining measures were secondary outcomes. All assessments were administered by research nurses, licensed independent practitioners (including psychiatrists), and psychologists who often evaluated the same patients concurrently to maximize reliability: for the MADRS, the inter-class correlation coefficient (ICC) = 0.94; HDRS17: ICC = 0.92; and YMRS: ICC = 0.92. Whenever possible, the same blinded rater conducted the clinician-administered ratings for an individual patient. As all subjects were inpatients, daily ratings were obtained for the entirety of the 28-day trial, even if the subjects relapsed post-ketamine infusion (see Results for additional information on treatment retention).\nFactorial linear mixed models with restricted maximum likelihood estimation and an autoregressive moving average covariance structure were used to examine the change in clinical ratings over the treatment course with study day as the within-subjects factor and family history of an alcohol use disorder and medication (riluzole vs. placebo) extension as between-subjects factors. Baseline rating scale scores were included as covariates. All potential interactions between time, family history of an alcohol use disorder, and drug were included in the model. The fixed intercept was included, but the random intercept and random subject effect were not included because they did not contribute significantly to the model. The primary analysis used the intent-to-treat sample, where all participants had at least one post-baseline measure.\nKaplan-Meier survival analyses were performed using patients who responded (≥50% MADRS improvement from baseline) to ketamine at ≤230 minutes post-infusion. Relapse was defined by 2 consecutive days where the patient had ≤25% improvement from baseline MADRS. A log-rank test was used to compare drug effects, and family history of an alcohol use disorder was examined within each drug group.\nAdditional models examined a lifetime personal history of an alcohol use disorder in the same fashion as described above.\nAll analyses used two-tailed significance criteria of p < .05 and were performed with SPSS 21 (IBM).\nAs in our prior studies (Phelps et al., 2009; Luckenbaugh et al., 2012; Niciu, Luckenbaugh, et al., 2014), family history was assessed pre-infusion with the Family Interview for Genetic Studies. FHP was defined as having at least one first-degree relative with an alcohol use disorder, and, as corollary, FHN was defined as an absence of a first-degree relative with an alcohol use disorder. Subjects were rated with a battery of neuropsychiatric measures at 60 minutes prior to infusion, at several post-infusion time points on infusion day (+40, +80, +120, and +230 minutes) and throughout the following 28 days. The following measures were rated daily: the MADRS (Montgomery and Asberg, 1979), HDRS17 (Hamilton, 1960), the Beck Depression Inventory (Beck and Beamesderfer, 1974), the Scale of Suicide Ideation (Beck et al., 1979), and the Young Mania Rating Scale (YMRS; Young et al., 1978). The Hamilton Anxiety Rating Scale (Hamilton, 1959) was obtained at days 1, 3, 7, 14, 21, and 28. Change in MADRS was primary and the remaining measures were secondary outcomes. All assessments were administered by research nurses, licensed independent practitioners (including psychiatrists), and psychologists who often evaluated the same patients concurrently to maximize reliability: for the MADRS, the inter-class correlation coefficient (ICC) = 0.94; HDRS17: ICC = 0.92; and YMRS: ICC = 0.92. Whenever possible, the same blinded rater conducted the clinician-administered ratings for an individual patient. As all subjects were inpatients, daily ratings were obtained for the entirety of the 28-day trial, even if the subjects relapsed post-ketamine infusion (see Results for additional information on treatment retention).\nFactorial linear mixed models with restricted maximum likelihood estimation and an autoregressive moving average covariance structure were used to examine the change in clinical ratings over the treatment course with study day as the within-subjects factor and family history of an alcohol use disorder and medication (riluzole vs. placebo) extension as between-subjects factors. Baseline rating scale scores were included as covariates. All potential interactions between time, family history of an alcohol use disorder, and drug were included in the model. The fixed intercept was included, but the random intercept and random subject effect were not included because they did not contribute significantly to the model. The primary analysis used the intent-to-treat sample, where all participants had at least one post-baseline measure.\nKaplan-Meier survival analyses were performed using patients who responded (≥50% MADRS improvement from baseline) to ketamine at ≤230 minutes post-infusion. Relapse was defined by 2 consecutive days where the patient had ≤25% improvement from baseline MADRS. A log-rank test was used to compare drug effects, and family history of an alcohol use disorder was examined within each drug group.\nAdditional models examined a lifetime personal history of an alcohol use disorder in the same fashion as described above.\nAll analyses used two-tailed significance criteria of p < .05 and were performed with SPSS 21 (IBM).", "All subjects (18–65 years old) had a diagnosis of MDD without psychotic features as assessed by face-to-face evaluation with a licensed independent psychiatric practitioner and Structured Clinical Interview for Axis I DSM-IV Disorders-Patient Version. They were admitted to the Clinical Research Center of the National Institute of Mental Health in Bethesda, Maryland, between January 2006 and September 2013 and had a Montgomery Asberg Depression Rating Scale (MADRS) severity score of ≥22 both at screening and on the day of ketamine infusion (with no greater than a 25% decrease between screening and infusion). Additionally, participants were in a major depressive episode of at least four weeks duration at the time of screening. Treatment resistance was confirmed by prior failure of at least 2 adequate antidepressant trials using a modified version of the antidepressant treatment history form (Sackeim, 2001).\nStable physical health was assessed by medical history, physical examination, standard laboratory measures, electrocardiogram, and urine toxicology. All subjects could not meet criteria for an active substance use disorder (excluding nicotine or caffeine) for at least 3 months prior to enrollment. Comorbid axis I anxiety disorders were permitted if they were not the primary focus of treatment within 12 months prior to screening. Exclusion criteria included serious unstable medical conditions (e.g. uncontrolled asthma or hypertension), previous use of ketamine, riluzole, or phencyclidine, and concomitant treatment with psychotropic medications or electroconvulsive therapy in the 2 weeks prior to infusion (at least 5 weeks for fluoxetine). Female subjects could not be pregnant or nursing and agreed to use approved methods of birth control or complete abstinence during the entirety of the protocol.\nThe written protocol was approved by the Combined Neuroscience Institutional Review Board of the National Institutes of Health (NIH). All subjects provided written informed consent for screening and this specific protocol, and were assigned an independent clinical research advocate to impartially monitor the consent process and ensure ethical research participation.", "As previously described (Ibrahim et al., 2012), this was a double-blind, randomized, parallel-group, placebo-controlled, flexible-dose, inpatient study conducted to determine the antidepressant efficacy of an intravenous ketamine infusion followed by oral riluzole. Following a 2-week drug-free period (5 weeks for fluoxetine), 52 subjects received a single open-label infusion of 0.5mg/kg ketamine hydrochloride over 40 minutes. Four to six hours post-infusion, subjects were randomized to either flexible-dose (100–200mg/day) riluzole or placebo twice daily for 4 weeks. Dose escalations occurred on a weekly basis until the appearance of treatment-limiting side effects or study completion. Dose reductions were permitted by one capsule (50mg/week to a minimum of 100mg/day) in the case of intolerable side effects. Nursing staff monitored medication adherence. No concomitant medications with central nervous system effects were permitted throughout the 4-week trial.", "As in our prior studies (Phelps et al., 2009; Luckenbaugh et al., 2012; Niciu, Luckenbaugh, et al., 2014), family history was assessed pre-infusion with the Family Interview for Genetic Studies. FHP was defined as having at least one first-degree relative with an alcohol use disorder, and, as corollary, FHN was defined as an absence of a first-degree relative with an alcohol use disorder. Subjects were rated with a battery of neuropsychiatric measures at 60 minutes prior to infusion, at several post-infusion time points on infusion day (+40, +80, +120, and +230 minutes) and throughout the following 28 days. The following measures were rated daily: the MADRS (Montgomery and Asberg, 1979), HDRS17 (Hamilton, 1960), the Beck Depression Inventory (Beck and Beamesderfer, 1974), the Scale of Suicide Ideation (Beck et al., 1979), and the Young Mania Rating Scale (YMRS; Young et al., 1978). The Hamilton Anxiety Rating Scale (Hamilton, 1959) was obtained at days 1, 3, 7, 14, 21, and 28. Change in MADRS was primary and the remaining measures were secondary outcomes. All assessments were administered by research nurses, licensed independent practitioners (including psychiatrists), and psychologists who often evaluated the same patients concurrently to maximize reliability: for the MADRS, the inter-class correlation coefficient (ICC) = 0.94; HDRS17: ICC = 0.92; and YMRS: ICC = 0.92. Whenever possible, the same blinded rater conducted the clinician-administered ratings for an individual patient. As all subjects were inpatients, daily ratings were obtained for the entirety of the 28-day trial, even if the subjects relapsed post-ketamine infusion (see Results for additional information on treatment retention).\nFactorial linear mixed models with restricted maximum likelihood estimation and an autoregressive moving average covariance structure were used to examine the change in clinical ratings over the treatment course with study day as the within-subjects factor and family history of an alcohol use disorder and medication (riluzole vs. placebo) extension as between-subjects factors. Baseline rating scale scores were included as covariates. All potential interactions between time, family history of an alcohol use disorder, and drug were included in the model. The fixed intercept was included, but the random intercept and random subject effect were not included because they did not contribute significantly to the model. The primary analysis used the intent-to-treat sample, where all participants had at least one post-baseline measure.\nKaplan-Meier survival analyses were performed using patients who responded (≥50% MADRS improvement from baseline) to ketamine at ≤230 minutes post-infusion. Relapse was defined by 2 consecutive days where the patient had ≤25% improvement from baseline MADRS. A log-rank test was used to compare drug effects, and family history of an alcohol use disorder was examined within each drug group.\nAdditional models examined a lifetime personal history of an alcohol use disorder in the same fashion as described above.\nAll analyses used two-tailed significance criteria of p < .05 and were performed with SPSS 21 (IBM).", "A total of 142 subjects were assessed under our screening protocol, 59 subjects were enrolled, and 52 subjects received ketamine followed by randomization to riluzole or placebo (Supplemental Figure S1). The demographics and clinical characteristics of the sample are reported in Supplemental Table S1. Family history and drug groups resulting from randomization were in the following proportions: FHN placebo (n = 17), FHP placebo (n = 9), FHN riluzole (n = 16), and FHP riluzole (n = 10).\nOn controlling for baseline MADRS, we first observed a main effect of group [MADRS: FHN (n = 33) < FHP (n = 19); F(1,49) = 5.25, p = .03] over the course of 4 weeks but no main effect of drug [F(1,50) = 0.07, p = .79]. Yet, there was a significant group-by-drug interaction [F(1,49) = 5.18, p = .03], such that FHP subjects had less depression than FHN subjects [F(1,50) = 9.69, p = .003] when randomized to placebo (Figure 1A). An analogous effect was not evident with riluzole [F(1,48) = 0.003, p = .95; Figure 1B]. Although potentially underpowered, the three-way interaction (group-by-drug-by-time) did not reach statistical significance [F(27,403) = 1.50, p = .053].\nKetamine’s antidepressant efficacy is improved for at least four weeks in treatment-resistant unipolar depressed subjects with a family history of an alcohol use disorder. (A) When randomized to placebo 4–6 hours after a single subanesthetic intravenous ketamine infusion, treatment-resistant unipolar depressed subjects with a family history of an alcohol use disorder displayed a greater antidepressant response over the next four weeks [group x time interaction: F(1,50) = 9.69, p = .003]. (B) When randomized to flexible-dose riluzole (100–200mg/day) 4–6 hours after a single subanesthetic intravenous infusion of ketamine, there was no statistically significant difference in antidepressant response based on family history status [group x time interaction: F(1,68) = .003, p = .95]. Abbreviations: FHP: family history positive; FHN: family history negative.\nA similar group-by-drug interaction was observed for the HDRS17 [F(1,48) = 9.82, p = .003]. There were no significant group-by-drug effects, however, observed for the Beck Depression Inventory [F(1,49) = 1.95, p = .17], Hamilton Anxiety Rating Scale [F(1,44) = 3.41, p = .09], Scale of Suicide Ideation [F(1,30) = 0.09, p = .77] or YMRS [F(1,48) = 1.83, p = .18]. There were no statistically-significant three-way interactions on any of these secondary measures.\nWe next performed time-to-relapse survival analyses in ketamine responders (placebo: n = 17; riluzole: n = 15; Figure 2). Riluzole did not significantly delay time-to-relapse (χ2 = 3.73, p = .053; again, the analysis may be underpowered to detect this effect as the effect size was large [Cohen’s d = 0.78]; Figure 2A). The group-by-drug responder breakdown was as follows: FHN placebo responders: n = 9; FHP placebo responders, n = 8; FHN riluzole responders: n = 9; and FHP riluzole responders, n = 6. The FHN group relapsed more quickly than the FHP group on randomization to placebo (χ2 = 7.38, p = .007; FHN placebo responders [3.6 days, SE = 1.0] vs. FHP placebo responders [17.0 days, SE = 3.9]; Figure 2B). Five of the nine FHN placebo responders dropped out, on average, 14±3.9 days into the 28-day trial due to worsening mood and anxiety. Only 1 of the 8 FHP placebo responders dropped out before study completion: at day 18, again due to worsening depression. There was no significant difference between FHP and FHN subjects randomized to riluzole post-ketamine infusion (χ2 = 0.16, p = .69; FHN riluzole responders [19.6 days, SE = 3.3] vs. FHP riluzole responders [15.8 days, SE = 3.6]; data not shown).\nKetamine’s antidepressant efficacy is maintained in treatment-resistant unipolar depressed subjects with a family history of an alcohol use disorder. (A) Prior to stratification by family history status, in a Kaplan-Meier survival analysis, riluzole did not delay time-to-relapse in treatment-resistant MDD antidepressant responders (χ2 = 3.73, p = .053). Response was defined as ≥50% MADRS improvement from baseline at any time point before 230 minute post-infusion, and relapse was defined as two consecutive days where patients had <25% improvement from baseline MADRS. (B) In the subgroup analysis, ketamine’s antidepressant response was extended in FHP patients randomized to placebo post–ketamine infusion. Abbreviations: FHP: family history positive; FHN: family history negative.\nSimilar predictor analyses were performed with a lifetime personal history of an alcohol use disorder (see Supplemental Materials).", "Ketamine has rapid-acting antidepressant effects in both treatment-resistant unipolar (Berman et al., 2000; Zarate et al., 2006; Valentine et al., 2011; Murrough, Iosifescu, et al., 2013) and bipolar (Diazgranados et al., 2010; Zarate et al., 2012) depression. Although the effect size is large to very large, even in refractory populations (Aan Het Rot et al., 2012), not all patients have an antidepressant (or even a positive) response (Niciu, Grunschel, et al., 2013; Szymkowicz et al., 2014). In order to better predict response, our group has extensively investigated treatment response biomarkers (Zarate et al., 2013; Niciu, Mathews, et al., 2014), and one of the strongest positive predictors is a family history of an alcohol use disorder in a first-degree relative (Phelps et al., 2009; Luckenbaugh et al., 2012; Niciu, Luckenbaugh, et al., 2014). In our combined dataset, the strength of this association increased over time, such that it was the strongest identified predictor at one week, alone explaining up to 22% of the antidepressant variance (Niciu, Luckenbaugh, et al., 2014). Yet, this mediating effect in both unipolar and bipolar depression has only been studied up to one week after ketamine infusion. In the present report, ketamine’s antidepressant efficacy was extended for four weeks (and potentially even longer, as the study completed at this time) in FHP subjects. Additionally, FHP extended the duration of antidepressant response by, on average, 13.4 days. These differences, however, were not due to poorer tolerability of ketamine in the FHN group, as the 5 FHN placebo patients who dropped out discontinued their participation, on average, two weeks into the trial due to worsening mood and anxiety.\nNext, the lack of antidepressant efficacy in the FHP riluzole group was contrary to our initial hypothesis. As a potential explanation, we hypothesize that the acute “glutamate surge” is greater in the FHP group, which increases AMPA-to-NMDA receptor throughput and intracellular second messenger/signal transduction cascades critical for ketamine’s antidepressant response (Niciu, Ionescu, et al., 2013). The acute post-infusion administration of riluzole may decrease this synaptic glutamate release by antagonizing presynaptic ionotropic sodium channels, thereby preferentially attenuating ketamine’s antidepressant efficacy. Although too rapid to explain the acute effects, increased riluzole-induced astrocytic GLT-1/EAAT-2 expression also may abrogate the extended antidepressant efficacy of ketamine in the FHP group.\nWe view a family history of an alcohol use disorder as a proxy for genetic or epigenetic risk. As alcohol use disorders are estimated to be at least 50% heritable (Enoch, 2013), we hypothesize that at least a portion of the increased antidepressant efficacy in FHP TRD is attributable to common genetic variation: e.g., single nucleotide polymorphisms and variable number of tandem repeats. Differential glutamate receptor sensitivity may be based on such variation in NMDA receptor subunits (Schumann et al., 2008) and other downstream effectors proteins (Niciu, Ionescu, et al., 2013). However, a family history of an alcohol use disorder also predisposes to other factors, (e.g., an increased risk of physical abuse which, of note, was the only investigated demographic factor significantly increased in the FHP group) that may have long-lasting epigenetic effects (e.g., differential methylation, acetylation and microRNA expression), contributing to this enhanced antidepressant efficacy. Differential methylation (Ressler et al., 2011) and microRNA expression (Zhou et al., 2014) have been observed in post-traumatic stress disorder. Future research should be aimed at identifying the genetic and neural substrates of this differential sensitivity, which may ultimately allow patient stratification based on more objective, continuous measures than the subjective, categorical domain of family history.\nContrary to family history, a lifetime personal history of an alcohol use disorder did not predict ketamine’s antidepressant efficacy in this (potentially underpowered) sample. In post hoc analyses from our ketamine bipolar depression studies (Diazgranados et al., 2010; Zarate et al., 2012), however, a lifetime personal history of an alcohol use disorder moderated improved antidepressant response (Luckenbaugh et al., 2012), a finding which has been replicated in an independent Polish bipolar depression ketamine cohort (Permoda-Osip et al., 2014). In addition to its γ-aminobutyric acid effects, alcohol is also a weak NMDA receptor antagonist (Lovinger, 1995; Fink and Gothert, 1996; Kash et al., 2008). We hypothesize that, due to lingering NMDA receptor blockade, chronic alcohol exposure produces long-term glutamatergic dysfunction—i.e., differential expression of ionotropic (postsynaptic) and/or metabotropic (both pre- and postsynaptic) receptors—that persists even after prolonged abstinence. In support of this hypothesis, central glutamate perturbations have been reported in alcohol use disorders alone and in combination with bipolar disorder, even after ≥1 year abstinence (Thoma et al., 2011). Decreased dorsolateral prefrontal cortical “Glx” (magnetic resonance-detectable glutamate + glutamine) has also been observed in (primarily male) alcohol-dependent bipolar patients compared to non-alcohol dependent bipolar and healthy control subjects (Nery et al., 2010). Taken together, ketamine’s differential effects in PHP treatment-resistant unipolar vs. bipolar depression may represent a critical avenue for future neurobiological and pharmacological investigations.\nIn conclusion, we again present compelling evidence that FHP treatment-resistant unipolar depressed subjects have a more robust antidepressant response to ketamine. Due to the length of this study, we report for the first time that the antidepressant effect of a single infusion is sustained over an entire for at least four weeks. FHP also delayed time-to-relapse in ketamine responders. Finally, although potentially underpowered, total MADRS change was not predicted by personal history status. Due to the strength and longevity of ketamine’s antidepressant efficacy in FHP patients, we encourage all future ketamine depression studies to assess, report, and potentially co-vary based on this variable.", "" ]

[ null, "methods", null, null, null, null, null, "supplementary-material" ]

[ "alcohol use disorder", "family history", "ketamine", "major depressive disorder", "riluzole" ]

[ 1047, 368, 186, 615, 994, 1189 ]

[ "ketamine", "history", "subjects", "infusion", "use", "antidepressant", "alcohol", "disorder", "family", "use disorder" ]

[ "antidepressant efficacy ketamine", "based preliminary antidepressant", "mdd antidepressant responders", "acting antidepressants quickly", "resistant mdd antidepressant" ]

[ "Humans", "Carcinoma, Hepatocellular", "RNA, Circular", "Sorafenib", "Liver Neoplasms", "Prognosis", "Biomarkers, Tumor" ]

[ "INTRODUCTION", "Cell culture and clinical samples", "Quantitative real‐time polymerase chain reaction", "Statistical analysis", "Hepatocellular carcinoma patients exhibit serum hsa_circ_0000615 upregulation", "Hsa_circ_0000615 levels are related to clinical features in HCC patients", "Hsa_circ_0000615 is associated with poor chemoresistant hepatocellular carcinoma patient prognosis", "Serum hsa_circ_0000615 levels offer diagnostic utility for the detection of hepatocellular carcinoma chemoresistance" ]

[ "Hepatocellular carcinoma (HCC) is the leading cause of cancer‐related death worldwide.\n1\n In most cases, long‐term sorafenib administration is associated with the onset of chemoresistance. As such, there is a clear need to identify the mechanistic basis for sorafenib resistance and to design novel approaches to effectively treat this cancer type.\nCircular RNAs (circRNAs) are a covalently closed looping structure that renders them resistant to degradation and more stable than linear RNAs.\n2\n, \n3\n, \n4\n A growing body of evidence suggests that circRNAs can regulate a range of cancers and other important diseases by influencing cellular proliferation, survival, migration, glucose metabolism, and differentiation.\n5\n, \n6\n, \n7\n, \n8\n, \n9\n As such, circRNAs offer great promise as diagnostic biomarkers or therapeutic targets in cancer patients and individuals with other conditions.\n10\n\n\nRecently, circRNAs have been found to be dysregulated in HCC and to play an important functional role in this pathological context.\n11\n, \n12\n, \n13\n The recently identified circRNA hsa_circ_0000615 has been found to play an oncogenic role in prostate,\n14\n breast,\n15\n gastric,\n16\n and colorectal cancers.\n17\n Moreover, hsa_circ_0000615 has been found to promote HCC cell migration, invasion, stemness, and proliferation.\n18\n, \n19\n How hsa_circ_0000615 functions in the context of tumor chemoresistance, however, remains to be defined.\nHerein, we explored the expression of hsa_circ_0000615 in HCC patient serum and its relationship with patient clinical findings. Overall, we found that sorafenib‐resistant HCC patients exhibited hsa_circ_0000615 upregulation that was related to poorer overall survival (OS) outcomes. Moreover, hsa_circ_0000615 exhibited reasonably good area under the ROC curve (AUC) values, suggesting that it may offer value as a novel prognostic biomarker of sorafenib‐resistant HCC.", "Human Hep G2 and Huh 7 were grown in DMEM (Invitrogen, NY, USA). Hep G2/sorafenib and Huh 7/sorafenib cell lines were established by maintaining Hep G2 and Huh 7 cells at 1 mmol/L sorafenib and gradually increasing it at a rate of 0.5 mmol/L per month (up to 5 mmol/L) more than 10‐month. Serum samples from 202 HCC patients and 202 healthy controls were obtained from the First Affiliated Hospital of Bengbu Medical College. This study was approved by the Ethics Committee of the First Affiliated Hospital of Bengbu Medical College, with all patients having provided written informed consent.", "An RNA Isolation Kit (Vazyme Biotech, Nanjing, China) was used to extract total RNA from 500 μl of patient serum, after which a Prime Script RT reagent Kit (Takara, Dalian, China) was used for cDNA synthesis. Prepared cDNA was then used as input for qPCR reactions performed with SYBR Green (Takara). The U6 small nuclear B noncoding RNA (U6) was used to normalize expression values via the 2−ΔΔCt method, with primers used being as follows: hsa_circ_0000615: F 5′–CAGCGCTATCCTTTGGGA–3′, R 5′–GACCTGCCACATTGGTCAGTA–3′; U6: F 5′–TGCGGGTGCTCGCTTCGGCAGC–3′, R 5′–GTGCAGGGTCCGAGGT–3′.", "Data are means ± standard deviation (SD) and were compared via Student's t tests using GraphPad Prism 7. The Kaplan–Meier method was used for survival analyses, with p < .05 as the threshold of significance.", "We began by assessing the levels of hsa_circ_0000615 in control and sorafenib‐resistant HCC cells. The sorafenib‐resistant Hep G2/sorafenib and Huh 7/sorafenib cell lines exhibited marked upregulation of this circRNA relative to corresponding parental cell lines (Figure 1A). To explore the potential utility of hsa_circ_0000615 as a biomarker of chemoresistance, we then assessed the levels of this circRNA in serum samples from 202 HCC patients and 202 healthy controls. HCC patients exhibited significantly elevated serum hsa_circ_0000615 levels compared with healthy controls (Figure 1B). Moreover, hsa_circ_0000615 expression levels were higher in sorafenib‐resistant patients (n = 122) relative to those in sorafenib‐sensitive individuals (n = 80) (Figure 1C). As such, hsa_circ_0000615 offers potential value as an HCC chemotherapy biomarker.\nHepatocellular carcinoma (HCC) patient serum samples exhibit hsa_circ_0000615 upregulation. (A). Hsa_circ_0000615 levels were significantly increased in sorafenib‐resistant HCC cells. (B). Serum hsa_circ_0000615 levels were higher in HCC patients. (C). sorafenib‐resistant patients (n = 122) exhibited higher levels of hsa_circ_0000615 expression compared with sorafenib‐sensitive patients in the before treatment and after treatment (n = 80). *p < .05.", "Next, we stratified HCC patients into those with high and low levels of serum hsa_circ_0000615 based on the mean expression of this circRNA in this cohort and compared clinical features between these two patient groups. Chi‐squared analyses revealed that hsa_circ_0000615 expression was associated with clinical stage, TNM stage, and lymph node metastasis (Table 1), but was unrelated to age, sex, or histological grade. Kaplan–Meier analyses indicated that patients exhibiting higher levels of hsa_circ_0000615 expression presented with shorter OS relative to patients expressing low hsa_circ_0000615 levels (Figure 2).\nCorrelations between hsa_circ_0000615 levels and hepatocellular carcinoma patient clinicopathological features\nHsa_circ_0000615 levels are linked with hepatocellular carcinoma patient survival. Patients exhibiting higher hsa_circ_0000615 expression levels exhibited prolonged overall survival compared with patients with lower levels of this circRNA.", "Through Kaplan–Meier analyses and log‐rank tests, we found chemoresistant HCC patients to exhibit significantly reduced OS and progression‐free survival (PFS) compared with chemosensitive patients (Figure 3). Through Cox proportional hazards regression analyses, we determined that clinical stage, chemoresistance, TNM stage, lymph node metastasis, and hsa_circ_0000615 levels were associated with patient PFS (Table 2) and OS (Table 3), highlighting hsa_circ_0000615 as a promising independent predictor of chemoresistant HCC patient survival.\nHsa_circ_0000615 levels were significantly linked to poor outcomes in chemoresistant hepatocellular carcinoma (HCC) patients. Chemoresistant HCC patients exhibited significantly decreased progression‐free survival (A) and overall survival (B) relative to chemosensitive patients.\nUnivariate and multivariate analyses of hepatocellular carcinoma patient progression‐free survival\nUnivariate and multivariate analyses of hepatocellular carcinoma patient overall survival", "Previous studies have shown that circRNAs show excellent potential diagnostic utility in various cancers, such as, breast cancer,\n20\n gastric cancer,\n21\n and HCC.\n22\n To assess the potential diagnostic utility of serum hsa_circ_0000615 in patients with HCC, the area under the receiver operating characteristic (ROC) curve (AUC) was determined and found to be 0.9238 (95% CI, 0.8915–0.956, Figure 4, p < .0001), consistent with the value of serum hsa_circ_0000615 as a biomarker capable of differentiating between HCC patients and healthy controls.\nSerum hsa_circ_0000615 levels offer diagnostic value as predictors of hepatocellular carcinoma (HCC) patient chemoresistance. Receiver‐operating characteristic curves were used to differentiate between chemoresistant HCC patients before and after therapy." ]

[ null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "MATERIALS AND METHODS", "Cell culture and clinical samples", "Quantitative real‐time polymerase chain reaction", "Statistical analysis", "RESULTS", "Hepatocellular carcinoma patients exhibit serum hsa_circ_0000615 upregulation", "Hsa_circ_0000615 levels are related to clinical features in HCC patients", "Hsa_circ_0000615 is associated with poor chemoresistant hepatocellular carcinoma patient prognosis", "Serum hsa_circ_0000615 levels offer diagnostic utility for the detection of hepatocellular carcinoma chemoresistance", "DISCUSSION", "CONCLUSIONS", "CONFLICT OF INTEREST" ]

[ "Hepatocellular carcinoma (HCC) is the leading cause of cancer‐related death worldwide.\n1\n In most cases, long‐term sorafenib administration is associated with the onset of chemoresistance. As such, there is a clear need to identify the mechanistic basis for sorafenib resistance and to design novel approaches to effectively treat this cancer type.\nCircular RNAs (circRNAs) are a covalently closed looping structure that renders them resistant to degradation and more stable than linear RNAs.\n2\n, \n3\n, \n4\n A growing body of evidence suggests that circRNAs can regulate a range of cancers and other important diseases by influencing cellular proliferation, survival, migration, glucose metabolism, and differentiation.\n5\n, \n6\n, \n7\n, \n8\n, \n9\n As such, circRNAs offer great promise as diagnostic biomarkers or therapeutic targets in cancer patients and individuals with other conditions.\n10\n\n\nRecently, circRNAs have been found to be dysregulated in HCC and to play an important functional role in this pathological context.\n11\n, \n12\n, \n13\n The recently identified circRNA hsa_circ_0000615 has been found to play an oncogenic role in prostate,\n14\n breast,\n15\n gastric,\n16\n and colorectal cancers.\n17\n Moreover, hsa_circ_0000615 has been found to promote HCC cell migration, invasion, stemness, and proliferation.\n18\n, \n19\n How hsa_circ_0000615 functions in the context of tumor chemoresistance, however, remains to be defined.\nHerein, we explored the expression of hsa_circ_0000615 in HCC patient serum and its relationship with patient clinical findings. Overall, we found that sorafenib‐resistant HCC patients exhibited hsa_circ_0000615 upregulation that was related to poorer overall survival (OS) outcomes. Moreover, hsa_circ_0000615 exhibited reasonably good area under the ROC curve (AUC) values, suggesting that it may offer value as a novel prognostic biomarker of sorafenib‐resistant HCC.", " Cell culture and clinical samples Human Hep G2 and Huh 7 were grown in DMEM (Invitrogen, NY, USA). Hep G2/sorafenib and Huh 7/sorafenib cell lines were established by maintaining Hep G2 and Huh 7 cells at 1 mmol/L sorafenib and gradually increasing it at a rate of 0.5 mmol/L per month (up to 5 mmol/L) more than 10‐month. Serum samples from 202 HCC patients and 202 healthy controls were obtained from the First Affiliated Hospital of Bengbu Medical College. This study was approved by the Ethics Committee of the First Affiliated Hospital of Bengbu Medical College, with all patients having provided written informed consent.\nHuman Hep G2 and Huh 7 were grown in DMEM (Invitrogen, NY, USA). Hep G2/sorafenib and Huh 7/sorafenib cell lines were established by maintaining Hep G2 and Huh 7 cells at 1 mmol/L sorafenib and gradually increasing it at a rate of 0.5 mmol/L per month (up to 5 mmol/L) more than 10‐month. Serum samples from 202 HCC patients and 202 healthy controls were obtained from the First Affiliated Hospital of Bengbu Medical College. This study was approved by the Ethics Committee of the First Affiliated Hospital of Bengbu Medical College, with all patients having provided written informed consent.\n Quantitative real‐time polymerase chain reaction An RNA Isolation Kit (Vazyme Biotech, Nanjing, China) was used to extract total RNA from 500 μl of patient serum, after which a Prime Script RT reagent Kit (Takara, Dalian, China) was used for cDNA synthesis. Prepared cDNA was then used as input for qPCR reactions performed with SYBR Green (Takara). The U6 small nuclear B noncoding RNA (U6) was used to normalize expression values via the 2−ΔΔCt method, with primers used being as follows: hsa_circ_0000615: F 5′–CAGCGCTATCCTTTGGGA–3′, R 5′–GACCTGCCACATTGGTCAGTA–3′; U6: F 5′–TGCGGGTGCTCGCTTCGGCAGC–3′, R 5′–GTGCAGGGTCCGAGGT–3′.\nAn RNA Isolation Kit (Vazyme Biotech, Nanjing, China) was used to extract total RNA from 500 μl of patient serum, after which a Prime Script RT reagent Kit (Takara, Dalian, China) was used for cDNA synthesis. Prepared cDNA was then used as input for qPCR reactions performed with SYBR Green (Takara). The U6 small nuclear B noncoding RNA (U6) was used to normalize expression values via the 2−ΔΔCt method, with primers used being as follows: hsa_circ_0000615: F 5′–CAGCGCTATCCTTTGGGA–3′, R 5′–GACCTGCCACATTGGTCAGTA–3′; U6: F 5′–TGCGGGTGCTCGCTTCGGCAGC–3′, R 5′–GTGCAGGGTCCGAGGT–3′.\n Statistical analysis Data are means ± standard deviation (SD) and were compared via Student's t tests using GraphPad Prism 7. The Kaplan–Meier method was used for survival analyses, with p < .05 as the threshold of significance.\nData are means ± standard deviation (SD) and were compared via Student's t tests using GraphPad Prism 7. The Kaplan–Meier method was used for survival analyses, with p < .05 as the threshold of significance.", "Human Hep G2 and Huh 7 were grown in DMEM (Invitrogen, NY, USA). Hep G2/sorafenib and Huh 7/sorafenib cell lines were established by maintaining Hep G2 and Huh 7 cells at 1 mmol/L sorafenib and gradually increasing it at a rate of 0.5 mmol/L per month (up to 5 mmol/L) more than 10‐month. Serum samples from 202 HCC patients and 202 healthy controls were obtained from the First Affiliated Hospital of Bengbu Medical College. This study was approved by the Ethics Committee of the First Affiliated Hospital of Bengbu Medical College, with all patients having provided written informed consent.", "An RNA Isolation Kit (Vazyme Biotech, Nanjing, China) was used to extract total RNA from 500 μl of patient serum, after which a Prime Script RT reagent Kit (Takara, Dalian, China) was used for cDNA synthesis. Prepared cDNA was then used as input for qPCR reactions performed with SYBR Green (Takara). The U6 small nuclear B noncoding RNA (U6) was used to normalize expression values via the 2−ΔΔCt method, with primers used being as follows: hsa_circ_0000615: F 5′–CAGCGCTATCCTTTGGGA–3′, R 5′–GACCTGCCACATTGGTCAGTA–3′; U6: F 5′–TGCGGGTGCTCGCTTCGGCAGC–3′, R 5′–GTGCAGGGTCCGAGGT–3′.", "Data are means ± standard deviation (SD) and were compared via Student's t tests using GraphPad Prism 7. The Kaplan–Meier method was used for survival analyses, with p < .05 as the threshold of significance.", " Hepatocellular carcinoma patients exhibit serum hsa_circ_0000615 upregulation We began by assessing the levels of hsa_circ_0000615 in control and sorafenib‐resistant HCC cells. The sorafenib‐resistant Hep G2/sorafenib and Huh 7/sorafenib cell lines exhibited marked upregulation of this circRNA relative to corresponding parental cell lines (Figure 1A). To explore the potential utility of hsa_circ_0000615 as a biomarker of chemoresistance, we then assessed the levels of this circRNA in serum samples from 202 HCC patients and 202 healthy controls. HCC patients exhibited significantly elevated serum hsa_circ_0000615 levels compared with healthy controls (Figure 1B). Moreover, hsa_circ_0000615 expression levels were higher in sorafenib‐resistant patients (n = 122) relative to those in sorafenib‐sensitive individuals (n = 80) (Figure 1C). As such, hsa_circ_0000615 offers potential value as an HCC chemotherapy biomarker.\nHepatocellular carcinoma (HCC) patient serum samples exhibit hsa_circ_0000615 upregulation. (A). Hsa_circ_0000615 levels were significantly increased in sorafenib‐resistant HCC cells. (B). Serum hsa_circ_0000615 levels were higher in HCC patients. (C). sorafenib‐resistant patients (n = 122) exhibited higher levels of hsa_circ_0000615 expression compared with sorafenib‐sensitive patients in the before treatment and after treatment (n = 80). *p < .05.\nWe began by assessing the levels of hsa_circ_0000615 in control and sorafenib‐resistant HCC cells. The sorafenib‐resistant Hep G2/sorafenib and Huh 7/sorafenib cell lines exhibited marked upregulation of this circRNA relative to corresponding parental cell lines (Figure 1A). To explore the potential utility of hsa_circ_0000615 as a biomarker of chemoresistance, we then assessed the levels of this circRNA in serum samples from 202 HCC patients and 202 healthy controls. HCC patients exhibited significantly elevated serum hsa_circ_0000615 levels compared with healthy controls (Figure 1B). Moreover, hsa_circ_0000615 expression levels were higher in sorafenib‐resistant patients (n = 122) relative to those in sorafenib‐sensitive individuals (n = 80) (Figure 1C). As such, hsa_circ_0000615 offers potential value as an HCC chemotherapy biomarker.\nHepatocellular carcinoma (HCC) patient serum samples exhibit hsa_circ_0000615 upregulation. (A). Hsa_circ_0000615 levels were significantly increased in sorafenib‐resistant HCC cells. (B). Serum hsa_circ_0000615 levels were higher in HCC patients. (C). sorafenib‐resistant patients (n = 122) exhibited higher levels of hsa_circ_0000615 expression compared with sorafenib‐sensitive patients in the before treatment and after treatment (n = 80). *p < .05.\n Hsa_circ_0000615 levels are related to clinical features in HCC patients Next, we stratified HCC patients into those with high and low levels of serum hsa_circ_0000615 based on the mean expression of this circRNA in this cohort and compared clinical features between these two patient groups. Chi‐squared analyses revealed that hsa_circ_0000615 expression was associated with clinical stage, TNM stage, and lymph node metastasis (Table 1), but was unrelated to age, sex, or histological grade. Kaplan–Meier analyses indicated that patients exhibiting higher levels of hsa_circ_0000615 expression presented with shorter OS relative to patients expressing low hsa_circ_0000615 levels (Figure 2).\nCorrelations between hsa_circ_0000615 levels and hepatocellular carcinoma patient clinicopathological features\nHsa_circ_0000615 levels are linked with hepatocellular carcinoma patient survival. Patients exhibiting higher hsa_circ_0000615 expression levels exhibited prolonged overall survival compared with patients with lower levels of this circRNA.\nNext, we stratified HCC patients into those with high and low levels of serum hsa_circ_0000615 based on the mean expression of this circRNA in this cohort and compared clinical features between these two patient groups. Chi‐squared analyses revealed that hsa_circ_0000615 expression was associated with clinical stage, TNM stage, and lymph node metastasis (Table 1), but was unrelated to age, sex, or histological grade. Kaplan–Meier analyses indicated that patients exhibiting higher levels of hsa_circ_0000615 expression presented with shorter OS relative to patients expressing low hsa_circ_0000615 levels (Figure 2).\nCorrelations between hsa_circ_0000615 levels and hepatocellular carcinoma patient clinicopathological features\nHsa_circ_0000615 levels are linked with hepatocellular carcinoma patient survival. Patients exhibiting higher hsa_circ_0000615 expression levels exhibited prolonged overall survival compared with patients with lower levels of this circRNA.\n Hsa_circ_0000615 is associated with poor chemoresistant hepatocellular carcinoma patient prognosis Through Kaplan–Meier analyses and log‐rank tests, we found chemoresistant HCC patients to exhibit significantly reduced OS and progression‐free survival (PFS) compared with chemosensitive patients (Figure 3). Through Cox proportional hazards regression analyses, we determined that clinical stage, chemoresistance, TNM stage, lymph node metastasis, and hsa_circ_0000615 levels were associated with patient PFS (Table 2) and OS (Table 3), highlighting hsa_circ_0000615 as a promising independent predictor of chemoresistant HCC patient survival.\nHsa_circ_0000615 levels were significantly linked to poor outcomes in chemoresistant hepatocellular carcinoma (HCC) patients. Chemoresistant HCC patients exhibited significantly decreased progression‐free survival (A) and overall survival (B) relative to chemosensitive patients.\nUnivariate and multivariate analyses of hepatocellular carcinoma patient progression‐free survival\nUnivariate and multivariate analyses of hepatocellular carcinoma patient overall survival\nThrough Kaplan–Meier analyses and log‐rank tests, we found chemoresistant HCC patients to exhibit significantly reduced OS and progression‐free survival (PFS) compared with chemosensitive patients (Figure 3). Through Cox proportional hazards regression analyses, we determined that clinical stage, chemoresistance, TNM stage, lymph node metastasis, and hsa_circ_0000615 levels were associated with patient PFS (Table 2) and OS (Table 3), highlighting hsa_circ_0000615 as a promising independent predictor of chemoresistant HCC patient survival.\nHsa_circ_0000615 levels were significantly linked to poor outcomes in chemoresistant hepatocellular carcinoma (HCC) patients. Chemoresistant HCC patients exhibited significantly decreased progression‐free survival (A) and overall survival (B) relative to chemosensitive patients.\nUnivariate and multivariate analyses of hepatocellular carcinoma patient progression‐free survival\nUnivariate and multivariate analyses of hepatocellular carcinoma patient overall survival\n Serum hsa_circ_0000615 levels offer diagnostic utility for the detection of hepatocellular carcinoma chemoresistance Previous studies have shown that circRNAs show excellent potential diagnostic utility in various cancers, such as, breast cancer,\n20\n gastric cancer,\n21\n and HCC.\n22\n To assess the potential diagnostic utility of serum hsa_circ_0000615 in patients with HCC, the area under the receiver operating characteristic (ROC) curve (AUC) was determined and found to be 0.9238 (95% CI, 0.8915–0.956, Figure 4, p < .0001), consistent with the value of serum hsa_circ_0000615 as a biomarker capable of differentiating between HCC patients and healthy controls.\nSerum hsa_circ_0000615 levels offer diagnostic value as predictors of hepatocellular carcinoma (HCC) patient chemoresistance. Receiver‐operating characteristic curves were used to differentiate between chemoresistant HCC patients before and after therapy.\nPrevious studies have shown that circRNAs show excellent potential diagnostic utility in various cancers, such as, breast cancer,\n20\n gastric cancer,\n21\n and HCC.\n22\n To assess the potential diagnostic utility of serum hsa_circ_0000615 in patients with HCC, the area under the receiver operating characteristic (ROC) curve (AUC) was determined and found to be 0.9238 (95% CI, 0.8915–0.956, Figure 4, p < .0001), consistent with the value of serum hsa_circ_0000615 as a biomarker capable of differentiating between HCC patients and healthy controls.\nSerum hsa_circ_0000615 levels offer diagnostic value as predictors of hepatocellular carcinoma (HCC) patient chemoresistance. Receiver‐operating characteristic curves were used to differentiate between chemoresistant HCC patients before and after therapy.", "We began by assessing the levels of hsa_circ_0000615 in control and sorafenib‐resistant HCC cells. The sorafenib‐resistant Hep G2/sorafenib and Huh 7/sorafenib cell lines exhibited marked upregulation of this circRNA relative to corresponding parental cell lines (Figure 1A). To explore the potential utility of hsa_circ_0000615 as a biomarker of chemoresistance, we then assessed the levels of this circRNA in serum samples from 202 HCC patients and 202 healthy controls. HCC patients exhibited significantly elevated serum hsa_circ_0000615 levels compared with healthy controls (Figure 1B). Moreover, hsa_circ_0000615 expression levels were higher in sorafenib‐resistant patients (n = 122) relative to those in sorafenib‐sensitive individuals (n = 80) (Figure 1C). As such, hsa_circ_0000615 offers potential value as an HCC chemotherapy biomarker.\nHepatocellular carcinoma (HCC) patient serum samples exhibit hsa_circ_0000615 upregulation. (A). Hsa_circ_0000615 levels were significantly increased in sorafenib‐resistant HCC cells. (B). Serum hsa_circ_0000615 levels were higher in HCC patients. (C). sorafenib‐resistant patients (n = 122) exhibited higher levels of hsa_circ_0000615 expression compared with sorafenib‐sensitive patients in the before treatment and after treatment (n = 80). *p < .05.", "Next, we stratified HCC patients into those with high and low levels of serum hsa_circ_0000615 based on the mean expression of this circRNA in this cohort and compared clinical features between these two patient groups. Chi‐squared analyses revealed that hsa_circ_0000615 expression was associated with clinical stage, TNM stage, and lymph node metastasis (Table 1), but was unrelated to age, sex, or histological grade. Kaplan–Meier analyses indicated that patients exhibiting higher levels of hsa_circ_0000615 expression presented with shorter OS relative to patients expressing low hsa_circ_0000615 levels (Figure 2).\nCorrelations between hsa_circ_0000615 levels and hepatocellular carcinoma patient clinicopathological features\nHsa_circ_0000615 levels are linked with hepatocellular carcinoma patient survival. Patients exhibiting higher hsa_circ_0000615 expression levels exhibited prolonged overall survival compared with patients with lower levels of this circRNA.", "Through Kaplan–Meier analyses and log‐rank tests, we found chemoresistant HCC patients to exhibit significantly reduced OS and progression‐free survival (PFS) compared with chemosensitive patients (Figure 3). Through Cox proportional hazards regression analyses, we determined that clinical stage, chemoresistance, TNM stage, lymph node metastasis, and hsa_circ_0000615 levels were associated with patient PFS (Table 2) and OS (Table 3), highlighting hsa_circ_0000615 as a promising independent predictor of chemoresistant HCC patient survival.\nHsa_circ_0000615 levels were significantly linked to poor outcomes in chemoresistant hepatocellular carcinoma (HCC) patients. Chemoresistant HCC patients exhibited significantly decreased progression‐free survival (A) and overall survival (B) relative to chemosensitive patients.\nUnivariate and multivariate analyses of hepatocellular carcinoma patient progression‐free survival\nUnivariate and multivariate analyses of hepatocellular carcinoma patient overall survival", "Previous studies have shown that circRNAs show excellent potential diagnostic utility in various cancers, such as, breast cancer,\n20\n gastric cancer,\n21\n and HCC.\n22\n To assess the potential diagnostic utility of serum hsa_circ_0000615 in patients with HCC, the area under the receiver operating characteristic (ROC) curve (AUC) was determined and found to be 0.9238 (95% CI, 0.8915–0.956, Figure 4, p < .0001), consistent with the value of serum hsa_circ_0000615 as a biomarker capable of differentiating between HCC patients and healthy controls.\nSerum hsa_circ_0000615 levels offer diagnostic value as predictors of hepatocellular carcinoma (HCC) patient chemoresistance. Receiver‐operating characteristic curves were used to differentiate between chemoresistant HCC patients before and after therapy.", "Herein, we found that serum samples from HCC patients exhibited significant increases in hsa_circ_0000615 levels compared with those from control individuals. Moreover, the upregulation of this circRNA in samples from sorafenib‐resistant HCC patients relative to those from chemosensitive patients suggested that it may offer value as an independent predictor of patient outcomes.\nA growing body of evidence suggests that circRNAs are functionally important in cancer and may offer value as predictive biomarkers or therapeutic targets. In colorectal cancer, for example, circRNA_0000392 can promote tumor progression via the miR‐193a‐5p/PIK3R3/AKT axis.\n23\n Moreover, in non‐small cell lung cancer, circNDUFB2 can destabilize IGF2BPs and activate anti‐tumor immune responses to suppress tumor progression.\n24\n In HCC, circRNA‐SORE can stabilize YBX1 to drive sorafenib resistance.\n25\n As such, circRNAs function in a tumor‐specific manner.\nNeoadjuvant chemotherapy is a mainstay of treatment for many cancers and has been used with increasing frequency over the past decade, with sorafenib‐based neoadjuvant chemotherapy being a standard of care for HCC patients. Those HCC patients that undergo sorafenib‐based chemotherapy prior to radical cystectomy exhibit better OS outcomes, but a subset of patients fail to attain any benefit from such treatment, with pathological responses to neoadjuvant chemotherapy being predictive of disease‐specific survival outcomes. Identifying reliable biomarkers capable of guiding clinicians to the selection of patients most likely to benefit from chemotherapeutic intervention is thus a critical clinical task.\nIn HCC, circRNAs can function as central regulators of sorafenib‐resistance,\n26\n, \n27\n, \n28\n with hsa_circ_0000615 having previously been shown to drive HCC tumor growth and metastatic progression.\n18\n, \n19\n In this study, we further found hsa_circ_0000615 to be expressed at significantly higher levels in Hep G2/sorafenib and Huh 7/sorafenib cells relative to corresponding parental cell lines. The expression of this circRNA was similarly elevated in sorafenib‐resistant HCC patients compared with their chemosensitive counterparts, suggesting that hsa_circ_0000615 may offer value as a predictor of chemotherapeutic responses. Levels of hsa_circ_0000615 were also related to clinical stage, lymph node metastasis, and T stage in HCC patients, although they were unrelated to tumor histological stage, N stage, M stage, or patient age and gender. Kaplan–Meier analyses indicated that higher levels of hsa_circ_0000615 expression were associated with shorter patient OS compared with low levels of this circRNA. Moreover, chemoresistant HCC patients exhibited shorter OS and PFS compared with chemosensitive patients. Univariate and multivariate analyses further revealed clinical stage, T stage, lymph node metastasis, and chemoresistance to be correlated with OS and PFS outcomes, suggesting hsa_circ_0000615 to be a valuable independent predictor of HCC patient outcomes. In addition, the AUC value for this circRNA in HCC patients was 0.9238, indicating that serum levels of hsa_circ_0000615 can be used to reliably differentiate between HCC patients and healthy individuals.", "In summary, we herein found hsa_circ_0000615 upregulation to be prominent within serum samples from HCC patients, with such upregulation being significantly more pronounced in samples from chemosensitive patients relative to chemoresistant patients. As such, hsa_circ_0000615 is a promising target that warrants further study in an effort to understand the mechanistic basis for HCC patient chemoresistance.", "The authors of this work declare that they have no conflict of interest." ]

[ null, "materials-and-methods", null, null, null, "results", null, null, null, null, "discussion", "conclusions", "COI-statement" ]

[ "hepatocellular carcinoma", "hsa_circ_0000615", "sorafenib resistance" ]

[ 361, 123, 108, 47, 231, 146, 153, 143 ]

[ "hsa_circ_0000615", "patients", "hcc", "levels", "sorafenib", "hcc patients", "patient", "serum", "hsa_circ_0000615 levels", "survival" ]

[ "circrna hcc patients", "circrna samples sorafenib", "hcc circrnas function", "circrna_0000392 promote tumor", "circular rnas circrnas" ]

[ "Aged", "Arginine", "COVID-19", "Female", "Humans", "Male", "Middle Aged", "Partial Thromboplastin Time", "Pipecolic Acids", "Platelet Aggregation Inhibitors", "SARS-CoV-2", "Sulfonamides", "Thrombocytopenia", "Thrombosis", "COVID-19 Drug Treatment" ]

[]

[]

[]

[ "Introduction", "Methods", "Results", "Discussion" ]

[ "Argatroban is licensed for use in patients with Heparin induced thrombocytopenia (HIT) and more recently it has been used in COVID-19 patients and Vaccine-induced Immune Thrombocytopenia (VITT). The summary of product characteristics (SmPC) advises users to monitor this anticoagulant using the activated partial thromboplastin time (APTT) with a target range of 1.5 to 3.0 times the initial baseline value but not exceeding 100 s.\n1\n This baseline APTT, however, is not always available or known.\n2\n The recommended range is based on a trial which used the APTT reagent Actin FSL in 73 healthy volunteers.\n3\n Limitations of the APTT for monitoring argatroban have been reported in several publications.4,5 Despite this, both the British Committee for Standards in Haematology\n6\n and the American College of Chest Physicians\n7\n guidelines suggest users monitor the anticoagulation through the APTT ratio. Keyl et al.\n8\n showed that in critically ill patients on argatroban there is a poor correlation between APTT values and drug concentration (r2 = 0.28) with a flattening of the dose response with increasing argatroban concentration. The APTT is known to plateau at higher levels of argatroban. In contrast, the dTT (dilute thrombin time) Hemoclot thrombin inhibitor assay (HTI) shows a linear relationship (r2 = 0.84) making it a preferable monitoring method.\n8\n\nFrench guidance on HIT management and monitoring\n9\n suggests that anti-IIa methods are more appropriate than APTT and proposed a therapeutic range of 0.5 to 1.5ug/ml but also reference a range of 0.25 to 1.5ug/ml (derived by control plasma spiked with argatroban using HTI) Tardy-Poncet et al.\n10\n The Swiss guidance\n11\n cites 0.4 to 1.5ug/ml as a target for therapy and recommend the use of monitoring by anti-IIa assay, with or without the APTT, adding the caveat that the target range for various assays has not been established in an outcome-based setting. This range maybe based on earlier work of Colucci et al.\n12\n who established that range with spiked plasma comparing the APTT ratio (by Pathromtin SL) corresponding to a range of argatroban concentrations. We have previously published patient data\n5\n showing that Pathromtin SL gave rise to a mean APTT ratio 2.13 and a poor correlation to dTT (HTI) (r2 = 0.10). APTT testing with Actin FSL gave a mean ratio of 1.58 (correlation to dTT [HTI]) was slightly better at r2 = 0.29. These reagent dependent differences in APTT ratio mean that a therapeutic range established by identifying the concentration of drug corresponding to APTT therapeutic range would be different for different APTT reagents. It could be safer to use a range which considered efficacy and safety such as the range suggested by Vu et al.\n13\n which was based on a retrospective patient study on argatroban comparing monitoring by APTT and a chromogenic anti-IIa assay giving rise to this range of 0.4 −1.2 µg/ml.\nThe British Society of Haematology Vaccine-induced Immune Thrombocytopenia and Thrombosis (VITT) guidance produced by their Expert Haematology Panel\n14\n permits use of argatroban to anticoagulate probable cases of VITT and state “Argatroban levels should ideally monitored by a direct thrombin inhibitor assay if available eg, Hemoclot as APTT correlates poorly with the argatroban effect due to high levels of Factor VIII‘.\nIn the present study we are reporting data on a cohort of 3 COVID-19 patients with HIT (n- = 60) and 5 VITT patients (n = 54) who were being treated with argatroban and who have had measurements of the APTT ratios derived from the patients baseline APTT and the mean normal APTT. In addition the argatroban plasma concentration was measured using dTT.", "Plasma from COVID-19 infected (60 samples) from 3 patients with positive HIT and VITT patients (54 samples) from 5 patients receiving argatroban were collected in 0.109 M citrate BD vacutainer (Becton Dickinson, Franklin Lakes, NJ, USA) centrifuged at 1700 g for 10 min. Consecutive patients were included where samples were available. Tests were performed either as requested for patient management or were performed on anonymized residual plasma in accordance with local ethical approval. Plasma was tested on Sysmex CS51000i (Sysmex, Milton Keynes UK) with APTT reagent Actin FS (Siemens, Erlangen, Germany). APTT Ratios were derived from the mean of normal APTT for the Actin FS (n = 20) – (which is common practice in routine monitoring) as well as the patient‘s baseline APTT in accordance with the SmPC. The argatroban concentration was determined using the dTT (HTI) (Hyphen Biomed, Neuville-sur–Oise, France) with stored calibration curve (Hyphen Biomed argatroban calibrator). The dTT uses a 1 in 8 dilution in Owrens Veronal Buffer, one part of this dilution is tested with two parts normal pooled plasma, followed by the addition of α thrombin (containing calcium); the clotting time in seconds is proportional to the concentration of argatroban in the test plasma.\nInstat version 3.05 (GraphPad Software Inc, San Diego, CA, USA) and GraphPad Prism 8 (GraphPad Software Inc) were used to perform the statistical analysis.", "Patient demographics are given in Table 1 along with baseline clotting screen and Acustar HIT results for 3 COVID-19 patients and for the 5 VITT patients the Acustar HIT results alongside the Hyphen Zymutest HIA IgG and Stago Asserchrom HIT IgG ELISA methods. The patient and samples are a low number because argatroban is indicated in very infrequent circumstances like HIT or VITT suspicion. The results are shown in Table 2 as mean results and in Table 3 as concordant and discordant with respect to APTT / argatroban level and therapeutic range. The mean APTT ratio derived according to SmPC from the baseline APTT of the patient: COVID-19 1.71 and VITT 1.33, compared to APTT ratio (derived from mean normal APTT): COVID-19 1.65 and VITT 1.48. The plasma drug concentration quantified by dTT had a mean of 0.64 µg/ml in COVID-19 and 0.53 µg/ml in VITT. Poor correlations were seen in both methods for deriving APTT ratio when compared to dTT COVID-19 baseline APTT ratio r2 = 0.1526 p <0.0001, mean normal r2 = 0.2188 p < 0.0001; VITT baseline APTT ratio r2 = 0.04 p < 0.001, VITT mean normal r2 = 0.0064 p < 0.001. Table 3 defines concordant and discordant results by APTT ratio and argatroban concentration, concordant are therefore samples with APTT ratio of 1.5 - 3.0 and argatroban concentration of 0.4 - 1.2 µg/ml (based on Vu et al.\n13\n cited range) or where both the APTT ratio and argatroban concentration are sub-therapeutic (<1.5 and 0.4 µg/ml) or supra-therapeutic (>3.0 and 1.2 µg/ml) these are shown as bold.\nGives the patients demographics including Sex, Age group, number of samples tested, with the additional baseline Clotting Screen and HIT methods used for diagnosis of HIT or VITT. Due to the nature of the patient cohorts some patients had larger samples sizes, no samples were taken during bridging to warfarin or any other anticoagulants.\nAcustar HIT = HemosIL Acustar HIT IgG Chemiluminescent method not sensitive for VITT; normal range 0 −1.0u/mL\nHyphen HIT IgG = Hyphen Zymutest HIA IgG – ELISA method suitable for VITT detection; normal range 0 −0.239 OD\nStago Asserchrom HPIA IgG – ELISA method suitable for VITT detection; normal range 0 to 0.238 OD\nNormal ranges for PT and APTT are reagent lot specific hence different ranges given.\nMean APTT in Ratios of 60 samples from 3 COVID-19 patients; and 54 samples from 5 VITT patients receiving argatroban and the correlation of these APTT ratios to the dTT (HTI). APTT ratios were calculated using patient baseline and mean normal APTT. Comparison of the two patients from the two cohorts with the most samples tested is also given. P value given is for a two-tailed paired t test, showing extremely significant differences.\nConcordant result in bold indicate both APTT ratio and argatroban concentration were sub- therapeutic, therapeutic or supra-therapeutic. APTT ratios were calculated using patient‘s baseline and mean normal APTT. Shows the Concordant (highlighted in BOLD) and discordant APTT ratios and dTT plasma drug concentration to argatroban for COVID-19 cohort and VITT cohort utilizing both the ratio obtained by utilizing the patients’ baseline APTT or by using the mean normal for the APTT. ie APTT baseline <1.5 argatroban <0.4 = 5 samples out of 19 APTT ratios of <1.5 were discordant.\nFrom the data shown in Table 2 the correlation between baseline APTT and mean normal APTT for the COVID-19 cohort r2 = 0.9382 p < 0.0001; VITT r2 = 0.9201 p < 0.0001 although statistically significant they are low and not clinically relevant.\nTable 3 demonstrates that the poor correlation significantly influences clinical management. Focusing on the use of baseline APTT as recommended by SmPC 13/19 samples in the COVID-19 cohort and 21/36 in the VITT cohort had therapeutic dTT levels despite an APTT ratio <1.5. Monitoring by APTT ratio would have resulted in unnecessary increase in the argatroban infusion rate. Conversely 8/40 in the COVID-19 cohort and 3/18 in the VITT cohort samples had subtherapeutic dTT levels despite therapeutic APTT ratio and therefore potentially would have been under anticoagulated. Finally, 3 samples in the COVID-19 cohort had dTT levels >1.4 µg/ml: 1 being sub therapeutic and the remaining two had therapeutic APTT ratios. Figures 1 and 2 shows the relationship between the APTT ratios and dTT.\n(a) shows the relationship between APTT ratios (by mean normal or patient baseline) and dTT in 3 COVID-19 patients receiving argatroban. Each point is a single APTT ratio/argatroban measurement: Open circles represents mean normal APTT ratio (regression line solid), Blue diamonds represent patients baseline APTT ratio (regression line dashes). Dotted lines denotes the therapeutic range by both APTT ratio and argatroban. (b) shows the relationship between APTT ratios (by mean normal or patient baseline) and dTT in 5 VITT patients receiving argatroban. Each point is a single APTT ratio/argatroban measurement: Open circles represents mean normal APTT ratio (regression line solid), Blue diamonds represent patients baseline APTT ratio (regression line dashes). Dotted lines denotes the therapeutic range by both APTT ratio and argatroban.", "Argatroban is recommended to be monitored by APTT according to the SmPC;\n1\n we have demonstrated in previous publications that the APTT has limitations for monitoring argatroban.4,5 In this present study we are reporting data from two patient cohorts receiving argatroban (COVID-19 and VITT), the SmPC\n1\n defines the APTT to be 1.5 to 3 times the baseline value of the patients APTT however it is not always available or known,\n2\n we investigated if there was a clinical difference if the baseline APTT was used to derive the APTT ratio or the mean normal APTT.\nSeveral anti-IIa methods have been described in the literature for measuring argatroban15,16 with the exception of LC MS/MS they can be easily performed in most specialized Coagulation/Haemostasis laboratories. Beyer et al.\n16\n has shown that dTT correlated well (r2 = 0.8428) with LC MS/MS, the HTI dTT method has also the benefit of having a commercially available standard\n15\n although in-house argatroban calibrators can be produced using normal plasma spiked with argatroban where commercial calibrators are unavailable. Another advantage of dTT levels is that they are not impacted by the plateau seen with the APTT measurements. We have seen this plateau effect in two samples received by our laboratory had very high argatroban levels, later confirmed to have been samples taken from the arm with the argatroban infusion. The APTT ratios of 4.17 and 3.66 corresponded to dTT levels of 14.8 µg/ml and 4.86 µg/ml respectively.\nOthers have previously described argatroban resistance in patients which has been caused by increased levels of Factor VIII where the APTT has stayed the same despite increasing the dose of argatroban.17,18 McGlynn et al.\n19\n specifically demonstrated a COVID-19 patient treated with argatroban with Factor VIII 477 IU/dL, which had baseline APTT 23 s. Factor VIII assays (FVIII:C) were not performed on all the samples in the data provided and this is a limitation in the study; however one of COVID-19 patient and one VITT patient had a FVIII:C performed utilizing the Biophen Chromogenic FVIII Assay, (Hyphen Biomed, Neuville-sur–Oise, France, normal range 62 to 199 IU/dL). COVID-19 patient had FVIII:C 458 IU/dL with a corresponding argatroban level of 0.51 µg/ml with an APTT 33.2 s (normal range 19.2- 28.5 s), baseline APTT ratio 1.53, mean normal APTT ratio 1.41, dosing may have been altered if the APTT ratios were used as they were around the lower target of therapeutic range despite therapeutic argatroban levels. The VITT patient had FVIII:C 294 IU/dL with a corresponding argatroban level of 0.78 µg/ml, APTT 27.2 s, baseline APTT ratio 1.00, mean normal APTT ratio 1.16, this high FVIII:C level is reducing the APTT and would lead the clinician to increasing the argatroban infusion unnecessarily.\nFor all patients except one we targeted therapeutic anticoagulation with argatroban. In one VITT case with cerebral vein thrombosis, extensive intracerebral haemorrhage and thrombocytopenia the argatroban was used at the critical illness concentration without dose escalation.\nWith respect to how the APTT ratio is derived there is little difference between the mean results obtained: COVID-19 baseline APTT 1.71 v mean normal 1.65; although the VITT cohort had mean results below the target therapeutic range (baseline APTT 1.33 v mean normal 1.48) this may reflect that 36 datasets were from the patient targeted with the critical illness concentration without dose escalation whose Factor VIII was also high (294 IU/dL).\nDespite most laboratories using the APTT we believe the dTT is superior to monitoring the concentration of argatroban. We have shown significant differences between APTT ratios and dTT levels which would have clinical impact. This is especially so in COVID-19 and VITT where the high FVIII levels can influence the APTT." ]

[ "intro", "methods", "results", "discussion" ]

[ "COVID-19", "VITT", "argatroban", "APTT", "dilute thrombin time" ]

[]

[ "aptt", "argatroban", "ratio", "aptt ratio", "vitt", "mean", "baseline", "normal", "patients", "19" ]

[ "argatroban infusion rate", "monitor anticoagulant activated", "thrombocytopenia argatroban", "thromboplastin time aptt", "anticoagulation aptt ratio" ]

[ "Adolescent", "Adult", "Aged", "Behavior Therapy", "Behavior, Addictive", "Cross-Sectional Studies", "Female", "Humans", "Male", "Middle Aged", "Motivation", "Patient Compliance", "Psychometrics", "Reproducibility of Results", "Self Efficacy", "Social Environment", "Substance-Related Disorders", "Surveys and Questionnaires", "Young Adult" ]

[ "\nI. Item generation\n", "\nA. Interview with 21 participants.\n", "\nB. Review of literature\n", "\nII. Making an initial questionnaire\n", "\nIII. Content validity\n", "\nIV. Exploratory factor analysis\n", "\nV. Reliability\n", "Highlights" ]

[ "\nInterview and review of literature identified reasons and motivations associated with the action and continuity of abandonment\n", "\nParticipants were volunteers, including physicians, psychotherapists (with working experience in addiction treatment clinics) and outpatients. The main question was “What are the reasons for treatment retention among clients in addiction clinics”. Briefly, the following steps were taken for conventional content analysis:\n\n Writing and implementation of the interview\n\nReading the text for understanding\n\n\nDetermining the meaning of primary codes\n\n\nClassification of the same primary codes in categories\n\n\nDetermining the content within the data.\n\n\nThe interviews lasted for 30-40 min. All interviews were recorded and transcribed verbatim; of course, the verbal permission had already been taken for recording and transcription.\n\n\nThe consistency of ideas and experiences was examined in the transcripts. Then, a detailed list of meaning units was formed from each interview transcript. They were coded into the various sub-categories. The categories were formed based on the similarities and differences between each sub-category.\n\n\nIn addition, the meaning units and sub-categories were reviewed and approved by some of the participants and experts in the field of qualitative research and addiction treatment.\n", "\nOne hundred and twenty cross-sectional studies published by Elsevier, Science Direct, external and internal valid scientific sites (mostly specific and related to addiction) were chosen by searching in Google Scholar. Key words used were “addiction, treatment, motivation, readiness, maintenance and factors”. Finally 23 articles (13 internal and 10 external) were used and evaluated. They have greater sample size and more citations than the others.\n\n\nThese items were associated with the action and continuity of abandonment. For example, negative attitudes towards consumption, external pressures, the consequences of abuse, fear of legal troubles, humiliation, loss of job, the family's insistence, for children and parents, saving family communications, family support (family’s care and company, assistance of spouse) and others.\n", "\nBased on literature review and interviews, a framework was identified in order to develop the initial questionnaire. The initial questionnaire contained 40 items. The content validity of the questionnaire was examined by thirteen specialists from different disciplines, including health educator, physicians and psychotherapists. The purpose of this step was to ensure that the instrument was clear and culturally relevant.\n", "\nContent validity was applied in two phases (qualitative and quantitative). The qualitative phase was conducted by 13 experts who reviewed the items of the questionnaire for grammar, wording, item allocation and scaling. The quantitative phase was conducted to calculate CVI and CVR. CVR examines the essentiality of each item for the Iranian culture by using 3-points rating scale (essential, useful but not essential and not essential). The CVR for every item was calculated using the formula CVR = [Ne − (𝑁/2)] ÷ (𝑁/2) (Ne is the number of panelists indicating \"essential\" for each particular item and N is the total number of panelists). The numeric value of CVR was determined by Lawshe table, accordingly, an acceptable CVR value for 13 panelists is 0.54(19). To obtain CVI for relevancy, simplicity and clarity of each item, ordinal scale with four possible responses were used. The responses included a rating from 1 = not relevant, not simple and not clear to 4 = very relevant, very simple and very clear. The number of those judging the item as relevant or clear (rating 3 or 4) was divided by the number of content experts. Polite and Beck recommended 0.79 as the acceptable lower limit for CVI value 20).\n\n\nConsequently, 10 items were removed and a primary version of the questionnaire with 30 items was developed (CVI >0.79 and CVR >0.54).\n", "\nConstruct validity was determined through exploratory factor analysis (EFA). EFA was performed to determine the dimensionality of the questionnaire using the principal component analysis with varimax rotation. Factor loading values of 0.5 or higher were considered acceptable and showed that there was an important relationship between items and factors. In order to evaluate sampling adequacy to perform a satisfactory factor analysis, KMO Measure of Sampling Adequacy and Bartlett test was high values of KMO (more than 0.7) generally indicated that a factor analysis may be useful with the data. The criteria used to determine the subscales (factors) were minimum Eigenvalues >1.00 (Kaiser Criterion) 21.\n", "\nTo determine the reliability of the instrument, the internal consistency was tested using the Cronbach’s alpha coefficient. Reliability of the scale was determined by computing Cronbach’s Alpha as an internal consistency coefficient (α>0.7). Cronbach’s coefficient alpha (α) was calculated separately for total scale and each item.\n\n\nAt the first stage, sampling was conducted based on the cluster method. Each cluster was in different sections of the city. Ten addiction treatment clinics were chosen, among one hundred and four clinics within the designated metropolitan area of the study population. Each clinic was in different section of the city at the second stage, patients in each clinic were selected through simple sampling method, based on performance capacity of the data collection.\n\n\nThe sample size was estimated based on the number of items in the questionnaire multiplied by 6-10 as recommended (300 participants). The sample size was determined by scientific references in exploratory factor analysis19. Data were analyzed using SPSS 16 software (Chicago, IL, USA).\n", "\nFamily factors, threats, friend’s factors and self-efficacy are significant factors in substance abuse treatment.\n\n\nThere is the lack of an instrument for measuring factors related to addiction treatment for Iranian conditions.\n\n This study suggests a reliable and valid questionnaire to determine the reason for addiction treatment." ]

[ null, null, null, null, null, null, null, null ]

[ "Introduction", "Methods", "\nI. Item generation\n", "\nA. Interview with 21 participants.\n", "\nB. Review of literature\n", "\nII. Making an initial questionnaire\n", "\nIII. Content validity\n", "\nIV. Exploratory factor analysis\n", "\nV. Reliability\n", "Results", "Discussion", "Conclusions", "Acknowledgments", "Conflict of interest statement", "Highlights" ]

[ "\n“Drug abuse is a chronic, relapsing brain disease identified by compulsive substance seeking and use, despite harmful consequences”1. Substance dependency is an illness that can affect anyone, regardless of being male or female, young or old, rich or poor and any race and ethnicity2. The prevalence of drug use disorders is estimated 35/1000 persons in the Eastern Mediterranean Region3. Addiction is a problem for public health, one of the main causes of crime, disorder, family breakdown and community disintegration4 with high costs for both addicts’ population and the society5.\n\n\nAlthough, different programs for prevention and rehabilitation were designed and implemented, the addicts’ population remained high in most parts of the world6. Motivations and readiness for treatment are salient factors7. The basic component of quitting addiction is the reason for taking action against addiction8. Motivational factors at the beginning of treatment can positively impact success in the treatment9.\n\n\nSocial stability; previous experience and expectations of treatment, and higher motivation were predictors of addiction treatment retention10. Attitudes towards continued substance abuse, partners and community stigma; perceptions of cessation and drug treatment are significant items for treatment11.\n\n\nSome of the factors that determine addiction treatment include self-hatred, shame and humiliation related to substance abuse, negative beliefs and feelings about addiction, stigma and distrust; positive feeling about acceptance and well-being to life12. In the field of treatment, the most significant factors to stop drug abuse proved to be economic, social and empowering individuals13.\n\n\nAddiction treatment intentions are motives ranging from internal to external influences, including a negative impact on oneself and others; influence of family, peers, partners and community stigma 11 and similar factors. These are also very important for predicting treatment success. Influence of family, peers and partners are motives behind drug addiction treatment14.\n\n\nAddiction treatment studies have shown that self-efficacy is a major predictor for health behaviors. Motivational level, consequences of addiction and criminal history are other factors to be considered in taking action against addiction7. Addiction is a chronic disease; hence, addiction treatment requires long-term management15‏. Understanding the role of personal motivation in addiction treatment is very important for a better perception of relapse and treatment retention. There is experimental evidence that treatment motivation and readiness are closely related to retention16. Therefore, the factors influencing the addiction abandonment are different.\n\n\nThese are several instruments for measuring factors related to addiction treatment motivations for example: TCU Motivation tests that assess motivation for treatment concerning desire for help, treatment readiness and pressures for treatment12, the readiness to change questionnaire in Addiction17; Barriers to treatment inventory (BTI) 18. But, there is the lack of an instrument for measuring factors related to addiction treatment motivations among outpatient referred to addiction treatment clinics for Iranian conditions.\n\n\nThis study aimed to develop a valid questionnaire to determine the reason for addiction treatment among outpatient referred to addiction treatment clinics, by determining the content validity of measures based on the obtained opinions from specialists and participants, and for evaluating the factor structure of the scale using exploratory factor analysis EFA); and assessing reliability of the questionnaire using internal consistency.\n", "\nThis cross-sectional validation study was performed in Bojnourd, North East of Iran from May to September 2014. The inclusion criteria were the addicted people referred to addiction treatment clinics (outpatients) and consent to participate in the study. At least, they used a type of drug. The exclusion criteria included did not agree to participate in the study. Participants were selected using a multistage random sampling method. All participants agreed to complete the questionnaires.\n\n\nInformed assent and consent were obtained from participants. The study was conducted with approval from Tarbiat Modares University’ Institutional Review Board and Ethical Committee.\n\n\nData collection methods were based on anonymous questionnaires completed by the participants, and also among the illiterate people by trained psychologists in ten clinics. Patients completed a questionnaire on a Likert scale of 1-5, strongly disagree= 1, disagree= 2, no idea=3, agree= 4 and strongly agree= 5. The questionnaire was developed through the following steps (Figure 1):‏\n\n A Flow Chart Depicting the Process Used to Evaluating the Psychometric Properties\n \nI. Item generation\n \nInterview and review of literature identified reasons and motivations associated with the action and continuity of abandonment\n\n\nInterview and review of literature identified reasons and motivations associated with the action and continuity of abandonment\n\n \nA. Interview with 21 participants.\n \nParticipants were volunteers, including physicians, psychotherapists (with working experience in addiction treatment clinics) and outpatients. The main question was “What are the reasons for treatment retention among clients in addiction clinics”. Briefly, the following steps were taken for conventional content analysis:\n\n Writing and implementation of the interview\n\nReading the text for understanding\n\n\nDetermining the meaning of primary codes\n\n\nClassification of the same primary codes in categories\n\n\nDetermining the content within the data.\n\n\nThe interviews lasted for 30-40 min. All interviews were recorded and transcribed verbatim; of course, the verbal permission had already been taken for recording and transcription.\n\n\nThe consistency of ideas and experiences was examined in the transcripts. Then, a detailed list of meaning units was formed from each interview transcript. They were coded into the various sub-categories. The categories were formed based on the similarities and differences between each sub-category.\n\n\nIn addition, the meaning units and sub-categories were reviewed and approved by some of the participants and experts in the field of qualitative research and addiction treatment.\n\n\nParticipants were volunteers, including physicians, psychotherapists (with working experience in addiction treatment clinics) and outpatients. The main question was “What are the reasons for treatment retention among clients in addiction clinics”. Briefly, the following steps were taken for conventional content analysis:\n\n Writing and implementation of the interview\n\nReading the text for understanding\n\n\nDetermining the meaning of primary codes\n\n\nClassification of the same primary codes in categories\n\n\nDetermining the content within the data.\n\n\nThe interviews lasted for 30-40 min. All interviews were recorded and transcribed verbatim; of course, the verbal permission had already been taken for recording and transcription.\n\n\nThe consistency of ideas and experiences was examined in the transcripts. Then, a detailed list of meaning units was formed from each interview transcript. They were coded into the various sub-categories. The categories were formed based on the similarities and differences between each sub-category.\n\n\nIn addition, the meaning units and sub-categories were reviewed and approved by some of the participants and experts in the field of qualitative research and addiction treatment.\n\n \nB. Review of literature\n \nOne hundred and twenty cross-sectional studies published by Elsevier, Science Direct, external and internal valid scientific sites (mostly specific and related to addiction) were chosen by searching in Google Scholar. Key words used were “addiction, treatment, motivation, readiness, maintenance and factors”. Finally 23 articles (13 internal and 10 external) were used and evaluated. They have greater sample size and more citations than the others.\n\n\nThese items were associated with the action and continuity of abandonment. For example, negative attitudes towards consumption, external pressures, the consequences of abuse, fear of legal troubles, humiliation, loss of job, the family's insistence, for children and parents, saving family communications, family support (family’s care and company, assistance of spouse) and others.\n\n\nOne hundred and twenty cross-sectional studies published by Elsevier, Science Direct, external and internal valid scientific sites (mostly specific and related to addiction) were chosen by searching in Google Scholar. Key words used were “addiction, treatment, motivation, readiness, maintenance and factors”. Finally 23 articles (13 internal and 10 external) were used and evaluated. They have greater sample size and more citations than the others.\n\n\nThese items were associated with the action and continuity of abandonment. For example, negative attitudes towards consumption, external pressures, the consequences of abuse, fear of legal troubles, humiliation, loss of job, the family's insistence, for children and parents, saving family communications, family support (family’s care and company, assistance of spouse) and others.\n\n \nII. Making an initial questionnaire\n \nBased on literature review and interviews, a framework was identified in order to develop the initial questionnaire. The initial questionnaire contained 40 items. The content validity of the questionnaire was examined by thirteen specialists from different disciplines, including health educator, physicians and psychotherapists. The purpose of this step was to ensure that the instrument was clear and culturally relevant.\n\n\nBased on literature review and interviews, a framework was identified in order to develop the initial questionnaire. The initial questionnaire contained 40 items. The content validity of the questionnaire was examined by thirteen specialists from different disciplines, including health educator, physicians and psychotherapists. The purpose of this step was to ensure that the instrument was clear and culturally relevant.\n\n \nIII. Content validity\n \nContent validity was applied in two phases (qualitative and quantitative). The qualitative phase was conducted by 13 experts who reviewed the items of the questionnaire for grammar, wording, item allocation and scaling. The quantitative phase was conducted to calculate CVI and CVR. CVR examines the essentiality of each item for the Iranian culture by using 3-points rating scale (essential, useful but not essential and not essential). The CVR for every item was calculated using the formula CVR = [Ne − (𝑁/2)] ÷ (𝑁/2) (Ne is the number of panelists indicating \"essential\" for each particular item and N is the total number of panelists). The numeric value of CVR was determined by Lawshe table, accordingly, an acceptable CVR value for 13 panelists is 0.54(19). To obtain CVI for relevancy, simplicity and clarity of each item, ordinal scale with four possible responses were used. The responses included a rating from 1 = not relevant, not simple and not clear to 4 = very relevant, very simple and very clear. The number of those judging the item as relevant or clear (rating 3 or 4) was divided by the number of content experts. Polite and Beck recommended 0.79 as the acceptable lower limit for CVI value 20).\n\n\nConsequently, 10 items were removed and a primary version of the questionnaire with 30 items was developed (CVI >0.79 and CVR >0.54).\n\n\nContent validity was applied in two phases (qualitative and quantitative). The qualitative phase was conducted by 13 experts who reviewed the items of the questionnaire for grammar, wording, item allocation and scaling. The quantitative phase was conducted to calculate CVI and CVR. CVR examines the essentiality of each item for the Iranian culture by using 3-points rating scale (essential, useful but not essential and not essential). The CVR for every item was calculated using the formula CVR = [Ne − (𝑁/2)] ÷ (𝑁/2) (Ne is the number of panelists indicating \"essential\" for each particular item and N is the total number of panelists). The numeric value of CVR was determined by Lawshe table, accordingly, an acceptable CVR value for 13 panelists is 0.54(19). To obtain CVI for relevancy, simplicity and clarity of each item, ordinal scale with four possible responses were used. The responses included a rating from 1 = not relevant, not simple and not clear to 4 = very relevant, very simple and very clear. The number of those judging the item as relevant or clear (rating 3 or 4) was divided by the number of content experts. Polite and Beck recommended 0.79 as the acceptable lower limit for CVI value 20).\n\n\nConsequently, 10 items were removed and a primary version of the questionnaire with 30 items was developed (CVI >0.79 and CVR >0.54).\n\n \nIV. Exploratory factor analysis\n \nConstruct validity was determined through exploratory factor analysis (EFA). EFA was performed to determine the dimensionality of the questionnaire using the principal component analysis with varimax rotation. Factor loading values of 0.5 or higher were considered acceptable and showed that there was an important relationship between items and factors. In order to evaluate sampling adequacy to perform a satisfactory factor analysis, KMO Measure of Sampling Adequacy and Bartlett test was high values of KMO (more than 0.7) generally indicated that a factor analysis may be useful with the data. The criteria used to determine the subscales (factors) were minimum Eigenvalues >1.00 (Kaiser Criterion) 21.\n\n\nConstruct validity was determined through exploratory factor analysis (EFA). EFA was performed to determine the dimensionality of the questionnaire using the principal component analysis with varimax rotation. Factor loading values of 0.5 or higher were considered acceptable and showed that there was an important relationship between items and factors. In order to evaluate sampling adequacy to perform a satisfactory factor analysis, KMO Measure of Sampling Adequacy and Bartlett test was high values of KMO (more than 0.7) generally indicated that a factor analysis may be useful with the data. The criteria used to determine the subscales (factors) were minimum Eigenvalues >1.00 (Kaiser Criterion) 21.\n\n \nV. Reliability\n \nTo determine the reliability of the instrument, the internal consistency was tested using the Cronbach’s alpha coefficient. Reliability of the scale was determined by computing Cronbach’s Alpha as an internal consistency coefficient (α>0.7). Cronbach’s coefficient alpha (α) was calculated separately for total scale and each item.\n\n\nAt the first stage, sampling was conducted based on the cluster method. Each cluster was in different sections of the city. Ten addiction treatment clinics were chosen, among one hundred and four clinics within the designated metropolitan area of the study population. Each clinic was in different section of the city at the second stage, patients in each clinic were selected through simple sampling method, based on performance capacity of the data collection.\n\n\nThe sample size was estimated based on the number of items in the questionnaire multiplied by 6-10 as recommended (300 participants). The sample size was determined by scientific references in exploratory factor analysis19. Data were analyzed using SPSS 16 software (Chicago, IL, USA).\n\n\nTo determine the reliability of the instrument, the internal consistency was tested using the Cronbach’s alpha coefficient. Reliability of the scale was determined by computing Cronbach’s Alpha as an internal consistency coefficient (α>0.7). Cronbach’s coefficient alpha (α) was calculated separately for total scale and each item.\n\n\nAt the first stage, sampling was conducted based on the cluster method. Each cluster was in different sections of the city. Ten addiction treatment clinics were chosen, among one hundred and four clinics within the designated metropolitan area of the study population. Each clinic was in different section of the city at the second stage, patients in each clinic were selected through simple sampling method, based on performance capacity of the data collection.\n\n\nThe sample size was estimated based on the number of items in the questionnaire multiplied by 6-10 as recommended (300 participants). The sample size was determined by scientific references in exploratory factor analysis19. Data were analyzed using SPSS 16 software (Chicago, IL, USA).\n", "\nInterview and review of literature identified reasons and motivations associated with the action and continuity of abandonment\n", "\nParticipants were volunteers, including physicians, psychotherapists (with working experience in addiction treatment clinics) and outpatients. The main question was “What are the reasons for treatment retention among clients in addiction clinics”. Briefly, the following steps were taken for conventional content analysis:\n\n Writing and implementation of the interview\n\nReading the text for understanding\n\n\nDetermining the meaning of primary codes\n\n\nClassification of the same primary codes in categories\n\n\nDetermining the content within the data.\n\n\nThe interviews lasted for 30-40 min. All interviews were recorded and transcribed verbatim; of course, the verbal permission had already been taken for recording and transcription.\n\n\nThe consistency of ideas and experiences was examined in the transcripts. Then, a detailed list of meaning units was formed from each interview transcript. They were coded into the various sub-categories. The categories were formed based on the similarities and differences between each sub-category.\n\n\nIn addition, the meaning units and sub-categories were reviewed and approved by some of the participants and experts in the field of qualitative research and addiction treatment.\n", "\nOne hundred and twenty cross-sectional studies published by Elsevier, Science Direct, external and internal valid scientific sites (mostly specific and related to addiction) were chosen by searching in Google Scholar. Key words used were “addiction, treatment, motivation, readiness, maintenance and factors”. Finally 23 articles (13 internal and 10 external) were used and evaluated. They have greater sample size and more citations than the others.\n\n\nThese items were associated with the action and continuity of abandonment. For example, negative attitudes towards consumption, external pressures, the consequences of abuse, fear of legal troubles, humiliation, loss of job, the family's insistence, for children and parents, saving family communications, family support (family’s care and company, assistance of spouse) and others.\n", "\nBased on literature review and interviews, a framework was identified in order to develop the initial questionnaire. The initial questionnaire contained 40 items. The content validity of the questionnaire was examined by thirteen specialists from different disciplines, including health educator, physicians and psychotherapists. The purpose of this step was to ensure that the instrument was clear and culturally relevant.\n", "\nContent validity was applied in two phases (qualitative and quantitative). The qualitative phase was conducted by 13 experts who reviewed the items of the questionnaire for grammar, wording, item allocation and scaling. The quantitative phase was conducted to calculate CVI and CVR. CVR examines the essentiality of each item for the Iranian culture by using 3-points rating scale (essential, useful but not essential and not essential). The CVR for every item was calculated using the formula CVR = [Ne − (𝑁/2)] ÷ (𝑁/2) (Ne is the number of panelists indicating \"essential\" for each particular item and N is the total number of panelists). The numeric value of CVR was determined by Lawshe table, accordingly, an acceptable CVR value for 13 panelists is 0.54(19). To obtain CVI for relevancy, simplicity and clarity of each item, ordinal scale with four possible responses were used. The responses included a rating from 1 = not relevant, not simple and not clear to 4 = very relevant, very simple and very clear. The number of those judging the item as relevant or clear (rating 3 or 4) was divided by the number of content experts. Polite and Beck recommended 0.79 as the acceptable lower limit for CVI value 20).\n\n\nConsequently, 10 items were removed and a primary version of the questionnaire with 30 items was developed (CVI >0.79 and CVR >0.54).\n", "\nConstruct validity was determined through exploratory factor analysis (EFA). EFA was performed to determine the dimensionality of the questionnaire using the principal component analysis with varimax rotation. Factor loading values of 0.5 or higher were considered acceptable and showed that there was an important relationship between items and factors. In order to evaluate sampling adequacy to perform a satisfactory factor analysis, KMO Measure of Sampling Adequacy and Bartlett test was high values of KMO (more than 0.7) generally indicated that a factor analysis may be useful with the data. The criteria used to determine the subscales (factors) were minimum Eigenvalues >1.00 (Kaiser Criterion) 21.\n", "\nTo determine the reliability of the instrument, the internal consistency was tested using the Cronbach’s alpha coefficient. Reliability of the scale was determined by computing Cronbach’s Alpha as an internal consistency coefficient (α>0.7). Cronbach’s coefficient alpha (α) was calculated separately for total scale and each item.\n\n\nAt the first stage, sampling was conducted based on the cluster method. Each cluster was in different sections of the city. Ten addiction treatment clinics were chosen, among one hundred and four clinics within the designated metropolitan area of the study population. Each clinic was in different section of the city at the second stage, patients in each clinic were selected through simple sampling method, based on performance capacity of the data collection.\n\n\nThe sample size was estimated based on the number of items in the questionnaire multiplied by 6-10 as recommended (300 participants). The sample size was determined by scientific references in exploratory factor analysis19. Data were analyzed using SPSS 16 software (Chicago, IL, USA).\n", "\nA total of 300 participants, 80.6% male and 19.4% female completed the questionnaire. The respondents were aged between 16 and 71 year of mean age of 39.4±12.06. Most of them were married (78.62% married, 14% single, and 7.38 % divorced). They used opium (39%), cooked dross (36%), heroin (5.7%), methamphetamine (10%) and others were multiple drug user. The average lifetime drug use among participants was 15.12±10.03 year (range = 1 to 46 year).\n\n\nContent validity was calculated. According to the Lawshe table Items with CVI >0.79 and CVR >0.54 was remained. Construct validity was determined. In the first step, Kaiser-Meyer-Olkin (KMO = 0.88) and Bartlett's Test (P<0.01, df= 595 , x2=5195.65 ) showed the adequacy of the sample size. Principal component analysis with Varimax rotation identified eight factors (Eigenvalues >1.0, factor loading cut off ≥ 0.5) which explained 60.6% of the variance in the data.\n\n\nNext, 8 items were removed from the questionnaire that seemed to be similar or unrelated items. The remaining 22 items were subjected to principal components analysis with varimax rotation that showed a good fit of 4-factor solution for the questionnaire.\n\n\nThe four factors were: Family’s Factors (five items), Treats (eight items), Friend’s Factors (four items), and Self-Efficacy (five items) and explained variance (%) of each factor (Table 1).\n\n\nInternal consistency of the questionnaire was examined by computing the Cronbach’s alpha that gave a satisfactory value of 0.896. Cronbach’s coefficient alpha (α) was calculated separately for total scale and each item (Table 2).\n", "\nAccording to the results, four factors were related to motives of addiction treatment including family factors, threats, friend’s factors and self-efficacy, which is in line with previous studies7,14,16.\n\n\nThe family and friends factors are the two components related to addiction treatment. Family and friends factors included supported by them and motivation to comply with them. In this regard, the likelihood of drug abuse was greater among those who engaged in emotional and social problems, such as psychological problems and family dispute compared with their counterparts who did not engage in such problems22.\n\n\nFamily support is a positive factor in addiction rehabilitation23. Family and friends support is a type of emotional support24. Family support and other types of social support are mechanisms of changes in treatment 25. Social support is one of the essential services to stop or reduce substance abuse. In other words, motivation to comply with family and friends were associated with the action and continuity of addiction treatment 26-27.\n\n\nThis study showed that the role of family and friends is common in social support and motivation to comply among the addicted population. Previous researches showed some similarities with our results14,23.\n\n\nThe present study indicated that “threats” was another significant factor in addiction treatment. Threats vary and include loosing job and money, the consequences of abuse, fear of legal troubles, going to jail, losing families; and the severity28. Treatment motivation was positively correlated with problem severity29 and the consequences of drug abuse were important predictors of motivation to addiction treatment30.\n\n\nThe other factor is self-efficacy; in this study, it was measured using five items. According to Bandura self-efficacy is the most important precondition for behavioral change 31, self-efficacy is a psychological construct of central importance in understanding human behavior 32 and directly affects on performance 33. It is one of the directly related predictors in quitting 34. Increasing the self-efficacy is the most effective in substance abuse treatment 32,35. It may be the best effective addiction treatment that increases self-efficacy36. Higher self-efficacy, is a predictor of making a quit attempt37. Self-efficacy is as an important predictor of outcome, or as a mediator of substance abuse treatment 38.\n\n\nThe major limitation of this study was the lack of control on drug types used by the participants. Confirmatory factor analysis was another limitation because it needed new samples and more time.\n", "\nThis study designed questionnaire with 22 items and suggested a reliable and valid instrument with four factors related to motives of addiction treatment, including: family factors, threats, friend’s factors and self-efficacy. The questioner can be used as an instrument in substance abuse treatment because it is valid and reliable.\n", "\nWe would like to appreciate all the participants and participating clinics and others who helped us in this research.\n\n\nThis manuscript was based on the thesis of Hamid Tavakoli Ghouchani, with reference number 52/4470 D, supported by the Research and Technology Deputy of Research and Technology (Tarbiat Modares University).\n", "\nThe authors declare that there is no conflict of interest regarding the publication of this paper.\n", "\nFamily factors, threats, friend’s factors and self-efficacy are significant factors in substance abuse treatment.\n\n\nThere is the lack of an instrument for measuring factors related to addiction treatment for Iranian conditions.\n\n This study suggests a reliable and valid questionnaire to determine the reason for addiction treatment." ]

[ "introduction", "methods", null, null, null, null, null, null, null, "results", "discussion", "conclusions", "acknowledgments", "COI-statement", null ]

[ "Psychometrics", "Motivations", "Treatment", "Substance Abuse", "Outpatients" ]

[ 19, 209, 154, 68, 274, 121, 196, 57 ]

[ "treatment", "addiction", "questionnaire", "factors", "addiction treatment", "items", "family", "factor", "item", "cvr" ]

[ "individuals13 addiction treatment", "effective addiction treatment", "determine addiction treatment", "addiction treatment retention10", "addiction treatment motivations" ]

[ "Aged", "Anastomosis, Surgical", "Anastomotic Leak", "Esophageal Diseases", "Esophagectomy", "Female", "Fluorescein Angiography", "Humans", "Intraoperative Period", "Lasers", "Male", "Middle Aged", "Stomach" ]

[ "METHODS", "Laser-assisted Indocyanine Green Fluorescent-Dye Angiography", "Safety of Indocyanine Green", "Intraoperative Assessment of Graft Perfusion and Placement of the Anastomosis", "Assessment of Anastomotic Healing", "Statistical Analysis" ]

[ "After initially using intraoperative LAA on several esophagectomies with GPU we saw that perfusion in the tip of the gastric graft as assessed visibly with the SPY system was variable. In some patients, the entire graft showed rapid, bright perfusion by LAA (Fig. 1). Often, though, there was a point of demarcation where rapid and bright perfusion transitioned into slower and less robust perfusion. We prospectively decided to evaluate the utility of LAA by placing a suture at the site of this transition if present, and recording in the operative note the location of the anastomosis relative to the suture (proximal vs distal to the stitch) (Fig. 2). During this time, we used standard techniques including our clinical judgment and Doppler to evaluate graft perfusion for placement of the anastomosis. In addition to noting the site of a transition in perfusion by LAA if present, we also noted the proximal-most extent of the Doppler signal. We subsequently evaluated the outcome of these anastomoses by retrospectively reviewing the records of these patients. The study was approved by the University of Southern California institutional review board.\nRapid and bright perfusion of the entire gastric graft by LAA.\nA transition point is seen between rapid and bright versus slower, less robust perfusion (arrow). A suture is placed at the site of this transition point and if possible the anastomosis was placed proximal to this suture in an area of good perfusion by LAA.\n Laser-assisted Indocyanine Green Fluorescent-Dye Angiography The SPY Imaging System is designed to acquire fluorescence images. This is achieved using a fluorescent agent, indocyanine green (ICG), which upon intravascular administration is rapidly and extensively (>98%) bound to plasma proteins. The ICG is a sterile, water soluble, tricarbocyanine dye with a peak spectral absorption at 800 to 810 nm in blood. It is taken up by the liver and excreted unchanged into the bile. The plasma half-life of ICG is 3 to 5 minutes. The ICG is caused to fluoresce by illumination with a laser at 806 nm. The ICG molecules absorb the light, get “excited,” drop back to an “unexcited” state, and emit light in a longer wavelength. Fluorescence images of the GPU graft are acquired using a charge coupled device video camera, sensitive into the near infrared, and equipped with an edge filter to permit efficient transmission of fluorescent light (in the range 815–880 nm) while blocking laser and room light. The images are visible in real-time on a monitor and are captured to hard drive for analysis, future review, and archiving.\nThe SPY Imaging System is designed to acquire fluorescence images. This is achieved using a fluorescent agent, indocyanine green (ICG), which upon intravascular administration is rapidly and extensively (>98%) bound to plasma proteins. The ICG is a sterile, water soluble, tricarbocyanine dye with a peak spectral absorption at 800 to 810 nm in blood. It is taken up by the liver and excreted unchanged into the bile. The plasma half-life of ICG is 3 to 5 minutes. The ICG is caused to fluoresce by illumination with a laser at 806 nm. The ICG molecules absorb the light, get “excited,” drop back to an “unexcited” state, and emit light in a longer wavelength. Fluorescence images of the GPU graft are acquired using a charge coupled device video camera, sensitive into the near infrared, and equipped with an edge filter to permit efficient transmission of fluorescent light (in the range 815–880 nm) while blocking laser and room light. The images are visible in real-time on a monitor and are captured to hard drive for analysis, future review, and archiving.\n Safety of Indocyanine Green Indocyanine green (ICG) has been approved for use in humans and has been extensively used for determining cardiac output, hepatic function, liver blood flow, for ophthalmologic angiography, and during cardiac bypass and plastic and reconstructive surgery. The incidence of adverse reactions to ICG is low and most are mild (sore throat, feeling of warmth). Rare reports describe hypotension requiring treatment with epinephrine. Caution is recommended in patients with iodine or shellfish allergy.\nIndocyanine green (ICG) has been approved for use in humans and has been extensively used for determining cardiac output, hepatic function, liver blood flow, for ophthalmologic angiography, and during cardiac bypass and plastic and reconstructive surgery. The incidence of adverse reactions to ICG is low and most are mild (sore throat, feeling of warmth). Rare reports describe hypotension requiring treatment with epinephrine. Caution is recommended in patients with iodine or shellfish allergy.\n Surgical Procedure All patients underwent esophagectomy with a transhiatal, en bloc transthoracic, minimally invasive thoracoscopic/laparoscopic or vagal-sparing approach. The tubularized gastric graft was brought up through the posterior mediastinum and a handsewn single-layer cervical anastomosis onto the anterior wall of the gastric pull-up was performed in all patients.\nAll patients underwent esophagectomy with a transhiatal, en bloc transthoracic, minimally invasive thoracoscopic/laparoscopic or vagal-sparing approach. The tubularized gastric graft was brought up through the posterior mediastinum and a handsewn single-layer cervical anastomosis onto the anterior wall of the gastric pull-up was performed in all patients.\n Intraoperative Assessment of Graft Perfusion and Placement of the Anastomosis After creating a 3- to 4-cm wide gastric tube, but before bringing the graft up to the neck, the SPY system was used to assess graft perfusion. The time between gastric tube creation and LAA was approximately 15 minutes. Images were obtained beginning 5 seconds after intravenous central-line injection of 2.5 mg of ICG followed by a 5 mL flush of saline. This dose was recommended by Novadaq and provided excellent visualization of microperfusion in the gastric grafts. After LAA assessment of perfusion and placement of a suture, if a transition point was seen, the graft was brought up to the neck through the posterior mediastinum. The anastomosis was placed in a suitable area of the anterior wall of the gastric graft, and the location of the anastomosis relative to the suture, if present, was recorded in the operative note. An effort was always made to place the anastomosis proximal to the suture, in an area of good perfusion by LAA, but in patients where the anastomosis would not reach to a portion of stomach proximal to the suture it was placed at or distal to the suture.\nAfter creating a 3- to 4-cm wide gastric tube, but before bringing the graft up to the neck, the SPY system was used to assess graft perfusion. The time between gastric tube creation and LAA was approximately 15 minutes. Images were obtained beginning 5 seconds after intravenous central-line injection of 2.5 mg of ICG followed by a 5 mL flush of saline. This dose was recommended by Novadaq and provided excellent visualization of microperfusion in the gastric grafts. After LAA assessment of perfusion and placement of a suture, if a transition point was seen, the graft was brought up to the neck through the posterior mediastinum. The anastomosis was placed in a suitable area of the anterior wall of the gastric graft, and the location of the anastomosis relative to the suture, if present, was recorded in the operative note. An effort was always made to place the anastomosis proximal to the suture, in an area of good perfusion by LAA, but in patients where the anastomosis would not reach to a portion of stomach proximal to the suture it was placed at or distal to the suture.\n Assessment of Anastomotic Healing A videoesophagram was routinely obtained at 5 to 7 days postoperatively, and if there was evidence of a leak or abnormality, or when indicated by clinical deterioration of the patient, upper endoscopy was performed. If a leak was evident either by videoesophagram or by upper endoscopy, the patient was classified as having an anastomotic leak. Furthermore, for this study, the leak was defined as minor when conservative treatment with antibiotics or nil per os was sufficient to lead to healing and major when an intervention (endoscopic stenting) or reoperation was necessary.\nComorbidities and risk factors for poor anastomotic healing that were evaluated included cardiac disease, hypertension, diabetes, chronic obstructive pulmonary disease, current cigarette smoking, or alcohol abuse.\nA videoesophagram was routinely obtained at 5 to 7 days postoperatively, and if there was evidence of a leak or abnormality, or when indicated by clinical deterioration of the patient, upper endoscopy was performed. If a leak was evident either by videoesophagram or by upper endoscopy, the patient was classified as having an anastomotic leak. Furthermore, for this study, the leak was defined as minor when conservative treatment with antibiotics or nil per os was sufficient to lead to healing and major when an intervention (endoscopic stenting) or reoperation was necessary.\nComorbidities and risk factors for poor anastomotic healing that were evaluated included cardiac disease, hypertension, diabetes, chronic obstructive pulmonary disease, current cigarette smoking, or alcohol abuse.\n Statistical Analysis Data are expressed as medians and interquartile range. Comparisons of proportions were performed using the Fisher exact test. A P < 0.05 was considered significant. Univariate and multivariate analysis were performed using Prism software (GraphPad, La Jolla, CA).\nData are expressed as medians and interquartile range. Comparisons of proportions were performed using the Fisher exact test. A P < 0.05 was considered significant. Univariate and multivariate analysis were performed using Prism software (GraphPad, La Jolla, CA).", "The SPY Imaging System is designed to acquire fluorescence images. This is achieved using a fluorescent agent, indocyanine green (ICG), which upon intravascular administration is rapidly and extensively (>98%) bound to plasma proteins. The ICG is a sterile, water soluble, tricarbocyanine dye with a peak spectral absorption at 800 to 810 nm in blood. It is taken up by the liver and excreted unchanged into the bile. The plasma half-life of ICG is 3 to 5 minutes. The ICG is caused to fluoresce by illumination with a laser at 806 nm. The ICG molecules absorb the light, get “excited,” drop back to an “unexcited” state, and emit light in a longer wavelength. Fluorescence images of the GPU graft are acquired using a charge coupled device video camera, sensitive into the near infrared, and equipped with an edge filter to permit efficient transmission of fluorescent light (in the range 815–880 nm) while blocking laser and room light. The images are visible in real-time on a monitor and are captured to hard drive for analysis, future review, and archiving.", "Indocyanine green (ICG) has been approved for use in humans and has been extensively used for determining cardiac output, hepatic function, liver blood flow, for ophthalmologic angiography, and during cardiac bypass and plastic and reconstructive surgery. The incidence of adverse reactions to ICG is low and most are mild (sore throat, feeling of warmth). Rare reports describe hypotension requiring treatment with epinephrine. Caution is recommended in patients with iodine or shellfish allergy.", "After creating a 3- to 4-cm wide gastric tube, but before bringing the graft up to the neck, the SPY system was used to assess graft perfusion. The time between gastric tube creation and LAA was approximately 15 minutes. Images were obtained beginning 5 seconds after intravenous central-line injection of 2.5 mg of ICG followed by a 5 mL flush of saline. This dose was recommended by Novadaq and provided excellent visualization of microperfusion in the gastric grafts. After LAA assessment of perfusion and placement of a suture, if a transition point was seen, the graft was brought up to the neck through the posterior mediastinum. The anastomosis was placed in a suitable area of the anterior wall of the gastric graft, and the location of the anastomosis relative to the suture, if present, was recorded in the operative note. An effort was always made to place the anastomosis proximal to the suture, in an area of good perfusion by LAA, but in patients where the anastomosis would not reach to a portion of stomach proximal to the suture it was placed at or distal to the suture.", "A videoesophagram was routinely obtained at 5 to 7 days postoperatively, and if there was evidence of a leak or abnormality, or when indicated by clinical deterioration of the patient, upper endoscopy was performed. If a leak was evident either by videoesophagram or by upper endoscopy, the patient was classified as having an anastomotic leak. Furthermore, for this study, the leak was defined as minor when conservative treatment with antibiotics or nil per os was sufficient to lead to healing and major when an intervention (endoscopic stenting) or reoperation was necessary.\nComorbidities and risk factors for poor anastomotic healing that were evaluated included cardiac disease, hypertension, diabetes, chronic obstructive pulmonary disease, current cigarette smoking, or alcohol abuse.", "Data are expressed as medians and interquartile range. Comparisons of proportions were performed using the Fisher exact test. A P < 0.05 was considered significant. Univariate and multivariate analysis were performed using Prism software (GraphPad, La Jolla, CA)." ]

[ "methods", null, null, null, null, null ]

[ "METHODS", "Laser-assisted Indocyanine Green Fluorescent-Dye Angiography", "Safety of Indocyanine Green", "Surgical Procedure", "Intraoperative Assessment of Graft Perfusion and Placement of the Anastomosis", "Assessment of Anastomotic Healing", "Statistical Analysis", "RESULTS", "DISCUSSION", "CONCLUSIONS" ]

[ "After initially using intraoperative LAA on several esophagectomies with GPU we saw that perfusion in the tip of the gastric graft as assessed visibly with the SPY system was variable. In some patients, the entire graft showed rapid, bright perfusion by LAA (Fig. 1). Often, though, there was a point of demarcation where rapid and bright perfusion transitioned into slower and less robust perfusion. We prospectively decided to evaluate the utility of LAA by placing a suture at the site of this transition if present, and recording in the operative note the location of the anastomosis relative to the suture (proximal vs distal to the stitch) (Fig. 2). During this time, we used standard techniques including our clinical judgment and Doppler to evaluate graft perfusion for placement of the anastomosis. In addition to noting the site of a transition in perfusion by LAA if present, we also noted the proximal-most extent of the Doppler signal. We subsequently evaluated the outcome of these anastomoses by retrospectively reviewing the records of these patients. The study was approved by the University of Southern California institutional review board.\nRapid and bright perfusion of the entire gastric graft by LAA.\nA transition point is seen between rapid and bright versus slower, less robust perfusion (arrow). A suture is placed at the site of this transition point and if possible the anastomosis was placed proximal to this suture in an area of good perfusion by LAA.\n Laser-assisted Indocyanine Green Fluorescent-Dye Angiography The SPY Imaging System is designed to acquire fluorescence images. This is achieved using a fluorescent agent, indocyanine green (ICG), which upon intravascular administration is rapidly and extensively (>98%) bound to plasma proteins. The ICG is a sterile, water soluble, tricarbocyanine dye with a peak spectral absorption at 800 to 810 nm in blood. It is taken up by the liver and excreted unchanged into the bile. The plasma half-life of ICG is 3 to 5 minutes. The ICG is caused to fluoresce by illumination with a laser at 806 nm. The ICG molecules absorb the light, get “excited,” drop back to an “unexcited” state, and emit light in a longer wavelength. Fluorescence images of the GPU graft are acquired using a charge coupled device video camera, sensitive into the near infrared, and equipped with an edge filter to permit efficient transmission of fluorescent light (in the range 815–880 nm) while blocking laser and room light. The images are visible in real-time on a monitor and are captured to hard drive for analysis, future review, and archiving.\nThe SPY Imaging System is designed to acquire fluorescence images. This is achieved using a fluorescent agent, indocyanine green (ICG), which upon intravascular administration is rapidly and extensively (>98%) bound to plasma proteins. The ICG is a sterile, water soluble, tricarbocyanine dye with a peak spectral absorption at 800 to 810 nm in blood. It is taken up by the liver and excreted unchanged into the bile. The plasma half-life of ICG is 3 to 5 minutes. The ICG is caused to fluoresce by illumination with a laser at 806 nm. The ICG molecules absorb the light, get “excited,” drop back to an “unexcited” state, and emit light in a longer wavelength. Fluorescence images of the GPU graft are acquired using a charge coupled device video camera, sensitive into the near infrared, and equipped with an edge filter to permit efficient transmission of fluorescent light (in the range 815–880 nm) while blocking laser and room light. The images are visible in real-time on a monitor and are captured to hard drive for analysis, future review, and archiving.\n Safety of Indocyanine Green Indocyanine green (ICG) has been approved for use in humans and has been extensively used for determining cardiac output, hepatic function, liver blood flow, for ophthalmologic angiography, and during cardiac bypass and plastic and reconstructive surgery. The incidence of adverse reactions to ICG is low and most are mild (sore throat, feeling of warmth). Rare reports describe hypotension requiring treatment with epinephrine. Caution is recommended in patients with iodine or shellfish allergy.\nIndocyanine green (ICG) has been approved for use in humans and has been extensively used for determining cardiac output, hepatic function, liver blood flow, for ophthalmologic angiography, and during cardiac bypass and plastic and reconstructive surgery. The incidence of adverse reactions to ICG is low and most are mild (sore throat, feeling of warmth). Rare reports describe hypotension requiring treatment with epinephrine. Caution is recommended in patients with iodine or shellfish allergy.\n Surgical Procedure All patients underwent esophagectomy with a transhiatal, en bloc transthoracic, minimally invasive thoracoscopic/laparoscopic or vagal-sparing approach. The tubularized gastric graft was brought up through the posterior mediastinum and a handsewn single-layer cervical anastomosis onto the anterior wall of the gastric pull-up was performed in all patients.\nAll patients underwent esophagectomy with a transhiatal, en bloc transthoracic, minimally invasive thoracoscopic/laparoscopic or vagal-sparing approach. The tubularized gastric graft was brought up through the posterior mediastinum and a handsewn single-layer cervical anastomosis onto the anterior wall of the gastric pull-up was performed in all patients.\n Intraoperative Assessment of Graft Perfusion and Placement of the Anastomosis After creating a 3- to 4-cm wide gastric tube, but before bringing the graft up to the neck, the SPY system was used to assess graft perfusion. The time between gastric tube creation and LAA was approximately 15 minutes. Images were obtained beginning 5 seconds after intravenous central-line injection of 2.5 mg of ICG followed by a 5 mL flush of saline. This dose was recommended by Novadaq and provided excellent visualization of microperfusion in the gastric grafts. After LAA assessment of perfusion and placement of a suture, if a transition point was seen, the graft was brought up to the neck through the posterior mediastinum. The anastomosis was placed in a suitable area of the anterior wall of the gastric graft, and the location of the anastomosis relative to the suture, if present, was recorded in the operative note. An effort was always made to place the anastomosis proximal to the suture, in an area of good perfusion by LAA, but in patients where the anastomosis would not reach to a portion of stomach proximal to the suture it was placed at or distal to the suture.\nAfter creating a 3- to 4-cm wide gastric tube, but before bringing the graft up to the neck, the SPY system was used to assess graft perfusion. The time between gastric tube creation and LAA was approximately 15 minutes. Images were obtained beginning 5 seconds after intravenous central-line injection of 2.5 mg of ICG followed by a 5 mL flush of saline. This dose was recommended by Novadaq and provided excellent visualization of microperfusion in the gastric grafts. After LAA assessment of perfusion and placement of a suture, if a transition point was seen, the graft was brought up to the neck through the posterior mediastinum. The anastomosis was placed in a suitable area of the anterior wall of the gastric graft, and the location of the anastomosis relative to the suture, if present, was recorded in the operative note. An effort was always made to place the anastomosis proximal to the suture, in an area of good perfusion by LAA, but in patients where the anastomosis would not reach to a portion of stomach proximal to the suture it was placed at or distal to the suture.\n Assessment of Anastomotic Healing A videoesophagram was routinely obtained at 5 to 7 days postoperatively, and if there was evidence of a leak or abnormality, or when indicated by clinical deterioration of the patient, upper endoscopy was performed. If a leak was evident either by videoesophagram or by upper endoscopy, the patient was classified as having an anastomotic leak. Furthermore, for this study, the leak was defined as minor when conservative treatment with antibiotics or nil per os was sufficient to lead to healing and major when an intervention (endoscopic stenting) or reoperation was necessary.\nComorbidities and risk factors for poor anastomotic healing that were evaluated included cardiac disease, hypertension, diabetes, chronic obstructive pulmonary disease, current cigarette smoking, or alcohol abuse.\nA videoesophagram was routinely obtained at 5 to 7 days postoperatively, and if there was evidence of a leak or abnormality, or when indicated by clinical deterioration of the patient, upper endoscopy was performed. If a leak was evident either by videoesophagram or by upper endoscopy, the patient was classified as having an anastomotic leak. Furthermore, for this study, the leak was defined as minor when conservative treatment with antibiotics or nil per os was sufficient to lead to healing and major when an intervention (endoscopic stenting) or reoperation was necessary.\nComorbidities and risk factors for poor anastomotic healing that were evaluated included cardiac disease, hypertension, diabetes, chronic obstructive pulmonary disease, current cigarette smoking, or alcohol abuse.\n Statistical Analysis Data are expressed as medians and interquartile range. Comparisons of proportions were performed using the Fisher exact test. A P < 0.05 was considered significant. Univariate and multivariate analysis were performed using Prism software (GraphPad, La Jolla, CA).\nData are expressed as medians and interquartile range. Comparisons of proportions were performed using the Fisher exact test. A P < 0.05 was considered significant. Univariate and multivariate analysis were performed using Prism software (GraphPad, La Jolla, CA).", "The SPY Imaging System is designed to acquire fluorescence images. This is achieved using a fluorescent agent, indocyanine green (ICG), which upon intravascular administration is rapidly and extensively (>98%) bound to plasma proteins. The ICG is a sterile, water soluble, tricarbocyanine dye with a peak spectral absorption at 800 to 810 nm in blood. It is taken up by the liver and excreted unchanged into the bile. The plasma half-life of ICG is 3 to 5 minutes. The ICG is caused to fluoresce by illumination with a laser at 806 nm. The ICG molecules absorb the light, get “excited,” drop back to an “unexcited” state, and emit light in a longer wavelength. Fluorescence images of the GPU graft are acquired using a charge coupled device video camera, sensitive into the near infrared, and equipped with an edge filter to permit efficient transmission of fluorescent light (in the range 815–880 nm) while blocking laser and room light. The images are visible in real-time on a monitor and are captured to hard drive for analysis, future review, and archiving.", "Indocyanine green (ICG) has been approved for use in humans and has been extensively used for determining cardiac output, hepatic function, liver blood flow, for ophthalmologic angiography, and during cardiac bypass and plastic and reconstructive surgery. The incidence of adverse reactions to ICG is low and most are mild (sore throat, feeling of warmth). Rare reports describe hypotension requiring treatment with epinephrine. Caution is recommended in patients with iodine or shellfish allergy.", "All patients underwent esophagectomy with a transhiatal, en bloc transthoracic, minimally invasive thoracoscopic/laparoscopic or vagal-sparing approach. The tubularized gastric graft was brought up through the posterior mediastinum and a handsewn single-layer cervical anastomosis onto the anterior wall of the gastric pull-up was performed in all patients.", "After creating a 3- to 4-cm wide gastric tube, but before bringing the graft up to the neck, the SPY system was used to assess graft perfusion. The time between gastric tube creation and LAA was approximately 15 minutes. Images were obtained beginning 5 seconds after intravenous central-line injection of 2.5 mg of ICG followed by a 5 mL flush of saline. This dose was recommended by Novadaq and provided excellent visualization of microperfusion in the gastric grafts. After LAA assessment of perfusion and placement of a suture, if a transition point was seen, the graft was brought up to the neck through the posterior mediastinum. The anastomosis was placed in a suitable area of the anterior wall of the gastric graft, and the location of the anastomosis relative to the suture, if present, was recorded in the operative note. An effort was always made to place the anastomosis proximal to the suture, in an area of good perfusion by LAA, but in patients where the anastomosis would not reach to a portion of stomach proximal to the suture it was placed at or distal to the suture.", "A videoesophagram was routinely obtained at 5 to 7 days postoperatively, and if there was evidence of a leak or abnormality, or when indicated by clinical deterioration of the patient, upper endoscopy was performed. If a leak was evident either by videoesophagram or by upper endoscopy, the patient was classified as having an anastomotic leak. Furthermore, for this study, the leak was defined as minor when conservative treatment with antibiotics or nil per os was sufficient to lead to healing and major when an intervention (endoscopic stenting) or reoperation was necessary.\nComorbidities and risk factors for poor anastomotic healing that were evaluated included cardiac disease, hypertension, diabetes, chronic obstructive pulmonary disease, current cigarette smoking, or alcohol abuse.", "Data are expressed as medians and interquartile range. Comparisons of proportions were performed using the Fisher exact test. A P < 0.05 was considered significant. Univariate and multivariate analysis were performed using Prism software (GraphPad, La Jolla, CA).", "There were 150 consecutive patients that had intraoperative LAA assessment of perfusion during esophagectomy with GPU using the SPY system from March 2008 until July 2011. The median age of the patients was 66.7 years (interquartile range: 57–74). There were 125 men and 25 women. The indication for esophagectomy was cancer in 133 patients and end-stage benign disease in 17 patients. The type of esophagectomy was en bloc in 88 patients, transhiatal in 26, minimally invasive in 24 and vagal-sparing in 12 (open 10, laparoscopic 2). Major complications occurred in 22% and there was one mortality (Table 1). The median hospital stay in all patients was 14 days. The median hospital stay was significantly longer in patients with a leak (20 days with leak vs 13 days with no leak; P = 0.0096) and in those with a major versus a minor leak (40.5 days with a major leak vs 18 days with a minor leak, P = 0.0198).\n\nIntraoperative injection of ICG was well-tolerated by all patients with no adverse events or noticeable adverse effects. There were no technical difficulties and images were obtained in all patients. The entire graft was noted to have good perfusion in 66 of 150 patients (44%), whereas in 84 (66%) patients a line of demarcation was noted between rapid, bright perfusion and slower, less robust perfusion in the fundus of the gastric tube. In these 84 patients, the anastomosis was placed proximal to the stitch in 29 patients, at or distal to the stitch in 49 patients and in 6 patients no anastomosis was performed. These 6 patients all had significant comorbid conditions and poor perfusion by LAA in the area where the anastomosis was to be performed, and we elected to delay the reconstruction until ischemic conditioning led to better graft perfusion. In these patients, the graft was brought up to the neck and sutured to the sternocleidomastoid muscle as has been previously described.6 Subsequent reconstruction was done once the patient had satisfactorily recovered from the esophagectomy, usually at about 8 to 12 weeks.\nAnastomotic leaks occurred in 24 (16.7%) of the 144 patients who had an anastomosis and were classified as major in 8 and minor in 16 patients. Patients in whom the anastomosis was placed at or distal to the site of the suture were significantly more likely to have a leak compared with those in whom no suture was placed (entire graft well-perfused) or where the anastomosis was placed proximal to the transition point in an area of good perfusion by LAA (45% vs 2%, P < 0.0001) (Fig. 3). Similarly, major leaks were significantly more common when the anastomosis was not placed in an area of good perfusion by LAA (15% vs 0; P = 0.0002). Major leaks were treated with an endoscopic stent in 4 patients and reoperation with neck drainage in 4 patients. No patient required graft takedown. All leaks except 1 occurred in patients with cancer, and all patients with leaks had at least 1 comorbid condition. On univariate analysis, placement of the anastomosis at or distal to the suture and a history of hypertension were significantly associated with an anastomotic leak (Table 2). By multivariate analysis, anastomotic placement at or distal to the suture was the only significant factor associated with a leak.\nThe frequency of major and minor leaks in patients where the anastomosis was placed in an area of good perfusion by LAA [either entire graft with good perfusion (n = 66) or anastomosis placed proximal to suture at site of transition (n = 29)] versus those patients that had an anastomosis placed at or distal to the site of the suture at the transition point (n = 49) (2% vs 45%, P < 0.0001).", "Adequate perfusion is a prerequisite for reliable healing of a gastrointestinal anastomosis. One of the most tenuous anastomoses in all of gastrointestinal surgery is the cervical esophagogastric anastomosis during esophagectomy with gastric reconstruction. Leaks are reported in 20% to 35% of these patients and are a major source of short- and long-term morbidity and occasionally mortality.7 Intraoperative assessment of gastric graft perfusion has typically been on the basis of color, temperature, and Doppler signal. A bluish color and cool temperature are unsettling but lack specificity, and although the Doppler is good for gross perfusion, it is unreliable for microperfusion. Seldom is there a discernible Doppler signal beyond about two thirds the way up the greater curvature of the gastric tube and thus the Doppler is not useful to assess perfusion in the area where the anastomosis is likely to be performed in most patients. In this study, we found that the Doppler signal always disappeared proximal to the site of demarcation by LAA (if present) and could not differentiate grafts with complete microperfusion to the tip versus those with a zone of demarcation as seen using the SPY technology (data not shown).\nWe started using the SPY system to see if it would provide real-time information about perfusion, particularly microperfusion, that could be useful to assess gastric grafts during esophagectomy. Because we were uncertain of the significance of perfusion as visually assessed with the SPY system, we decided to place a stitch if there was a transition by LAA between fast and bright versus slower and less robust perfusion. We found that an anastomosis was unlikely to leak in patients with no transition point or when it was placed proximal to the transition point when present, in an area of good LAA perfusion. The leaks that occurred in these patients were all minor and healed with conservative therapy. In contrast, 45% of patients with an anastomosis placed at or distal to the stitch, in an area of slower and less robust perfusion by LAA, had an anastomotic leak. Furthermore, 36% of these leaks were major leaks that required an intervention.\nThere are several important issues in relation to this finding. First, when perfusion to the site of the planned anastomosis was good by LAA leaks were unlikely and minor if they occurred. These patients may be considered for fast tracking or elimination of a barium swallow in the absence of any clinical suggestion of a leak. In contrast, when the anastomosis had to be placed at or distal to a transition point in perfusion by LAA, a leak will develop in almost one-half of the patients, and some of these leaks will require an intervention. These patients should be monitored closely and evaluated promptly for any evidence of clinical deterioration. Furthermore, in these patients, planned graft evaluation with an upper endoscopy at 5 to 7 days after reconstruction may be useful to address a leak before it becomes clinically significant. We have previously shown the safety and efficacy of early endoscopy after esophagectomy and reconstruction.8 It is important to recognize that in these patients with an anastomosis at or distal to the transition site healing without leak occurred in more than half of the patients. Therefore, when faced with this situation factors such as the patient's ability to tolerate a leak should be taken into consideration.\nIf there were no intraoperative options then defining perfusion with the SPY system would be informative for postoperative care but would not be clinically useful at the time of the operation. However, since understanding the implications of putting the anastomosis in an area of less robust perfusion, we now will alter our operative plan in patients at high risk for doing poorly with a leak. These patients include those with significant comorbid conditions or very elderly patients who tend to have little reserve for major complications. In this series, we had 6 such patients in whom we elected to delay the reconstruction. With this technique, the graft is left in the neck but no anastomosis is performed. Over several weeks, ischemic conditioning leads to improved perfusion in the graft and the subsequent anastomosis typically heals reliably in these patients.6,9 Alternatively, in some cases, we will now resect a portion of the manubrium and first rib and place the anastomosis proximal to the stitch either with the graft in the posterior mediastinum or in a substernal location. Using this strategy, we can assess the risk for anastomotic leak and tailor the operative plan as necessary when the perfusion by LAA or condition of the patient indicates it appropriate to do so.\nIn an effort to further refine assessment of perfusion and to move from qualitative to quantitative assessment, the SPY-Q system has been introduced (Fig. 4). Efforts are underway to define a threshold of perfusion below which the majority of anastomoses will not heal. In this way, the risk of anastomotic leak can be defined even more precisely and operative decisions tailored more specifically for an individual patient. Since gaining confidence with the SPY system, we have expanded use of LAA to all types of reconstruction after esophagectomy including colon and jejunal grafts and have found it equally useful to evaluate perfusion in these grafts. Furthermore, the recent introduction of the Pinpoint (Novadaq Ontario, Canada) and Firefly (Intuitive Surgical, Sunnyvale, CA) systems allow LAA perfusion assessment during minimally invasive and robotic procedures.\nPerfusion by LAA shown in (A) qualitative mode versus (B) with quantitative (SPY-Q) overlay.\nA limitation of this study is that the evaluation of the SPY images is largely qualitative at this point, and as we have gained experience with the images and perfusion implications we undoubtedly altered our practice, which may have impacted the results of this retrospective review. However, if anything these alterations would likely have led to a reduced rate of leaks since with experience, we began making even greater efforts to place the anastomosis proximal to the suture or alter the surgical plan. Furthermore, our overall small number of leaks prohibited an evaluation of the impact of operative approach on anastomotic healing and likely masked the role of important comorbid conditions that contribute to leaks.", "Perfusion is critical for anastomotic healing after esophagectomy and gastric pull-up. Intraoperative real-time assessment of perfusion with LAA correlated with the likelihood of an anastomotic leak, and the cervical anastomotic leak rate was trivial when the anastomosis was placed in an area of the graft shown to have good perfusion. The use of LAA during esophagectomy with gastric pull-up may lead to an altered surgical plan in some patients and contribute to reduced anastomotic morbidity and better overall patient outcomes." ]

[ "methods", null, null, "methods", null, null, null, "results", "discussion", "conclusions" ]

[ "anastomotic leak", "esophageal resection", "esophagectomy", "gastric pullup", "graft perfusion" ]

[ 1812, 213, 85, 208, 135, 46 ]

[ "patients", "perfusion", "anastomosis", "graft", "leak", "laa", "gastric", "suture", "icg", "placed" ]

[ "anastomosis esophagectomy gastric", "perfusion laa anastomotic", "gastric grafts laa", "evaluated outcome anastomoses", "perfusion placement anastomosis" ]

[ "Animals", "Apoptosis", "Brain Injuries", "Hyperglycemia", "Inflammation", "Mitochondrial Dynamics", "Rats", "Subarachnoid Hemorrhage" ]

[ "2.1. ELISA Assay for Inflammatory Factors In Vitro", "2.2. Neurological Outcomes", "2.3. Morphological, Cross-Sectional-Area, and Thickness Changes in Basal Artery (BA)", "2.4. Microglia and Astrocyte Proliferation", "2.5. Real-Time PCR of Pro-Inflammatory Factors", "2.6. Apoptosis of Neuron Cells", "2.7. Western Blot Analysis", "4. Materials and Methods", "4.1. Cell Culture and Treatment", "4.2. Animal Preparation", "4.3. Hyperglycemia Induction", "4.4. SAH Induction", "4.5. Experimental Design and Drug Administration", "4.6. Neurological Assessment", "4.7. Tissue Processing", "4.8. Morphometric Assessment of BA", "4.9. Immunofluorescence", "4.10. Enzyme-Linked Immunosorbent Assay (ELISA)", "4.11. TUNEL Staining", "4.12. Western Blot Analysis", "4.13. Real-Time Quantitative PCR (qRT-PCR)", "4.14. Statistical Analysis" ]

[ "The TNF-α, IL-1β, and IL-6 levels in the supernatant samples from BV-2 were examined using ELISA 6 h after LPS induction to investigate the relationship between pro-inflammatory factors and Mdivi-1. ELISA revealed that LPS induced the release of TNF-α, IL-1β, and IL-6; however, Mdivi-1 blocked the release of TNF-α (Figure 1A), IL-1β (Figure 1B), and IL-6 (Figure 1C) after LPS induction.", "The neurobehavioral scores, including ambulation, placing/stepping reflex, and MDI, were not different between the SAH, DM + SAH, and DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) groups (Table 1). In animals subjected to SAH, both the ambulation (1.91 ± 0.37) and placing/stepping reflex (1.34 ± 0.11) scores were significantly lower in the SAH animals than in the DM + SAH animals (ambulation: 2.39 ± 0.27 and placing/stepping reflex: 1.77 ± 0.19). Treatment with a high dose of Mdivi-1 (1.2 mg/kg) significantly decreased both the ambulation (1.62 ± 0.13; p < 0.05) and the placing/stepping reflex (0.57 ± 0.21) scores when compared with the DM + SAH group, but treatment with the low-dose Mdivi-1 (0.24 mg/kg) did not (ambulation: 2.11 ± 0.19 and placing/stepping reflex: 1.59 ± 0.29). Similarly, the MDI in the high-dose Mdivi-1 (1.2 mg/kg) treatment group (1.89 ± 0.31; p < 0.05) was also significantly reduced when compared with that in the DM + SAH group (4.20 ± 0.31) (Table 1).", "Microscopic examination revealed endothelial deformation, internal elastic laminae twisting, and smooth muscle necrosis in the BAs of rats subjected to normal, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1, and DM + SAH + high-dose Mdivi-1 (Figure 2A). The mean cross-sectional areas of BA were 0.52 ± 0.11, 0.21 ± 0.059, 0.14 ± 0.028, 0.23 ± 0.051, and 0.37 ± 0.060 mm2 in the control, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1 (0.24 mg/kg), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups, respectively (Figure 2B). The BA cross-sectional area in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group was reduced by 37.8% (p < 0.05) and 47.0% (p < 0.001) compared with that in the SAH and DM + SAH group, respectively. The BA thickness exhibited no significant difference between the SAH (0.0328 ± 0.006 mm) and DM + SAH only (0.0333 ± 0.005 mm) groups (Figure 2C). A significant increase in the BA thickness was observed in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group (0.0183 ± 0.003 mm; p < 0.01 vs. both SAH and DM + SAH groups) (Figure 2C).", "Aside from the bleeding area, the activated microglia diffused into the brain parenchyma such as the brain stem, cortex, and hippocampus [31,32]. Similarly, after SAH, astrocytes were activated as part of gliosis [33]. This study employed immunofluorescence staining for Iba-1 and GFAP to detect the presence of microglial cells and astrocytes, respectively. Immunofluorescence staining for Iba-1 indicated that SAH induced microglial cell proliferation in the rat brain and was enhanced by hyperglycemia (Figure 3). In addition, quantitative analysis of the Iba-1 staining intensity revealed comparable levels between the control (set at 1.0), SAH (7.80 ± 1.88), DM + SAH (14.76 ± 2.07), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.81 ± 1.80), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (2.15 ± 0.74). In contrast, Iba-1 staining in the brain of the SAH and DM + SAH rats was significantly elevated, and the Mdivi-1 treatment significantly reduced microglial cell proliferation (low-dose Mdivi-1: p < 0.01 compared with the SAH group and p <0.001 compared with the DM +SAH; high-dose Mdivi-1: p < 0.001 compared with the SAH group and P <0.001 compared with the DM + SAH group) (Figure 3B). The immunofluorescence staining results for GFAP were consistent with those of the Iba-1 staining. In addition, the quantitative analysis the of GFAP staining intensity revealed comparable levels between the control (set at 1.0), SAH (2.33 ± 0.72), DM + SAH (6.53 ± 1.32), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.14 ± 1.63), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (1.63 ± 0.42). In contrast, GFAP staining in the brains of the SAH and DM + SAH rats was substantially elevated, and the Mdivi-1 treatment significantly reduced astrocyte proliferation (low-dose Mdivi-1: p < 0.001 compared with DM + SAH; high-dose Mdivi-1: p < 0.001 compared with DM + SAH) (Figure 4B).", "The TNF-α, IL-1β, and IL-6 levels in the brain were examined using real-time PCR 7 days after SAH, to investigate the relationship between pro-inflammatory factors in SAH and Mdivi-1. The real-time PCR result indicated that the TNF-α, IL-1β, and IL-6 expression in the DM + SAH group were significantly higher than those in the SAH group in the brain (Figure 5). All of the aforementioned increases in protein expression were significantly attenuated after the administration of the Mdivi-1 treatment (TNF-α: p < 0.05; IL-1β: p < 0.01; IL-6: p < 0.05, compared with the respective DM + SAH group upon treatment with low-dose Mdivi-1) (TNF-α, IL-1β, and IL-6: p < 0.001, compared with the respective DM + SAH group upon treatment with high-dose Mdivi-1) (Figure 5).", "This study conducted immunofluorescence staining for TUNEL and neuron cells to detect neuron cell apoptosis. Quantitative analysis of the number of instances of double immunofluorescence positive staining for TUNEL and NeuN revealed that SAH induced neuron cell apoptosis in the rat brain (Figure 6A). In contrast, double staining in the brain of hyperglycemic rats was substantially elevated (26.625 ± 9.50) and the Mdivi-1 treatment significantly reduced neuron cell apoptosis (low-dose Mdivi-1: 17.5 ± 3.93, p < 0.05; high-dose Mdivi-1: 8.125 ± 5.11, p < 0.001 compared with the DM + SAH group) (Figure 6B).", "Drp1 is demonstrated as an intrinsic component of multiple mitochondria-dependent apoptosis pathways, and its activity predominantly controls mitochondrial fission [26]. Mdivi-1 is a derivative of quinazolinone that can selectively inhibit Drp1 to downregulate mitochondrial fission [29]. This study demonstrates that the phospho-Drp1 (p-Drp1) level in the DM + SAH group was significantly higher than that in the SAH group in the Western blot analysis. High-dose Mdivi-1 (1.2 mg/kg) treatment significantly reduced the p-Drp1 expression (p < 0.001). However, low-dose Mdivi-1 (0.24 mg/kg) had a trend toward decreasing the expression of p-Drp1, albeit not significantly (Figure 7).", "4.1. Cell Culture and Treatment The mouse BV2 microglial cells were cultured with DMEM, including 10% fetal bovine serum and 5% carbon dioxide, at 37 °C. The BV2 cells were treated with Mdivi-1 30 min before the addition of lipopolysaccharide (LPS) at 100 ng/mL to measure the anti-inflammatory effects of Mdivi-1.\nThe mouse BV2 microglial cells were cultured with DMEM, including 10% fetal bovine serum and 5% carbon dioxide, at 37 °C. The BV2 cells were treated with Mdivi-1 30 min before the addition of lipopolysaccharide (LPS) at 100 ng/mL to measure the anti-inflammatory effects of Mdivi-1.\n4.2. Animal Preparation Male Sprague Dawley rats weighing between 350 and 450 g were used (BioLasco; Taipei; Taiwan). All rats were housed at a constant temperature (24 °C) and at regular light/dark cycles between 6:00 am and 6:00 pm, with free access to a diet. The study procedures were executed in accordance with the protocol approved by the Committee of Institutional Animal Research at the Kaohsiung Medical University (IACUC 108215).\nMale Sprague Dawley rats weighing between 350 and 450 g were used (BioLasco; Taipei; Taiwan). All rats were housed at a constant temperature (24 °C) and at regular light/dark cycles between 6:00 am and 6:00 pm, with free access to a diet. The study procedures were executed in accordance with the protocol approved by the Committee of Institutional Animal Research at the Kaohsiung Medical University (IACUC 108215).\n4.3. Hyperglycemia Induction Hyperglycemia was induced according to the method described by Yu-Hua Huang [44]. A single dose of STZ at 50 mg/kg was intraperitoneally injected to induce hyperglycemia. Blood glucose was measured via the tail vein of each rat using a portable glucometer (Accu-Chek Performa, Roche Diagnostics Ltd., Indianapolis, IN, USA) that was calibrated according to the manufacturer’s protocols. Diabetes mellitus (DM) induction was considered successful if the blood-glucose level was >300 mg/dL at 7 days following STZ administration [32].\nHyperglycemia was induced according to the method described by Yu-Hua Huang [44]. A single dose of STZ at 50 mg/kg was intraperitoneally injected to induce hyperglycemia. Blood glucose was measured via the tail vein of each rat using a portable glucometer (Accu-Chek Performa, Roche Diagnostics Ltd., Indianapolis, IN, USA) that was calibrated according to the manufacturer’s protocols. Diabetes mellitus (DM) induction was considered successful if the blood-glucose level was >300 mg/dL at 7 days following STZ administration [32].\n4.4. SAH Induction The one-shot SAH model was used in rats [45]. Briefly, the animals were anesthetized using an intraperitoneal injection of Zoletil 50® (VIRBAC; Carros; France) at 40 mg/mL, which contained a mixture of zolazepam and tiletamine hydrochloride (Virbac, Carros, France). The rats’ heads were fixed in a stereotactic apparatus, and a 25-gauge butterfly needle was advanced into the cisterna magna, which was confirmed by withdrawing 0.3-mL of cerebrospinal fluid (CSF). Fresh, autologous, and non-heparinized blood (0.1 mL/100 g of body weight) drawn from the central tail artery was slowly instilled into the subarachnoid space through a butterfly needle and tubing. The animals were then kept in a ventral recumbent position for at least 30 min to promote ventral blood distribution. The respiratory pattern of rats was closely inspected, and mechanical ventilation was provided if required. Once fully awake, the animals were sent back to the vivarium.\nThe one-shot SAH model was used in rats [45]. Briefly, the animals were anesthetized using an intraperitoneal injection of Zoletil 50® (VIRBAC; Carros; France) at 40 mg/mL, which contained a mixture of zolazepam and tiletamine hydrochloride (Virbac, Carros, France). The rats’ heads were fixed in a stereotactic apparatus, and a 25-gauge butterfly needle was advanced into the cisterna magna, which was confirmed by withdrawing 0.3-mL of cerebrospinal fluid (CSF). Fresh, autologous, and non-heparinized blood (0.1 mL/100 g of body weight) drawn from the central tail artery was slowly instilled into the subarachnoid space through a butterfly needle and tubing. The animals were then kept in a ventral recumbent position for at least 30 min to promote ventral blood distribution. The respiratory pattern of rats was closely inspected, and mechanical ventilation was provided if required. Once fully awake, the animals were sent back to the vivarium.\n4.5. Experimental Design and Drug Administration The rats were randomly selected and divided into the following five groups (n = 6 per group): (1) control (no DM or SAH), (2) SAH only, (3) DM + SAH, (4) DM + SAH + Mdivi-1 (0.24 mg/kg), and (5) DM + SAH + Mdivi-1 (1.2 mg/kg). The dose and the time point of the Mdivi-1 treatment were chosen based on the previous study [15]. Mdivi-1 (MedChemExpress; Monmouth Junction; USA) was dissolved in 0.1% dimethyl sulfoxide (DMSO) and administered via intraperitoneal injection immediately after SAH induction. The vehicle animals received an intraperitoneal injection of 0.1% DMSO. The blood-glucose levels were monitored before and after STZ injection. The SAH model was established on day 7 after STZ injection. The animals that survived for 2 days after SAH were included for analysis, and then sacrificed for subsequent experiments.\nThe rats were randomly selected and divided into the following five groups (n = 6 per group): (1) control (no DM or SAH), (2) SAH only, (3) DM + SAH, (4) DM + SAH + Mdivi-1 (0.24 mg/kg), and (5) DM + SAH + Mdivi-1 (1.2 mg/kg). The dose and the time point of the Mdivi-1 treatment were chosen based on the previous study [15]. Mdivi-1 (MedChemExpress; Monmouth Junction; USA) was dissolved in 0.1% dimethyl sulfoxide (DMSO) and administered via intraperitoneal injection immediately after SAH induction. The vehicle animals received an intraperitoneal injection of 0.1% DMSO. The blood-glucose levels were monitored before and after STZ injection. The SAH model was established on day 7 after STZ injection. The animals that survived for 2 days after SAH were included for analysis, and then sacrificed for subsequent experiments.\n4.6. Neurological Assessment Neurobehavioral evaluation of animals was performed by assessing the sensorimotor integration of the forelimb and hindlimb activities using the modified limb-placing test, which consisted of ambulation, as well as placing and stepping reflex [46]. The motor-deficit index (MDI) represented the sum of scores for walking using the lower limbs and for placing/stepping response, and was determined before and 48 h after SAH induction. High MDI values indicated poor neurological outcomes.\nNeurobehavioral evaluation of animals was performed by assessing the sensorimotor integration of the forelimb and hindlimb activities using the modified limb-placing test, which consisted of ambulation, as well as placing and stepping reflex [46]. The motor-deficit index (MDI) represented the sum of scores for walking using the lower limbs and for placing/stepping response, and was determined before and 48 h after SAH induction. High MDI values indicated poor neurological outcomes.\n4.7. Tissue Processing At the end of the experiments, each animal was re-anesthetized for perfusion and fixation. The thoracic cage was opened by canalling the left ventricle using a No. 16 catheter. The brain was perfused with 180 mL of 2% paraformaldehyde and 100 mL of phosphate buffer (0.01 M) at below 36 °C and 100-mmHg perfusion pressure, after clamping the descending aorta and puncturing the right atrium. Gross inspection of harvested brains was performed to confirm the presence of subarachnoid blood clots over the BA, and the specimen was immersed in a fixative solution. The BAs were then separated from the brainstems, and the middle third of each vessel was dissected. The arterial segments were flat-embedded in paraffin, and BA cross-sections were cut into 3-μm sections that were stained with hematoxylin and eosin stain for subsequent analysis.\nAt the end of the experiments, each animal was re-anesthetized for perfusion and fixation. The thoracic cage was opened by canalling the left ventricle using a No. 16 catheter. The brain was perfused with 180 mL of 2% paraformaldehyde and 100 mL of phosphate buffer (0.01 M) at below 36 °C and 100-mmHg perfusion pressure, after clamping the descending aorta and puncturing the right atrium. Gross inspection of harvested brains was performed to confirm the presence of subarachnoid blood clots over the BA, and the specimen was immersed in a fixative solution. The BAs were then separated from the brainstems, and the middle third of each vessel was dissected. The arterial segments were flat-embedded in paraffin, and BA cross-sections were cut into 3-μm sections that were stained with hematoxylin and eosin stain for subsequent analysis.\n4.8. Morphometric Assessment of BA Three cross-sections from the middle-third BA from each animal were analyzed by a trained member of research staff who was blinded to the experimental groups. The BA thickness was defined as the largest vertical distance between the inner surface of the endothelium and the outer surface of the adventitia. The arterial cross-sectional area was calculated using a computer-based morphometric analysis (ImageJ; Universal Imaging Corp., Hialeah, FL, USA). The average area of the BA cross-section from each rat was calculated to obtain the mean values for the degree of vasospasm at 48 h after SAH.\nThree cross-sections from the middle-third BA from each animal were analyzed by a trained member of research staff who was blinded to the experimental groups. The BA thickness was defined as the largest vertical distance between the inner surface of the endothelium and the outer surface of the adventitia. The arterial cross-sectional area was calculated using a computer-based morphometric analysis (ImageJ; Universal Imaging Corp., Hialeah, FL, USA). The average area of the BA cross-section from each rat was calculated to obtain the mean values for the degree of vasospasm at 48 h after SAH.\n4.9. Immunofluorescence After deparaffinization and rehydration, the paraffin-embedded brain samples were treated with steam heating for antigen retrieval (30 min) using a DAKO antigen retrieval solution (DAKO, Carpinteria, CA, USA). The slides were washed twice with TBS, and the sections were incubated with mouse anti-GFAP (Sigma-Aldrich; G3893; St. Louis, MI, USA) and rabbit anti-Iba1 (Proteintech; 10904-1-AP; Taiwan) antibodies for 16 h at 4 °C. The slides were, again, washed twice with TBS, and subsequently incubated with goat anti-rabbit IgG (H+L)-FAM (Croyez; C04013; Taiwan) and goat anti-mouse IgG (H+L)-TAMRA (Croyez; C04012; Taiwan) antibodies for 90 min at room temperature. Afterward, the slides were washed twice with TBS and were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich; F6057; St. Louis, MI, USA).\nAfter deparaffinization and rehydration, the paraffin-embedded brain samples were treated with steam heating for antigen retrieval (30 min) using a DAKO antigen retrieval solution (DAKO, Carpinteria, CA, USA). The slides were washed twice with TBS, and the sections were incubated with mouse anti-GFAP (Sigma-Aldrich; G3893; St. Louis, MI, USA) and rabbit anti-Iba1 (Proteintech; 10904-1-AP; Taiwan) antibodies for 16 h at 4 °C. The slides were, again, washed twice with TBS, and subsequently incubated with goat anti-rabbit IgG (H+L)-FAM (Croyez; C04013; Taiwan) and goat anti-mouse IgG (H+L)-TAMRA (Croyez; C04012; Taiwan) antibodies for 90 min at room temperature. Afterward, the slides were washed twice with TBS and were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich; F6057; St. Louis, MI, USA).\n4.10. Enzyme-Linked Immunosorbent Assay (ELISA) To remove the cells, the samples were immediately centrifuged at 2000× g for 10 min at 4 °C. The collected supernatant was stored below −15 °C before analysis. The collected body fluids were first concentrated by passing them through the C2 columns, to determine the amounts of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL6 in the collected supernatant (Amersham, Nutley, NJ, USA). The amount of inflammatory factor present in the media was detected using an inflammatory factor ELISA system (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm.\nTo remove the cells, the samples were immediately centrifuged at 2000× g for 10 min at 4 °C. The collected supernatant was stored below −15 °C before analysis. The collected body fluids were first concentrated by passing them through the C2 columns, to determine the amounts of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL6 in the collected supernatant (Amersham, Nutley, NJ, USA). The amount of inflammatory factor present in the media was detected using an inflammatory factor ELISA system (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm.\n4.11. TUNEL Staining Apoptotic nuclei were stained using a TUNEL detection kit (Roche Inc., Indianapolis, IN, USA) according to the manufacturer’s protocols. Briefly, the tissue sections were fixed in 4% methanol-free paraformaldehyde at 4 °C and washed with phosphate-buffered saline (PBS) for 30 min. Equilibrium buffer (0.1 mL) was added to each slide, which was then covered with parafilm for 10 min. A 50-μL mixture comprising 45 μL equilibrium buffer, 5-μL nucleotide mix, and 1-μL TdT enzyme was prepared and added onto each slide. The slides were incubated in the dark for 1–2 h at 37 °C. Saline sodium citrate (2×) was added to stop the TdT enzyme reaction for 15 min at room temperature. The unbound fluorescent-12-dUTP was washed out using PBS. Then, the slides were dipped in propidium iodide to stain the cells in the dark for 15 min. The slides were dried after rinsing with de-ionized water, and coverslips were overlaid on the interesting area of the slides.\nApoptotic nuclei were stained using a TUNEL detection kit (Roche Inc., Indianapolis, IN, USA) according to the manufacturer’s protocols. Briefly, the tissue sections were fixed in 4% methanol-free paraformaldehyde at 4 °C and washed with phosphate-buffered saline (PBS) for 30 min. Equilibrium buffer (0.1 mL) was added to each slide, which was then covered with parafilm for 10 min. A 50-μL mixture comprising 45 μL equilibrium buffer, 5-μL nucleotide mix, and 1-μL TdT enzyme was prepared and added onto each slide. The slides were incubated in the dark for 1–2 h at 37 °C. Saline sodium citrate (2×) was added to stop the TdT enzyme reaction for 15 min at room temperature. The unbound fluorescent-12-dUTP was washed out using PBS. Then, the slides were dipped in propidium iodide to stain the cells in the dark for 15 min. The slides were dried after rinsing with de-ionized water, and coverslips were overlaid on the interesting area of the slides.\n4.12. Western Blot Analysis Tissue extracts were prepared in 500-μL of RIPA buffer (Millipore; 20-188; Burlington, MA, USA), including 1× protease inhibitor (Roche, Germany) and 1× phosphatase inhibitor (Roche, Germany), and incubated on ice for 30 min. The protein amount in the supernatant was quantified using a BCA kit (Sigma-Aldrich; C2284; USA), and the samples (50 μg) were electrophoresed on 10% SDS–polyacrylamide gels, and then transferred to PVDF membranes following centrifugation at 13,000 rpm (10,000 g) for 30 min at 4 °C. The membranes were blocked for 60 min at room temperature in TBS containing 5% fat-free milk, and then incubated for 16 h at 4 °C with antibodies against β-actin (Sigma-Aldrich; A6316; USA) and p-Drp1 (ProSci; 79-951; Fort Collins, CO, USA). After washing, the membranes were incubated for 1.5 h at room temperature with the appropriate horseradish peroxidase-labeled secondary antibodies, and bound antibodies were visualized and quantified via chemiluminescence detection. β-actin was used as the internal control. The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of β-actin; then, the density of the band was expressed as the relative density compared with that in the control group.\nTissue extracts were prepared in 500-μL of RIPA buffer (Millipore; 20-188; Burlington, MA, USA), including 1× protease inhibitor (Roche, Germany) and 1× phosphatase inhibitor (Roche, Germany), and incubated on ice for 30 min. The protein amount in the supernatant was quantified using a BCA kit (Sigma-Aldrich; C2284; USA), and the samples (50 μg) were electrophoresed on 10% SDS–polyacrylamide gels, and then transferred to PVDF membranes following centrifugation at 13,000 rpm (10,000 g) for 30 min at 4 °C. The membranes were blocked for 60 min at room temperature in TBS containing 5% fat-free milk, and then incubated for 16 h at 4 °C with antibodies against β-actin (Sigma-Aldrich; A6316; USA) and p-Drp1 (ProSci; 79-951; Fort Collins, CO, USA). After washing, the membranes were incubated for 1.5 h at room temperature with the appropriate horseradish peroxidase-labeled secondary antibodies, and bound antibodies were visualized and quantified via chemiluminescence detection. β-actin was used as the internal control. The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of β-actin; then, the density of the band was expressed as the relative density compared with that in the control group.\n4.13. Real-Time Quantitative PCR (qRT-PCR) The expression levels of inflammatory factors (TNF-α, IL-1β, and IL-6) were detected via qRT-PCR, using the cDNA as the template, on a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in triplicate, and data were analyzed using the comparative threshold cycle (2−ΔΔCT) method. The PCR amplification cycles consisted of denaturing at 95 °C for 5 min, 45 cycles of denaturing at 95 °C for 90 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final elongation at 72 °C for 10 min. To minimize errors arising from variations in the amount of starting RNA in the samples, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. GAPDH: Forward 5′-AGACAGCCGCATCTTCTTGT-3′ and Reverse 5′-CTTGCCGTGGGTAGAGTCAT; TNF-α: Forward 5′-GCCCAGACCCTCACACTC-3′ and Reserve 5′-CACTCCAGCTGCTCCTCT-3′; IL-1β: Forward 5′- ATGGCAGAAGTACCTAAGCTCGC-3′ and Reverse 5′-ACACAAATTGCATGGTGAAGTCAGTT-3′; IL-6: Forward 5′-CCGGAGAGGAGACTTCACAG-3′ and Reverse 5′-ACAGTGCATCATCGCTGTTC-3′.\nThe expression levels of inflammatory factors (TNF-α, IL-1β, and IL-6) were detected via qRT-PCR, using the cDNA as the template, on a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in triplicate, and data were analyzed using the comparative threshold cycle (2−ΔΔCT) method. The PCR amplification cycles consisted of denaturing at 95 °C for 5 min, 45 cycles of denaturing at 95 °C for 90 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final elongation at 72 °C for 10 min. To minimize errors arising from variations in the amount of starting RNA in the samples, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. GAPDH: Forward 5′-AGACAGCCGCATCTTCTTGT-3′ and Reverse 5′-CTTGCCGTGGGTAGAGTCAT; TNF-α: Forward 5′-GCCCAGACCCTCACACTC-3′ and Reserve 5′-CACTCCAGCTGCTCCTCT-3′; IL-1β: Forward 5′- ATGGCAGAAGTACCTAAGCTCGC-3′ and Reverse 5′-ACACAAATTGCATGGTGAAGTCAGTT-3′; IL-6: Forward 5′-CCGGAGAGGAGACTTCACAG-3′ and Reverse 5′-ACAGTGCATCATCGCTGTTC-3′.\n4.14. Statistical Analysis The results were analyzed using Statistical Package for the Social Sciences version 20.0 (IBM SPSS Statistics). Data were expressed as mean ± standard deviation (SD). The estimates were compared with the one-way analysis of variance (ANOVA). A p-value of <0.05 was defined as statistically significant.\nThe results were analyzed using Statistical Package for the Social Sciences version 20.0 (IBM SPSS Statistics). Data were expressed as mean ± standard deviation (SD). The estimates were compared with the one-way analysis of variance (ANOVA). A p-value of <0.05 was defined as statistically significant.", "The mouse BV2 microglial cells were cultured with DMEM, including 10% fetal bovine serum and 5% carbon dioxide, at 37 °C. The BV2 cells were treated with Mdivi-1 30 min before the addition of lipopolysaccharide (LPS) at 100 ng/mL to measure the anti-inflammatory effects of Mdivi-1.", "Male Sprague Dawley rats weighing between 350 and 450 g were used (BioLasco; Taipei; Taiwan). All rats were housed at a constant temperature (24 °C) and at regular light/dark cycles between 6:00 am and 6:00 pm, with free access to a diet. The study procedures were executed in accordance with the protocol approved by the Committee of Institutional Animal Research at the Kaohsiung Medical University (IACUC 108215).", "Hyperglycemia was induced according to the method described by Yu-Hua Huang [44]. A single dose of STZ at 50 mg/kg was intraperitoneally injected to induce hyperglycemia. Blood glucose was measured via the tail vein of each rat using a portable glucometer (Accu-Chek Performa, Roche Diagnostics Ltd., Indianapolis, IN, USA) that was calibrated according to the manufacturer’s protocols. Diabetes mellitus (DM) induction was considered successful if the blood-glucose level was >300 mg/dL at 7 days following STZ administration [32].", "The one-shot SAH model was used in rats [45]. Briefly, the animals were anesthetized using an intraperitoneal injection of Zoletil 50® (VIRBAC; Carros; France) at 40 mg/mL, which contained a mixture of zolazepam and tiletamine hydrochloride (Virbac, Carros, France). The rats’ heads were fixed in a stereotactic apparatus, and a 25-gauge butterfly needle was advanced into the cisterna magna, which was confirmed by withdrawing 0.3-mL of cerebrospinal fluid (CSF). Fresh, autologous, and non-heparinized blood (0.1 mL/100 g of body weight) drawn from the central tail artery was slowly instilled into the subarachnoid space through a butterfly needle and tubing. The animals were then kept in a ventral recumbent position for at least 30 min to promote ventral blood distribution. The respiratory pattern of rats was closely inspected, and mechanical ventilation was provided if required. Once fully awake, the animals were sent back to the vivarium.", "The rats were randomly selected and divided into the following five groups (n = 6 per group): (1) control (no DM or SAH), (2) SAH only, (3) DM + SAH, (4) DM + SAH + Mdivi-1 (0.24 mg/kg), and (5) DM + SAH + Mdivi-1 (1.2 mg/kg). The dose and the time point of the Mdivi-1 treatment were chosen based on the previous study [15]. Mdivi-1 (MedChemExpress; Monmouth Junction; USA) was dissolved in 0.1% dimethyl sulfoxide (DMSO) and administered via intraperitoneal injection immediately after SAH induction. The vehicle animals received an intraperitoneal injection of 0.1% DMSO. The blood-glucose levels were monitored before and after STZ injection. The SAH model was established on day 7 after STZ injection. The animals that survived for 2 days after SAH were included for analysis, and then sacrificed for subsequent experiments.", "Neurobehavioral evaluation of animals was performed by assessing the sensorimotor integration of the forelimb and hindlimb activities using the modified limb-placing test, which consisted of ambulation, as well as placing and stepping reflex [46]. The motor-deficit index (MDI) represented the sum of scores for walking using the lower limbs and for placing/stepping response, and was determined before and 48 h after SAH induction. High MDI values indicated poor neurological outcomes.", "At the end of the experiments, each animal was re-anesthetized for perfusion and fixation. The thoracic cage was opened by canalling the left ventricle using a No. 16 catheter. The brain was perfused with 180 mL of 2% paraformaldehyde and 100 mL of phosphate buffer (0.01 M) at below 36 °C and 100-mmHg perfusion pressure, after clamping the descending aorta and puncturing the right atrium. Gross inspection of harvested brains was performed to confirm the presence of subarachnoid blood clots over the BA, and the specimen was immersed in a fixative solution. The BAs were then separated from the brainstems, and the middle third of each vessel was dissected. The arterial segments were flat-embedded in paraffin, and BA cross-sections were cut into 3-μm sections that were stained with hematoxylin and eosin stain for subsequent analysis.", "Three cross-sections from the middle-third BA from each animal were analyzed by a trained member of research staff who was blinded to the experimental groups. The BA thickness was defined as the largest vertical distance between the inner surface of the endothelium and the outer surface of the adventitia. The arterial cross-sectional area was calculated using a computer-based morphometric analysis (ImageJ; Universal Imaging Corp., Hialeah, FL, USA). The average area of the BA cross-section from each rat was calculated to obtain the mean values for the degree of vasospasm at 48 h after SAH.", "After deparaffinization and rehydration, the paraffin-embedded brain samples were treated with steam heating for antigen retrieval (30 min) using a DAKO antigen retrieval solution (DAKO, Carpinteria, CA, USA). The slides were washed twice with TBS, and the sections were incubated with mouse anti-GFAP (Sigma-Aldrich; G3893; St. Louis, MI, USA) and rabbit anti-Iba1 (Proteintech; 10904-1-AP; Taiwan) antibodies for 16 h at 4 °C. The slides were, again, washed twice with TBS, and subsequently incubated with goat anti-rabbit IgG (H+L)-FAM (Croyez; C04013; Taiwan) and goat anti-mouse IgG (H+L)-TAMRA (Croyez; C04012; Taiwan) antibodies for 90 min at room temperature. Afterward, the slides were washed twice with TBS and were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich; F6057; St. Louis, MI, USA).", "To remove the cells, the samples were immediately centrifuged at 2000× g for 10 min at 4 °C. The collected supernatant was stored below −15 °C before analysis. The collected body fluids were first concentrated by passing them through the C2 columns, to determine the amounts of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL6 in the collected supernatant (Amersham, Nutley, NJ, USA). The amount of inflammatory factor present in the media was detected using an inflammatory factor ELISA system (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm.", "Apoptotic nuclei were stained using a TUNEL detection kit (Roche Inc., Indianapolis, IN, USA) according to the manufacturer’s protocols. Briefly, the tissue sections were fixed in 4% methanol-free paraformaldehyde at 4 °C and washed with phosphate-buffered saline (PBS) for 30 min. Equilibrium buffer (0.1 mL) was added to each slide, which was then covered with parafilm for 10 min. A 50-μL mixture comprising 45 μL equilibrium buffer, 5-μL nucleotide mix, and 1-μL TdT enzyme was prepared and added onto each slide. The slides were incubated in the dark for 1–2 h at 37 °C. Saline sodium citrate (2×) was added to stop the TdT enzyme reaction for 15 min at room temperature. The unbound fluorescent-12-dUTP was washed out using PBS. Then, the slides were dipped in propidium iodide to stain the cells in the dark for 15 min. The slides were dried after rinsing with de-ionized water, and coverslips were overlaid on the interesting area of the slides.", "Tissue extracts were prepared in 500-μL of RIPA buffer (Millipore; 20-188; Burlington, MA, USA), including 1× protease inhibitor (Roche, Germany) and 1× phosphatase inhibitor (Roche, Germany), and incubated on ice for 30 min. The protein amount in the supernatant was quantified using a BCA kit (Sigma-Aldrich; C2284; USA), and the samples (50 μg) were electrophoresed on 10% SDS–polyacrylamide gels, and then transferred to PVDF membranes following centrifugation at 13,000 rpm (10,000 g) for 30 min at 4 °C. The membranes were blocked for 60 min at room temperature in TBS containing 5% fat-free milk, and then incubated for 16 h at 4 °C with antibodies against β-actin (Sigma-Aldrich; A6316; USA) and p-Drp1 (ProSci; 79-951; Fort Collins, CO, USA). After washing, the membranes were incubated for 1.5 h at room temperature with the appropriate horseradish peroxidase-labeled secondary antibodies, and bound antibodies were visualized and quantified via chemiluminescence detection. β-actin was used as the internal control. The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of β-actin; then, the density of the band was expressed as the relative density compared with that in the control group.", "The expression levels of inflammatory factors (TNF-α, IL-1β, and IL-6) were detected via qRT-PCR, using the cDNA as the template, on a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in triplicate, and data were analyzed using the comparative threshold cycle (2−ΔΔCT) method. The PCR amplification cycles consisted of denaturing at 95 °C for 5 min, 45 cycles of denaturing at 95 °C for 90 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final elongation at 72 °C for 10 min. To minimize errors arising from variations in the amount of starting RNA in the samples, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. GAPDH: Forward 5′-AGACAGCCGCATCTTCTTGT-3′ and Reverse 5′-CTTGCCGTGGGTAGAGTCAT; TNF-α: Forward 5′-GCCCAGACCCTCACACTC-3′ and Reserve 5′-CACTCCAGCTGCTCCTCT-3′; IL-1β: Forward 5′- ATGGCAGAAGTACCTAAGCTCGC-3′ and Reverse 5′-ACACAAATTGCATGGTGAAGTCAGTT-3′; IL-6: Forward 5′-CCGGAGAGGAGACTTCACAG-3′ and Reverse 5′-ACAGTGCATCATCGCTGTTC-3′.", "The results were analyzed using Statistical Package for the Social Sciences version 20.0 (IBM SPSS Statistics). Data were expressed as mean ± standard deviation (SD). The estimates were compared with the one-way analysis of variance (ANOVA). A p-value of <0.05 was defined as statistically significant." ]

[ null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "1. Introduction", "2. Results", "2.1. ELISA Assay for Inflammatory Factors In Vitro", "2.2. Neurological Outcomes", "2.3. Morphological, Cross-Sectional-Area, and Thickness Changes in Basal Artery (BA)", "2.4. Microglia and Astrocyte Proliferation", "2.5. Real-Time PCR of Pro-Inflammatory Factors", "2.6. Apoptosis of Neuron Cells", "2.7. Western Blot Analysis", "3. Discussion", "4. Materials and Methods", "4.1. Cell Culture and Treatment", "4.2. Animal Preparation", "4.3. Hyperglycemia Induction", "4.4. SAH Induction", "4.5. Experimental Design and Drug Administration", "4.6. Neurological Assessment", "4.7. Tissue Processing", "4.8. Morphometric Assessment of BA", "4.9. Immunofluorescence", "4.10. Enzyme-Linked Immunosorbent Assay (ELISA)", "4.11. TUNEL Staining", "4.12. Western Blot Analysis", "4.13. Real-Time Quantitative PCR (qRT-PCR)", "4.14. Statistical Analysis", "5. Conclusions" ]

[ "Spontaneous subarachnoid hemorrhage (SAH) is a devastating disease with high mortality and morbidity rates [1]. Only one-third of survival-to-discharge patients resume the same employment as pre-event [2]. Even patients with favorable outcomes are frequently left with significant impairment to residual memory or executive function, or language deficits [3]. Early or delayed brain injuries, presenting in the first 72 h or later within 14 days following SAH, are major components associated with neurological sequelae [4,5,6].\nOne of the critical mechanisms of early brain injury is the disruption of the blood–brain barrier (BBB), a structure that primarily consist of cerebral microvascular endothelial cells, astrocytic endfeet, an extracellular matrix, and pericytes [7]. Loss of BBB integrity results in the direct exposure of the brain tissues to neurotoxic blood contents and immune cells, which leads to secondary brain insults, including inflammation and oxidative stress, as well as other cascades [8]. In addition, apoptosis is one major catastrophic event in the early stage of SAH [6,9]. Apoptotic cell death, which can occur in cerebral neurons or endothelial cells through the intrinsic or extrinsic pathways, has played a significant role in the prognosis in animal SAH models [4,10,11]. Meanwhile, the most common cause of delayed brain injuries is cerebral arterial vasospasm. Cerebral ischemia secondary to vasospasm occurs in 20–30% of these patients, and has been correlated with a 1.5–3-fold increase in mortality in the first 2 weeks following SAH [12,13].\nMitochondrial activity modulation has been reported to alleviate brain injuries and improve neurological deficits following experimental SAH [14,15]. Mitochondria are among the irreplaceable endomembrane systems and are highly dynamic organelles that constantly fuse and divide [16]. Mitochondrial fusion and fission are important to maintain functions, including energy provision to cells, anabolic and catabolic biochemical pathway intervention, calcium homeostasis, regulation, and cell-death initiation [17,18]. The morphology or the shape change in mitochondria is mediated mainly by dynamin-related protein (Drp1) and mitochondrial fission 1 (Fis1) for fission, and mitofusin (Mfn) and optic atrophy-1 (OPA1) for fusion [19]. Defects in mitochondrial fission and fusion proteins have been linked to neurodegenerative diseases such as Alzheimer’s, Parkinson’s, and Huntington’s disease, with the essential role of mitochondrial dynamics in neurons [20]. In addition, the loss of balance in fusion and fission leads to acute central nervous system injuries. The studies demonstrated that Drp1 inhibition could attenuate the neurological dysfunction of traumatic brain injury or spinal cord injury by inhibiting mitochondrial fragmentation and apoptosis activation [21,22]. Drp1 downregulation or Mfn2 upregulation reduces neuronal apoptosis by restoring mitochondrial function in hypoxic or ischemic brain models [23,24].\nIt has been reported that hyperglycemia after cerebral ischemia, a known detrimental factor, further exacerbates the imbalance between mitochondrial fission and fusion, and favors mitochondrial fragmentation and subsequent mitochondrial damage [25]. Our previous study demonstrated that hyperglycemia was partly involved in early brain injuries in as SAH rat model, and induced more profound apoptosis, which mostly occurs in the neurons of the cerebral cortex. Furthermore, morphologically, we found that hyperglycemia exacerbated post-SAH vasospasm, as evidenced by the greater cross-sectional area reduction of the basilar arteries.\nDrp1 is demonstrated as an intrinsic component of multiple mitochondria-dependent apoptosis pathways, and its activity predominantly controls mitochondrial fission [26]. Drp1 proteins, mainly in the cytoplasm, translocate to the mitochondria and are subjected to several post-transcriptional modifications, including ubiquitination, phosphorylation, nitrosylation and SUMOylation [27,28]. Mitochondrial division inhibitor-1 (Mdivi-1) is a quinazolinone derivative that can selectively inhibit Drp1 to downregulate mitochondrial fission [29]. Investigations have reported that Mdivi-1 helps attenuate cell death following experimental traumatic brain injury by maintaining mitochondrial morphology, mitigating autophagy dysfunction, or inhibiting apoptosis activation [21,30]. This study investigated the influence of Mdivi-1 on cell death, severe neurological outcomes, and neuronal apoptosis following SAH with hyperglycemia.", "2.1. ELISA Assay for Inflammatory Factors In Vitro The TNF-α, IL-1β, and IL-6 levels in the supernatant samples from BV-2 were examined using ELISA 6 h after LPS induction to investigate the relationship between pro-inflammatory factors and Mdivi-1. ELISA revealed that LPS induced the release of TNF-α, IL-1β, and IL-6; however, Mdivi-1 blocked the release of TNF-α (Figure 1A), IL-1β (Figure 1B), and IL-6 (Figure 1C) after LPS induction.\nThe TNF-α, IL-1β, and IL-6 levels in the supernatant samples from BV-2 were examined using ELISA 6 h after LPS induction to investigate the relationship between pro-inflammatory factors and Mdivi-1. ELISA revealed that LPS induced the release of TNF-α, IL-1β, and IL-6; however, Mdivi-1 blocked the release of TNF-α (Figure 1A), IL-1β (Figure 1B), and IL-6 (Figure 1C) after LPS induction.\n2.2. Neurological Outcomes The neurobehavioral scores, including ambulation, placing/stepping reflex, and MDI, were not different between the SAH, DM + SAH, and DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) groups (Table 1). In animals subjected to SAH, both the ambulation (1.91 ± 0.37) and placing/stepping reflex (1.34 ± 0.11) scores were significantly lower in the SAH animals than in the DM + SAH animals (ambulation: 2.39 ± 0.27 and placing/stepping reflex: 1.77 ± 0.19). Treatment with a high dose of Mdivi-1 (1.2 mg/kg) significantly decreased both the ambulation (1.62 ± 0.13; p < 0.05) and the placing/stepping reflex (0.57 ± 0.21) scores when compared with the DM + SAH group, but treatment with the low-dose Mdivi-1 (0.24 mg/kg) did not (ambulation: 2.11 ± 0.19 and placing/stepping reflex: 1.59 ± 0.29). Similarly, the MDI in the high-dose Mdivi-1 (1.2 mg/kg) treatment group (1.89 ± 0.31; p < 0.05) was also significantly reduced when compared with that in the DM + SAH group (4.20 ± 0.31) (Table 1).\nThe neurobehavioral scores, including ambulation, placing/stepping reflex, and MDI, were not different between the SAH, DM + SAH, and DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) groups (Table 1). In animals subjected to SAH, both the ambulation (1.91 ± 0.37) and placing/stepping reflex (1.34 ± 0.11) scores were significantly lower in the SAH animals than in the DM + SAH animals (ambulation: 2.39 ± 0.27 and placing/stepping reflex: 1.77 ± 0.19). Treatment with a high dose of Mdivi-1 (1.2 mg/kg) significantly decreased both the ambulation (1.62 ± 0.13; p < 0.05) and the placing/stepping reflex (0.57 ± 0.21) scores when compared with the DM + SAH group, but treatment with the low-dose Mdivi-1 (0.24 mg/kg) did not (ambulation: 2.11 ± 0.19 and placing/stepping reflex: 1.59 ± 0.29). Similarly, the MDI in the high-dose Mdivi-1 (1.2 mg/kg) treatment group (1.89 ± 0.31; p < 0.05) was also significantly reduced when compared with that in the DM + SAH group (4.20 ± 0.31) (Table 1).\n2.3. Morphological, Cross-Sectional-Area, and Thickness Changes in Basal Artery (BA) Microscopic examination revealed endothelial deformation, internal elastic laminae twisting, and smooth muscle necrosis in the BAs of rats subjected to normal, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1, and DM + SAH + high-dose Mdivi-1 (Figure 2A). The mean cross-sectional areas of BA were 0.52 ± 0.11, 0.21 ± 0.059, 0.14 ± 0.028, 0.23 ± 0.051, and 0.37 ± 0.060 mm2 in the control, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1 (0.24 mg/kg), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups, respectively (Figure 2B). The BA cross-sectional area in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group was reduced by 37.8% (p < 0.05) and 47.0% (p < 0.001) compared with that in the SAH and DM + SAH group, respectively. The BA thickness exhibited no significant difference between the SAH (0.0328 ± 0.006 mm) and DM + SAH only (0.0333 ± 0.005 mm) groups (Figure 2C). A significant increase in the BA thickness was observed in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group (0.0183 ± 0.003 mm; p < 0.01 vs. both SAH and DM + SAH groups) (Figure 2C).\nMicroscopic examination revealed endothelial deformation, internal elastic laminae twisting, and smooth muscle necrosis in the BAs of rats subjected to normal, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1, and DM + SAH + high-dose Mdivi-1 (Figure 2A). The mean cross-sectional areas of BA were 0.52 ± 0.11, 0.21 ± 0.059, 0.14 ± 0.028, 0.23 ± 0.051, and 0.37 ± 0.060 mm2 in the control, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1 (0.24 mg/kg), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups, respectively (Figure 2B). The BA cross-sectional area in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group was reduced by 37.8% (p < 0.05) and 47.0% (p < 0.001) compared with that in the SAH and DM + SAH group, respectively. The BA thickness exhibited no significant difference between the SAH (0.0328 ± 0.006 mm) and DM + SAH only (0.0333 ± 0.005 mm) groups (Figure 2C). A significant increase in the BA thickness was observed in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group (0.0183 ± 0.003 mm; p < 0.01 vs. both SAH and DM + SAH groups) (Figure 2C).\n2.4. Microglia and Astrocyte Proliferation Aside from the bleeding area, the activated microglia diffused into the brain parenchyma such as the brain stem, cortex, and hippocampus [31,32]. Similarly, after SAH, astrocytes were activated as part of gliosis [33]. This study employed immunofluorescence staining for Iba-1 and GFAP to detect the presence of microglial cells and astrocytes, respectively. Immunofluorescence staining for Iba-1 indicated that SAH induced microglial cell proliferation in the rat brain and was enhanced by hyperglycemia (Figure 3). In addition, quantitative analysis of the Iba-1 staining intensity revealed comparable levels between the control (set at 1.0), SAH (7.80 ± 1.88), DM + SAH (14.76 ± 2.07), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.81 ± 1.80), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (2.15 ± 0.74). In contrast, Iba-1 staining in the brain of the SAH and DM + SAH rats was significantly elevated, and the Mdivi-1 treatment significantly reduced microglial cell proliferation (low-dose Mdivi-1: p < 0.01 compared with the SAH group and p <0.001 compared with the DM +SAH; high-dose Mdivi-1: p < 0.001 compared with the SAH group and P <0.001 compared with the DM + SAH group) (Figure 3B). The immunofluorescence staining results for GFAP were consistent with those of the Iba-1 staining. In addition, the quantitative analysis the of GFAP staining intensity revealed comparable levels between the control (set at 1.0), SAH (2.33 ± 0.72), DM + SAH (6.53 ± 1.32), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.14 ± 1.63), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (1.63 ± 0.42). In contrast, GFAP staining in the brains of the SAH and DM + SAH rats was substantially elevated, and the Mdivi-1 treatment significantly reduced astrocyte proliferation (low-dose Mdivi-1: p < 0.001 compared with DM + SAH; high-dose Mdivi-1: p < 0.001 compared with DM + SAH) (Figure 4B).\nAside from the bleeding area, the activated microglia diffused into the brain parenchyma such as the brain stem, cortex, and hippocampus [31,32]. Similarly, after SAH, astrocytes were activated as part of gliosis [33]. This study employed immunofluorescence staining for Iba-1 and GFAP to detect the presence of microglial cells and astrocytes, respectively. Immunofluorescence staining for Iba-1 indicated that SAH induced microglial cell proliferation in the rat brain and was enhanced by hyperglycemia (Figure 3). In addition, quantitative analysis of the Iba-1 staining intensity revealed comparable levels between the control (set at 1.0), SAH (7.80 ± 1.88), DM + SAH (14.76 ± 2.07), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.81 ± 1.80), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (2.15 ± 0.74). In contrast, Iba-1 staining in the brain of the SAH and DM + SAH rats was significantly elevated, and the Mdivi-1 treatment significantly reduced microglial cell proliferation (low-dose Mdivi-1: p < 0.01 compared with the SAH group and p <0.001 compared with the DM +SAH; high-dose Mdivi-1: p < 0.001 compared with the SAH group and P <0.001 compared with the DM + SAH group) (Figure 3B). The immunofluorescence staining results for GFAP were consistent with those of the Iba-1 staining. In addition, the quantitative analysis the of GFAP staining intensity revealed comparable levels between the control (set at 1.0), SAH (2.33 ± 0.72), DM + SAH (6.53 ± 1.32), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.14 ± 1.63), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (1.63 ± 0.42). In contrast, GFAP staining in the brains of the SAH and DM + SAH rats was substantially elevated, and the Mdivi-1 treatment significantly reduced astrocyte proliferation (low-dose Mdivi-1: p < 0.001 compared with DM + SAH; high-dose Mdivi-1: p < 0.001 compared with DM + SAH) (Figure 4B).\n2.5. Real-Time PCR of Pro-Inflammatory Factors The TNF-α, IL-1β, and IL-6 levels in the brain were examined using real-time PCR 7 days after SAH, to investigate the relationship between pro-inflammatory factors in SAH and Mdivi-1. The real-time PCR result indicated that the TNF-α, IL-1β, and IL-6 expression in the DM + SAH group were significantly higher than those in the SAH group in the brain (Figure 5). All of the aforementioned increases in protein expression were significantly attenuated after the administration of the Mdivi-1 treatment (TNF-α: p < 0.05; IL-1β: p < 0.01; IL-6: p < 0.05, compared with the respective DM + SAH group upon treatment with low-dose Mdivi-1) (TNF-α, IL-1β, and IL-6: p < 0.001, compared with the respective DM + SAH group upon treatment with high-dose Mdivi-1) (Figure 5).\nThe TNF-α, IL-1β, and IL-6 levels in the brain were examined using real-time PCR 7 days after SAH, to investigate the relationship between pro-inflammatory factors in SAH and Mdivi-1. The real-time PCR result indicated that the TNF-α, IL-1β, and IL-6 expression in the DM + SAH group were significantly higher than those in the SAH group in the brain (Figure 5). All of the aforementioned increases in protein expression were significantly attenuated after the administration of the Mdivi-1 treatment (TNF-α: p < 0.05; IL-1β: p < 0.01; IL-6: p < 0.05, compared with the respective DM + SAH group upon treatment with low-dose Mdivi-1) (TNF-α, IL-1β, and IL-6: p < 0.001, compared with the respective DM + SAH group upon treatment with high-dose Mdivi-1) (Figure 5).\n2.6. Apoptosis of Neuron Cells This study conducted immunofluorescence staining for TUNEL and neuron cells to detect neuron cell apoptosis. Quantitative analysis of the number of instances of double immunofluorescence positive staining for TUNEL and NeuN revealed that SAH induced neuron cell apoptosis in the rat brain (Figure 6A). In contrast, double staining in the brain of hyperglycemic rats was substantially elevated (26.625 ± 9.50) and the Mdivi-1 treatment significantly reduced neuron cell apoptosis (low-dose Mdivi-1: 17.5 ± 3.93, p < 0.05; high-dose Mdivi-1: 8.125 ± 5.11, p < 0.001 compared with the DM + SAH group) (Figure 6B).\nThis study conducted immunofluorescence staining for TUNEL and neuron cells to detect neuron cell apoptosis. Quantitative analysis of the number of instances of double immunofluorescence positive staining for TUNEL and NeuN revealed that SAH induced neuron cell apoptosis in the rat brain (Figure 6A). In contrast, double staining in the brain of hyperglycemic rats was substantially elevated (26.625 ± 9.50) and the Mdivi-1 treatment significantly reduced neuron cell apoptosis (low-dose Mdivi-1: 17.5 ± 3.93, p < 0.05; high-dose Mdivi-1: 8.125 ± 5.11, p < 0.001 compared with the DM + SAH group) (Figure 6B).\n2.7. Western Blot Analysis Drp1 is demonstrated as an intrinsic component of multiple mitochondria-dependent apoptosis pathways, and its activity predominantly controls mitochondrial fission [26]. Mdivi-1 is a derivative of quinazolinone that can selectively inhibit Drp1 to downregulate mitochondrial fission [29]. This study demonstrates that the phospho-Drp1 (p-Drp1) level in the DM + SAH group was significantly higher than that in the SAH group in the Western blot analysis. High-dose Mdivi-1 (1.2 mg/kg) treatment significantly reduced the p-Drp1 expression (p < 0.001). However, low-dose Mdivi-1 (0.24 mg/kg) had a trend toward decreasing the expression of p-Drp1, albeit not significantly (Figure 7).\nDrp1 is demonstrated as an intrinsic component of multiple mitochondria-dependent apoptosis pathways, and its activity predominantly controls mitochondrial fission [26]. Mdivi-1 is a derivative of quinazolinone that can selectively inhibit Drp1 to downregulate mitochondrial fission [29]. This study demonstrates that the phospho-Drp1 (p-Drp1) level in the DM + SAH group was significantly higher than that in the SAH group in the Western blot analysis. High-dose Mdivi-1 (1.2 mg/kg) treatment significantly reduced the p-Drp1 expression (p < 0.001). However, low-dose Mdivi-1 (0.24 mg/kg) had a trend toward decreasing the expression of p-Drp1, albeit not significantly (Figure 7).", "The TNF-α, IL-1β, and IL-6 levels in the supernatant samples from BV-2 were examined using ELISA 6 h after LPS induction to investigate the relationship between pro-inflammatory factors and Mdivi-1. ELISA revealed that LPS induced the release of TNF-α, IL-1β, and IL-6; however, Mdivi-1 blocked the release of TNF-α (Figure 1A), IL-1β (Figure 1B), and IL-6 (Figure 1C) after LPS induction.", "The neurobehavioral scores, including ambulation, placing/stepping reflex, and MDI, were not different between the SAH, DM + SAH, and DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) groups (Table 1). In animals subjected to SAH, both the ambulation (1.91 ± 0.37) and placing/stepping reflex (1.34 ± 0.11) scores were significantly lower in the SAH animals than in the DM + SAH animals (ambulation: 2.39 ± 0.27 and placing/stepping reflex: 1.77 ± 0.19). Treatment with a high dose of Mdivi-1 (1.2 mg/kg) significantly decreased both the ambulation (1.62 ± 0.13; p < 0.05) and the placing/stepping reflex (0.57 ± 0.21) scores when compared with the DM + SAH group, but treatment with the low-dose Mdivi-1 (0.24 mg/kg) did not (ambulation: 2.11 ± 0.19 and placing/stepping reflex: 1.59 ± 0.29). Similarly, the MDI in the high-dose Mdivi-1 (1.2 mg/kg) treatment group (1.89 ± 0.31; p < 0.05) was also significantly reduced when compared with that in the DM + SAH group (4.20 ± 0.31) (Table 1).", "Microscopic examination revealed endothelial deformation, internal elastic laminae twisting, and smooth muscle necrosis in the BAs of rats subjected to normal, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1, and DM + SAH + high-dose Mdivi-1 (Figure 2A). The mean cross-sectional areas of BA were 0.52 ± 0.11, 0.21 ± 0.059, 0.14 ± 0.028, 0.23 ± 0.051, and 0.37 ± 0.060 mm2 in the control, SAH, DM + SAH, DM + SAH + low-dose Mdivi-1 (0.24 mg/kg), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups, respectively (Figure 2B). The BA cross-sectional area in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group was reduced by 37.8% (p < 0.05) and 47.0% (p < 0.001) compared with that in the SAH and DM + SAH group, respectively. The BA thickness exhibited no significant difference between the SAH (0.0328 ± 0.006 mm) and DM + SAH only (0.0333 ± 0.005 mm) groups (Figure 2C). A significant increase in the BA thickness was observed in the DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) group (0.0183 ± 0.003 mm; p < 0.01 vs. both SAH and DM + SAH groups) (Figure 2C).", "Aside from the bleeding area, the activated microglia diffused into the brain parenchyma such as the brain stem, cortex, and hippocampus [31,32]. Similarly, after SAH, astrocytes were activated as part of gliosis [33]. This study employed immunofluorescence staining for Iba-1 and GFAP to detect the presence of microglial cells and astrocytes, respectively. Immunofluorescence staining for Iba-1 indicated that SAH induced microglial cell proliferation in the rat brain and was enhanced by hyperglycemia (Figure 3). In addition, quantitative analysis of the Iba-1 staining intensity revealed comparable levels between the control (set at 1.0), SAH (7.80 ± 1.88), DM + SAH (14.76 ± 2.07), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.81 ± 1.80), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (2.15 ± 0.74). In contrast, Iba-1 staining in the brain of the SAH and DM + SAH rats was significantly elevated, and the Mdivi-1 treatment significantly reduced microglial cell proliferation (low-dose Mdivi-1: p < 0.01 compared with the SAH group and p <0.001 compared with the DM +SAH; high-dose Mdivi-1: p < 0.001 compared with the SAH group and P <0.001 compared with the DM + SAH group) (Figure 3B). The immunofluorescence staining results for GFAP were consistent with those of the Iba-1 staining. In addition, the quantitative analysis the of GFAP staining intensity revealed comparable levels between the control (set at 1.0), SAH (2.33 ± 0.72), DM + SAH (6.53 ± 1.32), DM + SAH + low-dose Mdivi-1 (0.24 mg/kg) (3.14 ± 1.63), and DM + SAH + high-dose Mdivi-1 (1.2 mg/kg) groups (1.63 ± 0.42). In contrast, GFAP staining in the brains of the SAH and DM + SAH rats was substantially elevated, and the Mdivi-1 treatment significantly reduced astrocyte proliferation (low-dose Mdivi-1: p < 0.001 compared with DM + SAH; high-dose Mdivi-1: p < 0.001 compared with DM + SAH) (Figure 4B).", "The TNF-α, IL-1β, and IL-6 levels in the brain were examined using real-time PCR 7 days after SAH, to investigate the relationship between pro-inflammatory factors in SAH and Mdivi-1. The real-time PCR result indicated that the TNF-α, IL-1β, and IL-6 expression in the DM + SAH group were significantly higher than those in the SAH group in the brain (Figure 5). All of the aforementioned increases in protein expression were significantly attenuated after the administration of the Mdivi-1 treatment (TNF-α: p < 0.05; IL-1β: p < 0.01; IL-6: p < 0.05, compared with the respective DM + SAH group upon treatment with low-dose Mdivi-1) (TNF-α, IL-1β, and IL-6: p < 0.001, compared with the respective DM + SAH group upon treatment with high-dose Mdivi-1) (Figure 5).", "This study conducted immunofluorescence staining for TUNEL and neuron cells to detect neuron cell apoptosis. Quantitative analysis of the number of instances of double immunofluorescence positive staining for TUNEL and NeuN revealed that SAH induced neuron cell apoptosis in the rat brain (Figure 6A). In contrast, double staining in the brain of hyperglycemic rats was substantially elevated (26.625 ± 9.50) and the Mdivi-1 treatment significantly reduced neuron cell apoptosis (low-dose Mdivi-1: 17.5 ± 3.93, p < 0.05; high-dose Mdivi-1: 8.125 ± 5.11, p < 0.001 compared with the DM + SAH group) (Figure 6B).", "Drp1 is demonstrated as an intrinsic component of multiple mitochondria-dependent apoptosis pathways, and its activity predominantly controls mitochondrial fission [26]. Mdivi-1 is a derivative of quinazolinone that can selectively inhibit Drp1 to downregulate mitochondrial fission [29]. This study demonstrates that the phospho-Drp1 (p-Drp1) level in the DM + SAH group was significantly higher than that in the SAH group in the Western blot analysis. High-dose Mdivi-1 (1.2 mg/kg) treatment significantly reduced the p-Drp1 expression (p < 0.001). However, low-dose Mdivi-1 (0.24 mg/kg) had a trend toward decreasing the expression of p-Drp1, albeit not significantly (Figure 7).", "Our previous study demonstrated that hyperglycemia aggravated neuronal apoptosis that was related to unfavorable neurological outcomes following SAH in a rodent model. Enhancement of the extrinsic caspase cascade activation through the ERK signal pathway may be the mechanism underlying hyperglycemia-mediated apoptosis. Meanwhile, hyperglycemia exacerbated cerebral vasospasm and was associated with poor neurological outcomes after SAH. An increasing number of clinical studies have reported a correlation between mitochondrial fission/fusion and unfavorable prognosis in SAH cases. Fan et al. demonstrated that mitochondrial fission might inhibit mitochondrial complex I to become a cause of oxidative stress in SAH; moreover, they demonstrated that Drp1 inhibition by Mdivi-1 attenuated early brain injury following SAH, probably by suppressing inflammation-related BBB disruption and endoplasmic reticulum stress-induced apoptosis [15]. The neurological outcomes of our study revealed significantly reduced MDI in the high-dose (1.2 mg/kg) Mdivi-1 treatment group compared with the SAH and DM + SAH groups, but not in the low-dose Midiv-1 group. Morphologically, we previously revealed that hyperglycemia exacerbated post-SAH vasospasm, as evidenced by a significant reduction in the rat BA cross-sectional area and basilar artery thickness. In this study, treatment with a high-dose Mdivi-1 (1.2 mg/kg) significantly attenuated post-SAH vasospasm with or without hyperglycemia.\nMany reports have revealed that glial cells (microglia and astrocyte) regulate SAH-induced vasospasm and neuronal apoptosis by releasing inflammation factors such as TNF-α, IL-1β, and IL-6. Inflammation and cytokines may participate in the pathology of BBB disruption and brain edema, which are characteristic features of both clinical and experimental SAH [34,35]. A variety of inflammatory cytokines, including IL-1β, IL-6, and TNF-α, are strongly associated with rat brain injury [36]. Neuronal apoptosis was inhibited in various experimental animal models of neurological disease, in addition to the anti-inflammatory effects. The systemic levels of TNF-α and IL-6 are elevated in DM, and can directly promote insulin resistance [37,38]. Thus, elevated cytokine levels may not only serve as DM markers, but also play a significant role in type 2 diabetes etiology. The tendency of diabetes patients to have higher levels of inflammation has serious consequences [39]. Microglia and astrocyte activation aggravates SAH-induced brain injury by secreting inflammatory factors [40,41,42], whereas the inhibition of microglia and astrocyte activation attenuates brain injury following SAH. Our results indicate that hyperglycemia enhanced SAH-induced microglia and astrocyte activation and proliferation, thereby increasing the inflammatory factor concentration in the CSF and the number of instances of neuron cell apoptosis in the brain. Mitochondrial fusion and fission are essential for maintaining mitochondrial functions, including energy metabolism, free-radical formation regulation, calcium circulation, and cell-death pathway initiation [43]. Previous studies demonstrated that Mdivi-1, a Drp-1 inhibitor, can provide neuroprotection against transient ischemic brain damage in vivo, and reduce the infarct volume [23]. In animals with SAH, the current evidence shows that Mdivi-1 potentially suppresses BBB disruption, oxidative stress, and endoplasmic-reticulum-stress-induced apoptosis [14,15]. Our study demonstrates that a high-dose of Mdivi-1 attenuated inflammation and neuron cell apoptosis by inhibiting SAH-induced activation and microglia and astrocyte proliferation, with or without hyperglycemia.", "4.1. Cell Culture and Treatment The mouse BV2 microglial cells were cultured with DMEM, including 10% fetal bovine serum and 5% carbon dioxide, at 37 °C. The BV2 cells were treated with Mdivi-1 30 min before the addition of lipopolysaccharide (LPS) at 100 ng/mL to measure the anti-inflammatory effects of Mdivi-1.\nThe mouse BV2 microglial cells were cultured with DMEM, including 10% fetal bovine serum and 5% carbon dioxide, at 37 °C. The BV2 cells were treated with Mdivi-1 30 min before the addition of lipopolysaccharide (LPS) at 100 ng/mL to measure the anti-inflammatory effects of Mdivi-1.\n4.2. Animal Preparation Male Sprague Dawley rats weighing between 350 and 450 g were used (BioLasco; Taipei; Taiwan). All rats were housed at a constant temperature (24 °C) and at regular light/dark cycles between 6:00 am and 6:00 pm, with free access to a diet. The study procedures were executed in accordance with the protocol approved by the Committee of Institutional Animal Research at the Kaohsiung Medical University (IACUC 108215).\nMale Sprague Dawley rats weighing between 350 and 450 g were used (BioLasco; Taipei; Taiwan). All rats were housed at a constant temperature (24 °C) and at regular light/dark cycles between 6:00 am and 6:00 pm, with free access to a diet. The study procedures were executed in accordance with the protocol approved by the Committee of Institutional Animal Research at the Kaohsiung Medical University (IACUC 108215).\n4.3. Hyperglycemia Induction Hyperglycemia was induced according to the method described by Yu-Hua Huang [44]. A single dose of STZ at 50 mg/kg was intraperitoneally injected to induce hyperglycemia. Blood glucose was measured via the tail vein of each rat using a portable glucometer (Accu-Chek Performa, Roche Diagnostics Ltd., Indianapolis, IN, USA) that was calibrated according to the manufacturer’s protocols. Diabetes mellitus (DM) induction was considered successful if the blood-glucose level was >300 mg/dL at 7 days following STZ administration [32].\nHyperglycemia was induced according to the method described by Yu-Hua Huang [44]. A single dose of STZ at 50 mg/kg was intraperitoneally injected to induce hyperglycemia. Blood glucose was measured via the tail vein of each rat using a portable glucometer (Accu-Chek Performa, Roche Diagnostics Ltd., Indianapolis, IN, USA) that was calibrated according to the manufacturer’s protocols. Diabetes mellitus (DM) induction was considered successful if the blood-glucose level was >300 mg/dL at 7 days following STZ administration [32].\n4.4. SAH Induction The one-shot SAH model was used in rats [45]. Briefly, the animals were anesthetized using an intraperitoneal injection of Zoletil 50® (VIRBAC; Carros; France) at 40 mg/mL, which contained a mixture of zolazepam and tiletamine hydrochloride (Virbac, Carros, France). The rats’ heads were fixed in a stereotactic apparatus, and a 25-gauge butterfly needle was advanced into the cisterna magna, which was confirmed by withdrawing 0.3-mL of cerebrospinal fluid (CSF). Fresh, autologous, and non-heparinized blood (0.1 mL/100 g of body weight) drawn from the central tail artery was slowly instilled into the subarachnoid space through a butterfly needle and tubing. The animals were then kept in a ventral recumbent position for at least 30 min to promote ventral blood distribution. The respiratory pattern of rats was closely inspected, and mechanical ventilation was provided if required. Once fully awake, the animals were sent back to the vivarium.\nThe one-shot SAH model was used in rats [45]. Briefly, the animals were anesthetized using an intraperitoneal injection of Zoletil 50® (VIRBAC; Carros; France) at 40 mg/mL, which contained a mixture of zolazepam and tiletamine hydrochloride (Virbac, Carros, France). The rats’ heads were fixed in a stereotactic apparatus, and a 25-gauge butterfly needle was advanced into the cisterna magna, which was confirmed by withdrawing 0.3-mL of cerebrospinal fluid (CSF). Fresh, autologous, and non-heparinized blood (0.1 mL/100 g of body weight) drawn from the central tail artery was slowly instilled into the subarachnoid space through a butterfly needle and tubing. The animals were then kept in a ventral recumbent position for at least 30 min to promote ventral blood distribution. The respiratory pattern of rats was closely inspected, and mechanical ventilation was provided if required. Once fully awake, the animals were sent back to the vivarium.\n4.5. Experimental Design and Drug Administration The rats were randomly selected and divided into the following five groups (n = 6 per group): (1) control (no DM or SAH), (2) SAH only, (3) DM + SAH, (4) DM + SAH + Mdivi-1 (0.24 mg/kg), and (5) DM + SAH + Mdivi-1 (1.2 mg/kg). The dose and the time point of the Mdivi-1 treatment were chosen based on the previous study [15]. Mdivi-1 (MedChemExpress; Monmouth Junction; USA) was dissolved in 0.1% dimethyl sulfoxide (DMSO) and administered via intraperitoneal injection immediately after SAH induction. The vehicle animals received an intraperitoneal injection of 0.1% DMSO. The blood-glucose levels were monitored before and after STZ injection. The SAH model was established on day 7 after STZ injection. The animals that survived for 2 days after SAH were included for analysis, and then sacrificed for subsequent experiments.\nThe rats were randomly selected and divided into the following five groups (n = 6 per group): (1) control (no DM or SAH), (2) SAH only, (3) DM + SAH, (4) DM + SAH + Mdivi-1 (0.24 mg/kg), and (5) DM + SAH + Mdivi-1 (1.2 mg/kg). The dose and the time point of the Mdivi-1 treatment were chosen based on the previous study [15]. Mdivi-1 (MedChemExpress; Monmouth Junction; USA) was dissolved in 0.1% dimethyl sulfoxide (DMSO) and administered via intraperitoneal injection immediately after SAH induction. The vehicle animals received an intraperitoneal injection of 0.1% DMSO. The blood-glucose levels were monitored before and after STZ injection. The SAH model was established on day 7 after STZ injection. The animals that survived for 2 days after SAH were included for analysis, and then sacrificed for subsequent experiments.\n4.6. Neurological Assessment Neurobehavioral evaluation of animals was performed by assessing the sensorimotor integration of the forelimb and hindlimb activities using the modified limb-placing test, which consisted of ambulation, as well as placing and stepping reflex [46]. The motor-deficit index (MDI) represented the sum of scores for walking using the lower limbs and for placing/stepping response, and was determined before and 48 h after SAH induction. High MDI values indicated poor neurological outcomes.\nNeurobehavioral evaluation of animals was performed by assessing the sensorimotor integration of the forelimb and hindlimb activities using the modified limb-placing test, which consisted of ambulation, as well as placing and stepping reflex [46]. The motor-deficit index (MDI) represented the sum of scores for walking using the lower limbs and for placing/stepping response, and was determined before and 48 h after SAH induction. High MDI values indicated poor neurological outcomes.\n4.7. Tissue Processing At the end of the experiments, each animal was re-anesthetized for perfusion and fixation. The thoracic cage was opened by canalling the left ventricle using a No. 16 catheter. The brain was perfused with 180 mL of 2% paraformaldehyde and 100 mL of phosphate buffer (0.01 M) at below 36 °C and 100-mmHg perfusion pressure, after clamping the descending aorta and puncturing the right atrium. Gross inspection of harvested brains was performed to confirm the presence of subarachnoid blood clots over the BA, and the specimen was immersed in a fixative solution. The BAs were then separated from the brainstems, and the middle third of each vessel was dissected. The arterial segments were flat-embedded in paraffin, and BA cross-sections were cut into 3-μm sections that were stained with hematoxylin and eosin stain for subsequent analysis.\nAt the end of the experiments, each animal was re-anesthetized for perfusion and fixation. The thoracic cage was opened by canalling the left ventricle using a No. 16 catheter. The brain was perfused with 180 mL of 2% paraformaldehyde and 100 mL of phosphate buffer (0.01 M) at below 36 °C and 100-mmHg perfusion pressure, after clamping the descending aorta and puncturing the right atrium. Gross inspection of harvested brains was performed to confirm the presence of subarachnoid blood clots over the BA, and the specimen was immersed in a fixative solution. The BAs were then separated from the brainstems, and the middle third of each vessel was dissected. The arterial segments were flat-embedded in paraffin, and BA cross-sections were cut into 3-μm sections that were stained with hematoxylin and eosin stain for subsequent analysis.\n4.8. Morphometric Assessment of BA Three cross-sections from the middle-third BA from each animal were analyzed by a trained member of research staff who was blinded to the experimental groups. The BA thickness was defined as the largest vertical distance between the inner surface of the endothelium and the outer surface of the adventitia. The arterial cross-sectional area was calculated using a computer-based morphometric analysis (ImageJ; Universal Imaging Corp., Hialeah, FL, USA). The average area of the BA cross-section from each rat was calculated to obtain the mean values for the degree of vasospasm at 48 h after SAH.\nThree cross-sections from the middle-third BA from each animal were analyzed by a trained member of research staff who was blinded to the experimental groups. The BA thickness was defined as the largest vertical distance between the inner surface of the endothelium and the outer surface of the adventitia. The arterial cross-sectional area was calculated using a computer-based morphometric analysis (ImageJ; Universal Imaging Corp., Hialeah, FL, USA). The average area of the BA cross-section from each rat was calculated to obtain the mean values for the degree of vasospasm at 48 h after SAH.\n4.9. Immunofluorescence After deparaffinization and rehydration, the paraffin-embedded brain samples were treated with steam heating for antigen retrieval (30 min) using a DAKO antigen retrieval solution (DAKO, Carpinteria, CA, USA). The slides were washed twice with TBS, and the sections were incubated with mouse anti-GFAP (Sigma-Aldrich; G3893; St. Louis, MI, USA) and rabbit anti-Iba1 (Proteintech; 10904-1-AP; Taiwan) antibodies for 16 h at 4 °C. The slides were, again, washed twice with TBS, and subsequently incubated with goat anti-rabbit IgG (H+L)-FAM (Croyez; C04013; Taiwan) and goat anti-mouse IgG (H+L)-TAMRA (Croyez; C04012; Taiwan) antibodies for 90 min at room temperature. Afterward, the slides were washed twice with TBS and were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich; F6057; St. Louis, MI, USA).\nAfter deparaffinization and rehydration, the paraffin-embedded brain samples were treated with steam heating for antigen retrieval (30 min) using a DAKO antigen retrieval solution (DAKO, Carpinteria, CA, USA). The slides were washed twice with TBS, and the sections were incubated with mouse anti-GFAP (Sigma-Aldrich; G3893; St. Louis, MI, USA) and rabbit anti-Iba1 (Proteintech; 10904-1-AP; Taiwan) antibodies for 16 h at 4 °C. The slides were, again, washed twice with TBS, and subsequently incubated with goat anti-rabbit IgG (H+L)-FAM (Croyez; C04013; Taiwan) and goat anti-mouse IgG (H+L)-TAMRA (Croyez; C04012; Taiwan) antibodies for 90 min at room temperature. Afterward, the slides were washed twice with TBS and were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich; F6057; St. Louis, MI, USA).\n4.10. Enzyme-Linked Immunosorbent Assay (ELISA) To remove the cells, the samples were immediately centrifuged at 2000× g for 10 min at 4 °C. The collected supernatant was stored below −15 °C before analysis. The collected body fluids were first concentrated by passing them through the C2 columns, to determine the amounts of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL6 in the collected supernatant (Amersham, Nutley, NJ, USA). The amount of inflammatory factor present in the media was detected using an inflammatory factor ELISA system (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm.\nTo remove the cells, the samples were immediately centrifuged at 2000× g for 10 min at 4 °C. The collected supernatant was stored below −15 °C before analysis. The collected body fluids were first concentrated by passing them through the C2 columns, to determine the amounts of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL6 in the collected supernatant (Amersham, Nutley, NJ, USA). The amount of inflammatory factor present in the media was detected using an inflammatory factor ELISA system (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm.\n4.11. TUNEL Staining Apoptotic nuclei were stained using a TUNEL detection kit (Roche Inc., Indianapolis, IN, USA) according to the manufacturer’s protocols. Briefly, the tissue sections were fixed in 4% methanol-free paraformaldehyde at 4 °C and washed with phosphate-buffered saline (PBS) for 30 min. Equilibrium buffer (0.1 mL) was added to each slide, which was then covered with parafilm for 10 min. A 50-μL mixture comprising 45 μL equilibrium buffer, 5-μL nucleotide mix, and 1-μL TdT enzyme was prepared and added onto each slide. The slides were incubated in the dark for 1–2 h at 37 °C. Saline sodium citrate (2×) was added to stop the TdT enzyme reaction for 15 min at room temperature. The unbound fluorescent-12-dUTP was washed out using PBS. Then, the slides were dipped in propidium iodide to stain the cells in the dark for 15 min. The slides were dried after rinsing with de-ionized water, and coverslips were overlaid on the interesting area of the slides.\nApoptotic nuclei were stained using a TUNEL detection kit (Roche Inc., Indianapolis, IN, USA) according to the manufacturer’s protocols. Briefly, the tissue sections were fixed in 4% methanol-free paraformaldehyde at 4 °C and washed with phosphate-buffered saline (PBS) for 30 min. Equilibrium buffer (0.1 mL) was added to each slide, which was then covered with parafilm for 10 min. A 50-μL mixture comprising 45 μL equilibrium buffer, 5-μL nucleotide mix, and 1-μL TdT enzyme was prepared and added onto each slide. The slides were incubated in the dark for 1–2 h at 37 °C. Saline sodium citrate (2×) was added to stop the TdT enzyme reaction for 15 min at room temperature. The unbound fluorescent-12-dUTP was washed out using PBS. Then, the slides were dipped in propidium iodide to stain the cells in the dark for 15 min. The slides were dried after rinsing with de-ionized water, and coverslips were overlaid on the interesting area of the slides.\n4.12. Western Blot Analysis Tissue extracts were prepared in 500-μL of RIPA buffer (Millipore; 20-188; Burlington, MA, USA), including 1× protease inhibitor (Roche, Germany) and 1× phosphatase inhibitor (Roche, Germany), and incubated on ice for 30 min. The protein amount in the supernatant was quantified using a BCA kit (Sigma-Aldrich; C2284; USA), and the samples (50 μg) were electrophoresed on 10% SDS–polyacrylamide gels, and then transferred to PVDF membranes following centrifugation at 13,000 rpm (10,000 g) for 30 min at 4 °C. The membranes were blocked for 60 min at room temperature in TBS containing 5% fat-free milk, and then incubated for 16 h at 4 °C with antibodies against β-actin (Sigma-Aldrich; A6316; USA) and p-Drp1 (ProSci; 79-951; Fort Collins, CO, USA). After washing, the membranes were incubated for 1.5 h at room temperature with the appropriate horseradish peroxidase-labeled secondary antibodies, and bound antibodies were visualized and quantified via chemiluminescence detection. β-actin was used as the internal control. The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of β-actin; then, the density of the band was expressed as the relative density compared with that in the control group.\nTissue extracts were prepared in 500-μL of RIPA buffer (Millipore; 20-188; Burlington, MA, USA), including 1× protease inhibitor (Roche, Germany) and 1× phosphatase inhibitor (Roche, Germany), and incubated on ice for 30 min. The protein amount in the supernatant was quantified using a BCA kit (Sigma-Aldrich; C2284; USA), and the samples (50 μg) were electrophoresed on 10% SDS–polyacrylamide gels, and then transferred to PVDF membranes following centrifugation at 13,000 rpm (10,000 g) for 30 min at 4 °C. The membranes were blocked for 60 min at room temperature in TBS containing 5% fat-free milk, and then incubated for 16 h at 4 °C with antibodies against β-actin (Sigma-Aldrich; A6316; USA) and p-Drp1 (ProSci; 79-951; Fort Collins, CO, USA). After washing, the membranes were incubated for 1.5 h at room temperature with the appropriate horseradish peroxidase-labeled secondary antibodies, and bound antibodies were visualized and quantified via chemiluminescence detection. β-actin was used as the internal control. The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of β-actin; then, the density of the band was expressed as the relative density compared with that in the control group.\n4.13. Real-Time Quantitative PCR (qRT-PCR) The expression levels of inflammatory factors (TNF-α, IL-1β, and IL-6) were detected via qRT-PCR, using the cDNA as the template, on a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in triplicate, and data were analyzed using the comparative threshold cycle (2−ΔΔCT) method. The PCR amplification cycles consisted of denaturing at 95 °C for 5 min, 45 cycles of denaturing at 95 °C for 90 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final elongation at 72 °C for 10 min. To minimize errors arising from variations in the amount of starting RNA in the samples, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. GAPDH: Forward 5′-AGACAGCCGCATCTTCTTGT-3′ and Reverse 5′-CTTGCCGTGGGTAGAGTCAT; TNF-α: Forward 5′-GCCCAGACCCTCACACTC-3′ and Reserve 5′-CACTCCAGCTGCTCCTCT-3′; IL-1β: Forward 5′- ATGGCAGAAGTACCTAAGCTCGC-3′ and Reverse 5′-ACACAAATTGCATGGTGAAGTCAGTT-3′; IL-6: Forward 5′-CCGGAGAGGAGACTTCACAG-3′ and Reverse 5′-ACAGTGCATCATCGCTGTTC-3′.\nThe expression levels of inflammatory factors (TNF-α, IL-1β, and IL-6) were detected via qRT-PCR, using the cDNA as the template, on a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in triplicate, and data were analyzed using the comparative threshold cycle (2−ΔΔCT) method. The PCR amplification cycles consisted of denaturing at 95 °C for 5 min, 45 cycles of denaturing at 95 °C for 90 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final elongation at 72 °C for 10 min. To minimize errors arising from variations in the amount of starting RNA in the samples, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. GAPDH: Forward 5′-AGACAGCCGCATCTTCTTGT-3′ and Reverse 5′-CTTGCCGTGGGTAGAGTCAT; TNF-α: Forward 5′-GCCCAGACCCTCACACTC-3′ and Reserve 5′-CACTCCAGCTGCTCCTCT-3′; IL-1β: Forward 5′- ATGGCAGAAGTACCTAAGCTCGC-3′ and Reverse 5′-ACACAAATTGCATGGTGAAGTCAGTT-3′; IL-6: Forward 5′-CCGGAGAGGAGACTTCACAG-3′ and Reverse 5′-ACAGTGCATCATCGCTGTTC-3′.\n4.14. Statistical Analysis The results were analyzed using Statistical Package for the Social Sciences version 20.0 (IBM SPSS Statistics). Data were expressed as mean ± standard deviation (SD). The estimates were compared with the one-way analysis of variance (ANOVA). A p-value of <0.05 was defined as statistically significant.\nThe results were analyzed using Statistical Package for the Social Sciences version 20.0 (IBM SPSS Statistics). Data were expressed as mean ± standard deviation (SD). The estimates were compared with the one-way analysis of variance (ANOVA). A p-value of <0.05 was defined as statistically significant.", "The mouse BV2 microglial cells were cultured with DMEM, including 10% fetal bovine serum and 5% carbon dioxide, at 37 °C. The BV2 cells were treated with Mdivi-1 30 min before the addition of lipopolysaccharide (LPS) at 100 ng/mL to measure the anti-inflammatory effects of Mdivi-1.", "Male Sprague Dawley rats weighing between 350 and 450 g were used (BioLasco; Taipei; Taiwan). All rats were housed at a constant temperature (24 °C) and at regular light/dark cycles between 6:00 am and 6:00 pm, with free access to a diet. The study procedures were executed in accordance with the protocol approved by the Committee of Institutional Animal Research at the Kaohsiung Medical University (IACUC 108215).", "Hyperglycemia was induced according to the method described by Yu-Hua Huang [44]. A single dose of STZ at 50 mg/kg was intraperitoneally injected to induce hyperglycemia. Blood glucose was measured via the tail vein of each rat using a portable glucometer (Accu-Chek Performa, Roche Diagnostics Ltd., Indianapolis, IN, USA) that was calibrated according to the manufacturer’s protocols. Diabetes mellitus (DM) induction was considered successful if the blood-glucose level was >300 mg/dL at 7 days following STZ administration [32].", "The one-shot SAH model was used in rats [45]. Briefly, the animals were anesthetized using an intraperitoneal injection of Zoletil 50® (VIRBAC; Carros; France) at 40 mg/mL, which contained a mixture of zolazepam and tiletamine hydrochloride (Virbac, Carros, France). The rats’ heads were fixed in a stereotactic apparatus, and a 25-gauge butterfly needle was advanced into the cisterna magna, which was confirmed by withdrawing 0.3-mL of cerebrospinal fluid (CSF). Fresh, autologous, and non-heparinized blood (0.1 mL/100 g of body weight) drawn from the central tail artery was slowly instilled into the subarachnoid space through a butterfly needle and tubing. The animals were then kept in a ventral recumbent position for at least 30 min to promote ventral blood distribution. The respiratory pattern of rats was closely inspected, and mechanical ventilation was provided if required. Once fully awake, the animals were sent back to the vivarium.", "The rats were randomly selected and divided into the following five groups (n = 6 per group): (1) control (no DM or SAH), (2) SAH only, (3) DM + SAH, (4) DM + SAH + Mdivi-1 (0.24 mg/kg), and (5) DM + SAH + Mdivi-1 (1.2 mg/kg). The dose and the time point of the Mdivi-1 treatment were chosen based on the previous study [15]. Mdivi-1 (MedChemExpress; Monmouth Junction; USA) was dissolved in 0.1% dimethyl sulfoxide (DMSO) and administered via intraperitoneal injection immediately after SAH induction. The vehicle animals received an intraperitoneal injection of 0.1% DMSO. The blood-glucose levels were monitored before and after STZ injection. The SAH model was established on day 7 after STZ injection. The animals that survived for 2 days after SAH were included for analysis, and then sacrificed for subsequent experiments.", "Neurobehavioral evaluation of animals was performed by assessing the sensorimotor integration of the forelimb and hindlimb activities using the modified limb-placing test, which consisted of ambulation, as well as placing and stepping reflex [46]. The motor-deficit index (MDI) represented the sum of scores for walking using the lower limbs and for placing/stepping response, and was determined before and 48 h after SAH induction. High MDI values indicated poor neurological outcomes.", "At the end of the experiments, each animal was re-anesthetized for perfusion and fixation. The thoracic cage was opened by canalling the left ventricle using a No. 16 catheter. The brain was perfused with 180 mL of 2% paraformaldehyde and 100 mL of phosphate buffer (0.01 M) at below 36 °C and 100-mmHg perfusion pressure, after clamping the descending aorta and puncturing the right atrium. Gross inspection of harvested brains was performed to confirm the presence of subarachnoid blood clots over the BA, and the specimen was immersed in a fixative solution. The BAs were then separated from the brainstems, and the middle third of each vessel was dissected. The arterial segments were flat-embedded in paraffin, and BA cross-sections were cut into 3-μm sections that were stained with hematoxylin and eosin stain for subsequent analysis.", "Three cross-sections from the middle-third BA from each animal were analyzed by a trained member of research staff who was blinded to the experimental groups. The BA thickness was defined as the largest vertical distance between the inner surface of the endothelium and the outer surface of the adventitia. The arterial cross-sectional area was calculated using a computer-based morphometric analysis (ImageJ; Universal Imaging Corp., Hialeah, FL, USA). The average area of the BA cross-section from each rat was calculated to obtain the mean values for the degree of vasospasm at 48 h after SAH.", "After deparaffinization and rehydration, the paraffin-embedded brain samples were treated with steam heating for antigen retrieval (30 min) using a DAKO antigen retrieval solution (DAKO, Carpinteria, CA, USA). The slides were washed twice with TBS, and the sections were incubated with mouse anti-GFAP (Sigma-Aldrich; G3893; St. Louis, MI, USA) and rabbit anti-Iba1 (Proteintech; 10904-1-AP; Taiwan) antibodies for 16 h at 4 °C. The slides were, again, washed twice with TBS, and subsequently incubated with goat anti-rabbit IgG (H+L)-FAM (Croyez; C04013; Taiwan) and goat anti-mouse IgG (H+L)-TAMRA (Croyez; C04012; Taiwan) antibodies for 90 min at room temperature. Afterward, the slides were washed twice with TBS and were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich; F6057; St. Louis, MI, USA).", "To remove the cells, the samples were immediately centrifuged at 2000× g for 10 min at 4 °C. The collected supernatant was stored below −15 °C before analysis. The collected body fluids were first concentrated by passing them through the C2 columns, to determine the amounts of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL6 in the collected supernatant (Amersham, Nutley, NJ, USA). The amount of inflammatory factor present in the media was detected using an inflammatory factor ELISA system (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm.", "Apoptotic nuclei were stained using a TUNEL detection kit (Roche Inc., Indianapolis, IN, USA) according to the manufacturer’s protocols. Briefly, the tissue sections were fixed in 4% methanol-free paraformaldehyde at 4 °C and washed with phosphate-buffered saline (PBS) for 30 min. Equilibrium buffer (0.1 mL) was added to each slide, which was then covered with parafilm for 10 min. A 50-μL mixture comprising 45 μL equilibrium buffer, 5-μL nucleotide mix, and 1-μL TdT enzyme was prepared and added onto each slide. The slides were incubated in the dark for 1–2 h at 37 °C. Saline sodium citrate (2×) was added to stop the TdT enzyme reaction for 15 min at room temperature. The unbound fluorescent-12-dUTP was washed out using PBS. Then, the slides were dipped in propidium iodide to stain the cells in the dark for 15 min. The slides were dried after rinsing with de-ionized water, and coverslips were overlaid on the interesting area of the slides.", "Tissue extracts were prepared in 500-μL of RIPA buffer (Millipore; 20-188; Burlington, MA, USA), including 1× protease inhibitor (Roche, Germany) and 1× phosphatase inhibitor (Roche, Germany), and incubated on ice for 30 min. The protein amount in the supernatant was quantified using a BCA kit (Sigma-Aldrich; C2284; USA), and the samples (50 μg) were electrophoresed on 10% SDS–polyacrylamide gels, and then transferred to PVDF membranes following centrifugation at 13,000 rpm (10,000 g) for 30 min at 4 °C. The membranes were blocked for 60 min at room temperature in TBS containing 5% fat-free milk, and then incubated for 16 h at 4 °C with antibodies against β-actin (Sigma-Aldrich; A6316; USA) and p-Drp1 (ProSci; 79-951; Fort Collins, CO, USA). After washing, the membranes were incubated for 1.5 h at room temperature with the appropriate horseradish peroxidase-labeled secondary antibodies, and bound antibodies were visualized and quantified via chemiluminescence detection. β-actin was used as the internal control. The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of β-actin; then, the density of the band was expressed as the relative density compared with that in the control group.", "The expression levels of inflammatory factors (TNF-α, IL-1β, and IL-6) were detected via qRT-PCR, using the cDNA as the template, on a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in triplicate, and data were analyzed using the comparative threshold cycle (2−ΔΔCT) method. The PCR amplification cycles consisted of denaturing at 95 °C for 5 min, 45 cycles of denaturing at 95 °C for 90 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final elongation at 72 °C for 10 min. To minimize errors arising from variations in the amount of starting RNA in the samples, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. GAPDH: Forward 5′-AGACAGCCGCATCTTCTTGT-3′ and Reverse 5′-CTTGCCGTGGGTAGAGTCAT; TNF-α: Forward 5′-GCCCAGACCCTCACACTC-3′ and Reserve 5′-CACTCCAGCTGCTCCTCT-3′; IL-1β: Forward 5′- ATGGCAGAAGTACCTAAGCTCGC-3′ and Reverse 5′-ACACAAATTGCATGGTGAAGTCAGTT-3′; IL-6: Forward 5′-CCGGAGAGGAGACTTCACAG-3′ and Reverse 5′-ACAGTGCATCATCGCTGTTC-3′.", "The results were analyzed using Statistical Package for the Social Sciences version 20.0 (IBM SPSS Statistics). Data were expressed as mean ± standard deviation (SD). The estimates were compared with the one-way analysis of variance (ANOVA). A p-value of <0.05 was defined as statistically significant.", "Our previous study revealed that hyperglycemia exacerbated cerebral vasospasm and was associated with poorer neurological outcomes following SAH. In addition, hyperglycemia enhanced inflammation and neuron cell apoptosis in the brain with SAH. Mdivi-1, a drp-1 inhibitor, attenuated cerebral vasospasm, poorer neurological outcomes, inflammation, and neuron cell apoptosis following SAH plus hyperglycemia. This study reveals that hyperglycemia enhanced SAH-induced Drp1 phosphorylation. Mdivi-1, a drp-1 inhibitor, attenuated cerebral vasospasm, poor neurological outcomes, inflammation, and neuron cell apoptosis following SAH, with or without hyperglycemia. The data suggest that hyperglycemia aggravated SAH-induced neurological prognosis through mitochondrial fission. Therefore, after Mdivi-1 treatment in hyperglycemic SAH animals, the inhibition of Drp1 significantly reduces the morphological change in mitochondria while alleviating neurobehavioral deficits. The number of apoptotic neurons decreased in a dose-dependent manner. The results prove that Mdivi-1 has therapeutic effects against hyperglycemia-exacerbated neuronal death." ]

[ "intro", "results", null, null, null, null, null, null, null, "discussion", null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, "conclusions" ]

[ "hyperglycemia", "Mdivi-1", "SAH" ]

[ 85, 235, 268, 412, 170, 115, 136, 4080, 60, 82, 106, 186, 182, 86, 161, 114, 179, 111, 202, 268, 191, 60 ]

[ "sah", "mdivi", "dm", "dm sah", "dose", "dose mdivi", "il", "mg", "group", "mg kg" ]

[ "apoptosis brain sah", "attenuates brain injury", "early brain injuries", "disruption blood brain", "blood brain barrier" ]

[ "Animals", "Bile Acids and Salts", "Blood Glucose", "Ceramides", "Chenodeoxycholic Acid", "Diabetes Mellitus, Type 2", "Duodenum", "Glucose", "Jejunum", "Rats", "Salicylamides", "Streptozocin" ]

[ "INTRODUCTION", "Animals and surgical procedures", "CDCA gavage", "Oral glucose tolerance test", "Blood sample preparation", "Luminal bile acid detection", "Western blot", "RNA analysis", "Ceramide detection", "Statistical analysis", "RESULTS", "Body weight and energy intake", "OGTT", "Luminal bile acids", "Ceramides", "Expression of Smpd3 and Sptlc2", "DISCUSSION", "CONCLUSION" ]

[ "Duodenal-jejunal bypass (DJB) can induce rapid and durable amelioration of type 2 diabetes mellitus[1-3]. The underlying mechanisms remain incompletely understood. Our previous research has proved that bile acids play an important role in the amelioration of type 2 diabetes following DJB[4], and found that serum taurine-conjugated bile acids are preferentially elevated postoperatively[5]. However, the clinical relevance of the specific alterations of serum bile acids is still not known. Bile acids in the peripheral circulation reflect the amount of bile acids that could not be totally reabsorbed by hepatocytes during the enterohepatic circulation[6]. Therefore, the alterations of serum bile acids might be a secondary change of the bile acids within the gut, and a further investigation of luminal bile acids following DJB is of great significance.\nBile acids are traditionally known as lipid absorption-facilitating agents. It was not until recent years that the role of bile acids as signaling molecules in modulating metabolism has be unveiled. The intestinal lumina, where bile acid concentrations are high, is the main place for bile acid signaling. Two major receptors, including Takeda G-protein-coupled receptor 5 (TGR5) and nuclear farnesoid X receptor (FXR) are responsible for luminal bile acid sensing. TGR5 expression is detected in a variety of enteroendocrine cells and acute exposure of TGR5 to luminal bile acids lead to significant secretion of glucagon-like peptide 1 (GLP-1), which is a vital hormone for maintaining normal incretin effect in type 2 diabetes[7,8]. The interaction between bile acids and FXR is more complicated, as different subtypes of bile acids have distinct effect on the downstream pathway of FXR[9]. Chenodeoxycholic acid (CDCA) represents the most potent FXR stimulator while ursodeoxycholic acid (UDCA) and β-muricholic acid (βMCA) are FXR inhibitors[9-11]. Therefore, the net effect of luminal bile acids on FXR depends on the proportion of FXR-stimulating bile acids rather than the total amount of bile acids.\nIntestinal FXR could affect lipid metabolism and this process is closely related to ceramide synthesis. Intestine-selective FXR inhibition downregulates the expression of ceramide synthesis-related genes sphingomyelin phosphodiesterase 3 (Smpd3) and serine palmitoyltransferase long chain base subunit 2 (Sptlc2), resulting in decreased concentrations of ceramides within the small intestine, portal system and peripheral circulation[12]. Decreased ceramides inhibit the expression of sterol regulatory element binding protein-1 (SREBP-1) in the liver[12], which is a key enzyme in the process of hepatic fat accumulation. Coincidentally, the changes in lipid metabolism after intestine-selective FXR inhibition is similar to the changes following DJB that hepatic fat accumulation is alleviated and the key transcriptional regulators and enzymes involved in hepatic de novo lipogenesis are downregulated[13]. Therefore, we hypothesized that the net effect of luminal bile acids on intestinal FXR might be inhibitory after DJB which leads to decreased ceramide synthesis. To test this hypothesis, we measure the changes of individual luminal bile acid and ceramide concentrations within the enterohepatic circulation after DJB in a high-fat diet (HFD)/streptozotocin (STZ)-induced diabetic rat model.", "Eight-week-old male Wistar rats (220 g on average, purchased from Huafukang Biotech, China) were individually housed with a 12 h light/dark cycle under constant temperature (24-26 °C) and humidity (50%-70%). All rats were fed with HFD (42% carbohydrate, 18% protein and 40% fat, as a total percentage of calories, Huafukang Biotech, China) with no restriction to tap water for 1 mo to induce insulin resistance. After fasting for 12 h, 30 mg/kg STZ (Sigma Aldrich, United States) dissolved in sodium citrate buffer (pH 4.2) was injected into the peritoneal cavity. Random blood glucose concentrations were measured with a glucometer (Roche Diagnostics, Germany) from tail veins 72 h later. Thirty rats with random blood glucose ≥ 16.7 mmol/L were considered diabetic and were matched into salicylhydroxamic acid (SHAM) group (n = 10), DJB group (n = 10) and DJB + CDCA group (n = 10). One month later, surgery was performed as we previously reported[5]. Body weight and calorie intake were recorded daily. All rats were sacrificed after 12 h fasting at week 12 postoperatively. All procedures involving animals were reviewed and approved by the Ethics Committee on Animal Experiment of Shandong University Qilu Hospital.", "Without fasting, rats in the DJB + CDCA group were administrated with CDCA suspension (100 mg/kg suspended in 3 mL tap water) by intragastric gavage three times a week since week 5 postoperatively. The gavage procedure ceased after week 11.", "At week 4 and week 12, after 12 h fasting, the rats were administrated with 20% of glucose (1 g/kg) by intragastric gavage. Blood glucose concentrations were measured at t = 0, 10, 30, 60 and 120 min.", "Peripheral blood samples were collected from the retrobulbar venous plexus after 12 h fasting before sacrificing. Portal venous blood samples were collected directly from the portal vein. After centrifugation, the supernatant was stored at -80 °C until analysis.", "Three independent intestinal segments (3 cm each) was excised at the proximal, medium and distal sites within the common limb, respectively, without prior flushing. The control intestinal segments from SHAM group were excised at the corresponding anatomic location. Total luminal bile acids from intestinal segments were extracted by 9 mL 50 % tert-butyl alcohol for 1 h at 37 °C. After centrifugation, the supernatant was collected for bile acid analysis. Total bile acids were measured by Roche Cobas 8000 system using enzyme cycling method and individual bile acid species was measured using high-pressure liquid chromatography coupled with tandem mass spectrometry as we previously described[5].", "Small intestinal mucosa were flushed with saline and then scratched. Total protein was extracted by RIPA lysis buffer (KeyGEN, China) with protease and phosphatase inhibitor cocktail (KeyGEN, China) and was quantified using bicinchoninic acid protein assay kit (Beyotime, China). Equivalent amount of small intestinal mucosal protein were loaded on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels (Bio-Rad, United States) and separated by electrophoresis. Then, proteins were transferred onto 0.45 μm polyvinylidene fluoride membranes (Millipore, Ireland). After being blocked in 5 % skim milk powder (Beyotime, China) for 2 h, the membranes were incubated with primary antibodies to Smpd3 (Abcam, United Kingdom) and Sptlc2 (Invitrogen, United States) overnight, followed by incubation in horseradish peroxidase-conjugated secondary antibodies (Proteintech, China) for 60 min. The protein bands were visualized by ECL solution (Millipore, United States) and their density was assessed with LI-COR Odyssey Imager (LI-COR Biosciences, United States).", "The expression of smpd3 and sptlc2 in the small intestine was analyzed by real-ime quantitative polymerase chain reaction (RT-qPCR). RNA was isolated using Trizol reagent (Invitrogen, United States), and the concentration of RNA was measured using the NanoDrop spectrophotometer (NanoDrop Technologies, United States). RNA was then reverse transcribed into complementary DNA (cDNA) using a ReverTra Ace qPCR RT Kit (TOYOBO, Japan). Amplification of messenger RNA (mRNA) was carried out using SYBR Green Real-time PCR Master Mix Kit (TOYOBO, Japan) at a range of temperatures in a Roche Lightcycle 2.0 system (Roche, Switzerland). The housekeeping gene gapdh was used as an internal reference, and mRNA levels for each target were then calculated by the 2-ΔΔCt method. The primers were smpd3 (forward primer: 5’-ACTCGCTCGCAAGGCTCAATAATG-3’, reverse primer: 5’-CTGAAGCTGGCTGCACTGATGG-3’), sptlc2 (forward primer: 5’-CGCCTTCCTGAAGTGATTGCTCTC-3’, reverse primer: 5’-AGTCTACTACACCACGCCCTGAAG-3’), and gapdh (forward primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’; reverse primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’).", "Ceramide concentrations peripheral circulation and the portal vein were measured as previously described using Ceramide LIPIDOMIX Mass Spec Standard (#330712X-1EA, Avanti, United States) as standards[14].", "Data are mean ± SEM. Area under the curve (AUC) for oral glucose tolerance test (OGTT) was calculated by trapezoidal integration. Intergroup comparisons were performed by one-way analysis of variance followed by Bonferroni post hoc comparisons. P < 0.05 was considered statistically significant. All calculations were performed using SPSS version 25.0.", "One rat in SHAM group died of intestinal obstruction. Two rats in DJB group and 2 rats in DJB + CDCA group died of anastomotic leak. At the end of the study, the number of rats alive in SHAM, DJB and DJB + CDCA groups were 9, 8 and 8, respectively.\nBody weight and energy intake At baseline, both body weight and energy intake were comparable between three groups. After surgery, both body weight and energy intake decreased sharply in all three groups and increased gradually thereafter. At week 2-5 postoperatively, body weight of the rats in DJB and DJB + CDCA groups was significantly less than that in SHAM group (P < 0.05 all). At week 7-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in DJB group (P < 0.05 all) (Figure 1A). At week 9-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in SHAM group (P < 0.05 all). At week 9-12 postoperatively, energy intake of the rats in DJB + CDCA group was significantly less than that in SHAM and DJB groups (P < 0.05 all) (Figure 1B).\n\nBody weight and energy intake from baseline to week 12 after operations as well as oral glucose tolerance test and the corresponding areas under the curves at baseline, week 4 and week 12 after operations. A: Body weight; B: Energy intake; C: Area under the curve of oral glucose tolerance test; D: Oral glucose tolerance test at baseline; E: Oral glucose tolerance test at week 4; F: Oral glucose tolerance test at week 12. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid.\nAt baseline, both body weight and energy intake were comparable between three groups. After surgery, both body weight and energy intake decreased sharply in all three groups and increased gradually thereafter. At week 2-5 postoperatively, body weight of the rats in DJB and DJB + CDCA groups was significantly less than that in SHAM group (P < 0.05 all). At week 7-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in DJB group (P < 0.05 all) (Figure 1A). At week 9-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in SHAM group (P < 0.05 all). At week 9-12 postoperatively, energy intake of the rats in DJB + CDCA group was significantly less than that in SHAM and DJB groups (P < 0.05 all) (Figure 1B).\n\nBody weight and energy intake from baseline to week 12 after operations as well as oral glucose tolerance test and the corresponding areas under the curves at baseline, week 4 and week 12 after operations. A: Body weight; B: Energy intake; C: Area under the curve of oral glucose tolerance test; D: Oral glucose tolerance test at baseline; E: Oral glucose tolerance test at week 4; F: Oral glucose tolerance test at week 12. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid.\nOGTT There was no difference in glucose tolerance between three groups at baseline based on AUCOGTT. At week 4 and 12, glucose tolerance was significantly improved with DJB and DJB + CDCA groups compared to SHAM group based on AUCOGTT (P < 0.05 each). There was no difference between DJB and DJB + CDCA groups, or between week 4 and week 12 within each group (Figures 1C-F).\nThere was no difference in glucose tolerance between three groups at baseline based on AUCOGTT. At week 4 and 12, glucose tolerance was significantly improved with DJB and DJB + CDCA groups compared to SHAM group based on AUCOGTT (P < 0.05 each). There was no difference between DJB and DJB + CDCA groups, or between week 4 and week 12 within each group (Figures 1C-F).\nLuminal bile acids Total luminal bile acid concentrations were significantly less with SHAM group compared to both DJB and DJB + CDCA groups in either proximal, medium or distal segment in the common limb (P < 0.05 all). In the distal segment, luminal total bile acid concentrations were significantly greater with DJB + CDCA group than DJB group (P < 0.05), while this difference was not significant in the proximal or medium segment (Figure 2A).\n\nLuminal total and individual bile acid concentrations and ceramide concentrations within the peripheral and portal circulations. A: Total amount of luminal bile acids; B: Luminal individual bile acid percentage in the proximal; C: Medium segment within the common limb; D: Distal segment within the common limb; E: Ratio of farnesoid X receptor agonist and antagnist within the common limb; F: Peripheral serum ceramides; G: Portal serum ceramides. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. FXR: Farnesoid X receptor; SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; αMCA: α-muricholic acid; UDCA: Ursodeoxycholic acid; LCA: Lithocholic acid; HDCA: Hyocholic acid; TLCA: Taurine-conjugated lithocholic acid.\nIn the proximal segment (Figure 2B), CA accounted for over 20% of the total luminal bile acids in all three groups, and was significantly greater with SHAM group than DJB and DJB + CDCA groups (P < 0.05). The percentages of α-muricholic acid (αMCA), βMCA, deoxycholic acid, CDCA, lithocholic acid (LCA), hyocholic acid (HDCA), and taurine-conjugated LCA (TLCA) were comparable between all three groups. The percentage of UDCA was less with DJB + CDCA group compared to SHAM and DJB groups (P < 0.05). The percentages of taurine-conjugated forms of αMCA, βMCA, CA, DCA, CDCA and UDCA were all greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). The percentage of TCDCA was greater with DJB + CDCA group than DJB group (P < 0.05).\nIn the medium segment (Figure 2C), the difference in TαMCA and TDCA between three groups was no longer significant compared to the proximal segment. The percentage of TβMCA increased to more than 5% in DJB and DJB + CDCA groups which was significantly greater than SHAM group (P < 0.05). The percentage of TCDCA was comparable between SHAM and DJB groups, which was significantly less than DJB + CDCA group (P < 0.05).\nIn the distal segment (Figure 2D), the percentage of TβMCA, TCA and TUDCA was significantly greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05), without any difference between the former two groups. The percentage of CA was significantly less with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). There was no difference in the percentage of UDCA between three groups. The percentage of other individual bile acids was comparable to that in the medium segment. The ratio of FXR agonists (including CA, TCA, DCA, TDCA, CDCA, TCDCA, LCA, and TLCA) and antagonists (including αMCA, TαMCA, βMCA, TβMCA, UDCA, TUDCA and HDCA) in DJB and DJB + CDCA groups was decreased compared to SHAM group in either proximal, medium or distal segment (P < 0.05). No difference was observed between DJB group and DJB + CDCA group (Figure 2E).\nTotal luminal bile acid concentrations were significantly less with SHAM group compared to both DJB and DJB + CDCA groups in either proximal, medium or distal segment in the common limb (P < 0.05 all). In the distal segment, luminal total bile acid concentrations were significantly greater with DJB + CDCA group than DJB group (P < 0.05), while this difference was not significant in the proximal or medium segment (Figure 2A).\n\nLuminal total and individual bile acid concentrations and ceramide concentrations within the peripheral and portal circulations. A: Total amount of luminal bile acids; B: Luminal individual bile acid percentage in the proximal; C: Medium segment within the common limb; D: Distal segment within the common limb; E: Ratio of farnesoid X receptor agonist and antagnist within the common limb; F: Peripheral serum ceramides; G: Portal serum ceramides. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. FXR: Farnesoid X receptor; SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; αMCA: α-muricholic acid; UDCA: Ursodeoxycholic acid; LCA: Lithocholic acid; HDCA: Hyocholic acid; TLCA: Taurine-conjugated lithocholic acid.\nIn the proximal segment (Figure 2B), CA accounted for over 20% of the total luminal bile acids in all three groups, and was significantly greater with SHAM group than DJB and DJB + CDCA groups (P < 0.05). The percentages of α-muricholic acid (αMCA), βMCA, deoxycholic acid, CDCA, lithocholic acid (LCA), hyocholic acid (HDCA), and taurine-conjugated LCA (TLCA) were comparable between all three groups. The percentage of UDCA was less with DJB + CDCA group compared to SHAM and DJB groups (P < 0.05). The percentages of taurine-conjugated forms of αMCA, βMCA, CA, DCA, CDCA and UDCA were all greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). The percentage of TCDCA was greater with DJB + CDCA group than DJB group (P < 0.05).\nIn the medium segment (Figure 2C), the difference in TαMCA and TDCA between three groups was no longer significant compared to the proximal segment. The percentage of TβMCA increased to more than 5% in DJB and DJB + CDCA groups which was significantly greater than SHAM group (P < 0.05). The percentage of TCDCA was comparable between SHAM and DJB groups, which was significantly less than DJB + CDCA group (P < 0.05).\nIn the distal segment (Figure 2D), the percentage of TβMCA, TCA and TUDCA was significantly greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05), without any difference between the former two groups. The percentage of CA was significantly less with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). There was no difference in the percentage of UDCA between three groups. The percentage of other individual bile acids was comparable to that in the medium segment. The ratio of FXR agonists (including CA, TCA, DCA, TDCA, CDCA, TCDCA, LCA, and TLCA) and antagonists (including αMCA, TαMCA, βMCA, TβMCA, UDCA, TUDCA and HDCA) in DJB and DJB + CDCA groups was decreased compared to SHAM group in either proximal, medium or distal segment (P < 0.05). No difference was observed between DJB group and DJB + CDCA group (Figure 2E).\nCeramides At week 12, in the peripheral circulation, serum C16:0 ceramide concentrations were lower with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05); no difference in C18:0, C24:0 or C24:1 ceramides between three groups (Figure 2F). In the portal vein, serum C16:0, C24:0 and C24:1 ceramide concentrations were lower with DJB group compared to SHAM group (P < 0.05); there was no difference in either ceramide species between DJB and DJB + CDCA groups or between DJB + CDCA and SHAM groups (Figure 2G).\nAt week 12, in the peripheral circulation, serum C16:0 ceramide concentrations were lower with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05); no difference in C18:0, C24:0 or C24:1 ceramides between three groups (Figure 2F). In the portal vein, serum C16:0, C24:0 and C24:1 ceramide concentrations were lower with DJB group compared to SHAM group (P < 0.05); there was no difference in either ceramide species between DJB and DJB + CDCA groups or between DJB + CDCA and SHAM groups (Figure 2G).\nExpression of Smpd3 and Sptlc2 At week 12, the expression of Smpd3 and Sptlc2 were lower with DJB and DJB + CDCA groups than SHAM group at both protein and mRNA levels (P < 0.05). Compared to DJB + CDCA group, the expression of Smpd3 and Sptlc2 with DJB group were even lower at both protein and mRNA levels (P < 0.05) (Figures 3A, 3B and 3C).\n\nExpression of ceramide synthesis-related enzyme sphingomyelin phosphodiesterase 3 and serine palmitoyltransferase long chain base subunit 2 at protein and mRNA levels. A: Expression of sphingomyelin phosphodiesterase 3 (Smpd3), serine palmitoyltransferase long chain base subunit 2 (Sptlc2) and GAPDH; B: Expression of Smpd3, Sptlc2 at protein; C: Expression of Smpd3, Sptlc2 mRNA levels. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; Smpd3: Sphingomyelin phosphodiesterase 3; Sptlc2: Serine palmitoyltransferase long chain base subunit 2.\nAt week 12, the expression of Smpd3 and Sptlc2 were lower with DJB and DJB + CDCA groups than SHAM group at both protein and mRNA levels (P < 0.05). Compared to DJB + CDCA group, the expression of Smpd3 and Sptlc2 with DJB group were even lower at both protein and mRNA levels (P < 0.05) (Figures 3A, 3B and 3C).\n\nExpression of ceramide synthesis-related enzyme sphingomyelin phosphodiesterase 3 and serine palmitoyltransferase long chain base subunit 2 at protein and mRNA levels. A: Expression of sphingomyelin phosphodiesterase 3 (Smpd3), serine palmitoyltransferase long chain base subunit 2 (Sptlc2) and GAPDH; B: Expression of Smpd3, Sptlc2 at protein; C: Expression of Smpd3, Sptlc2 mRNA levels. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; Smpd3: Sphingomyelin phosphodiesterase 3; Sptlc2: Serine palmitoyltransferase long chain base subunit 2.", "At baseline, both body weight and energy intake were comparable between three groups. After surgery, both body weight and energy intake decreased sharply in all three groups and increased gradually thereafter. At week 2-5 postoperatively, body weight of the rats in DJB and DJB + CDCA groups was significantly less than that in SHAM group (P < 0.05 all). At week 7-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in DJB group (P < 0.05 all) (Figure 1A). At week 9-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in SHAM group (P < 0.05 all). At week 9-12 postoperatively, energy intake of the rats in DJB + CDCA group was significantly less than that in SHAM and DJB groups (P < 0.05 all) (Figure 1B).\n\nBody weight and energy intake from baseline to week 12 after operations as well as oral glucose tolerance test and the corresponding areas under the curves at baseline, week 4 and week 12 after operations. A: Body weight; B: Energy intake; C: Area under the curve of oral glucose tolerance test; D: Oral glucose tolerance test at baseline; E: Oral glucose tolerance test at week 4; F: Oral glucose tolerance test at week 12. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid.", "There was no difference in glucose tolerance between three groups at baseline based on AUCOGTT. At week 4 and 12, glucose tolerance was significantly improved with DJB and DJB + CDCA groups compared to SHAM group based on AUCOGTT (P < 0.05 each). There was no difference between DJB and DJB + CDCA groups, or between week 4 and week 12 within each group (Figures 1C-F).", "Total luminal bile acid concentrations were significantly less with SHAM group compared to both DJB and DJB + CDCA groups in either proximal, medium or distal segment in the common limb (P < 0.05 all). In the distal segment, luminal total bile acid concentrations were significantly greater with DJB + CDCA group than DJB group (P < 0.05), while this difference was not significant in the proximal or medium segment (Figure 2A).\n\nLuminal total and individual bile acid concentrations and ceramide concentrations within the peripheral and portal circulations. A: Total amount of luminal bile acids; B: Luminal individual bile acid percentage in the proximal; C: Medium segment within the common limb; D: Distal segment within the common limb; E: Ratio of farnesoid X receptor agonist and antagnist within the common limb; F: Peripheral serum ceramides; G: Portal serum ceramides. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. FXR: Farnesoid X receptor; SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; αMCA: α-muricholic acid; UDCA: Ursodeoxycholic acid; LCA: Lithocholic acid; HDCA: Hyocholic acid; TLCA: Taurine-conjugated lithocholic acid.\nIn the proximal segment (Figure 2B), CA accounted for over 20% of the total luminal bile acids in all three groups, and was significantly greater with SHAM group than DJB and DJB + CDCA groups (P < 0.05). The percentages of α-muricholic acid (αMCA), βMCA, deoxycholic acid, CDCA, lithocholic acid (LCA), hyocholic acid (HDCA), and taurine-conjugated LCA (TLCA) were comparable between all three groups. The percentage of UDCA was less with DJB + CDCA group compared to SHAM and DJB groups (P < 0.05). The percentages of taurine-conjugated forms of αMCA, βMCA, CA, DCA, CDCA and UDCA were all greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). The percentage of TCDCA was greater with DJB + CDCA group than DJB group (P < 0.05).\nIn the medium segment (Figure 2C), the difference in TαMCA and TDCA between three groups was no longer significant compared to the proximal segment. The percentage of TβMCA increased to more than 5% in DJB and DJB + CDCA groups which was significantly greater than SHAM group (P < 0.05). The percentage of TCDCA was comparable between SHAM and DJB groups, which was significantly less than DJB + CDCA group (P < 0.05).\nIn the distal segment (Figure 2D), the percentage of TβMCA, TCA and TUDCA was significantly greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05), without any difference between the former two groups. The percentage of CA was significantly less with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). There was no difference in the percentage of UDCA between three groups. The percentage of other individual bile acids was comparable to that in the medium segment. The ratio of FXR agonists (including CA, TCA, DCA, TDCA, CDCA, TCDCA, LCA, and TLCA) and antagonists (including αMCA, TαMCA, βMCA, TβMCA, UDCA, TUDCA and HDCA) in DJB and DJB + CDCA groups was decreased compared to SHAM group in either proximal, medium or distal segment (P < 0.05). No difference was observed between DJB group and DJB + CDCA group (Figure 2E).", "At week 12, in the peripheral circulation, serum C16:0 ceramide concentrations were lower with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05); no difference in C18:0, C24:0 or C24:1 ceramides between three groups (Figure 2F). In the portal vein, serum C16:0, C24:0 and C24:1 ceramide concentrations were lower with DJB group compared to SHAM group (P < 0.05); there was no difference in either ceramide species between DJB and DJB + CDCA groups or between DJB + CDCA and SHAM groups (Figure 2G).", "At week 12, the expression of Smpd3 and Sptlc2 were lower with DJB and DJB + CDCA groups than SHAM group at both protein and mRNA levels (P < 0.05). Compared to DJB + CDCA group, the expression of Smpd3 and Sptlc2 with DJB group were even lower at both protein and mRNA levels (P < 0.05) (Figures 3A, 3B and 3C).\n\nExpression of ceramide synthesis-related enzyme sphingomyelin phosphodiesterase 3 and serine palmitoyltransferase long chain base subunit 2 at protein and mRNA levels. A: Expression of sphingomyelin phosphodiesterase 3 (Smpd3), serine palmitoyltransferase long chain base subunit 2 (Sptlc2) and GAPDH; B: Expression of Smpd3, Sptlc2 at protein; C: Expression of Smpd3, Sptlc2 mRNA levels. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; Smpd3: Sphingomyelin phosphodiesterase 3; Sptlc2: Serine palmitoyltransferase long chain base subunit 2.", "In the present study, we performed SHAM, DJB and DJB + CDCA procedures in a HFD/STZ induced diabetic rat model, and for the first time, demonstrated the changes of luminal individual bile acids in the distal small intestine. We also found that the subsequent changes of the bile acids within the distal common limb after DJB elicited inhibitory effect on regional ceramide synthesis and this phenomenon could be partially antagonized by luminal supplementation of FXR activating bile acid CDCA.\nDJB was initially designed to investigate the weight loss independent mechanisms of bariatric surgery[3]. This procedure has no effect on weight loss but could induce fast and sustainable amelioration of type 2 diabetes[4]. Consistent with other bariatric procedures[15,16], serum bile acid concentrations were also increased following DJB, and this phenomenon is clearly related to reconstruction of the gastrointestinal tract[5]. Via the biliopancreatic limb, bile acids contact the distal small intestine, where luminal bile acid reabsorption mainly occurs, more rapidly and lead to early and increased reabsorption of luminal bile acids in the small intestine. A recent study has proved that in the biliopancreatic limb, increased reabsorption of luminal bile acids has already commenced as a result of highly concentrated bile acids as well as lack of lipids[17]. While in the alimentary limb, only trace amount of luminal bile acids could be detected[4]. Decreased luminal bile acids lead to marked luminal sodium insufficiency, and hence, intestinal uptake of glucose in the alimentary limb is significantly decreased[18], which represents another mechanism in controlling postprandial glucose excursion. The common limb is where food and bile mix up and the major place for intestinal FXR expression. Therefore, we concentrated on bile acid milieu within the common limb rather than the biliopancreatic or alimentary limb because the common limb is the place mostly close to physiological conditions.\nTo our knowledge, the present study is the first study reporting luminal bile acid changes after DJB. Most clinical and animal studies concentrated on serum or fecal bile acids, as the intestinal lumen is deep inside and in vivo study of luminal contents, particularly in the small intestine, is technically difficult and ethically challenging. Consistent with our previous findings of serum bile acid changes after DJB, the total amount of luminal bile acids and the proportion of FXR-inhibitory bile acids were both increased. These specific changes have at least two clinical relevance. First, concentrated luminal bile acids stimulate TRG5 on the surface of enteroendocrine cells and leads to potentiated GLP-1 secretion[4]; second, increased proportion of FXR-inhibitory bile acids has inhibited expression of FXR downstream pathways and reduced biosynthesis of intestinal-derived ceramides[12]. Compared to TGR5, FXR appears to be a more important and complicated receptor in metabolic regulation; in the absence of FXR, the ability of bariatric surgery to reduce body weight and improve glucose tolerance is substantially reduced while these metabolic benefits are largely preserved when TGR5 is deficient[19-20]. Whole body FXR knock-out mice were associated with elevated serum triglycerides, cholesterols, free fatty acids and severe liver fat accumulation, but were protected from diet- or genetically- induced obesity[21]. In contrast, liver-specific FXR knock-out mice were not protected from diet-induced obesity and insulin resistance[22], suggesting the distinct role of hepatic and intestinal FXR activation in improving glucose tolerance and insulin resistance. In the small intestine, the role of FXR is controversial. After bariatric surgery, increased serum fibroblast growth factor 19 (FGF19) concentrations have been thought to play a role in the remission of human diabetes[15]. And intestinal FXR activation by luminal bile acids has been thought as a major source of increased serum FGF19. However, no direct evidence was available to confirm the state of intestinal FXR activation, and other tissues may also be sources of FGF19. In contrast, more studies support that intestinal FXR activation would damage metabolic homeostasis by reducing energy expenditure and impairing glucose tolerance[12,14,23]. To investigate the direct influence of bile acids on intestinal FXR, bile diversion procedure was reported by three separate studies[4,24,25], including one from our group[4]. Surprisingly, all three studies showed activated intestinal FXR in response to direct bile acid stimulation. However, in contrast, in DJB, the effect of bile acids on intestinal FXR within the common limb was inhibitory. The discrepancy suggests the biliopancreatic limb may have altered the luminal bile acid composition by premature bile acid reabsorption.\nConsistent with our hypothesis, both ceramides in the portal vein and in the peripheral circulation were decreased in response to increased proportion of luminal FXR-inhibitory bile acids. Ceramides are signaling molecules and are associated with obesity and insulin resistance at high concentrations[26]. Decreased ceramides inhibits the expression of SREBP-1 in the liver and alleviates hepatic fat accumulation, thus increasing hepatic insulin sensitivity[12]. Our previous study found that DJB suppressed hepatic de novo lipogenesis and alleviates liver fat accumulation by inhibiting SREBP-1. However, the mechanisms underlying were unknown. Based on results from the present study, we have unveiled at least one mechanism accounting for alleviated hepatic fat accumulation. Therefore, manipulation of luminal bile acid composition towards FXR-inhibitory trend may have metabolic beneficial effects.\nThe present study has several limitations. First, bile acids are mixture with a variety of individual bile acids. As bile acids are mainly conjugated with taurine in rodents[27], we only tested luminal unconjugated and taurine-conjugated bile acids. Second, CDCA is not dissolved in water and we used CDCA suspension for gavage, which may have compromised CDCA absorption to a certain degree. Third, the results from the present study were based on a diabetic rat model and should be interpreted with caution due to species gap.", "In conclusion, DJB significantly changes luminal bile acid composition with increased proportion of FXR-inhibitory bile acids and reduce serum ceramide levels. There observations suggest a novel mechanism of bile acids in metabolic regulation after DJB." ]

[ null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "MATERIALS AND METHODS", "Animals and surgical procedures", "CDCA gavage", "Oral glucose tolerance test", "Blood sample preparation", "Luminal bile acid detection", "Western blot", "RNA analysis", "Ceramide detection", "Statistical analysis", "RESULTS", "Body weight and energy intake", "OGTT", "Luminal bile acids", "Ceramides", "Expression of Smpd3 and Sptlc2", "DISCUSSION", "CONCLUSION" ]

[ "Duodenal-jejunal bypass (DJB) can induce rapid and durable amelioration of type 2 diabetes mellitus[1-3]. The underlying mechanisms remain incompletely understood. Our previous research has proved that bile acids play an important role in the amelioration of type 2 diabetes following DJB[4], and found that serum taurine-conjugated bile acids are preferentially elevated postoperatively[5]. However, the clinical relevance of the specific alterations of serum bile acids is still not known. Bile acids in the peripheral circulation reflect the amount of bile acids that could not be totally reabsorbed by hepatocytes during the enterohepatic circulation[6]. Therefore, the alterations of serum bile acids might be a secondary change of the bile acids within the gut, and a further investigation of luminal bile acids following DJB is of great significance.\nBile acids are traditionally known as lipid absorption-facilitating agents. It was not until recent years that the role of bile acids as signaling molecules in modulating metabolism has be unveiled. The intestinal lumina, where bile acid concentrations are high, is the main place for bile acid signaling. Two major receptors, including Takeda G-protein-coupled receptor 5 (TGR5) and nuclear farnesoid X receptor (FXR) are responsible for luminal bile acid sensing. TGR5 expression is detected in a variety of enteroendocrine cells and acute exposure of TGR5 to luminal bile acids lead to significant secretion of glucagon-like peptide 1 (GLP-1), which is a vital hormone for maintaining normal incretin effect in type 2 diabetes[7,8]. The interaction between bile acids and FXR is more complicated, as different subtypes of bile acids have distinct effect on the downstream pathway of FXR[9]. Chenodeoxycholic acid (CDCA) represents the most potent FXR stimulator while ursodeoxycholic acid (UDCA) and β-muricholic acid (βMCA) are FXR inhibitors[9-11]. Therefore, the net effect of luminal bile acids on FXR depends on the proportion of FXR-stimulating bile acids rather than the total amount of bile acids.\nIntestinal FXR could affect lipid metabolism and this process is closely related to ceramide synthesis. Intestine-selective FXR inhibition downregulates the expression of ceramide synthesis-related genes sphingomyelin phosphodiesterase 3 (Smpd3) and serine palmitoyltransferase long chain base subunit 2 (Sptlc2), resulting in decreased concentrations of ceramides within the small intestine, portal system and peripheral circulation[12]. Decreased ceramides inhibit the expression of sterol regulatory element binding protein-1 (SREBP-1) in the liver[12], which is a key enzyme in the process of hepatic fat accumulation. Coincidentally, the changes in lipid metabolism after intestine-selective FXR inhibition is similar to the changes following DJB that hepatic fat accumulation is alleviated and the key transcriptional regulators and enzymes involved in hepatic de novo lipogenesis are downregulated[13]. Therefore, we hypothesized that the net effect of luminal bile acids on intestinal FXR might be inhibitory after DJB which leads to decreased ceramide synthesis. To test this hypothesis, we measure the changes of individual luminal bile acid and ceramide concentrations within the enterohepatic circulation after DJB in a high-fat diet (HFD)/streptozotocin (STZ)-induced diabetic rat model.", "Animals and surgical procedures Eight-week-old male Wistar rats (220 g on average, purchased from Huafukang Biotech, China) were individually housed with a 12 h light/dark cycle under constant temperature (24-26 °C) and humidity (50%-70%). All rats were fed with HFD (42% carbohydrate, 18% protein and 40% fat, as a total percentage of calories, Huafukang Biotech, China) with no restriction to tap water for 1 mo to induce insulin resistance. After fasting for 12 h, 30 mg/kg STZ (Sigma Aldrich, United States) dissolved in sodium citrate buffer (pH 4.2) was injected into the peritoneal cavity. Random blood glucose concentrations were measured with a glucometer (Roche Diagnostics, Germany) from tail veins 72 h later. Thirty rats with random blood glucose ≥ 16.7 mmol/L were considered diabetic and were matched into salicylhydroxamic acid (SHAM) group (n = 10), DJB group (n = 10) and DJB + CDCA group (n = 10). One month later, surgery was performed as we previously reported[5]. Body weight and calorie intake were recorded daily. All rats were sacrificed after 12 h fasting at week 12 postoperatively. All procedures involving animals were reviewed and approved by the Ethics Committee on Animal Experiment of Shandong University Qilu Hospital.\nEight-week-old male Wistar rats (220 g on average, purchased from Huafukang Biotech, China) were individually housed with a 12 h light/dark cycle under constant temperature (24-26 °C) and humidity (50%-70%). All rats were fed with HFD (42% carbohydrate, 18% protein and 40% fat, as a total percentage of calories, Huafukang Biotech, China) with no restriction to tap water for 1 mo to induce insulin resistance. After fasting for 12 h, 30 mg/kg STZ (Sigma Aldrich, United States) dissolved in sodium citrate buffer (pH 4.2) was injected into the peritoneal cavity. Random blood glucose concentrations were measured with a glucometer (Roche Diagnostics, Germany) from tail veins 72 h later. Thirty rats with random blood glucose ≥ 16.7 mmol/L were considered diabetic and were matched into salicylhydroxamic acid (SHAM) group (n = 10), DJB group (n = 10) and DJB + CDCA group (n = 10). One month later, surgery was performed as we previously reported[5]. Body weight and calorie intake were recorded daily. All rats were sacrificed after 12 h fasting at week 12 postoperatively. All procedures involving animals were reviewed and approved by the Ethics Committee on Animal Experiment of Shandong University Qilu Hospital.\nCDCA gavage Without fasting, rats in the DJB + CDCA group were administrated with CDCA suspension (100 mg/kg suspended in 3 mL tap water) by intragastric gavage three times a week since week 5 postoperatively. The gavage procedure ceased after week 11.\nWithout fasting, rats in the DJB + CDCA group were administrated with CDCA suspension (100 mg/kg suspended in 3 mL tap water) by intragastric gavage three times a week since week 5 postoperatively. The gavage procedure ceased after week 11.\nOral glucose tolerance test At week 4 and week 12, after 12 h fasting, the rats were administrated with 20% of glucose (1 g/kg) by intragastric gavage. Blood glucose concentrations were measured at t = 0, 10, 30, 60 and 120 min.\nAt week 4 and week 12, after 12 h fasting, the rats were administrated with 20% of glucose (1 g/kg) by intragastric gavage. Blood glucose concentrations were measured at t = 0, 10, 30, 60 and 120 min.\nBlood sample preparation Peripheral blood samples were collected from the retrobulbar venous plexus after 12 h fasting before sacrificing. Portal venous blood samples were collected directly from the portal vein. After centrifugation, the supernatant was stored at -80 °C until analysis.\nPeripheral blood samples were collected from the retrobulbar venous plexus after 12 h fasting before sacrificing. Portal venous blood samples were collected directly from the portal vein. After centrifugation, the supernatant was stored at -80 °C until analysis.\nLuminal bile acid detection Three independent intestinal segments (3 cm each) was excised at the proximal, medium and distal sites within the common limb, respectively, without prior flushing. The control intestinal segments from SHAM group were excised at the corresponding anatomic location. Total luminal bile acids from intestinal segments were extracted by 9 mL 50 % tert-butyl alcohol for 1 h at 37 °C. After centrifugation, the supernatant was collected for bile acid analysis. Total bile acids were measured by Roche Cobas 8000 system using enzyme cycling method and individual bile acid species was measured using high-pressure liquid chromatography coupled with tandem mass spectrometry as we previously described[5].\nThree independent intestinal segments (3 cm each) was excised at the proximal, medium and distal sites within the common limb, respectively, without prior flushing. The control intestinal segments from SHAM group were excised at the corresponding anatomic location. Total luminal bile acids from intestinal segments were extracted by 9 mL 50 % tert-butyl alcohol for 1 h at 37 °C. After centrifugation, the supernatant was collected for bile acid analysis. Total bile acids were measured by Roche Cobas 8000 system using enzyme cycling method and individual bile acid species was measured using high-pressure liquid chromatography coupled with tandem mass spectrometry as we previously described[5].\nWestern blot Small intestinal mucosa were flushed with saline and then scratched. Total protein was extracted by RIPA lysis buffer (KeyGEN, China) with protease and phosphatase inhibitor cocktail (KeyGEN, China) and was quantified using bicinchoninic acid protein assay kit (Beyotime, China). Equivalent amount of small intestinal mucosal protein were loaded on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels (Bio-Rad, United States) and separated by electrophoresis. Then, proteins were transferred onto 0.45 μm polyvinylidene fluoride membranes (Millipore, Ireland). After being blocked in 5 % skim milk powder (Beyotime, China) for 2 h, the membranes were incubated with primary antibodies to Smpd3 (Abcam, United Kingdom) and Sptlc2 (Invitrogen, United States) overnight, followed by incubation in horseradish peroxidase-conjugated secondary antibodies (Proteintech, China) for 60 min. The protein bands were visualized by ECL solution (Millipore, United States) and their density was assessed with LI-COR Odyssey Imager (LI-COR Biosciences, United States).\nSmall intestinal mucosa were flushed with saline and then scratched. Total protein was extracted by RIPA lysis buffer (KeyGEN, China) with protease and phosphatase inhibitor cocktail (KeyGEN, China) and was quantified using bicinchoninic acid protein assay kit (Beyotime, China). Equivalent amount of small intestinal mucosal protein were loaded on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels (Bio-Rad, United States) and separated by electrophoresis. Then, proteins were transferred onto 0.45 μm polyvinylidene fluoride membranes (Millipore, Ireland). After being blocked in 5 % skim milk powder (Beyotime, China) for 2 h, the membranes were incubated with primary antibodies to Smpd3 (Abcam, United Kingdom) and Sptlc2 (Invitrogen, United States) overnight, followed by incubation in horseradish peroxidase-conjugated secondary antibodies (Proteintech, China) for 60 min. The protein bands were visualized by ECL solution (Millipore, United States) and their density was assessed with LI-COR Odyssey Imager (LI-COR Biosciences, United States).\nRNA analysis The expression of smpd3 and sptlc2 in the small intestine was analyzed by real-ime quantitative polymerase chain reaction (RT-qPCR). RNA was isolated using Trizol reagent (Invitrogen, United States), and the concentration of RNA was measured using the NanoDrop spectrophotometer (NanoDrop Technologies, United States). RNA was then reverse transcribed into complementary DNA (cDNA) using a ReverTra Ace qPCR RT Kit (TOYOBO, Japan). Amplification of messenger RNA (mRNA) was carried out using SYBR Green Real-time PCR Master Mix Kit (TOYOBO, Japan) at a range of temperatures in a Roche Lightcycle 2.0 system (Roche, Switzerland). The housekeeping gene gapdh was used as an internal reference, and mRNA levels for each target were then calculated by the 2-ΔΔCt method. The primers were smpd3 (forward primer: 5’-ACTCGCTCGCAAGGCTCAATAATG-3’, reverse primer: 5’-CTGAAGCTGGCTGCACTGATGG-3’), sptlc2 (forward primer: 5’-CGCCTTCCTGAAGTGATTGCTCTC-3’, reverse primer: 5’-AGTCTACTACACCACGCCCTGAAG-3’), and gapdh (forward primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’; reverse primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’).\nThe expression of smpd3 and sptlc2 in the small intestine was analyzed by real-ime quantitative polymerase chain reaction (RT-qPCR). RNA was isolated using Trizol reagent (Invitrogen, United States), and the concentration of RNA was measured using the NanoDrop spectrophotometer (NanoDrop Technologies, United States). RNA was then reverse transcribed into complementary DNA (cDNA) using a ReverTra Ace qPCR RT Kit (TOYOBO, Japan). Amplification of messenger RNA (mRNA) was carried out using SYBR Green Real-time PCR Master Mix Kit (TOYOBO, Japan) at a range of temperatures in a Roche Lightcycle 2.0 system (Roche, Switzerland). The housekeeping gene gapdh was used as an internal reference, and mRNA levels for each target were then calculated by the 2-ΔΔCt method. The primers were smpd3 (forward primer: 5’-ACTCGCTCGCAAGGCTCAATAATG-3’, reverse primer: 5’-CTGAAGCTGGCTGCACTGATGG-3’), sptlc2 (forward primer: 5’-CGCCTTCCTGAAGTGATTGCTCTC-3’, reverse primer: 5’-AGTCTACTACACCACGCCCTGAAG-3’), and gapdh (forward primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’; reverse primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’).\nCeramide detection Ceramide concentrations peripheral circulation and the portal vein were measured as previously described using Ceramide LIPIDOMIX Mass Spec Standard (#330712X-1EA, Avanti, United States) as standards[14].\nCeramide concentrations peripheral circulation and the portal vein were measured as previously described using Ceramide LIPIDOMIX Mass Spec Standard (#330712X-1EA, Avanti, United States) as standards[14].\nStatistical analysis Data are mean ± SEM. Area under the curve (AUC) for oral glucose tolerance test (OGTT) was calculated by trapezoidal integration. Intergroup comparisons were performed by one-way analysis of variance followed by Bonferroni post hoc comparisons. P < 0.05 was considered statistically significant. All calculations were performed using SPSS version 25.0.\nData are mean ± SEM. Area under the curve (AUC) for oral glucose tolerance test (OGTT) was calculated by trapezoidal integration. Intergroup comparisons were performed by one-way analysis of variance followed by Bonferroni post hoc comparisons. P < 0.05 was considered statistically significant. All calculations were performed using SPSS version 25.0.", "Eight-week-old male Wistar rats (220 g on average, purchased from Huafukang Biotech, China) were individually housed with a 12 h light/dark cycle under constant temperature (24-26 °C) and humidity (50%-70%). All rats were fed with HFD (42% carbohydrate, 18% protein and 40% fat, as a total percentage of calories, Huafukang Biotech, China) with no restriction to tap water for 1 mo to induce insulin resistance. After fasting for 12 h, 30 mg/kg STZ (Sigma Aldrich, United States) dissolved in sodium citrate buffer (pH 4.2) was injected into the peritoneal cavity. Random blood glucose concentrations were measured with a glucometer (Roche Diagnostics, Germany) from tail veins 72 h later. Thirty rats with random blood glucose ≥ 16.7 mmol/L were considered diabetic and were matched into salicylhydroxamic acid (SHAM) group (n = 10), DJB group (n = 10) and DJB + CDCA group (n = 10). One month later, surgery was performed as we previously reported[5]. Body weight and calorie intake were recorded daily. All rats were sacrificed after 12 h fasting at week 12 postoperatively. All procedures involving animals were reviewed and approved by the Ethics Committee on Animal Experiment of Shandong University Qilu Hospital.", "Without fasting, rats in the DJB + CDCA group were administrated with CDCA suspension (100 mg/kg suspended in 3 mL tap water) by intragastric gavage three times a week since week 5 postoperatively. The gavage procedure ceased after week 11.", "At week 4 and week 12, after 12 h fasting, the rats were administrated with 20% of glucose (1 g/kg) by intragastric gavage. Blood glucose concentrations were measured at t = 0, 10, 30, 60 and 120 min.", "Peripheral blood samples were collected from the retrobulbar venous plexus after 12 h fasting before sacrificing. Portal venous blood samples were collected directly from the portal vein. After centrifugation, the supernatant was stored at -80 °C until analysis.", "Three independent intestinal segments (3 cm each) was excised at the proximal, medium and distal sites within the common limb, respectively, without prior flushing. The control intestinal segments from SHAM group were excised at the corresponding anatomic location. Total luminal bile acids from intestinal segments were extracted by 9 mL 50 % tert-butyl alcohol for 1 h at 37 °C. After centrifugation, the supernatant was collected for bile acid analysis. Total bile acids were measured by Roche Cobas 8000 system using enzyme cycling method and individual bile acid species was measured using high-pressure liquid chromatography coupled with tandem mass spectrometry as we previously described[5].", "Small intestinal mucosa were flushed with saline and then scratched. Total protein was extracted by RIPA lysis buffer (KeyGEN, China) with protease and phosphatase inhibitor cocktail (KeyGEN, China) and was quantified using bicinchoninic acid protein assay kit (Beyotime, China). Equivalent amount of small intestinal mucosal protein were loaded on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels (Bio-Rad, United States) and separated by electrophoresis. Then, proteins were transferred onto 0.45 μm polyvinylidene fluoride membranes (Millipore, Ireland). After being blocked in 5 % skim milk powder (Beyotime, China) for 2 h, the membranes were incubated with primary antibodies to Smpd3 (Abcam, United Kingdom) and Sptlc2 (Invitrogen, United States) overnight, followed by incubation in horseradish peroxidase-conjugated secondary antibodies (Proteintech, China) for 60 min. The protein bands were visualized by ECL solution (Millipore, United States) and their density was assessed with LI-COR Odyssey Imager (LI-COR Biosciences, United States).", "The expression of smpd3 and sptlc2 in the small intestine was analyzed by real-ime quantitative polymerase chain reaction (RT-qPCR). RNA was isolated using Trizol reagent (Invitrogen, United States), and the concentration of RNA was measured using the NanoDrop spectrophotometer (NanoDrop Technologies, United States). RNA was then reverse transcribed into complementary DNA (cDNA) using a ReverTra Ace qPCR RT Kit (TOYOBO, Japan). Amplification of messenger RNA (mRNA) was carried out using SYBR Green Real-time PCR Master Mix Kit (TOYOBO, Japan) at a range of temperatures in a Roche Lightcycle 2.0 system (Roche, Switzerland). The housekeeping gene gapdh was used as an internal reference, and mRNA levels for each target were then calculated by the 2-ΔΔCt method. The primers were smpd3 (forward primer: 5’-ACTCGCTCGCAAGGCTCAATAATG-3’, reverse primer: 5’-CTGAAGCTGGCTGCACTGATGG-3’), sptlc2 (forward primer: 5’-CGCCTTCCTGAAGTGATTGCTCTC-3’, reverse primer: 5’-AGTCTACTACACCACGCCCTGAAG-3’), and gapdh (forward primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’; reverse primer: 5’-ACCCTGTTGCTGTAGCCATATTC-3’).", "Ceramide concentrations peripheral circulation and the portal vein were measured as previously described using Ceramide LIPIDOMIX Mass Spec Standard (#330712X-1EA, Avanti, United States) as standards[14].", "Data are mean ± SEM. Area under the curve (AUC) for oral glucose tolerance test (OGTT) was calculated by trapezoidal integration. Intergroup comparisons were performed by one-way analysis of variance followed by Bonferroni post hoc comparisons. P < 0.05 was considered statistically significant. All calculations were performed using SPSS version 25.0.", "One rat in SHAM group died of intestinal obstruction. Two rats in DJB group and 2 rats in DJB + CDCA group died of anastomotic leak. At the end of the study, the number of rats alive in SHAM, DJB and DJB + CDCA groups were 9, 8 and 8, respectively.\nBody weight and energy intake At baseline, both body weight and energy intake were comparable between three groups. After surgery, both body weight and energy intake decreased sharply in all three groups and increased gradually thereafter. At week 2-5 postoperatively, body weight of the rats in DJB and DJB + CDCA groups was significantly less than that in SHAM group (P < 0.05 all). At week 7-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in DJB group (P < 0.05 all) (Figure 1A). At week 9-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in SHAM group (P < 0.05 all). At week 9-12 postoperatively, energy intake of the rats in DJB + CDCA group was significantly less than that in SHAM and DJB groups (P < 0.05 all) (Figure 1B).\n\nBody weight and energy intake from baseline to week 12 after operations as well as oral glucose tolerance test and the corresponding areas under the curves at baseline, week 4 and week 12 after operations. A: Body weight; B: Energy intake; C: Area under the curve of oral glucose tolerance test; D: Oral glucose tolerance test at baseline; E: Oral glucose tolerance test at week 4; F: Oral glucose tolerance test at week 12. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid.\nAt baseline, both body weight and energy intake were comparable between three groups. After surgery, both body weight and energy intake decreased sharply in all three groups and increased gradually thereafter. At week 2-5 postoperatively, body weight of the rats in DJB and DJB + CDCA groups was significantly less than that in SHAM group (P < 0.05 all). At week 7-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in DJB group (P < 0.05 all) (Figure 1A). At week 9-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in SHAM group (P < 0.05 all). At week 9-12 postoperatively, energy intake of the rats in DJB + CDCA group was significantly less than that in SHAM and DJB groups (P < 0.05 all) (Figure 1B).\n\nBody weight and energy intake from baseline to week 12 after operations as well as oral glucose tolerance test and the corresponding areas under the curves at baseline, week 4 and week 12 after operations. A: Body weight; B: Energy intake; C: Area under the curve of oral glucose tolerance test; D: Oral glucose tolerance test at baseline; E: Oral glucose tolerance test at week 4; F: Oral glucose tolerance test at week 12. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid.\nOGTT There was no difference in glucose tolerance between three groups at baseline based on AUCOGTT. At week 4 and 12, glucose tolerance was significantly improved with DJB and DJB + CDCA groups compared to SHAM group based on AUCOGTT (P < 0.05 each). There was no difference between DJB and DJB + CDCA groups, or between week 4 and week 12 within each group (Figures 1C-F).\nThere was no difference in glucose tolerance between three groups at baseline based on AUCOGTT. At week 4 and 12, glucose tolerance was significantly improved with DJB and DJB + CDCA groups compared to SHAM group based on AUCOGTT (P < 0.05 each). There was no difference between DJB and DJB + CDCA groups, or between week 4 and week 12 within each group (Figures 1C-F).\nLuminal bile acids Total luminal bile acid concentrations were significantly less with SHAM group compared to both DJB and DJB + CDCA groups in either proximal, medium or distal segment in the common limb (P < 0.05 all). In the distal segment, luminal total bile acid concentrations were significantly greater with DJB + CDCA group than DJB group (P < 0.05), while this difference was not significant in the proximal or medium segment (Figure 2A).\n\nLuminal total and individual bile acid concentrations and ceramide concentrations within the peripheral and portal circulations. A: Total amount of luminal bile acids; B: Luminal individual bile acid percentage in the proximal; C: Medium segment within the common limb; D: Distal segment within the common limb; E: Ratio of farnesoid X receptor agonist and antagnist within the common limb; F: Peripheral serum ceramides; G: Portal serum ceramides. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. FXR: Farnesoid X receptor; SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; αMCA: α-muricholic acid; UDCA: Ursodeoxycholic acid; LCA: Lithocholic acid; HDCA: Hyocholic acid; TLCA: Taurine-conjugated lithocholic acid.\nIn the proximal segment (Figure 2B), CA accounted for over 20% of the total luminal bile acids in all three groups, and was significantly greater with SHAM group than DJB and DJB + CDCA groups (P < 0.05). The percentages of α-muricholic acid (αMCA), βMCA, deoxycholic acid, CDCA, lithocholic acid (LCA), hyocholic acid (HDCA), and taurine-conjugated LCA (TLCA) were comparable between all three groups. The percentage of UDCA was less with DJB + CDCA group compared to SHAM and DJB groups (P < 0.05). The percentages of taurine-conjugated forms of αMCA, βMCA, CA, DCA, CDCA and UDCA were all greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). The percentage of TCDCA was greater with DJB + CDCA group than DJB group (P < 0.05).\nIn the medium segment (Figure 2C), the difference in TαMCA and TDCA between three groups was no longer significant compared to the proximal segment. The percentage of TβMCA increased to more than 5% in DJB and DJB + CDCA groups which was significantly greater than SHAM group (P < 0.05). The percentage of TCDCA was comparable between SHAM and DJB groups, which was significantly less than DJB + CDCA group (P < 0.05).\nIn the distal segment (Figure 2D), the percentage of TβMCA, TCA and TUDCA was significantly greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05), without any difference between the former two groups. The percentage of CA was significantly less with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). There was no difference in the percentage of UDCA between three groups. The percentage of other individual bile acids was comparable to that in the medium segment. The ratio of FXR agonists (including CA, TCA, DCA, TDCA, CDCA, TCDCA, LCA, and TLCA) and antagonists (including αMCA, TαMCA, βMCA, TβMCA, UDCA, TUDCA and HDCA) in DJB and DJB + CDCA groups was decreased compared to SHAM group in either proximal, medium or distal segment (P < 0.05). No difference was observed between DJB group and DJB + CDCA group (Figure 2E).\nTotal luminal bile acid concentrations were significantly less with SHAM group compared to both DJB and DJB + CDCA groups in either proximal, medium or distal segment in the common limb (P < 0.05 all). In the distal segment, luminal total bile acid concentrations were significantly greater with DJB + CDCA group than DJB group (P < 0.05), while this difference was not significant in the proximal or medium segment (Figure 2A).\n\nLuminal total and individual bile acid concentrations and ceramide concentrations within the peripheral and portal circulations. A: Total amount of luminal bile acids; B: Luminal individual bile acid percentage in the proximal; C: Medium segment within the common limb; D: Distal segment within the common limb; E: Ratio of farnesoid X receptor agonist and antagnist within the common limb; F: Peripheral serum ceramides; G: Portal serum ceramides. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. FXR: Farnesoid X receptor; SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; αMCA: α-muricholic acid; UDCA: Ursodeoxycholic acid; LCA: Lithocholic acid; HDCA: Hyocholic acid; TLCA: Taurine-conjugated lithocholic acid.\nIn the proximal segment (Figure 2B), CA accounted for over 20% of the total luminal bile acids in all three groups, and was significantly greater with SHAM group than DJB and DJB + CDCA groups (P < 0.05). The percentages of α-muricholic acid (αMCA), βMCA, deoxycholic acid, CDCA, lithocholic acid (LCA), hyocholic acid (HDCA), and taurine-conjugated LCA (TLCA) were comparable between all three groups. The percentage of UDCA was less with DJB + CDCA group compared to SHAM and DJB groups (P < 0.05). The percentages of taurine-conjugated forms of αMCA, βMCA, CA, DCA, CDCA and UDCA were all greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). The percentage of TCDCA was greater with DJB + CDCA group than DJB group (P < 0.05).\nIn the medium segment (Figure 2C), the difference in TαMCA and TDCA between three groups was no longer significant compared to the proximal segment. The percentage of TβMCA increased to more than 5% in DJB and DJB + CDCA groups which was significantly greater than SHAM group (P < 0.05). The percentage of TCDCA was comparable between SHAM and DJB groups, which was significantly less than DJB + CDCA group (P < 0.05).\nIn the distal segment (Figure 2D), the percentage of TβMCA, TCA and TUDCA was significantly greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05), without any difference between the former two groups. The percentage of CA was significantly less with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). There was no difference in the percentage of UDCA between three groups. The percentage of other individual bile acids was comparable to that in the medium segment. The ratio of FXR agonists (including CA, TCA, DCA, TDCA, CDCA, TCDCA, LCA, and TLCA) and antagonists (including αMCA, TαMCA, βMCA, TβMCA, UDCA, TUDCA and HDCA) in DJB and DJB + CDCA groups was decreased compared to SHAM group in either proximal, medium or distal segment (P < 0.05). No difference was observed between DJB group and DJB + CDCA group (Figure 2E).\nCeramides At week 12, in the peripheral circulation, serum C16:0 ceramide concentrations were lower with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05); no difference in C18:0, C24:0 or C24:1 ceramides between three groups (Figure 2F). In the portal vein, serum C16:0, C24:0 and C24:1 ceramide concentrations were lower with DJB group compared to SHAM group (P < 0.05); there was no difference in either ceramide species between DJB and DJB + CDCA groups or between DJB + CDCA and SHAM groups (Figure 2G).\nAt week 12, in the peripheral circulation, serum C16:0 ceramide concentrations were lower with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05); no difference in C18:0, C24:0 or C24:1 ceramides between three groups (Figure 2F). In the portal vein, serum C16:0, C24:0 and C24:1 ceramide concentrations were lower with DJB group compared to SHAM group (P < 0.05); there was no difference in either ceramide species between DJB and DJB + CDCA groups or between DJB + CDCA and SHAM groups (Figure 2G).\nExpression of Smpd3 and Sptlc2 At week 12, the expression of Smpd3 and Sptlc2 were lower with DJB and DJB + CDCA groups than SHAM group at both protein and mRNA levels (P < 0.05). Compared to DJB + CDCA group, the expression of Smpd3 and Sptlc2 with DJB group were even lower at both protein and mRNA levels (P < 0.05) (Figures 3A, 3B and 3C).\n\nExpression of ceramide synthesis-related enzyme sphingomyelin phosphodiesterase 3 and serine palmitoyltransferase long chain base subunit 2 at protein and mRNA levels. A: Expression of sphingomyelin phosphodiesterase 3 (Smpd3), serine palmitoyltransferase long chain base subunit 2 (Sptlc2) and GAPDH; B: Expression of Smpd3, Sptlc2 at protein; C: Expression of Smpd3, Sptlc2 mRNA levels. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; Smpd3: Sphingomyelin phosphodiesterase 3; Sptlc2: Serine palmitoyltransferase long chain base subunit 2.\nAt week 12, the expression of Smpd3 and Sptlc2 were lower with DJB and DJB + CDCA groups than SHAM group at both protein and mRNA levels (P < 0.05). Compared to DJB + CDCA group, the expression of Smpd3 and Sptlc2 with DJB group were even lower at both protein and mRNA levels (P < 0.05) (Figures 3A, 3B and 3C).\n\nExpression of ceramide synthesis-related enzyme sphingomyelin phosphodiesterase 3 and serine palmitoyltransferase long chain base subunit 2 at protein and mRNA levels. A: Expression of sphingomyelin phosphodiesterase 3 (Smpd3), serine palmitoyltransferase long chain base subunit 2 (Sptlc2) and GAPDH; B: Expression of Smpd3, Sptlc2 at protein; C: Expression of Smpd3, Sptlc2 mRNA levels. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; Smpd3: Sphingomyelin phosphodiesterase 3; Sptlc2: Serine palmitoyltransferase long chain base subunit 2.", "At baseline, both body weight and energy intake were comparable between three groups. After surgery, both body weight and energy intake decreased sharply in all three groups and increased gradually thereafter. At week 2-5 postoperatively, body weight of the rats in DJB and DJB + CDCA groups was significantly less than that in SHAM group (P < 0.05 all). At week 7-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in DJB group (P < 0.05 all) (Figure 1A). At week 9-12 postoperatively, body weight of the rats in DJB + CDCA group was significantly less than that in SHAM group (P < 0.05 all). At week 9-12 postoperatively, energy intake of the rats in DJB + CDCA group was significantly less than that in SHAM and DJB groups (P < 0.05 all) (Figure 1B).\n\nBody weight and energy intake from baseline to week 12 after operations as well as oral glucose tolerance test and the corresponding areas under the curves at baseline, week 4 and week 12 after operations. A: Body weight; B: Energy intake; C: Area under the curve of oral glucose tolerance test; D: Oral glucose tolerance test at baseline; E: Oral glucose tolerance test at week 4; F: Oral glucose tolerance test at week 12. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid.", "There was no difference in glucose tolerance between three groups at baseline based on AUCOGTT. At week 4 and 12, glucose tolerance was significantly improved with DJB and DJB + CDCA groups compared to SHAM group based on AUCOGTT (P < 0.05 each). There was no difference between DJB and DJB + CDCA groups, or between week 4 and week 12 within each group (Figures 1C-F).", "Total luminal bile acid concentrations were significantly less with SHAM group compared to both DJB and DJB + CDCA groups in either proximal, medium or distal segment in the common limb (P < 0.05 all). In the distal segment, luminal total bile acid concentrations were significantly greater with DJB + CDCA group than DJB group (P < 0.05), while this difference was not significant in the proximal or medium segment (Figure 2A).\n\nLuminal total and individual bile acid concentrations and ceramide concentrations within the peripheral and portal circulations. A: Total amount of luminal bile acids; B: Luminal individual bile acid percentage in the proximal; C: Medium segment within the common limb; D: Distal segment within the common limb; E: Ratio of farnesoid X receptor agonist and antagnist within the common limb; F: Peripheral serum ceramides; G: Portal serum ceramides. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. FXR: Farnesoid X receptor; SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; αMCA: α-muricholic acid; UDCA: Ursodeoxycholic acid; LCA: Lithocholic acid; HDCA: Hyocholic acid; TLCA: Taurine-conjugated lithocholic acid.\nIn the proximal segment (Figure 2B), CA accounted for over 20% of the total luminal bile acids in all three groups, and was significantly greater with SHAM group than DJB and DJB + CDCA groups (P < 0.05). The percentages of α-muricholic acid (αMCA), βMCA, deoxycholic acid, CDCA, lithocholic acid (LCA), hyocholic acid (HDCA), and taurine-conjugated LCA (TLCA) were comparable between all three groups. The percentage of UDCA was less with DJB + CDCA group compared to SHAM and DJB groups (P < 0.05). The percentages of taurine-conjugated forms of αMCA, βMCA, CA, DCA, CDCA and UDCA were all greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). The percentage of TCDCA was greater with DJB + CDCA group than DJB group (P < 0.05).\nIn the medium segment (Figure 2C), the difference in TαMCA and TDCA between three groups was no longer significant compared to the proximal segment. The percentage of TβMCA increased to more than 5% in DJB and DJB + CDCA groups which was significantly greater than SHAM group (P < 0.05). The percentage of TCDCA was comparable between SHAM and DJB groups, which was significantly less than DJB + CDCA group (P < 0.05).\nIn the distal segment (Figure 2D), the percentage of TβMCA, TCA and TUDCA was significantly greater with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05), without any difference between the former two groups. The percentage of CA was significantly less with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05). There was no difference in the percentage of UDCA between three groups. The percentage of other individual bile acids was comparable to that in the medium segment. The ratio of FXR agonists (including CA, TCA, DCA, TDCA, CDCA, TCDCA, LCA, and TLCA) and antagonists (including αMCA, TαMCA, βMCA, TβMCA, UDCA, TUDCA and HDCA) in DJB and DJB + CDCA groups was decreased compared to SHAM group in either proximal, medium or distal segment (P < 0.05). No difference was observed between DJB group and DJB + CDCA group (Figure 2E).", "At week 12, in the peripheral circulation, serum C16:0 ceramide concentrations were lower with DJB and DJB + CDCA groups compared to SHAM group (P < 0.05); no difference in C18:0, C24:0 or C24:1 ceramides between three groups (Figure 2F). In the portal vein, serum C16:0, C24:0 and C24:1 ceramide concentrations were lower with DJB group compared to SHAM group (P < 0.05); there was no difference in either ceramide species between DJB and DJB + CDCA groups or between DJB + CDCA and SHAM groups (Figure 2G).", "At week 12, the expression of Smpd3 and Sptlc2 were lower with DJB and DJB + CDCA groups than SHAM group at both protein and mRNA levels (P < 0.05). Compared to DJB + CDCA group, the expression of Smpd3 and Sptlc2 with DJB group were even lower at both protein and mRNA levels (P < 0.05) (Figures 3A, 3B and 3C).\n\nExpression of ceramide synthesis-related enzyme sphingomyelin phosphodiesterase 3 and serine palmitoyltransferase long chain base subunit 2 at protein and mRNA levels. A: Expression of sphingomyelin phosphodiesterase 3 (Smpd3), serine palmitoyltransferase long chain base subunit 2 (Sptlc2) and GAPDH; B: Expression of Smpd3, Sptlc2 at protein; C: Expression of Smpd3, Sptlc2 mRNA levels. aP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass + chenodeoxycholic acid; bP < 0.05, salicylhydroxamic acid vs duodenal-jejunal bypass; cP < 0.05, duodenal-jejunal bypass vs duodenal-jejunal bypass + chenodeoxycholic acid. SHAM: Salicylhydroxamic acid; DJB: Duodenal-jejunal bypass; CDCA: Chenodeoxycholic acid; Smpd3: Sphingomyelin phosphodiesterase 3; Sptlc2: Serine palmitoyltransferase long chain base subunit 2.", "In the present study, we performed SHAM, DJB and DJB + CDCA procedures in a HFD/STZ induced diabetic rat model, and for the first time, demonstrated the changes of luminal individual bile acids in the distal small intestine. We also found that the subsequent changes of the bile acids within the distal common limb after DJB elicited inhibitory effect on regional ceramide synthesis and this phenomenon could be partially antagonized by luminal supplementation of FXR activating bile acid CDCA.\nDJB was initially designed to investigate the weight loss independent mechanisms of bariatric surgery[3]. This procedure has no effect on weight loss but could induce fast and sustainable amelioration of type 2 diabetes[4]. Consistent with other bariatric procedures[15,16], serum bile acid concentrations were also increased following DJB, and this phenomenon is clearly related to reconstruction of the gastrointestinal tract[5]. Via the biliopancreatic limb, bile acids contact the distal small intestine, where luminal bile acid reabsorption mainly occurs, more rapidly and lead to early and increased reabsorption of luminal bile acids in the small intestine. A recent study has proved that in the biliopancreatic limb, increased reabsorption of luminal bile acids has already commenced as a result of highly concentrated bile acids as well as lack of lipids[17]. While in the alimentary limb, only trace amount of luminal bile acids could be detected[4]. Decreased luminal bile acids lead to marked luminal sodium insufficiency, and hence, intestinal uptake of glucose in the alimentary limb is significantly decreased[18], which represents another mechanism in controlling postprandial glucose excursion. The common limb is where food and bile mix up and the major place for intestinal FXR expression. Therefore, we concentrated on bile acid milieu within the common limb rather than the biliopancreatic or alimentary limb because the common limb is the place mostly close to physiological conditions.\nTo our knowledge, the present study is the first study reporting luminal bile acid changes after DJB. Most clinical and animal studies concentrated on serum or fecal bile acids, as the intestinal lumen is deep inside and in vivo study of luminal contents, particularly in the small intestine, is technically difficult and ethically challenging. Consistent with our previous findings of serum bile acid changes after DJB, the total amount of luminal bile acids and the proportion of FXR-inhibitory bile acids were both increased. These specific changes have at least two clinical relevance. First, concentrated luminal bile acids stimulate TRG5 on the surface of enteroendocrine cells and leads to potentiated GLP-1 secretion[4]; second, increased proportion of FXR-inhibitory bile acids has inhibited expression of FXR downstream pathways and reduced biosynthesis of intestinal-derived ceramides[12]. Compared to TGR5, FXR appears to be a more important and complicated receptor in metabolic regulation; in the absence of FXR, the ability of bariatric surgery to reduce body weight and improve glucose tolerance is substantially reduced while these metabolic benefits are largely preserved when TGR5 is deficient[19-20]. Whole body FXR knock-out mice were associated with elevated serum triglycerides, cholesterols, free fatty acids and severe liver fat accumulation, but were protected from diet- or genetically- induced obesity[21]. In contrast, liver-specific FXR knock-out mice were not protected from diet-induced obesity and insulin resistance[22], suggesting the distinct role of hepatic and intestinal FXR activation in improving glucose tolerance and insulin resistance. In the small intestine, the role of FXR is controversial. After bariatric surgery, increased serum fibroblast growth factor 19 (FGF19) concentrations have been thought to play a role in the remission of human diabetes[15]. And intestinal FXR activation by luminal bile acids has been thought as a major source of increased serum FGF19. However, no direct evidence was available to confirm the state of intestinal FXR activation, and other tissues may also be sources of FGF19. In contrast, more studies support that intestinal FXR activation would damage metabolic homeostasis by reducing energy expenditure and impairing glucose tolerance[12,14,23]. To investigate the direct influence of bile acids on intestinal FXR, bile diversion procedure was reported by three separate studies[4,24,25], including one from our group[4]. Surprisingly, all three studies showed activated intestinal FXR in response to direct bile acid stimulation. However, in contrast, in DJB, the effect of bile acids on intestinal FXR within the common limb was inhibitory. The discrepancy suggests the biliopancreatic limb may have altered the luminal bile acid composition by premature bile acid reabsorption.\nConsistent with our hypothesis, both ceramides in the portal vein and in the peripheral circulation were decreased in response to increased proportion of luminal FXR-inhibitory bile acids. Ceramides are signaling molecules and are associated with obesity and insulin resistance at high concentrations[26]. Decreased ceramides inhibits the expression of SREBP-1 in the liver and alleviates hepatic fat accumulation, thus increasing hepatic insulin sensitivity[12]. Our previous study found that DJB suppressed hepatic de novo lipogenesis and alleviates liver fat accumulation by inhibiting SREBP-1. However, the mechanisms underlying were unknown. Based on results from the present study, we have unveiled at least one mechanism accounting for alleviated hepatic fat accumulation. Therefore, manipulation of luminal bile acid composition towards FXR-inhibitory trend may have metabolic beneficial effects.\nThe present study has several limitations. First, bile acids are mixture with a variety of individual bile acids. As bile acids are mainly conjugated with taurine in rodents[27], we only tested luminal unconjugated and taurine-conjugated bile acids. Second, CDCA is not dissolved in water and we used CDCA suspension for gavage, which may have compromised CDCA absorption to a certain degree. Third, the results from the present study were based on a diabetic rat model and should be interpreted with caution due to species gap.", "In conclusion, DJB significantly changes luminal bile acid composition with increased proportion of FXR-inhibitory bile acids and reduce serum ceramide levels. There observations suggest a novel mechanism of bile acids in metabolic regulation after DJB." ]

[ null, "methods", null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "Bariatric surgery", "Duodenal-jejunal bypass", "Farnesoid X receptor", "Ceramide", "Bile acids", "Liver fat accumulation" ]

[ 579, 254, 47, 50, 43, 121, 197, 200, 32, 62, 2921, 308, 77, 709, 106, 219, 1064, 40 ]

[ "djb", "acid", "cdca", "group", "bile", "05", "groups", "djb cdca", "sham", "week" ]

[ "bile acids inhibited", "bile acids metabolic", "diabetes interaction bile", "bile acids intestinal", "serum bile acids" ]

[ "Anxiety", "COVID-19", "Cross-Sectional Studies", "Depression", "Health Personnel", "Humans", "Pandemics", "SARS-CoV-2", "Sleep Initiation and Maintenance Disorders", "Taiwan" ]

[ "2. Materials and Methods" ]

[ "Study design and participants: a cross-sectional study was conducted in a regional teaching hospital in central Taiwan between 1 November 2021 and 28 February 2022, after two waves of infection in Taiwan. Participants were first-line HCW who actively cared and treated suspected or confirmed COVID-19 cases, including physicians, nurses, physician assistants (PA), respiratory therapists (RT), and radiological and laboratory medical technical assistants (MTA), as well as pharmacists. Staffs of emergency rooms, intensive care units, and isolation rooms where included, with professionals who are specialized in infection disease, pneumology, intensive care, and emergency medicine. Two hundred and seventy paper questionnaires were issued.\nThe contents of the questionnaire consisted of three parts: the first part includes socio-demographic parameters (age, gender, occupation, years of professional experience, marital status, living alone or not, education level, previous working experience on infection disease, history of chronic disease and psychiatric disease, and current use of alcohol or cigarettes); these were defined as intrinsic factors.\nThe second part of the questionnaire consisted of an evaluation of psychological impact. We used the Hospital Anxiety and Depression Scale (HADS) [22]; this includes eight items for anxiety and seven items for depression. Using a four-point Likert scale, the maximum score is 21, a score under 8 is considered normal, a score of 8 to 10 indicates a borderline level, and 11 to 21 indicates an abnormal level. Its Cronbach’s α coefficient was 0.91. \nFor evaluation of insomnia, we used Insomnia Severity Index (ISI) [23], which includes seven items; using a five-point Likert scale, a maximum score was 21 and the level of insomnia was defined as follows: a score of 8 to 14 indicates a subthreshold level, 15 to 21 indicates a moderate level, 22 to 28 indicates severe insomnia, and its Cronbach’s α coefficient was 0.91. To reflect the level of loneliness, we used the Oslo social support scale (OSSS–3) [24], which includes three items; using a four- to five-point Likert scale, a score of 3–8 indicates poor support, 9–11 indicates a moderate level of support, and 12–14 indicates strong social support. OSSS–3’s Cronbach’s α coefficient in this study was 0.77.\nThe third part of the questionnaire evaluates seven aspects of working conditions and potential problems, defined as extrinsic factors. We used a four-point Likert scale. These factors include: changes of workload and schedules (five items, ranging from “no” to “very frequent”), sufficiency of PPE and medical supplies (four items, ranging from “not enough” to “very complete”), concerns over the risk of infection (four items, ranging from “not worried” to “very worried”), working place relationships (four items, ranging from “none at all” to “very good”), social pressure (three items, ranging from “none at all” to “very frequent”), family support (two items, ranging from “none at all” to “very supportive”), and public health policy and information accuracy and transparency (five items, ranging from “none at all” to “very complete”). The Cronbach’s α coefficient was 0.77 to 0.92, which indicates an acceptable level of internal consistency.\nStatistical analysis: the baseline socio-demographic characteristics and psychological impacts were analyzed with descriptive statistics.\nTo compare differences of psychological impacts during the first wave and second wave of infection, we used a paired sample t-test. The Pearson correlation test was applied to extrinsic factors with the intention to analyze their relation to psychological effects; then, we compared differences of extrinsic factors during the first wave and second wave of infection with a paired sample t-test. Multiple linear regression analysis on extrinsic factors was employed to evaluate their effect on psychological impact during the most affected wave of infection.\nStatistical analysis was performed in an IBM SPSS Statistics version 26, with a two-tailed p value of <0.05 indicating significance." ]

[ null ]

[ "1. Introduction", "2. Materials and Methods", "3. Results", "4. Discussion", "5. Conclusions" ]

[ "The coronavirus disease (COVID-19) has spread worldwide since the end of 2019; it has been affecting millions of people, which exceeds in number and scale severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS), causing a heavy burden on public health systems globally, consequently bringing impacts to healthcare workers (HCW) in an unprecedented way.\nSince its first imported case in January 2020, Taiwan experienced three definite waves of COVID-19 infections, different from other countries, with no new diagnosed cases between. Taiwan had a relatively lower number of confirmed cases and deceased patients in its first wave during January to May of 2020, followed by nearly 10 months of zero cases until April of 2021, when multiple chains of infection spread rapidly. It was a second wave of infection. By the end of August of 2021, there were more than 15,000 confirmed cases and over 800 deceased cases (Table 1). As most of the newly diagnosed patients were in the northern region of the country, the Taiwanese center of disease control (CDC) strategically deferred patients to medical centers and regional hospital in central and south Taiwan to unload the burden on hospitals in the northern regions. The number of new diagnosed cases dropped to a single digit by the beginning of September 2021, followed by a period of nearly no new cases until January of 2022, when the Omicron variant appeared, causing the third wave of infection.\nFrom experience of previous pandemics, these situations can cause detrimental psychological effects on HCW [1,2,3]. Taiwan’s experience with SARS in 2003 demonstrated that nearly 70% of HCW had mental health burdens [4]. In the early stage of the COVID-19 pandemic in Taiwan, a web-based survey of HCW from March to April of 2020 demonstrated that 40.3% of responders felt burnt out, with a significant level of anxiety in 78.1%, and 45.5% complained of depression [5]. \nIt is well-known that psychological problems in HCW during a pandemic are multifactorial: some factors are intrinsic to HCW, such as, for example, gender, occupation, education level, position, seniority, [2,3,6,7], frontline HCW [8], marital status/living conditions [9], use of tobacco/alcohol [10,11], and if they ever have any chronic disease or mental disease [7]. Other factors are extrinsic to HCW, such as work loading and shift changes [1,2,12], availability of personal protection equipment (PPE) and/or medical resources [6,13], risk of infection [1,2,3], workplace relationships between leaders and co-workers [7], social pressure and stigmatization [14], family support [9], and transparency/accuracy of public health policy and information from governments and hospitals [15,16]. \nMost of studies conducted during the COVID-19 pandemic had focused on the detrimental psychological effects of the pandemic and its related factors on HCW. Some studies had focused on a single second wave of infection [17,18]. A study comparing two waves of infection in India reported that HCW were less affected by psychological impacts during the second wave [19], but two Italian studies comparing psychological stress in the first and second waves reported no significant differences between the two waves [20,21]. These findings leave questions such as, if in different countries, with a variety in backgrounds or influencing factors, how can the negative psychological effects and severity in HCW during different waves of the pandemic differ?\nIn this study, we aim to investigate: 1. differences of severity of psychological impacts between the first and second waves of the pandemic in HCW in Taiwan, and 2. analysis of extrinsic factors to see how differently they manifested in both stages of the infection, and how they affected the negative psychological effects on Taiwanese HCW.", "Study design and participants: a cross-sectional study was conducted in a regional teaching hospital in central Taiwan between 1 November 2021 and 28 February 2022, after two waves of infection in Taiwan. Participants were first-line HCW who actively cared and treated suspected or confirmed COVID-19 cases, including physicians, nurses, physician assistants (PA), respiratory therapists (RT), and radiological and laboratory medical technical assistants (MTA), as well as pharmacists. Staffs of emergency rooms, intensive care units, and isolation rooms where included, with professionals who are specialized in infection disease, pneumology, intensive care, and emergency medicine. Two hundred and seventy paper questionnaires were issued.\nThe contents of the questionnaire consisted of three parts: the first part includes socio-demographic parameters (age, gender, occupation, years of professional experience, marital status, living alone or not, education level, previous working experience on infection disease, history of chronic disease and psychiatric disease, and current use of alcohol or cigarettes); these were defined as intrinsic factors.\nThe second part of the questionnaire consisted of an evaluation of psychological impact. We used the Hospital Anxiety and Depression Scale (HADS) [22]; this includes eight items for anxiety and seven items for depression. Using a four-point Likert scale, the maximum score is 21, a score under 8 is considered normal, a score of 8 to 10 indicates a borderline level, and 11 to 21 indicates an abnormal level. Its Cronbach’s α coefficient was 0.91. \nFor evaluation of insomnia, we used Insomnia Severity Index (ISI) [23], which includes seven items; using a five-point Likert scale, a maximum score was 21 and the level of insomnia was defined as follows: a score of 8 to 14 indicates a subthreshold level, 15 to 21 indicates a moderate level, 22 to 28 indicates severe insomnia, and its Cronbach’s α coefficient was 0.91. To reflect the level of loneliness, we used the Oslo social support scale (OSSS–3) [24], which includes three items; using a four- to five-point Likert scale, a score of 3–8 indicates poor support, 9–11 indicates a moderate level of support, and 12–14 indicates strong social support. OSSS–3’s Cronbach’s α coefficient in this study was 0.77.\nThe third part of the questionnaire evaluates seven aspects of working conditions and potential problems, defined as extrinsic factors. We used a four-point Likert scale. These factors include: changes of workload and schedules (five items, ranging from “no” to “very frequent”), sufficiency of PPE and medical supplies (four items, ranging from “not enough” to “very complete”), concerns over the risk of infection (four items, ranging from “not worried” to “very worried”), working place relationships (four items, ranging from “none at all” to “very good”), social pressure (three items, ranging from “none at all” to “very frequent”), family support (two items, ranging from “none at all” to “very supportive”), and public health policy and information accuracy and transparency (five items, ranging from “none at all” to “very complete”). The Cronbach’s α coefficient was 0.77 to 0.92, which indicates an acceptable level of internal consistency.\nStatistical analysis: the baseline socio-demographic characteristics and psychological impacts were analyzed with descriptive statistics.\nTo compare differences of psychological impacts during the first wave and second wave of infection, we used a paired sample t-test. The Pearson correlation test was applied to extrinsic factors with the intention to analyze their relation to psychological effects; then, we compared differences of extrinsic factors during the first wave and second wave of infection with a paired sample t-test. Multiple linear regression analysis on extrinsic factors was employed to evaluate their effect on psychological impact during the most affected wave of infection.\nStatistical analysis was performed in an IBM SPSS Statistics version 26, with a two-tailed p value of <0.05 indicating significance.", "Two hundred and seventy paper questionnaires were issued, 39 incomplete questionnaires were excluded, and the complete response rate was 85.55%. The mean age of participants was 35.85 years (SD = 9.76). The mean years of professional experience was 12.06 (SD = 8.82) and 75.8% were women (n = 175). Nearly 70% were university graduates (69.7%, n = 161). Nurses composed 55.4% (n = 128) of the total sample size. Nearly half of responders were married (50.2%, n = 116) and most of them live with family members (77.5%, n = 179). Very few responders have chronic disease, psychiatric disease, or a habit of alcohol–cigarettes use (Table 2). \nLevels of anxiety, depression, insomnia, and social support during the first wave and second wave of infection were analyzed.\nIn both the first and second waves of the pandemic, more than 40% of HCW suffered from abnormal levels of anxiety, nearly 30% had abnormal levels of depression, around 15% of them suffered from moderate to severe insomnia, and one in three had low levels of social support (Table 3). \nA paired sample t-test to compare psychological impacts during the first and second waves of infection was performed. Compared to the first wave, anxiety is significantly more severe during the second wave of infection (M = 10.09, SD = 5.71 vs. M = 10.65, SD = 5.11, p = 0.049), without a significant difference in the levels of depression, insomnia, and social support between the first and second waves (Table 4). \nOnce we compared both waves of infections and their differences, based on the findings of the second wave, for further analysis and understanding of the relationship between extrinsic factors and negative psychological impacts, we used Pearson correlation (Table 5).\nChanges of workload and schedules (r = 0.43, p < 0.001), concerns over risk of infection (r = 0.54, p < 0.001), and social pressure (r = 0.34, p < 0.001) were positively related to anxiety. Sufficiency of personal protection equipment and medical supplies (r = −0.29, p < 0.001), working place relationships (r = −0.22, p < 0.001), family support (r = −0.16, p = 0.01), and public health policy and information accuracy and transparency (r = −0.29, p < 0.001) were negatively related to anxiety. Extrinsic factors that are positively related to depression are changes of workload and schedules (r = 0.41, p < 0.001), concerns over risk of infection (r = 0.45, p < 0.001), and social pressure (r = 0.23, p < 0.001). Factors that negatively related to depression are sufficiency of personal protection equipment and medical supplies (r = −0.26, p < 0.001), working place relationships (r = −0.34, p < 0.001), family support (r = −0.27, p < 0.001), and public health policy and information accuracy and transparency (r = −0.31, p < 0.001).\nIn relation to insomnia, changes of workload and schedules (r = 0.44, p < 0.001), concerns over risk of infection (r = 0.38, p < 0.001), and social pressure (r = 0.25, p < 0.001) were positively related to insomnia. Sufficiency of personal protection equipment and medical supplies (r = −0.29, p < 0.001), working place relationships (r = −0.28, p < 0.001), family support (r = −0.21, p = 0.001), and public health policy and information accuracy and transparency (r = −0.29, p < 0.001) were negatively related to insomnia.\nExtrinsic factors that positively related to social support are sufficiency of personal protection equipment and medical supplies (r = 0.28, p < 0.001), working place relationships (r = 0.39, p < 0.001), family support (r = 0.37, p < 0.001), and public health policy and information accuracy and transparency (r = 0.28, p < 0.001). Factors that negatively related to social support were changes of workload and schedules (r = −0.13, p = 0.04).\nAnalysis using a paired sample t-test comparing the first and second waves on extrinsic factors showed changes of workload and schedules were more significant during the second wave (M = 1.18, SD = 0.70 vs. M = 1.04, SD = 0.67, p < 0.001), as well as increased concerns over risk of infection (M = 1.56, SD = 0.75 vs. M = 1.47, SD = 0.74, p < 0.05). Public health policy and information accuracy and transparency were considered as having improved during the second wave (M =1.82, SD = 0.55 vs. M = 1.77, SD = 0.52, p < 0.01) (Table 6).\nIn multivariate correlations analysis, increases in workload and schedules (β = 0.13, p = 0.043), concerns over risk of infection (β = 0.42, p < 0.001), and lower levels of family support (β = −0.15, p = 0.006) worsen\nlevels of anxiety. Concerns over risk of infection (β = 0.39, p < 0.001), poor working place relationships (β = −0.19, p < 0.01), and insufficient family support (β = −0.22, p < 0.001) are related to depression.\nInsomnia can be aggravated by changes in workload and schedules (β = 0.23, p = 0.001), more concerns over risk of infection (β = 0.22, p = 0.001), and poor family support (β = −0.16, p = 0.008). Better levels of working place relationships (β = 0.27, p < 0.001) and family support (β = 0.30, p < 0.001) and better the perception of social support indicates a lower level of loneliness (Table 7).", "Our study had demonstrated that the COVID-19 pandemic causes negative psychological impacts on HCW regardless of the stages/waves of the infection or the severity of the pandemic. Despite the low number of confirmed cases during the first wave of the COVID-19 pandemic in Taiwan, more than 40% of our first-line HCW had abnormal levels of anxiety, nearly 30% had abnormal levels of depression, approximately 15% had moderate to severe insomnia, and more than 30% felt loneliness. During the second wave, even though the country had nearly 10 months of zero cases, enough time on either the institutional level or personal level to prepare for the possibility of a larger-scale second hit, which had occurred during April–August of 2021, a significant higher level of anxiety was observed in HCW during this period, compared to the first wave. The levels of depression, insomnia, and loneliness, reflected by social support, remained similar in both waves.\nBased on Pearson correlation analysis, all seven extrinsic factors investigated in this study, either positively or negatively, had influenced a negative psychological impact on HCW included in this study, with some of them being much more significant. \nIncreased changes of workload and schedules had a significant adverse psychological effect, particularly increasing levels of anxiety and insomnia during the second wave of infection in Taiwan, while the pandemic became exacerbated. The work burden, psychological distress, and insomnia during COVID-19 are interrelated and multifactorial [25]. A study conducted by Boudreau et al. proved that shift work causes sleep disorders that consequently negatively disturb the moods of HCW [26]. More frequent is the shift of work schedule, especially alternating day–night shifts, when more occurrence of shift work sleep disorder (SWSD) is observed, contributing to the severity of anxiety and depression [27]. A study based on a university hospital in Portugal in 2020 during the COVID-19 pandemic proved that working overtime is one of the main factors causing anxiety, depression, and psychological stress; more overtime, the worse the negative psychological impact [12]. Work burden as a stress factor should be addressed, as increased workload and schedule shift worsens the severity of anxiety, altering sleeping pattern, in combination, they could induce abnormal hypothalamo–pituitary–adrenal secretory activity with subsequent deterioration of sleep disturbances [28], which further weakens the immune system, increasing even more the risk of infection [29].\nWith a rapid increase in the numbers of infected patients, our frontline HCW were more concerned with being infected, or being the source of infection of coworkers and family members, and these concerns significantly affected the anxiety, depression, and insomnia of HCW in this study. The anxiety over the risk of infection for HCW is not only related to increases in the numbers of infected patients, but also because the excess of workload/schedule shift altering sleeping patterns may contribute to an altered immune system, as mentioned before. As a consequence, during the second wave, the number of infected HCW was in fact increased. This is a real threat to our HCW [30]. Studies showed that this is one of main stress factors to HCW during previous major pandemics [1,31]. From the experience of SARS in 2003, study of the post-pandemic stage proved that working in a high-risk environment and direct contact with infected patients, with fear of being a source of infection to family, caused a very high level of psychological stress that persisted even after the SARS pandemic had waned [32]. Observations from studies of the early stage of the COVID-19 pandemic found that worries over the risk of infection on HCW themselves, and, more, to colleagues or family members, significantly exacerbates the levels of anxiety and depression of frontline HCW [7,33].\nAs HCW face an immense increase in duties during pandemics, well-functioning teamwork is essential, workplace relationships play an important role as an influencing factor on the psychological impacts of HCW. Our study showed that the better the workplace relationships, the better the sense of social support, and the lower the level of depression. A study in Germany showed that a lack of trust between co-workers of a medical team is a risk factor for anxiety and depression. Confidence and support from the leadership is essential, encouraging team members to manifest their needs and challenges, listen to their opinions and advice, and provide mutual support to find solutions together, and are very helpful strategies to decrease the psychological impacts of HCW [34,35].\nIn our study, more than 70% of our HCW felt that the public demands too much from them, showing certain levels of discrimination or disrespect. Despite that social pressure seems to correlate positively to anxiety, depression, and insomnia in our study, statistically it did not show significant negative psychological impact on HCW. Possible explanations for this result are good family support and adequate working place relationships: more than 70% of our HCW responded as having sufficient support from their family, and nearly 80% responded as having adequate working place relationships with their co-workers and leaders. Several studies concluded that satisfaction over family support and working place relationships helps in ameliorating negative psychological effects from social pressure [34,36,37]. \nFamily support is one of the essential factors for the resilience of HCW during a pandemic. Our study proved that the less the family support, the worse the level of anxiety, depression, and insomnia, and the better the family support, the better the sense of social support, which means fewer feelings of loneliness. Chen et al., in their study of Taiwanese HCW during SARS, proved that good family support helped in reducing the psychological stress and improving resilience during their fight against the pandemic [38]. A study from Korea concluded that one of the main factors related to psychological fatigue in HCW during MERS is a lack of family support [39]. Our study also showed that the better the family members understand the job of HCW, the better they felt supported; this finding is compatible to other studies [34,36].\nSufficiency of PPE and medical supplies and public health policy/information accuracy and transparency are two factors that did not affect HCW in our study.\nAfter a temporary shortage of PPE and medical supplies during the first wave, the Taiwanese government had responded efficiently by providing medical resources to hospitals in charge, so more than half of our HCW considered that the government and hospital had provided enough PPE and medical supplies. Sampaio et al., in their study, concluded that sufficient provision of PPE and medical supplies and securing their quality significantly reduces anxiety, depression, and stress in frontline HCW [12]. \nIn this study, our HCW responded with a high level of satisfaction about public health policy and information accuracy and transparency, as more than 70% of them responded “complete” or “very complete” on this issue. It is crucial to provide transparent and concrete information and policies [1]. A better informed and trained HCW is more confident in their duties, and consequently has less stress. The Taiwanese CDC has held press conferences daily since the very beginning of the pandemic, providing information and guidelines and announcing policies; this is very helpful to avoid misinformation and fake news, and avoid chaos and panic, which coincides with the findings of previous studies [16]. A study from China concluded that uncertainties in public health policies and guidelines reduces work efficiency and causes psychological stress for HCW [15]. Japanese studies also suggested that transparency of information from the government and hospitals in combination with adequate on-the-job training significantly reduces the anxiety and stress of HCW during a pandemic [6,13].\nThis study had some limitations: first, this study was based in a single regional healthcare system in central Taiwan, so a study of a larger scale on the cross-regional or national level would help to further understand HCW’s psychological impact in Taiwan. Despite of this limitation, this study can provide information, references, and guidance for future studies. Second, as we could never predict how the pandemic would develop in the country, a 10-month interval between the first wave and second wave was not expected. The intention of comparing the psychological impacts on HCW in two different waves surged after the second wave had been waning, so the study was designed as a cross-sectional study, conducted in the time that the second wave had ended. To reduce recall bias, a longitudinal study, which would reflect the psychological impact in real time, could be considered for future studies. \nIn summary, during the COVID-19 pandemic in Taiwan, HCW were significantly affected by negative psychological impacts such as anxiety, depression, insomnia, and loneliness, regardless of the wave of infection. A significant higher level of anxiety was observed during the second wave of COVID-19 in Taiwan, when the number of infected patients had surged rapidly and, consequently, the workload increased and changes of working schedules varied significantly. HCW became more concerned over being infected or being a source of infection during the second wave. By the same period, HCW demonstrated more confidence and satisfaction in public health policy and information accuracy and transparency than during the first wave. Increased changes in workload and working schedules, concerns over the risk of infection, workplace relationships, and family support were significant influencing factors on the negative psychological impacts.", "COVID-19 is the major and most recent pandemic that human beings have faced in the 21st century but would not be the last. By the time of redaction, many countries continue to be under the pressure of COVID-19 Omicron variants such as BA.4 and BA.5, and Taiwan is experiencing the third wave of the COVID-19 pandemic; meanwhile, monkeypox has been declared by the WHO to be a public health emergency of international concern.\nThe challenge continues. Understanding the influencing factors that affect HCW psychologically is helpful and essential for building mental health strategies, which should be timely, flexibly, and holistically responsive to protect our HCW [1,34,36,40]. Administrative efforts to reduce workload and to adjust working schedules, providing medical resources to reduce risk of infection, and creating a supportive working environment and good family support are important measures to protect our frontline HCW. " ]

[ "intro", null, "results", "discussion", "conclusions" ]

[ "COVID-19", "healthcare workers", "psychological impact" ]

[ 795 ]

[ "hcw", "support", "infection", "psychological", "wave", "001", "study", "second", "family", "factors" ]

[ "covid 19 cases", "infection taiwan participants", "pandemic taiwan hcw", "taiwan pandemic exacerbated", "covid 19 taiwan" ]

[ "Age Distribution", "Age Factors", "Aged", "Aged, 80 and over", "Case-Control Studies", "Central Nervous System Diseases", "Comorbidity", "Female", "Hospitals, University", "Humans", "Logistic Models", "Male", "Middle Aged", "Pemphigoid, Bullous", "Portugal", "Prevalence", "Sex Distribution" ]

[ "Objective", "Statistical analysis" ]

[ "The primary endpoint of the present study was to determine the prevalence and\nassociation of comorbid conditions with BP in patients who had medical attendance at\nour hospital.", "Statistical analysis was performed using the Software Package for Statistical Science\n(SPSS for Windows, version 18.0, Chicago, IL). Continuous data are presented as the\nmean value and standard deviation (SD), and categorical variables are presented as\npercentages. Patients and control subjects were compared using the Student's t-test\nfor continuous variables, while the Pearson Chi-square test was applied for\ncategorical variables. Univariate logistic regression was used to calculate the crude\nodds ratios (OR) and 95% confidence intervals (CI) for comorbid conditions in\nrelation to BP. A logistic regression model was used to measure the association\nbetween BP and neurological disorders in a multivariate analysis." ]

[ null, null ]

[ "INTRODUCTION", "Objective", "MATERIALS AND METHODS", "Statistical analysis", "RESULTS", "DISCUSSION", "CONCLUSIONS" ]

[ "Bullous pemphigoid (BP) is the most common autoimmune blistering disease and\npredominantly affects the elderly.1-3 However, on rare occasions, it can be\npresent in young adults and children.4\nBoth genders are equally affected. The annual incidence of BP has been estimated to\nrange from 2 to 14 new cases per million people.1,3,5-6 Its incidence is expected\nto rise as a consequence of population ageing. A recent study in France found a 3-fold\nincrease in the annual incidence of BP over the last 15 years, with 21.7 new cases per\nmillion inhabitants.7\nBP is characterized by the presence of circulating IgG autoantibodies directed against\ntwo proteins of the basement membrane zone, bullous pemphigoid antigens 1 and 2 (BPAG1\nand BPAG2), which are detectable by both direct and indirect immunofluorescence.\nHowever, pathogenesis is still not completely understood. Previous studies have\nsuggested a relationship between BP and comorbid conditions like neurological and\npsychiatric diseases, diabetes mellitus, and malignancy.8-12 Recently, a\nprospective casecontrol study, which evaluates risk factors for BP, identified\nneurological disorders, namely dementia and Parkinson's disease, psychiatric disorders\n(unipolar and bipolar disorders), bedridden condition, and chronic use of several drugs,\nas risk factors for BP.13\nSystemic corticotherapy (prednisone 0.5-1 mg per kilogram of body weight per day) is\nconsidered the standard treatment, but serious adverse effects can occur, including\ndeath, particularly in elderly patients.14-18 In spite of the\nprogress in BP treatment, the mortality rate of these patients can be up to sixfold\nhigher than in the general population.7\nIn 2002, Joly et al conducted a large controlled clinical trial, which\ndemonstrated that high potency topical steroids improve survival in patients with\nextensive BP, as compared with oral corticosteroid therapy.19\n Objective The primary endpoint of the present study was to determine the prevalence and\nassociation of comorbid conditions with BP in patients who had medical attendance at\nour hospital.\nThe primary endpoint of the present study was to determine the prevalence and\nassociation of comorbid conditions with BP in patients who had medical attendance at\nour hospital.", "The primary endpoint of the present study was to determine the prevalence and\nassociation of comorbid conditions with BP in patients who had medical attendance at\nour hospital.", "This case-control study was approved by the research ethics board of Coimbra University\nHospital. Between January 1998 and December 2010, we identified, in our department, all\nindividuals who had undergone a histological procedure (n=97) on the basis of clinical\nsuspicion of BP. From this initial cohort, we performed a manual chart review,\nabstracting medical records individually to ensure that these patients fulfilled the\nfollowing three criteria: (1) typical clinical features, such as tense blisters on both\nthe normal and erythematous bases, (2) characteristic histopathologic findings, such as\nsubepidermal blisters and (3) immunological findings of positive direct\nimmunofluorescence (DIF) tests (linear IgG and/or C3 deposits along the epidermal\nbasement-membrane zone). Of the ninety-seven patients identified as potentially eligible\ncases, we excluded 20 patients who did not meet these inclusion criteria, thus the\nsample for this study comprised 77 patients. The following data were recorded: age at\ndiagnosis, gender, degree of autonomy, clinical features, laboratorial parameters,\ntherapy adopted, concomitant medications and comorbidities (neurological and psychiatric\ndisorders, hypertension, diabetes mellitus, thyroid dysfunction, psoriasis, leg ulcers\nor other chronic wounds, history of fracture or joint-replacement surgery). One hundred\nand seventysix controls (~2 for each BP patient) were randomly selected from the list of\nour clinical folders, excluding patients with a diagnosis of bullous or cutaneous\nmalignant disease, and matched according to age, sex and inpatient to outpatient\nratio.\n Statistical analysis Statistical analysis was performed using the Software Package for Statistical Science\n(SPSS for Windows, version 18.0, Chicago, IL). Continuous data are presented as the\nmean value and standard deviation (SD), and categorical variables are presented as\npercentages. Patients and control subjects were compared using the Student's t-test\nfor continuous variables, while the Pearson Chi-square test was applied for\ncategorical variables. Univariate logistic regression was used to calculate the crude\nodds ratios (OR) and 95% confidence intervals (CI) for comorbid conditions in\nrelation to BP. A logistic regression model was used to measure the association\nbetween BP and neurological disorders in a multivariate analysis.\nStatistical analysis was performed using the Software Package for Statistical Science\n(SPSS for Windows, version 18.0, Chicago, IL). Continuous data are presented as the\nmean value and standard deviation (SD), and categorical variables are presented as\npercentages. Patients and control subjects were compared using the Student's t-test\nfor continuous variables, while the Pearson Chi-square test was applied for\ncategorical variables. Univariate logistic regression was used to calculate the crude\nodds ratios (OR) and 95% confidence intervals (CI) for comorbid conditions in\nrelation to BP. A logistic regression model was used to measure the association\nbetween BP and neurological disorders in a multivariate analysis.", "Statistical analysis was performed using the Software Package for Statistical Science\n(SPSS for Windows, version 18.0, Chicago, IL). Continuous data are presented as the\nmean value and standard deviation (SD), and categorical variables are presented as\npercentages. Patients and control subjects were compared using the Student's t-test\nfor continuous variables, while the Pearson Chi-square test was applied for\ncategorical variables. Univariate logistic regression was used to calculate the crude\nodds ratios (OR) and 95% confidence intervals (CI) for comorbid conditions in\nrelation to BP. A logistic regression model was used to measure the association\nbetween BP and neurological disorders in a multivariate analysis.", "The median (range) age at presentation for BP was 79.6 (SD 8.3) years. The age\ndistribution ranged from 49 to 96 years. Thirty nine (50.6%) of the patients were female\nand 38 (49.4%) were male. The age, age group and gender distributions of the cohort are\npresented in Table 1. Control patients were well\nmatched in terms of age (p=0.64), gender (p=0.51), and had the same inpatient to\noutpatient ratio (p=0.19). Controls had various cutaneous diseases\n(erysipela/cellulitis, leg ulcer, drug eruption, eczema, psoriasis and vasculitis), as\nillustrated in Graph 1.\nDemographic features of cases and controls\nDiseases of the controls\nChronic treatment with at least one drug before onset of BP was observed in 87% of\ncases, namely diuretics (48.1% of BP patients), angiotensin-converting enzyme\ninhibitors/angiotensin II receptors antagonists (40.3%) and benzodiazepines (35.1%)\n(Table 2).\nChronic medication (at least one drug in the last three months) in BP patients\nAbbreviations: NSAIDs, nonsteroidal anti-inflammatory drugs.\nUpon diagnosis, all patients had cutaneous blisters and 34 patients (44.2%) also had\nurticarial plaques. In addition, the oral mucosa of 11 patients (14.3%) were affected,\nwhile 92.2% complained of pruritus. About half of the cases involved peripheral blood\neosinophilia (50.6%) (Table 3).\nClinical characteristic of BP patients\nAbout one fifth of patients (20.8%) was successfully treated with high-potency topical\nsteroids in monotherapy. The rest also received systemic treatment, mainly oral\ncorticosteroids (57.1%). Dapsone was the second most prescribed systemic drug, alone or\nconcurrently with oral corticosteroids (Table\n4). Some patients treated with dapsone (11.4%) experienced side effects:\nhemolysis and anemia (data not shown).\nTreatment modalities\nComplications occurred in 25 patients (32.5 %), mainly infections (urinary tract\ninfection, respiratory infection and erysipela/cellulitis) and decompensation of\ndiabetes, which affected 20.8 and 14.3% of BP patients, respectively. In 3 patients, the\ninfection progressed to sepsis, with fatal outcomes for 2 of them. BP patients who\nunderwent systemic treatment were eight times more likely to have complications than\npatients who only received topical corticosteroids (p< 0.017).\nClinical remission was achieved in a mean of 42.7 days (SD 29). Twenty-two patients were\nlost to follow-up. Of the 55 BP patients who were still in follow-up, 27\n(49.1%) experienced at least one relapse. The mean interval until relapse was 4.4\nmonths. BP patients were kept in follow-up for a mean of 8.5 months (SD 11).\nTable 5 shows the univariate comparison of cases\nand controls. 44.2% of patients (34 BP) were in a bedridden condition, compared with\n13.6% (24) of the controls (OR 5.2, 95% CI 2.8-9.8). Also, BP patients had been\nhospitalized for a longer period of time compared to controls (mean 20.5 vs 13.2 days,\np<0.001).\nUnivariate comparison of cases and controls\nOdds ratios with 95% CI.\nP-value of the Pearson Chi-square test.\nEight (11%) BP patients had a prior diagnosis of malignancy, namely prostate cancer (2\npatients) and lymphoproliferative disorders (2 patients) (data not shown). No\nstatistical difference was found between cases and controls.\n\nAt least one neurological disease was present in 55.8% (43) of BP cases before the\ndiagnosis of BP compared with 20.5% (36) of controls (OR 5.36, 95% CI 2.97-9.66). BP\npatients had significantly increased odds for cerebral stroke (OR 8.10, 95% CI\n3.80-17.25), dementia (OR 5.25, 95% CI 2.71-10.16) and Parkinson's disease (OR 4.91, 95%\nCI 0.88-27.44). However, the association with Parkinson's disease became\nnon-statistically significant after correction for multiple testing (Table 6).\nMultivariate logistic regression for the association between neurological\ndisorders and BP patients\nOdds ratios were adjusted for matching variables (age, gender) and neurological\ndisorders\nNo association was found between BP and Alzheimer's disease, depression and diabetes\nmellitus. Controls were more likely than BP patients to have hypertension (2.17\nodds).", "We found an association between BP and neurological disorders (dementia and cerebral\nstroke), which remained to be independently associated with BP by multivariate analysis.\nParkinson's disease missed its association, probably due to the small number of patients\nin our cohort. Our results confirmed earlier findings of a higher prevalence of\nneurological diseases among BP patients when compared with the general population. In\nFrance, 36% of BP patients were diagnosed with at least one neurological disorder,\nnamely dementia, in 20% of BP patients.8,13\nThese associations have been widely investigated in recent years. The hypothesis of\nimmunological cross-reactivity between the neuronal isoform of BPAG1 and its epithelial\nisoform, seems to explain those associations. Neurological diseases could expose the\nneuronal isoform and trigger a subsequent immunological reaction that causes the\ncutaneous lesions. Further studies are needed to better understand the underlying\nmolecular pathways.20\nThe relationship between BP and malignancy has been under debate for many years and is\nstill controversial. Some reports have suggested an increased frequency of certain\ncarcinomas (e.g. stomach, colon, prostate, breast and lung) as well as\nlymphoproliferative disorders.12,21\n23 As BP affects predominantly the\nelderly, it was expected that there would be a higher frequency of malignancies than in\nthe general population. In 1990, Venning et al reported that the rate\nof malignant disease was higher in BP patients (17.9%) compared with matched controls\n(5.3%).21 Ogawa et\nal studied a large Japanese population of BP patients (1113 patients) and\nfound malignant disease in 5.8% of patients compared with 0.61% among\ncontrols.12 However no\nstatistical analysis was conducted to clarify these findings. In addition, other authors\nfound no link between BP and malignancy.24,25 In our control group,\nall patients whose reason for consultation or hospital admission was cutaneous\nmalignancy, were excluded., Even removing this bias, we did not find any association\nbetween malignancy and BP. We agree with some authors who recommend cancer screening\nwhen there are systemic manifestations and atypical presentations, such as onset in a\nmiddle-aged person.Also, BP patients should have regular cancer screening tests as\nrecommended for the general population.\nChuang et al reported an association between BP and diabetes, showing\n20% diabetic BP patients versus 2.5% diabetic controls (p=0.004).11 This was supported by other\nstudies.26-27 It has been proposed that an autoimmune response occurs\nafter exposure of the BP antigens, by glycation of proteins of the dermoepidermal\njunction. Like other authors, we did not find an association between BP and\ndiabetes.24 Further studies are\nneeded to clarify this issue.\nSystemic corticosteroid treatment is the most common treatment for BP\npatients.14 However, BP\ntreatment is not devoid of side effects and is often responsible for the exacerbation of\nassociated diseases in the elderly population. Thus, a careful judgment should be made\nbefore starting any treatment. In our study, BP patients under systemic treatment\nexperienced more complications compared with those treated using topical\ncorticosteroids. In this context, two fatal outcomes occurred. In a previous study,\nsepsis represented the main cause of death in BP patients.16 It is interesting to note that all patients treated with\ntopical corticosteroids, in addition to clinical remission, experienced no major\ncomplications.\nOur study has some limitations, such as the retrospective chart analysis and the\nrelatively small number of patients. Further, we could not conclude anything about BP\nincidence because a considerable number of BP patients were not submitted to\nhistological and immunofluorescence studies, and therefore were not included in this\nstudy.", "We identified an association between neurological diseases and BP in Portuguese\npatients, supporting associations found in previous studies. This association is of\ninterest due to the possible role in BP etiology. Further research is required to\nelucidate these findings." ]

[ "intro", null, "materials|methods", null, "results", "discussion", "conclusions" ]

[ "Comorbidity", "Nervous system diseases", "Neurologic manifestations", "Pemphigoid, bullous", "Portugal" ]

[ 31, 135 ]

[ "bp", "patients", "bp patients", "association", "controls", "neurological", "disorders", "analysis", "compared", "treatment" ]

[ "bullous pemphigoid bp", "antigens bpag1 bpag2", "autoimmune blistering", "pemphigoid bp common", "autoimmune blistering disease" ]

[ "Aged", "Biomarkers", "Cardiovascular System", "Case-Control Studies", "China", "Cross-Sectional Studies", "Echocardiography", "Exercise Test", "Exercise Tolerance", "Forced Expiratory Volume", "Hospitals, University", "Humans", "Lactic Acid", "Lung", "Male", "Middle Aged", "Oxygen", "Oxygen Consumption", "Predictive Value of Tests", "Pulmonary Disease, Chronic Obstructive", "Respiration", "Spirometry", "Time Factors" ]

[ "Study design", "Protocols and measurements", "Pulmonary function testing", "Maximum cardiopulmonary exercise testing", "Two-dimensional echocardiography", "Arterial blood sampling and lactate determination", "Statistical analysis", "Conclusion" ]

[ "In this cross-sectional comparative study, the patients were divided into three groups based on six variables obtained from CPET. Patients with abnormal values for all six variables were assigned to a full IPO group, those with normal values for all six variables were assigned to a non-IPO group, and the remaining patients were assigned to an intermediate IPO group. Two-dimensional echocardiography, changes (Δ) in lactate, Δ in oxygen uptake \n(V˙O2), a parameter of cardiovascular function,9 and arterial pH values were compared across the groups. Arterial pH values should be lower in patients with cardiovascular dysfunction than in those without cardiovascular dysfunction performing at the same exercise intensity or cardiovascular stress level. A comparison of respiratory dynamics was performed across the groups. The institutional review board of Chung Shan Medical University Hospital approved the study (approval number CS11144) and all participants provided their written informed consent. This trial is registered with the number CSH-2012-C-23 at Chung Shan Medical University Hospital, Taichung, Taiwan.", " Pulmonary function testing FEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\nFEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\n Maximum cardiopulmonary exercise testing After acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\nAfter acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\n Two-dimensional echocardiography Two-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\nTwo-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\n Arterial blood sampling and lactate determination Brachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.\nBrachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.", "FEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.", "After acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)", "Two-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21", "Brachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.", "The data are shown as the mean ± standard deviation or median (interquartile range). Analysis of variance was initially considered for comparing the means across the groups; however, there were no patients in the non-IPO group. Therefore, only two groups were established. Thus, the unpaired-t-test or Mann–Whitney U-test was used to compare the means between the two independent groups. Fisher’s Exact test for contingency tables was used to compare the stages of COPD between the two groups. A P<0.05 was considered to be statistically significant, and P<0.1 but P>0.05 was considered to have a trend to be significant.24 All statistical procedures were performed using SAS software package version 9.3 (SAS Institute Inc, Cary, NC, USA).", "Although the six variables used herein are related to IPO or circulatory function, they are inconsistent with the findings of two-dimensional echocardiography and \nΔlactate/ΔV˙O2 in patients with COPD. Further analysis shows that the mechanisms of exercise intolerance in COPD-IPO patients are primarily due to derangements in airflow and/or dead space ventilation. Given the strength of our findings, this study might help with the interpretation of CPET reports for COPD patients." ]

[ "methods", null, null, null, null, null, "methods", null ]

[ "Introduction", "Materials and methods", "Study design", "Subjects", "Protocols and measurements", "Pulmonary function testing", "Maximum cardiopulmonary exercise testing", "Two-dimensional echocardiography", "Arterial blood sampling and lactate determination", "Statistical analysis", "Results", "Discussion", "Study limitations", "Conclusion" ]

[ "Impaired peripheral oxygenation (IPO) of exercising muscles is caused by impaired circulation and/or mitochondrial function and a low arterial oxygen content, such that oxygen cannot flow adequately to myocytes.1 The mechanisms of IPO are quite different from those of hypoxemia, mostly due to respiratory pathology. IPO can seriously limit patients’ ability to perform certain activities of daily living, and the impact of related symptoms can be quite significant.2\nClinicians tend to screen for the causes of exertional dyspnea using non-invasive cardiopulmonary exercise testing (CPET).1,3–5 IPO-related variables obtained from CPET include peak oxygen uptake \n(V˙O2)<85% predicted, anaerobic threshold \n<40%V˙O2max predicted, \nV˙O2-work rate slope <8.6 mL/watt, oxygen pulse <80% predicted, and ventilatory equivalents for O2 and CO2 at nadirs of >31 and >34, respectively.1\nThese six individual IPO variables represented cardiovascular parameters, but are reported to be non-specific in discriminating chronic obstructive pulmonary disease (COPD) with and without chronic circulatory changes6–8 using invasive pulmonary artery catheterization.7,8 However, at present, it is not clear how we can effectively interpret the algorithm since some of the six variables may be normal while others are abnormal. We hypothesized that patients with all six variables found to be abnormal would have worse cardiovascular function than those with none or some having abnormal values. Our approach in this study was oriented toward interpretation of the CPET report, and we found that this approach may be more useful when evaluating IPO-related variables with regard to their clinical implications.", " Study design In this cross-sectional comparative study, the patients were divided into three groups based on six variables obtained from CPET. Patients with abnormal values for all six variables were assigned to a full IPO group, those with normal values for all six variables were assigned to a non-IPO group, and the remaining patients were assigned to an intermediate IPO group. Two-dimensional echocardiography, changes (Δ) in lactate, Δ in oxygen uptake \n(V˙O2), a parameter of cardiovascular function,9 and arterial pH values were compared across the groups. Arterial pH values should be lower in patients with cardiovascular dysfunction than in those without cardiovascular dysfunction performing at the same exercise intensity or cardiovascular stress level. A comparison of respiratory dynamics was performed across the groups. The institutional review board of Chung Shan Medical University Hospital approved the study (approval number CS11144) and all participants provided their written informed consent. This trial is registered with the number CSH-2012-C-23 at Chung Shan Medical University Hospital, Taichung, Taiwan.\nIn this cross-sectional comparative study, the patients were divided into three groups based on six variables obtained from CPET. Patients with abnormal values for all six variables were assigned to a full IPO group, those with normal values for all six variables were assigned to a non-IPO group, and the remaining patients were assigned to an intermediate IPO group. Two-dimensional echocardiography, changes (Δ) in lactate, Δ in oxygen uptake \n(V˙O2), a parameter of cardiovascular function,9 and arterial pH values were compared across the groups. Arterial pH values should be lower in patients with cardiovascular dysfunction than in those without cardiovascular dysfunction performing at the same exercise intensity or cardiovascular stress level. A comparison of respiratory dynamics was performed across the groups. The institutional review board of Chung Shan Medical University Hospital approved the study (approval number CS11144) and all participants provided their written informed consent. This trial is registered with the number CSH-2012-C-23 at Chung Shan Medical University Hospital, Taichung, Taiwan.\n Subjects Global Initiative for Chronic Obstructive Lung Disease criteria were used to diagnose COPD.10 Adult patients with COPD who underwent lung function tests were enrolled only if their forced expired volume in one second (FEV1) was <80% of the predicted value and their FEV1/forced vital capacity ratio was <70%. If they agreed, they performed symptom-limited incremental CPET with arterial blood gas analysis and lactate measurements. All patients were clinically stable and had had no significant changes in medication in the month prior to performing the tests. Patients were excluded if they had significant comorbidities, such as left ventricular failure, renal failure, cancer, significant anemia, peripheral arterial occlusive disease, uncontrolled diabetes mellitus, or hypertension, or if they were participating in any physical training program during the study period.\nGlobal Initiative for Chronic Obstructive Lung Disease criteria were used to diagnose COPD.10 Adult patients with COPD who underwent lung function tests were enrolled only if their forced expired volume in one second (FEV1) was <80% of the predicted value and their FEV1/forced vital capacity ratio was <70%. If they agreed, they performed symptom-limited incremental CPET with arterial blood gas analysis and lactate measurements. All patients were clinically stable and had had no significant changes in medication in the month prior to performing the tests. Patients were excluded if they had significant comorbidities, such as left ventricular failure, renal failure, cancer, significant anemia, peripheral arterial occlusive disease, uncontrolled diabetes mellitus, or hypertension, or if they were participating in any physical training program during the study period.\n Protocols and measurements Pulmonary function testing FEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\nFEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\n Maximum cardiopulmonary exercise testing After acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\nAfter acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\n Two-dimensional echocardiography Two-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\nTwo-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\n Arterial blood sampling and lactate determination Brachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.\nBrachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.\n Pulmonary function testing FEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\nFEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\n Maximum cardiopulmonary exercise testing After acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\nAfter acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\n Two-dimensional echocardiography Two-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\nTwo-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\n Arterial blood sampling and lactate determination Brachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.\nBrachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.\n Statistical analysis The data are shown as the mean ± standard deviation or median (interquartile range). Analysis of variance was initially considered for comparing the means across the groups; however, there were no patients in the non-IPO group. Therefore, only two groups were established. Thus, the unpaired-t-test or Mann–Whitney U-test was used to compare the means between the two independent groups. Fisher’s Exact test for contingency tables was used to compare the stages of COPD between the two groups. A P<0.05 was considered to be statistically significant, and P<0.1 but P>0.05 was considered to have a trend to be significant.24 All statistical procedures were performed using SAS software package version 9.3 (SAS Institute Inc, Cary, NC, USA).\nThe data are shown as the mean ± standard deviation or median (interquartile range). Analysis of variance was initially considered for comparing the means across the groups; however, there were no patients in the non-IPO group. Therefore, only two groups were established. Thus, the unpaired-t-test or Mann–Whitney U-test was used to compare the means between the two independent groups. Fisher’s Exact test for contingency tables was used to compare the stages of COPD between the two groups. A P<0.05 was considered to be statistically significant, and P<0.1 but P>0.05 was considered to have a trend to be significant.24 All statistical procedures were performed using SAS software package version 9.3 (SAS Institute Inc, Cary, NC, USA).", "In this cross-sectional comparative study, the patients were divided into three groups based on six variables obtained from CPET. Patients with abnormal values for all six variables were assigned to a full IPO group, those with normal values for all six variables were assigned to a non-IPO group, and the remaining patients were assigned to an intermediate IPO group. Two-dimensional echocardiography, changes (Δ) in lactate, Δ in oxygen uptake \n(V˙O2), a parameter of cardiovascular function,9 and arterial pH values were compared across the groups. Arterial pH values should be lower in patients with cardiovascular dysfunction than in those without cardiovascular dysfunction performing at the same exercise intensity or cardiovascular stress level. A comparison of respiratory dynamics was performed across the groups. The institutional review board of Chung Shan Medical University Hospital approved the study (approval number CS11144) and all participants provided their written informed consent. This trial is registered with the number CSH-2012-C-23 at Chung Shan Medical University Hospital, Taichung, Taiwan.", "Global Initiative for Chronic Obstructive Lung Disease criteria were used to diagnose COPD.10 Adult patients with COPD who underwent lung function tests were enrolled only if their forced expired volume in one second (FEV1) was <80% of the predicted value and their FEV1/forced vital capacity ratio was <70%. If they agreed, they performed symptom-limited incremental CPET with arterial blood gas analysis and lactate measurements. All patients were clinically stable and had had no significant changes in medication in the month prior to performing the tests. Patients were excluded if they had significant comorbidities, such as left ventricular failure, renal failure, cancer, significant anemia, peripheral arterial occlusive disease, uncontrolled diabetes mellitus, or hypertension, or if they were participating in any physical training program during the study period.", " Pulmonary function testing FEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\nFEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.\n Maximum cardiopulmonary exercise testing After acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\nAfter acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)\n Two-dimensional echocardiography Two-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\nTwo-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21\n Arterial blood sampling and lactate determination Brachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.\nBrachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.", "FEV1, total lung capacity, and residual volume were measured by spirometry and plethysmography (6200 Autobox DL, Yorba Linda, CA, USA, or MasterScreen™ Body, Carefusion, Würzburg, Germany) at body temperature, ambient atmospheric pressure, and fully saturated, using the best of three technically satisfactory readings.11–13 The diffusing capacity for carbon monoxide (DLCO) was measured by the single-breath technique. Direct maximum voluntary ventilation (MVV) was calculated from a 12-second maneuver of rapid and deep breathing as recommended for patients with COPD.14 All lung function data were obtained after inhaling 400 μg of fenoterol HCl.", "After acclimating to a computer-controlled and electronic-brake cycle ergometer (Medical Graphics, St Paul, MN, USA) and following a 2-minute rest period, each patient began a 2-minute period of unloaded cycling followed by a ramp-pattern exercise test to the limit of tolerance. Work rate was selected at a slope of 5–20 watts per minute based on a derived protocol formula.15 Twelve-lead electrocardiography, \nV˙O2(mL/min), \nV˙CO2(mL/min), minute ventilation, pulse rate, and oxyhemoglobin saturation were continuously measured. Blood pressure was recorded at the end of each minute and at the point where the patient reported having reached peak exercise. A dyspnea score was obtained using the Borg scale by asking the patients about their dyspnea levels while they were performing the ramp-pattern exercise at the end of each minute and at peak exercise. Please refer to Chuang and Lin16 for the anaerobic threshold, oxyhemoglobin saturation, calibrations of the pneumotachograph and O2 and CO2 analyzers, and \nV˙O2peak prediction equations.\nThe \nV˙O2peak achieved by patients was the highest recorded value averaged over the last 15 seconds of loaded exercise and designated as \nV˙O2peak or \nV˙O2max.15\nMaximum exercise effort achieved was a prerequisite for final analysis.4,5,17 Each criterion at peak exercise, such as respiratory exchange ratio ≥1.09, heart rate ≥85% of predicted maximum, pH ≤7.35, bicarbonate (HCO3−) concentration ≤21 mEq/L, change in HCO3− concentration between rest and peak exercise ≥4 mEq/L, and change in lactate concentration between rest and peak exercise ≥4 mEq/L represented one point. The maximum effort level was scored from 1 to 6 points. The accumulated points, representing the effort level of exercise, were compared across the groups.\nExercise intensity or cardiovascular stress level was defined as follows:\nExercise intensity or cardiovascular stress level=Heart ratte at peak exerciseHeart rate predicted maximum(1)where heart rate predicted maximum =220 – age.\nVentilatory limitation was defined as either <30% or <11–15 L/min breathing reserve, calculated as follows:1,4\nBreathing reserve=1−V˙Epeak/direct MVV(2)where \nV˙Epeak/direct MVV indicates \nV˙E demand/capacity ratio.\nMean inspiratory tidal flow rate=Tidal volume (VT)(L)Inspiratory time (seconds)18(3)\nRapid shallow breathing index=Breathing frequency (breath/min)VT(L)19(4)", "Two-dimensional echocardiography (iE33, Philips, Seattle, WA, USA) was performed within 4 weeks before or after CPET by two experienced cardiologists who were blinded to the clinical data, lung function, and CPET reports. If there were acute exacerbations of COPD in the time between the two tests, one of the tests would be postponed. Parasternal, apical, and subcostal studies were conducted, and the definition of cor pulmonale was used according to previous reports.20,21", "Brachial artery blood samples were drawn via an arterial catheter connected to a pressure transducer within the last 15 seconds of each minute after the start of exercise to the peak of exercise.22 Whole blood lactate was also analyzed (YSI Inc, Yellow Springs, OH, USA).\nAt the peak of exercise, the dead space to tidal volume ratio (VD/VT) was calculated using a standard formula.23\nThe slopes of lactate as a function of \nV˙O2 calculated using linear regression \n(Δlactate/ΔV˙O2) were compared across the groups.", "The data are shown as the mean ± standard deviation or median (interquartile range). Analysis of variance was initially considered for comparing the means across the groups; however, there were no patients in the non-IPO group. Therefore, only two groups were established. Thus, the unpaired-t-test or Mann–Whitney U-test was used to compare the means between the two independent groups. Fisher’s Exact test for contingency tables was used to compare the stages of COPD between the two groups. A P<0.05 was considered to be statistically significant, and P<0.1 but P>0.05 was considered to have a trend to be significant.24 All statistical procedures were performed using SAS software package version 9.3 (SAS Institute Inc, Cary, NC, USA).", "Fifty-eight consecutive male patients of mean age 64.6±6.1 years were enrolled in the study. After excluding one patient who did not reach the maximum exercise level when performing CPET, 14 patients were assigned to the IPO group, no patients were assigned to the non-IPO group, and the other 43 patients were assigned to the intermediate IPO group (Table 1). For the sake of simplicity, the latter two groups were deemed to be non-IPO groups. Table 2 presents the distribution of the six variables regarding the abnormal values for the non-IPO groups. The IPO and non-IPO groups had similar stages of COPD severity. The IPO group had more hyperinflated lungs and lower DLCO (P=0.05 to P<0.01; Table 1). Both groups performed at a similar level of maximum exercise effort.\nNo patient experienced an acute exacerbation in the time interval between echocardiography and CPET. Table 3 shows that the two-dimensional echocardiographic findings, including left ventricular ejection fraction and right ventricular morphology, were similar between the two groups (all P>0.05).\nThe heart rate percentage predicted maximum at peak exercise was similar between the two groups (IPO group: 77%±14% versus non-IPO group: 82%±10%, P=0.26). pH levels were higher at anaerobic threshold and peak exercise in the IPO group (P=0.007 and P=0.0007, respectively), with a smaller decrease in HCO3− concentration and increase in lactate concentration (3.6±0.5 mmol/L versus 5.7±0.3 mmol/L, P=0.02, and 1.4±1.8 mmol/L versus 2.9±1.8 mmol/L, P=0.003, respectively). The slopes of \nΔlactate/ΔV˙O2 were similar between the two groups (2.4 [error 0.15] versus 2.3 [error 0.1] mmol/L, not statistically significant).\nThe IPO group had a rapid increase in \nV˙E but slower expansion of tidal volume in response to exercise (Figure 1A and D, both P<0.05). The IPO group had a significantly lower \nV˙E demand/capacity ratio (P<0.05) with slower inspiratory tidal flow and lower VT/total lung capacity expansion at both anaerobic threshold and peak exercise (Figure 1B, C, and E, P<0.01 and P<0.05, and both P≤0.001, respectively) and higher VD/VT, rapid shallow breathing index, and \nBorg/V˙O2 in the IPO group at peak exercise (Figure 1F–H, P<0.001, P<0.05, and P<0.01, respectively).", "In this study, COPD patients with full IPO and those with non-IPO had similarly impaired forced vital capacity, FEV1, and COPD severity (Table 1). Both groups had different exercise capacity with very different cardiovascular exercise variables (Table 1), but were similar in terms of cardiovascular function measured by two-dimensional echocardiography and \nΔlactate/ΔV˙O2 (Table 3). These findings suggest that cardiovascular variables on CPET cannot predict cardiac function morphologically. We therefore further differentiated the mechanism of full IPO and non-IPO during exercise. We found that patients with IPO had much poorer airflow and lung expansion and a greater perception of breathlessness (Figure 1).\nLeft ventricular performance has been reported not to be impaired in COPD patients.25 A previous study reported that there were no differences in oxygen uptake, work rate, oxygen pulse, and heart rate at peak exercise between patients with and without pulmonary arterial hypertension.8 The authors concluded that ventilatory limitation itself was the primary factor causing exercise intolerance in COPD patients. Circulatory impairment is not usually a limiting factor for exercise intolerance in patients with COPD unless complications of severe pulmonary hypertension are involved.26 The cardiovascular response to exercise was constrained, but not impaired, by dynamic hyperinflation or intrathoracic pressure swings limiting ventilation in COPD patients.27–29 A study using multiple regression analysis showed that ventilatory inefficiency was not caused by oxygen uptake, work rate, oxygen pulse, or circulatory power at peak exercise, but was related to expiratory flow limitations and dynamic hyperinflation,30 which is consistent with other reports.31,32 Although all of the variables found in previous reports were comprehensive, they cannot be directly used when interpreting a CPET report. Our approach to the present study was oriented toward interpretation of the CPET.\nWe did not use pulmonary arterial hypertension as a study criterion because of the invasiveness of pulmonary arterial catheterization. Instead, we attempted to use the six non-invasive variables relating to circulatory function to categorize our COPD patients. We found that the circulatory function of the IPO patients was similar to that of the non-IPO patients according to a two-dimensional echocardiography study and by utilizing the slope of \nΔlactate/ΔV˙O2, which is a marker of cardiovascular impairment.30 In addition, relatively low changes in HCO3− and lactate concentrations and higher pH levels at peak exercise in the IPO group did not support cardiovascular limitations as being the primary factor of exercise limitation.\nResting FEV1, DLCO, peak inspiratory pressure, and exertional maximum \nV˙E play a pivotal role in exercise intolerance in patients with COPD.33,34 In the present study, the IPO group showed a lower \nV˙E demand/capacity, probably due to the slower inspiratory tidal flow not able to adequately increase \nV˙E further in response to exercise, thereby reaching the ventilatory limit at an earlier stage. The slower inspiratory tidal flow and poorer tidal volume expansion might be due to higher tension of the diaphragm caused by increased VD/VT when approaching peak exercise (Figure 2). This notion is supported by studies in lung volume reduction surgery and bronchodilator use showing decreases in VD/VT resulting in airflow improvement.31,32 Increased VD/VT contributes to dynamic hyperinflation,35 thereby resulting in more rapid shallow breathing and a greater perception of dyspnea (Figure 1G and H). In the present study, a strong statistical power of 0.98 for VD/VT was estimated, given 14 subjects with a mean VD/VT of 0.51±0.09 in the IPO group and of 0.4±0.09 in the non-IPO group, and the probability of type I error of 0.05.\n Study limitations There are a number of limitations in this study that are worthy of note. First, our COPD cohort was comprised exclusively of males, and as such the results cannot be extrapolated to females. However, it should be noted that the incidence of COPD is relatively low in Taiwanese females. Second, IPO includes impairment of cardiac, hemoglobin, and/or peripheral vascular function, and as a result, IPO cannot be fully evaluated by two-dimensional echocardiography. Further study of the peripheral circulation using near-infrared spectroscopy during exercise might be helpful.36 Moreover, cardiac function at rest as evaluated by two-dimensional echocardiography may not represent cardiac function during exercise. However, performing an echocardiographic examination while the subject is exercising is technically difficult. Stress echocardiography using pharmacological agents is feasible; however, cardiac performance using this modality is different from that seen during exercise. Third, the patient grouping in this study is not precise, given that some patients in the non-IPO group had abnormal values in some of the variables relevant to IPO. Since none of our 57 patients had all six variables in the normal range, 1,000 patients or more would be required to identify 20 with normal values in all six variables. Fourth, one may argue that using \nV˙E/V˙CO2 alone instead of the six IPO-related variables might draw similar conclusions to the study. However, this is another issue, and \nV˙E/V˙CO2 alone cannot represent IPO. Finally, this study did not evaluate intrapulmonary shunt during exercise, although this may not be an issue given that there was no difference in partial pressure of arterial oxygen at peak exercise between the two groups (IPO 68.6±13.1 mmHg versus non-IPO group 71±15.1 mmHg, not statistically significant).37\nThere are a number of limitations in this study that are worthy of note. First, our COPD cohort was comprised exclusively of males, and as such the results cannot be extrapolated to females. However, it should be noted that the incidence of COPD is relatively low in Taiwanese females. Second, IPO includes impairment of cardiac, hemoglobin, and/or peripheral vascular function, and as a result, IPO cannot be fully evaluated by two-dimensional echocardiography. Further study of the peripheral circulation using near-infrared spectroscopy during exercise might be helpful.36 Moreover, cardiac function at rest as evaluated by two-dimensional echocardiography may not represent cardiac function during exercise. However, performing an echocardiographic examination while the subject is exercising is technically difficult. Stress echocardiography using pharmacological agents is feasible; however, cardiac performance using this modality is different from that seen during exercise. Third, the patient grouping in this study is not precise, given that some patients in the non-IPO group had abnormal values in some of the variables relevant to IPO. Since none of our 57 patients had all six variables in the normal range, 1,000 patients or more would be required to identify 20 with normal values in all six variables. Fourth, one may argue that using \nV˙E/V˙CO2 alone instead of the six IPO-related variables might draw similar conclusions to the study. However, this is another issue, and \nV˙E/V˙CO2 alone cannot represent IPO. Finally, this study did not evaluate intrapulmonary shunt during exercise, although this may not be an issue given that there was no difference in partial pressure of arterial oxygen at peak exercise between the two groups (IPO 68.6±13.1 mmHg versus non-IPO group 71±15.1 mmHg, not statistically significant).37", "There are a number of limitations in this study that are worthy of note. First, our COPD cohort was comprised exclusively of males, and as such the results cannot be extrapolated to females. However, it should be noted that the incidence of COPD is relatively low in Taiwanese females. Second, IPO includes impairment of cardiac, hemoglobin, and/or peripheral vascular function, and as a result, IPO cannot be fully evaluated by two-dimensional echocardiography. Further study of the peripheral circulation using near-infrared spectroscopy during exercise might be helpful.36 Moreover, cardiac function at rest as evaluated by two-dimensional echocardiography may not represent cardiac function during exercise. However, performing an echocardiographic examination while the subject is exercising is technically difficult. Stress echocardiography using pharmacological agents is feasible; however, cardiac performance using this modality is different from that seen during exercise. Third, the patient grouping in this study is not precise, given that some patients in the non-IPO group had abnormal values in some of the variables relevant to IPO. Since none of our 57 patients had all six variables in the normal range, 1,000 patients or more would be required to identify 20 with normal values in all six variables. Fourth, one may argue that using \nV˙E/V˙CO2 alone instead of the six IPO-related variables might draw similar conclusions to the study. However, this is another issue, and \nV˙E/V˙CO2 alone cannot represent IPO. Finally, this study did not evaluate intrapulmonary shunt during exercise, although this may not be an issue given that there was no difference in partial pressure of arterial oxygen at peak exercise between the two groups (IPO 68.6±13.1 mmHg versus non-IPO group 71±15.1 mmHg, not statistically significant).37", "Although the six variables used herein are related to IPO or circulatory function, they are inconsistent with the findings of two-dimensional echocardiography and \nΔlactate/ΔV˙O2 in patients with COPD. Further analysis shows that the mechanisms of exercise intolerance in COPD-IPO patients are primarily due to derangements in airflow and/or dead space ventilation. Given the strength of our findings, this study might help with the interpretation of CPET reports for COPD patients." ]

[ "intro", "materials|methods", "methods", "subjects", null, null, null, null, null, "methods", "results", "discussion", "methods", null ]

[ "dead space ventilation", "dynamic hyperinflation", "air-trapping", "inspiratory tidal flow rate", "lung function", "cardiovascular function", "oxygen pulse" ]

[ 191, 1569, 116, 463, 88, 103, 144, 82 ]

[ "exercise", "patients", "peak", "ipo", "peak exercise", "maximum", "minute", "groups", "function", "rate" ]

[ "cardiopulmonary exercise testing", "oxygenation ipo exercising", "exercise patients pulmonary", "impaired peripheral oxygenation", "exercise dyspnea score" ]

[ "Animals", "Anopheles", "Benin", "DDT", "DNA, Complementary", "Gene Expression Regulation", "Genotype", "Insecticide Resistance", "Insecticides", "Mutation", "RNA", "RNA, Messenger" ]

[ "Background", "Mosquito sampling", "Insecticide susceptibility tests", "Species identification and kdrgenotyping", "mRNA expression of candidate metabolic genes", "RNA extraction and cDNA synthesis", "Reverse-transcription quantitative PCR (RT-qPCR)", "Data analysis", "DDT resistance", "Differential expression of metabolic genes in An. gambiae", "Target-site mutations in An. gambiaein Benin" ]

[ "The development of insecticide resistance in anopheles mosquitoes is a major threat for malaria vector control. In Anopheles gambiae mosquitoes, the main malaria vector in Africa, two main mechanisms of resistance have been widely studied: target site modifications and insecticide detoxification known as metabolic resistance [1].\nFor the former, two alternative substitutions occur at position 1014 in the voltage gated sodium channel (VGSC) of An. gambiae: leucine to phenylalanine (L1014F) and leucine to serine (L1014S). The distribution of these two alleles is currently expanding in the M and S molecular forms of An. gambiae as well as in An. arabiensis\n[2]. Furthermore, the frequency of these alleles is rising in many areas of Africa associated with selective sweeps [3]. These mutations are associated with cross resistance to DDT and pyrethroids [4]. Clear association between DDT or pyrethroids resistance and the presence of kdr mutations has been shown in several studies [5]. Recently, the emergence of a new mutation N1575Y, within the linker between domains III-IV of the VGSC was found in An. gambiae. N1575Y occurs inextricably with L1014F on the same haplotypic background and evidence suggests that a secondary selective sweep associated with resistance to pyrethroids/DDT is occurring throughout West Africa [6].\nMetabolic resistance results from increased detoxification processes by gene amplification and/or expression [1, 7–9]. The over-expression of P450 monooxygenases has been described from several pyrethroid-resistant populations of An. gambiae\n[8, 10–13] and An. arabiensis\n[14]\n. In this enzyme family, CYP6M2 is a promising genetic marker for pyrethroid/DDT resistance as it has been demonstrated to metabolize both insecticide classes [15]. A second family of metabolic enzymes, glutathione-S-transferases (GSTs), is thought to play a significant role in DDT and pyrethroid resistance in An. gambiae\n[8, 16].\nWhile the epidemiological consequences of pyrethroids resistance have yet to be established, the rapid evolution of insecticide resistant alleles over the past decade is a real cause for concern for vector control [17]. Monitoring these markers of pyrethroids resistance has significant advantages for insecticide resistance management. In Benin, entomological surveys carried out since 2007 have implicated the involvement of GSTs, P450s and esterases in insecticide resistance in Anopheles mosquitoes [8, 18]. The kdr mutations coupled with metabolic resistance was reported in several An. gambiae populations with variation described between species, sites and collection periods [8]. This situation is worrying since it can seriously threaten the efficiency of insecticide treated nets and insecticide residual spray as recently reported in Benin [19–21]. A better understanding of the genetic and evolutionary processes involved in insecticide resistance is essential to design insecticide resistance management strategies. In this study, we investigated the distribution of the kdr alleles and the gene expression of four candidate metabolisers of pyrethroids/DDT (CYP6M2, CYP6P3, GSTD3 and GSTE2) in An. gambiae throughout Benin.", "From December 2010 to December 2011, larvae of An. gambiae mosquitoes were collected in four different sites in Benin (Cotonou, Tori-Bossito, Bohicon and Malanville) in the framework of the WHO/TDR network project [18]. All larvae were brought back to laboratory of the Centre de Recherche Entomologique de Cotonou (CREC) for rearing. Emerging adult female mosquitoes (F0) were used for insecticide susceptibility tests and molecular assays.\nThe IRD (Institut de Recherche pour le Développement) Ethics Committee and the National Research Ethics Committee of Benin approved the study (CNPERS, reference number IRB00006860).", "Insecticide susceptibility tests were carried out on 2–5 days old female mosquitoes [22]. Samples collected in Cotonou and Malanville in December 2010 were exposed to DDT 4% for 1 hour and survivors of 48 hours after DDT exposure were stored in RNA later (SIGMA). In December 2011, WHO cylinder kits were used to expose mosquitoes (from Cotonou, Tori-Bossito and Bohicon) to increasing exposure times with the intention of generating time-response curves. Batches of 20–25 mosquitoes were exposed to test papers impregnated with DDT 4% at the following exposure times; 30 min, 45 min, 60 min, 90 min, 120 min, 150 min, 240 min and 300 min. Non-impregnated control papers were used throughout all experiments. Survivors and non-exposed mosquitoes were also stored in RNA later (SIGMA) and kept at −20°C for DNA and RNA analysis.", "DNA was extracted from control and alive mosquitoes following insecticide exposure using the LIVAK buffer method [23]. Specimens were identified to species and molecular form by the SINE-PCR protocol [2]. L1014F, L1014S and N1575Y were screened using TaqMan assays as previously described [6, 24]. Forward and reverse primers and three minor groove binding (MGB) probes (Applied Biosystems) were designed using the Primer Express™ Software Version 2.0. Primers kdr-Forward (5' CATTTTTCTTGGCCACTGTAGTGAT-3'), and kdr-Reverse (5'-CGATCTTGGTCCATGTTAATTTGCA-3') were standard oligonucleotides with no modification. The probe WT (5'-CTTACGACTAAATTTC-3') was labelled with VIC at the 5' end for the detection of the wild type allele, the probes kdrW (5'-ACGACAAAATTTC-3') and kdrE (5'-ACGACTGAATTTC- 3') were labelled with 6-FAM for detection of the kdr-w and kdr-e alleles respectively. For the N1575Y, the primers F3’TGGATCGCTAGAAATGTTCATGACA-5’ R3’CGAGGAATTGCCTTTAGAGGTTTCT-5’were used [6].", " RNA extraction and cDNA synthesis Mosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.\nMosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.", "Mosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.", "The relative gene expression of CYP6M2, CYP6P3, GSTD3 and GSTE2 was analyzed by quantitative PCR (qPCR). Actin-5C (AGAP000651) and ribosomal protein S7 (AGAP010592) were used as endogenous control genes to account for any differences in template input. Three biological replicates were run for each sample on a plate. A TaqMan gene expression assay was used for GSTE2 whereas SYBR Green was used for CYP6M2, CYP6P3 and GSTD3. Primers for qPCR were designed using NCBI primer BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) by using Xm codes from Vector Base. The Table 1 shows the primers used for qPCR.Table 1\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\nPrimersPrimer sequencesReferencesCYP6P3F: 5’-GTGATTGACGAAACCCTTCGGAAGT-3’[25]R: 5’-GCACCAGTGTTCGCTTCGGGA-3’CYP6M2F: 5’-TACGATGACAACAAGGGCAAG- 3’R: 5’- GCGATCGTGGAAGTACTGG-3’GSTD3F: 5’-CTAAGCTTAATCCGCAACATACCA-3R: 5’-GTGTCATCCTTGCCGTACAC-3’GSTE2F: 5’-GCCGGAATTTGTGAAGCTAAACCCG-3’R: 5’-TGCTTGACGGGGTCTTTCGGAT-3’S7F: 5’- AGAACCAGCAGACCACCATC-3’[14]R: 5’- GCTGCAAACTTCGGCTATTC-3’ActinF: 5’-ACATCGCCGAAGATCGCCCA-3’R: 5’-AGAGGGATTAAGTTGCAGCACTCG-3’\n\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\n\nThe expression of CYP6M2 and GSTE2 was determined in non-exposed (control batches) and exposed (DDT 300 minutes) mosquitoes. The Kisumu strain (susceptible; S-form) and N’Gousso (susceptible; M-form) were used as reference laboratory strains and not selected with insecticide. Real-time PCR reactions were run on the Agilent MxP3005P (Agilent Technologies). For each target gene, standard curves were generated using a five times serially diluted cDNA samples to assess the PCR efficiency and the dynamic range of cDNA. The PCR efficiencies of each gene fell ±10% of 100% and all had single melting curve peaks indicating specificity of the assay. The cDNA were diluted 5-fold in as this was the concentration that fitted within the dynamic range of each qPCR and stored at −20°C.", "The mortality rates were classified in accordance with the recommended criteria by WHO [22]. The resistance status was determined based on the following criteria:\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\nMortality 80 – 97%: suspected resistance in the Anopheles population.\nMortality < 80%: resistant Anopheles population\nOur hypothesis according to previous findings with the metabolic candidate genes was that gene expression is higher in resistant-field mosquitoes than the laboratory susceptible strain. Therefore, the relative expression (linear fold-changes) of CYP6M2, CYP6P3, GSTD3 and GSTE2 were calculated according to the ΔΔCt method described by Schmittgen, and Livak [26] using laboratory strains as calibrator samples. Strains were only compared belonging to the same molecular form (e.g. Cotonou/Malanville versus N’gousso (M-form) and Tori-Bossito/Bohicon versus Kisumu (S-form). PCR efficiencies were incorporated into the calculations. Basic data analysis (regression and t-tests were performed in Excel with p < 0.05 used to assess significant difference between treatments for the t-tests).", "In 2010, bioassays showed strong resistance to DDT in An. gambiae in two parts of the country (1% and 6% mortalities in Malanville and Cotonou respectively) [18]. In 2011, we observed no mortality in mosquitoes exposed to 4% DDT regardless of the exposure time (from 30 to 300 minutes), indicating that all mosquito populations were strongly resistant to this insecticide.", "The pre-dominant molecular form in Cotonou (M-form), Malanville (M-form), Bohicon (S-form) and Tori-Bossito (S-form) was exclusively used for qPCR analysis to avoid any bias in expression from mixed molecular forms.\nTwo experiments were performed to analyse the gene expression of metabolic candidates between the different strains from Benin. In the first experiment, M-form mosquitoes from Malanville and Cotonou collected in 2010 were exposed to DDT for one hour and the gene expression of GSTE2, GSTD3, CYP6P3 and CYP6M2 compared to the laboratory strain N’Gousso. All genes were up-regulated in DDT-exposed mosquitoes from Cotonou (between 2.8 and 3.8-fold (2-ΔΔCt)) (p < 0.05) whereas only CYP6P3 (2.4-fold) (p = 0.026) and GSTD3 (2.5-fold) (p = 0.020) were over-expressed in Malanville (Figure 1).Figure 1\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\n\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\nIn the second experiment, the gene expression of GSTE2 and CYP6M2 was compared between collections from three sites in 2011. Expression of each gene was compared between (i) mosquitoes exposed to DDT (ii) non-exposed resistant mosquitoes and (iii) laboratory susceptible strains. There were notable differences in expression between the wild mosquitoes and the laboratory strains (Figure 2). In M-form mosquitoes from Cotonou GSTE2 and CYP6M2 were up-regulated to 4.37 (p = 0.0013) and 2.23-fold (p = 0.037) compared to N’Gousso. In contrast, these genes did not show over-expression in the S-form in Tori-Bossito and Bohicon compared to Kisumu (p > 0.05). No significant differences in GSTE2 and CYP6M2 expression between DDT-exposed and non-exposed mosquitoes observed in any populations (p > 0.05).Figure 2\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.\n\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.", "The N1575Y and L1014F mutations were identified in both non-exposed M- and S- form of An. gambiae in Benin. The L1014F kdr allelic frequency was almost fixed in the S form (0.932-1.00), which predominates in the south of the country. The frequency of L1014F ranged between 0.67 and 0.91 in the M-forms in the south (Cotonou, Tori Bossito and Bohicon) and was 0.81 (0.691-0.891) in the north (Malanville).\nIn 2010, we found the 1575Y allele in both molecular forms of An. gambiae. In the M-form, the frequency of this allele was much higher in the northern site Malanville; 0.321 (95% CI 0.214-0.452) than in the southern site of Cotonou 0.019 (95% CI 0.003-0.098) (p = 0.00). In 2011 we did not detect the 1575Y allele in Cotonou whereas the frequencies of 1575Y were 0.291 (95% CI 0.223-0.368) in Bohicon and 0.36 (95% CI 0.267-0.466) in Tori Bossito (see Table 2). There was no significant difference in the 1575Y frequency between years (p = 0.071).Table 2\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\nM-form2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.10 (0.048-0.208)0.90 (0.792-0.952)580.98 (0.902-0.997)0.02 (0.003-0.098)54Malanville0.19 (0.109-0.309)0.81 (0.691-0.891)580.68 (0.548-0.786)0.32 (0.21-0.45)56Tori Bossito0.33 (0.138-0.609)0.67 (0.391-0.862)121012Bohicon0.12 (0.022-0.471)0.88 (0.529-0.978)81082011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.09 (0.046-0.156)0.91 (0.84-0.95)10410104Tori Bossito0.30 (0.10-0.60)0.70 (0.39-0.89)101010\nS-form\n2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon0.05 (0.014-0.165)0.95 (0.835-0.986)400.80 (0.652-0.895)0.20 (0.10-0.34)40Tori Bossito0.068 (0.024-0.182)0.932 (0.818-0.977)440.68 (0.534-0.8)0.32 (0.20-0.46)442011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon00.991480.71 (0.632-0.777)0.29 (0.22-0.36)148Tori Bossito01860.64 (0.534-0.733)0.36 (0.26-0.46)86\n\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\n\nThe 1014S allele was identified in one specimen of An. gambiae S-form in Bohicon in co-occurrence with the 1014 F allele." ]

[ null, null, null, null, null, null, null, null, null, null, null ]

[ "Background", "Methods", "Mosquito sampling", "Insecticide susceptibility tests", "Species identification and kdrgenotyping", "mRNA expression of candidate metabolic genes", "RNA extraction and cDNA synthesis", "Reverse-transcription quantitative PCR (RT-qPCR)", "Data analysis", "Results", "DDT resistance", "Differential expression of metabolic genes in An. gambiae", "Target-site mutations in An. gambiaein Benin", "Discussion", "Conclusion" ]

[ "The development of insecticide resistance in anopheles mosquitoes is a major threat for malaria vector control. In Anopheles gambiae mosquitoes, the main malaria vector in Africa, two main mechanisms of resistance have been widely studied: target site modifications and insecticide detoxification known as metabolic resistance [1].\nFor the former, two alternative substitutions occur at position 1014 in the voltage gated sodium channel (VGSC) of An. gambiae: leucine to phenylalanine (L1014F) and leucine to serine (L1014S). The distribution of these two alleles is currently expanding in the M and S molecular forms of An. gambiae as well as in An. arabiensis\n[2]. Furthermore, the frequency of these alleles is rising in many areas of Africa associated with selective sweeps [3]. These mutations are associated with cross resistance to DDT and pyrethroids [4]. Clear association between DDT or pyrethroids resistance and the presence of kdr mutations has been shown in several studies [5]. Recently, the emergence of a new mutation N1575Y, within the linker between domains III-IV of the VGSC was found in An. gambiae. N1575Y occurs inextricably with L1014F on the same haplotypic background and evidence suggests that a secondary selective sweep associated with resistance to pyrethroids/DDT is occurring throughout West Africa [6].\nMetabolic resistance results from increased detoxification processes by gene amplification and/or expression [1, 7–9]. The over-expression of P450 monooxygenases has been described from several pyrethroid-resistant populations of An. gambiae\n[8, 10–13] and An. arabiensis\n[14]\n. In this enzyme family, CYP6M2 is a promising genetic marker for pyrethroid/DDT resistance as it has been demonstrated to metabolize both insecticide classes [15]. A second family of metabolic enzymes, glutathione-S-transferases (GSTs), is thought to play a significant role in DDT and pyrethroid resistance in An. gambiae\n[8, 16].\nWhile the epidemiological consequences of pyrethroids resistance have yet to be established, the rapid evolution of insecticide resistant alleles over the past decade is a real cause for concern for vector control [17]. Monitoring these markers of pyrethroids resistance has significant advantages for insecticide resistance management. In Benin, entomological surveys carried out since 2007 have implicated the involvement of GSTs, P450s and esterases in insecticide resistance in Anopheles mosquitoes [8, 18]. The kdr mutations coupled with metabolic resistance was reported in several An. gambiae populations with variation described between species, sites and collection periods [8]. This situation is worrying since it can seriously threaten the efficiency of insecticide treated nets and insecticide residual spray as recently reported in Benin [19–21]. A better understanding of the genetic and evolutionary processes involved in insecticide resistance is essential to design insecticide resistance management strategies. In this study, we investigated the distribution of the kdr alleles and the gene expression of four candidate metabolisers of pyrethroids/DDT (CYP6M2, CYP6P3, GSTD3 and GSTE2) in An. gambiae throughout Benin.", " Mosquito sampling From December 2010 to December 2011, larvae of An. gambiae mosquitoes were collected in four different sites in Benin (Cotonou, Tori-Bossito, Bohicon and Malanville) in the framework of the WHO/TDR network project [18]. All larvae were brought back to laboratory of the Centre de Recherche Entomologique de Cotonou (CREC) for rearing. Emerging adult female mosquitoes (F0) were used for insecticide susceptibility tests and molecular assays.\nThe IRD (Institut de Recherche pour le Développement) Ethics Committee and the National Research Ethics Committee of Benin approved the study (CNPERS, reference number IRB00006860).\nFrom December 2010 to December 2011, larvae of An. gambiae mosquitoes were collected in four different sites in Benin (Cotonou, Tori-Bossito, Bohicon and Malanville) in the framework of the WHO/TDR network project [18]. All larvae were brought back to laboratory of the Centre de Recherche Entomologique de Cotonou (CREC) for rearing. Emerging adult female mosquitoes (F0) were used for insecticide susceptibility tests and molecular assays.\nThe IRD (Institut de Recherche pour le Développement) Ethics Committee and the National Research Ethics Committee of Benin approved the study (CNPERS, reference number IRB00006860).\n Insecticide susceptibility tests Insecticide susceptibility tests were carried out on 2–5 days old female mosquitoes [22]. Samples collected in Cotonou and Malanville in December 2010 were exposed to DDT 4% for 1 hour and survivors of 48 hours after DDT exposure were stored in RNA later (SIGMA). In December 2011, WHO cylinder kits were used to expose mosquitoes (from Cotonou, Tori-Bossito and Bohicon) to increasing exposure times with the intention of generating time-response curves. Batches of 20–25 mosquitoes were exposed to test papers impregnated with DDT 4% at the following exposure times; 30 min, 45 min, 60 min, 90 min, 120 min, 150 min, 240 min and 300 min. Non-impregnated control papers were used throughout all experiments. Survivors and non-exposed mosquitoes were also stored in RNA later (SIGMA) and kept at −20°C for DNA and RNA analysis.\nInsecticide susceptibility tests were carried out on 2–5 days old female mosquitoes [22]. Samples collected in Cotonou and Malanville in December 2010 were exposed to DDT 4% for 1 hour and survivors of 48 hours after DDT exposure were stored in RNA later (SIGMA). In December 2011, WHO cylinder kits were used to expose mosquitoes (from Cotonou, Tori-Bossito and Bohicon) to increasing exposure times with the intention of generating time-response curves. Batches of 20–25 mosquitoes were exposed to test papers impregnated with DDT 4% at the following exposure times; 30 min, 45 min, 60 min, 90 min, 120 min, 150 min, 240 min and 300 min. Non-impregnated control papers were used throughout all experiments. Survivors and non-exposed mosquitoes were also stored in RNA later (SIGMA) and kept at −20°C for DNA and RNA analysis.\n Species identification and kdrgenotyping DNA was extracted from control and alive mosquitoes following insecticide exposure using the LIVAK buffer method [23]. Specimens were identified to species and molecular form by the SINE-PCR protocol [2]. L1014F, L1014S and N1575Y were screened using TaqMan assays as previously described [6, 24]. Forward and reverse primers and three minor groove binding (MGB) probes (Applied Biosystems) were designed using the Primer Express™ Software Version 2.0. Primers kdr-Forward (5' CATTTTTCTTGGCCACTGTAGTGAT-3'), and kdr-Reverse (5'-CGATCTTGGTCCATGTTAATTTGCA-3') were standard oligonucleotides with no modification. The probe WT (5'-CTTACGACTAAATTTC-3') was labelled with VIC at the 5' end for the detection of the wild type allele, the probes kdrW (5'-ACGACAAAATTTC-3') and kdrE (5'-ACGACTGAATTTC- 3') were labelled with 6-FAM for detection of the kdr-w and kdr-e alleles respectively. For the N1575Y, the primers F3’TGGATCGCTAGAAATGTTCATGACA-5’ R3’CGAGGAATTGCCTTTAGAGGTTTCT-5’were used [6].\nDNA was extracted from control and alive mosquitoes following insecticide exposure using the LIVAK buffer method [23]. Specimens were identified to species and molecular form by the SINE-PCR protocol [2]. L1014F, L1014S and N1575Y were screened using TaqMan assays as previously described [6, 24]. Forward and reverse primers and three minor groove binding (MGB) probes (Applied Biosystems) were designed using the Primer Express™ Software Version 2.0. Primers kdr-Forward (5' CATTTTTCTTGGCCACTGTAGTGAT-3'), and kdr-Reverse (5'-CGATCTTGGTCCATGTTAATTTGCA-3') were standard oligonucleotides with no modification. The probe WT (5'-CTTACGACTAAATTTC-3') was labelled with VIC at the 5' end for the detection of the wild type allele, the probes kdrW (5'-ACGACAAAATTTC-3') and kdrE (5'-ACGACTGAATTTC- 3') were labelled with 6-FAM for detection of the kdr-w and kdr-e alleles respectively. For the N1575Y, the primers F3’TGGATCGCTAGAAATGTTCATGACA-5’ R3’CGAGGAATTGCCTTTAGAGGTTTCT-5’were used [6].\n mRNA expression of candidate metabolic genes RNA extraction and cDNA synthesis Mosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.\nMosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.\n RNA extraction and cDNA synthesis Mosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.\nMosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.\n Reverse-transcription quantitative PCR (RT-qPCR) The relative gene expression of CYP6M2, CYP6P3, GSTD3 and GSTE2 was analyzed by quantitative PCR (qPCR). Actin-5C (AGAP000651) and ribosomal protein S7 (AGAP010592) were used as endogenous control genes to account for any differences in template input. Three biological replicates were run for each sample on a plate. A TaqMan gene expression assay was used for GSTE2 whereas SYBR Green was used for CYP6M2, CYP6P3 and GSTD3. Primers for qPCR were designed using NCBI primer BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) by using Xm codes from Vector Base. The Table 1 shows the primers used for qPCR.Table 1\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\nPrimersPrimer sequencesReferencesCYP6P3F: 5’-GTGATTGACGAAACCCTTCGGAAGT-3’[25]R: 5’-GCACCAGTGTTCGCTTCGGGA-3’CYP6M2F: 5’-TACGATGACAACAAGGGCAAG- 3’R: 5’- GCGATCGTGGAAGTACTGG-3’GSTD3F: 5’-CTAAGCTTAATCCGCAACATACCA-3R: 5’-GTGTCATCCTTGCCGTACAC-3’GSTE2F: 5’-GCCGGAATTTGTGAAGCTAAACCCG-3’R: 5’-TGCTTGACGGGGTCTTTCGGAT-3’S7F: 5’- AGAACCAGCAGACCACCATC-3’[14]R: 5’- GCTGCAAACTTCGGCTATTC-3’ActinF: 5’-ACATCGCCGAAGATCGCCCA-3’R: 5’-AGAGGGATTAAGTTGCAGCACTCG-3’\n\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\n\nThe expression of CYP6M2 and GSTE2 was determined in non-exposed (control batches) and exposed (DDT 300 minutes) mosquitoes. The Kisumu strain (susceptible; S-form) and N’Gousso (susceptible; M-form) were used as reference laboratory strains and not selected with insecticide. Real-time PCR reactions were run on the Agilent MxP3005P (Agilent Technologies). For each target gene, standard curves were generated using a five times serially diluted cDNA samples to assess the PCR efficiency and the dynamic range of cDNA. The PCR efficiencies of each gene fell ±10% of 100% and all had single melting curve peaks indicating specificity of the assay. The cDNA were diluted 5-fold in as this was the concentration that fitted within the dynamic range of each qPCR and stored at −20°C.\nThe relative gene expression of CYP6M2, CYP6P3, GSTD3 and GSTE2 was analyzed by quantitative PCR (qPCR). Actin-5C (AGAP000651) and ribosomal protein S7 (AGAP010592) were used as endogenous control genes to account for any differences in template input. Three biological replicates were run for each sample on a plate. A TaqMan gene expression assay was used for GSTE2 whereas SYBR Green was used for CYP6M2, CYP6P3 and GSTD3. Primers for qPCR were designed using NCBI primer BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) by using Xm codes from Vector Base. The Table 1 shows the primers used for qPCR.Table 1\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\nPrimersPrimer sequencesReferencesCYP6P3F: 5’-GTGATTGACGAAACCCTTCGGAAGT-3’[25]R: 5’-GCACCAGTGTTCGCTTCGGGA-3’CYP6M2F: 5’-TACGATGACAACAAGGGCAAG- 3’R: 5’- GCGATCGTGGAAGTACTGG-3’GSTD3F: 5’-CTAAGCTTAATCCGCAACATACCA-3R: 5’-GTGTCATCCTTGCCGTACAC-3’GSTE2F: 5’-GCCGGAATTTGTGAAGCTAAACCCG-3’R: 5’-TGCTTGACGGGGTCTTTCGGAT-3’S7F: 5’- AGAACCAGCAGACCACCATC-3’[14]R: 5’- GCTGCAAACTTCGGCTATTC-3’ActinF: 5’-ACATCGCCGAAGATCGCCCA-3’R: 5’-AGAGGGATTAAGTTGCAGCACTCG-3’\n\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\n\nThe expression of CYP6M2 and GSTE2 was determined in non-exposed (control batches) and exposed (DDT 300 minutes) mosquitoes. The Kisumu strain (susceptible; S-form) and N’Gousso (susceptible; M-form) were used as reference laboratory strains and not selected with insecticide. Real-time PCR reactions were run on the Agilent MxP3005P (Agilent Technologies). For each target gene, standard curves were generated using a five times serially diluted cDNA samples to assess the PCR efficiency and the dynamic range of cDNA. The PCR efficiencies of each gene fell ±10% of 100% and all had single melting curve peaks indicating specificity of the assay. The cDNA were diluted 5-fold in as this was the concentration that fitted within the dynamic range of each qPCR and stored at −20°C.\n Data analysis The mortality rates were classified in accordance with the recommended criteria by WHO [22]. The resistance status was determined based on the following criteria:\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\nMortality 80 – 97%: suspected resistance in the Anopheles population.\nMortality < 80%: resistant Anopheles population\nOur hypothesis according to previous findings with the metabolic candidate genes was that gene expression is higher in resistant-field mosquitoes than the laboratory susceptible strain. Therefore, the relative expression (linear fold-changes) of CYP6M2, CYP6P3, GSTD3 and GSTE2 were calculated according to the ΔΔCt method described by Schmittgen, and Livak [26] using laboratory strains as calibrator samples. Strains were only compared belonging to the same molecular form (e.g. Cotonou/Malanville versus N’gousso (M-form) and Tori-Bossito/Bohicon versus Kisumu (S-form). PCR efficiencies were incorporated into the calculations. Basic data analysis (regression and t-tests were performed in Excel with p < 0.05 used to assess significant difference between treatments for the t-tests).\nThe mortality rates were classified in accordance with the recommended criteria by WHO [22]. The resistance status was determined based on the following criteria:\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\nMortality 80 – 97%: suspected resistance in the Anopheles population.\nMortality < 80%: resistant Anopheles population\nOur hypothesis according to previous findings with the metabolic candidate genes was that gene expression is higher in resistant-field mosquitoes than the laboratory susceptible strain. Therefore, the relative expression (linear fold-changes) of CYP6M2, CYP6P3, GSTD3 and GSTE2 were calculated according to the ΔΔCt method described by Schmittgen, and Livak [26] using laboratory strains as calibrator samples. Strains were only compared belonging to the same molecular form (e.g. Cotonou/Malanville versus N’gousso (M-form) and Tori-Bossito/Bohicon versus Kisumu (S-form). PCR efficiencies were incorporated into the calculations. Basic data analysis (regression and t-tests were performed in Excel with p < 0.05 used to assess significant difference between treatments for the t-tests).", "From December 2010 to December 2011, larvae of An. gambiae mosquitoes were collected in four different sites in Benin (Cotonou, Tori-Bossito, Bohicon and Malanville) in the framework of the WHO/TDR network project [18]. All larvae were brought back to laboratory of the Centre de Recherche Entomologique de Cotonou (CREC) for rearing. Emerging adult female mosquitoes (F0) were used for insecticide susceptibility tests and molecular assays.\nThe IRD (Institut de Recherche pour le Développement) Ethics Committee and the National Research Ethics Committee of Benin approved the study (CNPERS, reference number IRB00006860).", "Insecticide susceptibility tests were carried out on 2–5 days old female mosquitoes [22]. Samples collected in Cotonou and Malanville in December 2010 were exposed to DDT 4% for 1 hour and survivors of 48 hours after DDT exposure were stored in RNA later (SIGMA). In December 2011, WHO cylinder kits were used to expose mosquitoes (from Cotonou, Tori-Bossito and Bohicon) to increasing exposure times with the intention of generating time-response curves. Batches of 20–25 mosquitoes were exposed to test papers impregnated with DDT 4% at the following exposure times; 30 min, 45 min, 60 min, 90 min, 120 min, 150 min, 240 min and 300 min. Non-impregnated control papers were used throughout all experiments. Survivors and non-exposed mosquitoes were also stored in RNA later (SIGMA) and kept at −20°C for DNA and RNA analysis.", "DNA was extracted from control and alive mosquitoes following insecticide exposure using the LIVAK buffer method [23]. Specimens were identified to species and molecular form by the SINE-PCR protocol [2]. L1014F, L1014S and N1575Y were screened using TaqMan assays as previously described [6, 24]. Forward and reverse primers and three minor groove binding (MGB) probes (Applied Biosystems) were designed using the Primer Express™ Software Version 2.0. Primers kdr-Forward (5' CATTTTTCTTGGCCACTGTAGTGAT-3'), and kdr-Reverse (5'-CGATCTTGGTCCATGTTAATTTGCA-3') were standard oligonucleotides with no modification. The probe WT (5'-CTTACGACTAAATTTC-3') was labelled with VIC at the 5' end for the detection of the wild type allele, the probes kdrW (5'-ACGACAAAATTTC-3') and kdrE (5'-ACGACTGAATTTC- 3') were labelled with 6-FAM for detection of the kdr-w and kdr-e alleles respectively. For the N1575Y, the primers F3’TGGATCGCTAGAAATGTTCATGACA-5’ R3’CGAGGAATTGCCTTTAGAGGTTTCT-5’were used [6].", " RNA extraction and cDNA synthesis Mosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.\nMosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.", "Mosquitoes which survived DDT exposure (300 min) were used for the qPCR assays. Total RNA was extracted from batches of five mosquitoes (stored in RNA later) for each replicate by using PicoPure™ RNA kit isolation (Arcturus) according to the manufacturer’s instructions. RNA was treated using the RNA-Free DNAse set (Qiagen) to remove any contaminating genomic DNA. The concentration and the quality of the total RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, UK). SuperSript™ III Reverse Transcriptase was used to synthesize first strand cDNA.", "The relative gene expression of CYP6M2, CYP6P3, GSTD3 and GSTE2 was analyzed by quantitative PCR (qPCR). Actin-5C (AGAP000651) and ribosomal protein S7 (AGAP010592) were used as endogenous control genes to account for any differences in template input. Three biological replicates were run for each sample on a plate. A TaqMan gene expression assay was used for GSTE2 whereas SYBR Green was used for CYP6M2, CYP6P3 and GSTD3. Primers for qPCR were designed using NCBI primer BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) by using Xm codes from Vector Base. The Table 1 shows the primers used for qPCR.Table 1\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\nPrimersPrimer sequencesReferencesCYP6P3F: 5’-GTGATTGACGAAACCCTTCGGAAGT-3’[25]R: 5’-GCACCAGTGTTCGCTTCGGGA-3’CYP6M2F: 5’-TACGATGACAACAAGGGCAAG- 3’R: 5’- GCGATCGTGGAAGTACTGG-3’GSTD3F: 5’-CTAAGCTTAATCCGCAACATACCA-3R: 5’-GTGTCATCCTTGCCGTACAC-3’GSTE2F: 5’-GCCGGAATTTGTGAAGCTAAACCCG-3’R: 5’-TGCTTGACGGGGTCTTTCGGAT-3’S7F: 5’- AGAACCAGCAGACCACCATC-3’[14]R: 5’- GCTGCAAACTTCGGCTATTC-3’ActinF: 5’-ACATCGCCGAAGATCGCCCA-3’R: 5’-AGAGGGATTAAGTTGCAGCACTCG-3’\n\nPrimers used in quantitative real-times PCR (qPCR) (F = Forward; R = Reverse)\n\nThe expression of CYP6M2 and GSTE2 was determined in non-exposed (control batches) and exposed (DDT 300 minutes) mosquitoes. The Kisumu strain (susceptible; S-form) and N’Gousso (susceptible; M-form) were used as reference laboratory strains and not selected with insecticide. Real-time PCR reactions were run on the Agilent MxP3005P (Agilent Technologies). For each target gene, standard curves were generated using a five times serially diluted cDNA samples to assess the PCR efficiency and the dynamic range of cDNA. The PCR efficiencies of each gene fell ±10% of 100% and all had single melting curve peaks indicating specificity of the assay. The cDNA were diluted 5-fold in as this was the concentration that fitted within the dynamic range of each qPCR and stored at −20°C.", "The mortality rates were classified in accordance with the recommended criteria by WHO [22]. The resistance status was determined based on the following criteria:\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\n\n\n\nMortality > 97%: susceptible Anopheles population. Mortality 80 – 97%: suspected resistance in the Anopheles population.Mortality < 80%: resistant Anopheles population\nMortality 80 – 97%: suspected resistance in the Anopheles population.\nMortality < 80%: resistant Anopheles population\nOur hypothesis according to previous findings with the metabolic candidate genes was that gene expression is higher in resistant-field mosquitoes than the laboratory susceptible strain. Therefore, the relative expression (linear fold-changes) of CYP6M2, CYP6P3, GSTD3 and GSTE2 were calculated according to the ΔΔCt method described by Schmittgen, and Livak [26] using laboratory strains as calibrator samples. Strains were only compared belonging to the same molecular form (e.g. Cotonou/Malanville versus N’gousso (M-form) and Tori-Bossito/Bohicon versus Kisumu (S-form). PCR efficiencies were incorporated into the calculations. Basic data analysis (regression and t-tests were performed in Excel with p < 0.05 used to assess significant difference between treatments for the t-tests).", " DDT resistance In 2010, bioassays showed strong resistance to DDT in An. gambiae in two parts of the country (1% and 6% mortalities in Malanville and Cotonou respectively) [18]. In 2011, we observed no mortality in mosquitoes exposed to 4% DDT regardless of the exposure time (from 30 to 300 minutes), indicating that all mosquito populations were strongly resistant to this insecticide.\nIn 2010, bioassays showed strong resistance to DDT in An. gambiae in two parts of the country (1% and 6% mortalities in Malanville and Cotonou respectively) [18]. In 2011, we observed no mortality in mosquitoes exposed to 4% DDT regardless of the exposure time (from 30 to 300 minutes), indicating that all mosquito populations were strongly resistant to this insecticide.\n Differential expression of metabolic genes in An. gambiae The pre-dominant molecular form in Cotonou (M-form), Malanville (M-form), Bohicon (S-form) and Tori-Bossito (S-form) was exclusively used for qPCR analysis to avoid any bias in expression from mixed molecular forms.\nTwo experiments were performed to analyse the gene expression of metabolic candidates between the different strains from Benin. In the first experiment, M-form mosquitoes from Malanville and Cotonou collected in 2010 were exposed to DDT for one hour and the gene expression of GSTE2, GSTD3, CYP6P3 and CYP6M2 compared to the laboratory strain N’Gousso. All genes were up-regulated in DDT-exposed mosquitoes from Cotonou (between 2.8 and 3.8-fold (2-ΔΔCt)) (p < 0.05) whereas only CYP6P3 (2.4-fold) (p = 0.026) and GSTD3 (2.5-fold) (p = 0.020) were over-expressed in Malanville (Figure 1).Figure 1\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\n\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\nIn the second experiment, the gene expression of GSTE2 and CYP6M2 was compared between collections from three sites in 2011. Expression of each gene was compared between (i) mosquitoes exposed to DDT (ii) non-exposed resistant mosquitoes and (iii) laboratory susceptible strains. There were notable differences in expression between the wild mosquitoes and the laboratory strains (Figure 2). In M-form mosquitoes from Cotonou GSTE2 and CYP6M2 were up-regulated to 4.37 (p = 0.0013) and 2.23-fold (p = 0.037) compared to N’Gousso. In contrast, these genes did not show over-expression in the S-form in Tori-Bossito and Bohicon compared to Kisumu (p > 0.05). No significant differences in GSTE2 and CYP6M2 expression between DDT-exposed and non-exposed mosquitoes observed in any populations (p > 0.05).Figure 2\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.\n\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.\nThe pre-dominant molecular form in Cotonou (M-form), Malanville (M-form), Bohicon (S-form) and Tori-Bossito (S-form) was exclusively used for qPCR analysis to avoid any bias in expression from mixed molecular forms.\nTwo experiments were performed to analyse the gene expression of metabolic candidates between the different strains from Benin. In the first experiment, M-form mosquitoes from Malanville and Cotonou collected in 2010 were exposed to DDT for one hour and the gene expression of GSTE2, GSTD3, CYP6P3 and CYP6M2 compared to the laboratory strain N’Gousso. All genes were up-regulated in DDT-exposed mosquitoes from Cotonou (between 2.8 and 3.8-fold (2-ΔΔCt)) (p < 0.05) whereas only CYP6P3 (2.4-fold) (p = 0.026) and GSTD3 (2.5-fold) (p = 0.020) were over-expressed in Malanville (Figure 1).Figure 1\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\n\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\nIn the second experiment, the gene expression of GSTE2 and CYP6M2 was compared between collections from three sites in 2011. Expression of each gene was compared between (i) mosquitoes exposed to DDT (ii) non-exposed resistant mosquitoes and (iii) laboratory susceptible strains. There were notable differences in expression between the wild mosquitoes and the laboratory strains (Figure 2). In M-form mosquitoes from Cotonou GSTE2 and CYP6M2 were up-regulated to 4.37 (p = 0.0013) and 2.23-fold (p = 0.037) compared to N’Gousso. In contrast, these genes did not show over-expression in the S-form in Tori-Bossito and Bohicon compared to Kisumu (p > 0.05). No significant differences in GSTE2 and CYP6M2 expression between DDT-exposed and non-exposed mosquitoes observed in any populations (p > 0.05).Figure 2\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.\n\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.\n Target-site mutations in An. gambiaein Benin The N1575Y and L1014F mutations were identified in both non-exposed M- and S- form of An. gambiae in Benin. The L1014F kdr allelic frequency was almost fixed in the S form (0.932-1.00), which predominates in the south of the country. The frequency of L1014F ranged between 0.67 and 0.91 in the M-forms in the south (Cotonou, Tori Bossito and Bohicon) and was 0.81 (0.691-0.891) in the north (Malanville).\nIn 2010, we found the 1575Y allele in both molecular forms of An. gambiae. In the M-form, the frequency of this allele was much higher in the northern site Malanville; 0.321 (95% CI 0.214-0.452) than in the southern site of Cotonou 0.019 (95% CI 0.003-0.098) (p = 0.00). In 2011 we did not detect the 1575Y allele in Cotonou whereas the frequencies of 1575Y were 0.291 (95% CI 0.223-0.368) in Bohicon and 0.36 (95% CI 0.267-0.466) in Tori Bossito (see Table 2). There was no significant difference in the 1575Y frequency between years (p = 0.071).Table 2\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\nM-form2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.10 (0.048-0.208)0.90 (0.792-0.952)580.98 (0.902-0.997)0.02 (0.003-0.098)54Malanville0.19 (0.109-0.309)0.81 (0.691-0.891)580.68 (0.548-0.786)0.32 (0.21-0.45)56Tori Bossito0.33 (0.138-0.609)0.67 (0.391-0.862)121012Bohicon0.12 (0.022-0.471)0.88 (0.529-0.978)81082011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.09 (0.046-0.156)0.91 (0.84-0.95)10410104Tori Bossito0.30 (0.10-0.60)0.70 (0.39-0.89)101010\nS-form\n2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon0.05 (0.014-0.165)0.95 (0.835-0.986)400.80 (0.652-0.895)0.20 (0.10-0.34)40Tori Bossito0.068 (0.024-0.182)0.932 (0.818-0.977)440.68 (0.534-0.8)0.32 (0.20-0.46)442011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon00.991480.71 (0.632-0.777)0.29 (0.22-0.36)148Tori Bossito01860.64 (0.534-0.733)0.36 (0.26-0.46)86\n\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\n\nThe 1014S allele was identified in one specimen of An. gambiae S-form in Bohicon in co-occurrence with the 1014 F allele.\nThe N1575Y and L1014F mutations were identified in both non-exposed M- and S- form of An. gambiae in Benin. The L1014F kdr allelic frequency was almost fixed in the S form (0.932-1.00), which predominates in the south of the country. The frequency of L1014F ranged between 0.67 and 0.91 in the M-forms in the south (Cotonou, Tori Bossito and Bohicon) and was 0.81 (0.691-0.891) in the north (Malanville).\nIn 2010, we found the 1575Y allele in both molecular forms of An. gambiae. In the M-form, the frequency of this allele was much higher in the northern site Malanville; 0.321 (95% CI 0.214-0.452) than in the southern site of Cotonou 0.019 (95% CI 0.003-0.098) (p = 0.00). In 2011 we did not detect the 1575Y allele in Cotonou whereas the frequencies of 1575Y were 0.291 (95% CI 0.223-0.368) in Bohicon and 0.36 (95% CI 0.267-0.466) in Tori Bossito (see Table 2). There was no significant difference in the 1575Y frequency between years (p = 0.071).Table 2\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\nM-form2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.10 (0.048-0.208)0.90 (0.792-0.952)580.98 (0.902-0.997)0.02 (0.003-0.098)54Malanville0.19 (0.109-0.309)0.81 (0.691-0.891)580.68 (0.548-0.786)0.32 (0.21-0.45)56Tori Bossito0.33 (0.138-0.609)0.67 (0.391-0.862)121012Bohicon0.12 (0.022-0.471)0.88 (0.529-0.978)81082011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.09 (0.046-0.156)0.91 (0.84-0.95)10410104Tori Bossito0.30 (0.10-0.60)0.70 (0.39-0.89)101010\nS-form\n2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon0.05 (0.014-0.165)0.95 (0.835-0.986)400.80 (0.652-0.895)0.20 (0.10-0.34)40Tori Bossito0.068 (0.024-0.182)0.932 (0.818-0.977)440.68 (0.534-0.8)0.32 (0.20-0.46)442011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon00.991480.71 (0.632-0.777)0.29 (0.22-0.36)148Tori Bossito01860.64 (0.534-0.733)0.36 (0.26-0.46)86\n\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\n\nThe 1014S allele was identified in one specimen of An. gambiae S-form in Bohicon in co-occurrence with the 1014 F allele.", "In 2010, bioassays showed strong resistance to DDT in An. gambiae in two parts of the country (1% and 6% mortalities in Malanville and Cotonou respectively) [18]. In 2011, we observed no mortality in mosquitoes exposed to 4% DDT regardless of the exposure time (from 30 to 300 minutes), indicating that all mosquito populations were strongly resistant to this insecticide.", "The pre-dominant molecular form in Cotonou (M-form), Malanville (M-form), Bohicon (S-form) and Tori-Bossito (S-form) was exclusively used for qPCR analysis to avoid any bias in expression from mixed molecular forms.\nTwo experiments were performed to analyse the gene expression of metabolic candidates between the different strains from Benin. In the first experiment, M-form mosquitoes from Malanville and Cotonou collected in 2010 were exposed to DDT for one hour and the gene expression of GSTE2, GSTD3, CYP6P3 and CYP6M2 compared to the laboratory strain N’Gousso. All genes were up-regulated in DDT-exposed mosquitoes from Cotonou (between 2.8 and 3.8-fold (2-ΔΔCt)) (p < 0.05) whereas only CYP6P3 (2.4-fold) (p = 0.026) and GSTD3 (2.5-fold) (p = 0.020) were over-expressed in Malanville (Figure 1).Figure 1\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\n\nThe\nCYP6M2\n,\nCYP6P3\n,\nGSTE2\nand\nGSTD3\nexpression in Cotonou and Malanville after 48 hours DDT-exposure compared to those of. N’Gousso (M-form laboratory mosquito) Error bars are 95% confidence interval.\n\nIn the second experiment, the gene expression of GSTE2 and CYP6M2 was compared between collections from three sites in 2011. Expression of each gene was compared between (i) mosquitoes exposed to DDT (ii) non-exposed resistant mosquitoes and (iii) laboratory susceptible strains. There were notable differences in expression between the wild mosquitoes and the laboratory strains (Figure 2). In M-form mosquitoes from Cotonou GSTE2 and CYP6M2 were up-regulated to 4.37 (p = 0.0013) and 2.23-fold (p = 0.037) compared to N’Gousso. In contrast, these genes did not show over-expression in the S-form in Tori-Bossito and Bohicon compared to Kisumu (p > 0.05). No significant differences in GSTE2 and CYP6M2 expression between DDT-exposed and non-exposed mosquitoes observed in any populations (p > 0.05).Figure 2\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.\n\nThe\nGSTE2\nand\nCYP6M2\nexpression in non-exposed and DDT-exposed\nAn. gambiae s.l\ncollected in Cotonou, Tori-Bossito and Bohicon.\na) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon compared to those of N’Gousso (M-form laboratory mosquito) and Kisumu (S-form laboratory mosquito). Error bars are 95% confidence interval. b) The GSTE2 and CYP6M2 expression in An. gambiae s.l collected in Cotonou, Tori-Bossito and Bohicon after 300 min exposure to 4% DDT compared to those of non-exposed mosquitoes. Error bars are 95% confidence interval.", "The N1575Y and L1014F mutations were identified in both non-exposed M- and S- form of An. gambiae in Benin. The L1014F kdr allelic frequency was almost fixed in the S form (0.932-1.00), which predominates in the south of the country. The frequency of L1014F ranged between 0.67 and 0.91 in the M-forms in the south (Cotonou, Tori Bossito and Bohicon) and was 0.81 (0.691-0.891) in the north (Malanville).\nIn 2010, we found the 1575Y allele in both molecular forms of An. gambiae. In the M-form, the frequency of this allele was much higher in the northern site Malanville; 0.321 (95% CI 0.214-0.452) than in the southern site of Cotonou 0.019 (95% CI 0.003-0.098) (p = 0.00). In 2011 we did not detect the 1575Y allele in Cotonou whereas the frequencies of 1575Y were 0.291 (95% CI 0.223-0.368) in Bohicon and 0.36 (95% CI 0.267-0.466) in Tori Bossito (see Table 2). There was no significant difference in the 1575Y frequency between years (p = 0.071).Table 2\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\nM-form2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.10 (0.048-0.208)0.90 (0.792-0.952)580.98 (0.902-0.997)0.02 (0.003-0.098)54Malanville0.19 (0.109-0.309)0.81 (0.691-0.891)580.68 (0.548-0.786)0.32 (0.21-0.45)56Tori Bossito0.33 (0.138-0.609)0.67 (0.391-0.862)121012Bohicon0.12 (0.022-0.471)0.88 (0.529-0.978)81082011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Cotonou0.09 (0.046-0.156)0.91 (0.84-0.95)10410104Tori Bossito0.30 (0.10-0.60)0.70 (0.39-0.89)101010\nS-form\n2010\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon0.05 (0.014-0.165)0.95 (0.835-0.986)400.80 (0.652-0.895)0.20 (0.10-0.34)40Tori Bossito0.068 (0.024-0.182)0.932 (0.818-0.977)440.68 (0.534-0.8)0.32 (0.20-0.46)442011\nf 1014 L (95% C.I.)\nf 1014 F (95% C.I.)\nN (alleles)\nf 1575 N (95% C.I.)\nf 1575Y (95% C.I.)\nN (alleles)Bohicon00.991480.71 (0.632-0.777)0.29 (0.22-0.36)148Tori Bossito01860.64 (0.534-0.733)0.36 (0.26-0.46)86\n\nKdr\nallelic frequencies in\nAn. gambiae\nin each site per collection period\n\nThe 1014S allele was identified in one specimen of An. gambiae S-form in Bohicon in co-occurrence with the 1014 F allele.", "This study showed extremely high levels of DDT resistance in field populations of An. gambiae in Benin. This resistance profile is likely to be due to a combination the high frequencies of kdr mutations (L1014F and N1575Y) and over-expression of metabolic genes, i.e. GSTE2, GSTD3, CYP6M2 and CYP6P3 known to be involved in DDT and/or pyrethroids resistance.\nThe 1014 F kdr allelic frequency was almost fixed in the S-form and at a high frequency in the M-form. Such kdr 1014 F frequency in An. gambiae has been recently reported throughout sub-Saharan Africa [18, 27, 28]. In 2011 the kdr 1575Y allele was detected in the- S-form only and occurred solely upon a 1014 F haplotypic background confirming the results of Jones et al.\n[6]. The prevalence of this mutation has increased in West Africa in the last years hence indicating that the 1014 F-1575Y haplotype is under strong selection. From our data there was a slight but non-significant increase in 1575Y in the S-form. The 1575Y was only found at a high frequency in the M-form in the north of the country (0.321) close to the border of Burkina Faso where similar frequencies of this mutation have previously been observed [6]. We also detected L1014S from An. gambiae S-form confirming the extension of this mutation in An. gambiae s.s. in West Africa. Recent surveys carried in Benin and Burkina Faso detected the presence of 1014S kdr allele in both M and S form and An. arabiensis\n[18, 29, 30].\nThe additive resistance of 1575Y for permethrin and DDT in the S- and M-forms of An. gambiae respectively [6] and the presence of 1014S highlights the importance of continually monitoring for these mutations as part of insecticide resistance management.\nBased on previous findings that implicate metabolic candidate genes in DDT resistance we analysed the expression levels of two P450s and two GSTs in DDT resistant mosquitoes in Benin.\nThe over-expression of CYP6M2 and CYP6P3 has previously been associated with pyrethroid and DDT resistance in An. gambiae and are known metabolizers of both types I and type II of pyrethroids and DDT [11, 15]. The specific up-regulation of these two genes in the M-form from Cotonou agrees with previous findings in Benin and Ghana [7, 15]. Increased GST activity is known to confer DDT resistance in mosquitoes [31, 32] by catalyzing the removal of a chlorine group from the insecticide. In this study, GSTE2 and GSTD3 were up-regulated in M-form mosquitoes. Delta class GSTs have been implicated in insecticide resistance [33] but their role has previously thought to be relatively minor compared with those from the epsilon class. GSTE2 has been strongly associated with DDT and pyrethroid resistance in An. gambiae mosquitoes from Ghana [34–37] and with DDT resistance in An. funestus from Benin [38]. In this latter country, a single amino acid change (L119F) in an up-regulated glutathione S-transferase gene, GSTe2, in Anopheles funestus showed to confer high levels of metabolic resistance to DDT hence representing a promising marker to track the evolution of DDT and pyrethroid resistance in malaria vectors in West Africa [39, 40]. GSTD3 was up-regulated in DDT-resistant An. arabiensis from an urban site in Burkina Faso [30]. Further validation of the role of GSTD3 in DDT resistance is required.\nIn this paper, significant difference in gene expression between molecular forms and the laboratory strains was reported. No differential expression of CYP6M2 and GSTE2 was observed in the S-form from Bohicon and Tori-Bossito compared to the Kisumu strain whereas mosquitoes belonging to the M-form showed higher expression levels compared to N’Gousso. The difference of expression of these metabolic genes may be due to the differences of selection pressure induced by various xenobiotics in larval breeding sites. Indeed, general ecological differences have been documented between the M- and S-forms [41–43]. The M-form preferentially breeds in permanent polluted freshwater collections mainly resulting from human activity (e.g., agriculture and urbanization), whereas the S form thrives in temporary non-polluted breeding sites (e.g., rain-filled puddles, road ruts, and quarries) [42]. In the present study, the over-expression observed in M-form, may reflect the influence of a range of xenobiotics on selecting for resistance in mosquitoes [7, 44]. Whilst the impact of agricultural and public health use of insecticides has been widely linked to selection for resistance in malaria vector, recent evidence has also implicated other xenobiotics such as petroleum oils, heavy metals etc. [44–47]. We cannot exclude the possibility that besides these four metabolic genes, other enzymes and genetic mechanisms could be contributing to the phenotype as suggested from previous microarray studies [15, 37].\nIn the presence of xenobiotics, metabolic resistance can be related to constitutive or induced detoxification process or both [48]. Here we analyzed the induction effect of GSTE2 and CYP6M2 in An. gambiae mosquitoes after 300 minutes exposure to DDT. Results showed that mosquito exposure to DDT did not induce over-expression of GSTE2 and CYP6M2, suggesting that two genes are constitutively over-expressed in resistant mosquitoes.\nThe evidence that malaria vectors exhibit multiple insecticide resistance mechanisms is worrying for malaria prevention in Africa [4]. In Benin, reduced efficacy of LLIN and IRS has been shown in areas where malaria vectors exhibits high 1014 F frequency [21, 49]. There is an urgent need to implement routine insecticide resistance monitoring through all Malaria Control Programmes relying on DDT-based treatments. Monitoring the frequency and distribution of the genes contributing towards the resistance phenotype should play a role in insecticide resistance management. Quantifying the expression of the candidate genes analysed here using robust RT-qPCR assays in populations of resistant-mosquitoes throughout Benin could help this process.", "The spread of multi-resistance in wild populations of An. gambiae is worrying as it could threaten the effectiveness of malaria vector control strategies based on the use of chemicals." ]

[ null, "methods", null, null, null, null, null, null, null, "results", null, null, null, "discussion", "conclusions" ]

[ "\nAn. gambiae\n", "Insecticide resistance", "qPCR", "Kdr mutation", "Vector control", "Metabolic enzymes" ]

[ 573, 116, 179, 184, 222, 107, 350, 271, 76, 722, 604 ]

[ "form", "95", "mosquitoes", "expression", "ddt", "cotonou", "gambiae", "exposed", "gste2", "cyp6m2" ]

[ "pyrethroid resistance malaria", "ddt resistance gambiae", "resistance malaria vectors", "implicated insecticide resistance", "mutations insecticide resistance" ]