PMC / PMC_clustering_533.jsonl
masa-ok's picture
クラスタリングしたファイル100個_6
7d7c783 verified
raw
history blame
80.8 kB
{"text": "It was highlighted that the original article contained an alignment typesetting error in Table 1. This Correction article shows the correct Table"}
{"text": "As compared to the analysis presented in this work using rs247616) [47616 [2]"}
{"text": "In the original publication the bands in Fig.\u00a01J and Fig.\u00a02B were not visible. The correct versions of Fig."}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 28th January 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article has been updated."}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 29 June 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article has been corrected."}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 15th September to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article has been corrected."}
{"text": "The correct spelling is A.Kamel. This article has been corrected.1In the Research Letter titled \u201cAssociation of Ramadan Fasting and Clinical Outcomes in Patients With Myasthenia Gravis,\u201d"}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 22 May 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article was updated."}
{"text": "A total of 19 of 114 officers (17%) who had positive screening results for current mental illness symptoms had sought mental health care services in the past 12 months, not 19 of the 434 officers who completed the survey. This article has been corrected.In the Original Investigation titled \u201cPrevalence of Mental Illness and Mental Health Care Use Among Police Officers,\u201d"}
{"text": "Mycobacterium bovis BCG vaccination is not routinely administered of attenuated strains of the measles virus of MMR vaccine interacts with the host cell surface receptors, including CD46 . Immunog9\u2013"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssessment of Breast Cancer Mortality Trends Associated With Mammographic Screening and Adjuvant Therapy From 1986 to 2013 in the State of Victoria, Australia,\u201d"}
{"text": "In the original publication there are few errors in Figure\u00a01. The correct Figure"}
{"text": "In the original publication the Fig.\u00a02 and the Supplementary Material 1 was incorrect. The correct version of Fig.\u00a0NESTIN should be corrected to PAX6 in Fig.\u00a0Supplementary material 1 (PDF 320 kb)Below is the link to the electronic supplementary material."}
{"text": "In the original publication the labelling on Fig.\u00a02A and B were incorrectly published as E7.5. The correct labelling of Fig."}
{"text": "This error appears only in PDF versions downloaded on or before May 6, 2020."}
{"text": "The original version of this article unfortunately contained a mistake in Fig.\u00a06.The corrected Fig."}
{"text": "The References section incorrectly listed the article by Arshad et al2 as reference 26. The correct reference is Boulware et al.3 This article has been corrected.1In the Original Investigation titled \u201cRisk Factors Associated With In-Hospital Mortality in a US National Sample of Patients With COVID-19,\u201d"}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 18 June 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article was updated."}
{"text": "These dates appeared as 2012 to 2013 but should have appeared as 2011 to 2013. This article has been corrected.1In the Original Investigation titled \u201cPrevalence of Diabetes Medication Intensifications in Older Adults Discharged From US Veterans Health Administration Hospitals,\u201d"}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 10 July 2020 to \u00a9 The Author(s) 2020 and this article is licensed under a Creative Commons Attribution 4.0 International License (The original article has been updated."}
{"text": "Transthoracic echocardiography revealed large heterogeneous masses adhered to the myocardium with no clear cleavage plane, an intermediate echogenicity and involving the right ventricle, the atrioventricular groove and the large vessels Echocardiographic 2D cine loops Echocardiographic 2D cine loops"}
{"text": "The originally published Figure 4 contains wrong units on the y axes of both depicted CD spectra. The corrected Figure 4 is given below."}
{"text": "Pancreatic cancer has a poor prognosis with a 5-year survival of approximately 7%.5In this international EURECCA studyAlthough the quantity and quality of randomized clinical trials is increasing"}
{"text": "A second fluorescece image showing cell cultures after 4\u2009hours was incorrectly shown in the place of cell cultures after 1\u2009hour . A corrected version of the figure appears below."}
{"text": "Following publication of the original article [1], the authors identified an error in Fig.\u00a02e. The correct Fig."}
{"text": "He received compensation for his efforts through grant funding.\u201d The article has been corrected to include the acknowledgment.1In the Original Investigation titled \u201cAssessment of Birth Defects and Cancer Risk in Children Conceived via In Vitro Fertilization in the US,\u201d"}
{"text": "This article has been corrected.In the Original Investigation titled \u201cAssociation of Sex or Race With the Effect of Weight Loss on Physical Function: A Secondary Analysis of 8 Randomized Clinical Trials,\u201d"}
{"text": "In the above article by Leppin et al. [1], a funding source was missing. The following statement should have appeared at the end of the financial support section:KRS\u2019s contribution was made possible by CTSA grant UL 1TR002645.The original article has been updated online to include this."}
{"text": "It should have appeared as 14%. This article has been corrected.1In the Research Letter titled \u201cTrends in Racial and Ethnic Diversity in Internal Medicine Subspecialty Fellowships From 2006 to 2018,\u201d"}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 15 November 2019 to \u00a9 The Author(s) 2019 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article has been corrected."}
{"text": "The Fig.\u00a01b is wrongly published in the original publication of the article ["}
{"text": "We noticed an error in figure 5 in our published manuscript"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cPrevalence of and Factors Associated With Nurse Burnout in the US,\u201d"}
{"text": "This article has been corrected.In the Original Investigation titled \u201cEffect of Vitamin D"}
{"text": "This article has been corrected.In the Original Investigation titled \u201cAssociations of Menstrual Cycle Characteristics Across the Reproductive Life Span and Lifestyle Factors With Risk of Type 2 Diabetes,\u201d"}
{"text": "The authors regret the use of incorrect panels in Fig.\u00a05 B1) and Fig.\u00a06 of their publication [ and Fig.The corrected Figs."}
{"text": "The axis tick marks given as proportions should have been given as percentage values. This article was corrected.1In the Original Investigation titled \u201cAssociation Between the Percentage of US Drug Sales Subject to Inflation Penalties and the Extent of Drug Price Increases,\u201d"}
{"text": "The cDNA was synthesized with the PrimeScript RT reagent Kit . Real\u2010time PCR was carried out using an ABI 7500 real\u2010time PCR system . The mRNA expression level of GOT2 and ASS1 was normalized to the endogenous expression of GAPDH. Primers were provided by Invitrogen as described below:Total RNAs of breast cancer cells and mouse embryonic fibroblasts MEF BRCA1"}
{"text": "The number of care aides who spoke English as an additional language should have been 2663 care aides. This article has been corrected.1In the Original Investigation titled \u201cAssociation of Work Environment With Missed and Rushed Care Tasks Among Care Aides in Nursing Homes,\u201d"}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 06 March 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article has been corrected."}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 25 June 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License ("}
{"text": "With the author(s)\u2019 decision to opt for Open Choice the copyright of the article changed on 22 May 2020 to \u00a9 The Author(s) 2020 and the article is forthwith distributed under a Creative Commons Attribution 4.0 International License (The original article was updated."}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cPrimary Care Practitioner Perspectives on the Role of Primary Care in Dementia Diagnosis and Care,\u201d"}
{"text": "This is a peer-review report submitted for the paper \u201cAre We Sure We Fully Understand What an Infodemic Is? A Global Perspective on Infodemiological Problems.\u201dThis paper is a wel"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cPrevalence of and Factors Associated With Nurse Burnout in the US,\u201d"}
{"text": "Following publication of the original article [1], the label of Part A in Fig.\u00a01 has been updated.The original article has been corrected."}
{"text": "Figure 1 has been corrected in the PDF and HTML version of this Article. In addition, a few typographical errors were corrected and higher resolution image files used for Figures 2\u20134."}
{"text": "In the recent article by Siegel et al.\u00a0, the blaThe authors apologize for the error."}
{"text": "An omission to the funding section of the original article was made in error. The following sentence has been added: \u201cOpen access funding was provided by the Universit\u00e0 Della Svizzera Italiana.\u201dThe original article has been updated."}
{"text": "An omission to the funding section of the original article was made in error. The following sentence has been added: \u201cOpen access funding was provided by the Universit\u00e0 Della Svizzera Italiana.\u201dThe original article has been updated."}
{"text": "R is modified to Rs.In eq 2,"}
{"text": "Following publication of the original article , Fig.\u00a06 The original article has been corrected."}
{"text": "Following publication of the original article [1], in this article the Eq.\u00a07, has been updated as shown below:"}
{"text": "It has been noted that the Figure 5A Arg1 blots appear very similar to blots seen in an unrelated manuscript by Xing et al. 2018 (doi:"}
{"text": "Table 1 as published [In the original publication, there was a mistake in"}
{"text": "Chen-Mei Chen should only have affiliation 1. Affiliation 2 \u201cThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
{"text": "In the published article, there was an error in the Funding statement [LGH20H190003]. The correct Funding statement appears below."}
{"text": "We sincerely apologize for any offense caused, which was entirely unintentional. Figure 1 has been replaced with a new figure with the correct labels."}
{"text": "This article has been corrected.1In the Research Letter titled \u201cRates of Induction of Labor at 39 Weeks and Cesarean Delivery Following Publication of the ARRIVE Trial,\u201d"}
{"text": "There was a cited reference error in the original article . A corre"}
{"text": "We recently found that some pictures were mistakenly chosen and placed in Figure 5B, Supplementary Figure 1A and Supplementary Figure 4. The correct pictures are provided below. The revised figures do not alter the conclusions of this article. We apologized deeply for our careless and any inconvenience caused."}
{"text": "The conclusions were not affected by these corrections. This article has been corrected.1In the Original Investigation titled \u201cComparison of Work Patterns Between Physicians and Advanced Practice Practitioners in Primary Care and Specialty Practice Settings,\u201d"}
{"text": "In Table 3 the entry for Ethiopia contains incorrect sums of the subpopulation data within the larger geographical zones. Please see the corrected Table 3 here:"}
{"text": "This article has been republished to replace Figure 3 due to copyright issues."}
{"text": "In Table 3, the column detailing gender was missing. Please view the corrected Table 3 here:"}
{"text": "The labels \"A\" and \"B\" did not exist in Figure 7. A correct version of the figure is available here:"}
{"text": "In Table 3, the substrate/incline conditions are not aligned correctly with the corresponding metrics. Please see the corrected Table 3 here:"}
{"text": "The Y-axis of Figure 3 was incorrectly scaled. You may see the corrected Figure 3 here:"}
{"text": "The correct version of Figure S8 can be found here:"}
{"text": "The dashed guideline in Figure 4 was printed out of place. You can find the corrected Figure 4 here:"}
{"text": "The word gray was erroneously added in the k column of Table 1. Please see the corrected Table 1 here:"}
{"text": "There is an error in Table 3. A correct version of Table 3 can be seen here: [^]"}
{"text": "Please note that cited reference [10] is a duplicate of cited reference [9]. Both cite the same study by Calvert et al."}
{"text": "There was an error in Figure 7.The correct version of Figure 7 is available here:"}
{"text": "The correct version of Figure 6 can be viewed here:"}
{"text": "There was an error in equation 3). The correct equation can be viewed here:"}
{"text": "The symbol on the left side of equation 1 should be a \"phi\". Please see the correct Equation 1 here:"}
{"text": "Due to a technical error, there are missing symbols in Figure 4. Please view the correct Figure 4 file here:"}
{"text": "An error occurred during the production process affecting the readability of Figure 2. A more clear Figure 2 can be found here:"}
{"text": "The labelling of normal tissues and cancer tissues was inverted. Please see Figure\u00a0After publication of this article , the aut"}
{"text": "The version of Figure 3 displays its text incorrectly. There correct version is available here:"}
{"text": "There was an Error in Table 1. The correct Table can be found here:"}
{"text": "This article has been republished to correct errors in Figure 3."}
{"text": "There was a rendering error which affected the readability of Figure 1. The correct Figure 1 can be viewed here:"}
{"text": "The mouse squamous epithelial cell line HCC7 appears incorrectly throughout the article. The correct cell line is the mouse squamous carcinoma cell line SCC7."}
{"text": "There are several errors in the data listed in Table 1. Please see the correct table with highlighted changes:"}
{"text": "In Table 6, the alkaloid names have been placed incorrectly. Please see the corrected Table 6 here:"}
{"text": "The headings in the row \"Outcome\" were erroneously shifted. Please view the corrected Table 3 here:"}
{"text": "Equation 1 is incorrect and has been updated.Please see the corrected Equation 1 here."}
{"text": "Sensors in 2008 [We found that in 2008 . Therefo"}
{"text": "The graph for Figure 5 is incorrect and does not match the figure legend. See the correct Figure 5 here: [[^]"}
{"text": "We applied recently developed information theory methods ,2 to theWe found that there is substantially more information in the phase code compared with the spike rate alone for low LFP frequencies (< 30 Hz). Figure"}
{"text": "Appendix S1This file contains the software code necessary to perform the analyses that result in the main figures reported in this article.(R)Click here for additional data file."}
{"text": "The corresponding author provided an incorrect trial profile as Figure 1 due to an oversight during the copyediting process. Please view the correct version of Figure 1 here: . The legend for Figure 1 is correct as published."}
{"text": "There was an error in Figure 3. The revised version can be viewed here:"}
{"text": "There was an error the column arrangement of Table 3. Please see the corrected table at the following link:."}
{"text": "Due to a technical error, there are missing symbols in Figure 5. Please view the correct Figure 5 file here:"}
{"text": "Table 1 was incorrectly formatted causing a series of values to be in the incorrect positions. Please see the correct Table 1 here:"}
{"text": "In Fig. 5(b) and 5(c), the \"question marks\" under all columns should be changed to \"micro.\" The correct Figure 5 can be viewed here:"}
{"text": "There is an error in Figure 1. The revised, correct Figure 1 can be seen here: [^]"}
{"text": "Figure 4 is incorrect. The y-axis of Figure 4B was mislabeled. It should be \"Total HIV DNA/Integrated HIV DNA,\" but it was labeled the inverse. Please view the correct Figure 4 here:"}
{"text": "There was an error in the text in Figure 2. \"Type II\" MOB was incorrectly used twice. Please see the corrected Figure 2 here:"}
{"text": "An error occurred during uploading Figure 3(c), and the following is the correct figure."}
{"text": "There are errors in Table 2. The correct table can be viewed here:"}
{"text": "The vales in line 5 \"Total cost (\u20ac)\" should be listed in thousands, not millions. Please view the correct table here:"}
{"text": "Due to a technical error, there are missing symbols in Figure 3. Please view the correct Figure 3 file here:"}
{"text": "This paper was republished on December 4 due to a Table being erroneously incorporated into the text. Please download the corrected version."}
{"text": "The correct version of Figure 2 is available here:"}
{"text": "A model of the auditory system was developed which implements spike timing dependent plasticity (STDP) in a bio"}
{"text": "Table 4 has been corrected for orientation and readability.Please see the corrected"}
{"text": "Figure 2.There is an error in the information presented in Table"}
{"text": "There are errors in Table 1. A correct version of Table 1 can be seen here: [^]"}
{"text": "Figure 1 is distorted. This error occurred while the article was being prepared for publication. Please see the correct Figure 1 here:"}
{"text": "There was an error in Figure 3. The correct figure can be viewed here:"}
{"text": "There were equation formatting errors in the Figure 2 legend. The correct equations can be viewed here:"}
{"text": "There was an error in Figure 2. The arrows were missing from panel B. The correct Figure 2 can be viewed here:"}
{"text": "There was an error in Tubulin blot of Figure 7. The correct Figure 7 can be viewed here:"}
{"text": "There was an error in the axis labels of Figure 5. Please see the corrected Figure 5 here:"}
{"text": "An error in Figure 3 was introduced during the preparation of this article for publication. Figure 3 should include two additional graphs labeled D and H. Please see the corrected Figure 3 here:"}
{"text": "An error in the production process caused the incidence risk ratios in the rightmost column of Table 3 to be displayed incorrectly. Please see the corrected Table 3 here:"}
{"text": "A formatting error was introduced in Table 3 that may affect the readability of the table. Please see the corrected Table 3 here:"}
{"text": "There is an error in the formatting of Table 4. Bold formatting is not present. The correct Table 4 can be viewed here:"}
{"text": "The correct version of Equation 2 can be found here:"}
{"text": "In Figure 4, three colored circles are missing from the line of Graph B. Please see the corrected Figure 4 here:"}
{"text": "There is a misprint in Equation 11, which should read:"}
{"text": "Figure 5 is incorrect. The correct figure can be found here:"}
{"text": "Part of Figure 2 was cropped out during the production process. Please see the corrected Figure 2 here:"}
{"text": "There are typographical errors in Figure 6. The correct Figure 6 can be viewed here:"}
{"text": "This article was republished on December 3rd, 2013 because of incorrect figure order. Please download this article again to view the figures."}
{"text": "Table 3 was incorrectly omitted from the article. It is available here:"}
{"text": "There are numerous errors in Figure 3. Please see the correct figure here:"}
{"text": "GenBank policy as of 2011 is to not accept sequences <200 bp long . Thus the author has provided sequences of the newly identified haplotypes in a new Supplemental Table S3. Table S3 can be viewed here: Click here for additional data file."}
{"text": "There were errors in Figure 6. The correct version of the figure is available here:"}
{"text": "The correct version of Figure 2 can be found here:"}
{"text": "There are formatting errors in Figure 6. A correct image of Figure 6 can be seen here: [^]"}
{"text": "Data within the cells of Table 2 should appear on separate lines within the cell. Please see the correct Table 2 here:"}
{"text": "An error to the y-axis of Figure 1B was introduced during production of this article. Please see the corrected Figure 1 here:"}
{"text": "There was a formatting error in Table 1, which has been corrected for improved readability. Please see the corrected Table 1 here:"}
{"text": "Figure 8 has an error in the value under \"R\". Please see the correct figure at the following link: ."}
{"text": "There were errors in Table 1. The attache file contains a corrected version of the table:"}
{"text": "There were multiple errors introduced in Figure 1 during the preparation of this manuscript for publication. Please view the correct Figure 1 here:"}
{"text": "It has been brought to our attention that the Figure 1 (page 2177) in our published paper ["}
{"text": "Table S4 was omitted from the published article. Table S4 can be viewed here:Click here for additional data file.."}
{"text": "Only a portion of Figure 5 is included in the article. Please find a full version of Figure 5 here:"}
{"text": "In Table 1, the values for body mass index were incorrect in the manuscript originally published online. They have been corrected here."}
{"text": "There was an error introduced during the preparation of this manuscript for publication. Figure 3 is incorrect. Please view the correct Figure 3 here:"}
{"text": "There is an error in the time listed in third row of Table 7. The correct sentence should read \u201cTime from PRES onset to control of causative factor > 30 hours.\u201d"}
{"text": "There are errors in Table 1. The correct table can be found here: ."}
{"text": "In Table 1, in the second column of the \"Correct response?\" row of \"Training Phase II\", there was a missing \"x\" symbol. The correct Table 2 can be viewed here:"}
{"text": "In Figure Legend 6, \u2206 was replaced with a question mark. The correct version of Figure Legend 6 can be viewed here:"}
{"text": "The legend of section D in Figure 6 was removed during the production process. Please see the corrected Table 6 here:"}
{"text": "There was information missing from Figure 1. A correct, complete version of the figure is available here:"}
{"text": "The location of rs7946 was also noted incorrectly as 7409560; it should be 17409560. Please see the corrected Table 3 here:"}
{"text": "The name of the 14th author was misspelled. The correct spelling is St\u00e9phane Cruveiller."}
{"text": "To the Editor: We would like to retract the letter entitled \u201cTripleReassortant Swine Influenza A (H3N2) Virus in Waterfowl,\u201d which was published the April2010 issue of Emerging Infectious Diseases ("}
{"text": "An error was introduced in the preparation of this article for publication. Table 3 was only partially published. Please find a complete version of Table 3 here:"}
{"text": "In Figure 3, the y-axis is incorrect and should be the delta sign. Please see the corrected Figure 3 here:"}
{"text": "The following information is missing from the Funding section: This publication was funded by the French national IPSL project MODIF (D\u00e9veloppement d'un MOd\u00e8le num\u00e9rique du phytoplancton DIazotrophe)(Crocosphaera sp.) et de sa limitation en Fer.In the Materials and Methods section, the second to last sentence incorrectly lists the percentage of total particulate organic carbon represented by C content associated with bacteria as 4%. The correct percentage is 2.8+/- 0.9 %The final line of the second column of"}
{"text": "The labels on panels A and B in Figure 2 were switched. Panel A should be labeled \"Gammaproteobacteria\" and panel B should be labeled \"Alphaproteobacteria.\" Please see the corrected Figure 2 here:"}
{"text": "An error occurred in the legend of Figure 1 during the preparation of this article for publication. A reference is missing from the sentence beginning \"The area framed by thick gray lines with downward arrows represents a simple rule of thumb[?]...\". The sentence should instead read:\"The area framed by thick gray lines with downward arrows represents a simple rule of thumb [14] according to which a glycerol test should be considered as a diagnostic option when a patient with suspected Meni\u00e8re\u2019s disease has a mean low-frequency hearing loss between 30 and 70 dB and a mean high-frequency hearing loss that does not exceed the mean low-frequency loss."}
{"text": "D \u200a=\u200a OA + BA exp + CA exp Errors occurred during the preparation of this article for publication. Equation Four of the Data Analyses section under the subheading VHF telemetry in the Methods Section is incorrect. The correct equation is The publisher apologizes for these errors."}
{"text": "Panel B of Figure 3 is incorrectly labeled. It should read \"Total leucocytes.\" Additionally, there is a misspelling in the name of author 8. Her name should be spelled \"Sabrina Epiphanio.\"The corrected figure image can be found here:"}
{"text": "There was a formatting error affecting the column alignment of Table 3. The corrected Table 3 can be found here:"}
{"text": "There are errors in Figure 4. The correct figure can be found here:"}
{"text": "There is a white circle in Figure 6 that was erroneously introduced into a panel on the left side. The following link provides the correct version of Figure 6:"}
{"text": "The line colors were switched in Figure 8A. Please see the corrected Figure 8 here:"}
{"text": "There was an error in Figure 4. The correct version is available here:"}
{"text": "There was an error in Equation 4. A correct version of the equation is available here:"}
{"text": "The name of the fifth author was spelled incorrectly. The correct name is: Serv\u00e9 Olieslagers."}
{"text": "There was an error in Table 5. A correct version of the table is available here:"}
{"text": "There was an error in Figure 3.The correct version is available here:"}
{"text": "Due to a technical error, there are missing symbols in Figure 6. Please view the correct Figure 6 file here:"}
{"text": "There was a typographical error in the legend of Figure 7. Different fonts were used."}
{"text": "There was an error in Figure 5, panel A. Please see the corrected Figure 5 here:"}
{"text": "There was an error in Figure 6. The corrected image of Figure 6 can be seen here: [^]"}
{"text": "Figure 5 was omitted from the PDF. The figure is available here:"}
{"text": "Figure 5 of the article by Becker et al. containe"}
{"text": "There was a formatting error in Table 6. Please see the corrected Table 6 here:"}
{"text": "The correct version of Figure 1 can be viewed here:"}
{"text": "There was a formatting error in Equation 9. The correct Equation 9 can be viewed here:"}
{"text": "I read with interest the article by I noticed this complex scenario in a survey of 22 patients reporting sick building syndrome . AlthougIt would be surprising if these illnesses did not share a common root in the immune system."}
{"text": "There was an error in Figure 8. The correct figure can be found here:"}
{"text": "The authors noted that three values in Table Additional Table 1.Click here for fileAdditional Table 2.Click here for fileAdditional Table 3.Click here for file"}
{"text": "The image currently appearing as Figure 10 is incorrect. Please see the correct Figure 10 here:"}
{"text": "In Figure 1, Panel F showing the logistic regression analysis of arrow impact over time is incorrect due to a mistake in the analysis script. Please view the corrected Figure 1 here:"}
{"text": "Synchronized bursting activity within the preB\u00f6tzinger complex (preB\u00f6tC) of the mammalian brainstem underlies the inspiratory phase of the respiratory rhythm. Experimental evidence suggests that neurons within the preB\u00f6tC are organized into clusters, such that neurons are synaptically coupled to several other neurons within their own cluster and a few neurons in each cluster have long reaching connections to other clusters . The pro"}
{"text": "A representative trace is present in error. Please see the correct Figure 1 here:"}
{"text": "Migraine is a common neurological disorder with a global prevalence around 10% . The fem"}
{"text": "Figure 9 is incorrect. The correct figure can be found here:"}
{"text": "The onset age is missing from the second column in Table 2. Patient KC43 was also erroneously identified as female. Please see the corrected Table 2 here:"}
{"text": "There is an error in Table 4. The correct table can be found here:"}
{"text": "Due to a technical error, there are missing symbols in Figure 7. Please view the correct Figure 7 file here:"}
{"text": "There is an error in Figure 5. The correct figure can be viewed here:"}
{"text": "There was an error in Figure 3. The correct Figure 3 can be viewed here: [^]"}
{"text": "The panels were labeled incorrectly. The correct Figure 3 can be viewed here:"}
{"text": "The heading \"Electrophysiological Task\" in Table 1 was misplaced into the table legend. It should appear above the lower half of the participant groups. Please see the correct Table 1 here:"}
{"text": "In Table 4, the letters c-q near the bottom of \"LCT haplotype\" were uppercase when they should be lowercase. Please see the corrected Table 4 here:"}
{"text": "The correct version of Figure 2 can be viewed here:"}
{"text": "There is an error in Figure 2. The correct Figure 2 image can be seen here: [^]"}
{"text": "The amount of virus actually injected was approximately 1.67x105 RNA copies. This does not affect the data or conclusions.The authors incorrectly report that 10"}
{"text": "There is an error in the pedigree squares for the affected dogs in Figure 5. Please view the correct Figure 5 here."}
{"text": "A panel in Figure 2 has now been obscured to remove copyrighted material. Please download this article again to view the"}
{"text": "There are numerical errors in the rT3 columns of Table 2 of the published article. Please see the correct"}
{"text": "Our original publication contains an erratic number of predicted antibiotic structures in Scheme 2. With this Erratum we provide the corrected Scheme 2."}
{"text": "Please download the PDF again to view the corrected article.This article was republished on September 22"}
{"text": "There are errors in Figure 2. Please see the corrected"}
{"text": "After publication of the original article , it cameThe captions for Figs. 4\u20137 have now been corrected in the original article."}
{"text": "There is an error in Equation 3. Please see the correct Equation 3 here."}
{"text": "The corrected Figure 1 appears in this erratum.In Figure 1A, which represents the association between the difference in BMI The authors regret this error."}
{"text": "IJMS [The authors wish to change Figure 2 in Section 2 of their paper published in IJMS . In Figu"}
{"text": "Fig 1 appears incorrectly in the published article. Please see the correct"}
{"text": "There are errors in Table 1. Please see the correct"}
{"text": "Network connectivity have been shown to play an important role in shaping the neuronal dynamics -5. A com"}
{"text": "The authors would like to clarify the figure presentation of Figure 7. A corrected legend for"}
{"text": "There are formatting errors in Table 2. In order to preserve the authors\u2019 original formatting, we have converted the table into a figure. Please see the corrected Table 2 as"}
{"text": "In the paper titled \u201cQuantitative Fraction Evaluation of Dermal Collagen and Elastic Fibres in the Skin Samples Obtained in Two Orientations from the Trunk Region\u201d in page 5 under Discussion Section paragraph 3 last line reference 15 should be read as reference 14 as follows:\u201cScar stretching occurs most frequently in the lower third of the scar overlying the xiphisternum and extending onto the abdomen [14].\u201dIn page 6 paragraph 3 one sentence (quoted below) gives wrong impression and should be corrected as follows:\u201cThe functional cause (the expansion of chest during respiration) leads to increase in the girth and hence stretch will be in horizontal direction. This necessitates more significant increment of collagen fiber content in horizontal direction than in its vertical direction (H > V) (Table 1).\u201d"}
{"text": "The gene LAMB1 appears incorrectly throughout the article. The correct gene name should be LMNB1. In"}
{"text": "S5 FigA marked difference in the presence of ITIMs is observed among the various FcRL members in frog. Some have up to 2 consensus ITAMs whereas many have not got a single canonical site or distantly related site.(TIF)Click here for additional data file."}
{"text": "Four oligonucleotide sequences are missing from S2 TableListed are the sequences of all oligonucleotides used in the experiments together with their modifications in the 3\u2032-free and 5\u2032-free ends respectively.(TIF)Click here for additional data file."}
{"text": "The key in Fig 3 was incorrectly labeled. The authors have provided a corrected figure here."}
{"text": "A patient concomitantly affected by breast cancer and melanoma is presented in order to contribute to the ongoing debate on breast cancer immunotherapy ,2. In 19"}
{"text": "In this Addendum, we provide Supplementary Table S6 which contains the periodicity scores of all genes as calculated by the MoPS algorithm. Supplementary Table S6Click here for additional data file."}
{"text": "After publication of this article , the autThe images provided for Fig.\u00a0In Fig."}
{"text": "Fig 1C is incorrectly included in the image of"}
{"text": "There is an error in Equation 1. Please see the corrected"}
{"text": "The table has since been corrected and renamed as Figure1, and the article has been corrected online.In the article \u201cWhen Planning Screw Fracture Fixation Why the 5.5\u200amm Screwis the Goldilocks Screw: An Observational Computer Tomographic Study of Fifth MetatarsalBone Anatomy in a Sample of Patients\u201d,"}
{"text": "PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies,\u201d the affiliations of the authors should be as shown above.In the paper titled \u201cPartial Gene Deletions of"}
{"text": "There are formatting errors in Table 2. The exponential equations should appear with superscript formatting. Please see the correct"}
{"text": "The 7th column in"}
{"text": "The figure legend for Fig 3 is incorrect. Please see the corrected"}
{"text": "The ferritin values in the second column of Table 1 are written incorrectly. The correct values should appear as 1 (n = 727) F\u22649.57. Please see the correct Tables 2\u20138 are misaligned in the published article. Please see the correctly aligned tables here."}
{"text": "The following information is missing from the Funding section: Marcus Munaf\u00f2 is supported by the MRC Integrative Epidemiology Unit at the University of Bristol."}
{"text": "Panel B of each figure is missing. Please see the complete"}
{"text": "Tables S1 and S2 were missing from the supplementary data. These errors have been corrected online.We apologise to the authors and readers for these mistakes."}
{"text": "The original version of this article unfortunately contained mistakes. Figures\u00a0The correct versions of Figs."}
{"text": "There is an error in the first sentence of the third paragraph in the Discussion. The correct sentence is: NF-\u03baB activation was blocked by either adenovirus-mediated overexpression of I\u03baB\u03b1 suppressor or pretreatment with MG132 in lung cancer cells [40]. The publisher apologizes for this error."}
{"text": "Table 4 was incorrectly captioned in the originally published version. The correct caption is \u2018Normalised differential"}
{"text": "The color legend is missing from the bottom part of Figure 1. The correct Figure 1 can be viewed here: f"}
{"text": "The published article incorrectly refers to the wheat 1A chromosome throughout the article. The correct chromosome is the wheat 5A chromosome."}
{"text": "There is an error in There is an error in S1 Table(DOC)Click here for additional data file."}
{"text": "The legends for Please see the complete, corrected Figure 3 here."}
{"text": "There are errors in Equation 1, Please see the corrected"}
{"text": "The text in Fig 1 highlighting rows of expression data by week is incorrectly reversed. The authors have provided a corrected version here."}
{"text": "Figure 5 is incorrect. The authors have provided a corrected version here."}
{"text": "The authors wish to change Figure 5D of the paper published in IJMS . In Figu"}
{"text": "The article has since been corrected online.In the article \u201cDifferent Prognostic Implications of"}
{"text": "Fig 2 appears incorrectly in the published article. Please see the correct"}
{"text": "Table 1 and Table 2 appear incorrectly in the published article. Please see the correct Tables"}
{"text": "Figure 4g in the original version of this article was misu"}
{"text": "During the third trimester of gestation fetal weight triples but Ca content quadruples with a faster increase in fetal body Ca accretion from 32 to 40 weeks of gestation ["}
{"text": "There is an error in Equation 1. Please see the correct Equation 1 here."}
{"text": "The publisher apologizes for the error.In the \u201cConnectivity from the right middle frontal gyrus (N"}
{"text": "All other values within Table 2 are correct.After publication of the original article , it came"}
{"text": "There is a shading error in the three molar shape reconstructions in Fig 3. Please view"}
{"text": "The incorrect image is used in Fig 7. Please see the correct"}
{"text": "In the paper published by Griffiths et al.\u00a0, the autThe authors apologize for this oversight."}
{"text": "Correction of image subtitlesThis article has received corrections in agreement with the ERRATUM published in Volume 72 Number 5."}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cRotating Night Shift Work and Healthy Aging After 24 Years of Follow-up in the Nurses' Health Study,\u201d"}
{"text": "The original article entitled \u201cBreviscapine prevents downregulation of renal water and sodium transport proteins in response to unilateral ureteral obstruction\u201d corresponded by Zhang Yan was published with incorrect pictures.Due to author request the pictures below should replace the ones in Figure 1 in the original article."}
{"text": "In the originally published version of this article, Methods S1 was missing fromthe supplemental information file due to a processing error. The complete supplementalinformation file now appears online with the article."}
{"text": "In this article the graphics relating to Figs.\u00a0The original article has been corrected."}
{"text": "Eligible patients were required to have 1 or more measurements of blood pressure before the measurement of cognition. This article has been corrected.1In the Original Investigation titled \u201cSex Differences in Cognitive Decline Among US Adults,\u201d"}
{"text": "In the original version of the article the wrong figure appeared as Fig.\u00a01; Fig.\u00a0The original article has been"}
{"text": "This article has been corrected at the request of the authors to replace Figures 3 and 4 with versions containing more accurately placed arrows."}
{"text": "The grant number should have been given as R21MH109783. This article has been corrected.1In the Original Investigation titled \u201cAssessment of Perceptions of Mental Health vs Medical Health Plan Networks Among US Adults With Private Insurance,\u201d"}
{"text": "The caption for Fig.\u00a07 has been incorrectly placed in the Results section of original publication.The original article has been corrected."}
{"text": "Authors would like to correct an error in Abstract.I53 must be I63The original article has been corrected."}
{"text": "Only the first author is affiliated with Yale University\u00a0School of Medicine. The other authors should have only one affiliation footnote listed for each (i.e., William LumryThe original article has been corrected."}
{"text": "In the recent article by Zhao et al.\u00a0, the mapThe authors apologize for the error."}
{"text": "The map was missing counties. This article has been corrected.1In the Original Investigation titled \u201cAssociation of Funding Cuts to the Patient Protection and Affordable Care Act Navigator Program With Privately Sponsored Television Advertising,\u201d"}
{"text": "The bold dashed line that appeared slightly to the right of the 2 value on the x-axis should have appeared in the position indicating \u201c1.98.\u201d This article has been corrected.1In the Original Investigation titled \u201cAssociation of Intravenous Potassium and Magnesium Administration With Spontaneous Conversion of Atrial Fibrillation and Atrial Flutter in the Emergency Department,\u201d"}
{"text": "In the original publication of the article, the authors noticed a mistake in Fig.\u00a0The original article has been corrected."}
{"text": "This article has been corrected: The authors found that Figure 5 contains the same graph panel for \u201cCell apoptosis (%)\u201d in Figures 5D and 5E. They replaced incorrect graph in Figure 5E with the panel corresponding to the wound healing assay graph measuring \u201cRelative migration level (%)\u201d from the original sets of experiments. This correction has no impact on the experimental outcome or conclusions.Figure 5 is presented below.Corrected"}
{"text": "In Fig.\u00a01 of this article an arrow was misplaced; the corrected Fig."}
{"text": "Following publication of the original article, the authors identified that they provided the wrong Funding Information. The correct grant reference number is 2020R1A4A1018598.The original article has been"}
{"text": "Following publication of the original article [1], there is a formatting error in Tables The original article has been corrected."}
{"text": "Please download this article again to view the correct version.This article was republished on December 29"}
{"text": "Following publication of the original article [1], the authors identified some errors in the Additional files 1\u20135.The original article has been"}
{"text": "This article was updated to remove black boxes introduced to Fig. 2 after the author reviewed proofs\u00a0and to change the placement of the quoted text."}
{"text": "The authors of the article by Claire Hopton et al.\u00a0 noticed The correct Figure 9b is as follows:The publisher apologizes for this error."}
{"text": "In the recent article by Silliman et al.,\u00a0, the visThe authors apologize for the error."}
{"text": "In the original publication of the article figure\u00a01 is incorrectly published. The correct Figure"}
{"text": "In Sun et al.,The correct Figure\u00a0The authors apologize for the error."}
{"text": "In this article Fig.\u00a02 is incomplete in the PDF. The Fig.\u00a0The original article has been corrected."}
{"text": "The authors regret that the original article contains unintentional misuse of tubule formation images in Figure 6C and Figure 7B during figure assembly. The correct versions of Figure 6C and Figure 7B are shown here below. The replacement does not alter result interpretation and conclusion. The authors are deeply sorry and sincerely apologize for any inconvenience or misunderstanding that may have caused."}
{"text": "One of the nonauthor collaborators was missing. This article has been corrected.1In the Original Investigation titled \u201cAdjunctive Transdermal Cannabidiol for Adults With Focal Epilepsy,\u201d"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cPrevalence of Hearing Loss and Hearing Aid Use Among Adults in France in the CONSTANCES Study,\u201d"}
{"text": "Footnotes were added to clarify the types of data shown in the 2 right columns. This article has been corrected.1In the Original Investigation titled \u201cEffect of Graphic Warning Labels on Cigarette Packs on US Smokers\u2019 Cognitions and Smoking Behavior After 3 Months: A Randomized Clinical Trial,\u201d"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssessment of Clinician Diagnostic Concordance With Video Telemedicine in the Integrated Multispecialty Practice at Mayo Clinic During the Beginning of COVID-19 Pandemic From March to June 2020,\u201d"}
{"text": "The hazard ratio comparison for gait speed plus Hopkins Verbal Learning Test-Revised score decliners vs nondecliners should have appeared as 24.9 . This article has been corrected.1In the Original Investigation titled \u201cAssociation of Dual Decline in Cognition and Gait Speed With Risk of Dementia in Older Adults,\u201d"}
{"text": "In the sections of \"Abstract\", \"Patients and Methods\u201d and Table 1, 31 April should be corrected to 30 April.The original article has been corrected."}
{"text": "In the recent article by Monnet et al.\u00a0, the hatThe authors apologize for the error."}
{"text": "This article has been corrected.1In the Research Letter titled \u201cGender Parity in Authorship of Published Randomized Clinical Trials in Stroke Neurology From 2000 to 2021,\u201d"}
{"text": "Due to a processing error a portion of Fig. 2b is missing in the original article. The corrected figure follows:"}
{"text": "Recently, we conducted an examination of our published article and found errors in Fig 5A.In Fig"}
{"text": "In the original publication of the article, the Table 1 caption is wrongly published. The correct caption is given below:Table 1 Characteristics of two cohorts of women age 50\u2009+\u2009Y who had breast cancer screening either in 2017 or 2018, overall and stratified by whether they had a subsequent screening two years following."}
{"text": "The correct number should have been 2/3. This has now been corrected in both the HTML and PDF versions of this Article."}
{"text": "With the author(s)\u2019 decision to opt for OpenChoice, the copyright of the article is changed to \u00a9 The Author(s) 2021 and thearticle is forthwith distributed under a Creative Commons Attribution 4.0International License (The original article has been corrected."}
{"text": "S3 Table was published with corrective annotations. Please view the correct version of S3 Table here. The publisher apologizes for the error."}
{"text": "The image of Figs.\u00a01 and 3 were interchanged in the Original published proof.The Original article has been corrected."}
{"text": "The symbols in the key for firearm deaths and asphyxiation deaths were inadvertently transposed. This article has been corrected.1In the Research Letter titled \u201cTemporal Trends in Suicide Methods Among Adolescents in the US,\u201d"}
{"text": "In the recent article by Manning et al.\u00a0, the autScat as a source of DNA for monitoring herbivorous reptile populations."}
{"text": "The authors of the article by Shigehiko Ogoh et al.\u00a0 noticed"}
{"text": "The original version of this article unfortunately contained a mistake. The statistical chart in Fig.\u00a0The corrected Fig."}
{"text": "Following publication of the original article , the autThe corrected Fig.\u00a0The original article has been corrected."}
{"text": "The original version of this article unfortunately contained some mistakes in figure. The authors found that explanation of the data lines in Fig.\u00a05b is wrong.The corrected version of Fig.\u00a05b is given below:"}
{"text": "The authors would like to make the following corrections to the published paper .Replacing the Institutional Review Board number 2019800990B0 with 201800990B0."}
{"text": "In Vivo: A Review\u201d should htigation shed ligWe thus believe that the results presented in the current metanalysis are incomplete since the omitted patient number is half of the included (55 omitted vs. 130 included) . Compris"}
{"text": "The original article containeThe original figures and data of Fig.\u00a0The corrected Fig."}
{"text": "The color representing Utah was transposed with the color representing Minnesota. This article has been corrected.1In the Original Investigation titled \u201cUS Geographical Variation in Rates of Shoulder and Knee Arthroscopy and Association With Orthopedist Density,\u201d"}
{"text": "The original version of this article unfortunately contained a mistake in Table 2. The corrected Table"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssessment of the Appropriateness of Antimicrobial Use in US Hospitals,\u201d"}
{"text": "Following publication of the original article , the autThe incorrect Fig.\u00a0 and corr"}
{"text": "In the section describing subcategories of reason for suicide that had 1 month with an excess suicide rate among women, the excess suicide rate for work fatigue should have read 133.3%. This article has been corrected.1In the Original Investigation titled \u201cReasons for Suicide During the COVID-19 Pandemic in Japan,\u201d"}
{"text": "Figure 3 was originally published in\u00a0Expert Reviews in Molecular Medicine (2001) Cambridge University Press. This information was mistakenly deleted from the figure legend during revisions and has now been re-added to the Figure 3 legend. Cureus regrets the error."}
{"text": "Unfortunately, the original publication of the article has an error in the labelling on Fig.\u00a0The original article has been corrected."}
{"text": "In the original publication figures\u00a07 and 11 need be updated with correct values. The correct version of Figs."}
{"text": "An incorrect version of the figure was published. This article has been corrected.1In the Original Investigation titled \u201cAssociation of Expanded Health Care Networks With Utilization Among Veterans Affairs Enrollees,\u201d"}
{"text": "Please see the correct In 2cumc for Eggs should be (0.02). Please see the correct In"}
{"text": "Journal of Cardiovascular Magnetic Resonance there were 3 articles [In volume 24 of the articles \u20133 with aThe original articles have been updated."}
{"text": "In We have noticed inadvertent errors in our article published in the December 2018 issue of Aging Dis (2018 9(6):"}
{"text": "In , the FigThe correct Figure 1 should be:"}
{"text": "The percentage of female patients given as 56.3 should have been 53.6. This article has been corrected.1In the Original Investigation titled \u201cYield and Utility of Germline Testing Following Tumor Sequencing in Patients With Cancer,\u201d"}
{"text": "Following publication of the original article , the autThe original version of figure Fig.\u00a0 is proviThe original article has been revised."}
{"text": "Following the publication of the original article , we wereThe corrected Fig.\u00a0The original article has been corrected."}
{"text": "The authors became aware that the representative Ki67\u2010staining image of the ipatasertib tumor had been displayed twice in the figure set. The authors state that the image displayed in Figure\u00a0Source Data for Figure\u00a05GClick here for additional data file."}
{"text": "In the right notes of Fig.\u00a0There add efferent nerve fibers at the bottom of hair cells in both Figs. The authors found mistakes in 2 figures of their publication \"Progress in protecting vestibular hair cells \", published online 13 May 2021. They have redrawn Fig."}
{"text": "After publication of this article , it is nThe correct Fig.\u00a0The original article has been updated."}
{"text": "The original version of this article unfortunately contained a mistake. There is one small mistake in Table 4.The corrected Table"}
{"text": "The corrected figure 4 is shown below:In the recent article by Cabugao et al. , the aut1"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssociation of Youth Age at Exposure to Household Dysfunction With Outcomes in Early Adulthood,\u201d"}
{"text": "In the article by Jiao et al.,Corrected Figure 4A."}
{"text": "Their correct affiliation is affiliation 1, This has now been corrected in the original article."}
{"text": "In the original publication there waThe updated 24 and 48 FACS plots are published in this correction article as Fig."}
{"text": "The authors used only 60 fmol of DNA template per 10 \u03bcl PURE reaction.In Materials and Methods, under the section \u2018Expressing protein and measuring fluorescence The authors apologise for this error."}
{"text": "During Figure\u00a01 preparation the carboxyl group in the AdoMet structure on panel B were accidentally not included. Peptide bonds were missing a hydrogen on several panels."}
{"text": "There are errors in S4 FileR script example to perform an analysis of distance.(TXT)Click here for additional data file."}
{"text": "The original version of the aIt has been corrected in this correction Figs.\u00a0 and 6.Fi"}
{"text": "It should have stated that grant T32NR009356 to Ms Foxwell was from the National Institutes of Health. This article has been corrected.1In the Original Investigation titled \u201cExperiences of Patients After Withdrawal From Cancer Clinical Trials,\u201d"}
{"text": "The label has been updated from 28 to 364 days to 0 to 11 months. This article has been corrected.1In the Original Investigation titled \u201cVariation in Health Care Access and Quality Among US States and High-Income Countries With Universal Health Insurance Coverage,\u201d"}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAnalysis of Therapeutic Inertia and Race and Ethnicity in the Systolic Blood Pressure Intervention Trial: A Secondary Analysis of a Randomized Clinical Trial,\u201d"}
{"text": "In the article titled \u201cNav1.7 via Promotion of ERK in the Trigeminal Ganglion Plays an Important Role in the Induction of Pulpitis Inflammatory Pain\u201d ["}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssessment of Functional Mobility After COVID-19 in Adults Aged 50 Years or Older in the Canadian Longitudinal Study on Aging,\u201d"}
{"text": "On page 8 symbol \u2018On page 12 symbol \u2018On page 16 symbol \u2018On page 21 Appendix B symbol \u2018On page 22 Appendix C symbol \u2018The authors wish to make the following correction to this paper . In our The changes do not influence substantive meaning and the obtained scientific results. The original article has been updated."}
{"text": "Error in Figure**Figure 1** as published. **The number 10 in Figure 1a needs to be replaced with 100**. The corrected **Figure 1** appears below.In the original publication , there wThe authors apologize for any inconvenience caused and state that the scientific conclusions are unaffected. The original publication has also been updated."}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssessment of Additional Medical Costs Among Older Adults in Japan With a History of Childhood Maltreatment,\u201d"}
{"text": "In the originally published version of this paper, figure 3 was missing a panel. This has now been corrected online."}
{"text": "This article has been corrected.1In the Invited Commentary titled \u201cOn the Lack of Native Hawaiian and Pacific Islander Individuals in the Physician Workforce,\u201d"}
{"text": "Following publication of the original article , the autThe incorrect Fig.\u00a0 and corr"}
{"text": "The colors of these curves have been switched to correctly match their respective keys. This article has been corrected.1In the Original Investigation titled \u201cAssociation of the Frequency and Quantity of Alcohol Consumption With Gastrointestinal Cancer,\u201d"}
{"text": "Authors would like to correct the errors in Supplementary Table 1. The revised\u00a0version of the Supplementary Table 1 is updated here.The original article has been corrected.Supplementary file1 (DOCX 19 kb)Below is the link to the electronic supplementary material."}
{"text": "In the original publication Table 1 has been removed as the authors did not obtain permission to\u00a0reproduce the BODY-Q scale. A revised Table The original article has been corrected."}
{"text": "In the figure key, the dark blue color should indicate the rate of long-acting reversible contraception use within 60 days post partum and the light blue color should indicate the rate of most or moderately effective contraception use within 60 days post partum. This article has been corrected.1In the Research Letter titled \u201cPostpartum Contraceptive Use Among US Medicaid Recipients,\u201d"}
{"text": "The original version of this article unfortunately contained a mistake. The presentation of Fig.\u00a02 was incorrect. The corrected Fig.\u00a0The original article has been corrected."}
{"text": "There is a typo in Eq 1. A log2 is missing before the fraction"}
{"text": "This article was originally published with Figure 2 appearing twice . The correct Figure 3 has now been uploaded to the article. Cureus regrets this error."}
{"text": "This article was updated to correct the labeling of Fig.\u00a06."}
{"text": "The original version of this article unfortunately contain some mistakes in figure. The authors found that the curves in Fig.\u00a0The corrected version of Fig."}
{"text": "In the original publication of the article, an unwanted asterisk was found in Fig. 3. The correct Fig.\u00a0The original article has been updated."}
{"text": "In Pan et\u00a0al.,The correct Figure The online version of this article has been corrected.The publisher regrets this error."}
{"text": "The summands in Equations 1)\u2013(3) in the original paper [\u2013(3) in tAny references to these equations appearing in the text should be modified accordingly."}
{"text": "Following the publication of this article , it was The x and y axis were accidentally omitted from Fig.\u00a0MaoB hemmer was erroneously used instead of the English term MaoB inhibitor in Fig.\u00a0The errors:The above errors have been corrected in the original version of this article ."}
{"text": "Please see the corrected There is an error with the Turn content of the SEE pH 6.0 Zn"}
{"text": "Unfortunately this article was publFundingEAACI and the BM4SIT project (Grant Number 601763) in the European Union\u2019s Seventh Framework ProgrammeFP7."}
{"text": "There are missing axes in Fig 1. Please view the correct"}
{"text": "It came to our attention that a paper has recently been published concerning one of the GEO datasets GSE34413) we cited in our published paper 3 we cite. In orde"}
{"text": "Actin forward primer: 5\u2032 ACCGCGAGAAGATGACCCAG 3\u2032Actin reverse primer: 5\u2032 AGGTCCAGACGCAGGATGG 3\u2032The authors wish to make the following correction to their paper . The seqThe authors would like to apologize for any inconvenience caused. The change does not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage."}
{"text": "In the original publication of this article Fig. 1 w"}
{"text": "After publication of this work it was nPlease see below the correct versions of Figs.\u00a0We apologise for these errors."}
{"text": "Unfortunately this article was publFundingEAACI and the BM4SIT project (Grant Number 601763) in the European Union\u2019s Seventh Framework Programme FP7."}
{"text": "Encrustation constitutes a serious complication of ureteral stent use and can result in difficult stent removal. We report the case of a patient with a retained ureteral stent for 3 years following a radical cystectomy."}
{"text": "In the original publication the supplementary figures have been missed out in the supplementary file section. The correct supplementary figures are provided in the link below.Supplementary material 1 (DOCX 902\u00a0kb)Below is the link to the electronic supplementary material."}
{"text": "The author found errors in Table\u00a01 after publication of the original article [The corrected Table"}
{"text": "We found a mistake when we read our article. In figure 6, the band of cleaved caspase\u20101 was not about cleaved caspase\u20101. The incorrect figure 6should be replaced with the revised and corrected figure 6.should be replaced with the revised and corrected figure 6."}
{"text": "In the Author Contributions section, Mar\u00eda Silvina Fornasari should be listed as one of the persons involved in conceptualization."}
{"text": "Fig 11 is incorrect. The authors have provided a corrected version here."}
{"text": "The term \u201cnutritional offer\u201d appears incorrectly throughout the paper. The correct term should be \u201cnutritional intake.\u201dFig 1 and its caption appear incorrectly in the published article. Please see the correct There are errors in Table 2 of the published article. Please see the correct"}
{"text": "Yongzhe Li was not originally credited as a corresponding author in the article. The article has since been corrected online.In the article \u201cDiagnostic Potential of Zymogen Granule Glycoprotein 2 Antibodies as Serologic Biomarkers in Chinese Patients With Crohn Disease\u201d,"}
{"text": "The mistake was corrected on 12 Feb 2018.In the article \u2018"}
{"text": "A formatting error was introduced into Table 3 during article production. Please view the correct table here. The publisher apologizes for the error."}
{"text": "A correct version of Fig. 1 is provided below.In the above article incorrect units were given for intrinsic leaf TE"}
{"text": "This article was republished on May 21, 2018 to replace an incorrect version of S1 Table. Please download this article again to view the corrected table."}
{"text": "Bar graphs are missing from Fig 3A of the published article. Please see the correct"}
{"text": "There is an error in The images in Fig 3 are incorrectly duplicated in Fig 5 is incorrectly duplicated in The publisher apologizes for these errors."}
{"text": "Unfortunately this article was publFundingEAACI and the BM4SIT project (Grant Number 601763) in the European Union\u2019s Seventh Framework Programme FP7."}
{"text": "Over a million new cases are reported every year from more developed regions of the World [1], more so among young adults \u201d. Please note the corrected statement with respect to the above mentioned line: \u201cOver a hundred thousand new cases are reported every year from more developed regions of the World [1], more so among young adults \u201d.The authors regret the error published in Introduction Section on Page 1, Line 7: \u201cThe authors would like to apologise for any inconvenience caused."}
{"text": "This duplication arose during consolidation of images into the composite figure where the H9 well image was inadvertently inserted for both panels. The revised"}
{"text": "In the original publication of this article Fig.\u00a02 has been incorrectly published. The correct Fig."}
{"text": "Please view the correct tert\u2212/\u2212 Fin lane shown. Further clarification and copies of the original gels can be found in In panel A of S1 File(DOCX)Click here for additional data file."}
{"text": "Fig 2 is incomplete as Panel C is missing. The authors have provided the complete"}
{"text": "The following information is missing from the Funding section: The study was funded by the open access publication funds of the Ruhr-Universit\u00e4t Bochum."}
{"text": "The original article [1] contains an error whereby the caption in Figure"}
{"text": "The authors have incorrectly referenced a GATA2 Inhibitor as K1747 throughout the paper and supporting information files. The correct GATA2 inhibitor is K7174."}
{"text": "Fig 7 appears incorrectly in the published article. Please see the correct"}
{"text": "There is an error in Equation 4. It should read:"}
{"text": "There are errors in the plus-minus symbols in Fig 5D. The authors have provided a corrected"}
{"text": "The following information is missing from the Funding section: This project has received funding from the European Union\u2019s Horizon 2020 research and innovation programme under grant agreement No. 696656 \u2013GrapheneCore1."}
{"text": "Unfortunately this article was publFundingEAACI and the BM4SIT project (Grant Number 601763) in the European Union\u2019s Seventh Framework Programme FP7."}
{"text": "Fig 6B appears incorrectly as a duplicate of Fig 6C in the published article. Please see the correct"}
{"text": "Please see the correct figure here.In panel G of"}
{"text": "Splenogonadal fusion usually presents as a left scrotal mass but rarely is the diagnosis suspected preoperatively. Herein, we present the first report of a left splenogonadal fusion which was suspected preoperatively by doppler ultrasonography in a 2 year old boy."}
{"text": "Multiple formatting errors were introduced into Tables 3, 6 and 7 in the preparation of this article for publication. Please view the correct tables here: f f f"}
{"text": "This article was republished on January 24, 2018 to replace an incorrect version of S1 Dataset. Please download this article again to view the correct version."}
{"text": "There are errors in the alignment of the data presented in Tables 2\u20136. Please see the corrected Tables 2\u20136 within S1 File(PDF)Click here for additional data file."}
{"text": "The image for Fig 8 is incorrectly duplicated in"}
{"text": "The effects of adenosine A2A receptors on the cells and tissues of healing wounds have only recently been explored. We review here the known effects of adenosine A2A receptor occupancy on the cells involved in wound healing.Recent studies have demonstrated that application of topical adenosine A"}
{"text": "The correct spelling should be \u201cLevantiniella.\u201dThere is a spelling error throughout the manuscript. The spelling for the new genus"}
{"text": "The captions for Figures 3 and 4 were switched during the production process. BMC HSR apologises for this error. The caption for Figure 3 should read \u2018Revised draft of SHARE framework\u2019. The caption for Figure 4 should read \u2018Model for exploring Sustainability in Health care by Allocating Resources Effectively in the local healthcare setting\u2019."}
{"text": "This article was republished on May 18, 2018 to replace an incorrect version of S1 File. Please download this article again to view a corrected file."}
{"text": "There are values missing from the SD column in Table 1. Please see the corrected"}
{"text": "It has been highlighted that in the original manuscript Table S3"}
{"text": "Saccaromyces should be spelt Saccharomyces in Table Kluveromyces should be spelt Kluyveromyces in Table Table 5 disjoint removed subsets of genes, with standard deviations bracketed and not \u201810 removed subsets\u2019 as per the original article. (Table 4)The legend for Table 4 should read: \u2018Numbers shown are rounded mean values from After publication of the original article the authThe original article has been corrected.Corrected versions of all figures and tables are included in this Erratum:Corrected Table Corrected Table 4"}
{"text": "Figure 2 was not reproduced correctly due to a problem during generation of a postscript file submitted for production. Please view the correct figure here:"}
{"text": "There was an error in Figure 6. Panels O and S were duplicated. The correct version of Figure 6 is available here:"}
{"text": "Figure 3 was incorrect as published. Please see the corrected figure here:"}
{"text": "The legends for Figures 1-8 were published with the words \"and carotenoids\" inserted into the text by mistake."}
{"text": "There was an error in part D of Figure 5C. Part D was incorrectly a duplicate of part C. The corrected figure is available here:"}
{"text": "The Figure 7 Legend is incorrect. The correct legend should read:"}
{"text": "Part C in Figure 6 was missing. See the correct figure here:"}
{"text": "In Table 1, the center row of data is misaligned. Please view the corrected Table 1 here:"}
{"text": "Figure 2 contains a typographic error. One of the centroid labels should be \"E\" instead of \"K\". Please view the correct figure here:"}
{"text": "Figure 1 was published with the labels for Savannas and Woody Savannas reversed in part A. Please view the correct figure 1 here:"}
{"text": "Table 2 was not formatted correctly in the published article. The correct version is available here:"}
{"text": "In Figure 2A, the word \"Hypothalamus\" is missing from the key. Please view the corrected Figure 2 here:"}
{"text": "The resolution in Figure 7 is too low, making the figure illegible. Please view a revised version of Figure 7 here:"}
{"text": "There was an error in the y-axis label of Figure 2B. The corrected figure is available here:"}
{"text": "After publication of this work we realiCorrected table 2.Click here for file"}
{"text": "A row of data is incorrect. Please view the corrected Table 1 here:"}
{"text": "The flow cytometry dot plots in the left panels of Figure 3 were duplicates. Please see the corrected figure here:"}
{"text": "Table 1 was not included in the published article. The table is available here:"}
{"text": "There were formatting errors and missing data in Table 1. The corrected table is available here:"}
{"text": "If our reasoning is accepted then they are absent from normal cells, and thus restricted in vivo to malignant cells.(3) Tumour type antigenic molecules are at least 10(4) Hyperplastic tissues do not contain cancer basic protein.(5) Human chronic lymphatic leukaemic leucocytes possess the same type of cancer antigenic activity as solid tumours. This antigenic activity is not shared by normal lymphocytes."}
{"text": "In the Methods section, Equation 2 is incorrect. Please see the correct equation here:"}
{"text": "Some text in Figure 1 was incorrectly replaced by symbols. Please view the correct figure here:"}
{"text": "The headings in Table 1 are incorrect. Please view the correct table here:"}
{"text": "There was an error in Figure 2. Please view the correct figure here:"}
{"text": "Table 1b is not displayed correctly in the published article. Please see the correct Table 1 here:"}
{"text": "There was an error in the numbering in Figure 1A. The corrected figure is available here:"}
{"text": "The different time distribution of mortality for 1173 patients undergoing mastectomy in comparison with 250 untreated patients suggests that primary tumour removal could result in changes of the metastatic process even for breast cancer. \u00a9 2001 Cancer Research Campaign"}
{"text": "Table 1 one is incomplete. See the correct version here:"}
{"text": "There was an error in Figure 3. The corrected figure is available here:"}
{"text": "Table 1 was not formatted correctly in the published article. The correct version of Table 1 is available here:"}
{"text": "The two histograms in Figure 4B were incorrectly switched. Please view the corrected version of Figure 4 here:"}
{"text": "The plus/minus symbols were left out of the second through fifth columns of Table 4. Please view the correct Table 4 here:"}
{"text": "The sequence shown in Figure 1C is incorrect. Please view the entire corrected figure here:"}
{"text": "The values in the first column of table 1 were published incorrectly. Please view the corrected table here:"}
{"text": "In Figure 6, panel C is a duplicate of panel B. The correct Figure 6 can be viewed here:"}
{"text": "Figure 3 is incorrect. A detailed explanation can be found in the Comments section ofthis article. Please view the corrected figure and legend here:"}
{"text": "Sir,3. It would help to clarify if there was any difference in average age and CD4 counts among males and females.I have read the article \"A prospective observational cohort study to elicit adverse effects of antiretroviral agents in a remote resource-restricted tribal population of Chhattisgarh\". It was a2"}
{"text": "The results in the section titled \"Increasing Bias with Larger Datasets\" have changed, which affects the data in Figure 6. Please view the corrected Figure 6 here:"}
{"text": "Figure 2 is incorrect. The correct figure can be viewed at:"}
{"text": "We present this case of an unusual recurrence of a periosteal osteosarcoma in the distal right tibia 2 years after a successful proximal right tibia primary periosteal osteosarcoma excision with a successful fibular graft. This recurrence lead to a right below-knee amputation."}
{"text": "Several references in the rightmost column of Table 9 are incorrect. Please see the corrected table here:"}
{"text": "In the Results section, there was an error in Equation 3. Please view the correct equation here:"}
{"text": "The published Table 2 is an incorrect version. Please see the correct table here:"}
{"text": "The image for Figure 6 represents the wrong data set. Please view the correct figure here:"}
{"text": "The symbols in Figure 1 appear incorrectly. Please view the corrected figure here:"}
{"text": "CYP19 gene codes for the aromatase enzyme that is involved in the synthesis of oestrogens. This case\u2013control study examines the relationship between a tetranucleotide repeat sequence in the CYP19 gene and the development of male breast cancer. No significant differences were found between male breast cancer cases and controls. \u00a9 2000 Cancer Research CampaignThe"}
{"text": "In Figure 2, the bootstrap support values indicated in the legend have been omitted in the figure. Please view the correct Figure 2 here:"}
{"text": "The subheadings on figure 6 are incorrect. The correct figure can be viewed here:"}
{"text": "Patients with small-cell lung cancer who survive more than 2 years have a significantly increased risk (relative risk of 3.6) of developing a second primary tumour. The cessation of cigarette smoking after successful therapy is associated with a significantly decreased risk of a second primary tumour."}
{"text": "The subheadings on figure 8 are incorrect. The correct figure can be viewed here:"}
{"text": "A row of data was inadvertently left out. Please view the corrected Table 2 here:"}
{"text": "A line is missing from Table 4. Please view the correct table at:"}
{"text": "The plus/minus symbols were left out of the second through fifth columns of Table 5. Please view the correct Table 5 here:"}
{"text": "Dear Editor,We appreciate the opinions about our article by Wiwan35"}
{"text": "The authors wish to bring to the readers' attention typographical error identified in Supplementary Table\u00a02 with the online version of the article showing the dose constraints guidance used for 3D conformal planning for total prescription dose of 36Gy in 6 fractions"}
{"text": "The third column of Table 2 incorrectly repeated the second column header 'GERD without chest pain' instead of the correct 'GERD with\u00a0chest pain'.The Table header has been revised to correct this error and is now correctly labeled 'GERD with\u00a0chest pain'."}
{"text": "There are a number of errors in the formatting of Table 3. The authors have provided a corrected Table 3 below as Supporting Information file S1 FileThemes emergent across participants\u2019 assessments of advantages and disadvantages of contraception requirements.(PDF)Click here for additional data file."}
{"text": "It has been highlighted that in the original manuscript Fig. 1 w"}
{"text": "The correct spelling in all cases is circZKSCAN1."}
{"text": "These table values did not match the values in the Results section. This article has been corrected.1In the Original Investigation titled \u201cEstimated Changes in Manufacturer and Health Care Organization Revenue Following List Price Reductions for Hepatitis C Treatments,\u201d"}
{"text": "After the publication of this article [1], we noticed that in Fig."}
{"text": "This occurred due to a production error. The corrected Table is shown below.In the article titled \u201cIncreased Expression of TLR10 in B Cell Subsets Correlates with Disease Activity in Rheumatoid Arthritis\u201d ["}
{"text": "With great interest we read the article by Lin et al. about thInsulin therapy is a cornerstone therapy for many patients with type 2 diabetes . Initial"}
{"text": "Figure 2 of this paper has been amended to correct a formatting error.The corrected figure is displayed below."}
{"text": "The original version of this article unfortunately contained a mistake in Table\u00a0The original article has been corrected."}
{"text": "This error occurred during the production process. The correct figure is shown below.In the article titled \u201cMolecular Responses of Human Retinal Cells to Infection with Dengue Virus,\u201d there wa"}
{"text": "The original article was published with an erroneously duplicated image in Fig.\u00a02a. The corrected Fig."}
{"text": "The original version of this article unfortunately contained a mistake.The presentation of Table 1 and ESM 1 have been published incorrectly. Corrected units have been provided for LDL-C values. The corrected Table\u00a0Supplementary material 1 (PDF 206 kb)Below is the link to the electronic supplementary material."}
{"text": "As noted by Xuangzhi Cao and Qun Chen the term mentclass2pt{minimRegarding [Let mentclass2pt{minimWe have the following Bochner formula (formula (4.3) in )\\documenentclass1pt{minimaRegarding the second statement, we want to mention that the original proof is correct. Via the maximum principle we thus obtain the following in )\\documenWe also correct several typos in ["}
{"text": "The first author's name was erroneously entered as\u00a0Jehan S Abdou Soliman .The correct first author has been added to the article: Ayman Fathy Abdelhaleim."}
{"text": "S1 TableBolds are the maximum absolute variable loadings among PCA axes in each variable. Only PCA axes that explained at least 10% of data variability are shown.(PDF)Click here for additional data file."}
{"text": "Table 3 of this original publication contained some errors. The updated Table 3 is published in this correction article."}
{"text": "After the publication of this work 1] an error in Fig. an error"}
{"text": "The authors have provided a corrected version here.There is an error in The artifacts presented here are plotted in Fig 16."}
{"text": "In the original publication the Supplementary Material and Fig.\u00a02 are incorrect. The correct version of Supplementary Material and Fig.\u00a0Supplementary material 1 (PDF 677 kb)Below is the link to the electronic supplementary material."}
{"text": "Following the publication of this article , the autIn Fig.\u00a0In Fig.\u00a0The authors regret any confusion caused by this error. The correct version of Fig."}
{"text": "There are errors in Please see the corrected S2 TableS2 data set is different from original source.(CSV)Click here for additional data file."}
{"text": "The key should have listed surgical complications in blue text and nonsurgical complications in black text. This article has been corrected.1In the Original Investigation titled \u201cAssessment of Postdonation Outcomes in US Living Kidney Donors Using Publicly Available Data Sets,\u201d"}
{"text": "Following publication of the original article , the autThe correct Table 3 Table\u00a0 here is The original publication of this article has been corrected."}