diff --git "a/deduped/dedup_0583.jsonl" "b/deduped/dedup_0583.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0583.jsonl"
@@ -0,0 +1,61 @@
+{"text": "The PLoS Medicine editors discuss a paper about the difficulties of identifying what makes a good peer reviewer, and the process of peer review in PLoS Medicine. PLoS Medicine, which assessed 2,856 reviews of 306 experienced reviewers at one well-regarded specialty journal. The study concluded that the only significant positive predictors of review quality were reviewers who were less than 10 years out of training or those that worked in a teaching hospital environment.Skill in scientific peer review may be as ill defined and hard to impart as is \u201ccommon sense\u201d . So say These are somewhat alarming conclusions for us, as editors of a peer-reviewed journal, but not ones that are completely surprising. A previous study concluded that the only predictor of good performance of reviewers of a general medical journal was prior training in epidemiology or statistics   As authors know to their frustration, on occasion a single review in one direction can weigh more heavily than two or more reviews in the other; editorial decisions are not made by counting beans but by taking many factors into account. The reviewers' comments are important, but so are the overall aims of the journal and other manuscripts submitted.Whatever the specific procedure and level of intensity, journal peer review hinges on a single factor, not always obvious to authors, namely, a separation between evaluation and decision making. As explained by the entry on Wikipedia , \u201creferePLoS Medicine could not survive without its reviewers. All the above is a rather long-winded way of leading up to the main point of this editorial, which is to thank the reviewers and academic editors who have provided tremendous advice to PLoS Medicine in our first two years. We have listed them all at http://journals.plos.org/plosmedicine/reviewthanks.php.Subjectively, however, reviewers provide a tremendous amount of valuable advice to editors. As Callaham and Tercier say, \u201cMost authors and editors would probably agree that the quality of peer review is crucial to selecting and publishing the best science\u201d and, furthermore, that that peer review improves the quality of published manuscripts. A journal such as Our second aim is introduce some minor changes to our system. Currently, we encourage but do not mandate open peer review, i.e., we encourage reviewers to sign their reviews, but reviewers may remain anonymous if they prefer, although we ask them to justify why. In the two years since we launched, we have found that most reviewers of research articles do not sign . When asked why they wish to remain anonymous, reviewers provide comments such as \u201cfear\u201d; \u201cthis author is not a forgiving person\u201d; that they do not wish to be contacted directly by authors; and perhaps the most common: \u201cS/he reviews my grants.\u201d Based on our experience, most reviewers of original research are therefore not comfortable with open review. Also, we have found a bias in that reviewers are more likely to sign positive reviews. Previous trials have suggested that requiring that reviews be signed has no effect on the quality of the review ,11, but So what makes a good reviewer? There are no simple answers, but a great place to start is the guidelines  laid outAnd to make our main point again: thank you to all our reviewers and academic editors. We are continually astounded by the insight and the time and care spent on what is a largely thankless task. Whatever the limitations of the process overall, the advice of our reviewers is crucial to us."}
+{"text": "The purpose of this study was to determine the inter-rater agreement between reviewers on the quality of abstract submissions to an annual national scientific meeting  to identify factors associated with low agreement.All abstracts were submitted using an on-line system and assessed by three volunteer CAEP reviewers blinded to the abstracts' source. Reviewers used an on-line form specific for each type of study design to score abstracts based on nine criteria, each contributing from two to six points toward the total (maximum 24). The final score was determined to be the mean of the three reviewers' scores using Intraclass Correlation Coefficient (ICC).495 Abstracts were received electronically during the four-year period, 2001 \u2013 2004, increasing from 94 abstracts in 2001 to 165 in 2004. The mean score for submitted abstracts over the four years was 14.4 (95% CI: 14.1\u201314.6). While there was no significant difference between mean total scores over the four years (p = 0.23), the ICC increased from fair  to moderate . Reviewers agreed less on individual criteria than on the total score in general, and less on subjective than objective criteria.The correlation between reviewers' total scores suggests general recognition of \"high quality\" and \"low quality\" abstracts. Criteria based on the presence/absence of objective methodological parameters  resulted in higher inter-rater agreement than the more subjective and opinion-based criteria. In future abstract competitions, defining criteria more objectively so that reviewers can base their responses on empirical evidence may lead to increased consistency of scoring and, presumably, increased fairness to submitters. There is a large body of valuable and high-quality research that is, for whatever reason, never published in full manuscript format,2. In faThe goal of abstract review is to screen for submissions that are acceptable for inclusion in a conference program . The ability to effectively identify high-quality abstracts worthy of acceptance, presentation, and possible publication, is based on the criteria used to rank submissions. The quality of an abstract is typically assessed through the expert judgment of two or more independent reviewers. The objective assessment of an abstract's quality is made more difficult, however, by evidence suggesting that reviewers' judgments vary widely when evaluating others' work, even whVariability is inherent in the abstract review process because no gold standard exists for evaluating the peer review process. One suggested measure of reliability for a set of criteria is how well reviewers agree on whether an abstract should score well or poorly. If expe1) quantify the level of agreement between conference abstract reviewers using the CAEP review criteria on the quality of abstract submissions; and2) identify factors that might result in low agreement.The Canadian Association of Emergency Physicians (CAEP) has utilized a web-based system for abstract submissions and reviews since its 2001 Annual Scientific Meeting. The overall system was conceived of and designed by the CAEP Research Committee (RC), and programmed by one of the authors (TS). The computerized system utilized for abstract submissions and reviews was \"VS Review\" published by VS Communications Inc. in Edmonton, Alberta.Canadian Journal of Emergency Medicine[Each year, a call for abstracts is published in a fall issue of the  Medicine,8 and on Medicine. SubmissEach submitted abstract is assigned three independent reviewers from the bank of volunteer CAEP reviewers. An administrator (CS) coordinates the review process and attempts to prevent conflict-of-interest situations during the reviewer assignment phase. Conflict-of-interest declarations on the reviewers' part are requested if such conflict is discovered during an abstract review. Each reviewer is assigned 15 to 20 abstracts per annual conference, and is blinded to the abstracts' author(s) and source. The median number of reviewers for the years 2001 to 2004 was 24. The pool of reviewers remained largely the same through the first three years; however, several new reviewers were added in 2004.Scoring is based on nine criteria Table . The CAEThe methodological and statistical criteria vary depending on the type of study reported in the abstract. For example, review criteria for statistics and methodology differ between randomized controlled trials and qualitative studies. During development of the system, content experts on each research design examined the criteria for face validity. Each of the nine criteria contributes a maximum value of two to six points to the total score. When reviewing submissions, reviewers are asked to assign a score for each criterion based on the descriptive text next to the \"radio button\" on the evaluation from. Table The maximum total score a reviewer can award an abstract is 24 points, and the minimum is zero. The final score used for ranking an abstract is the average of the three reviewers' total scores. Abstracts are assigned acceptance priority based on final score and mode of presentation.Although other approaches to variance analysis are possible, the investigators considered three main sources of variance that impact reviewer agreement to be: 1) abstract effect; 2) reviewer effect; and 3) abstract-reviewer effect. The absThis study is a retrospective analysis of an existing administrative database used for the on-line submission and review of CAEP Annual Scientific Meeting abstracts. SPSS Version 11  was utilized for statistical analysis.Inter-rater agreement was measured using the Intraclass Correlation Coefficient (ICC), which is commonly used to measure agreement between two or more raters. Computed ICC values range from -1 (perfect disagreement) to +1, which occurs when assessments are in perfect agreement,12. As tComparisons between means were conducted using one-way analysis-of-variance (ANOVA) and, where appropriate, summary measures are presented with 95% confidence intervals (95% CI).Over the four-year period being studied, 495 abstracts were electronically submitted. The mean final score of all 495 abstracts was 14.4 ranging from 14.8 (95% CI: 14.3\u201315.4) in 2001 to 14.06 (95% CI: 13.5\u201314.6) in 2003  and 2003\u20132004 (Block 2). The top four criteria in terms of reviewer agreement based on the rankings for 2001\u20132002 were Statistics, Overall, Recommendation, and Methods. For 2003\u20132004, the top four criteria were Methods II, Methods I, Statistics, and Overall.This study examined the reviewer agreement using an electronic abstract scoring system for an emergency medicine (EM) conference. From 495 abstracts submitted over 4 years, this system demonstrated several significant findings. First, agreement between reviewers on total score should be considered only \"moderate\" since the total score ICC was between 0.21 and 0.40 (fair) in 2001 and between 0.41 and 0.60 (moderate) in 2002, 2003, and 2004. Agreement values in terms of total score are at least as good as those reported by others in the literature, which are usually less than 0.40. Second,The ICC for Methods I increased substantially for 2003 and 2004 as compared to 2001 and 2002 despite very similar review criteria. A possible reason for this is the way in which submission types are assigned and the fact that review criteria are tailored to each submission type. In 2001 and 2002, each reviewer selected the submission type  upon which the review criteria were based. Reviewers did not always agree on the type of submission type, however. If there was a mismatch in the submission types selected by the reviewers, the abstract would be rated on different Methods criteria. Starting in 2003, the CAEP Research Committee requested that authors select their submission type so the same Methods criteria would be utilized by all three reviewers. The Committee felt that this approach would increase fairness for submitters in that all reviewers would be judging by the same criteria. In 2003 and later, if an author selected an inappropriate submission type , the abstract lost points on Methods, but the loss was reflected consistently across reviewers and could not be attributed to bias on the part of reviewers.Reviewer agreement achieved its maximum amount in the 2003 review season. This is likely due to the fact that the criteria were clarified and made less ambiguous (as a result of reviewer feedback), as well as due to the growing experience (and competence) of the pool of regular CAEP abstract reviewers. It is possible that the \"peak\" in reviewer agreement did not fully carry over in 2004 due to the addition of several new reviewers to the reviewer pool who would not have been as experienced in using the system to review and score abstracts.As this project analyses an administrative process, there are limitations that lead to difficulty in generating meaningful analysis of the data. First, we have no prospective data on reviewer satisfaction or problems with interpretation. Second, a limited pool of reviewers were available from a small community of EM researchers in Canada, complicating the process of assigning reviewers in a random manner while avoiding conflicts. Considerable efforts were made to maintain blinding; we suspect, however, that total anonymity of the authors and blinding of reviewers to abstracts was impossible given the small EM research community. Third, reviewers were not necessarily assigned abstracts whose topics fell within their specialty or areas of expertise. This would perhaps limit a reviewer's ability to judge abstracts on some of the more technical criteria. In addition to these, there were other factors, including press deadlines, which precluded fully \"scientific\" assignment of reviewers to abstracts. Finally, one could argue that reviewer agreement is higher for simple methodological descriptors such as \"double blinding\" because this is based on the presence or absence of words in the abstract, not on a more complex evaluation of quality.Notwithstanding the above concerns, this is one of the largest and most comprehensive evaluations of an electronic abstract scoring system ever conducted. This investigation, and the work of others, suggests ways in which the abstract review process can be improved upon for future years. The higher agreement between reviewers on the objective criteria suggests that modifications to the scoring sheets to reduce weighting of subjective criteria and increase weighting on the more objective criteria would further enhance scoring reliability. As well, modifying subjective criteria to incorporate less ambiguous guidelines or parameters might further improve reviewer agreement. Although the ICC one-way random effects model is not adversely affected by reviewer variability in scoring, it is nonetheless a good benchmark for agreement between reviewers. The tendency for some reviewers to consistently score higher (or lower) than others, the impact on overall reviewer agreement, and statistical methods to detect bias , need to be further investigated.Results from this investigation suggest that over the last four years the on-line conference abstract submission and peer review system developed by CEAP has generated moderate agreement among reviewers regarding the overall quality of submitted abstracts when the total score is used. Reviewer agreement declines somewhat when compared at an individual criterion level. Criteria that are based on empirical evidence and are less subjective appear to result in higher agreement. Differences of opinion will always occur; the responsibility of scientists is to determine when that difference in opinion adversely impacts scientific objectivity.Mr. Strome is a part-owner of the company that developed the review software (VS Communications Inc). No other author declares a conflict of interest.BHR is the lead author and contributed to developing the review criteria, the study design, manuscript preparation, and manuscript revision. TS developed the software, and contributed to the study design, statistical analyses, manuscript preparation, and manuscript revision. CS contributed to the study design and edited the manuscript. SB participated in the design of the study, statistical analysis, and edited the manuscript. EG and AW contributed to the study design and manuscript preparation.The pre-publication history for this paper can be accessed here:"}
+{"text": "Close to 200 bright young souls (and a few not so young) crammed into a small room for what proved to be a wonderful interchange among a group of whom approximately one-half had yet to publish their first paper. The advice I gave that day I have modified and present as ten rules for getting published.The student council  and thinking about their quality will also help. Being well read has another potential major benefit\u2014it facilitates a more objective view of one's own work. It is too easy after many late nights spent in front of a computer screen and/or laboratory bench to convince yourself that your work is the best invention since sliced bread. More than likely it is not, and your mentor is prone to falling into the same trap, hence rule 2.Alas, some scientists will never be objective about their own work, and will never make the best scientists\u2014learn objectivity early, the editors and reviewers have.before submission. Ideally, the reviews will improve your paper. But they will not get to imparting that advice if there are fundamental flaws.The quality of the editorial board is an early indicator of the review process. Look at the masthead of the journal in which you plan to publish. Outstanding editors demand and get outstanding reviews. Put your energy into improving the quality of the manuscript This is not just about grammar, but more importantly comprehension. The best papers are those in which complex ideas are expressed in a way that those who are less than immersed in the field can understand. Have you noticed that the most renowned scientists often give the most logical and simply stated yet stimulating lectures? This extends to their written work as well. Note that writing clearly is valuable, even if your ultimate career does not hinge on producing good scientific papers in English language journals. Submitted papers that are not clearly written in good English, unless the science is truly outstanding, are often rejected or at best slow to publish since they require extensive copyediting.A failure to be objective can make rejection harder to take, and you will be rejected. Scientific careers are full of rejection, even for the best scientists. The correct response to a paper being rejected or requiring major revision is to listen to the reviewers and respond in an objective, not subjective, manner. Reviews reflect how your paper is being judged\u2014learn to live with it. If reviewers are unanimous about the poor quality of the paper, move on\u2014in virtually all cases, they are right. If they request a major revision, do it and address every point they raise both in your cover letter and through obvious revisions to the text. Multiple rounds of revision are painful for all those concerned and slow the publishing process.Be objective about these ingredients when you review the first draft, and do not rely on your mentor. Get a candid opinion by having the paper read by colleagues without a vested interest in the work, including those not directly involved in the topic area.Some would argue that this places too much emphasis on publishing, but it could also be argued that it helps define scope and facilitates hypothesis-driven science. The temptation of novice authors is to try to include everything they know in a paper. Your thesis is/was your kitchen sink. Your papers should be concise, and impart as much information as possible in the least number of words. Be familiar with the guide to authors and follow it, the editors and reviewers do. Maintain a good bibliographic database as you go, and read the papers in it.Reviewing other papers will help you write better papers. To start, work with your mentors; have them give you papers they are reviewing and do the first cut at the review (most mentors will be happy to do this). Then, go through the final review that gets sent in by your mentor, and where allowed, as is true of this journal, look at the reviews others have written. This will provide an important perspective on the quality of your reviews and, hopefully, allow you to see your own work in a more objective way. You will also come to understand the review process and the quality of reviews, which is an important ingredient in deciding where to send your paper.This will define the form and level of detail and assumed novelty of the work you are doing. Many journals have a presubmission enquiry system available\u2014use it. Even before the paper is written, get a sense of the novelty of the work, and whether a specific journal will be interested.It is better to publish one paper in a quality journal than multiple papers in lesser journals. Increasingly, it is harder to hide the impact of your papers; tools like Google Scholar and the ISI Web of Science are being used by tenure committees and employers to define metrics for the quality of your work. It used to be that just the journal name was used as a metric. In the digital world, everyone knows if a paper has little impact. Try to publish in journals that have high impact factors; chances are your paper will have high impact, too, if accepted.When you are long gone, your scientific legacy is, in large part, the literature you left behind and the impact it represents. I hope these ten simple rules can help you leave behind something future generations of scientists will admire."}
+{"text": "Our colleague Charles J. Greenberg founded Biomedical Digital Libraries (BDL) in 2004, with the support of an outstanding team of editors and advisors . He enviBDL has covered a broad terrain. We have published resource reviews and commentaries, and documented innovative uses of technology that further scientific discovery and inform collection development. Readers are welcome to peruse all articles published thus far . One strPrint-only articles are not the only form of scholarly communication in the online era. BDL stands ready to publish multimedia works, including podcasts. Ramsey's \"Multimedia Bootcamp\" paper is the first BDL piece to feature movies , and we Regardless of the presentation format, our dedicated team of peer reviewers will critique submissions fairly and rigorously. After a healthy internal discussion BDL recently adopted an open peer review process, in which the authors and reviewers are all known to each other. Despite legitimate concerns that non-anonymity will cause reviewers to be less candid, we believe that transparency will lead to more thorough reviews overall. BioMed Central, BDL's publisher, has endorsed the concept of open peer review as well .New presentation formats, new reviewing protocols - All of this causes us to think we are looking at a new type of journal. In an era of rapidly disseminated pre-print articles and frequently cited web log postings, the concept of the formal journal must evolve in order to remain vibrant. We believe that BDL is up to this challenge, and cordially invite the insights of our editors, advisors, authors and readers as we begin the journey."}
+{"text": "A minority of scientific journals publishes the majority of scientific papers and receives the majority of citations. The extent of concentration of the most influential articles is less well known.The 100 most-cited papers in the last decade in each of 21 scientific fields were analyzed; fields were considered as ecosystems and their \u201cspecies\u201d  diversity was evaluated. Only 9% of journals in Journal Citation Reports had published at least one such paper. Among this 9%, half of them had published only one such paper. The number of journals that had published a larger number of most-cited papers decreased exponentially according to a Lotka law. Except for three scientific fields, six journals accounted for 53 to 94 of the 100 most-cited papers in their field. With increasing average number of citations per paper (citation density) in a scientific field, concentration of the most-cited papers in a few journals became even more prominent (p<0.001). Concentration was unrelated to the number of papers published or number of journals available in a scientific field. Multidisciplinary journals accounted for 24% of all most-cited papers, with large variability across fields. The concentration of most-cited papers in multidisciplinary journals was most prominent in fields with high citation density . Multidisciplinary journals had published fewer than eight of the 100 most-cited papers in eight scientific fields (none in two fields). Journals concentrating most-cited original articles often differed from those concentrating most-cited reviews. The concentration of the most-influential papers was stronger than the already prominent concentration of papers published and citations received.Despite a plethora of available journals, the most influential papers are extremely concentrated in few journals, especially in fields with high citation density. Existing multidisciplinary journals publish selectively most-cited papers from fields with high citation density. Despite a very large number of scientific journals , the concentration of scientific information is skewed to a minority of journals that publish the majority of the articles (Bradford's law) and receive the majority of the citations. In the Web of Knowledge, a core of 2,000 scientific journals publishes about 85% of all articles and 95% of cited articles To answer these questions, I considered the 100 most-cited papers published in the last decade in each of the 21 scientific fields to which scientific endeavour is categorized by the Web of Science y that have published n top-cited papers is given by ln(y)\u200a=\u200a5.6\u22121.6 x ln(n) with p<0.001 for both coefficients and R2\u200a=\u200a97% , followed by Cell (n\u200a=\u200a46), PNAS (n\u200a=\u200a41) and Astrophysical Journal (n\u200a=\u200a39).The overall literature of most-cited papers is characteristic of low species diversity. Across all scientific fields combined, i.e. among 5,969 journals in the Journal Citation Reports of the Web of Knowledge, only 530 (9%) journals have published at least one paper that belongs to the 100 most-cited of a scientific field. Of those, 284 journals have published only a single such paper. The number of journals that have published a larger number of most-cited papers decreases exponentially with very good fit to a Lotka law. The power of the law is 1.6. The best-fit curve for the number of journals R2\u200a=\u200a97% . Nature Astrophysics Journal in Space Science. With the exception of Engineering, General Social Sciences, and Economics/Business, two journals account for 14 to 46 of the 100 most-cited papers in each field, and 6 journals account for 53 to 94 of the 100 most-cited papers in each field. Thus in most scientific fields, there is limited diversity in the journals represented among those most influential publications, but this is not equally true across different disciplines.Examination of each scientific field separately can give additional insights . The jouCorrelation analyses show that the diversity indices are not related to the number of published papers, the number of indexed journals, or the total citations received by journals in the field. For example, the Pearson correlations of these variables with Hurlbert's PIE are 0.02 (p\u200a=\u200a0.94), 0.33 (p\u200a=\u200a0.15), and \u22120.29 (p\u200a=\u200a0.20), respectively. Conversely, diversity indices show strong negative correlations with the average number of citations received by each paper in the field, i.e. citation density : the PeaExclusion of the multidisciplinary journals from the calculations yields quite similar results with little attenuation in the correlation coefficients. Fields with higher citation density also concentrate their most-cited papers into fewer field-specific journals. The Pearson correlation coefficients are \u22120.64 (p\u200a=\u200a0.002), \u22120.70 (p<0.001), and \u22120.67 (p\u200a=\u200a0.001) between the average citation rate and the number of journals, Hurlbert's PIE and Shannon-Weiner index, respectively.Nature and Science have the lion's share (458/501). However, there is a clear pattern that multidisciplinary journals concentrate most-cited papers preferentially from scientific fields with high average number of citations per paper  of the 2,100 analyzed most-cited articles across all 21 fields combined, and Cell n\u200a=\u200a46, Astrophysical Journal n\u200a=\u200a39, Pharmacology Reviews n\u200a=\u200a29). This does not apply to the fourth outlier (Psychiatry/Psychology) where multidisciplinary journals also have no major presence (2/100 most-cited papers) despite modestly high citation density in the field.The relationship between citation density in the field and concentration of the most-cited papers in multidisciplinary journals is sigmoid, but there are 4 outliers to this pattern . For MolCa \u2013 A Cancer Journal for Clinicians publishes on an annual basis extremely highly-cited papers summarizing cancer statistics. While these are original data, they are practically annual reviews of the burden of disease due to cancer. The distinction between original articles and reviews is very impractical in the physical, mathematical, and social sciences, where several fully original papers are likely to deal with theoretical, conceptual, or mathematical constructs without specific empirical data.A considerable number of the 100 most-cited articles in each field are apparently review articles. The distinction between original articles vs. reviews is often difficult. It may be more relevant in the biological/life sciences, where a distinctive feature may be the presentation of new data, but even this rule is not absolute. For example, Pharmacology Reviews and Annual Reviews of Pharmacology and Toxicology); PNAS had published the largest number of highly-cited original articles, followed by Molecular Pharmacology and for both of these journals, all their most-cited papers were original articles. Review specialization of journals was less prominent for most-cited papers in some other fields, such as Clinical Medicine  and others published only most-cited original articles (e.g. Lancet and PNAS).Allowing for this caveat, Medicine , where tThe concentration of the most-cited papers is even stronger than the already prominent concentration of the number of papers published and citations received. For example, in Molecular Biology and Genetics the 6 most prolific journals account for 17% of the papers published in the field, the 6 most-cited journals account for 35% of the citations received in the field, and 6 journals account for 85 of the 100 most-cited papers in the field. This increasing concentration to the leading journals (concentration in most-cited papers>citations received>papers published) is seen even for scientific fields with low citation densities. For example, in the General Social Sciences the 6 most prolific journals account for 4% of the papers published in the field, the 6 most-cited journals account for 12% of the citations received in the field, and 6 journals account for 38 of the 100 most-cited papers in the field.For example, for Environment & Ecology (a field with mid-range citation density), the 6 most-prolific journals account for 18% of the papers published in the field, the 6 most-cited journals account for 26% of the citations received, and 6 journals account for 62 of the 100 most-cited papers in the field. The strongest concentration of most-cited papers is also shown when cumulative proportion curves are plotted .Influential scientific research is clearly highly concentrated, not only in terms of where it is produced Nature, Science, and, to some extent, PNAS) contribute also to this centralization. However, their impact pertains primarily to fields where papers receive a lot of citations on average. For over a third of the examined scientific fields, the existing multidisciplinary journals currently have little or no presence in the high-impact literature. These fields include Mathematics, arguably the most rigorous science of all, where existing multidisciplinary journals have published none of the 100 most-cited papers in the last decade. Other sciences with very strong mathematical methodology and rigorous theoretical and applied methods such as Computer Science, Engineering, Space Science, Agricultural Sciences and practically all social sciences  are also not concentrated in these journals. The neglect for mathematics has been highlighted even by the demonstration of poorly applied routine mathematical/statistical methods in NatureDespite an overwhelming plethora of available scientific journals, the optimal mode for scientific publishing remains controversial. In many fields, few journals cover most of the influential literature, regardless of the total number of journals circulating in the field and regardless of how many papers are published in the field. This may be interpreted as a strong tendency for centralization of the key literature, despite the large numbers of circulating periodicals. The existing high-quality, highly-competitive multidisciplinary journals  or they also have a bearing on the scientific reasoning of the citing work. However, the same caveat applies also for most-cited articles with original data. Several empirical studies have documented the high citation rates of reviews and the fact that systematic reviews and meta-analyses performed with rigorous scientific methods for collecting, appraising and synthesizing information get more citations than non-systematic reviews One should also acknowledge that there is no guarantee that the most-cited papers would even be \u201ccorrect\u201d or truly the \u201cbest\u201d ones in the field. Controversy and refutation may also sometimes attract debate and citations Allowing for these caveats, one may conclude that densely-cited scientific fields have the characteristics of severe, highly competitive ecosystems where few journals \u201csurvive\u201d to attract the most influential papers. The number of journals operating in a field and the number of articles being published do not influence the extent of this concentration. Existing multidisciplinary journals target their efforts primarily in densely-cited fields. This is not so for scientific fields with lesser citation densities in which more journals survive in the top-rank ecosystems and where multidisciplinary journals currently have a minimal share.Science, Nature, and PNAS for which each paper is allocated to a specific field based on the categorization of the journals that cite it.The data of the Essential Science Indicators module of the Web of Knowledge, Thomson ISI that were used cover the period January 1, 1996 to March 1, 2006. Information on most-cited papers, number of journals, number of papers, average number of citations per paper, and total citations in each scientific field are derived from the Essential Science Indicators module. The categorization of journals by Thomson ISI is based on the citations received and given by each journal with clustering in 21 scientific fields and a miscellaneous/multidisciplinary category. Each journal is categorized in only one field, with the exception of a few journals such as ip is the proportion of the sample represented by species  i with i\u200a=\u200a1\u2026S. The Shannon-Weiner index is given byip is the proportion of the sample represented by species  i with i\u200a=\u200a1\u2026S.In order to evaluate the diversity of journals represented among the 100 most-cited papers in each field, I considered traditional indices of alpha diversity  for these journal ecosystems. These are the number of species in the ecosystem , Hurlbert's probability of an interspecific encounter , and the Shannon-Weiner diversity index. PIE is given byCalculations of diversity indices were performed in EcoSim version 7.72, Acquired Intelligence, Inc., Kelsey-Bear, 1997\u20132005.The main analysis considered all journals in each field and a sensitivity analysis did not consider the multidisciplinary journals. Analyses for alpha diversity indices excluding the multidisciplinary journals used an appropriate rarefaction procedure so as to estimate the diversity indices based on the same number of papers in each scientific field. Alpha diversity indices cannot be compared across ecosystems, when the samples are of unequal size, because the indices depend on the sample size (with the exception of PIE). The number of papers published by multidisciplinary journals among the 100 most-cited ones ranged from 0 (Mathematics) to 54 (Immunology) and therefore all diversity indices are estimated here for abundance n\u200a=\u200a46 (i.e. 100\u221254).For the separate analyses of reviews and original articles, only PIE is presented that is not influenced by the different number of papers in these two categories. The category of \u201creviews\u201d includes traditional reviews, systematic reviews, editorials, guidelines, consensus, classification and nomenclature papers.Field-specific analyses also examined whether the extent of concentration into a few journals is similar for papers, citations, and most-cited papers. Journals were ranked according to number of papers published, citations received and most-cited papers, respectively. The proportion of papers, citations received and most-cited papers accounted was contrasted for the 6 top-ranked journals and was also shown with cumulative proportion curves.2) is also provided. Spearman non-parametric coefficients are also reported when considered more appropriate. Statistical analyses were performed in SPSS version 13.0  and p-values are two-tailed.Parametric (Pearson) and non-parametric (Spearman) correlation coefficients are reported, as appropriate. The power of the Lotka law is estimated with weighted least squares linear regression and the coefficient of determination (R"}
+{"text": "The implications for PLoS Medicine and other journals of new research, published in this issue, showing that there are major variations in the reporting quality of systematic reviews. The past decade has seen the establishment of the systematic review (SR) as one of the cornerstones of evidence-based medicine. The value of SRs to researchers, practitioners, and policy makers is well established; when done well, they are considered the highest level of evidence for medical decision making. Potentially, they are also a resource for patients seeking to make sense of the relative value of different treatments.http://www.cochrane.org/resources/glossary.htm) of the Cochrane Collaboration , an international organization that publishes rigorous SRs evaluating the effectiveness of a wide range of health care interventions. Their definition of a SR is this: \u201cA review of a clearly formulated question that uses systematic and explicit methods to identify, select, and critically appraise relevant research, and to collect and analyze data from the studies that are included in the review. Statistical methods  may or may not be used to analyze and summarize the results of the included studies.\u201dIt is important to distinguish SRs from the traditional, narrative reviews also often published in medical journals. A helpful definition of a SR, which also clarifies the difference between an SR and meta-analysis, comes from the Web site  have beIn this issue we publish an article  by DavidThere were clear differences in the quality of reporting between Cochrane and non-Cochrane SRs. Many reviews included no mention of a pre-specified protocol by which the review was conducted. Although a protocol is required of all Cochrane reviews, only 11% of non-Cochrane reviews had one. This lack of a protocol\u2014which delineates the search strategy, inclusion criteria, and the plan for the analysis that will be conducted\u2014naturally leads to concerns about methodological rigor in the assessment of the study question.It is Cochrane policy that published reviews should be regularly updated. One-third of the CDSR reviews in Moher's sample were in fact updates. However, updating is uncommon elsewhere; in the Moher sample, only 2% of non-Cochrane reviews were updates. Related to this issue is the observation that outside of the Cochrane Collaboration none of the reviews were registered with a central body. Hence, it would be hard to locate and access updates even if they were done.The quality of reporting in many of the SRs was disappointing. Despite the guidelines of the Cochrane Collaboration and the QUOROM  initiative , importaPerhaps of most concern, the authors noted: \u201cStrong evidence of outcome reporting bias was recently reported within clinical trials. Our results suggest that some aspect of selective outcome reporting bias might also exist within non-Cochrane reviews. Only about one-quarter of them reported a primary outcome, of which half report statistical significance in favour of this outcome (versus 14.4% for Cochrane reviews).\u201dCollectively, given the importance accorded to SRs, these findings are worrying. While length limitations imposed by most journals (but not by CDSR) may contribute to incomplete reporting, it seems more likely that many authors are not fully aware of the tools that are available to help them report SRs. Reporting all the items on the QUOROM checklist is neither onerous nor excessively lengthy; unfortunately many journals, especially the smaller subspecialty journals in which many SRs are published, have yet to adopt these reporting guidelines. For example, as Moher and colleagues point out, less than 7% overall  used a QUOROM flowchart to illustrate the stages of doing the systematic review.PLoS Medicine can accept is limited, so we are not able to publish every well-conducted SR that comes our way. We will restrict ourselves to publishing those that we believe have findings that represent an important advance that will interest our general medical audience.PLoS is committed to publishing high-quality systematic reviews, and the online format of our journals allows flexibility in the length of the research articles we publish. However, the number of research articles that PLoS ONE is, however, able to publish many more papers than PLoS Medicine can. PLoS ONE is committed to publishing any SR that is conducted, described, and interpreted well, and it welcomes the submission of SRs across all areas of health care. Moreover, PLoS ONE can also publish updates of SRs, provided that the update itself contains sufficient detail for a reader who cannot access the original report to understand what was done. If the original report is freely available, the update can be linked electronically to the original publication. We require that that all SRs submitted to us include a protocol and QUOROM checklist (or any updated version of this checklist) submitted as supplementary files. These items will be made available to peer reviewers, and published with the paper. In order to help authors report SRs systematically, we now also provide an optional template that follows the current QUOROM checklist. This template will be updated as needed in future.PLoS's new journal, But no one journal or publisher can single-handedly address the issues involved here. Moher and colleagues call for the registration of SRs in the same manner as is now required for clinical trials: it would then, at least, be possible to track those that are performed. This is an interesting proposal, and would certainly help in the linking of SRs to updates. We would welcome opinions on this proposal.Despite the best efforts of the Cochrane Collaboration and the QUOROM group, there is still a long way to go before readers can assume that all SRs are conducted and reported in a way that reliably provides an accurate synthesis of the evidence available.The QUOROM group is responding to this situation. The group met toward the end of 2006 and has made major revisions to its guidelines. Additionally, to facilitate a better understanding and dissemination of the guidelines, the group has embarked on developing an explanation and elaboration document similar to that used to create the corresponding CONSORT  and STARD  documents. It is anticipated that both documents will be submitted for publication consideration around the middle of this year. The group will also be changing its name from the much misspelled \u201cQUOROM\u201d to PRISMA .We hope these developments will go some way to maximizing the dependability of systematic reviews and justifying their position as the gold standard of evidence in health care."}
+{"text": "PLoS Biology will transfer reviews to any interested journal upon request by the authors.Subject to permission from our reviewers,  Why do reviewers do it? Why do they, in a best-case scenario, spend several hours reading, evaluating, and constructively commenting on a manuscript from a group of authors they might not even know? The reasons are many, oft repeated, and about as varied as the comments that reviewers provide on a single paper, on a scale as broad as the human nature from which they derive. Among the more frequently cited motivations are civic duty (good scientific citizenship), loyalty to a particular journal, probable need to read and critique the paper anyway, once it's published, and a desire to control and influence the presentation of science, for noble or ignoble reasons.Increasingly, however, one hears that the system is overloaded. The best reviewers\u2014the ones who can provide perspective on a field, attention to detail, constructive feedback, and timely responses\u2014can receive as many as ten requests per week. Inevitably, scientists are forced to make choices about which papers to review, and often are willing to review a paper within only a fairly narrow scope that is of immediate relevance to their research. This limits the pool of qualified reviewers for particular papers and hampers the review of interdisciplinary papers. Therefore, if a paper has been reviewed and rejected from one journal, chances are that an editor from a different journal will unwittingly ask some of the same scientific reviewers to review it again. And these reviewers will either agree to review it again, on the basis that they've already seen the paper and can offer a relatively quick assessment, or insist that the authors are provided with the opportunity of a new opinion.A fresh eye can be an attractive thing, and since no single editorial process can be entirely free from bias and a certain level of incestuousness, a diversified portfolio of journals and editorial models can stand science in good stead, ensuring that the widest possible definition of worthy science is available for postpublication scrutiny. A fresh opinion can also help journal editors make decisions on a paper that might otherwise suffer the ill effects of reviewer fatigue. However, new reviews do not always serve the best interest of the authors. Quite often, reviewers have meted out fair criticisms for the standards or scope of one particular journal, judging the article technically sound but, for example, insufficiently novel. If the door is then closed to resubmission to that journal, an author is sent back to the starting post, when what he or she would prefer is to continue the process to a successful publication rather than have to face new concerns of a second (or third) set of reviewers. Since for virtually any paper, the number of possible concerns is at least equal to (and likely many-fold higher than) the number of possible reviewers, the need to start over can waste an enormous amount of time and energy on the part of authors and reviewers, delay publication, and ultimately reduce the pace of scientific discovery. http://www.slais.ucl.ac.uk/papers/dni-20050925.pdf]). Nevertheless, it behooves us all to explore ways to make the process more efficient and more effective. Publishers such as the British Medical Association have explored the benefits of more open peer review, while other journals, such as Atmospheric Chemistry and Physics (http://www.copernicus.org/EGU/acp/), have combined closed and open review in a single process.What can be done? Certainly, the answer is not to do away with peer review, which, despite its deficiencies, is frequently identified in surveys as one of the most important features of the traditional process of scholarly publishing .Publishers that offer a portfolio of journals have come up with another approach to the challenge created by rejection and resubmission; examples include the Nature Publishing Group journals and the Cell Press journals, which allow reviews to be passed from one journal to another within the family. PLoS also provides the possibility of transferring reviews between PLoS Biology wish to have it considered by a journal outside of the PLoS family, we will seek permission from our reviewers to release their identities and confidential reviews to that journal's editors. We hope, of course, that these authors will choose another open-access journal or one of the increasing number of journals with an open-access option. Our respect for our reviewers' confidentiality and for their time is paramount, but within those parameters, we feel that such a service can only benefit the scientific community as a whole. Thus far, we have transferred reviews to Proceedings of the National Academy of Sciences, Development, and Conservation Biology.However, PLoS goes one step further. Should an author of a paper rejected from Some journals have, in turn, agreed to a similar sharing of reviews with PLoS. Others have not, and their reasons are unclear. For some, financial motives clearly command\u2014the service of procuring reviews is not one to be given away lightly to a competing publisher. But we believe that our first responsibility is to facilitate the communication of scientific research in any way we can. Improving the efficiency of the review process at a time when reviewers are increasingly burdened\u2014and without constraining authors' choices of alternative journals\u2014is just one way we, and all journals, can help."}
+{"text": "Although peer review is widely considered to be the most credible way of selecting manuscripts and improving the quality of accepted papers in scientific journals, there is little evidence to support its use. Our aim was to estimate the effects on manuscript quality of either adding a statistical peer reviewer or suggesting the use of checklists such as CONSORT or STARD to clinical reviewers or both.Interventions were defined as 1) the addition of a statistical reviewer to the clinical peer review process, and 2) suggesting reporting guidelines to reviewers; with \u201cno statistical expert\u201d and \u201cno checklist\u201d as controls. The two interventions were crossed in a 2\u00d72 balanced factorial design including original research articles consecutively selected, between May 2004 and March 2005, by the Medicina Clinica (Barc) editorial committee. We randomized manuscripts to minimize differences in terms of baseline quality and type of study . Sample-size calculations indicated that 100 papers provide an 80% power to test a 55% standardized difference. We specified the main outcome as the increment in quality of papers as measured on the Goodman Scale. Two blinded evaluators rated the quality of manuscripts at initial submission and final post peer review version. Of the 327 manuscripts submitted to the journal, 131 were accepted for further review, and 129 were randomized. Of those, 14 that were lost to follow-up showed no differences in initial quality to the followed-up papers. Hence, 115 were included in the main analysis, with 16 rejected for publication after peer review. 21 (18.3%) of the 115 included papers were interventions, 46 (40.0%) were longitudinal designs, 28 (24.3%) cross-sectional and 20 (17.4%) others. The 16 (13.9%) rejected papers had a significantly lower initial score on the overall Goodman scale than accepted papers . The effect of suggesting a guideline to the reviewers had no effect on change in overall quality as measured by the Goodman scale . The estimated effect of adding a statistical reviewer was 5.5 (95% CI: 4.3\u20136.7), showing a significant improvement in quality.This prospective randomized study shows the positive effect of adding a statistical reviewer to the field-expert peers in improving manuscript quality. We did not find a statistically significant positive effect by suggesting reviewers use reporting guidelines. Despite being widely accepted as the best way to filter low-quality research, to detect flaws in scientific communications and to improve papers with significant contributions to their fields The suggestion of adding a methodological expert to the reviewers pool of a Spanish biomedical journal gave us the chance to conduct a masked, randomized experiment to assess the effect of peer review, not only without interfering with the regular course of the editorial process, but also describing more realistically the true role of peer reviewing in improving the quality of papers. The two main objectives of our investigation were to assess the effects of (1) adding a statistical peer reviewer and (2) suggesting reporting guidelines www.doyma.es/medicinaclinica) is a peer-reviewed weekly Spanish biomedical journal included in the Science Citation Index, the Current Contents, the Index Medicus and Excerpta Medica. It aims to publish original research papers, review articles, brief clinical notes, challenging editorials and the opinions of readers in the \u201cletter to the editor\u201d section. All submitted original research manuscripts are first evaluated by the journal's editorial committee, who decide which papers meet the journal's criteria and standards of relevance, and which are consequently sent for external peer-review, usually by two referees from the journal pool who are particularly familiar with the subject matter of the paper.Medicina Cl\u00ednica . Articles not fitting the journal's editorial policy were excluded.We randomly allocated the manuscripts accepted for review into four groups defined by the interventions: Clinical reviewers (C) as normal procedure; Clinical reviewers plus a Statistical reviewer (CS); Clinical reviewers with checKlist (CK); and, Clinical reviewers plus a Statistical reviewer and checKlist (CSK). In this fashion, group C, acting as control group, only applied a clinical review, and therefore each article was sent to two clinical reviewers chosen from among the usual pool used by the journal. Papers were randomized once the two clinical peers had been chosen. Then, those allocated to the CS set were also sent to an expert statistical reviewer selected from the Medicina Clinica referee pool, which includes mainly senior methodological experts and graduate statisticians. A total of 39 methodological experts  were emphttp:/www.sign.ac.uk/guidelines/fulltext/50/annexc.html) or by Mora (Med Clin (Barc) 1999;113: 138\u201349\u201d]. Reviewers were not asked to report whether they used the reporting guideline in reviewing the manuscript. Finally, manuscripts from the CSK group were defined by the use of both interventions.Manuscripts sorted into the CK intervention group were simply sent to the two clinical reviewers with a standard letter  wasTwo evaluators  independently rated the reporting quality of manuscripts at initial submission and following peer review and revision, according to the MQAI. Both knew the initial and final status but were blinded to the intervention group. The final score awarded to each scale item was reached by averaging the two evaluators' item scores after allowing each one to modify his or her score once the reasons for the other evaluator's score was made known. Primary outcome was defined as the difference in the quality of papers between the initial and final submission, expressed as the sum of the 36 specific MQAI items, resulting in a minimum of 36  and a maximum of 180 points.In order to evaluate the success of masking, the evaluators tried to guess which papers had been revised by a statistical reviewer (or with the help of a guideline) from the changes they observed in each article. The evaluators had to answer the following question by consensus: \u201cHas it been reviewed by a statistician (or with the help of a guideline)?\u201d The possible answers were \u201cYes\u201d, \u201cNo\u201d and \u201cI don't know\u201d. The blinding process was analyzed and considered successful if the evaluators' hit-proportion was not bigger than that expected by chance (50%). The cases with an answer \u201cI don't know\u201d were not included in the analysis. Only after the results had been validated and introduced into the database, was the group corresponding to each article revealed to the evaluators so that they could carry out the analysis.Three different populations were considered: \u201ccomplete\u201d which included all randomized manuscripts not lost to follow-up, which was the population for the main analysis. Two other populations were defined for the sensitive analyses: one taking into consideration all \u201crandomized\u201d manuscripts and one including only those manuscripts accepted for publication. Those manuscripts rejected due to reviewers' comments and those lost to follow-up were analyzed considering two different values for their final quality: 1) the initial overall quality was imputed as the final overall quality interpreted as no change in quality during the editorial process), or 2) the final overall quality was assigned a value equal to the mean final quality value of the final versions of the received articles. The second method accounted for the positive effects of rejecting the low quality manuscripts, since the lower the initial score of the manuscript, the better the score in the initial-final difference assigned.A 2\u00d72 analysis of variance of the primary variable  was carried out to test the two hypotheses: 1, adding a statistical reviewer to the field expert peers and 2, suggesting reviewers reporting guidelines. Since both hypotheses addressed different objectives, no adjustment of the alpha risk consumption was made. Sample-size calculations indicated that a hundred articles were needed to reach an 80% power to detect a difference in means equivalent to a 55% of the intra-group standard deviation .2 tests. To check the effectiveness of the masking procedure, the percentage of matched trials between the appraisers' assessment and the real allocation of each article was computed. The main analysis was repeated stratifying by response to the masking question in order to analyze if it was able to account for the intervention effect.Secondary analysis were also based on ANOVA and included the same comparison of quality improvement by each individual item, as well as the segregated analysis of the rejected manuscripts and comparisons of initial quality between the originals that completed the editorial process and those which were lost to follow-up, by means of t-tests and \u03c7Of the 327 originals received between May 2004 and March 2005, 196 (59.9%) were directly rejected by the editorial team. The remaining 131 (40.1%) were selected by the editorial committee as possible publications and therefore randomized. Of these, 2 were excluded either as a result of an administrative error (n\u200a=\u200a1) or because the authors refused to participate (n\u200a=\u200a1). From the 129 randomized manuscripts, 14 were lost of follow up because authors missed the deadline and the masked allocation was revealed; 21 (18.3%) of the 115 included papers were \u201cinterventions\u201d, but only 3 were randomized clinical trials, 46 (40.0%) were longitudinal designs, 28 (24.3%) cross-sectional and 20 (17.4%) others. On the other hand, 16 were rejected by the editorial team after evaluating peer-review reports. The rejected papers had a significantly lower initial score on the overall Goodman scale than the accepted papers . No significant differences in initial quality were found between the lost to follow-up articles and the ones studied. The initial mean overall quality of the 115 originals analyzed was 84.5 (SD 19.1), without significant differences between the intervention groups. On the \u201cpresence of a statistical reviewer\u201d question, 20 (20.2%) originals were evaluated as \u201cI don't know\u201d. The remaining 79 originals (79.8%) were inspected with a match percentage of 60.8% (95% CI from 49.1 to 71.6%). On the use of a checklist, the evaluators were able to guess the intervention group in 65.3% (95% CI from 53.5 to 76.0%) of the 75 over 99 (75.8%) cases analyzed. The remaining 24 (24.2%) were evaluated as \u201cI don't know\u201d. After stratifying by response to both of the blinding questions, the overall conclusion on the main effects remained the same .We have shown that the addition of a supplementary statistical reviewer improves manuscript quality during the editorial process. As the control intervention was \u201ctwo clinical reviewers\u201d, the estimated effect can be imputed either to the addition of an extra reviewer, or to the inclusion of a statistical expert, both of which confirm that peer review improves overall quality as measured by the MQAI. This result is consistently sustained by the alternative analysis of the sensitive populations. The guess (yes/no/don't know) of the statistician intervention was not able to remove the observed effect.The size of the effect found can be interpreted in terms of specific item improvement: the 5.5 effect value counts as a 1-point quality improvement in a 5-point scale on more than five specific items. Although this effect is significant and positive, its size is very small related to the scale range (3.8%) but medium size (85.9%) related to the improvement variability (6.4), which may be due to some prudence or cautiousness during masked evaluation. In any case, in the light of the two evaluator scores, there is still room for improvement.Mainly because it is not easy to check peer review without interfering with the editorial process, but also because it is considered a self-evident idea, the scientific testing of a process that is essential for science, which filters and shapes scientific communications and decides major research funding, has barely deserved the interest of researchers. Some research groups have tried to assess the effect on the quality of peer review of training evaluators The 14 papers lost to follow-up did not differ, in terms of baseline quality, from the originals in the complete population. On the other hand, the 16 rejected papers present a significantly lower initial score on the overall Goodman scale than the 99 accepted papers. However, we have to be careful when interpreting these results as the two evaluators, although blinded to the intervention group, knew the editorial decision-as they didn't have the final manuscript version.For this study we have concentrated on the quantitative results. We do not provide qualitative information about what the statistical reviewers actually did to improve the manuscripts or how they differ from clinical reviewers. Furthermore, we did not study if authors followed all of the reviewer's suggestions, either clinical or methodological; or if there are manuscript characteristics related to potential improvement introduced by peer review.It should also be stressed that our target population was a single journal with an impact factor of just over 1: external validity of our results may be compromised if the positive effect of including a methodological reviewer depends upon journal, paper or reviewer characteristics. If journals with higher impact factors have better methodological papers We did not find statistical significance on the effect of enclosing a Spanish checklist Here we have shown scientific evidence that peer review has a positive effect on the final quality of papers, by means of demonstrating, in a randomized trial with masked evaluation, the effects of adding a methodological expert to the review panel. Nonetheless, there is still a long way to go to ensure that scientific communications achieve the maximum quality. Even, if peer review is not the last system to improve research or, at least, to improve scientific journals and reporting Text S1Authors and reviewers agreement(0.02 MB DOC)Click here for additional data file.Text S2Goodman scale(0.11 MB DOC)Click here for additional data file."}
+{"text": "BioMed Central (BMC) requires authors to suggest four reviewers when making a submission. Editors searching for reviewers use these suggestions as a source. The review process of the medical journals in the BMC series is open \u2013 authors and reviewers know each other's identity \u2013 although reviewers can make confidential comments to the editor. Reviews are published alongside accepted articles so readers may see the reviewers' names and recommendations.Our objective was to compare the performance of author-nominated reviewers (ANR) with that of editor-chosen reviewers (ECR) in terms of review quality and recommendations about submissions in an online-only medical journal.BMC series  were assessed by two raters, blinded to reviewer type, using a validated review quality instrument (RQI) which rates 7 items on 5-point Likert scales. The raters discussed their ratings after the first 20 pairs (keeping reviewer type masked) and resolved major discrepancies in scoring and interpretation to improve inter-rater reliability. Reviewers' recommendations were also compared.Pairs of reviews from 100 consecutive submissions to medical journals in the Reviewer source had no impact on review quality (mean RQI score (\u00b1 SD) 2.24 \u00b1 0.55 for ANR, 2.34 \u00b1 0.54 for ECR) or tone  (maximum score = 5 in both cases). However author-nominated reviewers were significantly more likely to recommend acceptance (47 vs 35) and less likely to recommend rejection (10 vs 23) than editor-chosen reviewers after initial review (p < 0.001). However, by the final review stage (i.e. after authors had responded to reviewer comments) ANR and ECR recommendations were similar . The number of reviewers unable to decide about acceptance was similar in both groups at both review stages.Author-nominated reviewers produced reviews of similar quality to editor-chosen reviewers but were more likely to recommend acceptance during the initial stages of peer review. Identifying peer reviewers is an important part of an editor's job. This task is especially difficult for general journals that cover a wide range of subject areas, many of which will be outside the editor's own area of expertise. If reviewers are unsuitable (e.g. do not know enough about the subject or are biased) this might affect the outcome of the peer-review process (i.e. decisions about acceptance). The choice of reviewer may also affect the quality of reviews and how opinions are expressed (i.e. the tone of the review and whether it is courteous).BMJ put it 'the worry about using nominated reviewers is that peer review will become a cosy process of endorsement by friends and colleagues'.)[Some journals ask authors to suggest potential reviewers but little is known about the effects of such a policy. Concerns have been raised that reviewers nominated by authors will not be as critical as those chosen by editors.  At the teagues'.) We thereWhen submitting an article, authors are asked to suggest four possible reviewers. All submissions are done online and the reviewer suggestion fields are compulsory.Authors are advised that reviewers 'should be experts in their field of study, who will be able to provide an objective assessment of the manuscript'. They are also asked to exclude anyone who has published with any of the authors within the last five years and anyone who works at the authors' research institution(s).Editors searching for reviewers use authors' suggestions as one source for identifying potential reviewers. Editors aim not to use more than one author-nominated reviewer (ANR) without one editor-chosen reviewer (ECR). Two reviews are usually obtained for each submission. Reviewers' names are shown on the reviews, although there is also a facility for reviewers to make confidential comments to the editor. Reviews are published alongside accepted articles so readers also know who the reviewers were and what recommendations they made.Reviews are submitted using an online form. Reviewers are asked for their comments on the submission and must choose between the options: accept without revisions; accept with discretionary revisions; accept after minor essential revisions; unable to decide; reject because too small an advance; or reject because not scientifically sound.BMC series were assessed by two raters (EW and PST). We included the 100 most recent submissions which had a final decision about publication and for which the journal had received reviews from one ANR and one ECR (this comprised submissions from October 2003 to March 2004). Raters were blinded to reviewer type (ANR or ECR) but not to reviewer identity. Reviews were assessed using the Review Quality Instrument (RQI).[Pairs of reviews from 100 submissions to medical journals in the a priori, as editorially significant, in line with previous studies. Secondary objectives were to compare recommendations about acceptance/rejection, review tone and timeliness.The primary objective was to compare the quality of reviews received from ANRs with those from ECRs as shown by the mean RQI  score. A difference in review quality of at least 10% (0.4/4) was defined, To detect a difference of 10%  we required 94 manuscripts to analyse. As distributions of scores and differences were close to a normal distribution we used paired t-tests to compare evaluations of ANR and ECR review quality. Reviewers' recommendations on publication were compared using the chi-squared test.There was no statistically significant difference in review quality for ANRs and ECRs as measured by the mean RQI score Table . There wpost hoc analysis of this. The lowest item scores were associated with discussing the originality of the research, providing evidence to substantiate comments, and commenting on authors' interpretation of their results. Reviewers tended to perform better on providing constructive comments, identifying methodological strengths and weaknesses, and assessing the writing and organization of submissions. The difference in scores between the three items with the highest mean scores  and the three with the lowest mean scores  was statistically significant (p = 0.04).Mean scores for the individual RQI items are shown in Table Our findings suggest that ANRs produce reviews of similar quality to ECRs. However, ANRs were significantly more likely to recommend acceptance and less likely to recommend rejection than ECRs during the initial stages of peer review. The significance of this observation depends on how editors regard reviewer recommendations. In journals that rely on reviewer judgements to a great extent  use of ANRs could affect a submission's chance of acceptance. However, in many journals, although editors base their decision on the reviewers' comments, they do not necessarily follow the reviewers' recommendations about acceptance or rejection. Indeed, it has been pointed out that it is not a good idea to 'count votes' since 'one would need to have at least six reviewers, all favouring publication or rejection for their votes to yield a statistically significant conclusion'. If ANRs ANRs' unwillingness to reject papers and their tendency to state that they were unable to decide  may be a feature of using ANRs within an open peer-review system. A reviewer known personally to the author may feel more constrained about rejecting a submission, despite having produced an objective and critical review. Requiring reviewers to sign their reviews may increase this phenomenon. One study comparing open and anonymous review found that anonymous reviewers rejected 8% more manuscripts than identified reviewers, however this difference was not statistically significant.While it may seem reasonable to assume that ANRs are more likely to know authors personally than ECRs this may not necessarily be true. Authors may select reviewers by their reputation or publication record and editors may unknowingly select reviewers with personal links to the authors. In our study, reviewers were not told who had selected them, so ANRs were probably unaware of their status unless authors had informed them. Although authors are asked to suggest reviewers without obvious close links (such as recent joint publications or working at the same institution), they do not always follow these instructions and editors rely on reviewers to inform them if they have a conflict of interest. One aspect that our study did not address is how distinct ANRs and ECRs really are. It would be interesting to follow up with a study in which editors selected reviewers before viewing the authors' recommendations and measuring how often the editors identified the same potential reviewers as the authors.Our study was done in a series of journals that use online, open peer-review. We cannot tell to what extent our findings are generalizable to journals that use different peer-review systems such as anonymous review. Our findings across a range of biomedical specialties may also have masked variations between research fields .When we started our research, only one other study on ANRs had been published.et al compared the reviews from ANRs with those from ECRs in a surgery journal that used anonymous reviewing. However, in this case, the authors were told that reports from ANRs would not be used to assess their submission. A non-validated 5-item scoring scheme was used, with each item scored 1\u20134. Earnshaw et al concluded that ECRs produced more critical reviews than ANRs. However the actual difference between the groups was small, and the difference only reached statistical significance for assessments of scientific importance  and decision . These differences, despite reaching statistical significance, do not reach the threshold suggested by Van Rooyen et al that an editorially meaningful difference should be at least 10% (in this case 0.3/3).Earnshaw et al at the BMJ.[BMJ study assessed 329 submissions to 10 biomedical journals and found mean RQI scores of 2.58 for ANR and 2.64 for ECR (our figures were 2.24 and 2.34 respectively). Reviewers could choose between recommending acceptance, resubmission or rejection. Schroter et al found that ANRs were more likely to recommend acceptance (57% vs 46%) and less likely to recommend rejection (13% vs 24%) than ECRs. This is a similar pattern to our findings, although the proportion of reviewers recommending rejection is higher, probably reflecting the actual rejection rates and editorial policies at the BMJ journals.Our findings of no important difference in review quality between ANRs and ECRs is also supported by a study undertaken at around the same time as ours by Schroter  the BMJ. The BMJ BMJ. Schroter et al report a median of 18 days for both groups, while we observed medians of 18 and 17 days for ANRs and ECRs.The time taken to supply reviews was also virtually identical in our study and that from the et al who also found average scores below the midpoint.[We observed that mean total review quality scores and mean scores for individual questions were generally low (<3 (= midpoint) out of a maximum of 5 in each case). However, the range is similar to that observed by Schroter midpoint.post hoc analysis, the scoring ranks assigned by the two independent raters were consistent, suggesting that this analysis was valid. We noted that reviewers performed best on aspects that help authors improve the quality of their submission (e.g. providing constructive comments) while they tended to perform less well on aspects that help editors select papers . This may be because most reviewers have more experience as authors than as editors. Our observations are similar to those of van Rooyen et al who compared anonymous with identified reviewers using the RQI. They also reported the highest scores for constructive comments and the lowest score for commenting on the originality of the research.[Although the RQI was not designed to compare different components of reviews, and this was a research. These obAuthor-nominated reviewers (ANRs) produced reviews of similar quality to editor-chosen reviewers (ECRs). However, ANRs were significantly more likely to recommend acceptance at initial review, and slightly more likely to state that they were unable to decide between acceptance and rejection on final review, than ECRs. We conclude that the use of ANRs is unlikely to materially affect the quality of reviews received, however it could affect acceptance decisions if journals rely heavily on reviewer recommendations.EW had the original idea for the study, which was designed jointly by EW, PST and ECP. EW and PST did the ratings, ECP identified reviews for inclusion and collected and analysed the data. EW prepared the first draft of the paper, which was critically revised by PST and ECP.This study was done with the cooperation of BioMed Central but without formal funding. At the time of the study PST and ECP were employees of BioMed Central and received a fixed salary.The pre-publication history for this paper can be accessed here:"}
+{"text": "Peer review is considered crucial to the selection and publication of quality science, but very little is known about the previous experiences and training that might identify high-quality peer reviewers. The reviewer selection processes of most journals, and thus the qualifications of their reviewers, are ill defined. More objective selection of peer reviewers might improve the journal peer review process and thus the quality of published science.306 experienced reviewers  completed a survey of past training and experiences postulated to improve peer review skills. Reviewers performed 2,856 reviews of 1,484 separate manuscripts during a four-year study period, all prospectively rated on a standardized quality scale by editors. Multivariable analysis revealed that most variables, including academic rank, formal training in critical appraisal or statistics, or status as principal investigator of a grant, failed to predict performance of higher-quality reviews. The only significant predictors of quality were working in a university-operated hospital versus other teaching environment and relative youth (under ten years of experience after finishing training). Being on an editorial board and doing formal grant (study section) review were each predictors for only one of our two comparisons. However, the predictive power of all variables was weak.Our study confirms that there are no easily identifiable types of formal training or experience that predict reviewer performance. Skill in scientific peer review may be as ill defined and hard to impart as is \u201ccommon sense.\u201d Without a better understanding of those skills, it seems unlikely journals and editors will be successful in systematically improving their selection of reviewers. This inability to predict performance makes it imperative that all but the smallest journals implement routine review ratings systems to routinely monitor the quality of their reviews . A survey of experienced reviewers, asked about training they had received in peer review, found there are no easily identifiable types of formal training and experience that predict reviewer performance. PLoS Medicine, have to decide whether the articles sent to them are of good quality and accurate and whether they will be of interest to the readers of their journal. To do this they need to obtain specialist advice, so they contact experts in the topic of the research article and ask them to write reports. This is the process of scientific peer review, and the experts who write such reports are known as \u201cpeer reviewers.\u201d Although the editors make the final decision, the advice and criticism of these peer reviewers to the editors is essential in making decisions on publication, and usually in requiring authors to make changes to their manuscript. The contribution that peer reviewers have made to the article by the time it is finally published may, therefore, be quite considerable.When medical researchers have concluded their research and written it up, the next step is to get it published as an article in a journal, so that the findings can be circulated widely. These published findings help determine subsequent research and clinical use. The editors of reputable journals, including Although peer review is accepted as a key part of the process for the publishing of medical research, many people have argued that there are flaws in the system. For example, there may be an element of luck involved; one author might find their paper being reviewed by a reviewer who is biased against the approach they have adopted or who is a very critical person by nature, and another author may have the good fortune to have their work considered by someone who is much more favorably disposed toward their work. Some reviewers are more knowledgeable and thorough in their work than others. The editors of medical journals try to take in account such biases and quality factors in their choice of peer reviewers or when assessing the reviews. Some journals have run training courses for experts who review for them regularly to try to make the standard of peer review as high as possible.It is hard for journal editors to know who will make a good peer reviewer, and there is no proven system for choosing them. The authors of this study wanted to identify the previous experiences and training that make up the background of good peer reviewers and compare them with the quality of the reviews provided. This would help journal editors select good people for the task in future, and as a result will affect the quality of science they publish for readers, including other researchers.. A total of 306 of these experienced reviewers  completed a survey of past training and experiences that might be expected to improve peer review skills. These reviewers had done 2,856 reviews of 1,484 separate manuscripts during a four-year study period, and during this time the quality of the reviews had been rated by the journal's editors. Surprisingly, most variables, including academic rank, formal training in critical appraisal or statistics, or status as principal investigator of a grant, failed to predict performance of higher-quality reviews. The only significant predictors of quality were working in a university-operated hospital versus other teaching environment and relative youth (under ten years of experience after finishing training), and even these were only weak predictors.The authors contacted all the regular reviewers from one specialist journal This study suggest that there are no easily identifiable types of formal training or experience that predict peer reviewer performance, although it is clear that some reviewers (and reviews) are better than others. The authors suggest that it is essential therefore that journals routinely monitor the quality of reviews submitted to them to ensure they are getting good advice .Additional Information.http://dx.doi.org/doi:10.1371/journal.pmed.0040040Please access these Web sites via the online version of this summary at WAME is an association of editors from many countries who seek to foster international cooperation among editors of peer-reviewed medical journals\u2022\u2002The Fifth International Congress on Peer Review and Biomedical Publication is one of a series of conferences on peer review\u2022\u2002PLoS Medicine guidelines for reviewersThe  outline what we look for in a review\u2022\u2002Council of Science Editors promotes ethical scientific publishing practices\u2022\u2002The editorial also published in this issue of PLoS Medicine discusses the peer review process further\u2022\u2002An  Most authors and editors would agree that the expertise of those who perform peer reviews for scientific journals has a lot to do with the quality of what is disseminated to the scientific community to become the foundation of future research . Nonethe.It would be useful to be able to predict the likelihood of success of a peer reviewer from information readily available from a curriculum vitae or a brief survey, before they were ever appointed to this post. This mechanism would allow editors and journals to most efficiently develop strategies to recruit the best reviewers. However, only four previous studies have attempted to determine whether some combination of peer reviewer experience could predict the quality of their subsequent reviews; these studies were relatively limited in size (most examining only a few hundred reviews or less), and were often a subanalysis of a study of some other intervention (such as blinding reviewers) \u20136.We therefore conducted a study of a larger group of peer reviewers, reviews, and possible contributors to performance, using as an outcome measure a standardized quality rating already in long use, with the hypothesis that some combination of reviewer training and experience could be identified that predicted subsequent production of high-quality reviews.Annals of Emergency Medicine is the leading journal in the specialty of emergency medicine and ranks in the top 11% among 5,876 science and medical journals listed by the ISI in frequency of citations [For over fifteen years every review at this journal has been rated for quality by an editor, based on a predefined 5-point score that has been shown to primarily reflect review quality . Six comAll permanent reviewers who had completed reviews during January 2002 to December 2005 were eligible for entry into this study and were invited to participate. If they consented, they were asked to complete a survey of their background and training in skills relevant to peer review and critical appraisal . Senior Two separate methods of identifying different levels of quality were analyzed because we felt that both could be useful metrics for editors. In the first , review scores of 3 and above (satisfactory to outstanding) were compared to 1 or 2 (unsatisfactory), separating reviews into acceptable versus unacceptable groups. This distinction could be useful for a journal with difficulty in recruiting sufficient peer reviewers, a common dilemma in many small journals. In the second outcome (satisfactory reviews only), scores of 4 or 5 were compared to 3, thus separating the reviews into excellent versus satisfactory. This distinction could be useful for a journal with far more potential applicants than needed. Univariate GEE  models were used to predict the quality of a review based on reviewer characteristics for either of these two outcomes. These were models for binomially distributed outcomes and used a logit link function. The models used an exchangeable working correlational structure for association of reviews within reviewers.p-value of less than 0.10 was considered a trend , and less than 0.05 significant. All analyses were carried out in SAS, Version 9.1 .Both univariate and multivariable analyses were employed, but major conclusions in this paper are based on the multivariable analysis, which controlled for confounders. Since all the survey variables were chosen because of their logical connection to better scores, all were included in the multivariable GEE model. Analyses were carried out separately using both the aggregate review score for each reviewer, and the individual review score as the unit of analysis. The scores of individual reviews are predefined, validated, unambiguous, and easy to interpret. By comparison, any decision as to what ranges of scores constitute a particular level of performance for an aggregate score for a reviewer is arbitrary, and would be debated and disputed by readers, reviewers, and editors. Furthermore, even reviewers with excellent mean aggregate scores can and do produce individual reviews of poorer quality. We therefore chose to employ the individual review as the default unit of analysis, but also compared this method to that of using the aggregate review score. In the analysis by aggregate reviewer scores, a weight variable was used which is the reciprocal of the variance of the reviewer's mean score. For purposes of discussion , a At the time of the survey there were 460 reviewers in the journal's pool of permanent reviewers. (Reviewers invited only once as a \u201cguest\u201d to review a particular manuscript were not included.) Of this number, 30 reviewers had performed no reviews during the study period and were excluded, leaving 430 who were sent the survey.A final of 308 reviewers (72%) consented to participate and returned a completed survey instrument. Two reviewers submitted surveys with no identifier on them, which were excluded. The remaining 306 reviewers constitute the subjects in this study; they completed a total of 2,856 reviews of 1,484 separate manuscripts during the study period , with a mean score of 3.6  by a total of 32 editors. The mean number of reviews per reviewer was 9.4 ; the range was one review only  to 46 reviews (0.3%). 25 reviews were rated 1, 164 rated 2, 717 rated 3, 1,296 rated 4, and 654 rated 5.The 124 nonresponding reviewers had conducted 1,165 reviews for a mean 4.4 each  and a range of one review only  to 27 (1% of reviewers). The mean quality score of nonresponders was 3.6 . There was no difference in the mean scores of reviews performed by responders versus nonresponders.Results of the univariate analysis are shown in p = 0.09) for holding an advanced statistics degree. Being on an IRB was associated with worse reviews . For excellent versus satisfactory reviews, being on an editorial board  and university versus other teaching environment  were associated with better reviews; being on an IRB was associated with poorer reviews . None of the other experience or training variables predicted outcome. Even for variables with significant ORs, however, the predictive power of the model was poor, with an area under the curve of 0.52 for the model in The multivariable logistic model  and 5 deOur results show that, unfortunately, almost none of the experiences and training that might logically be thought to make for a high-quality reviewer  actually predict subsequent performance of higher-quality reviews \u20135. The mp-values, the area under the curve was barely better than chance alone, demonstrating the lack of usefulness of these criteria in the real world.Most importantly, most of the ORs were less than 2, and even when our model produced ORs of 2 or more and significant Our study involved a large number of reviewers and reviews. It examined a larger number of types of training and experience that might be expected to improve reviewing skills, compared to prior studies. Reviews were rated by 32 editors, as compared to four or fewer previously \u20136. It isJournal of Clinical Investigation in 1983 [Most authors and editors would probably agree that the quality of peer review is crucial to selecting and publishing the best science, but remarkably little study has been conducted to determine how to identify good reviewers. A search of PubMed since 1966 using the MeSH keywords \u201cPeer Review/Research\u201d and \u201cPublication\u201d or \u201cPeriodicals\u201d identified only four prior studies on this topic, whose findings are summarized in In a substudy of a randomized controlled trial of reviewer blinding, Evans reported on data from the curricula vitae of 201 internist reviewers of 131 manuscripts using a newly devised  rating system with nine components as well as a global score . More thBMJ, rated by four editors using a newly developed but validated seven-component scale with a global summary rating very similar to the one we used [Black reported a subanalysis of a randomized controlled trial of blinding . He eval we used . A chiefKliewer examined only limited demographic characteristics  versus review scores of radiology journal reviewers for one year, using a unique and unvalidated four-point quality score assigned by four or five editors, and reporting correlations only . Review A comparison of our results with those of previous studies reveals a good deal of variation in the variables studied, and few common themes as to what is related to quality  None of them were newly appointed to the journal. We would have liked to assess reviewers completely new to the journal, but the annual number of recruits is small and many of them do not perform substantial numbers of reviews, making such an analysis logistically impossible. Reviewers who returned the survey might not be similar in experience or performance to those who did not respond, although we did have a high rate of response (over 70%) and the quality score of respondents did not differ from that of those who responded to the survey. However, nonresponders did have a review volume less than half that of responders. It is possible that our study population may under-represent poor or less committed reviewers, but when we tested the performance of the multivariable model in predicting review outcome, it was the same for both groups.All reviewers in this study came from a single-specialty peer review journal (as in previous studies), but our reviewers had appointments at virtually every US medical school and a broad variety of backgrounds and training. This particular reviewer population has been well studied in the past, and has performed similarly to journal reviewers from other specialties. For example, their ability to detect deliberately introduced flaws in a manuscript was very similar to that in a large general medicine journal and a small Scandinavian language journal \u201312. StudOur outcome measure was scores on a previously reported global rating scale of review quality . There iOur study confirms and expands the prior literature by examining experience and training that seem logically relevant to the development of good review skills. It confirmed prior findings that more experienced reviewers (>10 y after residency in our study) perform lower-quality reviews than do younger ones, and found that only editorial board experience, grant review, and working in a university hospital environment (versus other types of teaching environments) were associated with better-quality reviews in multivariable analysis. However, even these predictors were weak, with a small area under the curve in our study and poor predictive power in the other studies that reported on that measure ,5. None Building on the few previous reports, our findings suggest that it will not be easy to identify types of formal training and experience that predict reviewer performance, and indeed there may be none. It has not yet even been demonstrated that the qualities that make a good reviewer can be taught; the studies done so far show no effect of conventional reviewer training ,14,16. IThe reviewer selection processes of most journals, and thus the qualifications of their reviewers, are ill defined ,18. MoreThere are two possible approaches for future research. One could involve performing more studies similar to ours with more complex analyses, covering multiple journals and many thousands of reviewers, and collecting data on many more variables that might predict quality performance. The disadvantage of this approach is that we do not know enough to do more than guess at relevant variables to assess, and even if a predictive model were found, the resulting tool might not be practical for use in the everyday life of journals. We predict that this approach would not be very productive.A second approach would be to go back to the beginning, collaborating with experts in cognition and learning to identify and understand the specific analytic strategies and thought processes used in manuscript reviews conducted by high-quality reviewers. This would probably require initial qualitative research, which could generate new hypotheses about which easily identifiable characteristics of reviewers might be associated with quality review.  If we knew what cognitive approach(es) produced a good review, we might not only be able to identify in advance those who use that approach, but we might also be able to design educational interventions to strengthen those skills in all reviewers\u2014something that has eluded us so far. The chief obstacle to this approach, as mentioned above, is that reviewers' decisions may be based on complex pattern recognition far more difficult to understand than simple, mechanistic problem solving."}
+{"text": "Head & Face Medicine (HFM) was launched in August 2005 to provide multidisciplinary science in the field of head and face disorders with an open access and open peer review publication platform. The objective of this study is to evaluate the characteristics of submissions, the effectiveness of open peer reviewing, and factors biasing the acceptance or rejection of submitted manuscripts.A 1-year period of submissions and all concomitant journal operations were retrospectively analyzed. The analysis included submission rate, reviewer rate, acceptance rate, article type, and differences in duration for peer reviewing, final decision, publishing, and PubMed inclusion. Statistical analysis included Mann-Whitney U test, Chi-square test, regression analysis, and binary logistic regression.HFM received 126 articles (10.5 articles/month) for consideration in the first year. Submissions have been increasing, but not significantly over time. Peer reviewing was completed for 82 articles and resulted in an acceptance rate of 48.8%. In total, 431 peer reviewers were invited (5.3/manuscript), of which 40.4% agreed to review. The mean peer review time was 37.8 days. The mean time between submission and acceptance (including time for revision) was 95.9 days. Accepted papers were published on average 99.3 days after submission. The mean time between manuscript submission and PubMed inclusion was 101.3 days. The main article types submitted to HFM were original research, reviews, and case reports. The article type had no influence on rejection or acceptance. The variable 'number of invited reviewers' was the only significant (p < 0.05) predictor for rejection of manuscripts.HFM's peer review time comes in shorter than the 6-weeks turnaround time the Editors set themselves as the maximum. Rejection of manuscripts was associated with the number of invited reviewers. None of the other parameters tested had any effect on the final decision. Thus, HFM's ethical policy, which is based on Open Access, Open Peer, and transparency of journal operations, is free of 'editorial bias' in accepting manuscripts.The positive trend in submissions confirms the need for publication platforms for multidisciplinary science. Provided as a downloadable tab-delimited text file . HFM) was launched in August 2005 to provide multidisciplinary research with a state-of-the-art publication platform [HFM will be an ideal platform to disseminate multidisciplinary knowledge in the area of head and face disorders. HFM still is developmental in character and the journal's ethical policy based on open access and open peer review results in a commitment to a regular self-analysis of HFM's maturation. The aim of the present paper was therefore to evaluate the characteristics of submissions, the effectiveness of the open peer reviewing process, and factors biasing acceptance or rejection of manuscripts. This analysis attempts to generate information to assess the journal's development and was also conducted for the sake of transparency and objectivity in all journal operations of Head & Face Medicine.Head & Face Medicine \u2022 Date of PubMed recordThe following times were calculated based on the obtained data.\u2022 Peer review time (PRT): The time between date of submission and date when reports are returned to the authors. PRT is at any time greater than the time used for processing the review because of the time differential between invitation to review and agreement of peer reviewers. PRT does not include revision time and re-review time.\u2022 Acceptance/rejection time (A/RT): The time between date of submission and \"editorial\" acceptance or rejection. A/RT includes revision time and re-review time. Editorial acceptance is different from full acceptance and concerns the content of the paper and positive reports only. Full acceptance is declared when the paper complies with the formatting requirements laid out in the instructions for authors. Full acceptance is, in general, equal to the provisional publication of the article.\u2022 Publishing time (PT): The time between date of submission and date of provisional publication of the paper. With its provisional publication on the HFM website, the paper is immediately accessible via the Internet and searchable by any web browser.\u2022 PubMed availability time (PAT): The time between date of submission and date of inclusion into PubMed of the final title and abstract. The PubMed entry was obtained from the EDAT tag.Additionally, the following data were evaluated.\u2022 Submission and acceptance rates\u2022 Type of submission\u2022 Editorial workload. Editorial work is difficult to measure. The only quantifiable data are the number of submissions and the number of e-mails generated through communication between authors, reviewers, and editors.The Mann-Whitney U test was chosen to assess differences in journal operations between accepted and rejected papers. Crosstabs with Chi-square test was used to evaluate differences between various types of articles.Binary logistic regression analysis was performed to identify variables most responsible for the prediction of acceptance or rejection . For this purpose, the observed event 'editorial decision' was dichotomized to two values, which represent the occurrence (acceptance) or non-occurrence (rejection) of the event.In total, 126 manuscripts were submitted between August 2005 and July 2006. An additional number of 40 manuscripts were submitted incomplete and therefore not yet under review. Figure Between August 2005 and August 2006, peer reviewing was completed for 82 articles. Of those, 40 manuscripts were rejected and two were withdrawn, which is equal to an acceptance rate of 48.8%.Prospective reviewers for all manuscripts were selected from the Editorial Board and from PubMed only. In total, 431 experts were invited to review 82 manuscripts. 174 peer reviewers agreed to review and 52 of them reviewed more than one paper. 199 invited experts declined to review, while six experts agreed but did not provide any report. The maximum number of invitations sent before two reports were finally received was 18. On average, 5.3 experts were invited per manuscript.HFM's peer review process is based on a minimum of two reports per manuscript. The peer review time for the first and seond reports were 33.8 and 41.9 days, respectively. In total, the mean PRT was 37.8 days, which comes in shorter than the 6-weeks turnaround time the Editors set themselves as the maximum. The PRT of rejected manuscripts was shorter (35.3 days) when compared to accepted papers (40.3 days), but not to a significant extent (p > 0.05).The mean acceptance time was 95.9 days. Taking into account the time needed for re-reviews required after authors' revisions, this figure calculates down to approximately 95.9-40.3 = 55.6 days for revision. The mean rejection time was 49 days. The Editors-in-Chief needed approximately 49-35.3 = 13.7 days for the final decision by assessing the reports and manuscripts.The mean publishing time (PT) was 99.3 days. After this time, the authors' work was first made available to the scientific community because title, abstract, and a provisional PDF of the manuscript were published on the HFM website and thus, became both accessible and retrievable via the Internet. PubMed availability time, the time between submission and inclusion into PubMed of the title and abstract, was on average 101.3 days.HFM were original research articles, reviews, and case reports , there is no increased probability for case reports to be rejected (p > 0.05). In general, the variable 'article type' is not a predictor for rejection or acceptance. There is also no significant relation between article type and the time of peer reviewing  at the beginning of HFM. The first significant improvement (FI1) of the online system was the e-mail archiving in November 2005. Any e-mails sent by the editors were then automatically added to a history page, resulting in a chronological overview which facilitates evaluation of the whole peer reviewing process. Because of a further functionality improvement (FI2) in March 2006, multiple notifications to authors and reviewers were eliminated. From that point in time, only the following was performed independently from the editorial managemet tools: a) informing authors if revisions were required, b) requesting re-review of a manuscript if required after revisions, and c) accepting a manuscript. This resulted in a significant reduction of e-mails from March to April '06  and requesting revisions online (FI4).The e-mail rate in Figure 6 Figure . Two furPR could be computed by the logistic equationExcept for one parameter, none of the obtained variables had an effect on the decision to accept or reject papers. Binary logistic regression revealed a significant relationship (p < 0.05) between rejection of a paper and the number of invited reviewers. The probability of rejection z is computed as z = constant + regression coefficient.z = -0.519+0.148. The graphical representation is shown in Figure PR = 0.57 that the paper will be rejected.Based on our data Medical journals have to assume a high level of ethical responsibility because by disseminating scientific findings they cause far-reaching consequences for patients. Due to the global availability of the Internet, the volume and the speed of dissemination of medical data has grown exponentially. However, such a fortunate consequence for medical science, also puts a strain on control schemes (such as peer reviewing) that are supposed to ensure the quality of the published outcomes.An important step related to process quality is to reduce pre-publication bias through transparent journal operations. New journals, which cannot rely on a tradition of experience and reputation, therefore have the obligation to demonstrate their process quality and objectivity throughtout the publication process. The obtained data can be useful, furthermore, to assess the profile of other journals. The aim of this paper was therefore to evaluate the characteristics of submissions, the effectiveness of the open-peer reviewing process, and factors biasing acceptance or rejection of manuscripts.Data on the first-year submission rates to a medical journal are not available. Just as with trans-discipline comparisons, it is uncertain whether this kind of comparison makes sense at all. Despite the difficulties of interpretation, we consider that the slightly increasing submission rate, at a mean 10.5 papers/month in the first year, validates the multidisciplinary approach of HFM. The acceptance rate was established at 48%. The HFM Editorial Team does not consider the number of rejected manuscripts to be a quality criterion for a journal. Thus no comparison was made as to the rejection rates.The APC introduction in March 2006 seems to have adversely affected the submission rate, which would also explain the high number of submissions in February 2006 Figure . NeverthTimely peer reviewing is an exceptionally essential factor for new journals. There seems to be a minimum time when requesting a review from an unpaid, well-renowned reviewer, which it is impossible to shorten any further. Other journals have also recognized that their shortened peer review time could only be achieved at the expense of the destruction of the very process . A mean A further important point, besides timely peer reviewing, is fast publication. This time depends on cumulated times of revision, re-reviewing, and the final decision made by the editorial team. The mean acceptance time was 95.9 days, and provisional publication occurred after a mean 99.3 days. This timeframe is the critical item, since it reflects the duration after which the paper becomes retrievable via the Internet for the first time and starts to exist within the scientific community. Another important marker related to this process is the PubMed inclusion. PAT amounted to a mean 101.3 days from submission and depended also on e-publication workflow.HFM mainly received standard types of manuscripts, such as original research articles, reviews, and case reports. Case studies, database articles, hypotheses, methodology articles, short reports, software articles, and study protocols are underrepresented, indicating an increased need for information to be provided to contributors on the avaliability of publishing different typed of manuscripts in HFM. Although case reports represent the majority of rejected papers (52%), there is no increased probability for this type of article to be rejected according to the logistic regression model. Compared with other article types, the shorter publishing time associated with case reports can be explained by the shorter length of these papers, which also means less revision time. No difference in PRT was found.The editorial workload is difficult to measure and was presented herein with the e-mail data to describe the amount of editorial time as a basis for comparison. Time is a major factor in the quality of a journal and has to be reasonably supported by staff. Currently, editorial workflow (except peer review) is handled by a core team of 3 editors-in-chief, 1 deputy editor, 1 executive editor, 2 section editors, 2 peer review coordinators, and one statistical advisor.HFM affects significantly the decision as to acceptance or rejection. Only the number of invited peer reviewers was associated with a higher probability of rejection. Inviting a minimum of 2 reviewers corresponds to a probability of rejection PR = 0.44. HFM's reviewer rate of 5.3/manuscript corresponds to a probability of rejection PR = 0.57, which is close to the current rejection rate of 51.2%. Inviting 15 reviewers would increase PR to 0.85. The advantage of keeping the peer review time below 6 weeks is achieved at the expense of inviting more than two reviewers, which in turn increases the probability of rejection.A hidden decision bias may compromise the objectivity of a journal, and regular analysis is, therefore, required. With the exception of one parameter, none of the recorded journal operations of PR amounting to 0.57 does not indicate a negative effect insofar as one has to take into account that Open Peer generally results in higher acceptance rates [In our opinion, however, a ce rates . This coHFM confirms the need for publication platforms for multidisciplinary science. HFM's peer review time comes in shorter than the 6-weeks turnaround time the Editors set themselves as the maximum. Rejection of manuscripts was associated with the number of invited reviewers but had no negative effect on the overall rejection rate. None of the other parameters had any effect on the final decision. Thus, HFM's ethical policy, which is based on Open Access, Open Peer, and transparency of journal operations, was found to be free of 'editorial bias' in accepting manuscripts.The positive trend in submissions to The authors declare that they have no competing interests other than being Editors-in-Chief of the journal.TS suggested the original idea for the study, initiated the investigations leading to these results, participated in discussions on the undertaking of the study, did the statistical analysis and interpreted the data, reviewed all iterations of the paper, and wrote the first draft and the final version of the paper. UM interpreted the data, and reviewed and contributed to the writing of all iterations of the paper, including the final version of the manuscript. HPW and JK participated in discussions on the undertaking of the study, interpreted the data, reviewed the paper for content and contributed to the writing of all iterations of the paper, including the final version of the manuscript. MC and ZCC participated in discussions on the undertaking of the study, interpreted the data, reviewed all iterations of the paper and contributed to the writing of the manuscript. MC and ZCC revised the English grammar of the final version of the manuscript. All authors approved the final manuscript.Tab-delimited file containing original data. Variables: n = number of article; rev = number of reviewers; peer1 = PRT of reviewer 1; peer2 PRT of reviewer 2; accep = accepted ; print = PT; pubmed = PAT; a_p = days between acceptance and print; a_pub = days between acceptance and PubMed inclusion; peer = average peer review time; a_type = article type.Click here for file"}
+{"text": "After reading your interesting paper , I thinkSo, they will probably stick to the old practice: try to get a good group of reviewers and ask them to do it. However, this way of working is based on the assumption that being a good reviewer is a long-lasting quality, so that doing a good review predicts that the next review will also be good.I could not find a clear answer to that question in this paper. I think that with their dataset the authors can probably provide us with an answer that will reassure editors on their decision to stick to the group of reviewers that have produced good reviews in the past.Would they be so kind?"}
+{"text": "Ten Simple Rules for Reviewers is based upon our years of experience as reviewers and as managers of the review process. Suggestions also came from PLoS staff and Editors and our research groups, the latter being new and fresh to the process of reviewing.Last summer, the Student Council of the International Society for Computational Biology prompted an Editorial, \u201cTen Simple Rules for Getting Published\u201d . The intTen Rules for Reviewers helpful. There is no magic formula for what constitutes a good or a bad paper\u2014the majority of papers fall in between\u2014so what do you look for as a reviewer? We would suggest, above all else, you are looking for what the journal you are reviewing for prides itself on. Scientific novelty\u2014there is just too much \u201cme-too\u201d in scientific papers\u2014is often the prerequisite, but not always. There is certainly a place for papers that, for example, support existing hypotheses, or provide a new or modified interpretation of an existing finding. After journal scope, it comes down to a well-presented argument and everything else described in \u201cTen Simple Rules for Getting Published\u201d [PLoS Computational Biology material) we invite readers to use the PLoS eLetters feature to suggest their own rules and comments on this important subject.The rules for getting articles published included advice on becoming a reviewer early in your career. If you followed that advice, by working through your mentors who will ask you to review, you will then hopefully find these blished\u201d . Once yoLate reviews are not fair to the authors, nor are they fair to journal staff. Think about this next time you have a paper under review and the reviewers are unresponsive. You do not like delays when it is your paper, neither do the authors of the paper you are reviewing. Moreover, a significant part of the cost of publishing is associated with chasing reviewers for overdue reviews. No one benefits from this process.Reviews come in various forms\u2014anonymous, open, and double-blind, where reviewers are not revealed to the authors and authors are not revealed to reviewers. Whatever the process, act accordingly and with the highest moral principles. The cloak of anonymity is not intended to cover scientific misconduct. Do not take on the review if there is the slightest possibility of conflict of interest. Conflicts arise when, for example, the paper is poor and will likely be rejected, yet there might be good ideas that you could apply in your own research, or, someone is working dangerously close to your own next paper. Most review requests first provide the abstract and then the paper only after you accept the review assignment. In clear cases of conflict, do not request the paper. With conflict, there is often a gray area; if you are in any doubt whatsoever, consult with the Editors who have asked you to review.Terse, ill-informed reviews reflect badly on you. Support your criticisms or praise with concrete reasons that are well laid out and logical. While you may not be known to the authors, the Editor knows who you are, and your reviews are maintained and possibly analyzed by the publisher's manuscript tracking system. Your profile as a reviewer is known by the journal\u2014that profile of review quality as assessed by the Editor and of timeliness of review should be something you are proud of. Many journals, including this one, provide you with the reviews of your fellow reviewers after a paper is accepted or rejected. Read those reviews carefully and learn from them in writing your next review.Your comments, when revisions are requested, should lead to a better paper. In extreme cases, a novel finding in a paper on the verge of rejection can be saved by (often) multiple rounds of revision based on detailed reviewers' comments and become highly cited. You are an unacknowledged partner in the success of the paper. It is always beneficial to remember that you are there to help the authors in their work, even if this means rejecting their manuscript.Peer review is an important community service and you should participate. Unfortunately, the more you review, in all likelihood the more you will be asked to review. Often you will be asked to review boring papers that are of no interest to you. While it is important to serve as a reviewer, only accept papers in which you are keenly interested, because either they are close to your area of research or you feel you can learn something. You might say, should I not know the work very well to be a reviewer? Often a perspective from someone in a slightly different area can be very effective in improving a paper. Do not hesitate to indicate to the Editor the perspective that you can bring to a paper (see Rule 10); s/he can then decide how to weigh your review. Editors would of course like to see you review papers even if you are not particularly interested in them, but the reality is that good reviewers must use their reviewing time wisely.This may be different for different people. A sound approach may be to read the manuscript carefully from beginning to end before considering the review. This way you get a complete sense of the scope and novelty of the work. Then read the journal's Guide to Authors, particularly if you have not published in the journal yourself, or if the paper is a particular class of article with which you are not overly familiar, a review for example. With this broad background, you can move to analyzing the paper in detail, providing a summary statement of your findings as well as detailed comments. Use clear reasoning to justify each criticism, and highlight the good points about the work as well as the weaker points. Including citations missed by the author (not your own) is often a short but effective way to help improve a paper. A good review touches on both major issues and minor details in the manuscript.The publish-or-perish syndrome leads to many poor papers that may not be filtered out by the Editors prior to sending it out for review. Do not spend a lot of time on poor papers (this may not be obvious when you take on the paper by reading only the abstract), but be very clear as to why you have spent limited time on the review. If there are positive aspects of a poor paper, try to find some way of encouraging the author while still being clear on the reasons for rejection.Many of us have received reviews where it is fairly obvious who reviewed the work, sometimes because they suggest you cite their work. It is hard to maintain anonymity in small scientific communities, and you should reread your review to be sure it does not endanger the anonymity if anonymous reviews are the policy of the journal. If anonymity is the rule of the journal, do not share the manuscript with colleagues unless the Editor has given the green light. Anonymity as a journal policy is rather a religious rule\u2014people are strongly for and against. Conform strictly to the policy defined by the journal asking you to review.A poorly written review is as bad as a poorly written paper (see Rule 3). Try to be sure the Editors and the authors can understand the points you are making. A point-by-point critique is valuable since it is easy to read and to respond to. For each point, indicate how critical it is to your accepting the paper. If English is not your strong point, have someone else read the paper and the review, but without violating other rules, particularly Rule 2. Further, as passionate as you might be about the subject of the paper, do not push your own opinion or hypotheses. Finally, give the Editors a clear answer as to your recommendation for publication. Reviewers frequently do not give a rating even when requested. Provide a rating\u2014fence-sitting prolongs the process unnecessarily.Most journals provide the opportunity to send comments to the Editors, which are not seen by the authors. Use this opportunity to provide your opinion or personal perspective of the paper in a few clear sentences. However, be sure those comments are clearly supported by your review\u2014do not leave the Editor guessing with comments like \u201cthis really should not be published\u201d if your review does not strongly support that statement. It is also a place where anonymity can be relaxed and reasons for decisions made clearer. For example, your decision may be based on other papers you have reviewed for the journal, which can be indicated in the Editor-only section. It is also a good place to indicate your own shortcomings, biases, etc., with regard to the content of the paper (see Rule 5). This option is used too infrequently and yet can make a great deal of difference to an Editor trying to deal with a split decision."}
+{"text": "The World Academy of Young Scientists argue that double blind peer-review will generate a better perception of fairness and equality in global scientific funding and publishing Created under the auspices of the United Nations Educational, Scientific, and Cultural Organization (UNESCO) as an offspring of the \u201cInternational Forum of Young Scientists,\u201d the World Academy of Young Scientists (WAYS) was officially launched in November 2003 at the World Science Forum in Budapest, Hungary. Our organization represents a permanent global platform for young researchers, and presently gathers some 2,000 members in all disciplines from about 100 countries. WAYS benefits from the support of a number of distinguished senior scientists, including several Nobel laureates. Our objectives are to make science more attractive, comprehensible, and accessible, and to support career development opportunities for young scientists from around the world. WAYS encourages interdisciplinary collaboration and networking among scientists, irrespective of their age or institutional affiliations. We provide a global forum to communicate the opinions, concerns, and questions of young scientists to decision-makers in science policy.At our first general assembly in December 2004 in Marrakech, Morocco, peer-review procedures in scientific publication and research funding were debated intensely. Even though peer review is universally accepted as an essential element of research, considerable debate persists on how to implement it. The vast majority of our members, especially from developing countries, were concerned about the apparent unfairness of the current procedure, a perception that is prone to generate frustration, fear of discrimination, and distrust. We reached a consensus that slight modifications to the current review process would help in getting more objective reviews based on the quality of the research rather than the age, affiliation, gender, or pedigree of the authors.Single-blind peer review (SBPR), in which the reviewer knows the identity of the author but not vice versa, is the currently accepted practice. Because SBPR can be vulnerable to sexism and nepotism , its ethWe believe that current peer-review process, even though functional, can be, and should be, improved.In open peer review, the identities of both authors and reviewers are revealed, affording the authors the ability to identify the reviewers' comments to a person. Even though this might be an equitable strategy to prevent unfair rejections, this process has no safeguard against unfair acceptance of papers\u2014reviewers, and especially newcomers, may feel pressured into accepting a mediocre paper from a more established lab in fear of future reprisals.DBPR, in which both the reviewers and the authors remain anonymous to each other, is thought to disentangle the peer-review process from non-scientific factors, thereby presenting an appealing alternative. The a priori case for masking and blinding is strong, and several studies have suggested that articles published in DBPR journals were cited significantly more often than articles published in non-DBPR journals ,4. HowevMaintenance of trust within the international scientific community is crucial, not only for future scientific development, but also to continue the dialogue of civilizations. We believe that the current peer-review process, even though functional, can be, and should be, improved to bolster a more even playing field for all scientists. In biomedical sciences, the effectiveness of DBPR is hotly debated. However\u2014using data from computer science, philosophy, or economics, which have adopted and have been using DBPR for some time\u2014the inescapable conclusion is that DBPR performs at least as well as the traditional peer-review process. We propose here that DBPR is a better system because, in addition to being a reasonably fair process, it also bears symbolic power that will go a long way to quell fears and frustrations, thereby generating a better perception of fairness and equality in global scientific funding and publishing. This will, in turn, help to keep research more accessible for future generations."}
+{"text": "The Editorial Board of CytoJournal devotes significant efforts, time, and resources to review numerous manuscripts. As it is impossible to include all the experts on the editorial board, there is always a need for additional peers who are requested to join periodically to act as 'academic editors' and reviewers. We take this opportunity to thank all the reviewers and academic editors who offered their time and efforts by participating in peer-review process for CytoJournal manuscripts. We request their continued enthusiasm to support this important academic exercise. According to the 'close review' policy of CytoJournal, the peer-reviewers are not identified in the individual manuscripts and articles. But the 'academic editors', who conduct and complete the peer-review process by appointing reviewers are acknowledged in the articles ,1-9. HowOn behalf of CytoJournal's editorial body and Cytopathology-Foundation Inc, we take this opportunity to specifically thank all reviewers and academic editors listed in the Table We also thank all the authors that submitted the manuscripts to CytoJournal and supported the 'open access' initiative in cytopathology. 'Open access' extends numerous benefits to the authors including the retention of their copyrights to the published material .pro bono hard work. To join as a core reviewer of CytoJournal, please e-mail the details by copy pasting the brief form (Table We invite all the experts in cytopathology and related areas to join the ever increasing demand of good reviewers. High standard of peer-review process of CytoJournal is the topmost agenda at periodic 'reviewer's retreats'. Existing editorial board members and potential core reviewers could participate at such retreats . It is arm Table  in the bSincerely,  Vinod B. Shidham, MD, FRCPath, FIAC  Executive editor and co-editor-in-chief Barbara F. Atkinson, MD Co-editor-in-chief"}
+{"text": "PLoS Medicine Essay [Emma Veitch cites my ne Essay  about hone Essay .While I agree with the second assertion, the first assertion\u2014that the data are not subjected to external, independent peer review\u2014is off the mark. FDA reviews are indeed external and independent to the sponsor. These reviews are conducted not by the sponsors but by physicians and scientists employed by the United States government. True, the data originate with the sponsor. However, once the sponsor submits data to the FDA, a level of rigor and scrutiny is applied to them that is arguably higher than what occurs in the typical journal manuscript review process.First, FDA reviewers typically revisit the original protocol submitted before the study was conducted in order to verify that the sponsor has not engaged in hypothesizing after the results are known (\u201cHARKing\u201d) . By contSecond, FDA statistical reviewers obtain the raw data from the sponsor, and determine whether the sponsor's findings can be replicated. By contrast, journal reviewers typically have access to only the summary statistics reported (perhaps selectively) to them by the authors or the sponsors. Consequently, reviewers can only speculate whether they could replicate the findings.As a result, I believe that the FDA review process warrants a higher level of confidence than the conventional journal manuscript review process."}
+{"text": "The objectives of this research were (a) to describe the current status of grant review for biomedical projects and programmes from the perspectives of international funding organisations and grant reviewers, and (b) to explore funders' interest in developing uniform requirements for grant review aimed at making the processes and practices of grant review more consistent, transparent, and user friendly.A survey to a convenience sample of 57 international public and private organisations that give grants for biomedical research was conducted. Nine participating organisations then emailed a random sample of their external reviewers an invitation to participate in a second electronic survey.A total of 28 of 57 (49%) organisations in 19 countries responded. Organisations reported these problems as frequent or very frequent: declined review requests (16), late reports (10), administrative burden (7), difficulty finding new reviewers (4), and reviewers not following guidelines (4). The administrative burden of the process was reported to have increased over the past 5 years. In all, 17 organisations supported the idea of uniform requirements for conducting grant review and for formatting grant proposals. A total of 258/418 (62%) reviewers responded from 22 countries. Of those, 48% (123/258) said their institutions encouraged grant review, yet only 7% (17/258) were given protected time and 74% (192/258) received no academic recognition for this. Reviewers rated these factors as extremely or very important in deciding to review proposals: 51% (131/258) desire to support external fairness, 47% (120/258) professional duty, 46% (118/258) relevance of the proposal's topic, 43% (110/258) wanting to keep up to date, 40% (104/258) desire to avoid suppression of innovation. Only 16% (42/258) reported that guidance from funders was very clear. In all, 85% (220/258) had not been trained in grant review and 64% (166/258) wanted this.Funders reported a growing workload of biomedical proposals that is getting harder to peer review. Just under half of grant reviewers take part for the good of science and professional development, but many report lack of academic and practical support and clear guidance. Around two-thirds of funders supported the development of uniform requirements for the format and peer review of proposals to help ease the current situation. Peer review for submissions to scientific journals has developed over more than 300 years, and there is now a considerable body of evidence on its methods, outcomes, effectiveness, best practice, problems, and ethics . Peer reIn contrast, editorial peer review at journals has a much wider evidence base and is subject to continuous review and debate. Strengths, weaknesses, ways to reduce bias, and different models in journal peer review have been studied extensively, yet many questions remain unanswered. Although there is evidence on how to conduct peer review fairly and efficiently, there is only limited evidence that journal peer review improves the quality of published biomedical science according to a Cochrane review that systematically reviewed 28 of 61 retrieved studies . InternaThere has been one Cochrane systematic review about grant review practices, but it found evidence only on biases and other process weaknesses and included only 10 studies . The autErnest Starling was an eminent physiologist who when asked by the British Medical Research Council in the 1920s about how to best distribute funding answered 'get the best of men, give them the equipment you can afford, and leave them alone'. Peer review is the main 'equipment' used by research councils and other funders. To explore the current status of grant review, the eponymous 'Starling Group' of funders, policy makers, researchers, and editors, who first met in Frankfurt to discuss the European Medical Research Councils' strategy for medical research in Europe , initiatThe first Starling Group study is an international survey to describe the current status of peer review among biomedical funding organisations and the problems they face when evaluating proposals for biomedical project and programme grants. The second is a survey to determine the workload of external grant reviewers, the level of institutional support for this activity, reviewers' motivations and perceived barriers to taking on grant review, and their views on possible solutions. We report on both surveys here.We took a convenience sample of biomedical research funding organisations across Europe and also approached key national funders from North America, Australia, and New Zealand to broaden the survey's reach and relevance; members of the Starling Group suggested international public and private grant giving organisations they thought should be included. We also sought the advice of the European Foundation Centre for suggestions for inclusions of private foundations in Europe. The final list of 57 funding organisations included both small and large international funding organisations. The purpose was to include a range of different funders from different countries to illustrate some of the current problems they face rather than to create a representative sample and draw inferences beyond the sample.http://www.SurveyMonkey.com) to a named contact person at the funding organisation explaining the purpose of the research and requesting their help. Non-responders were sent an email reminder 2 weeks and 6 weeks after the original mailing.A draft questionnaire was developed based on discussions with several funding organisations about current practice and common problems with peer review. The questionnaire was then refined by members of the Starling Group and revised before field testing. The questionnaire asked participants to respond to all questions in relation to grants that provide support for biomedical studies addressing a single research question or research theme (project and programme grants) not infrastructure grants or fellowships. We sent an invitation and link to the electronic survey on SurveyMonkey  of the 56 funders. Table A total of 15/29 of the organisations reject 10% or less of research project grant applications based on internal review only. However, 13/29 of the organisations accept 30% or less of project grant applications following external review. A total of 17/27 use an electronic tracking system to contact external reviewers and manage their reviews but few (6/29) use an electronic system for grant applicants to track their proposals during each stage of the decision-making process.Only 13/27 organisations limit the number of annual requests to external reviewers in order to reduce individual burden and the potential for bias in the system. However, 18/27 organisations invite more than 3 external reviewers on average to review a single application. In all, 16/27 use programme managers, 15/27 boards/panels/committees, 6/27 board chairpersons, and 10/27 grant applicants to suggest external reviewers.The majority (22/27) provide guidelines for external reviewers on what applications should be judged on, 22/27 provide review forms or templates for external reviewers to submit their reviews, and 21/27 a scoring/ranking system to rate specific aspects of proposals.Only 2/27 organisations hide the grant applicants' names from the external reviewers whereas 21/27 hide external reviewers' names from applicants. Only 4/27 hide the names of all reviewers on the funding board/panel from applicants. However, 5/27 organisations commented that they make a list of reviewers' names available  at the end of the funding round.During the review process, 7/27 organisations allow grant applicants to see the full external reviewers' reports, 3/27 the funding board/panels' comments/reports, and 5/27 the scores assigned to their application. However, after the decision has been made on their application, these figures rose to 16/27, 18/27, and 13/27, respectively. A total of 22/27 organisations routinely ask their reviewers to declare their conflicts of interest for each proposal reviewed.Table Over half the sample perceived no change over the last 5 years in the following problems: having an inadequate number of reviewers' reports available at time of assessment 15/29), receiving poor quality reviews (19/29), receiving late reviews (19/29), reviewers not following guidelines appropriately (20/29), reviewers not declaring their conflicts of interest (16/29), reviewers breaking confidentiality (16/29), applicants questioning the conflicts of interest of reviewers (18/29), and applicants questioning the funder's choice of reviewers (20/29) , too many applications in the system (12/29), and the administrative burden of process (11/29). Funders reported a better situation now than 5 years ago for applicants recommending inappropriate reviewers (18/29) reviewers declaring their conflicts of interest.The self-reported most important challenges faced by organisations included finding available and suitable reviewers, problems with review quality and time taken to complete reviews, and problems with administration and transparency.In all, 14/27 organisations routinely give external peer reviewers the funding board/panel's decision on the proposal(s) they reviewed, but only 3/27 the details of their discussions and decisions. Only about a quarter (7/27) give feedback to reviewers on the usefulness of their reviews.Some organisations reward or acknowledge their reviewers by naming them on their website (7/27), telling their institutions that they are reviewers for their organisation (4/27), giving feedback on the quality of their reviews (5/27), and by paying them (10/27). Other ways of thanking them included: naming them in the annual report, annual letters of thanks, informing those that give the most useful reports that they are the best, honorariums, giving formal confirmation if requested, invitations to the grant delivery ceremony or inauguration dinners, emails of gratitude and feedback on reviews if requested, allowing reviewers to submit grant applications outside of call deadlines, reviewers' award programs, and dinner invitations.We proposed that a set of standards, such as the ICMJE guidelines  for the In all, 9 funding organisations took part and we received an overall response of 258/418 (62%) Table . Two-thiReviewers were asked to indicate approximately how long it takes them to review a single biomedical science grant proposal . Only 15% (39/258) said that the whole process took them less than or equal to 3 hours; 30% (77/258) spend on average between 4 and 6 hours, 9% (22/258) spend 7 to 9 hours, 17% (44/258) spend 10 to 24 hours and 10% (27/258) spend more than 24 hour.A total of 48% (123/258) said their institution or managers encouraged them to take part in biomedical science grant review, yet only 14% (37/258) said their institution or managers knew how much time they spent reviewing and 31% (79/258) knew which funding organisations they reviewed for. A total of 32% (82/258) were expected to review grants in their own time  and only 7% (17/258) were given protected time to conduct grant review. In all, 28% (73/258) said they always conduct biomedical science grant review in their own time, 44% (113/258) often do, 19% (49/258) occasionally and only 1% (2/258) never do.A total of 74% (192/258) do not receive any academic recognition for conducting grant review. Comments from the 43 who said they did included the fact that it contributes to promotional review, is recognised within the 'indicators of esteem' element of the UK's Research Assessment Exercise, is one of the metrics for assessing research portfolios in clinical departmental review, is a recognised research service when applying for grants and fellowships, and prestige.Reviewers rated the following as extremely or very important in their decision to review: 51% (131/258) to help external fairness in decision taking by review committees, 47% (120/258) sense of professional duty, 46% (118/258) relevance of the topic, 43% (110/258) wanting to keep up to date on research advances, 40% (104/258) to help ensure innovation is not suppressed (Table Only 9% (22/258) had received some formal training in how to conduct biomedical science grant review and 64% (166/258) said they would be interested in receiving training if funding organisations provided it (free of charge). Whilst 63% (162/258) reported that instructions and guidance for external reviewers provided by biomedical science funding organisations are quite clear and that they usually know what they are expect to do as a reviewer, only 16% (42/258) said that these were very clear and they always know what they are expected to do. Only 9% (23/258) reported that the clarity of instructions and guidance varied by organisation.At least 25% of the reviewers reported the following factors often or always acted as barriers to undertaking grant review: conflicts with other workload , having to review too many journal articles , reviewing taking too much time , insufficient knowledge on the focus of the application , tight deadlines for completing the review , and having to review too many grant proposals for funding organisations   , have coThe ICMJE set an editorial precedent for the development of uniform requirements. A similar set of guidelines on grant review might enable researchers, funders, and peer reviewers to practise grant review more consistently and, we hope, more efficiently and effectively. Most of the funding organisations in the survey were receptive to the idea of such standards for grant review and reviewers indicated problems with heterogeneous requirements from funders. Further exploration of the feasibility and acceptability of uniform requirements for grant review is required.With a bursting system reliant on good will, is it time for all funding organisations to more formally recognise contributions from reviewers through, for example, public acknowledgement, certificates, or rewards? Funding organisations should help reviewers to do their job effectively by providing clear guidance and training as well as improved feedback and communication. We are not the first to advocate the need for nurturing reviewers , but mosThe workload of biomedical research funders is growing. Our surveys suggest that few funders have used their experiences of deteriorating efficiency or the  evidence base on editorial peer review to assess and improve their processes. We suggest that funders provide clearer guidance to reviewers, draw on evidence from both editorial and grant review to maximise the efficiency and fairness of their work, and come together to consider the development of a set of uniform requirements for submitting and peer reviewing biomedical grant proposals.SS has no competing interests. TG is a member of Council of the Committee on Publication Ethics, which produces guidance on ethics aspects of peer review and directly advises editors on handling difficult submissions. LH is Chair of EMRC, the European Medical Research Councils, ESF, Strasbourg, EMRC is the membership organisation of the public funders in medical research in Europe. LH is a frequent peer reviewer of grant proposals.SS helped develop the content of the questionnaires, conducted the survey, analysed the results, and wrote the first draft of the manuscript. TG and LH initiated the research, helped develop the content of the questionnaires, and helped write the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1741-7015/8/62/prepub"}
+{"text": "The Working Group on Peer Review of the Advisory Committee to the Director of NIH has recommended that at least 4 reviewers should be used to assess each grant application. A sample size analysis of the number of reviewers needed to evaluate grant applications reveals that a substantially larger number of evaluators are required to provide the level of precision that is currently mandated. NIH should adjust their peer review system to account for the number of reviewers needed to provide adequate precision in their evaluations. On February 21, 2008 the recommendations of the Working Group on Peer Review of the Advisory Committee to the Director of the National Institutes of Health (NIH) were posted on the internet Thus, the Advisory Committee has left the actual number of reviewers to evaluate each grant application ambiguous. No guidelines were provided to determine the number of reviewers that would be needed. Consequently, we have conducted a statistical analysis to provide guidance in arriving at appropriate numbers. Our analysis shows an inherent statistical inconsistency in the NIH peer review recommendations concerning the number of reviewers. We also demonstrate how crucial this number is and how it influences the precision of the eventual score.For each grant proposal reviewers from the relevant scientific community are asked to report their evaluations within a pre-defined scale. The average grade obtained through this process is considered a valid estimate of the \u201ctrue\u201d value of the proposal.\u03b1/2 is the upper percentile of the standard normal distribution. For a 95% confidence interval and an alpha  of .05, Z\u03b1/2 is equal to 1.96. The parameter \u03c3 represents the underlying standard deviation. Finally, L indicates the desired half-width of the interval between two consecutive evaluations or the precision of the evaluation.The survey sample size is a crucial parameter in determining whether we can rely on these mean estimates. Elementary sampling techniques give us the minimum number of respondents that are needed for the evaluation procedure to deliver reliable estimates:There are two important implications of this equation. First, the inverse correlation between n and L indicates that more reviewers are needed to obtain a more fine-grained or precise evaluation. Moreover, this relation is exponential so that greater precision comes with an increasingly greater number of reviewers.Second, typically the standard deviation \u03c3 of a population is not observed and needs to be estimated. Since the data necessary to estimate \u03c3 for the review of biomedical research proposals have not been collected in a statistically robust sampling system, we have relied on a model system of peer review with short movie proposals reviewed on a scale from 1 to 5 by undergraduate students . We used short movie proposals in order to increase the potential sample size since all undergraduate students could be considered expert enough to grade the proposals. In this study 10 proposals were scored by an average of 48 reviewers. The average standard deviation was approximately 1.0 with a standard deviation considerably less than 0.1. Therefore, we estimate \u03c3 to be equal to 1. Obviously, a more accurate estimate of the standard deviation can eventually be obtained for each form of application requested by NIH, although it should be clear that a large number of independent evaluators is required to make any estimate of \u03c3 reliable.Using equation (1), we can assess the effect of having 4 reviewers for each proposal. With four reviewers and a standard deviation of 1, the review would be expected to distinguish applications at the level of the unit interval:Yet, in the evaluation of grant proposals NIH currently uses a 41-grade scale with a range of scores from 1.0 to 5.0 In The disconnect between the needed precision in order to allocate funds in a fair way and the number of reviewers required for this level of precision demonstrates a major inconsistency that underlies NIH peer review. With only four reviewers used for the evaluation of applications, an allocation system that requires a precision level in the range of 0.01 to 0.1 is not statistically meaningful and consequently not reliable. Moreover, the 4 reviewers NIH proposes are not independent which degrades the precision that could be obtained otherwise.Consequently, NIH faces a major challenge. On the one hand, a fine-grained evaluation is mandated by their review process. On the other hand, for such criterion to be consistent and meaningful, an unrealistically high number of evaluators, independent of each other, need to be involved for each and every proposal.5, a small number of evaluators would lead to unreliable mean estimates.Further insights can be derived from the analysis of expression (1). The value of \u03c3 is a measure of the underlying variability in the ratings. The minimum number of reviewers for any given degree of ratings precision decreases with decreasing standard deviations. The standard deviation across ratings is also an indicator of the degree of agreement among different reviewers. If the standard deviation is small, for instance equal to 0.01 instead of our previous working estimate of 1.0, there is essentially consensus among the referees. If \u03c3\u200a=\u200a0.01, then the following relation holds:Our estimate of \u03c3 is not based on an analysis of biomedical research experts judging research projects close to their area of specialty. Scoring standard deviations for large numbers of experts obtained in a statistically acceptable sampling system have not been collected. Instead, as described above, we have used a model system that has allowed us to readily collect opinion data about proposals with undefined potential. Although we believe our estimate is reasonable, it is informative to visualize how the sample size estimate varies with different values of standard deviation for a level of precision of 0.1 . It is eThe importance of scoring accuracy ultimately relates to the rank ordering of proposals. In our model system there were 5 movie proposals with mean scores ranging from 3.46 to 3.64. We have analyzed how the rank ordering of these 5 proposals varied as reviewers were randomly included in the analysis from 1 to 40 reviewers . What isIt is clear from our analysis that NIH needs to adjust their peer review system to account for low precision evaluations. Additionally, it would be valuable to determine the standard deviations of scores given by independent reviewers. This information could be used to obtain more appropriate estimates of \u03c3 and consequently would be invaluable in designing and implementing a statistically rational system of social choice for NIH.Our data demonstrate that funding decisions will vary widely with the number of reviewers in considering proposals that are closely scored. Making choices between applications that vary by less than 1 will require larger numbers of reviewers than NIH has been contemplating. Recognition of the statistical inconsistencies of NIH peer review will allow for the implementation of new policies that take into consideration the accepted relationship between the number of reviewers, the precision of scoring needed, and the standard deviation of the scores given.2. Obviously, the length of the application impacts the number of reviewers that could possibly be used for scoring. More reviewers can be used for shorter applications.The Working Group also recommended shortening the length of the application although no specific suggestions were includedIt is commonly accepted that NIH will not fund clinical trials that do not include a cogent sample size determination. It is ironic that NIH insists on this analysis for clinical studies but has not recognized its value in evaluating its own system of peer review. We posit that this analysis should be considered in the revisions of NIH scientific review.The NIH peer review structure has not been based in rigorous applications of statistical principles involving sampling"}
+{"text": "The Neuroscience Peer Review Consortium (NPRC) was conceived in the summer of 2007 at a meeting of editors and publishers of neuroscience journals. One of the working groups addressed whether it was possible to construct a system for permitting authors whose manuscript received supportive reviews at one journal but was not accepted to send a revised manuscript together with its first round of reviews to a new journal for the second round. This would speed up the review process and reduce the work for reviewers and editors. The working group not only designed a framework for transferring reviews among journals, but also implemented it as the NPRC. By the fall of 2007, more than a dozen major journals had signed onto the NPRC, sufficient to launch the experiment in January, 2008. We invite authors who have not yet used the NPRC to try this method for appropriate manuscripts.In order to encourage dissemination of the details outlined in this Editorial, it will also be published in other journals in the Neuroscience Peer Review Consortium. As the Neuroscience Peer Review Consortium (NPRC) ends its first year, it is worth looking back to see how the experiment has worked.NPRC was conceived in the summer of 2007 at a meeting of editors and publishers of neuroscience journals. One of the working groups addressed whether it was possible to construct a system for permitting authors whose manuscript received supportive reviews at one journal but was not accepted  to send a revised manuscript together with its first round of reviews to a new journal for the second round. This would speed up the review process and reduce the work for reviewers and editors.. You will find information for Authors, Reviewers, Editors, and Publishers there, as well as the information on how journals can join the Consortium.The working group not only designed a framework for transferring reviews among journals, but also implemented it as the NPRC. By the fall of 2007, more than a dozen major journals had signed onto the NPRC, sufficient to launch the experiment in January, 2008. As of the autumn of 2008, 33 journals belong to the Consortium Table . For detThe editors of Consortium journals were recently polled to determine how the NPRC has been working. They responded that during the first nine months about 1\u20132% of manuscripts that they received had been forwarded from another Consortium journal. A similar number had been sent out from each journal to other participants. In most cases, the papers had been expedited, because the editors at the second journal felt the previous reviews, and the authors' response to them, were sufficiently positive to permit re-review by one or both of the original referees. In those cases when the editor at the second journal felt that they needed to get new reviews, the review time at the second journal was about what it would have been if the paper had been submitted there by ordinary means.So, the savings in time and labor are considerable for most of the papers that are transferred between journals via the NPRC. Why then are so few authors using this option?One reason may be that authors resubmit their manuscripts to a journal outside the NPRC. The Consortium includes journals with large volumes of submissions and publications, but the list is far from complete. For example, ISI Web of Knowledge lists 211 Neuroscience journals. The Consortium currently spans this spectrum of journals, from very general to highly specific. However, as more journals join the NPRC, the utility of the system will undoubtedly increase.A more likely reason for authors not using the NPRC is that they are simply not aware of it. Although there were attempts to publicize the NPRC at its onset, many authors may not know about the possibility, or know which journals participate.The process of transferring a paper from one journal to another could not be easier. The author simply revises the paper in response to the original reviews, and writes a cover letter that lists the changes that have been made, the name of the journal at which the paper was previously reviewed, and the accession number at the previous journal. When the paper is submitted to the second journal, the author notes the new accession number and then sends an email to the first journal , asking them to send the reviews for their manuscript to the second journal . The first journal will then send the reviews directly to the second journal, including the names of the reviewers (if they have agreed to have their names transferred). The editors at the second journal then can treat the paper as they see fit, based on the first set of reviews.Of course, not all papers (and reviews) lend themselves to this process. If the reason for rejection at the first journal is that the referees had substantive requirements for additional work or revisions, authors may decide to revise the paper, but then start fresh at the second journal. In the end, we estimate that it is not likely that more than about 10% of rejected manuscripts are appropriate to be handled via the NPRC. But given rejection rates between 50\u201380% at many of the consortium journals, many papers could benefit from the NPRC, and certainly many more than are currently using it.The current members of the NPRC decided in November to extend the life of the Consortium, which was originally a one-year experiment, by at least another year. The International Neuroinformatics Coordinating Facility (INCF), which provides the infrastructure for the NPRC, has agreed to provide its resources for another year. The intention is to continue forward on a year-to-year basis, at the voluntary participation of the member journals. We have in particular to thank Jan Bjaalie, the director of the INCF, and Elli Chatzopoulou, who has been doing all of the administrative work in the INCF, for supporting the NPRC.. Those who have questions are encouraged to contact the co-chairs at csaper@bidmc.harvard.edu or maunsell@hms.harvard.edu.We invite authors who have not yet used the NPRC to try this method for appropriate manuscripts. We invite journal editors and publishers who have held back during the first year to join in. The NPRC entails virtually no cost or work, and provides a payoff in reduced work for authors, reviewers and editors. The methods for authors and editors to use the NPRC are clearly outlined in its website On behalf of the NPRC Editors and Publishers,Clifford B. SaperJohn H.R. MaunsellCo-Chairs, Neuroscience Peer Review Consortium"}
+{"text": "In an effort to identify previously unrecognized aspects of editorial decision-making, we explored the words and phrases that one group of editors used during their meetings.JAMA, a major US general medical journal. One of us (KD) attended 12 editorial meetings in 2003 as a visitor and took notes recording phrases from discussion surrounding 102 manuscripts. In addition, editors attending the meetings completed a form for each manuscript considered, listing the reasons they were inclined to proceed to the next step in publication and reasons they were not (DR attended 4/12 meetings). We entered the spoken and written phrases into NVivo 2.0. We then developed a schema for classifying the editors' phrases, using an iterative approach.We performed an observational study of discussions at manuscript meetings at Our classification schema has three main themes: science, journalism, and writing. We considered 2,463 phrases, of which 87 related mainly to the manuscript topic and were not classified . Phrases related to science predominated . The editors, most of whom were physicians, also placed major weight on goals important to JAMA's mission  such as importance to medicine, strategic emphasis for the journal, interest to the readership, and results (729 or 31% of phrases). About 16% (n = 373) of the phrases used related to writing issues, such as clarity and responses to the referees' comments.Classification of editorial discourse provides insight into editorial decision making and concepts that need exploration in future studies. No public knowledge is gained from scientific and biomedical research unless the study methods and results are properly written up and disseminated, typically by publication in a widely available journal. The decision to publish study findings involves many individuals and groups, including the investigators, the designated authors, the peer reviewers, the journal editors, and editor-in-chief. Some parts of the decision-making process are more easily studied than others, in part because traditionally, publishing decisions have been confidential. From substantial existing research, we know that investigators, not journal editors, are the ones mainly responsible for the decision to publish, and that this decision is related to the direction and strength of study findings (publication bias) -6.JAMA found that editors favor high quality science, and any bias against negative results is either small or does not exist [There are many fewer studies of the editorial decision-making process -10. Editot exist . StudiesJAMA, a major, weekly, general medical journal in the United States, has a broad mission and low acceptance rate. We decided to attend journal editorial decision-making meetings to learn more about what was discussed, to allow construction of quantitative survey instruments that would capture a richer picture of factors influencing publication decisions. The discussions we listened to relate particularly to understanding the mechanisms used when editors must choose only 5% to 10% from a large pool of submitted manuscripts.In an effort to identify previously unrecognized aspects of editorial decision-making, we explored the words and phrases that one group of editors used during their meetings. We did not use formal qualitative methods to analyze the information collected, rather our goal was to help to generate hypotheses for those doing research on editorial decision making and publication practices.JAMA. These were distributed to the editors, almost all physicians, who reject at least half outright without obtaining comments from peer reviewers. When manuscripts are returned from peer reviewers, typically two or three, editors can reject directly or bring the manuscript to an editorial meeting. Some editors bring most of their papers to the table for a decision and others bring only papers they feel have a very good chance of acceptance. Because manuscripts are assigned to a single editor for review, only one editor has typically read a manuscript before the meeting. In 2003, approximately 940 manuscripts were brought to the meeting for discussion. All discussions at the meetings are kept in strict confidence, by JAMA's standing rules.In 2003, 5064 manuscripts (not including letters) were submitted to JAMA offices in Chicago, Illinois, USA in January and February 2003 (some meetings were missed by KD because of scheduling conflicts), and took notes on the discussion surrounding 102 manuscripts . Her notes were not verbatim transcripts of the meeting's discussions. The meeting attendees varied somewhat from meeting to meeting, but typically comprised about eight in-house editors, including editors with content, managing, and statistical responsibilities, and the Editor-in-Chief. Other editors  attended by teleconference if a manuscript for which they were responsible was being discussed. Editors volunteered one-by-one, but in no particular order, to discuss the manuscripts for which they were responsible. Anecdotal reports from editors attending the manuscript meetings is that the meetings attended as part of this study were representative of other meetings.One of us (KD) attended 12 twice weekly editorial meetings, as a visitor, at the The discussion of each manuscript began with a description of the paper topic and study characteristics, with details added as necessary. The presentation progressed to comments made by the peer reviewers. The vast majority of presented manuscripts had completed at least one round of peer review.The note-taker (KD) recorded words and phrases spoken by the editors in the context of each manuscript discussed, the time each discussion took, and the comments and publication recommendation of each of the peer reviewers. In addition, at the end of discussion about each manuscript, editors attending the meeting completed a form on which they listed the reasons they were \"inclined to proceed to the next step towards review and/or acceptance\" and reasons they were not. The editors were asked not to record their names on these forms. Forms were not collected at meetings KD did not attend.ES and CM extracted the phrases from KD's notes and from the completed forms and entered them into NVivo 2.0 qualitative analysis software . Each manuscript was considered a separate document with an array of attributes such as date of discussion, number of positive and negative reviews by outside peer reviewers, time taken for discussion, its categorization by the editors as describing research or not, and final disposition of the manuscript.JAMA objectives [see Table ad hoc schema suggested by the phrases recorded.We next used an iterative process to develop a classification schema for the 2,463 spoken and written phrases. We considered several possible themes, including the For the first draft of the schema, CM and KD reviewed the phrases and documents from the editors' discussions and assigned them to 20 categories related to medical editorial decision-making and publication bias (as defined above). This schema was reviewed by two independent epidemiologists. Each performed an independent review followed by a group discussion with KD. We modified the schema further, categorizing phrases by whether they were related to science , editorial beliefs or values , or manuscript features . Using Nvivo, CM re-sorted most of the 20 categories into the new schema, retiring some categories and merging others. In a one hour meeting, CM and KD presented the revised schema to two independent social scientists, who suggested additional refinements.Finally, we revised the concept of editorial beliefs and values to encompass what we called general journalistic goals, and developed a separate construct within the schema. We considered journalism in medicine to encompass a broad mission that includes educational, public health, and strategic goals such as timeliness, serving the readers' interests, presenting important medical issues, and addressing controversies. In the present instance, \"journalism goals\" were those that spoke to the mission of JAMA and other medical journals \u2013 meaning factors and values important to medical  journals that publish new research .Thus, we classified each phrase as belonging to one of three mutually exclusive categories: science, journalism, and writing. Each phrase was further classified using a subcode within each category and each phrase was assigned a single code. All categories include phrases that are both favorable and unfavorable, although we describe the category using mainly positive terms [see Table We exported 2,463 coded phrases into Excel 2003 (Microsoft Corp) for counts. We excluded 87 phrases (76 of which were spoken) that were coded as describing the title or topic of the manuscript, leaving 2376 coded phrases for analysis.Because our goal was to develop new ways to assess manuscript decision-making and publication bias, and because it could in no way influence the fate of manuscripts being discussed, our project did not involve written informed consent. Editors received written material describing the project, and the project was thoroughly discussed, at the initial manuscript meeting before note-taking and form completion began. We consulted officials at the Johns Hopkins Bloomberg School of Public Health Committee on Human Research who requested that we not include identifying information about the editors, peer reviewers, or authors.Our results include 2,376 phases, 1,773 spoken and 603 written, which we present combined unless otherwise noted. Spoken phrases include 459 referring specifically to comments made by the peer reviewers and 1,314 that reflect the editors' own comments.The most frequent phrases used concerned scientific issues , including research design and methods, presentation and interpretation of results, analysis methods, population studied, power and sample size, measurement variables and measures used, the need for additional data, generalizability, quality of the data, and conflict of interest/ethics [see Table When we examined the 603 written comments made by the editors following each manuscript discussion, we found that science, journalism, and writing were all important factors in the editors' opinions, regarding whether to proceed with acceptance or not [see Table Our goal was to identify new aspects of editorial decision-making that can be used to guide research on publication bias, particularly relating to the stage of the process where editors physically meet around a table and by teleconference to discuss the merits of the manuscripts presented to the group. We found that the discourse at manuscript meetings could be recorded and analyzed, using two means of word and phrase collection. One method was simple note-taking at the meeting, which, by its nature, is likely to be incomplete, for example because the note-taker did not hear or did not record all comments. The other method was a collection of a paper form on which editors were asked to list the reasons they were inclined to proceed to the next step in publication and reasons they were not. Neither of these methods uses standard qualitative research methodology, but instead combines qualitative and epidemiologic approaches. As far as we know, this methodology has not been employed before.We developed our classification schema iteratively, with full knowledge of the phrases recorded. While our classification schema is only one of many possible perspectives, with overlapping categories, and the coding of individual phrases is subjective, our goal was to group editorial commentary in a way that would help future researchers to study the editorial process, rather than to identify \"the truth\".By identifying the major topics of editorial discussion, our work contributes also to development of new variables for studying the publication process more generally. While a body of literature exists on factors involved in editorial decision making, the hypotheses tested in past studies  have mainly reflected individual authors' opinions and experience regarding the decision-making process, and anecdotal rather than recorded evidence.We did not collect any data on the manuscripts rejected before this stage, and cannot infer anything about the process leading to rejection. It is possible for example, that some reasons for rejection are not reflected in the discussion of manuscripts considered at the manuscript meetings.JAMA manuscript meetings concerned the science of research presented in the manuscripts. This corresponds indirectly to the findings of Olson and colleagues who found an association between acceptance for publication and factors positively associated with study quality, for reports of clinical trials submitted to JAMA [Most of the discussion around the table at the 12  to JAMA .Perhaps more interesting is the discussion related to what we categorized as \"journalism\" concerns. This included phrases conveying the concept that the topic or findings were \"important,\" as well as related phrases such as \"interesting\" and those associated with the study findings. While there is nothing surprising about medical journal editors being attracted to important or interesting reports, nor about physician-editors attaching degrees of importance to studies likely to affect the care of patients, we now are able to see the context in which study results are discussed. We would expect, and indeed found, that comments in this category were less frequent than those related to science, given that if the science is shaky there would be little point in much further discussion.JAMA\", \"too long\", \"too specialized\". Examination of the statement of JAMA's aims reveals extensive language indicating that such journalistic features of articles are valued. It is understandable that biomedical editors choose manuscripts that match the stated mission of a journal, which includes an embedded code of values and beliefs. No matter what the intention, those beliefs are a \"differential inclination,\" and may contribute to publication bias, broadly defined. In addition, publishing is a business with profit-making goals, which can indirectly influence a journal's scope and selection of manuscripts [A second aspect of the journalism category involved the editors' interest in maximizing strategic advantage for the journal and related readership issues. Phrases classified in the \"strategic emphasis\" category included \"refer to Archives\", \"published elsewhere\", \"we want the whole thing, not just a salami slice\", \"similar paper in revision\", \"not for uscripts , for exaWritten summaries of reasons to proceed to the next stage toward acceptance or not, completed for each manuscript by the editors, reflected the combined importance of science, journalism, and writing considerations. Peer reviewer comments ranked high in reasons given by editors to proceed toward acceptance or not. Given that the manuscripts discussed at meetings are those still under consideration after two elimination rounds, and that referees are not necessarily experts and can sometimes be wrong, the continuing influence of peer reviewers is especially important. Our meeting notes also indicate a major role for peer review in editorial decision-making, with more than 25% (459/1773) of the spoken phrases referring to comments by the reviewers.In the future, it would be useful to examine whether accepted and rejected manuscripts differ in the discussion content and written summaries. It would also be interesting to see whether similar proportions of peer reviewer comments mentioned in the discussions were positive and negative. Finally, it would be useful to compare the comments attributed to the peer reviewers with phrases used by the editors, to see if their comments reflect similar concerns.JAMA is generalizable to other journals, expansion of our thinking in this area will inform future research, which was our goal.This project provides insight into the process at one journal, focusing specifically on comments leading to requests for manuscript revision, acceptance, or rejection. This journal was selected because it has a tradition of willingness to participate in research about the peer review process . AlthougWe developed a classification of editorial discourse that provides insight into editorial decision-making and concepts that need exploration in future studies.DR is Deputy Editor (West) at JAMAKD conceived of, designed, and provided oversight of the project, and participated in the acquisition, analysis and interpretation of data. With CM, she drafted the manuscript and she coordinated subsequent edits and revisions. She serves as the project's guarantor. ES contributed to acquisition, analysis, and interpretation of the data, and to revision of the manuscript. CM contributed to the concept and design of the study, the acquisition, analysis and interpretation of the data. She also participated in drafting the manuscript and its finalization. DR contributed to the concept and design of the study, and to revision of the manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The tannin fractions isolated from hazelnuts, walnuts and almonds were characterised by colorimetric assays and by an SE-HPLC technique. The complexation of Cu(II) and Zn(II) was determined by the reaction with tetramethylmurexide, whereas for Fe(II), ferrozine was employed. The walnut tannins exhibited a significantly weaker reaction with the vanillin/HCl reagent than hazelnut and almond tannins, but the protein precipitation capacity of the walnut fraction was high. The SE-HPLC chromatogram of the tannin fraction from hazelnuts revealed the presence of oligomers with higher molecular weights compared to that of almonds. Copper ions were most effectively chelated by the constituents of the tannin fractions of hazelnuts, walnuts and almonds. At a 0.2 mg/assay addition level, the walnut tannins complexed almost 100% Cu(II). The Fe(II) complexation capacities of the tannin fractions of walnuts and hazelnuts were weaker in comparison to that of the almond tannin fraction, which at a 2.5 mg/assay addition level, bound Fe(II) by ~90%. The capacity to chelate Zn(II) was quite varied for the different nut tannin fractions: almond tannins bound as much as 84% Zn(II), whereas the value for walnut tannins was only 8.7%; and for hazelnut tannins, no Zn(II) chelation took place at the levels tested. Control samples were prepared in the same way: redistilled water was added instead of TMM reagents. A standard curve of absorbance ratio vs. metal ions concentration was prepared; Cu(II) in the range of 0.025\u20130.125 mM and Zn(II) from 0.2 to 2.0 mM. The percentage of bound metal ions was calculated.In order to determine Cu(II) and Zn(II) chelation capacity, tannin fractions were dissolved in 0.01 M hexamine/HCl buffer with addition of 0.01 M KCl, pH 5.0 . The sam2 \u00d7 4H2O, then 0.5 mL of 5 mM ferrozine was added. Then reaction mixture was left for 10 min at room temperature and absorbance at 562 nm was measured. Control samples were prepared in the same way, but water was added instead of ferrozine solution. The percentage of Fe(II) bound was calculated.Fe(II) chelation activity of tannin fractions from hazelnuts, walnuts and almonds was examined using ferrozine . Tannin 4.This study revealed that tannin fractions obtained from walnuts, hazelnuts and almonds seeds by Sephadex LH-20 column chromatography were able to chelate copper and iron ions, while zinc ions were only bound significantly by almond and hazelnut tannins. Among the metal ions tested, the effectiveness of chelation by the constituents of nut tannin fractions decreased in the order Cu(II) > Fe(II) > Zn(II). The exception was the case of tannin from almonds, which chelated more zinc than iron ions. The chelating capacity of individual tannin fractions analysed varies for different complexed metals and it cannot be pointed out which fraction is the best chelator of metal ions. No relationship was found between molecular weight or type of tannins present in isolated nut fractions and their ability to chelate Cu(II), Fe(II) and Zn(II). Tannin fraction from walnuts containing mainly hydrolysable tannins hardly complexed Zn(II), whereas its Cu(II) chelating capacity was much higher than the fractions isolated from almonds and hazelnuts, which comprise mainly proanthocyanidins. Oligomers of hazelnuts tannins which possess higher molecular weights than condensed tannins of almonds fraction, complexed Cu(II) stronger, but Fe(II) and Zn(II) less effectively."}
+{"text": "Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine welcomes an ever-increasing number of submissions while maintaining an acceptance level well below half of all submitted manuscripts,[The uscripts, meaning uscripts, the editNotably, all papers submitted to the SJTREM and potentially deemed suitable for publication will undergo peer-review from at least 2 (and often more) referees before making a final decision to accept or reject. Due to an increasing number of case reports, the decision to immediately reject those deemed unsuitable for the SJTREM has become more rigorous. The SJTREM wishes to maintain a main focus on original articles, review articles and solicited commentaries to selected studies.peer review is indispensable ...but we also know that it is widely misunderstood. Peer review is not the absolute or final arbiter of scientific quality...it does not test the validity of a piece of research. It does not guarantee truth. Peer review can improve the quality of a research paper...it tells you something about the acceptability of new findings among fellow scientists...\" where he explores this in a greater context of science[While peer-review is currently the best, yet however an imperfect, controversial and, sometimes a misused tool for vesting the scholarly work performed by others-5, the ef science. Thus, ssine qua non for any academic Journal, the editors and editorial board members will, as academically active clinicians and researchers, from time to time submit papers for consideration to \"their own\" journal, in this case the SJTREM. The readers of SJTREM should rest assured that any means of ensuring that integrity and avoiding a corruptive type of camaraderie has been taken. The responsibility of disclosing any conflicts of interest lies with authors as well as referees and editors. Reviewers, alike with authors and editors, need to declare all conflicts of interest, not only financial ties. Often, competitive issues or personal relationships lead to more important and less obvious biases.While editorial integrity is the According to the World Association of Medical Editors (WAME), of which SJTREM is also a member, any conflict of interest can be said to exists when \"...there is a divergence between an individual's private interests (competing interests) and his or her responsibilities to scientific and publishing activities such that a reasonable observer might wonder if the individual's behaviour or judgment was motivated by considerations of his or her competing interests...\". ObviousWith the growing SJTREM reputation and workload it has become even more prudent to properly ensure the integrity within the editorial board. Thus, we thus like to introduce and welcome three new Associate Editors, which will undertake manuscript handling and executive tasks of submitted manuscripts. In particular, this will reduce the possibility of conflicting interests in case of submission from any of the editors or members of the editorial board, as manuscript handling may be covered by a larger and more diverse group of editors. The new editors are professor Maaret Castren , dr. David Lockey  and dr. Stefano Di Bartolomeo . With this addition to the editorial team we have not only vested in diversity but also recruited some of the most experienced researchers in Europe when it comes to research in trauma, resuscitation and emergency medicine. Welcome onboard!http://www.icmje.org) as well as the Committee on Publication Ethics . The latter provides a forum for editors of academic journals to discuss issues relating to the integrity of the work submitted to, or published in, their journals. Examples include conflicts of interest, falsification and fabrication of data, plagiarism, unethical experimentation, redundant publication and authorship disputes. COPE encourages its members to seek investigation into possible misconduct by universities, hospitals or other funders. Flowcharts on how to handle the more common publication misconduct problems are accessible to all on the website . COPE has an independent \"ombudsman\" to adjudicate disputes between COPE members or between them and the organisation. COPE also publishes a Code of Conduct for Editors who are members of the organisation and will investigate complaints against Editors, if raised.The editors wishes to emphasize that the SJTREM endorses the standards set by the Vancouver-group, also known as the International Committee of Medical Journal Editors  for all papers accepted for publication in the Journal. Else, there are no other financial, or otherwise stated, conflicts with the authors."}
+{"text": "The Indian Journal of Urology under the aegis of Urological Society of India conducted the first Peer Review Workshop on October 23-24, 2009. A total of 22 members participated in this exercise. The objective of this exercise was to train the members to critically evaluate manuscripts. The enthusiasm of the participants and the faculty was very satisfying. The Indian Journal of Urology has been following the practice of peer review for the last couple of years. One may sometimes question the wisdom of the peer reviewer as many times their views do not agree with the authors. The process of peer review is not without fallacies and has not been scientifically proven. Many a times the classic papers or scientific content has not been accepted by the peers of their times but have stood the test of time. Still peer review of scientific manuscripts is a corner stone of modern science and medicine. Scientific journals rely on the objective review by the knowledgeable researchers to ensure the quality and standard of papers which they publish. Authors too learn to write better when they go through the advice or criticism of reviewers. Most of the well known high standard journals like Nature, Lancet, and BMJ rely on the process of peer review. The objective of the whole exercise to get impartial judgment, prevent duplication or malpractices in the field of publication.So naturally, the peer reviewers play a very important part in scientific publications. They are like silent backstage workers who receive no credit for their hard work, as most journals do not offer any financial incentive for peer reviewer. A few journals, including as IJU acknowledge all the reviewers by printing their names in the final issue of each year. No wonder they are called the Gate Keepers of Science.There is no formal teaching to peer review. Most of us learn by trial and error. And this becomes a significant handicap for most of us whenever we are asked to review a manuscript. Some departments may have a mentor who may guide the junior faculty to learn the basics of peer review. In this workshop we attempted to provide a basic understanding about the process of journal publication and peer review. The participants were introduced to the important topics by didactic lectures followed by hands on manuscript review and they were encouraged to write a critical review.The most important requirement to become a good reviewer is to be knowledgeable on his subject; he should be willing to spend time, be honest and independent. He should keep up his commitment to the time as prescribed by the editor. He should never forget that he is the central and most important component in the process of publication and has tremendous obligation both to authors and editors.I sincerely hope that continuing the training process we will be able to generate a local resource both in medical writing and in peer review, which would help raise the standard of the journal.I am thankful to the Urological Society of India for supporting the editorial team in this endeavor.This issue has number of impressive articles on renal cell carcinoma and full symposium edited by Dr. Mahesh Gaitonde. He is the Clinical Director at University of Cincinnati College of Medicine, Cincinnati, Ohio, USA.Nephron sparing surgery is rapidly becoming the standard of care for incidentally detected SOL. But it is important to pause and think that despite the huge number of partial nephrectomies carried out in the last decade, the mortality from RCC hasn't declined in the same proportion. It highlights that significant number of patients undergo partial nephrectomies without apparent benefit. Approximately 15-20% of these lesions turn out to be benign. Hence there is an urgent need for basic science and research to be able to distinguish between the good, the bad and the ugly. I am thankful to Dr. Gaitonde and his co-authors for this indepth symposium on renal cell carcinoma.As 2009 draws to a close, IJU has achieved a mile stone of being available in PubMed. I take this opportunity to thank my co-editors for their hard work and the entire team of Medknow Publications for their support.I wish you all a very happy and Prosperous 2010,See you all at Agra.With best wishes."}
+{"text": "We show that when ecologists act as reviewers their reported rejection rates recommended for manuscripts increases with their publication frequency in high impact factor journals. Rejection rate however does not relate to reviewer age. These results indicate that the likelihood of getting a paper accepted for publication may depend upon factors in addition to scientific merit. Multiple reviewer selection for a given manuscript therefore should consider not only appropriate expertise, but also reviewers that have variable publication experience with a range of different journals to ensure balanced treatment. Interestingly since age did not relate to rejection rates, more senior scientists are not necessarily more jaded in reviewing practices. In the peer-review of publications, scientists alternate between two roles: one as author and the other as reviewer If objective assessment of potential publication by others is one of our principal activities, then the effect of experience as referees needs critical examination, particularly since assessment could be balanced by selection of different categories of referees if they exist. In several instances, it has been shown that ecologists who publish more papers experience higher rejection rates of their manuscripts As part of an NCEAS working group on publication bias, we conducted an online survey of ecologists to develop a profile of their experiences with publication and review. A total of 17 open-ended, multiple choice, and likert-scale questions relating to the publication process were included in the survey, however only those pertaining to this paper were analysed and reported here . SpecifiThe survey was posted online from May 4th, 2006 to November 4th, 2006 and was distributed to the Ecological Society of America (ECOLOG) and EvolDir mailing lists as well as promoted at international ecological and evolutionary conferences and posted on the working group website. These distribution lists were selected as a representative means to target ecologists and evolutionary biologists. The extent to which individual respondents subscribe to both list-serves was unknown hence the minimum (assuming there was complete overlap in subscribers to both list-serves) and maximum (where there was no subscription overlap) population sizes ranged from 6000 to 12 200. After removal of duplicates and incomplete surveys, the sample size was 1334 responses, representing between 11% and 22% of the total population solicited. We were unable to test for response bias as non-respondents could not be tracked due to the use of list-serves for survey distribution rs) to examine the association between the recommended rejection rates and reviewer's scientific age and the number of high impact factor journals in which he/she has published. Sensitivity analyses via exclusions were also used to ensure that a relationship detected was not a product of single individuals.Chi-square tests were used to compare the distribution of rejection rate categories among respondents with and without publication experience in high impact factor journals. We calculated Spearman rank correlation coefficients (Respondents reported significantly different recommended rejection rates of reviewed manuscripts depending on publication experience in high-impact-factor (IF) journals . Furtherper se, but that they do likely become more critical as they publish more in high-IF journals. The increase in recommended rejection rates can be as much as double or triple , or whether those with less experience are insufficiently critical (i.e. fail to notice significant shortcomings). Nevertheless, variation in rejection rate by reviewer attributes, as reported here, represents a potential reviewer bias, which is likely to affect community-level perception and assignment of relative merit in the peer-review process Appendix S1(0.03 MB DOC)Click here for additional data file."}
+{"text": "EHP, I indicated in the editorial \u201cRecent Changes at Environmental Health Perspectives\u201d that we were planning to implement a new web-based manuscript submission and tracking system. I am pleased to announce that, as of 15 July 2008, all manuscripts submitted to the journal are being handled by ScholarOne\u2019s Manuscript Central. We are joining more than 170 societies and publishers  in using this system.In the May 2008 issue of EHP. Approximately 40% of all peer-reviewed papers are accepted for publication.At the present time, all commentaries, reviews, and research articles are initially screened by an advisory board to determine if they meet criteria relative to originality, scientific quality, environmental significance, appropriate degree of speculation, clarity of presentation, and conciseness. About 60% of the 1,200 manuscripts submitted to the journal each year are rejected without further review. Those papers selected for peer review are assigned to an associate editor, who is responsible for identifying reviewers and coordinating the peer review of the manuscript. Ultimately, the Associate Editors recommend to the editor-in-chief whether a paper should be published in In 2007, we determined that the average time to first decision for papers was approximately 2 months, and the average time from submission to acceptance was about 6.5 months. Our goal is to shorten the time between submission and acceptance of manuscripts by 20%. We believe that Manuscript Central will help us achieve that goal by streamlining what is currently a labor-intensive process. It will also significantly improve our ability to track manuscripts during the review process and provide critical information to the editor-in-chief and associate editors concerning expertise and performance of potential reviewers.http://mc.manuscriptcentral.com/ehp, where they will be asked to provide five or more keywords concerning their research expertise and interests. Then authors will be guided through a few simple steps to submit their papers.Before submitting a paper for the first time using the new system, authors will need to register with Manuscript Central at Once a paper is in the system, it will be tracked automatically by Manuscript Central. Because this system is web-based, all associate editors will be able to access the database to determine the status of papers assigned to them and retrieve information concerning potential reviewers. Of course, Manuscript Central is password protected, and information concerning authors and reviewers will be available only to the editor-in-chief and the relevant associate editors.EHP are excited by the opportunities afforded by the implementation of Manuscript Central. We look forward to continuing to receive high-quality research papers on environmental health sciences and the satisfaction of knowing that we are publishing the best research in the most timely and efficient manner possible.We at"}
+{"text": "PLoS Medicine editors offer some suggestions for New Year's resolutions for authors, reviewers, editors, and readers to consider.The  For the most part, publishing of research is a gratifying experience for journals and authors. Such publishing is predicated, above all, on trust. Authors need to trust that a journal's reviewers and editors provide a fair review process of their papers. And of course journals need to trust authors to provide a fair, honest, and complete account of their work. Only then can readers have trust in the articles that are published.Looking back over the past year at PLoS, as well as across the broader landscape of academic publishing, it would be hard to conclude that this trusting relationship has not been shaken rather profoundly at times. Editors have sometimes been taken unawares by ghost and guest authors, manipulation of figures, lack of authors' willingness to share data, failure to register trials, and salami-slicing of data to produce the \u201cleast publishable unit.\u201d From an author's perspective\u2014reflected in our survey of authors earlier this year, for example\u2014the relationship may not have been as rosy as it should have been. Long decision times, hypercritical reviewers, seemingly impossible demands at the production stage, and rejection after an extended review process are always hard for authors to bear.So in the spirit of a soon-to-be New Year we'd like to gently offer some suggestions for resolutions for all authors, reviewers, readers, and editors to ponder. We hope that no one will take offence and trust that our choices will become clear as we explain.My authorship list will be complete and accurate, and everyone named will deserve authorship; in particular there will be no ghost or guest authors. The New York Times, in a court case PLoS Medicine have both guest and ghost authors lurking in our papers In case anyone doubts that such a resolution is necessary, look at the furor in July 2009 about the involvement of ghost authors in Wyeth's marketing of Prempro that came to light after our intervention, with I'll have all the data to back up my paper and its images, and none of it will have been manipulated to look prettier than it really was when it came off the scanner/computer.PLoS Biology and PLoS Medicine in 2009 found that 15% of all authors who have been asked for original data could not find it. We don't yet know how often, say, a misplaced gel means manipulation of data, but being fooled even once would be too often, so we will continue to routinely check all images on accepted papers.Unfortunately, many authors are unable to provide the original data underpinning their studies and images. For example, a preliminary survey by I'll stand by my agreement to share all the data that underpins my research . As part of that commitment I will share the study protocol for that research, when requested by editors. PLoS Medicine, we consider the minimization of reporting biases an important part of our role, and duly require authors submitting reports of clinical trials to also provide a copy of the prespecified study protocol. We have on occasion had our requests for protocols met with the response \u201cHow would you like the document written?\u201d Can it surprise anyone that such a response shakes our confidence in the prespecified nature of the analyses?At I'll make sure I've complied with all the requirements for trial registration.Trials are still submitted to us that have not been registered. Compulsory trial registration has been in place for more than three years now, and it is clearly laid out in our author guidelines If I'm unable to review a paper, I'll let the editor know within a few days of receiving the request to review.Editors expect reviewers to say \u201cno\u201d to requests quite often\u2014we understand you are busy. But if you can let us know quickly, we can then provide authors with a faster editorial peer review process. We also expect reviewers to declare competing interests related to the paper or the authors If I promise to review I will do so.Late reviews cause even more problems than late responses to review requests. Not only does failure to provide a timely review set the evaluation process back, but reviews that never materialize also raise questions about a reviewer's motives for agreeing to review in the first place.I'll be polite when I review the paper.The tone of a review can mar an otherwise very helpful review. Reviews also aren't the place to impugn the authors' motives, unless of course you have incontrovertible evidence. Even so, it is best to stick to the facts. We'll take it very seriously if you contact us to say that there is something we must scrutinize further.Will you resolve to talk to us?We'd urge our readers to tell us more about what you want from the journal and its online functionality, and what you think of the articles themselves. Read, rate, and reuse the papers. Open access journals are only partially fulfilling their mission if the papers they publish remain embedded in the journals they were originally published in and not reused or redistributed.We're sure our authors will have opinions on this but here's what we resolve to do.We'll be quick, efficient, and courteous in our process.We understand how important your work is. We have all been authors too. Presubmission inquiries have been successful in reducing our first decision time to about 24 hours. We are now actively looking at all aspects of our process to decrease time to decisions later in the process.We'll review the composition of our editorial and reviewer boards in an attempt to be inclusive in the people we get to advise us.We'll listen to our authors and reviewers if they have complaints or suggestions.So please, if we send you a survey, fill it in. We love feedback, even if it's not positive.We'll continue to advocate for the highest level of publishing ethics. We will continue to publish editors' competing interests We'll continue to innovate. We recognize there is still a ways to go before open access journals fulfill the promise of a truly integrated information resource. So far this year we have instituted new ways of publishing by using our new TOPAZ software program, which provides enhanced ability to comment on articles. The recently launched article level metrics on all the PLoS journals Here's one more resolution we'd like to share with everyone. By the time this editorial is published, leaders representing signatories to the United Nations Framework Convention on Climate Change will have met in Copenhagen. Whatever the outcome of the summit, the solution to climate change can't just rest with politicians \u2013 it is the responsibility of us all. We've just signed up to 10:10"}
+{"text": "To the Editor:Rickettsia slovaca is a bacterium that infects Dermacentor marginatus ticks in central and western Europe. First detected in ticks, the bacterium was subsequently identified with genomic amplification by using polymerase chain reaction (PCR) followed by sequencing in a skin biopsy from a French patient (D. marginatus tick. The patient saw a physician 1 day later for low-grade fever (38\u00b0C) and myalgia. She was given amoxicillin (3 g once a day), but the fever worsened. She was examined at University Hospital on September 24, 2001, 4 days later. At that time, the patient had a fever; the site of the tick bite showed a necrotic black lesion surrounded by an erythematous halo 4 cm in diameter. Right cervical lymphadenopathy and a papular rash consisting of 10 pink spots on the thorax and arms were observed. Routine blood tests were within normal ranges but asparate aminotransferase , creatine phosphokinases , and lactate dehydrogenases  were elevated. A skin biopsy from the patient\u2019s scalp, serum, and the tick were sent to Marseille to test for possible rickettsial infection. The patient was treated with doxycycline , and her condition improved. At a check-up 1 month later, she complained of fatigue and insomnia; 2 months later, she had recovered completely, although alopecia still appeared at the site of the tick bite.A 79-year-old woman from St. Etienne, France, found a tick on the parietal area of her scalp 6 days after she returned from a trip to rural southern Burgundy. The tick was removed and subsequently identified as an adult female R. slovaca was demonstrated in the tick and the biopsy by using PCR with primers derived from the citrate synthase and the rOmpA genes as previously reported , respectively.R. slovaca, first identified in dermacentor ticks from Slovakia, has subsequently been found in both D. marginatus and D. reticulatus in France, Switzerland, Portugal, Spain, Armenia, and Germany  and regional lymphadenopathy that may be painful. Fever and rash develop subsequently, and the acute disease can be followed by fatigue and residual alopecia at the bite site. The disease may be prevalent within the distribution range of D. marginatus and D. reticulatis in southern, western, and central Europe. This new spotted rickettsiosis should be added to the list of recognized rickettsial diseases, mainly those caused by R. africae (R. felis (R. mongolotimonae ("}
+{"text": "Brachyspirales ord. nov., Brevinematales ord. nov. and Leptospirales ord. nov. and the emended description we proposed for the order Spirochaetales . The type genus is Spirochaeta Ehrenberg 1835 (Approved Lists 1980) Skerman et al. . The type genus is Spirochaeta Ehrenberg 1835 (Approved Lists 1980) Skerman et al. , bifunctional Hpr kinase/phosphatase and 30S ribosomal protein S13.Borreliaceae .Borrelia and Cristispira. Organisms are helical, 0.2\u20133 \u03bcm in diameter and 3\u2013180 \u03bcm in length. Cells do not have hooked ends. Periplasmic flagella overlap in the central region of the cell. Cells are motile, host-associated and microaerophilic. The diamino acid component of the peptidoglycan is L-ornithine. Organisms are chemo-organotrophic and utilize carbohydrates or amino acids as carbon and energy sources. The G+C content of the DNA is 27\u201332 (mol%). The type genus is Borrelia .Brachyspiraceae. Organisms are helical, 0.2\u20130.4 \u03bcm in diameter and 2\u201311 \u03bcm in length. Cell ends may be blunt or pointed and do not have hooked ends. Periplasmic flagella overlap in the central region of the cell. Cells are motile, host-associated and obligately anaerobic and aerotolerant. The diamino acid component of the peptidoglycan is L-ornithine. Organisms are chemoorganotrophic and utilize monosaccharides, disaccharides, the trisaccharide trehalose, and amino sugars as carbon and energy sources. The G+C content of the DNA is 24\u201328 (mol%). The type genus is Brachyspira .Brevinemataceae. The description of this order is the same as that of the family Brevinemataceae .Leptospiraceae. Organisms are helical, 0.1\u20130.3 \u03bcm in diameter and 2\u201311 \u03bcm in length. Cells have hooked ends. Periplasmic flagella do not overlap in the central region of the cell. Cells are motile. The diamino acid component of the peptidoglycan is \u03b1,\u03b5-diaminopimelic acid. Obligately aerobic or microaerophilic. Organisms are chemoorganotrophic and utilize long-chain fatty acids or long-chain fatty alcohols as carbon and energy sources. Both free living and host-associated members. The G+C content of the DNA is 33\u201355 (mol%). The type genus is Leptospira (Noguchi, The order contains one family, Noguchi,  (ApproveOrganisms from this order are distinguished from all other bacteria examined to date by the conserved signature indels described in this report in the following proteins: 50S Ribosomal protein L14, 30S Ribosomal protein S2, alanyl-tRNA synthetase, flagellar basal-body rod protein FlgG, and flagellar filament core protein FlaB.Leptonema, Leptospira, and Turneriella. The description of the family Leptospiraceae (Hovind-Hougen, Leptospirales ord. nov. The type genus is Leptospira (Noguchi, The family contains three genera, Noguchi,  (Approve"}
+{"text": "Y) and still a lack of understanding. This paper reports three-dimensional numerical simulations with tip locations Y = 1.00 pile diameter (D), 0.25D, 0.00D, and \u22121.00D. It is found that, against expectations, the dragload and NSF are not proportionally related to the tip location. When maximum dragload (Pmax) is eventually eliminated due to an axial load, there is also a negative crest of the skin friction, indicating that NSF still exists based on the criterion of the dragload reduction. The side resistance of the piles with Y = 1.00D and 0.25D is almost fully mobilised, which is demonstrated by the increment of end resistance that greatly increases with the larger axial loads. However, the side resistance of the piles with Y = 0.00D and \u22121.00D has a potential capacity to carry more loads with continued displacement since the increment of end resistance increases almost linearly with axial load. Therefore, when designing the pile foundation, the inclusion of the NSF should be governed by the amount of axial load to be resisted.When applying axial load on piles subjected to negative skin friction (NSF), the yielded NSF is gradually eliminated. The process is notably influenced by the tip location ( Negative skin friction (NSF) due to the surrounding soil settling more than the pile has been reported by many researchers, who examined the NSF that occurs under the application of a surcharge load , withdraA number of tests have been carried out to investigate the behaviour of bored piles subjected to NSF , 5\u20138. PrY. When pile subjected to surcharge and axial loads (Step 2), the pile starts to settle and gradually exceeds the surrounding soil, leading to NSF and dragload elimination. Therefore, as an important factor, the tip location is considered to affect the degree of dragload elimination. However, how the tip location affects the occurrence or elimination of the dragload and NSF has not been studied and fully understood. Hence, three-dimensional numerical analyses are performed on piles with tip locations Y = 1.00D, 0.25D, 0.00D and \u22121.00D, where D is the cross-sectional diameter of the piles and \u22121.00D means the pile tip is located into the stiff sand layer with a depth of 1.00D. The numerical simulation with Y = 1.00D is verified by reported measured data by Lam et al. [This paper studies the effects of the tip location on single piles subjected to a surcharge load and a series of axial loads, as shown in m et al. .Y = 1.00D, there are 8,960 elements and 9,785 nodes for the soil and 896 elements and 1,189 nodes for the pile. Detailed information on the elements and nodes of the remaining three pile-soil systems is summarized in Numerical analyses are carried out based on a reported centrifuge test  used forThe boundary conditions are as follows: the roller supports are specified on the lateral boundary elements and the pinned supports are specified on the bottom boundary elements. The water table is kept at the ground surface, which is a drainage boundary. 45\u2009kPa pressures are applied on top of the clay layer to simulate the surcharge load. Coupled analysis is used in this paper. Hence, at the initial conditions, the initial effective stresses are set up using the buoyant unit weight.Ep = 30\u2009GPa). The density and void ratio are 2.7\u2009kg/m3 and 0.18, respectively. The pile-soil slips are simulated using duplicated nodes to form an interface of zero thickness. The interface friction angle (\u03b4) is estimated using the equation proposed by Randolph and Wroth [The constitutive models and parameters for each solid are shown in nd Wroth  as folloTherefore, the interface friction coefficient of 0.32 is used in these analyses. The limiting relative shear displacement is taken as 0.005.Es before yielding. After yielding, the stress-strain relationships of the sand layer are described by a composite Mohr-Coulomb criterion. The sand is simulated as having a 70% relative density, corresponding to a saturated unit weight (\u03b3sat\u2061 = 19.4\u2009kN/m3). Therefore, the value of p\u2032 at the middle of the sand layer is approximately 100\u2009kPa, corresponding to a maximum shear modulus of 103\u2009MPa [G) associated with a shear strain of 0.1% is approximately 46\u2009MPa. Therefore, the Poisson's ratio and Young's modulus of sand soil are taken as 0.3 and 120\u2009MPa, respectively. The friction angle at the critical state (\u03c6\u2032) is 29.7\u00b0. The dilation angle is 8.3\u00b0 according to the empirical equation by Bolton [The soil is consisted by two layers, including 12\u2009m sand underneath 18\u2009m clay. The bottom sand is modeled as an elastoplastic material, with a Young's modulus of  103\u2009MPa . The soi\u03b3sat\u2061 = .4\u2009kN/m3.y Bolton .e-ln\u2061p\u2032 plot. Experiments show that isotropic consolidation follows the isotropic loading line characterized by a material constant \u03bb. Because of the elasto-plastic nature, the unloading path does not follow the consolidation loading line. Instead, the material follows an unloading line characterized by a material constant \u03ba. When the material is reloaded, it usually follows the same path as unloading until the mean normal stress p\u2032 exceeds the maximum p\u2032 in the loading history, and it then follows the load line again. The two material constants can be obtained by the following equations:e is the void ratio, p\u2032 is the mean stress, and q is the deviatoric stress. Because a plastic volumetric strain increment can occur only when the current stress is on the yield locus, under isotropic loading, p\u2032 equals p0\u2032. Thus, the hardening parameter p0\u2032 is a function of \u03b5vp, which is given byFor the top clay stratum, the failure criterion is described by the modified Cam-clay model, which was developed at Cambridge between 1960\u20131970 by Roscoe and Burland . One of p\u2032-q space. The yield function of the modified Cam-clay model can be written byM is the slop of the critical state line and p0\u2032 is the value of p\u2032 at the intersection of the yield locus with the p\u2032 axis, where q = 0. The initial void ratio (e0 = 1.6) is obtained by reported measurements [\u03bb = 0.14 and \u03ba = 0.012 are specified through one-dimensional consolidation tests. Based on this test, the slop of the critical state line in p\u2032-q space (M) is given as 0.98 [urements . The val as 0.98 .Create pile-soil numerical meshes and give each part the corresponding material properties.Apply the boundary conditions.K0 = 1 \u2212 sin\u03c6\u2032. After the geostatic step, the settlement of the ground is smaller than 10\u22125\u2009m.Establish the initial stress conditions. The geostatic step is carried out with the lateral earth pressure ratio Apply a pressure of 45\u2009kPa on the ground surface to simulate the surcharge load. Reveal the tip location effects on the occurrence of the dragload and NSF. This step lasts for 6.75 years for clay consolidation according to the centrifuge tests conducted by Lam et al. .P) step by step with an increment of P/Pmax\u2061 = 0.25 (Pmax\u2061 is the maximum dragload which is obtained in step 4) to reveal the tip location effects on the elimination of the dragload and NSF, the variation of pile capacity, and the load transfer mechanism.Apply the axial load . The details of the simulation procedures are summarized as follows.Y = \u22121.00D) and a floating pile (Y = 0.25D). The results show that the neutral plane of the floating pile is located at approximately z/H = 0.75. For the end-bearing pile, the neutral plane is located near the bottom of the embedded pile length, causing NSF that almost acts on the whole pile. The result agrees with other studies [Y = 1.00D and 0.25D and two end-bearing piles with Y = 0.00D and \u22121.00D. The load condition changes from only a surcharge load to both surcharge and axial loads. The constitutive models and element meshes of the pile with Y = 1.00D are verified by means of the reported centrifuge test data [Tip location effects have been reported by Ng et al. , who maile Y = 0.5D. The rest data .Y = 1.00D, 0.25D, 0.00D, and \u22121.00D. To assist in the interpretation of the measured and computed dragload, the \u03b2-method is used to estimate the NSF [fs and \u03c3\u2032 are the NSF mobilised along the pile shaft and the effective overburden pressure, respectively. In soft clay, the value of \u03b2 is suggested as 0.25. Meyerhof [\u03b2 values ranging from 0.18 to 0.35. Using  are calculated and plotted in the figure for comparison. the NSF \u201324, exprY = 1.00D can be described by \u03b2 = 0.26, and the computed dragload can be estimated by \u03b2 = 0.30. It should be noted that the \u03b2-method only gives a reasonable estimation of the dragload at the upper bound. It cannot take into account the reduction of the dragload at the lower bound.The measured and computed dragload increases at the upper depth and then decreases under the neutral plane. On the top of the neutral plane, the measured dragload  for the Y = \u22121.00D is smaller than that of the pile with Y = 0.00D. The measured and computed maximum dragload of the pile with Y = 1.00D are 849\u2009kN and 741\u2009kN, respectively. The measured maximum dragload is 15% larger than the computed maximum dragload, indicating agreement between the numerical simulation and the centrifuge test. The computed maximum dragload of the piles with tip locations Y = 0.25D, Y = 0.00D, and Y = \u22121.00D are 907\u2009kN, 1571\u2009kN, and 1390\u2009kN, respectively, which are 122%, 212%, and 188% that of the pile with Y = 1.00D. In other words, the maximum dragload increases by 112% as the tip location ranges from Y = 1.00D to Y = 0.00D. Hence, the tip location should be as large as possible when floating piles are subjected to only a surcharge load. A large tip location can reduce the dragload and compression efficiently.The measured and computed maximum dragloads of piles with different tip locations are summarized in \u03c4) are illustrated in z/H = 0.60 and 0.71 for the floating piles with Y = 1.00D and 0.25D, respectively. Furthermore, the computed neutral planes are located at depths of z/H = 0.82 and 0.75 for the end-bearing piles with Y = 0.00D and \u22121.00D, respectively. This result indicates that the computed neutral plane shifts downward as the tip location decreases. However, when the pile tip is located in the stiff sand layer, the relative displacement between the pile and its surrounding soil is controlled, resulting in a smaller skin friction and a shallower neutral plane for the pile with Y = \u22121.00D compared to the pile with Y = 0.00D. As a reference, the measured neutral plan is located at z/H = 0.73 [The measured  and compH = 0.73 , indicatz/H = 0.3. Meanwhile, the computed NSF peaks at depth approximately z/H = 0.5. Additionally, the measured positive skin friction (PSF) does not have a peak value, but the computed PSF peaks at about z/H = 0.9. This is because it is difficult to install the strain gauge continuously to monitor the dragload and skin friction in the centrifuge test. Hence, there is lack of measured data near the pile tip, thus no peak value for the measured PSF. In this analysis, both the floating pile (Y = 1.00D and 0.25D) and end-bearing pile (Y = 0.00D and \u22121.00D) have PSF when subjected to the surcharge load. Each pile tip of four cases still settles more than its corresponding surrounding soil for the end-bearing piles. This phenomenon may be caused by two reasons. First, the relative stiffness between the clay layer and the sand layer is limited in this analysis. Second, the sliding effect of the pile-soil interface is used and affects the behaviour of skin friction, as discussed by Jeong et al. [Four piles have a similar trend that the computed NSF peaks at depth approximately g et al. .\u03b2-method  are also shown in the same figure. As discussed in the dragload, the measured NSF can be described by \u03b2 = 0.26 for the shallower depth. However, it cannot reveal the nonlinear variation of skin friction, especially for floating piles because the calculated skin friction varies linearly along the depth. Therefore, the \u03b2-method is more reasonable for estimating the NSF of end-bearing piles because they have a limit PSF.For reference, the calculated skin frictions by means of the Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively. When a surcharge load is applied to the surrounding soil, the displacement of the surrounding soil is larger than that of the pile at the upper depth. The negative relative displacement induces a downward-acting NSF. With increasing depth, most of the applied surcharge load is redistributed from the surrounding soil to the pile through the pile-soil interface. The tip of the floating pile settles more than its surrounding soil because of the lower stiffness of the bottom soil (soft clay layer), inducing obvious upward-acting PSF. However, the tip of the end-bearing pile has limited settlement because of the higher stiffness of the bottom soil (stiff sand layer), leading to slight upward-acting PSF. Therefore, there is an obvious intersection between upward-acting PSF and downward-acting NSF, which is governed by tip location.As is well known, the occurrence of PSF and NSF is governed by the relative displacement between the pile and its surrounding soil. To show the effects of the tip location directly, the settlement of the surrounding soil in relation to the surface contour is plotted in Figures Y = \u22121.00D settles less than the pile-soil system with Y = 0.00D, leading to a phenomenon in which the neutral plane of the pile with Y = \u22121.00D is shallower than that of the pile with Y = 0.00D.Against expectations, the settlement of the surrounding soil does not increase proportionally with decreasing tip location, especially for end-bearing piles. When encountering only a surcharge load, both the surrounding soil and the pile with Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively. On the other hand, the corresponding pile settle 16\u2009mm, 15\u2009mm, 8\u2009mm, and 5\u2009mm, respectively. It is concluded that the dragload and skin friction are heavily influenced by the relative pile-soil displacement. The larger the relative pile-soil displacement is, the larger the induced dragload and skin friction are for floating piles before yielding. From these contours, these contours, the locations of the neutral plane can be clearly illustrated. It is the zone surrounded by the downward settlement curve and the upward settlement curve.As summarized in Y = 1.00D, 0.25D, and 0.00D have a sphere of influence smaller than 6D, as shown in the contours. However, the pile with Y = \u22121.00D has a larger sphere of influence, approximately 8D far away from the pile, which may be caused by the embedded pile tip. For this case, the upper part of this pile is dragged by its surrounding soil, but the pile tip is difficult to insert into the stiff sand layer. Therefore, a large shear stress develops adjacent to the pile, resulting in vertical soil arching along the pile shaft. At the zone outside 8D, the settlement curve is almost a horizontal line at a given depth.A single pile influences the zone approximately 6D away from the pile . BecauseY = 1.00D) are taken into account and plotted for verification [Pmax\u2061; that is, P/Pmax\u2061 = 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 1.75, 2.00, 2.25, 2.50, 2.75, 3.00, 3.25, 3.50, 3.75, 4.00, 4.25, 4.50, 4.75, and 5.00.The settlement of a floating pile is more significant than that of an end-bearing pile , 6\u20138, 26fication . To reveY = \u22121.00D being studied), excessive settlement could develop on shaft bearing piles with pile tips in compressive soils, which is true for the Y = 1.00D case being studied. Davisson's criterion [L is the pile length (mm), A denotes the cross-sectional area of the pile (mm2), Ep denotes Young's modulus for the material of the pile (kN/mm2), and D\u2032 denotes the least lateral dimension of the pile (mm). Using this criterion, the normalised settlement of the piles being studied is \u0394 = 1.24D without varying with tip location. Therefore, the allowable load, also the pile capacity in this study, is 1728\u2009kN for the stated centrifuge test. For the computed load-settlement curve, the allowable load for the pile with Y = 1.00D is 1080\u2009kN, which is approximately 63% that of the measured results. Both the measured and computed load-settlement curves have a similar trend. The pile-soil system yields at an axial load of approximately 1600\u2009kN. When the axial load is smaller than 1600\u2009kN, an almost linear variation of the settlements is induced, indicating the elastic compression that occurs in soils. When the axial load is larger than 1600\u2009kN, both the measured and computed curves are far too steep to be taken as the serviceability condition. It is confirmed that the numerical simulations, including the constitutive models and element meshes, are reasonable.When designing deep foundations subjected to NSF, serviceability instead of the ultimate state usually becomes the governing factor. Because NSF is usually associated with a large settlement even with a small dragload  is increased by 14%, but the pile capacity can be improved by 266%. For this reason, the end-bearing pile is recommended when subjected to the axial loads.As expected, the pile settlement decreases with the decreasing tip location. Two floating piles with tip locations Y = 1.00D, 0.25D, 0.00D, and \u22121.00D are illustrated in Figures As the load component changes from only a surcharge load to both surcharge and axial loads, the variations of the axial force for the piles with As the axial load increases, a pile gradually settles faster than its surrounding soil. The position of the maximum dragload shifts upward, eliminating the dragload and NSF. Both the floating pile and the end-bearing pile have the same trend in that the maximum dragload eventually disappears, and is replaced by the maximum axial force at the pile head. However, it should be noted that the axial force along the pile shaft is not simply the sum of the dragload that is caused by the surcharge load and the axial force that is caused by the axial load. Under this load condition, the slope of the axial force and the proportion of the end resistance differ for different tip locations, which will be discussed later.R is the rate of maximum dragload reduction; Pmax\u2061 is the maximum dragload before the application of an axial load; and Pmax\u2061,axial is the maximum dragload at a given axial load. The reduction of the maximum dragload for each pile is summarized in P/Pmax\u2061 = 2.0, 2.5, 3.5, and 4.5 for the piles with Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively. This result coincides with Jeong et al. [Pmax\u2061 is required to eliminate dragload completely. For an end-bearing pile, especially a pile with the tip located in stiff bottom soil (as with the pile with Y = \u22121.00D being studied), although the magnitude of the dragload is limited due to the surcharge load, it is difficult to eliminate completely when subjected to axial loads.To describe the variation of the axial force from only a surcharge load to surcharge and axial loads, one coefficient, that is, the maximum dragload reduction, is defined. Jeong et al.  quantifig et al. , who repI is the base stress increment, qb is the dragload at the pile tip before the application of an axial load, and qb,axial is the axial force at the pile tip under a given axial load. The end resistance increment for each pile is summarized in Y = 1.00D and 0.25D, the increments of the base stress increase nonlinearly with the axial load and at an increasing rate. For the pile with Y = 1.00D, the end resistance heavily contributes to the pile capacity, which may be caused by the full mobilization of the side resistance at a larger axial load. For the piles with Y = 0.00D and \u22121.00D, the increments of the base stress increase almost linearly with the axial load. As stated, the maximum dragload is eliminated completely at P/Pmax\u2061 = 2.0, 2.5, 3.5, and 4.5 for the piles with Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively. Under the corresponding axial load, the increment of each end resistance is approximately 21%, 68%, 145%, and 248%, respectively. It is confirmed that the end resistance plays an important role for end-bearing piles before its dragload is eliminated completely.Furthermore, to describe the variation of the end resistance from only a surcharge load to both surcharge and axial loads, the other coefficient, that is, the end resistance increment, is defined as follows:P/Pmax\u2061 value that the dragload is eventually eliminated, the additional compressive force should not be taken into account. Although the end-bearing pile has a higher pile capacity, the procedure of dragload elimination is difficult.From only a surcharge load to surcharge and axial loads, the variations of those two coefficients are governed by stress transfer mechanisms between each pile and its surrounding soil. Under a surcharge load, the surface load is carried by the soil and then transferred to the pile by means of NSF. Under both surcharge and axial loads, the load is carried by the pile and then transferred to the soil by means of the pile-soil interface. Therefore, both the maximum dragload reduction and the base stress increment result from the variation of the stress condition. Thus, when designing the pile foundation, the dragload should not be added to the loads from the structure and the capacity value should not be reduced by the dragload. The inclusion of NSF in the foundation design should be governed by the amount of axial load to be resisted. Exceeding the Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively. As stated in dragload, when subjected to a surcharge load only, the positions of the neutral plane yield at z/L = 0.60, 0.71, 0.82, and 0.75, respectively. When subjected to both surcharge and axial loads, the neutral plane moves upward. At a certain axial load, there are two neutral planes for the skin friction. This is caused by the relative pile-soil displacement. With increasing axial load, the pile first settles and then drags the surrounding soil to settle. This mechanism contradicts the stated mechanism of piles subjected to a surcharge load only. When the axial load is large enough, the neutral plane disappears. In this analysis, the neutral plane disappears at P/Pmax\u2061 = 2.0, 3.0, 4.0, and 5.0 for the piles with Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively. The load steps follow these values for the maximum dragload elimination.The computed variations of the skin friction are shown in Figures Y = 1.00D and 0.25D almost does not increase with increasing axial load after P/Pmax\u2061 = 3.0 and 4.0, respectively. This indicates that the side resistance of each pile has almost been fully mobilised under the corresponding load step. This is the explanation of P/Pmax\u2061 = 2.0 and 3.0 for the piles with Y = 1.00D and 0.25D, respectively. For end-bearing piles, the skin friction still proportionally increases with the axial load, which agrees with the increment of the end resistance in For piles with different tip locations, the variation of the skin friction encounters different processes. For floating piles, the skin friction of the piles with There is an unexpected occurrence that NSF due to the surcharge load is not fully eliminated when the maximum dragload disappears. Four piles have the same phenomenon that there is a negative crest of the skin friction, although the maximum dragload is fully eliminated. Therefore, when designing pile foundations, it should be noted that the NSF still exists based on the criterion of the maximum dragload elimination.Y = 1.00D is verified by the reported centrifuge test. The measured and computed results are satisfactory, indicating the reasonability of the constitutive models and element meshes. As the basis of those numerical analyses, several conclusions are drawn as follows.As expected, the smaller the tip location is, the larger the dragload and skin friction are yielded for floating piles that the pile tip does not insert into the stiff funding soil. This is because the relative pile-soil displacement increases with decreasing tip location. Against expectations, the deeper the tip location is, the smaller the dragload and skin friction are for end-bearing piles that pile tip insert into the stiff funding soil. This effect is observed because the pile settlement is controlled by stiff funding sand. Hence, as the basis of this study, in order to reduce the dragload and the compression of pile shaft efficiently, the tip location of the floating pile should be as large as possible when meeting the requirement of the bearing capacity but the pile tip of the end-bearing pile should be located as deep into the bottom soil as possible.Y = 1.00D to Y = \u22121.00D, the pile length  is increased by 14%, but the pile capacity is improved by 266%. For this reason, the end-bearing pile is recommended when subjected to axial loads without surcharge load or when the surcharge load has been fully eliminated.The tip location plays an important role in controlling the pile settlement and improving pile capacity. From P/Pmax\u2061 = 2.0, 2.5, 3.5, and 4.5 for the piles with Y = 1.00D, 0.25D, 0.00D, and \u22121.00D, respectively, and the corresponding NSF is fully eliminated at P/Pmax\u2061 = 2.0, 3.0, 4.0, and 5.0, respectively. There is a negative crest of the skin friction, although the maximum dragload is fully eliminated. In other words, it should be noted that when designing a pile foundation, NSF still exists based on the criterion of the maximum dragload elimination.When the load condition changes from a surcharge load to surcharge and axial loads, the developed dragload can be eliminated completely at P/Pmax\u2061 = 2.0 and 3.0, the skin friction of the floating piles with Y = 1.00D and 0.25D almost does not increase with increasing axial load, respectively. This indicates that the side resistance of the floating piles is almost fully mobilised, as illustrated by the end resistance increment, which greatly increases with the axial load after P/Pmax\u2061 = 2.0 and 3.0, respectively. However, from P/Pmax\u2061 = 0.0 to P/Pmax\u2061 = 5.0, the skin friction of the end-bearing pile still increases proportionally with the axial loads. This finding means that the side resistance of the end-bearing pile can carry more axial load by sacrificing further settlement since the end resistance increment almost linearly increases with the applied axial load.At Therefore, when designing the pile foundations, the inclusion of NSF in the foundation design should be governed by the amount of applied axial load to be resisted and heavily influenced by the tip location. When the axial load exceeds a certain value, which eventually eliminates NSF, NSF need not be taken into account.Three-dimensional numerical analyses are performed to investigate the effects of the tip location on piles subjected to surcharge and axial loads by considering the occurrence of the dragload and NSF, the elimination of the dragload and NSF, the variation of the pile capacity, and the load transfer mechanisms. The back-analysis of the pile with"}
+{"text": "Retroperitoneal lymph node dissection (RPLND) is a prognostic, palliative, and potentially therapeutic procedure for patients with malignant phenotype Leydig cell tumours of the testis. We reviewed the records of patients diagnosed with malignant phenotype Leydig cell tumours of the testis treated by RPLND. Modified template dissection was performed in all cases with extra-template excision of tumour mass in Stage II disease. Routine clinico-radiological follow-up was performed. Six open RPLNDs (1 re-do procedure) were performed on 5 patients diagnosed with Stage I (n = 3) and Stage II (n = 2) malignant phenotype Leydig cell tumour of the testis. Median age = 63 years (range = 55-72). Median peri-operative blood loss = 1500 ml (range = 500-1500 ml). Median operating time = 6 h (range = 4.5-6.5). Two patients with Stage II disease developed post-operative complications of acute kidney injury (n = 1) and pneumonia (n = 1). Median length of stay was 8 days (range = 6-11). RPLND specimens from patients with Stage I were tumour-free, whilst patients with Stage II disease had evidence of metastatic tumour. At latest follow-up , no patient with Stage I disease had radiological evidence of recurrence, however the two patients with Stage II disease had died due to tumour recurrence at 13 months and 36 months. RPLND for malignant phenotype Leydig cell testicular tumours appears to be well tolerated. Despite surgery, overall outcomes for Stage II appear to be poor due to the disease phenotype. Larger prospective multi-centre studies are required to determine the definitive criteria for surgery in Stage I disease.The online version of this article (doi:10.1186/s40064-014-0781-x) contains supplementary material, which is available to authorized users. Testicular cancer is a relatively rare malignancy with ~2200 new cases diagnosed each year in the UK (Testicular cancer incidence statistics ). In ScoLeydig cell tumours are gonadal stromal tumours that represent less than 5% of adult testicular tumours, however are the most common non-germ cell testicular tumour (Cheville ). WhilstRetroperitoneal lymph node dissection (RPLND) can be performed subsequent to orchidectomy in patients with both organ-confined and metastatic disease, and serves as a prognostic, palliative, and potentially therapeutic procedure. The outcomes of RPLND for malignant Leydig cell tumours of the testis have been limited to a few case series  diagnosed with Stage I (n\u2009=\u20093) and Stage II (n\u2009=\u20092) malignant phenotype Leydig cell tumour of the testis. The median age at diagnosis was 63\u00a0years (range\u2009=\u200955-72), and there were 4 right-sided and 2 left-sided modified template RPLNDs performed. Clinico-pathological characteristics of the patient cohort are given in Table\u00a0Although pre-operative ejaculatory function data was not available, a standard modified unilateral template dissection was performed for all cases of Stage I disease with attempted nerve-sparing to preserve post-ganglionic sympathetic fibres for ejaculatory function. For Stage II, an extended dissection was performed to completely resect the tumour mass as indicated by pre-operative imaging. Peri-operative details are given in Table\u00a0One patient with Stage II disease (Case 1) had extensive involvement of the right ureter in tumour mass and therefore nephrectomy was performed. One patient with Stage II disease developed post-operative complications of acute kidney injury (Case 3) and one patient with Stage I disease developed pneumonia (Case 5). The median length of stay was 8\u00a0days (range\u2009=\u20096-11). On histopathological assessment, resected specimens from patients with Stage I were tumour-free, whilst patients with Stage II disease had evidence of metastatic tumour in the RPLND specimens. Unfortunately, post-operative ejaculatory function was not available for all patients.At latest follow-up , no patient with Stage I disease had radiological evidence of recurrence, however patients with Stage II disease had died due to tumour recurrence at 13\u00a0months and 36\u00a0months. One of the patients with Stage II disease (Case 3) developed an early left-sided pelvic recurrence adjacent to the mesentery of this sigmoid colon and ureter, and required re-resection with ureteric reconstruction with a Boari flap at 16\u00a0months post primary surgery. Figures\u00a0Malignant phenotype Leydig cell tumours typically present in older men with a reported median age of 62.1 (range 39\u201370) years , which Leydig cell tumours are historically quoted as having 10% risk of malignant phenotype with metastatic potential . Metastet al. report outcomes of RPLND (n\u2009=\u200917) for sex cord stromal tumours, including malignant phenotype Leydig cell tumours (n\u2009=\u20096) . Three et al. report outcomes of RPLND (n\u2009=\u20095) undertaken for Stage I (n\u2009=\u20093) and Stage II (n\u2009=\u20092) malignant phenotype Leydig cell tumours . Duringo et al. ), one mio et al. ). HoweveThe most recent series is from Memorial Sloan Kettering Cancer Centre: Of the 48 patients with sex cord stromal tumours described, 6 patients with either Stage I (n\u2009=\u20094) or Stage II n\u2009=\u20092) malignant phenotype Leydig cell tumours were managed by RPLND. Interestingly, two patients with Stage I disease, who harboured 5 pathological features  and peri-operative blood loss  appeared greater than the parameters from the only report including these outcomes , but may be due to the minimally-invasive technique employed . A furtTaken together with previously published data, there is still insufficient evidence to recommend RPLND as standard of care for all patients. For young patients with very few (\u22641) malignant histological features, a period of active monitoring may be considered. However, for older patients, those with a larger number of malignant histological features, or those with Stage II disease, RPLND may, at least, offer good palliation and a possibility of cure. Larger prospective multi-centre studies, with centralized histopathological reporting, are required to determine the definitive role for surgery in Stage I disease.The manuscript does not contain any experimental clinical studies or identifiable patient data."}
+{"text": "BCL2 and CXCL14 and one stabilising mutation in the 5\u2032 UTR of TAOK2. These mutations resulted in an increase or a decrease in translation of these mRNAs, respectively. These findings suggest that mutations that modulate the G4 stability in the noncoding regions could act as cancer driver mutations, which present an opportunity for early cancer diagnosis using individual sequencing information.Cancer is a multifactorial disease driven by a combination of genetic and environmental factors. Many cancer driver mutations have been characterised in protein-coding regions of the genome. However, mutations in noncoding regions associated with cancer have been less investigated. G-quadruplex (G4) nucleic acids are four-stranded secondary structures formed in guanine-rich sequences and prevalent in the regulatory regions. In this study, we used published whole cancer genome sequence data to find mutations in cancer patients that overlap potential RNA G4-forming sequences in 5\u2032 UTRs. Using RNAfold, we assessed the effect of these mutations on the thermodynamic stability of predicted RNA G4s in the context of full-length 5\u2032 UTRs. Of the 217 identified mutations, we found that 33 are predicted to destabilise and 21 predicted to stabilise potential RNA G4s. We experimentally validated the effect of destabilising mutations in the 5\u2032 UTRs of  One of the main goals of these projects is to differentiate cancer driver mutations, which contribute to cancer development, from non-functional passenger mutations and ultimately improve our understanding of how different types of cancers develop3. As a result of extensive efforts that have been directed towards detecting and characterising driver mutations in protein-coding regions, knowledge about abnormal proteins encoded by mutated cancer genes has grown substantially in recent years, such that new cancer therapeutics have been developed to target these anomalous proteins. Imatinib is an example of this type of therapeutic that inhibits the protein encoded by ABL, which is mutated in chronic myeloid leukaemia4. Noncoding somatic mutations, on the other hand, have not been examined as extensively as coding variations. Considering that less than 2% of the human genome encodes protein and that important regulatory regions including promoters and 5\u2032 and 3\u2032 untranslated regions (UTR) of mRNAs are located in the noncoding regions5, effective functional studies of mutations in the noncoding regions would provide a better understanding of cancer biology and development. Indeed, several studies have indicated that noncoding somatic mutations can alter gene expression in cancer8, prompting the hypothesis that these mutations affect regulatory motifs.Substantial efforts have been made to characterise the cancer genome. The advent of next generation sequencing has enabled affordable and rapid large-scale sequencing of cancer genomes. The Cancer Genome Atlas (TCGA)9. Intramolecular G4 is assembled from guanines within one nucleic acid strand, whereas separate nucleic acid strands can form an intermolecular G4. Intramolecular DNA G4s can adopt various topologies10, whereas intramolecular RNA G4s predominantly fold into the parallel propeller topology11. Several different G4 structures have been studied in vitro. The results from these studies have enabled the development of algorithms that predict potential G4-forming sequences in the genome14. Using these algorithms, computational studies have demonstrated that G4s are significantly enriched and conserved in regulatory elements, such as promoters and UTRs of mRNAs15. This observation suggests that G4s may have regulatory roles and be involved in biological processes.Guanine (G)-rich DNA and RNA sequences can fold into non-canonical secondary structures called G-quadruplexes (G4s). The building block of a G4 is called a G-tetrad, which consists of four guanines in a square planar arrangement. Each guanine is connected to the two adjacent guanines by hydrogen bonds at the Watson Crick and Hoogsteen edges. The G4 structure is formed by at least two stacked G-tetrads. A cation positioned at the center of each tetrad or between them further stabilises the G4 structure. Nucleotides that do not contribute to the G-tetrads form the loops16, most G4s that have been characterised to date act as repressors in the cap-dependent translation regulation of mRNA translation20, especially in case of proto-oncogenes, such as NRAS21. Given accumulating in vitro results that demonstrate 5\u2032 UTR G4s have regulatory functions and the increasing evidence that show G4 structures exist in vivo23 and a number are altered in cancer tissues24, we hypothesized that mutations in cancer patients alter the stability of 5\u2032 UTR G4s and consequently affect their regulatory function.A number of studies have demonstrated that G4s located in the 5\u2032 UTRs modulate translation activity. Although it has been shown that G4 can augment translationHere, we present an approach that permitted us to identify somatic mutations in cancer that change the stability of 5\u2032 UTR G4s. We have experimentally validated the effect of some of these mutations and showed that they can either destabilise RNA G4 structures or stabilise them. Furthermore, the mutations result in altered gene expression. Overall, our data suggest that mutations in regulatory elements such as 5\u2032 UTR that alter G4s stability could act as cancer driver mutations.13, which searches for the sequence pattern G3+N1\u20137G3+N1\u20137G3+N1\u20137G3+ across the genome, was employed to identify potential G4s. In this pattern, G refers to guanine and N can be any base including guanine. Concurrently, three publicly available databases, TCGA1, ICGC2 and Alexandrov et al.25, were used to obtain somatic mutation data in patients with different types of cancers. Comparing these two datasets, 217 overlaps were found between somatic mutations from cancer patients and potential G4-forming sequences in the 5\u2032 UTRs (Supplementary Dataset). Considering that putative G4 sequences might fold into other secondary structures instead of G4 structures, it is possible that overlapping mutations do not affect RNA G4 structural stability. To address this possibility, a further screening step was performed that investigated the effect of each mutation on the predicted RNA G4 stability using RNAfold software26. In addition to the G4 sequence pattern (G2\u20137N1\u201315G2\u20137N1\u201315G2\u20137N1\u201315G2\u20137), RNAfold takes account of thermodynamic parameters and is therefore a more stringent method to predict G4 structures. To simulate a more biologically relevant condition, the effect of each mutation was examined in the context of the entire 5\u2032 UTR.Previous studies have demonstrated that RNA G4s act as regulatory motifs in the 5\u2032 UTR of mRNAs. To determine the possible effects of mutations in cancer patients on the stability of G4s in this region, the procedure illustrated in Fig.\u00a0in silico results, one stabilising mutation in the 5\u2032 UTR of TAOK2 (TAO Kinase 2), one destabilising mutation in the 5\u2032 UTR of BCL2 (B-cell lymphoma 2) and two adjacent destabilising mutations in the 5\u2032 UTR of CXCL14 (C-X-C motif ligand 14) were selected for experimental validation.We found 33 RNA G4 destabilising mutations among 217 overlaps between somatic mutations and predicted 5\u2032 UTR G4s listed in the Supplementary Table\u00a0BCL2 proto-oncogene contributes to the resistance of cancer cells to apoptosis27. Our bioinformatics analysis identified a guanine to adenine point mutation in a patient with malignant lymphoma, which was predicted to destabilise the RNA G4 in the 5\u2032 UTR of BCL2 , which is consistent with destabilisation of the RNA G4 structure.Luciferase reporter assays were performed to evaluate the impact of the identified ene Fig.\u00a0. For eacncy Fig.\u00a0, which sin silico analysis using RNAfold and in vitro luciferase reporter assay have been performed in the context of the entire 5\u2032 UTR of BCL2, we repeated the biophysical studies using 62-mer oligos of the wild-type and mutated BCL2 RNA G4 that had 20 extra nucleotides from each side , which supports an effect of the destabilised RNA G4 in de-repressing translation , whereas the G4-deleted construct showed a significant increase in translation efficiency (P\u2009<\u20090.0001)  Fig.\u00a0. These r3. Most studies carried out to date have focused on the sequencing and characterization of mutations in protein-coding regions of the genome. However, knowledge regarding the effect of noncoding mutations in cancer development is very limited. Given that important regulatory elements, such as promoters and UTRs of mRNAs, are located in noncoding regions, it is likely that cancer driver mutations are found in these regions. Mutations in these regions can affect the structure and stability of regulatory motifs, including G4 structures. A number of G4s have been characterised as regulatory motifs in the promoters of many genes including proto-oncogenes, such as c-KIT34 and KRAS35. In addition to the promoters, there is evidence for regulatory functions of G4s in the 5\u2032 UTR of several genes including BCL228 and NRAS21 proto-oncogenes. Furthermore, a significant association between single nucleotide polymorphisms located in predicted G4 sequences and expression of the corresponding gene in individuals was previously demonstrated in a genome-wide study36. Here, for the first time, to the best of our knowledge, we demonstrate that noncoding mutations in cancer alter RNA G4s stability and affect their regulatory functions in the 5\u2032 UTRs.Cancer is considered as a multifactorial disease, where a combination of genetic and environmental factors contributes to cancer development, rather than a single gene mutation26. To mimic the biological condition as much as possible, we examined the effect of each overlapping mutation in the context of the full-length 5\u2032 UTR. We found 33 RNA G4 destabilising and 21 stabilising mutations and selected one stabilising mutation in the 5\u2032 UTR of TAOK2, one destabilising mutation in the 5\u2032 UTR of BCL2 and two adjacent destabilising mutations in the 5\u2032 UTR of CXCL14 to validate experimentally. It is noteworthy that if the RNAfold was used initially to find the overlapping mutations instead of the Quadparser algorithm, we might have overlooked the stabilising mutations.Using publically available whole-genome sequencing data, we found 217 mutations that overlap the potential G4-forming sequences in 5\u2032 UTRs. To distinguish mutations that potentially alter G4 stability from inconsequential mutations, we evaluated the effects of the mutations on predicted G4 structures using RNAfold. This software considers the most important thermodynamic parameters, which contribute to RNA G4 stabilityBCL2 is a human proto-oncogene and belongs to the Bcl-2-family of proteins. These proteins are responsible for the physiological regulation of apoptosis, which is essential for development and tissue homeostasis27. Many examples exist where the expression of BCL2 is elevated in human malignancies, particularly lymphomas. Several mechanisms contribute to the overexpression of BCL2, including chromosomal translocations and loss of endogenous microRNAs that repress BCL2 expression37. In addition, it has been demonstrated that cis-regulatory mutations contribute to the dysregulation of the BCL2 expression38. Balasubramanian et al. characterised a very stable RNA G4 in the 5\u2032 UTR of BCL2, which was found to negatively regulate translation of the gene in vitro28. Here, we report a mutation from a patient with malignant lymphoma that overlaps this RNA G4. Comparison between CD melting curves and Tm values of the wild-type and mutated BCL2 RNA G4 show that the mutation destabilises this RNA G4  protein kinases that involves in several different cellular processes including cell-signalling pathways42. TOAK2 has been suggested to be involved in the induction of apoptosis33. Here, we demonstrated that the predicted G4 sequence in the 5\u2032 UTR of TAOK2 folds into a parallel quadruplex in vitro  and the FTP site provided by Alexandrov et al. These mutations were used directly for the analysis. For samples obtained from TCGA, mutations were called from BAM files obtained from CGHub using Strelka with default parameters45. The genomic coordinates of somatic variants are reports using NCBI build 37, aka hg19.Somatic mutation data from whole cancer genomic sequences were obtained from three publicly available data sources: TCGA, ICGC and Alexandrov 13 was used to identify potential G4-forming sequences in the NCBI build 37 version of the human genome sequence. UCSC Table Browser46 was used to find the overlaps between identified mutations and potential G4-forming sequences in the 5\u2032 UTR regions. The effect of a mutation on the thermodynamic stability of an RNA G4 was evaluated using RNAfold and RNALfold26 version 2.1.9 in the context of the full-length 5\u2032 UTR while GU base paring was not allowed. In addition to RNAfold, the QGRS-Mapper14 online tool was used to investigate the effect of mutations on the RNA G4-forming sequences in the 5\u2032 UTR of BCL2, CXCL14 and TAOK2.Quadparser algorithm47. Briefly, RNA oligos were annealed by heating at 90\u2009\u00b0C for 10\u2009minutes and slowly cooling down to room temperature. CD spectra were recorded at 25\u2009\u00b0C on an Aviv 215S circular dichroism spectrometer equipped with a Peltier temperature controller. RNA G4 samples of the desired sequence were prepared at 5\u2009\u00b5M in the G4 folding buffer . KCl was replaced by LiCl in the control samples. Four scans were accumulated over the wavelength range 220\u2013320\u2009nm in a 0.1\u2009cm path length cell at the standard sensitivity, data pitch 0.1\u2009nm, continuous scanning mode, scanning speed 100\u2009nm\u2009min\u22121, response 4\u2009sec, and bandwidth 1\u2009nm. Buffers alone were scanned and these spectra subtracted from the average scans for each sample. Tm analysis was recorded by CD at 260\u2009nm and heated at 1\u2009\u00b0C min\u22121 over the temperature range 25\u201395\u2009\u00b0C. CD and melt curve spectra were collected in units of millidegrees, normalized to the total species concentrations and expressed as molar ellipticity units (deg\u2009\u00d7\u2009cm2 dmol\u22121). Each CD spectrum was smoothed by averaging ten neighbour points using Prism 6. Sigmoidal dose-response curves (variable slope) were fitted to the melt curve data using Prism 6.Circular dichroism spectra were recorded as previously describedBCL2, CXCL14 and TAOK2 were obtained from the UCSC Genome Browser48 based on the NCBI build 37 version of the human genome sequence. The synthetically synthesised full-length 5\u2032 UTRs of each candidate was purchased from GenScript and inserted in the KpnI and HindIII restriction sites of T7 or CMV pGL3 plasmid. These constructs are considered as wild-types. G4-mutated and G4-deleted constructs were created based on the wild-type constructs for each 5\u2032 UTR. The NEBaseChangerTM online tool provided by New England BioLabs was used to design primers for making desired point mutations in the G4-forming sequences and also deleting the entire G4-forming sequences from the 5\u2032 UTRs.Overlap extension PCR was used to clone either T7 or CMV promoter upstream of multiple restriction sites of pGL3 basic plasmid (Promega). The sequences of the 5\u2032 UTRs of in vitro using mMESSAGE mMACHINE T7 kit (Ambion). Transcripts were DNase treated and purified using the RNeasy Mini Kit (QIAGEN). The size and integrity of the transcripts were confirmed on a 1% agarose gel. The concentration of each set of transcripts was determined by NanoDrop.A gene fragment containing T7 promoter and the full-length 5\u2032 UTR attached to the firefly luciferase gene was provided from each of the wild-types, G4-mutated and G4-deleted constructs by PCR amplification. The size of each fragment was examined on a 1% agarose gel followed by gel purification. An additional step of PCR clean up was performed and RNase inhibitor (Ambion) at a final concentration of 1\u2009U/\u03bcL was added to each sample. The PCR products were used as templates to produce 5\u2032-capped transcripts in vitro transcribed 5\u2032-capped mRNA containing the full-length 5\u2032 UTR attached to the firefly luciferase coding sequence was translated according to the manufacturer\u2019s protocol. In order to measure the firefly luciferase activity, 5\u2009\u03bcL of the translation reaction was added to 75\u2009\u03bcL of luciferase assay reagent (Promega) at room temperature. The reaction was quickly mixed and luminescence was measured using CLARIO star microplate reader (BMG LABTECH).Nuclease-treated rabbit reticulocyte lysate (Promega) was used to perform the cell-free translation. 150\u2009ng/\u03bcL  of the 49: Ratio\u2009=\u2009(Etarget)\u0394CPtarget(control-sample)/(Ereference)\u0394CPreference(control-sample) where firefly and renilla were considered as the target and reference genes, respectively. GAPDH expression in each sample was considered as the control.MCF-7 cells were seeded in 12-well plates (Corning) and incubated until they reached to 70\u201380% confluency. The cells were co-transfected with pRL-TK (Promega) normalizing vector, which expresses renilla, and the CMV pGL3 plasmids constructs, which prepared as described earlier and express firefly, with the ratio of 1 to 7 using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer\u2019s protocol. When cells reached to 90\u201395% confluency, renilla and firefly luciferase activities were measured using Dual-Luciferase Reporter Assay System (Promega) following the manufacturer\u2019s protocol in the CLARIO star microplate reader (BMG LABTECH). Total RNA was extracted from the remaining cells using RNeasy mini kit (QIAGEN). 200\u2009ng of each total RNA sample was reverse-transcribed using SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific). The cDNA from each sample was used to perform RT-qPCR using LightCycler 480 SYBR Green I Master reagents (Roche) and a LightCycler 480 SYBR device (Roche). Primer sets are listed in the Supplementary Table\u00a0Supplementary Dataset 1Supplementary Information"}
+{"text": "Nodal metastases status among early stage tongue squamous cell cancer patients plays a decisive role in the choice of treatment, wherein about 70% patients can be spared from surgery with an accurate prediction of negative pathological lymph node status. This underscores an unmet need for prognostic biomarkers to stratify the patients who are likely to develop metastases.We performed high throughput sequencing of fifty four samples derived from HPV negative early stage tongue cancer patients habitual of chewing betel nuts, areca nuts, lime or tobacco using whole exome (n\u00a0=\u00a047) and transcriptome (n\u00a0=\u00a017) sequencing that were analyzed using in-house computational tools. Additionally, gene expression meta-analyses were carried out for 253 tongue cancer samples. The candidate genes were validated using qPCR and immuno-histochemical analysis in an extended set of 50 early primary tongue cancer samples.TP53, NOTCH1, CDKN2A, HRAS, USP6, PIK3CA, CASP8, FAT1, APC, and JAK1. Similarly, significant gains at genomic locus 11q13.3 , 5p15.33 , and 8q24.3 (BOP1); and, losses at 5q22.2 (APC), 6q25.3 (GTF2H2) and 5q13.2 (SMN1) were observed in these samples. Furthermore, an integrated gene-expression analysis of 253 tongue tumors suggested an upregulation of metastases-related pathways and over-expression of MMP10 in 48% tumors that may be crucial to predict nodal metastases in early tongue cancer patients. In overall, we present the first descriptive portrait of somatic alterations underlying the genome of tobacco/nut chewing HPV-negative early tongue cancer, and identify MMP10 as\u00a0a potential prognostic biomarker to stratify those likely to develop metastases.Somatic analysis revealed a classical tobacco mutational signature C:G\u00a0>\u00a0A:T transversion in 53% patients that were mutated in  Areca catechu) and slaked lime  is a part of the tradition EGFR and FGFR loci; focal deletions at NSD1, FAT1, NOTCH1, SMAD4 and CDKN2A loci; and, point mutations in TP53, CDKN2A, FAT1, PIK3CA, NOTCH1, KMT2D, and NSD1TRAF3, ATM deletion, E2F1 amplification, FGFR2/3 and KRAS mutations.Tongue cancer is the most predominant form of oral cancer in developed countries with a varying incidence in developing countries Another unique feature of tongue squamous cell carcinoma (TSCC) compared to other subsites of oral cancer is the occurrence of nodal metastases, observed in 27\u201340% of early stage (pT1 or pT2) patients. Neck dissection among them adds to morbidity and poor survival due to disease recurrence The sample set and study protocol were approved by (ACTREC-TMC) institutional Internal Review Board. All the tissue samples used under study have been taken after obtaining informed consent from patients. Primary tongue tumors were staged as\u00a0T1 (measuring \u22642\u00a0cm) or T2 (measuring >2\u00a0cm but <4\u00a0cm) as per AJCC (American Joint Committee on Cancer)/UICC  TNM classification (7th edition) system and primary tumors with early stage (T1 and T2) were included in this study. Samples were duly verified by two independent reviewers for histological examinations such as normal sample verification, percent tumor nuclei and lymph node metastasis. The tumor sample with concordant histopathological diagnosis by both reviewers was included in the study. Tumor with at least >50% tumor nuclei was used for data analysis. Clinical, histological and etiological features were collected along with follow-up data for recurrence . None ofExome capture and sequencing were performed as described previously The variant analysis was performed as described previously DNA copy number analysis of exome sequencing data was performed as described previously Transcriptome libraries for sequencing were constructed according to the TruSeq RNA library protocol (Illumina) outlined in TruSeq RNA Sample Prep (Illumina) performed as described previously TSCC gene expression profiling studies were identified by searching Gene Expression Omnibus (GEO) database Immunohistochemical staining, was performed with the help of pathologist as described previously http://nemates.org/MA/progs/representation.stats.html). The mutual exclusivity and co-occurrence analysis were performed using Gitools t-test and P-value <0.05 was considered as a threshold for statistical significance.The clinicopathologic association analysis was performed using IBM SPSS statistics software version 2. Test for overlap significance for a number of genes overlap for copy number changes different studies and databases were carried out using previously described method  and matched normal (n\u00a0=\u00a023) samples. We captured \u223c62\u00a0Mb of coding genome at a median coverage of 97x for tumor samples and 103x coverage for normal samples. Somatic variants were called using Mutect TP53 (44%), NOTCH1 (20%), CDKN2A (12%), HRAS (12%), USP6 (8%); while, mutations in FANCA, HLA-A, PIK3CA, KMT2D and PDE4DIP were observed as non-recurrent  863 of 1693 non-silent somatic variants across 767 genes were predicted to be deleterious . Furtherecurrent a. OveralCCND1, FGF19, ORAOV1, FADD); 8q21.3 (MMP16), and genes BOP1 (8q24.3), EGFR (33%); RICTOR (33%), PLEC (33%), TERT (26%), TNK2 (26%), PIK3CA and SOX2 (22%) MYC (14%) and NOTCH1 (14%). Comparative analysis of amplified and deleted gene with previous HNSCC including tongue cancer studies We used Control-FREEC CCND1, FGF19, ORAOV1, FADD ; PIK3CA and SOX2  in this study and TCGA-tongue tumors, which contains genes implicated in cell cycle, cell death/NF-kB pathway and, consistent with previously described in HPV-negative HNSCC tumors EGFR amplification was significantly mutually exclusive to CCND1, FGF19, ORAOV1 and FADD amplification  including TCGA-tongue cohort  and log fold change 2\u00a0as\u00a0a cut-off to identify 739 significantly differentially expressed genes  genes to be significantly differentially expressed, where average 619 (SD\u00a0\u00b1\u00a0364) and 662 (SD\u00a0\u00b1\u00a0447) genes showing up and down regulation, respectively ; and 20% (133/653) down regulated genes overlap  with recurrently up-regulated genes in previous datasets  and TCGA (transcriptome sequencing) datasets comprising of 243 tongue tumors and 79 adjacent normal tissue samples expression profile using BRB array toolkit ectively . In overectively . To idenectively . Among tectively . Interesdatasets b. Next, MMP1, 3, 7 and 9 have previously been described in head and neck cancer MMP10, 11, 12, 13 and 14) along with 3 hallmark genes CXCL13, CCNB1 and SNAI2, as described in MMP10 differential expression was most significant (p\u00a0<\u00a00.0001) that was further validated histochemically  family genes were among the highly up-regulated genes across \u22653 dataset . While temically b\u2013d. Incit-test)  of tongue cancer patients tumors b, consist-test) d and MMPTP53, NOTCH1, CDKN2A, CASP8, HRAS and PIK3CA . Survival data of these patients were far from maturity. Thus, analysis of GEO gene expression dataset of HNSCC (GSE2837) based on MMP10 transcript expression performed showed poor survival in the cancer patients with high MMP10 expression, similar to as observed in breast cancer (GSE2990), lung cancer , liposarcomas (GSE30929), and colorectal cancer (GSE12945) using PrognoScan MMP10 expression with poor survival in early TSCC remains to be verified in a larger sample set.The cohort did not reveal any significant association between clinical features such as age, gender, tumor stage, American Joint committee on Cancer (AJCC) TNM stage, nodal status, smoking, alcohol, tobacco usages with mutations in HNSCC hallmark gene; d PIK3CA . HoweverHere, we describe the landscape of genomic alterations in a unique set of early staged HPV-negative tobacco or nut chewing tongue cancer patients, using whole exome sequencing and transcriptome sequencing. While lack of survival data is a major limitation of the study, several lines of distinct features underlie this study attributing to unique etiology, subsite, and specific population, which has been previously described for HNSCC TP53 gene in this study  is consistent with previous reports in betel quid and tobacco chewing associated oral squamous cell carcinoma tumors from Indian population Firstly, the mutational profile of large fraction of patients display high frequency (53%) of C:G\u00a0>\u00a0A:T transversion in exome sequencing data\u2014a hallmark of smokeless tobacco usage\u2014reflecting tobacco as the most predominant etiological agent; which is considerably higher than observed (15\u201326%) in various non-tobacco associated cancer types HRAS mutations, which though were all tobacco chewers, consistent with previous reports from the Indian population NOTCH1 in HNSCC TP53, NOTCH1, CDKN2A, CASP8, PIK3CA, USP6, MLL2, HLA-A, FANCA, PDE4DIP, and FAT1 were also identified FADD CCND1, FGF19, and ORAOV1 (P\u00a0<\u00a00.0001) were found to occur mutually exclusive with EGFR amplification among HPV-negative early TSCC tumors, as previously described in other cancers EGFR and CCND1 oncogenic events are known to act via a common RAS-MAPK Kinase pathway to promote cell cycle and known to act as a driver of oral cancer tumorigenesis EGFR and CCND1 amplification suggests activation of a common downstream signalling pathway in different TSCC patients via diverse genetic alterations. Thus this finding may affect the benefit of common downstream inhibitor, such as MAPK inhibitor, to a broader spectrum of patients.Secondly, recent reports suggest the presence of low frequency (\u223c5%) of RAS mutations in tongue tumors MMP10, MMP11, MMP12, MMP14, CXCL13, CCNB1, SNIA2) showed significant up-regulation in tumors suggesting reliability of genes identified from this study. Of the multiple MMPs found to be up-regulated, immunohistochemical analysis of MMP10 in 50 paired normal early stage primary tumors showed significant up-regulation of protein expression in primary tumors owing its possible role in early stage progression as described in other cancer types as a potential prognostic biomarker to stratify those likely to develop metastases Thirdly, differential gene expression analysis showed significant up-regulation of gene-sets primarily involved in epithelial to mesenchymal transition (EMT) processes, corroborating with known occult lymph node metastasis and invasive behaviour of early stage tongue tumors"}
+{"text": "To assess the immediate effects of temporary bite-raising using light-cured orthodontic band cement on the superficial masseter and anterior temporalis electromyography (EMG) activity in healthy adults.Surface EMG signals were recorded bilaterally from the superficial masseter and anterior temporalis muscles of 30 volunteers with a normal occlusion, before and after having temporary bite-raising. The bite-raising was done by adding light-cured orthodontic band cement (3x5x2 mm WxLxH) on the lingual cusps of both upper first molars. The measurements were recorded (i) at rest, (ii) while clenching in centric occluding position and (iii) while chewing on an artificial test food. The EMG activity at rest and during clenching, the maximum voltage, and the duration of the identified EMG signal burst while chewing the artificial test food before and after temporary bite-raising were statistically compared using the paired t-test or the Wilcoxon signed-rank test based on the normality of the variables. The significance level was set at 5%.After temporary bite-raising, we found no significant change in integral EMG activity at rest position for the superficial masseter (mean difference (MD)=7.5 \u03bcVs) and for the anterior temporalis muscle (MD=36.8 \u03bcVs); however, the integral EMG activity during clenching was significantly reduced for the superficial masseter (MD=201.2 \u03bcVs) and for the anterior temporalis muscle (MD=151.8 \u03bcVs). During mastication, the maximum voltage of the identified burst was significantly reduced on the preferred chewing side of the superficial masseter and anterior temporalis muscles , while no significant change was found for the duration of the identified burst  after temporary bite-raising.The results point to an altered neuromuscular behavior during clenching and chewing immediately after temporary bite-raising with light-cured orthodontic band cement. This information is relevant for orthodontists to inform their patients what will happen to their masticatory muscle activity when this bite-raising method is used. Bite-raising is used to prevent the brackets from being sheared off, and to eliminate occlusal interferences, allowing unobstructed tooth movement,Several studies indicate that increased occlusal jaw opening may lead to changes on the electromyographic (EMG) activity of the jaw muscles and there are several studies on the consequence of bite-raising by other means on the EMG activityThe objective of this study was to examine the immediate masseter and temporalis muscle EMG activity before and after opening the bite with light-cured orthodontic band cement on the lingual cusps of both upper first molars during physiologic rest position, maximum voluntary clenching (MVC), and chewing on artificial test food in normal occlusion participants. The null hypothesis was that bite-raising using this method does not immediately affect the masseter or temporalis muscle EMG activity at rest, during MVC, and chewing.Forty-two volunteers, randomly recruited from Dentistry students of the Chulalongkorn University, received a clinical examination. Twelve volunteers were excluded due to having an edentulous area (n=2), overjet >3 mm (n=4), overbite >3 mm (n=5), or open bite (n=1). Thus, 30 volunteers  participated in this study. The participants were dentate with a Class I occlusion, an overjet less than 3 mm, and an overbite less than 3 mm . The participants had no edentulous area, no significant facial deformity, and no temporomandibular symptoms based on the assessment protocol of Schiffman, et al.The EMG measurements were performed on two appointments, with a week interval between each. The objective of the study and the measurement procedure were explained to the participants on the first appointment, we also measured the EMG activity without any intervention.During the second appointment, we performed a baseline recording at rest and during MVC. The bite of the participant was then temporarily raised by placing light-cured orthodontic band cement on the lingual cusp of the upper first molars. After polishing, rinsing, drying, and isolating the teeth, Ultra Band-Lok BLUE  was applied in a thermoplastic sheet template (3x5x2 mm WxLxH trapezoid-shaped slot) and placed on the tooth. We used a light-curing unit (600 mW continuous output) to cure the material. The occlusion was balanced by identifying an occlusal contact on each side with shimstock foil and locating the specific contact with the eight-micron thick articulating film according to the technique described by Anderson, Schulte and AeppliSurface EMGs were simultaneously recorded from the left and right superficial masseter and anterior temporalis muscles by a researcher using the ML866 PowerLab 4/35 , following the protocol indicated by the manufacturer. The participants were seated upright on a chair with their trunk perpendicular to the floor, both feet on the floor, hands resting on their lap, and looking forward with their head unsupported in a quiet place listening to relaxing musicAfter placing the electrodes and practicing for the measurement, the subjects were given a five minutes rest period to relax and for the skin to absorb the conductive gel. The EMG recordings were then made as follows:The purpose of this test was to monitor and quantify the amount of electrical activity generated by the superficial masseter and anterior temporalis muscles when at rest.The subjects were instructed to clench their teeth in centric occluding position using as much force as possible without causing pain and to hold this force intensity until instructed to relax after 2 seconds.The subjects were instructed to chew an artificial test food for 20 strokes on their preferred chewing side. When the subjects were not sure of their preferred chewing side, they were instructed to use the right side. The artificial test food was made with a dental impression material, OptoSil , using the standardized production of an artificial test food protocolWe performed two experimental sessions as recommended in a previous studyThe digital signal was analyzed using LabChart software (ADInstruments Pty Ltd.). For test A and B, the area of the integral EMG curve , was computed for each muscle. The left and right sides values were pooled for each muscle. The mean integral EMG activity of the three trials for each muscle was expressed as mean and standard deviation. To normalize the EMG signals, the root-mean-square (RMS) value of the EMG signals during the 2 seconds window was calculated and expressed as the percentage of the EMG activity during MVC in centric occlusion.For test C, the signal was full-wave rectified and smoothed by taking the RMS for each 100 ms interval. The start and the end of each burst were defined as the EMG signal reaching a level 10% above or below the mean area relative to the baseline signalThe baseline recordings for both muscles at rest were used to evaluate intra-examiner reliability, they were conducted in two visits, with a week interval between them. Both recordings were performed by the same examiner and in the same period of the day, according to the procedure mentioned above.Statistical analysis was performed using the software SPSS version 17.00 . The normality of the variables was verified by the Kolmogorov-Smirnov test. For comparisons between before and after bite-raising, the paired t-test or the Wilcoxon signed-rank test was used based on the normality of the data. We tested 16 pairs of before-after data. The paired t-test was performed for the integral superficial masseter and anterior temporalis muscles EMG activity during MVC, the normalized superficial masseter muscle EMG activity during MVC, the maximum voltage of the identified burst on the superficial masseter preferred chewing side, the duration of the identified burst on the superficial masseter and anterior temporalis preferred chewing side, and the duration of the identified burst on the anterior temporalis non-chewing side. The Wilcoxon signed-rank test was performed on the integral superficial masseter and anterior temporalis muscles EMG activity during rest, the normalized superficial masseter and anterior temporalis muscles EMG activity during rest, the normalized anterior temporalis muscle EMG activity during MVC, the maximum voltage of the identified burst on the superficial masseter non-chewing side, the maximum voltage of the identified burst on the anterior temporalis preferred chewing side and non-chewing side, and the duration of the identified burst on the superficial masseter non-chewing side. Significant differences were defined as p<0.05. The effect size was calculated for the significant comparisons The intraclass correlation coefficient for the superficial masseter and anterior temporalis muscles measurements were 0.93 and 0.91, respectively, indicating an excellent reproducibility of the EMG measurements. No significant differences were found between the superficial masseter integral EMG activity or normalized EMG activity before and after temporary bite-raising at rest. Similar results were also found for the anterior temporalis muscle at rest. However, integral EMG activity and normalized EMG activity for both muscles was significantly reduced during clenching after temporary bite-raising  and 2. TRepresentative EMG recordings for the superficial masseter and anterior temporalis muscles during mastication are shown in This study investigated the immediate effect of temporary bite-raising using light-cured orthodontic band cement on the occlusal surface of the upper first molars on the EMG activity of the superficial masseter and anterior temporalis muscles. We found that there was no change in EMG activity at rest, however, EMG activity was reduced during MCV and chewing. Based on these results, the null hypothesis was not rejected at rest, but it was rejected during MVC and chewing.,Except for sex, the factors affecting masticatory muscle EMG activity, such as age, facial type, malocclusion, and the EMG recording period, were controlled in this study,The difference was not significant on EMG activity for both muscles at rest, despite being reduced immediately after temporary bite-raising. The cause for this could be the opening distance chosen for this study, set at 2.5\u20133 mm, which is close to the physiological rest position and is usually adequate for treating orthodontic patients. However, several studies found that increasing the occlusal vertical dimension by \u22653 mm by other means affects the EMG activity of the superficial masseter and anterior temporalis musclesThe EMG activity of both muscles during MVC decreased significantly after temporary bite-raising. As reported by JimenezOur results are similar those of Dahlstrom and HaraldsonThe short period of investigation is a limitation of this study. Habituation should be considered when evaluating the effect of bite-raising, since muscle physiology and function may adapt if longer observation periods are allowed. In animal experiments, bite-raising for 2 weeks significantly reduced masseter muscle spindle sensitivity; however, no significant differences were found between control and after more than 6 weeks of bite-raisingOur results revealed that temporary bite-raising by placing orthodontic band cement on the occlusal surface of the upper first molars had no immediate effect on EMG activity at rest, however, superficial masseter and anterior temporalis muscles EMG activity reduced during MVC and mastication. This information is useful for orthodontists to inform their patients about what will happen to their masticatory muscle activity when this bite-raising method is used. Furthermore, the effects of this type of bite-raising on more clinical-related aspects, such as masticatory performance and masticatory ability should be investigated in future studies."}
+{"text": "M\u00fcllerian agenesis, also known as Mayer-Rokitansky-K\u00fcster-Hauser syndrome (MRKHS), a failure of female urogenital development, typically results in a completely stenotic or rudimentary dimple vagina, both of which are generally nonfunctional in adulthood without mechanical dilation or surgical reconstruction. A 20-year-old Tanner stage V heterosexual woman with normal sexual function since coitarche presented with a chief complaint of primary amenorrhea. She was found to have aplastic uterine buds, absent endometrium/cervix, normal ovaries, and an unusually well-developed lower vagina, a rare presentation of MRKHS. We discuss mechanisms by which the anomaly may have arisen. This case thus expands the clinical presentation of MRKHS to include a normal appearing vagina with intact sexual function from first sexual encounter, raising interesting questions about the basic underlying embryology. The M\u00fcllerian ducts are paired tubes abutting the urogenital ridge that give rise to the upper portion of the female reproductive tract. Failure of proper development of the upper female urogenital tract results in a wide spectrum of anatomical abnormalities of the gynecological and urological systems. M\u00fcllerian agenesis, also known as Mayer-Rokitansky-K\u00fcster-Hauser syndrome (MRKHS), represents a failure of urogenital development with an estimated incidence of 1/4500 live female births, characterized by absence or aplasia of the uterus, cervix, and/or upper vagina without or with associated urological and other organ system involvement  [Depending on the particular structures affected and the severity of involvement, such abnormalities may be detected at birth or may go clinically unnoticed until there is absence of menarche or complaints of dyspareunia/sexual dysfunction with attempted sexual activity . VaginalInformed consent was obtained from the patient to use her medical information for this case report.A 20-year-old woman from Honduras presented on 3/20/2018 with her adoptive mother for a normal gynecological annual exam with a chief complaint of never having a menstrual period. She had lacked access to gynecological care in Honduras and had thus never been previously evaluated by a gynecologist. Her first sexual encounter was at age 17 and she reported having penetrative vaginal intercourse on a few occasions, although she was not currently sexually active at the time of evaluation. Previous sexual history included one male partner, condom use for protection against sexually transmitted infections, and good sexual function. Importantly, she had never experienced poor sexual satisfaction or dyspareunia. Her known family history was limited but was significant for a cousin who had also never had a menstrual period and a maternal grandmother who had had a brain tumor of unspecified type. She took no medications, and her only allergy was penicillin, with no reaction documented. She denied tobacco or illicit drug use and used alcohol occasionally. She denied any breast lumps, masses, nipple discharge, breast pain, excessive facial/body hair, abdominal/pelvic pain, genital lesions, rashes, or pruritus.On physical exam, her vital signs were within normal limits and her body mass index (BMI) was 25.51. She was alert and oriented and in no acute distress. Neck was without lymphadenopathy or thyromegaly. Breasts were well-developed with no masses, tenderness, or discharge, Tanner stage V. Abdomen was soft and nontender. Gynecological exam showed no lesions and normal adult female pubic hair pattern, Tanner stage V. The cervix was unable to be palpated or visualized. The uterus was notpalpable and no adnexal masses were appreciated. The vagina was normal in appearance, measured 8\u2009cm, was two fingerbreadths in diameter, and was without bleeding or discharge. The urethra was normal in appearance. The patient was cooperative, with appropriate mood and affect.In light of the patient's presentation, transabdominal/transvaginal ultrasound was performed on 3/22/2018, which revealed bilateral remnant uteri with no endometrium appreciated . The rigA follow-up MRI of the pelvis without and with contrast performed on 4/4/2018 demonstrated absence of the cervix, bilateral homogeneous enhancing uterine buds within the pelvis measuring 3.0 \u00d7 1.7 \u00d7 2.3\u2009cm on right, 2.9 \u00d7 1.7 \u00d7 2.6\u2009cm left. The upper one-third of the vagina was absent, while the lower two-thirds were present. The right ovary was of normal size, measuring 2.8 \u00d7 1.4 \u00d7 1.6\u2009cm, and with multiple normal ovarian follicles. The left ovary was also of normal size measuring 2.1 \u00d7 1.5 \u00d7 1.9\u2009cm, with multiple normal ovarian follicles and 1\u2009cm left corpus luteum. Trace physiological free fluid was identified. No enlarged lymph nodes were noted. The bladder was unremarkable. The urethra was notable for 2 adjacent tiny cystic structures abutting the right posterior aspect of the external urethral meatus measuring 0.6\u2009cm and 0.3\u2009cm, respectively, most compatible with tiny Skene gland cysts. Together, the findings of primary amenorrhea, normal ovaries and female secondary sexual characteristics, and aplasia of the uterus with absence of the cervix and upper one-third of the vagina, were consistent with a diagnosis of MRKHS.A subsequent biochemical analysis was performed to further support the diagnosis of MRKHS. Levels of estriol, follicle-stimulating hormone (FSH), luteinizing hormone (LH), total testosterone, and anti-M\u00fcllerian hormone (AMH) were all within normal limits, again consistent with the diagnosis of MRKHS . The patBecause of the well-known association between MRKHS and anatomical abnormalities of the urological system , a renalUpon hearing the diagnosis, our patient was anxious, especially with regard to future reproductive prospects; however she was counseled for 45 minutes with her stepmother/guardian present regarding the implications of the diagnosis and reproductive options such as use of a surrogate to carry a pregnancy for her. She expressed gratitude at the end of the encounter for the information and services provided and was offered follow-up as needed.Upon last follow-up , the patient was doing well at age 21, living with her supportive stepmother, and not sexually active.MRKHS represents a spectrum of urogenital anomalies arising from failure of the upper female reproductive tract (M\u00fcllerian duct derivatives) to properly form during embryogenesis. In cases of MRKHS type I, patients exhibit varying degrees of congenital aplasia of the uterus and upper vagina, without extragynecological involvement and with normal secondary sexual characteristics . Cases ohttps://www.beautifulyoumrkh.org) and Accord Alliance , an organization that lists a number of support groups for people affected by disorders of sexual development. We will counsel our patient about these resources, and we encourage others to do the same.Regardless of subtype, the majority of patients afflicted by MRKHS exhibit vaginal aplasia, with a rudimentary vaginal dimple measuring between 1 and 4\u2009cm that, untreated, may preclude penile-vaginal intercourse or lead to sexual dysfunction and/or dyspareunia \u20134, althoHere, we report a case of a woman with MRKHS with a well-formed lower vagina and satisfactory sexual function since onset of first intercourse and with a sexual history of only a handful of previous penetrative sexual encounters, whose only complaint was primary amenorrhea. One limitation of our report is that we did not have access to a vaginal length before onset of intercourse and are thus unable to state unequivocally whether sexual intercourse played a role in vaginal expansion, although we feel this possibility is less likely given her sexual history. In addition, we were unable to confirm the patient's karyotype, which would have provided further support of the diagnosis of MRKHS over CAIS, although presence of pubic hair, sonographic and MRI evidence of ovaries, and normal female hormonal profiles in the absence of a formed uterus and upper vagina all favor MRKHS . Neverth WNT family genes [In any case, we hypothesize that in our patient's case, the urogenital sinus, responsible for giving rise to the lower two-thirds of the vagina, may have undergone unusually extensive proliferation during the 4th and 5th months of embryonic life, giving rise to a more elongated and well-canalized vagina than what would typically develop. This could compensate for the contraction and stenosis that would otherwise occur in the face of an aplastic upper vagina . While most cases of MRKHS are sporadic, a subgroup of patients has been shown to harbor mutations inly genes . Given tAs an alternative explanation, our patient may have undergone a more prolonged period of lower vaginal growth during embryogenesis than typically occurs, compensating for upper reproductive tract aplasia. The normal resting adult human vagina is known to vary in linear length of ~40-100\u2009mm, although the precise genetic or environmental factors determining this final length remain to be completely understood . PerhapsIn summary, here we present an atypical case of MRKHS with a well-developed lower vagina in the absence of a cervix and aplastic uterine buds, in a sexually active woman with no sexual dysfunction. This case demonstrates that vaginal agenesis/dimpling and poor sexual function are not requisite features of MRKHS, providing evidence that contradicts traditional views of M\u00fcllerian development."}
+{"text": "Staphylococcus aureus phage genomes and have been shown to interact with the Stl repressor protein of S. aureus pathogenicity island SaPIbov1. In the present work we set out to characterize the interactions between these proteins based on a range of biochemical and biophysical methods and shed light on the binding mechanism of the dimeric \u03c6NM1 phage dUTPase and Stl. Using hydrogen deuterium exchange mass spectrometry, we also characterize the protein regions involved in the dUTPase:Stl interactions. Based on these results we provide reasonable explanation for the enzyme inhibitory effect of Stl observed in both types of complexes. Our experiments reveal that Stl employs different peptide segments and stoichiometry for the two different phage dUTPases which allows us to propose a functional plasticity of Stl. The malleable character of Stl serves as a basis for the inhibition of both dimeric and trimeric dUTPases.The dUTPase enzyme family plays an essential role in maintaining the genome integrity and are represented by two distinct classes of proteins; the \u03b2-pleated homotrimeric and the all-\u03b1 homodimeric dUTPases. Representatives of both trimeric and dimeric dUTPases are encoded by  Staphylococcus aureus are hazardous for both humans and livestock especially since S. aureus strains develop resistance and adapt to the new hosts rapidly via horizontal gene transfer (HGT).,41.26,41erodimer  [6,9,26,"}
+{"text": "There is a considerable demand for legged robots with exploring capabilities such as passing through narrow pathways. Soft robots can provide a solution for such applications. Here, we propose a soft legged mobile robot with bimorph piezoelectric main body and pre-curved piezoelectric legs. We experimentally demonstrate the performance of the soft mobile robot. The mobile robot can move 70% of the body length per second. In addition, we investigate physical mechanisms behind the locomotion of the mobile robot using a numerical simulation. Interestingly, the mobile robot generates an animal-like running motion. We find that the amplitude difference of the legs, depending on the leg activation condition, may affect the performance of the robot. We also confirm that the soft mobile robot can maintain the movement under impulsive shock owing to its flexibility. These robots are used in various environments including hazardous situations and urban search and rescue work14.Legged robots have received a lot of attention in the past decades owing to the compelling characteristics of exploring challenging artificial and wild terrains11. These robots have the advantages of stability and performance using findings in animal-like walking and running motions15. Most developed legged robots are composed of powerful motors or hydraulic actuators and can operate under rugged outdoor conditions with their dynamic mobility11. Although many problems related to limited external ground, environmental sensing, control, and planning remain, quadruped robots have abundant exploration capabilities16.Inspired by walking and running motions of animals and insects, many researchers have proposed biomimetic legged robots that can achieve terrestrial mobility with legs23. These small-scale legged robots can be divided into two types: i) a robot with legs activated by embedded actuators and ii) a robot with legs passively moved by body actuation. Specifically, the former directly actuates its legs to generate walking motion24, whereas the latter has passive legs attached to the actuated body. The traveling wave is generated by the movement of the body structure, resulting in the locomotion22. These robots typically utilize piezoelectric beam oscillation.As well as large-scale legged robots, there is considerable need for small-scale robots to explore narrow passages and holes by using novel classes of actuators based on new materials, such as electro-active materials27. Soft robotics can have a lot of benefits, such as body transformation and shock absorption31. These characteristics are essential and attractive features for mobile robots exploring unpredictable situations and environments.In the development of small-scale legged robots, soft robots have been reportedIn this study, we introduce a soft mobile robot based on a flexible piezoelectric film as shown in Fig.\u00a0\u03bcm-thick PVDF film was cut in two prescribed rectangular shapes. To connect both films electrically, we covered a small portion of the film with a conductive epoxy , and an epoxy  was covered on the remaining area of the film. We arranged the PVDF films in series, which refers to the case where the poling directions of the films are opposite  film, which is highly flexible and is actuated by an electric input. The length and width of the main body were 50\u2009mm and 10\u2009mm, respectively. The legs had the same width as the body, and their length was 20\u2009mm. We fabricated the main body as a bimorph PVDF actuator. As shown in Fig.\u00a0ite Fig.\u00a0. To be site Fig.\u00a0. We atta\u03bcm-thick PVDF film23. The film was cut in a rectangular pattern .As depicted in Fig.\u00a0We experimentally investigated the mobility of the proposed soft mobile robot. We applied a square wave voltage signal to the robot. The amplitude of the applied voltage was peak-to-peak 130\u2009V (DC 65\u2009V \u00b1 AC 65\u2009V). The PVDF film is quite thin. High voltage inputs over critical level could cause electrical short-circuit at the edge of the film and inflict serious damages on the PVDF components. For this reason, we chose the square wave with DC 65\u2009V \u00b1 AC 65\u2009V as the input driving signal for safe and maximal operation of the proposed mobile robot.We conducted preliminary experiments to find the frequency at which the mobile robot performs best. The experiments were performed in the range of 1\u2009Hz\u2013200\u2009Hz. The robot presented optically detectable movement only at around 57\u2009Hz and 160\u2009Hz. In other words, driving input signals except both frequencies did not generate meaningful movement. We select the testing frequency of 160\u2009Hz wherein the robot has the highest velocity.We tried to find the reasons why the robot has confined frequency ranges by inquiring into the motion of the robot at the frequencies. However, since the displacement of the robot is of microscopic scales and the components of the robot is highly soft, it is hard to find a proper method that is able to determine the motion of flexible robots. For this limitation, we tried to analyze the motion of the robot utilizing experimental ways. We focused on the main body of the robot and tried to figure out the state of the main body at the frequency of 57\u2009Hz and 160\u2009Hz. Furthermore, owing to a lot of obstacles or the significant level of sophistication to construct a theoretical model with a pre-curved, pre-stretched, and layered structure, the tasks did not involve the front and hind legs of the robot.33. First, we conducted an experiment to find the resonance frequency of the beam under fixed-free condition. To be specific, we clamped the short side of the beam at a stand depicted in Fig.\u00a0To analyze the main body, we simplified it as a composite beam. We compared the resonance frequency under the free-free condition based on the weighted frequency to the frequency at which the robot presented noticeable movementWith the value combined with unknown properties and the equation of the weighted frequency under the free-free condition, we determined the resonance frequency of the main body without legs under the free-free condition. From the calculation, we obtained the the frequency of 147\u2009Hz. Despite of the small difference with the experimental finding of 160\u2009Hz, the calculated value indicates that the large movement of the main body at the resonance frequency is a factor leading the best mobility of the robot. Incidentally, the discrepancy between the obtained value and the experimental results may be linked to the influence of robot\u2019s surroundings, such as the existence of legs, gravity, and a floor. Specifically, the existence of legs and gravity seems to affect the mass distribution and the partial stiffness. In addition, it could be speculated that a floor beneath the robot influences on its boundary condition.L). In all cases, the normalized displacement increases with time, with minor discrepancies. The time taken for the robot to move as much as its body length was approximately 1.4\u2009s.Figure\u00a0The velocity data of the robot are shown in Fig.\u00a0To investigate the effect of the front and hind legs, we performed experiments under four different leg conditions: both legs activated, only front leg activated, only hind leg activated, and both legs deactivated. For all leg conditions, the main body is always actuated. A leg can be deactivated by detaching the copper tape, which provides the electrical connection between the main body and the leg. For each case, we also repeated the experiments 10 times and calculated the mean velocity and the standard deviation over ten runs.Figure\u00a0When one of the two legs does not work, we also observe a significant velocity drop. Interestingly, the velocity drop as the hind leg is deactivated is considerably greater than that when the front leg is deactivated. When the front leg is electrically disconnected, the velocity reduces to 69.8% of that when both legs are connected. Meanwhile, when the hind leg is electrically disconnected, the velocity decreases to 34.3% of that when both legs are activated. These results demonstrate that the hind leg has a better ability to improve the mobility of the robot than the front leg. Since the components of legs and the input condition on legs are equal, the legs have almost identical displacement. However, when boundary conditions become different, it could suppress the movement of legs. To be specific, owing to the center of gravity, the larger mass could be concentrated on the front leg, leading the movement of the front leg to be suppressed.The soft mobile robot has several noticeable tendencies in mobility under different leg condition. However, it is difficult to clearly understand the physical mechanisms responsible for these trends from the optical measurement, because the robot is operated by the microscopic displacement of piezoelectric actuators. To understand the physical mechanisms behind the flexible mobile robot, we conducted a numerical simulation using COMSOL Multiphysics 5.3a. In particular, we performed the simulation in two-dimensional space and utilized piezoelectric device module/physics in the model. To apply the stretched condition to the polyimide tape of the legs, we applied stress to the end of the legs, resulting in a curvature in the legs. Then, we applied harmonic excitation to the structure at a frequency of 160\u2009Hz. The boundary condition of the structure is the free-free condition. That is, the simulation model did not include floors beneath the robot and the effect of gravity due to the complex non-linearity from irregular contact between the legs of the robot and the floor.We verified the computational model for adequate simulation. We conducted the simulation of beams under the fixed-free condition, which is identical to the experiment in the previous section. We extracted the reliable thickness of the epoxy between the PVDF films of the main body by comparing frequency values from the simulation and the experiment in the last section. Through the obtained thickness, we were able to achieve the reliable results of simulations.t) is normalized by dividing the period of the input driving signal (T). When the normalized time (t/T) is 0.05, the body has a U shape, and the location of the front leg is below that of the hind leg. As the normalized time is increased until t/T\u2009=\u20090.35, the front leg moves upward and the hind leg moves downward. Simultaneously, the front leg extends, generating a motion which is analogous to striking to the ground. Unlike the front leg, the hind leg is flexed, which resembles the movement of leaving the ground. We noted that the front and hind legs move in opposite directions when both legs are electrically stimulated. After t/T\u2009=\u20090.35, the structure of the body starts to vary from the U shape to the inverse shape, carrying the front leg upward and the hind leg downward. Concurrently, the hind leg extends, showing hind leg footfall. Meanwhile, we can see the shrunk front leg. Majority of quadruped vertebrates utilize both their back and legs to achieve considerable speeds34. We observed that the robot inspired by running animals also employs both the postures of the body and the relative movement of the legs to obtain its mobility.Figure\u00a0Additionally, when one of the legs is electrically deactivated, we can observe that the inactive leg experiences a considerable reduction in the movement in the lateral direction as shown in Figs\u00a0x) and vertical (y) direction for one stride as shown in Fig.\u00a0To monitor the movement of the legs specifically, the displacement of the end point of the legs was traced in the horizontal  and an evaluation kit , where the gain of the amplifier is 100 Fig.\u00a0. Power sMobility of the soft mobile robotLocomotion gait of the mobile robotImpact test of the mobile robotSupplementary figures"}
+{"text": "The isolated strains from the two types of vinasse belong to class Bacilli, similar to Lysinibacillus, encode for nirK gene related to denitrification pathway. This study highlights the bacterial microbial composition particularly in CV what residue is currently recycled and recommended as a sustainable practice in sugarcane cultivation in the tropics.The use of residue of sugarcane ethanol industry named vinasse in fertirrigation is an established and widespread practice in Brazil. Both non-concentrated vinasse (NCV) and concentrated vinasse (CV) are used in fertirrigation, particularly to replace the potassium fertilizer. Although studies on the chemical and organic composition of vinasse and their impact on nitrous oxide emissions when applied in soil have been carried out, no studies have evaluated the microbial community composition and diversity in different forms of vinasse. We assessed the bacterial community composition of NCV and CV by non-culturable and culturable approaches. The non-culturable bacterial community was assessed by next generation sequencing of the 16S rRNA gene and culturable community by isolation of bacterial strains and molecular and biochemical characterization. Additionally, we assessed in the bacterial strains the presence of genes of nitrogen cycle nitrification and denitrification pathways. The microbial community based on  Furtheragenomes .2O emissions  according to manufacture. The DNA quantity and quality were determined by spectrophotometer NanoDrop 1000 .Four replicates of non-concentrated vinasse  and four replicates of concentrated vinasse  were obtained from different batches of a single sugarcane mill localized in Piracicaba, Brazil  by 16S rRNA amplicons were sequenced using Ion TorrentTM semiconductor technology chemistry for unidirectional sequencing of the amplicon libraries. Barcoded primers were used to multiplex the amplicon pools in order to be sequenced together and separated afterward. Template preparation was performed using Ion OneTouch 2 System and Ion PGM Template OT2 400 Kit, and sequencing using Ion PGM Sequencing 400 on Ion PGM System using Ion 318 Chip v2.The microbial community was determined based on V4 region of the 16S rRNA gene sequencing. The 16S rRNA was amplified by archaeal/bacterial primers 515F (5\u2032-GTGCCAGCMGCCGCGGTAA-3\u2032) and 806R (5\u2032-GGACTACVSGGGTATCTAAT-3\u2032). The 25 \u00b5L 25 PCR contained five \u00b5L of FastStart High Fidelity taq Enzyme, 10\u00d7 FastStart High Fidelity buffer containing 18 mM MgCl2 , 0.2 mM of each dNTP  and 0.1M of each primer. Each PCR had one \u00b5L DNA of each sample. The PCR conditions were 95 \u00b0C for 5 mi., followed 35 cycles at 95 \u00b0C for 30 s, 50 \u00b0C for 30 s and 72 \u00b0C for 1 min, with a final extension at 72 \u00b0C for 10 min. The PCRs were in triplicates and amplified in a termocycler C1000 . The PCR products were visualized on 1.5% agarose gel in TBE buffer. The PCRs were purified by QIAquick kit , quantified with Quant-iT Broad-Range DNA Assay Kit  in conjunction with the BioTek Synergy HT microplate reader and combined in equimolar ratios. The https://www.ebi.ac.uk/ena/) under the study accession no. PRJEB30243. Samples were then, rarefied to determine the alpha diversity and principal coordinate analysis (PCoA) based on beta diversity  medium and incubated at 37 \u00b0C for 48 h. The pure colonies were characterized by Gram staining test. The presence of different enzymes and different organic compounds as carbon sources of the isolated bacteria were determined by API 20 NE test  according to manufacture.http://www.ncbi.nlm.gov/GenBank) sequences. The 16S rRNA gene sequences (>85% identity) were downloaded from NCBI and aligned with the six strains 16S rRNA gene sequences using ClustalW in MEGA7  for molecular identification by sequencing the 16S rRNA gene. The 16S rRNA gene was amplified with 27f (5\u2032AGAGTTTGATCMTGGCTCAG3\u2032) and 1100r (5\u2032AGGGTTGGGGTGGTTG3\u2032) primers using the PCR conditions described in in MEGA7 . All thein MEGA7  was creaamoA, nifH, narG, nirS, nirK and nosZ. The primers and PCR conditions of each gene  are listed in The potential contribution of the isolated strains on nitrogen cycle was determined by amplification of 16S rRNA sequences were obtained for eight vinasse samples (four CV and four NCV) with average of 6,199, minimum of 3,688 and maximum of 9,496 sequences. Because differences in \u03b1- and \u03b2-diversities between NCV and CV can arise from differences in similarity, differences in dispersion or both, a separate test of dispersion using PERMDISP was used to detect the nature of such differences. The PERMDISP analysis revealed no significant difference in dispersion, that is, homogeneity of variance, suggesting that differences in alpha- and beta-diversities were largely driven by dissimilarity rather than dispersion (p > 0.05). The alpha-diversity was higher in NCV than in the CV based on Shannon\u2019s and Simpson\u2019s indexes, Chao and for observed OTUs, despite being non-significant only for richness calculations (p > 0.05). PCoA plots also showed that microbial communities grouped into two clusters . The first two principal coordinates, PC1 and PC2, explained 94% and 2% of the data variation, respectively, clearly separating the communities of NCV and CV.A total of 49,595 Megasphaera (43%), followed by Lactobacillus (40%) and Mitsuokella (18%) while CV was overrepresented by mainly Lactobacillus  were obtained from NCV and one strain (EK-V6) from CV. The phylogenetic tree based on 16S rRNA complete gene sequences of the strains showed two main distinct clusters . In clusnd EK-V6 .The Gram staining test showed that all strains are Gram positive. By API 20 NE test, the strains EK-V1, EK-V3 and EK-V6 are capable to reduce nitrate to nitrite and hydrolyze arginine; strains EK-V1 and EK-V6 are capable to metabolize urea; protease and B-galactosidase are metabolized only by EK-V1 strain . Regardi2O emissions, based on the isolation of the bacteria strain EK-V6, which possess nirK (nirK gene. This result suggests that strains EK-V1 and EK-V6 (in NCV and CV) can participate in one of the stages of nitrogen transformation in vinasse, more specifically the transformation of NO2\u2212 into NO. Moreover, the strains EK-V1 and EK-V6 are able to produce arginine, essential aminoacid to produce NO3\u2212, as well as produce urease enzyme related with urea hydrolysis . Actinobacteria and Bacteroidetes were only present in NCV. Within Firmicutes phylum are bacterial members capable of fermenting various organic substrates and forming spores. Previously, these bacteria group found to be abundant in the ethanol industry process . Aerobicentation . Heat-reentation . In NCV,2O fluxes in the soil than CV  and NCV (EK-V6) are able to reduce nitrate to nitrite. This step has emerged as an alternative route to the classical enzymatic NO and N2O formation.The application of vinasse on sugarcane fields has negative environmental aspects related to GHG emissions when applied in conjunction with inorganic nitrogen , 2018d.  than CV . Based oBacillaceae, Micrococcaceae, Hyphomicrobiaceae and Nitrospiraceae families  being the core genus present in the vinasse input.One issue that should be considered is the substantial amount of vinasse potentially being flushed into soil microbiome in sugarcane cropland. Vinasse may affect the resident microbial activity and relative abundance of specific taxonomic groups in sugarcane-cultivated soils by introducing labile nutrients and exogenous microbes. Traditionally, most studies on biological invasions have focused on invasive plants and animals , while ofamilies  with funBacillus, Clostridium, Enterococcus, Lactobacillus and Lactococcus, which execute the steps of hydrolysis and acidogenesis, were comparable to investigations done in anaerobic digesters  and production of the potent GHG, N2O. Urea hydrolysis to NH4+ and CO2 may also take place by microbial uptake  of concentrated vinasse (CV) and non-concentrated vinasse (NCV); Chemical composition of concentrated vinasse (CV) and non-cocncentrated (NCV); Primers and PCR conditions of each gene.Click here for additional data file."}
+{"text": "To evaluate the feasibility of quantifying visceral adipose tissue (VAT) oncomputed tomography (CT) and magnetic resonance imaging (MRI) scans, usingfreeware, as well as calculating intraobserver and interobserverreproducibility.We quantified VAT in patients who underwent abdominal CT and MRI at ourinstitution between 2010 and 2015, with a maximum of three months betweenthe two examinations. A slice acquired at the level of the umbilicus wasselected. Segmentation was performed with the region growing algorithm ofthe freeware employed. Intraobserver and interobserver reproducibility wereevaluated, as was the accuracy of MRI in relation to that of CT.2; p = 0.488), 86% for T1-weighted MRI, and 88% forT2-weighted MRI .The intraobserver reproducibility was 90% for CT , 92% for T1-weighted MRI , and 90% for T2-weightedMRI . Thereproducibility between T1-weighted MRI and T2-weighted MRI was 87% . In comparison with theaccuracy of CT, that of T1-weighted and T2-weighted MRI was 89% and 91%,respectively.Thirty-one patients  underwent CT and MRI . The interobserver reproducibility was 82% for CT  appears to be high, as do intraobserver and interobserverreproducibility. However, the quantification of VAT seems to be lessreproducible in T1-weighted sequences. Inrecent decades, evidence has been mounting that the quantity of visceral adiposetissue (VAT) is linked to a number of metabolic dysfunctions, such as insulinresistance, hyperinsulinemia, dyslipidemia, and hypertension. In addition, calculating thevariation in the quantity of VAT over time can be a useful way of evaluatingoutcomes in patients who have undergone bariatric surgery, have dietaryrestrictions,participate in weight loss programs, or follow specific physical exerciseregimens.In the human body, the main function of white adipose tissue is to contribute toenergy homeostasis by absorbing and storing lipids, as well as by preventing ectopiclipid deposition. White adipose tissue deposits are found mainly in the subcutaneouscompartments of the upper and lower body, as well as in the visceralcompartment. Inreceertension. In addic surgery, have ditrictions,particiregimens.invivo. In clinical practice, some anthropometric indices have beenproposed for quick, reliable evaluation, such as waist circumference, hip circumference,waist-to-hip ratio, skinfold thickness, and body mass index (BMI), although none ofthose are able to differentiate the distribution among the compartments or todistinguish between fat content and muscle mass. Although ultrasound has proven tobe an accurate means of evaluating the thickness of subcutaneousfat, itsperformance continues to be suboptimal for the quantification ofVAT. To addressthese issues, some authors have used other tools, such as dual-energy X-rayabsorptiometryand body impedance analysis, which provide data on lean and fat tissue. However,quantitative evaluation of body fat distribution is still difficult to perform.Various methods have been proposed to calculate the amount of fat tissue valuation, such asneousfat, itsperon ofVAT. To addrptiometryand body analysis, which p(-13). Although each method showsadvantages and disadvantages for that purpose, they both can accurately quantify VATand SCAT, thusquantifying total adipose tissue. CT is considered the most well-established imagingmethod for abdominal fat quantification, because adipose tissue has always the same(low) density. On MRI scans, the signal intensity of fat is high in T1- andT2-weighted sequences, although the numerical value varies depending on severalfactors. In theuse of CT and MRI, one option is to evaluate the amount of fat contained in a singleimage (slice) acquired at the level of the umbilicus, which has been reported tocorrelate well with the total VAT. The use of that strategy results in considerably lessradiation exposure during CT and in a markedly shorter duration of MRIexaminations.However, some limitations of single-slice analysis have also been reported, mainlythe fact that VAT can undergo great variations due to bowel movement or variablefilling of the intestine.Computed tomography (CT) and magnetic resonance imaging (MRI) have both been used astools to investigate the distribution of subcutaneous adipose tissue (SCAT) andVAT-13. Althand SCAT, thusqulfactors. In thetotal VAT. The useminations.Howeverintestine..Other studies have employed specific plugins that can be used with freeware , although such plugins are very difficult to use inclinical practice.OsiriX  is image processing software, dedicated tomedical imaging, that is widely used in many radiological applications. The basicversion of OsiriX is available for free online. The region growing algorithm of thesoftware can be used in order to calculate the area of different compartments of thebody and has previously been used in abdominal imaging.Several types of software have been used in the analysis of images obtained from CTand MRI scans. Some such software is developed in-house, and the results aretherefore not reproducible, because the software is not publiclyavailable.Other s practice.OsiriX l imaging.The objective of this study was to test the feasibility of using OsiriX to calculatethe amount of VAT in patients who have undergone CT and MRI of the abdomen. We alsocalculated the intraobserver and interobserver reproducibility.This was a retrospective study designed to quantify VAT in patients who underwentabdominal CT and abdominal MRI at our institution between 2010 and 2015. Thestudy was approved by the local institutional review board, and the requirementfor written informed consent was waived. The image archive and communicationsystem of our hospital were screened to identify patients who had undergoneabdominal CT and abdominal MRI, for any reason, with no more than three monthsbetween the two examinations. The exact interval between the CT and MRIexaminations was noted. Examinations of the upper abdomen, lower abdomen, orentire abdomen, with or without contrast, were included in the evaluation. Forboth imaging methods, a slice acquired at the level of the umbilicus wasconsidered. We included CT examinations with a non-contrast acquisition and MRIexaminations with at least one non-contrast, non-fat-saturated T1- orT2-weighted sequence.MRI examinations were performed in one of two 1.5 T MRI scanners  equipped with phased-arrayabdominal coils. Depending on the clinical problem to be investigated, differentacquisition sequences were used. However, all of the cases included theacquisition of at least one T1-weighted sequence  or one T2-weighted sequence . When itwas available, we selected the slice acquired at the level of the umbilicus in anon-contrast T1-weighted sequence, a non-contrast T2-weighted sequence, orboth.CT examinations were performed in multidetector scanners, either a 16-slicescanner  or a 64-slice scanner . The technical parameters of CT acquisitionwere adjusted according to the clinical problem under investigation and patientbody size. The slice acquired at the level of the umbilicus was selected in thenon-contrast acquisition. The slice thickness was 5 mm.For CT and MRI, the images were obtained from the archive at our hospital. Thoseimages were uploaded to a separate workstation on which the OsiriX software wasinstalled.On CT scans, abdominal fat has a hypodense appearance, whereas it has a highsignal intensity on T1- and T2-weighted MRI scans. The individual CT and MRIscans were anonymized and analyzed in random order by two readers, workingindependently-a radiology resident and a radiologist, both with experience inabdominal imaging .Prior to that analysis, both readers had a training session in which a series offive CT scans and five MRI scans, not included in the study, were evaluated inconsensus in order to optimize the segmentation technique..At the end of the procedure, the software provides the size of the area includedin the region growing algorithm that was considered for statistical analysis.The procedure is depicted in On each image, a region of interest (ROI) was manually drawn over the abdominalwall to delineate the interface between the abdominal wall and the abdominalfat. No extreme precision is needed in this phase, because the difference indensity/intensity between the abdominal wall and the abdominal fat is high on CTand MRI. The region growing (segmentation) algorithm was selected, thus allowingthe segmentation ROIs to be drawn with a semi-automated method. The cursor isplaced on a portion of the abdominal fat, and the software automatically createsa ROI that includes all pixels with gray levels similar to those selected. Thethreshold  can bemodified by the operator, who uses a slider to improve thecalibration,21.At tThe threshold and fat area data are expressed as mean \u00b1 standarddeviation. For the thresholds, coefficients of variation (CVs) were alsocalculated.p < 0.05 were consideredstatistically significant.To evaluate intraobserver reproducibility, the more experienced operator repeatedthe evaluation, using the same method reported above, after two months.Intraobserver and interobserver reproducibility were assessed with theBland-Altman method. Values of In the literature, CT is considered a reliable method to measure VAT. Therefore,CT was used as the reference in our study. The accuracy of MRI was estimated asthe inverse consistency error between CT-determined VAT quantity and thatmeasured on T1- and T2-weighted MRI scans.During the study period, 4137 patients underwent abdominal CT and 1977 patientsunderwent abdominal MRI. Among those, there were 31  whounderwent both types of examination. The mean age of the 31 patients was 57 \u00b115 years , and the mean interval between the two examinationswas 28 \u00b1 12 days. The CT and MRI examinations were performed for a variety ofreasons: hepatic lesion (n = 4); pancreatic lesion (n = 5); tumor of thegenitourinary tract (n = 7); liver metastases (n = 5); Crohn's disease (n = 5);diverticulitis (n = 1); endometriosis (n = 1); aortic aneurysm (n = 1);gastrointestinal stromal tumor (n = 1); and small bowel lymphoma (n = 1). CT scanswere available for all 31 patients; T1-weighted MRI scans were available for 26patients; T2-weighted MRI scans were available for 23 patients; and T1- andT2-weighted MRI scans were both available for 20 patients.As previously described, the threshold  was adjusted manually. The mean threshold values used for CTscans, T1-weighted MRI scans, and T2-weighted MRI scans in the first evaluationmade by the more experienced reader were 145 \u00b1 40 (CV = 27.6%), 475\u00b1 220 (CV = 46.3%), and 367 \u00b1 159 (CV = 43.3%), respectively.2, 130 \u00b1 71 cm2, and 130 \u00b1 68cm2, respectively. The mean area of abdominal fat on CT scans,T1-weighted MRI scans, and T2-weighted MRI scans, as calculated by the lessexperienced reader, was 143 \u00b1 68 cm2, 124 \u00b1 67cm2, and 130 \u00b1 63 cm2, respectively.The mean area of abdominal fat on CT scans, T1-weighted MRI scans, andT2-weighted MRI scans, as calculated by the more experienced reader, was 145\u00b1 63 cm2;p = 0.912), 92% for T1-weighted MRI , and 90% for T2-weighted MRI. The interobserverreproducibility was 82% for CT , 86% for T1-weighted MRI , and 88% for T2-weighted MRI . The reproducibility between T1- and T2-weightedMRI was 87% .The intraobserver reproducibility was 90% for CT , although CT has certainly been used more frequently.Multidetector CT has the advantage of performing quick scans with very highresolution. However, the high dose of ionizing radiation administered to patients isa major limitation of CT. Conversely, MRI has the great advantage of not usingionizing radiation as well as allowing for precise tissue characterization. However,certain contraindications , aswell as the high cost and long examination times, can limit the use of MRI inclinical practice.Regarding the evaluation of VAT, one major advantage of CT over MRI is that fatalways shows very low attenuation, with little variability among individuals. Thatallows a relatively narrow threshold to be used when applying a region growingalgorithm, as confirmed by our data, given that we found a CV of approximately 25%.That is also why we used CT as the reference to calculate the accuracy of MRI, whichwas found to be high (approximately 90% for T1- and T2-weighted MRI). Oneexplanation for that finding is that CT and MRI were performed at different timepoints. Therefore, bowel movement and differences in rectal filling may haveaffected the quantity of VAT in the selected slice. However, the signal intensity offat is high on T1- and T2-weighted MRI scans, although that intensity is highlyvariable, not only among the different types of sequences employed but also amongindividual patients. That is consistent with our findings, given that the CVexceeded 40% for T1- and T2-weighted MRI scans, which implies that a fully automatedsystem for VAT segmentation and quantification using MRI may be difficult toconstruct.CT and MRI have both been used in order to quantify VAT,23, alth practice.Regardi or asingle slice acquired at the level of the umbilicus. Although analysis of the entire abdomencertainly has the advantage of greater accuracy, it is extremely time consuming andhardly applicable in clinical practice. Various authors have demonstrated that VATquantification using a single slice acquired at the level of any one of severalanatomic landmarks correlates strongly with total VAT. In a study comparingdual-energy X-ray absorptiometry evaluation of whole-body fat and CT evaluation ofSCAT at the level of the interspace of the fourth and fifth lumbar vertebrae(L4-L5), Smith et al. found that the two approaches correlated strongly,especially among men. Abate et al. found that, although the most reliable single-sliceevaluation was achieved with a slice acquired at the L2-L3 level, the addition of aslice acquired at the L1-L2 level and another acquired at the L3-L4 level canincrease the predictability from 85% to 90%. Even if the use of three slices ispossible, it takes a considerable amount of time to perform the segmentation and theapproach should therefore be used only in cases in which greater precision isneeded. A slice acquired at the level of the umbilicus has been used because it iscommonly included in abdominal examinations performed for any reason. In one studyusing that approach, Schwenzer et al. found that VAT measured at the level of the umbilicuscorrelated strongly with total VAT, especially among women.Previous studies have quantified VAT on the basis of images of the abdomen as awhole or asinumbilicus. Althougth et al. found thte et al. found ther et al. found th compared a new automated software known as AdipoQuantwith the free software ImageJ, the latter having already been used for thispurpose. Theauthors found that the two programs provided almost identical VAT values, withexcellent agreement. However, the processing time per slice was only 2 s forAdipoQuant, compared with 8 min for ImageJ. OsiriX has previously been used foradipose tissue quantification. In a study involving 62 obese patients, O'Leary etal. used OsiriXto quantify VAT, as a means of determining the risk of acute pancreatitis. Thoseauthors found that the quantity of VAT correlated positively with the risk ofpancreatitis, although they did not report exactly how segmentation was performed.Kinsella et al.also used OsiriX to evaluate changes in fat distribution in patients who underwentrenal transplantation, identifying a significant correlation between VAT and BMI,although they also provided no details about the segmentation technique. Lee etal. assessedthe evaluation of a single CT slice acquired at the level of the umbilicus, asanalyzed with the Rapidia software , in comparison with the useof bioelectrical impedance analysis, in terms of the quantification of VAT. Theauthors found that the VAT area was smaller when evaluated by bioelectricalimpedance analysis than when evaluated by single-slice CT, with a tendency toincrease in parallel with increases in BMI. Yu et al. also used Rapidia to evaluatethe correlation between VAT and liver fibrosis among patients with nonalcoholicfatty liver disease, finding that the VAT area was significantly larger in thepatients with fibrosis than in those without.A wide variety of software has been used for VAT quantification, all such softwarerequiring continuous adjustments by the operator. However, most studies on the topichave provided very few technical details, which limits the reproducibility of theresults. Addeman et al. comparedspurpose. Theautry etal. used Osila et al.also useee etal. assessedYu et al. also use performed asemi-automated evaluation of CT-based fat quantification in obese population within-house software, finding excellent intraobserver and interobserverreproducibility. Yoshizumi et al. evaluated VAT in a CT slice acquired at the level of theumbilicus using an in-house algorithm: the attenuation range of CT values for fattissue was calculated, and a related histogram was constructed, considering the meanattenuation plus or minus two standard deviations. Those authors also found thatintraobserver and interobserver reproducibility were high. In our study,intraobserver reproducibility was \u2265 90%, whereas interobserverreproducibility was lower, although still relatively high (82-88%). We found thatstatistical significance was achieved only for the T1-weighted MRI scans. Thissomewhat unexpected finding might be explained by the fact that the hyperintensefluid within the bowel-which has a signal intensity similar to fat-could somehowhave affected the segmentation.In addition to the commercial software and freeware available, in-house systems ofVAT quantification have been developed and described by various authors. The mainlimitations of such studies are that they provide few technical details on thesoftware build and that the software is not publicly available, thus precluding anytesting of the reproducibility of the results. Maurovich-Horvat etal. performemi et al. evaluateOsiriX offers several advantages over other software in the evaluation of adiposetissue. First, because it is freeware, there is a greater likelihood that data willbe comparable across studies. Second, because it allows rapid data analysis, it canbe applied to large populations as well as to several examinations of the samepatient in order to analyze changes over time. In addition, we have demonstratedthat the VAT segmentation performed with OsiriX has high intraobserver andinterobserver reproducibility, which underscores the applicability of thismethod..The clinical relevance of the present study mainly resides in the fact that we haveshown that it is possible to use MRI as a reliable means of quantifying VAT. Themain advantage of that approach is the absence of ionizing radiation, which impliesthat evaluations can be repeated as needed over time. In addition, MRI isparticularly useful in specific cohorts of patients . Therefore, concurrentquantification of VAT with no need for a separate examination may represent afurther advantage, given that the presence of a high quantity of VAT has beenimplicated in predisposition to several diseases, as well as in a poor response toseveral treatments,3.Our study has several limitations. First, it was a prospective evaluation ofretrospective data, the CT and MRI examinations having been performed at differenttime points. Although it seems reasonable to assume that the quantity of VAT wouldnot have changed significantly over a period of three months, such changes couldhave occurred, which would have affected our evaluation and might explain, at leastin part, the differences observed. In addition, we included patients with a widerange of diseases, evaluated with different MRI protocols-some including only theupper abdomen, some including only the lower abdomen, and some including both.However, that limitation is mitigated by the fact that we always evaluated the sameslice acquired at the level of the umbilicus, in T1- or T2- weighted sequences, ineach patient. Furthermore, the sample size was relatively small. Nevertheless, itwas possible to obtain high levels of accuracy and reproducibility.In conclusion, OsiriX can be used in order to quantify VAT on CT and MRI scans(T1-weighted or T2-weighted). We found that MRI showed high accuracy, in comparisonwith that of CT, as well as high intraobserver and interobserver reproducibility.However, accuracy, intraobserver reproducibility, and interobserver reproducibilitywere higher for T2-weighted MRI scans, which might therefore be more suitable forVAT quantification."}
+{"text": "The topic of big data has attracted increasing interest in recent years. The emergence of big data leads to new difficulties in terms of protection models used for data privacy, which is of necessity for sharing and processing data. Protecting individuals\u2019 sensitive information while maintaining the usability of the data set published is the most important challenge in privacy preserving. In this regard, data anonymization methods are utilized in order to protect data against identity disclosure and linking attacks. In this study, a novel data anonymization algorithm based on chaos and perturbation has been proposed for privacy and utility preserving in big data. The performance of the proposed algorithm is evaluated in terms of Kullback\u2013Leibler divergence, probabilistic anonymity, classification accuracy, F-measure and execution time. The experimental results have shown that the proposed algorithm is efficient and performs better in terms of Kullback\u2013Leibler divergence, classification accuracy and F-measure compared to most of the existing algorithms using the same data set. Resulting from applying chaos to perturb data, such successful algorithm is promising to be used in privacy preserving data mining and data publishing. Big data has become a hot topic in the fields of academia, scientific research, IT industry, finance and business ,2,3. RecBig data may contain sensitive personal identifiable information that requires protection from unauthorized access and release ,8,9. FroIn big data, modifying the original data before publishing or sharing is essential for the data owner as individuals\u2019 private information is not to be visible in the published data set. The modification of sensitive data decreases data utility, which, on the contrary, should be convenient for sustaining the usefulness of data. This data modification process for privacy and utility of data, called as privacy preserving data publishing, protects original data sets, when releasing data. An original data set consists of four kinds of attributes. The attributes that directly identify individuals and have unique values are called identifier (ID), such as name, identity number and phone number. Sensitive attributes (SA) are the attributes that should be hidden while publishing and sharing data . The attributes that can be utilized by a malicious person to reveal an individual\u2019s identity are called quasi-identifier (QI), including age and sex. Other attributes are non-sensitive attributes (NSA). Before publishing, the original data set is anonymized by deleting identifiers and modifying quasi-identifiers, thereby preserving individuals\u2019 privacy .In order to preserve privacy, there are five types of anonymization operations, namely generalization, suppression, anatomization, permutation and perturbation. Generalization replaces values with more generic ones. Suppression removes specific values from data sets . Anatomization disassociates relations between quasi-identifiers and sensitive attributes. Furthermore, permutation disassociates a relation between a quasi-identifier and sensitive attribute by dividing a number of data records into groups and mixing their sensitive values in every group. Perturbation replaces original values with new ones by interchanging, adding noise or creating synthetic data. These anonymization operations decrease data utility, which is represented by information loss in general. In other words, higher data utility means lower information loss ,20.Various studies utilizing the aforementioned operations have been done by now. In this paper, to address the problems of data utility and information loss, a new anonymization algorithm using chaos and perturbation operation is introduced. Our main contribution is developing a comprehensive privacy preserving data publishing algorithm which is independent of data set type and can be applied on both numerical and categorical attributes. The proposed algorithm has higher data utility due to analyzing frequency of unique attribute values for every quasi-identifier, determining crucial values in compliance with frequency analysis and performing perturbation operation only for these determined crucial values. Another significant contribution of this study is to prove the efficiency of chaos, an interdisciplinary theory commonly used for randomness of systems, in perturbing data. To the best of the authors\u2019 knowledge, there is no other work in the literature pertaining to the utility of chaos in privacy preserving of big data in this framework. Great success of chaos in randomization motivated the authors to explore its utility in data perturbation. Evaluating the performance of the proposed algorithm through different metrics, the test results demonstrate that the algorithm is effective compared to previous studies.The organization of the rest of the paper is as follows: in k-anonymity and k-anonymity based algorithms like Datafly [k-anonymization is the process whereby the values of quasi-identifiers are modified so that any individual in the anonymized data set is indistinguishable from at least k \u2212 1 other ones [In privacy preserving data mining and data publishing, protection of privacy is achieved using various methods such as data anonymization ,25,26,27 Datafly , Incogni Datafly  and Mond Datafly  are the her ones . Table 1k-anonymization is demonstrated in The two-anonymous form of this original data set obtained by utilizing l-diversity principle in order to improve k-anonymity in which sensitive attributes lack diversity. l-diversity focuses on the relations between quasi-identifiers and sensitive attributes. If a quasi-identifier group includes at least l well-represented sensitive attribute values, it satisfies l-diversity. Furthermore, entropy l-diversity is satisfied if the entropy of sensitive attribute is bigger than ln l for every quasi-identifier group in a data set. In order to overcome the limitations of the l-diversity principle, Li et al. [t-closeness principle coping with attribute disclosure and similarity attack. Sun et al. [l-diversity and entropy l-diversity.Machanavajjhala et al.  introduci et al.  proposedn et al.  offered Agrawal and Srikant  presenteEvfimievski et al.  proposedYang and Qiao  presenteDwork  proposedk-anonymization technique utilizing suppression and sampling operations in order to satisfy differential privacy. Soria-Comas et al. [k-anonymity approach combining k-anonymity and differential privacy to enhance data utility. Fouad et al. [kd-tree algorithm [Mohammed et al.  introducs et al.  proposedd et al.  introducd et al.  proposedlgorithm . Zaman elgorithm  presentelgorithm  introduclgorithm  proposedDong et al.  presentek-Nearest Neighbours technique (k-NN) to protect sensitive data against probabilistic inference attack, linking attack, homogeneity attack and similarity attack. Unlike the aforementioned methods, in this work, a new chaos and perturbation based anonymization algorithm has been proposed to protect privacy and utility in big data.In a recent study, Nayahi and Kavitha  proposedIn this study, privacy and utility preservation are achieved using chaos and data perturbation techniques. The general block diagram of the proposed algorithm consists of the three main stages illustrated in An overview of the proposed algorithm is presented in Algorithm 1, which consists of these eight steps:D, quasi-identifier attributes QI , and sensitive attribute SA are specified.Step 1: The original input data set QI are found. |D| is the size of input data set D and |QI| is the number of quasi-identifier attributes QI.Step 2: The unique attribute values for each QI.Step 3: The number of records containing the unique attribute values is computed for each Step 4: The unique attribute values are sorted in ascending order in accordance with the frequency.D are found for subsequent randomization and replacement processes.Step 5: The record places of the unique attribute values in QI using Equation (1):Step 6: The number of crucial unique attribute values is calculated for each QI, the more crucial for identity disclosure and linking attacks. These attributes might be utilized by an intruder to infer the sensitive attribute of an individual.The less the number of unique attribute values for a particular \u03bb < 4. The chaotic behaviour of the function depends completely on \u03bb value. In order to make the function operate in the most chaotic region, \u03bb is defined in the range of 3.99 and 4 [\u03bb value approaches to 4. The aim of using logistic map in this study is to take advantage of its familiar chaotic behaviour in order for data perturbation.Step 7: The new attribute values for the selected crucial unique values are determined using a chaotic function known as logistic map (Equation (2)):99 and 4 . Figure D are replaced with the determined new attribute values. Finally, the privacy preserved data set pD is obtained.Step 8: The selected record values in The flowchart of the privacy preserving process is demonstrated in Algorithm 1: Efficient Privacy Preserving AlgorithmInput: Original input data set D, quasi-identifier attributes QI QI, and sensitive attribute SAOutput: Privacy preserved data set pDInitial assignments:c = 0, \u03bb = 3.99, iteration = 4001:d = |D|2:q = |QI|3:fori = 1 to qdo4:inu = number of unique values for each iQI\u2003\u20035:forj = 1 to inudo\u2003\u20036:iju = unique values for each iQI\u2003\u2003\u2003\u20037:ijv = number of records containing the unique value iju\u2003\u2003\u2003\u20038:end for\u2003\u20039:end for10:iju in ascending order based on ijv for each iQISort 11:irecord_place = \u00d8 (the size d \u00d7 inu for each iQI)12:fori = 1 to qdo13:forj = 1 to inudo\u2003\u200314:fork = 1 to ddo\u2003\u2003\u2003\u200315:ifk-th record value in iQI == j-th value in sorted ijuthen\u2003\u2003\u2003\u2003\u2003\u200316:c++\u2003\u2003\u2003\u2003\u2003\u2003\u2003\u200317:irecord_place  = j\u2003\u2003\u2003\u2003\u2003\u2003\u2003\u200318:else\u2003\u2003\u2003\u2003\u2003\u200319:\u2003\u2003\u2003\u2003\u2003\u2003\u2003\u2003continue20:end if\u2003\u2003\u2003\u2003\u2003\u200321:end for\u2003\u2003\u2003\u200322:c = 0\u2003\u2003\u2003\u200323:end for\u2003\u200324:end for25:fori = 1 to qdo26:ir = round (log2inu)\u2003\u200327:end for28:fori = 1 to qdo29:i1x = 0.1\u2003\u200330:forj = 1 to iterationdo\u2003\u200331:ij + 1x = \u03bb \u00d7 ijx \u00d7 (1 \u2212 ijx)\u2003\u2003\u2003\u200332:end for\u2003\u200333:end for34:ir value in sorted unique values iju based on the record places ijx for each iQIDetermine the new attribute values for the first 35:D with the determined new valuesReplace the chosen record values in 36:pDReturn In this section, the performance metrics used for evaluation of the proposed privacy preserving algorithm are presented. These metrics are Kullback\u2013Leibler divergence (relative entropy), probabilistic anonymity, classification accuracy, F-measure and execution time. The proposed algorithm is implemented in MATLAB R2016a  running on the Windows 7 64-bit operating system on a personal computer equipped with 16 GB RAM and an Intel Core i7-3820 (3.60 GHz) processor. The classification accuracy and F-measure results of the proposed algorithm are obtained using various classification techniques provided in Weka 3.8 .The performance of the proposed algorithm is evaluated on the Adult data set extracted from the 1994 U.S. Census database . The reak-anonymous forms of the Adult data set, ensuring k = 2, 4, 8 and 16. In order for comparing the performance of the proposed algorithm with the existing algorithms, three attributes are selected as quasi-identifiers which are \u201cage\u201d, \u201crace\u201d and \u201csex\u201d. Moreover, the attribute \u201cincome\u201d is chosen as the sensitive attribute (class attribute).To demonstrate the scalability of the proposed algorithm on big data, the Adult data set is uniformly enlarged as four data sets which have ~60 K, 120 K, 240 K and 480 K records, respectively. Furthermore, data doubling is performed evenly without corrupting data integrity to evaluate the classification accuracy, F-measure and execution time performance of the proposed algorithm on p(x) and q(x) are two distributions [p(x) and q(x) distributions are used for privacy preserved and original data sets, respectively.Kullback\u2013Leibler divergence (KL divergence) is used to quantify the difference between two distributions ,72. In pibutions . The KL ibutions . In thisProbabilistic anonymity is a statistical measurement for privacy or anonymity defined and proved by . In a prDefinition\u00a01i, i = 1, \u2026, m be the i-th quasi-identifier attribute in D and Entropy(Qi) be the entropy value of Qi. The probabilistic anonymity of D\u2019 is denoted as Pa(D\u2019) and defined asGiven a data set D and its anonymized form D\u2019. Let r be a record in D and r\u2019 \u2208 D\u2019 be its anonymized version. Symbolize r(QI) as the value combination of the quasi-identifier in r. The probabilistic anonymity of D\u2019 is defined as 1/P(r(QI)|r\u2019(QI)). P(r(QI)|r\u2019(QI)) is the probability that r(QI) might be inferred given r\u2019(QI). Let Q:(probabilistic anonymity). Pa(D\u2019) attains the maximal value when:Pa(D\u2019) can be made by calculating the geometric mean of all quasi-identifier diversities when:This proposition can be used as a general measurement for computing the probabilistic anonymity. An estimation of the scaled D is calculated as 1/Pa(D\u2019). Furthermore, this probability shows the confidence of a user for associating a sensitive value with an individual. Derived from Equation (7), Pa(D\u2019) is mostly greater than the geometric mean of all quasi-identifier diversities. In a similar way, Pa(D\u2019) is mostly greater than the sensitive attribute diversity. Given a diversity of a sensitive attribute sDiversity. The maximal confidence of a user in inferring the corresponding sensitivity is 1/sDiversity when it is certain that an individual is in the data set. Readers are referred to [The probability of estimating the original value of a quasi-identifier for an arbitrary record in erred to  for prooThe probabilistic anonymity of the proposed algorithm for the Adult data set is calculated using Equation (7) for which the corresponding value is 24.53. For an arbitrary record in the Adult data set, the estimation probability for the original value of a quasi-identifier is 0.04. These results show that the probabilistic anonymity of the proposed algorithm is quite good.The classification accuracy is the percentage of correctly classified test set tuples and defined as:P is the number of positive tuples. N is the number of negative tuples. True positives (TP) are correctly labelled as positive tuples. True negatives (TN) are correctly labelled as negative tuples. False positives (FP) are the negative tuples which are mislabelled as positive. False negatives (FN) are the positive tuples which are incorrectly labelled as negative. P\u2019 is the number of labelled positive tuples, and N\u2019 is the number of labelled negative tuples [e tuples . Figure k-fold cross validation technique, the results of the classification accuracy of the proposed algorithm for five data sets with different sizes are demonstrated in The classification accuracy of the proposed method is investigated using four different classifiers, which are Voted Perceptron (VP), OneR, Naive Bayes (NB) and Decision Tree (J48). For k value causes a small increase in classification accuracy for each data set in general. For all data sets, classification accuracies of privacy preserved data sets are the same or very close to the originals. The classification accuracies of the original and privacy preserved data sets are the same for Voted Perceptron and OneR classifiers and almost equal for Naive Bayes and J48 classifiers. Besides, the best accuracy values are achieved using J48 classifier for each data set.As seen from l-diversity,  and KNN- in 10-fold cross validation scheme is shown in For the same data set, quasi-identifiers, sensitive attribute, and classification algorithms, the comparison of classification accuracy of the proposed algorithm with the existing methods, namely Datafly, Incognito, Mondrian, Entropy It can be seen from the table that the classification accuracy of the proposed algorithm is better than the existing algorithms in all cases of Voted Perceptron, OneR and J48 classifiers. The performance of the proposed privacy preserving algorithm is the same with the original Adult data set in Voted Perceptron and OneR classifiers. Furthermore, the classification accuracy of the proposed algorithm is almost the same with the original value in J48 classifier. J48 classifier also gives the best accuracy results for all algorithms. Besides, the confusion matrices of the proposed algorithm pertaining to Voted Perceptron, OneR, Naive Bayes and J48 for the Adult data set in 10-fold cross validation scheme are demonstrated in 1 score is a measure for accuracy of a test and utilized in order for evaluating classification techniques. The F-measure is defined as:precision and recall are the measures of exactness and completeness, respectively. These measures are calculated as [The F-measure also known as F-score and Flated as :(11)Preck-fold cross validation technique. For each classification algorithm, 2-fold, 5-fold and 10-fold cross validation are carried out. In order to measure the performance of the proposed algorithm, F-measures of the original and privacy preserved versions of the data sets are compared with each other. Higher values of F-measure are preferred and closer F-measure values to the originals are better.To analyse the F-measure performance of the proposed algorithm, four classification algorithms are utilized. The results of the F-measure of the proposed algorithm for five data sets with different sizes are shown in It can be seen from the analysis of The F-measure comparison of the proposed algorithm with the existing methods for the same experiment conditions in 10-fold cross validation scheme is demonstrated in In this study, five data sets with different sizes are used to show the feasibility and scalability of the proposed algorithm on big data. The execution time performance of the proposed algorithm is investigated utilizing the Adult data set and its four enlarged versions including ~60 K, 120 K, 240 K and 480 K records . As seenIn this paper, a new chaos and perturbation based algorithm is introduced for privacy and utility preserving in big data. The scalability and feasibility of the proposed algorithm are evaluated using several data sets with different sizes. Kullback\u2013Leibler divergence, probabilistic anonymity, classification accuracy, F-measure and execution time are utilized as evaluation metrics. Privacy analyses and experimental results demonstrate that the proposed algorithm performs better than the previous studies with regards to Kullback\u2013Leibler divergence, classification accuracy and F-measure in the same experiment conditions. Probabilistic anonymity and execution time performance of the proposed algorithm are sufficient. Taking into consideration the success of the proposed algorithm which results from utilizing a chaotic function for data perturbation purpose, the algorithm ensures its suitability for the protection of individuals\u2019 privacy before publishing and sharing data."}
+{"text": "Staphylococcus aureus and S. epidermidis, isolated in a hospital intensive care unit in Madrid, Spain. Using checkerboard and time-kill assays, interesting synergistic effects were encountered for the combination of linezolid with imipenem in all the staphylococcal strains, and for linezolid\u2013doripenem in S.epidermidis isolates. The combination of plazomicin seemed to also have a good synergistic or partially synergistic activity against most of the isolates. None of the combinations assayed showed an antagonistic effect.Linezolid is a synthetic oxazolydinone active against multi-resistant Gram-positive cocci that inhibits proteins synthesis by interacting with the 50S ribosomal subunit. Although linezolid-resistant strains are infrequent, several outbreaks have been recently described, associated with prolonged treatment with the antibiotic. As an alternative to monotherapy, the combination of different antibiotics is a commonly used option to prevent the selection of resistant strains. In this work, we evaluated combinations of linezolid with classic and new aminoglycosides , carbapenems  and fosfomycin on several linezolid- and methicillin-resistant strains of  Staphylococcus aureus, enterococci and coagulase-negative staphylococci are the most frequently isolated agents [S. aureus (MRSA) have remained constant or have decreased over the last few years, the emergence of new isolates of S. epidermidis resistant, or with reduced sensitivities, to beta lactams or non-beta-lactam antibiotics such as glycopeptides  and aminoglycosides  causes severe difficulties or failures in patient treatments [Antibiotic resistance is considered a major global public health problem and constitutes a challenge for the treatment of infections caused by multi-drug-resistant microorganisms. Gram-positive bacteria are responsible for a high proportion of community- and hospital-acquired invasive infections, and d agents . Althougeatments ,3.11 colony forming units (CFU) [cfr gene. It encodes a methyltransferase that methylates a specific nucleotide in the binding site at the 23S rRNA [Linezolid is a synthetic oxazolidinone active against multi-resistant Gram-positive cocci and is one of the recommended treatments for pneumonia, bacteremia or central nervous system and soft tissue infections . Linezolts (CFU) , soon afts (CFU) . Linezol23S rRNA .Staphylococcus aureus. Nevertheless, many strains were susceptible to linezolid and susceptible to the rest of antibiotics assayed in combination [S. epidermidis.Failures in the treatment of multi-resistant staphylococci infections with classical or new antibiotics in monotherapy has led to the recommendation of combined therapies, mainly based on empirical clinical experience ,10. Combbination ,13, and,S. aureus strains, isolated during the first European nosocomial outbreak in an intensive care unit (ICU) in Madrid, Spain [S. epidermidis strains, also isolated in the ICU four years later. The main objective was to evaluate different combinations of linezolid with several antibiotics with different activities\u2014such as classic and new aminoglycosides, which inhibit protein synthesis, and carbapenems and fosfomycin, which interact with cell wall formation\u2014with the aim of providing experimental data that could help with the selection of new options for treating infections caused by linezolid-resistant staphylococci.In this work, we studied several linezolid-resistant d, Spain , and S. S. aureus strains were resistant to gentamicin and fosfomycin and showed elevated MIC values for carbapenems .The susceptibility of the strains was studied by broth microdilution, and the minimum inhibitory concentration (MIC) values are shown in S. epidermidis , while the isolates had elevated MICs for meropenem (8\u201316 mg/L), although they were lower than those of S. aureus (128 mg/L). The FDA breakpoint for plazomicin was used (2 mg/L), and all the staphylococcal isolates presented lower MIC values (0.0625\u20130.25 mg/L), as would be reasonable, since plazomicin has not been approved yet in European countries. Nevertheless, the studied S. epidermidis strains were resistant to amikacin and gentamicin .Fosfomycin showed good in vitro activity against S. aureus and S. epidermidis . All the strains of S. epidermidis were adequately inhibited in vitro with the combination linezolid\u2013doripenem, while this combination was less effective against S. aureus as various results were obtained (one synergy (S), three PS or one indifferent (I)). The third combination of linezolid with carbapenems (linezolid\u2013meropenem) rendered less satisfactory results as PS was observed for most of the strains, except for three S. epidermidis isolates, where synergy was observed. The results of the combination fosfomycin plus linezolid were not homogeneous among the staphylococcal isolates. Among the aminoglycosides tested in combination, plazomicin seemed to have synergistic (four strains), or partially synergistic (five strains), effects in most of the staphylococcal isolates, while for gentamicin and amikacin, mostly PS or I, respectively, was observed. Finally, no antagonism was found for any of the strains and antibiotic combinations.The results of the study of combinations of linezolid with different antibiotics are shown in S. epidermidis, followed by the combinations with doripenem, meropenem and fosfomycin. Nevertheless, for the S. aureus strains, useful combinations of linezolid are scarce.The MIC values of each antibiotic in combination at which a synergistic effect was obtained are also shown in S. aureus and four S. epidermidis) using 1/2 of the MIC of linezolid for each strain and a fixed concentration, SSC, for the other antibiotic in each combination. The results, expressed as CFU/mL after 24 h of incubation, are shown in S. epidermidis strains. In general, the best combinations were linezolid\u2013carbapenems (meropenem and imipenem) for all the staphylococcal isolates assayed, as also shown in Time-kill curves were for generated for eight strains (four No synergy was observed for any of the isolates when linezolid was combined with SSC plazomicin (10 mg/L), as this concentration is higher than the MIC , followed by the presence of the cfr gene (54% of S. aureus/15% of coagulase-negative species) and L3 and L4 mutations (20% of S. aureus/35% of coagulase-negative staphylococci) [Resistance to linezolid is still infrequent in terms of epidemiological incidence, remaining below 0.1% among Gram-positive cocci ,15 and rlococci) .S. aureus strains included in this study (100%) showed two resistance mechanisms, the cfr gene and L3 mutation  harbored the cfr gene, in accordance with the low rates of cfr coagulase-negative isolates encountered in a meta-analysis of linezolid-resistant staphylococci [cfr is a plasmidic gene that is transferable horizontally, and it could be hypothesized that normal microbiota, i.e., S. epidermidis, could have the potential to transfer the cfr gene to more pathogenic staphylococci such as S. aureus [S. epidermidis isolates (40%) but not in S. aureus. Interestingly, one of these strains, HCSC-Se12, presented the mutation in five copies of its rRNA, besides the cfr gene, and this could be responsible for its very high MIC of linezolid (256 mg/L), as has been previously described [S. aureus, although it is detected in approximately 20% of coagulase-negative strains [S. epidermidis isolates (20%). This strain, HCSC-Se45, had two resistance determinants (L4 and L3 mutations), and this could be related to the increased MIC of linezolid , as reported [S. aureus and S. epidermidis included in this study, which were all isolated from ICU patients treated with linezolid [The five mutation . The strylococci . cfr is . aureus . In the is study 00% showeescribed . A mutat strains . Similarnezolid 26 mg/L, anezolid 26 mg/L, areported  or enteronly one % harboreinezolid .S. aureus but also S. epidermidis isolates were highly resistant, thus representing an important problem for the treatment of the patients [Streptococcus pneumoniae have been described, plazomicin shows good activity against S. aureus, including MRSA, and coagulase-negative staphylococci [Besides linezolid, seven antibiotics of different families were included in the study. Not only the strains of patients ,22. The ylococci . SimilarS. aureus and coagulase-negative staphylococci, such as S. epidermidis, is worrying due to the high capacity for the adaptation of staphylococci, the possibility of the transmission of the cfr gene and the selection of mutants under antibiotic selective pressure [The possibilities for the successful treatment of infections caused by multi-resistant staphylococci are certainly scarce, although new antibiotics such as linezolid, daptomycin, ceftobriol and dalvamycin are good or promising alternatives . The emepressure ,24.S. aureus resistant or susceptible to methicillin: indifference was mostly found for the combinations with rifampicin [S. aureus) strains tested [S. aureus and five S. epidermidis), and we found similar unsatisfactory results for amikacin and gentamicin  to 90% (for imipenem) of the strains assayed . Severalisolates ,35,36,37Staphylococcus epidermidis because, as discussed before, most of the studies on the combinations of linezolid are focused on S. aureus, with few data about S. epidermidis. In two studies, linezolid-susceptible and resistant strains were used  and indifferent effects were described for the combinations with ceftobiprole, rifampicin and clindamycin [S. epidermidis isolates when linezolid was associated with carbapenems, fosfomycin and aminoglycosides , in order to inhibit bacterial growth without causing toxicity . TherefoFinally, the importance of the methods used to study the antibiotic combinations should be highlighted . CheckerS. aureus and S. epidermidis strains. The results obtained for S. epidermidis are of interest, as studies on coagulase-negative staphylococci are still scarce.Many antimicrobial resistance mechanisms are well characterized and harbored by individual bacterial strains and clonal groups. Based on this and together with the results of susceptibility tests from the laboratory and pharmacological experience, patient treatment can be adequately designed. Nevertheless, the synergistic activity of combined molecules is not always understood  and it sS. aureus and 5 S. epidermidis. They were isolated in the intensive care unit (ICU) of the Hospital Cl\u00ednico San Carlos (HCSC), Madrid, Spain, from different clinical samples , amikacin and gentamicin , plazomicin , fosfomycin  and imipenem, meropenem and doripenem .5 CFU/mL of each bacterial strain to obtain a final volume of 100 \u00b5L per well. The MIC was defined as the lowest concentration that prevented growth after 18\u201320 h of incubation in ambient air at 37 \u00b0C. All tests were carried out in duplicate. The results were interpreted using clinical breakpoints as defined by EUCAST . To date, no breakpoints for plazomicin have been established by EUCAST, so FDA (Food and Drug Administration) values were used [The minimum inhibitory concentration (MIC) of each antibiotic was determined by the microdilution method in Mueller\u2013Hinton broth  . Serial ere used .5 CFU/mL in a 100 \u03bcL final volume, and the plates were incubated for 18\u201320 h at 37 \u00b0C. All tests were carried out in duplicate. Fractional inhibitory concentrations (FIC) were calculated for each combination, and the smallest FIC value was used to establish the antimicrobial combination interaction for each specific strain. The interpretation of the FIC index (FICI) was as follows: \u22640.5, synergy; >0.5\u20131.0, partial synergy; >1.0\u20134.0, indifference; and antagonism if >4.0. All the procedures were performed according to CLSI  [The checkerboard microdilution method was used to determine the in vitro activity of linezolid combined with amikacin, gentamicin, plazomicin, fosfomycin, imipenem, meropenem and doripenem. The range of drug concentrations used in the assay was such that the dilution range encompassed the MIC for each drug employed in the analysis, the highest concentration being 2\u00d7 MIC. Serial two-fold dilutions of each antibiotic tested were prepared and mixed in each well of a microtitre plate so that each row (and column) contained a fixed amount of one agent and decreasing amounts of the second agent. The final inoculum was approximately 10stitute) .5 CFU/mL and incubated in a shaking bath at 37 \u00b0C for 24 h. The antibiotic concentration used in the time-kill assays corresponded to 0.5-fold the linezolid MIC values when in combination with the steady state concentrations (SSCs) of the other antimicrobial compounds: amikacin, 32 mg/mL [S. aureus strain using different concentrations of plazomicin . Samples were taken at 0, 3, 6 and 24 h, serially diluted, spread on Mueller\u2013Hinton agar plates, and incubated at 37 \u00b0C for 24 h. The time-kill curves were constructed by plotting mean colony counts (log10 CFU/mL) vs. time. Kill curves and colony counts for each curve were carried out in duplicate. Synergy was interpreted as a \u22652 log10 decrease in CFU/mL by the drug combination when compared with the value from its most active drug alone [Tubes containing freshly prepared Mueller\u2013Hinton broth supplemented with the drug were inoculated with the staphylococcal isolates at a density of 1032 mg/mL ; gentami32 mg/mL ; plazomi32 mg/mL ; imipene32 mg/mL ; meropen32 mg/mL . Additioug alone ."}
+{"text": "Trichocera maculipennis, an invasive Diptera, was described for the first time in Antarctica in 2006 in a sewage system of one of the scientific stations on King George Island, South Shetland Islands, and started to increase its distribution within the island. To date, only taxonomical description of this species, based on morphological data has been available, as there were no molecular data recorded. In the present study, we present two methods of molecular identification of this species\u2014based on partial cytochrome c oxidase subunit I (COI) and 16S ribosomal RNA (16S) genes. An appropriate and easy-to-use assay for proper and fast identification of invasive species is a key requirement for further management decisions, especially in such a fragile environment as found in terrestrial Antarctica. Deschampsia antarctica and Colobanthus quitensis. Animal species are represented mostly by micro-invertebrates, and only two species of macro-arthropods, both chironomiid flies, Parochlus steinenii and Belgica antarctica , Arctowski Polish Station, data, collected from sewage system as described in [[CH]: Switzerland, cave, 2. Galerie Sieben Hengste-Hohgant, alt. 1486\u00a0m, 26.12.1986\u201329.12. 1987 ; female: Poland, cave [PL] Pod Sokol\u0105, 19.02.2018 . Trichocera  regelationis (L.), 1758, female, Poland, Ojc\u00f3w National Park, W\u0105w\u00f3z [gorge] Ska\u0142bania, 11.04. 1999 ; Trichocera  nordica Krzemi\u0144ska & Gorzka, 2014  Korytania, 19.11.1992 (coll. E. Krzemi\u0144ska). All specimens are housed in ISEA if not otherwise stated.Specimens of ribed in   sodium dodecyl sulphate (SDS), 40\u00a0mM dithiotreitol (DTT), 50\u00a0\u00b5g/ml proteinase K, 100\u00a0mM Tris buffer pH 8 and 100\u00a0mM NaCl; final concentrations) were added. The homogenates were incubated overnight at 55\u00a0\u00b0C. Specimens were removed from the buffer, placed in 1\u00a0ml 95% (v/v) ethanol and replaced in their respective collections. The lysates were then extracted 3 times with an equal volume of phenol:chloroform:isoamyl alcohol  until the interface was clear. Nucleic acids were precipitated by addition of 0.7 volume of isopropanol. Three micro litres of glycogen (20\u00a0mg/ml) was added during the precipitation step to improve DNA yields. Samples were incubated at room temperature for 20\u00a0min and centrifuged\u00a0using a MiniSpin Plus centrifuge \u00a0at 14,000\u00d7g for 15\u00a0min. The supernatant was then removed and the DNA pellet washed twice in 500\u00a0\u00b5l room temperature 80% (v/v) ethanol, allowed to air-dry at 37\u00a0\u00b0C, and resuspended in 50\u00a0\u00b5l low-TE buffer . After isolation DNA quantity was measured using Qubit 3.0 fluorometer  and High Sensitivity DNA quantification kit . DNA concentration was normalized to final concentration of 5\u00a0ng/\u00b5l. All reagents used in the purification step were molecular biology grade and were purchased from Sigma.DNA isolation from insects was carried out as described by Gilbert et al.  with minThe standard cytochrome oxidase (COI) fragment was amplified using the primer pair described by Folmer et al. :LCO1490: 5\u2032- GGTCAACAAATCATAAAGATATTGG-3HCO2198: 5\u2032- TAAACTTCAGGGTGACCAAAAAATCA-3'16S mtrRNA fragment was amplified with following primer pair:LR-N-13398: 5\u2032-CGCCTGTTTAACAAAAACAT -3\u2019LR-J-12887: 5\u2032-ACGCCGGTTTGAACTCAGATC-3\u2019described by Simon et al. .PCR products were amplified using KAPA Robust PCR kit . PCR reactions were carried out in 20\u00a0\u00b5l final volume consisting of: 4\u00a0\u00b5l of KAPA 2G A buffer, 0.4\u00a0\u00b5l of 10\u00a0mM dNTPs, 1U of KAPA Robust polymerase (5 U/\u00b5l), 0.5\u00a0\u00b5l of each primer (10\u00a0\u00b5M), 11.45\u00a0\u00b5l of PCR-grade water and 2\u00a0\u00b5l of DNA template (10\u00a0ng). Amplification reaction conditions for both sets of barcoding primers were as follows: 3\u00a0min of initial denaturation at 95\u00a0\u00b0C, followed by 38 cycles of 30\u00a0s at 95\u00a0\u00b0C, 20\u00a0s at 50\u00a0\u00b0C, 30\u00a0s at 72\u00a0\u00b0C, and final extension period of 2\u00a0min at 72\u00a0\u00b0C. The amplified products were visualized through agarose gel electrophoresis  and ethidium bromide staining. The amplicons were purified using EPPiC Fast kit  and directly sequenced with the same primers used for PCR amplification. Sanger sequencing was done using BigDye Terminator v3.1 chemistry and ABI3730xl genetic analyzer .Sequence data were analyzed using FinchTV ver. 1.4.0 . Consensus sequences were obtained with Seqman Pro ver. 9.1 software .The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model . EvolutiTrichocera species are given in Table Accession numbers for each novel nucleotide sequence of COI and 16S mtrRNA genes of the nad6 or cytb using primer sets designed for Diptera [Trichocera Barcode of Life Data system (BOLD) mitochondrial COI sequence (accession number KR386810.1) based on a BLAST comparison to the GenBank\u2122 database. The 16S mtrRNA gene fragment showed 99% similarity to Trichocera bimacula mitochondrium sequence (accession number JN861750.1). Sequences obtained are listed in Table Eight specimens were subjected to a manual DNA isolation procedure. PCR amplification of 16S mitochondrial rRNA fragment was successful for all eight of the tested samples. In the case of COI fragment PCR was successful only for six samples. In the case of the two remaining specimens, they did not produce a visible amplification product. Several attempts were made to analyze additional molecular barcodes such as  Diptera  but onlyMolecular phylogenetic analysis by Maximum Likelihood method for both sequences are presented at Figs.\u00a0Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value, using 1000 bootstrap. The highest log likelihood was . The tree is drawn to scale, with branch lengths measured in the number of substitutions per site (next to the branches). The analysis involved nine nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 526 positions in the final dataset.Initial tree for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value, using 1000 bootstrap. The highest log likelihood was . The tree is drawn to scale, with branch lengths measured in the number of substitutions per site (next to the branches). The analysis involved 11 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 513 positions in the final dataset.T. maculipennis gave a satisfactory output by each method used  based on which they were allotted previously to the regelationis group of species [Identification of ed Figs. , 2; the  species .The remaining portions of both trees are difficult to compare, due to the separate sets of specimens and species analyzed in each.Trichocera (Trichocera) major, a representative of a different subgenus [T. (S.) bimacula and T. (S). brevicornis, both similar to the species of the regelationis group; the former by spotted wings, the latter by male and female genitalia [T. (S.) nordica in the cluster is not so well supported by morphology of the genitalia.The inner outgroup species is subgenus ; its sisenitalia . The posT. (S.) bimacula, morphologically closely related to the maculipennis\u2009+\u2009regelationis complex, is located far on the COI-gene based tree.Based on morphological data the method based on 16S ribosomal RNA gene would appear to be more consistent. Trichocera specimens, including new species identification projects and assessments of molecular variation between different geographical locations.Results presented herein could provide an important reference for future studies on There were unfortunately some limitations to this study. The number of specimens collected for analysis was relatively small and our findings were potentially related to the limited number of specimens in collections. More extensive investigations with a larger number of samples are required for the future studies and for definitive findings to be made.The presented data is a response to the Committee for Environmental Protection (CEP) recommendations regarding development of a standardized monitoring program to effectively control the spread of the flies in Maritime Antarctica, and identify a practical and coordinated management response for fly eradication , 28. In"}
+{"text": "Tumor microenvironments are the result of cellular alterations in cancer that support unrestricted growth and proliferation and result in further modifications in cell behavior, which are critical for tumor progression. Angiogenesis and therapeutic resistance are known to be modulated by hypoxia and other tumor microenvironments, such as acidic stress, both of which are core features of the glioblastoma microenvironment. Hypoxia has also been shown to promote a stem-like state in both non-neoplastic and tumor cells. In glial tumors, glioma stem cells (GSCs) are central in tumor growth, angiogenesis, and therapeutic resistance, and further investigation of the interplay between tumor microenvironments and GSCs is critical to the search for better treatment options for glioblastoma. Accordingly, we summarize the impact of hypoxia and acidic stress on GSC signaling and biologic phenotypes, and potential methods to inhibit these pathways. Glioblastoma (GBM), also known as a World Health Organization grade IV astrocytoma, is the most common and aggressive primary brain tumor in adults. From 2012-2016, the average incidence of malignant brain tumors in the U.S. was 7.08 per 100,000, and GBM accounted for about 15% of all central nervous system tumors, and close to half of all malignant brain tumors diagnosed. GBMs have a disproportionate incidence rate by sex and race, occurring 1.58 times more often in males than females, 1.95 times more often in whites than blacks, and 2.39 times more often in whites than Asian or Pacific Islanders in vitro via neurosphere formation assays and the expression of molecular markers  in symmetric and asymmetric division studies A characteristic that tumor cells share with non-neoplastic stem cells is their ability to proliferate indefinitely. Accordingly, many tumors appear to be maintained via a hierarchical organization that consists of slowly-dividing stem cells, precursor cells, and differentiated cells Through genetic and epigenetic characterization, a number of adult GBM subtypes have been defined GSCs assist in establishing the tumor microenvironment through complex crosstalk within their niche. The two most commonly described niches in which GSCs have been characterized are the perivascular and the perinecrotic niches Other GSC-associated niches, the peri-hypoxic, peri-immune, and extracellular matrix niche are reviewed in-depth in Aderetti et al. 2) of 5-9 mm Hg and an acidic pH of 6.8 or lower 2, and ratio imaging to measure pH, have demonstrated these microenvironments occur independently Figure 1. As hypoxia and/or low pH correlate with many aspects of tumorigenicity, including therapeutic resistance, patient survival, and tumor invasion, understanding tumor microenvironmental effects on GBM growth and recurrence is critical A pathologic hallmark of GBMs, pseudopalisading necrosis, often occurs near a collapsed blood vessel, and tends to be surrounded by cells surviving in a hypoxic and often, acidic zone 2) and extracellular pH compared to non-neoplastic tissue, as well as the development of regions of extreme hypoxia and low pH in vitro experiments continue to be performed in atmospheric oxygen (~21% O2 or 159 mmHg) using buffered media to minimize pH changes  in vitro approaches, a shift towards improved modeling of physiologic microenvironments is desperately needed.The presence of hypoxia promotes the use of anaerobic glycolysis to generate energy and essential precursors (nucleic and amino acids as well as lipids) required for cell growth Hypoxia-responsive signaling in both tumors and nonmalignant tissue is mediated through transcription factors called hypoxia-inducible factors (HIFs). HIFs exist as heterodimers, consisting of an alpha and a beta subunit. The beta subunit is constitutively expressed in all cells, while the alpha subunit exists in three isoforms, which are unstable and rapidly degraded in the presence of oxygen Two well-characterized HIF alpha isoforms are HIF1\u03b1 and HIF2\u03b1. Suggesting that these two isoforms program distinct responses to changes in the microenvironment, HIF2\u03b1 expression can be stabilized at higher oxygen levels (approximately 5%) than the more severely hypoxic conditions , where HIF1\u03b1 is induced in vivo-like multicellular tumor spheroids derived from GBM short-term culture with tumor stem cell properties, indicating that tumor cell phenotypes associated with stemness and chemoresistance may depend on the oxygen tension surrounding that particular tumor cell as well as cellular interactions GSCs are identified using cell surface markers or cell selection techniques that take advantage of phenotypes increased in this cellular subset, with sorting or validation using GSC markers that can include CD133, OCT4, and SOX2 among others in vivoFigure HIF1\u03b1 and HIF2\u03b1 are both critical for GSC function and can be expressed in different patterns dependent upon the level of hypoxia as mentioned above. The stabilization of HIF1\u03b1 leads to the expansion of the GSC population within the bulk of the tumor, which is, in part, mediated by the extracellular signaling related kinase (ERK) and the PI3K/AKT pathways in vitro and decreased tumor growth in vivoUnder less extreme hypoxia, when HIF2\u03b1 is preferentially expressed in GSC populations, HIF2\u03b1 levels were regulated not only via post-translational modification but also through increased transcription in vivo, relatively few studies focus on the biological effects of acidic stress in GBM or other solid tumor cells. The extracellular pH of solid tumors including GBMs has been measured as low as 5.9 with an average pH of 6.8, whereas the normal brain pH is approximately pH 7.1 Extracellular< pHIntracellular), drugs altering proton export or production, and buffer therapies are being explored as novel treatments in vivo and improved the efficacy of immunotherapy Although low pH is recognized to be an important component of the tumor microenvironment and has been shown to exist in the absence of hypoxia Applying acidic stress to GBM cells upregulates VEGFA mRNA via the ERK1/2 and MAPK pathway, which enhances AP-1 binding to the VEGF promoter Acidic stress also promotes glioma stem cell phenotypes independently of hypoxia, but these may still involve HIF2\u03b1 expression. Exposure of GBM cells to acidic stress increased GSC marker expression as well as self-renewal and tumor growth CAIX and CAXII contribute to cellular growth by maintaining extracellular acidification and an alkaline intracellular pH in response to tumor acidosis in vivo, suggesting that this enzyme is active in the necrotic zones of GBM tumors Figure Acidic stress-induced changes in metabolism occur in GBM, and GSCs can adapt to different tumor microenvironments via shifts between glycolysis and oxidative respiration One of the most well-defined biological effects of hypoxia and HIFs in solid tumors including GBMs is the promotion of new blood vessel formation, or angiogenesis. While gliomas first support their growth by taking advantage of existing brain blood vessels in a process called vascular co-option, hypoxia will still ultimately occur as the tumor grows. A hypoxic microenvironment has also been linked to defective neovasculature, resulting in significantly poorer prognosis in vitro. Experiments with fluorescently labeled GSCs demonstrated that GSCs can incorporate into the vasculature of GBM xenografts. However, the lack of endothelial cells with common driver mutations present in GSCs suggests that transdifferentiation is very rare in human GBMs GSCs express VEGF receptor 2 (VEGFR2), permitting an autocrine loop of VEGF/VEGFR signaling that can become further activated with increased VEGF under hypoxia VEGF production may also be regulated by the pro-angiogenic chemokine CXCL12, also known as stromal cell-derived factor 1, in GSCs. CXCL12 is highly expressed in GSCs Solid tumor cells in a hypoxic niche contribute to tumor aggressiveness and metastases, with specific roles for cancer stem cells that can have epithelial-to-mesenchymal transition (EMT) phenotypes 3 Adenosine Receptor was demonstrated to promote the migration/invasion of GSCs via a HIF-2-dependent mechanism Hypoxia is an important modulator of GSCs in the context of epithelial to mesenchymal transition, which often leads to greater migration and invasion and ultimately, tumor recurrence The increased invasiveness of GBMs in hypoxic condition has also been linked to their enhanced hyaluronic acid production in vivo in abundance in areas of pseudopalisades, where glioma cells are actively migrating A recent study focused on the importance of recombination signal binding protein for immunoglobulin kappa J . CBF1 is a master transcriptional regulator of the notch signaling pathway and contributor of GSC maintenance as well as an important regulator of EMT in GSCs Chromatin remodeling regulates the GSC state as well as therapeutic resistance, and a rapidly developing area of interest is regulation of the epigenetic landscape by the hypoxic tumor microenvironment. While it is known that there are many epigenetic alterations that are involved in the initiation and progression of brain tumors, much less is known about how hypoxia contributes to these mechanisms. The discovery that expression of mixed-lineage leukemia 1 (MLL1), a histone methyltransferase specific for the lysine 4 methylation of histone H3, is increased in GSCs by hypoxic conditions has driven interest in this field. MLL1 enhances hypoxia response gene expression, including VEGF, by enforcing expression of HIFs, mainly HIF2\u03b1, in hypoxia In GSCs, there are also established roles for some Jumonji Domain-Containing proteins that modify histones and are known to be oxygen dependent. GSCs that survived kinase inhibitor treatment had differential H3K27me3 profiles, and the Jumonji Domain-Containing Protein 3 (JMJD3)/Lysine Demethylase 6B (KDM6B) was implicated in cellular maintenance Hypoxia and acidic stress also repress the epigenetic modifier chromodomain-helicase-DNA-binding protein 7 (CHD7) Although we have thus far focused on direct effects of hypoxia on GBM cells to regulate tumor growth, the tumor microenvironment also impacts GBM cells indirectly via paracrine effects mediated through nearby non-neoplastic cells. Under a hypoxic microenvironment, macrophages undergo phenotypic changes that activate the expression of mitogenic and proangiogenic cytokines and enzymes Macrophage migration inhibitory factor (MIF) is a type of cytokine released by leukocytes. MIF levels have been associated with immunosuppression as well as angiogenesis, cell differentiation, and cell proliferation in tumor cell lines Gliomas have been characterized as immunologically \u201ccold\u201d tumors that have a highly immunosuppressive microenvironment, particularly in terms of adaptive immunity. Using immunogenomic characterization data compiled by The Cancer Genome Atlas (TCGA), Thorsson et al. characterized these tumors as immunologically quiet and lymphocyte depleted, as the current understanding of immune activity in these tumors is that it is largely driven by monocytes and innate immunity The hypoxic microenvironment of GBMs has many effects that result in tumor cell resistance to chemotherapy and radiation. These include effects on DNA repair, DNA stability, ABC transporter expression, cell cycle checkpoint protein expression, and vasculature function. As a broad indicator of GSC survival in the hypoxic microenvironment, the CD133-positive GSC fraction are more resistant to apoptosis under hypoxia Changes in the ability to repair DNA in the hypoxia microenvironment lead to therapeutic resistance Cell surface transporter proteins are considered important mechanisms of drug resistance and are affected by hypoxia in GSCs. The ATP-binding cassette (ABC) transporters are a class of proteins that have a wide range of biological effects. These transporters promote therapeutic resistance by removing chemotherapy from the tumor cells, minimizing the time that the drugs have to be effective Hypoxic regions form when tumor cells lack proximity to a functional blood vessel leading to low oxygen tensions. Cells located at least 70 \u00b5m away from the nearest functional blood vessel do not receive adequate amounts of oxygen, leading to a conversion to a hypoxic cell state Table 1 and Figure 4) focused on improved imaging modalities that identify tumors by regions of hypoxia or acidosis. An innovative study synergized radiomic features in MRI scans and RNA expression data from hypoxia markers to generate a hypoxia enrichment score (HES) that was highly predictive of the survival of GBM patients in vivo have proven challenging to develop but have recently gained traction. Cutting-edge MRI techniques that highlight regions of acidosis are being developed as novel imaging tools to improve patient care and explore the pathophysiology of brain tumors Diagnostic monitoring of tumor progression post-resection can be complicated by ischemia, and there are a number of clinical trials  is an intracellular kinase that regulates cell growth and cell cycle progression via signaling from nutrients and growth factors Mitogen-activated protein kinase (MAPK) can be activated by stress signaling such as that resulting from hypoxia Nitro compounds, N-oxides, and quinones are bioreductive prodrugs that target the hypoxic tumor cells by being reduced by intracellular oxidoreductases in an oxygen-sensitive manner to form cytotoxins in vivoThe quinone mitomycin C (MMC) is activated under hypoxic conditions in tumor cells in vitro or that we still do not fully understand. It is of our opinion that more accurately modeling the tumor microenvironment in vitro and consideration of its links to differentiation state and therapeutic resistance will allow for more efficient transfer of novel therapeutics from in vitro studies to the clinic. In addition, added emphasis on targeting these microenvironments during therapeutic design may lead to desirable improvements in standard of care. Considering this, hypoxia and acidic stress are major micro-environmental stresses that occur commonly in GBM solid tumors. This is especially important when considering the GSC niche that can be found within hypoxic and acidic zones. Establishing efficient models of these microenvironments in vitro and targeting these in vivo to exploit resistant cell populations, i.e. GSCs, is of substantial importance when identifying novel treatment strategies to synergize with standard of care.Glioblastoma remains a formidable tumor that is notoriously difficult to prevent from recurrence, which contributes to abysmal survival in patients. Compared to solid tumors outside the brain, glioblastoma treatment is also more complex due to the presence of the blood-brain-barrier: development of certain types of treatment modalities is precluded without novel delivery methods that are able to circumvent the restrictions of the blood-brain-barrier. For example, many conventional chemotherapies and antibodies that target antigens in and on the surface of tumor cells have difficulty crossing an intact blood-brain-barrier, although there are antibodies that work well in the bloodstream without having to cross into the tumor . While the tumor associated blood-brain-barrier is remarkably fenestrated and is constantly being remodeled, the blood-brain-barrier in regions where invading tumor cells reside may be intact preventing eradication of the disease. Continual failures with novel treatment strategies suggest that there are major characteristics of these tumors that are not adequately being modeled for drug testing"}
+{"text": "Background: Chemsex is defined as using certain substances immediately before or during sexual activities to facilitate, prolong and/or intensify sexual experience, mainly by some communities of men who have sex with men (MSM). Four substances are typically associated with chemsex: methamphetamine, mephedrone, GHB/GBL, and ketamine. While there is a lot of evidence for increased prevalence of HIV, sexually transmitted infections and other sexual health measures among MSM, who engage in chemsex, there has been little research on mental health aspects. This study aims to describe aspects of mental health among a sample of German men who have sex with men (MSM) who engage in chemsex and to describe potentially adverse consequences of chemsex behavior.Method: This paper refers to a subset of participants from the German Chemsex Survey, an MSM-community recruited, self-completed online survey with a self-selected convenience sample. The survey comprised 420 different items considering recreational substance use, substance use in sexual settings, mental health, sexual transmitted infections, adverse consequences of chemsex behavior, and experiences of non-consensual sex acts. A group of participants who used methamphetamine, mephedrone, GHB/GBL, and/or ketamine in a sexual setting in the last 12 months  was analyzed regarding symptoms of depression (PHQ-9), general anxiety disorder (GAD-7), somatization (PHQ-15), and PTSD (Primary Care PTSD Screen). Group comparisons were conducted between the chemsex group and men who did not use substances in a sexual context . Mean scores of mental health measures were compared, as well as scores above a cut-off that indicates clinically relevant symptoms. Logistical regression was utilized to determine whether mental health measures can predict adverse consequences of engagement in chemsex behaviors.Results: A total of 1,583 men started the survey; 1,050 participants provided information on substance use. Twenty-seven percent of participants (n = 280) reported that they used methamphetamine, mephedrone, GHB/GBL and/or ketamine in a sexual setting in the last 12 months. The chemsex group showed significantly higher mean scores for depression, anxiety, and somatization than the non-chemsex group, but effect sizes were low. Even though mean scores were heightened, they were still far below the cut-off for clinically relevant symptoms. The chemsex group reported significantly higher incidences of non-consensual sex acts compared with the non-chemsex group. Some men in the chemsex-group experienced potentially adverse consequences, such as loss of control regarding time and money spent for chemsex activities or amount of substances used at one occasion (49.6%), negative impacts on social functioning (33.6%), psychotic symptoms (13.2%), and physically aggressive behavior toward others (2.9%). Clinically relevant symptoms did not predict a higher likelihood for adverse consequences.Discussion: Mean scores for depression, anxiety, and somatization were significantly higher in the chemsex-group, but effect sizes were low. Both groups reported poorer mental health compared to men in the German general population. Mental health measures did not contribute to predict potentially adverse consequences of chemsex behavior. Chemsex is defined as using certain substances immediately before or during sexual activity to facilitate, prolong, and/or intensify sexual experience mainly by some communities of men who have sex with men (MSM) . There aPrevious studies have shown that MSM who engage in chemsex show a variety of distinctive features regarding their sexual behavior and their sexual health, including a higher likelihood to be HIV positive than MSM who do not engage in chemsex \u20136, as weIn contrast, there has been considerably less research concerning the mental health status of MSM who engage in chemsex. Identifying as gay, bisexual or another non-heterosexual identity generally carries a higher risk for poor mental health compared to the general population, resulting in higher rates of depression and anxiety, suicide, and substance use disorders . This coEngagement with the LGBT community, found to be a contributing factor to overall well-being of LGBT people , 17, alsA recent study of 3,017 gay or bisexual MSM in Australia found no significant relationship between drug use in sexual settings and clinically relevant symptoms of depression or anxiety  . HoweverIn a survey of 1,649 MSM from the UK those who used drugs in sexual settings had lower overall life satisfaction than other participants, but no significant differences in body image satisfaction and psychological distress .Since a high rate of HIV infections is often found among MSM who engage in chemsex, the implications of an HIV-infection also have to be considered when determining their mental health status. HIV positive people experience a higher risk of poor mental health outcomes, particularly depression , 24. It To describe these complex interdependencies, Singer has proposed the model of syndemics , 26. ThiThe aim of this study was to examine the mental health of German MSM practicing chemsex. Up to now, no other European sample of men who practice chemsex has been studied in this regard. In addition, the evaluation of mental health is more comprehensive than in previous studies, including for the first time somatization symptoms and trauma measures. Eventually, experiences of non-consensual sex as well as adverse outcomes of chemsex practice were investigated, which have not been widely covered before.The \u201cGerman Chemsex Survey\u201d was a self-completed online survey (September until December 2018). It was targeted at MSM who use substances, particularly in a sexual setting, and was advertised accordingly. Participants were recruited via free-of-charge advertising on \u201cPlanetRomeo\u201d (the most popular German MSM-dating website/smartphone application), postings on LGBT-related websites and social media channels, as well as HIV/sexual health clinics. The sample was a self-selected convenience sample. To be included, participants had to be at least 18 years of age, identify as male, be attracted to and/or have had sex with men and have sufficient knowledge of German to be able to complete the survey. There was no financial compensation for participating. For this study, a subset of the collected data was analyzed. The aim was to describe and examine a group that practices chemsex, defined by the four substances most closely associated with chemsex. To determine whether certain characteristics are tied to engagement in chemsex, a non-chemsex group was identified for comparison.All data in the study was collected anonymously. Participants could withdraw from the study at any time. They were supplied with a list of drug counseling and sexual health support services at the end of the survey should their participation have raised questions or concerns. The Ethics Committee of the Medical Department of the University of Duisburg-Essen granted its approval for the study (number UDE-18-8209-B0).The survey consisted of 420 items covering demographic characteristics, recreational substance use, substance use in sexual settings, mental health, sexual behavior, sexually transmitted infections, social support, experiences of discrimination and stigmatization, internalized homonegativity, the \u201cbig five\u201d personality factors, harm reduction strategies, quality of life, and health care service utilization. Mental health was assessed using the German version of the Patient Health Questionnaire (PHQ-D)  with itsP-values of <0.05 were taken to indicate statistical significance. The analyses presented here compare two groups: (i) men who used at least one \u201cchemsex substance\u201d  in a sexual setting in the previous 12 months (n = 280); and (ii) men who did not report any substance use in sexual settings  in the previous 12 months (n = 177).Data analysis was conducted using IBM SPSS Statistics 25.0. U tests were used, since all tested attributes were not normally distributed. For significant results, effect size was calculated by Cohen's d. Chi-square tests were used to compare the distribution of categorical variables. For significant results, effect size was calculated by the Phi coefficient. To assess associations between psychopathology and adverse consequences after practicing chemsex, logistic regression models were conducted.For group comparisons regarding numerical variables Mann-Whitney-In total 1,583 people commenced the survey, 712 of whom completed all questions (45.0%). Data of non-completers were included on a pairwise basis, resulting in a different number of responses per analysis. Two hundred and eighty participants met the criterion of having used at least one of the four chemsex substances in a sexual context within the previous 12 months. One-hundred and five of the 280 men who reported chemsex (37.5%) dropped out at various points. Forty-four people from the 177 men who did not use any substances apart from alcohol and/or nicotine in a sexual setting also did not completely finish the survey (24.9%). See t-test showed that people in the non-chemsex group were significantly younger. Chi-square tests showed significant differences between the groups regarding country of birth, employment status and monthly net income. For employment status, a post-hoc test showed significantly more university students in the non-chemsex group. A post-hoc test for monthly net income showed that in the non-chemsex group there were significantly more people that earned < 1.000 Euros per month. All other attributes were evenly distributed.For details on the sample demographics for the chemsex and the non-chemsex group, see Eighty four participants from the chemsex group (30.0%) reported having injected at least one of the substances. For substance used in a sexual setting by the whole chemsex sample and by IV substance users see For an overview of all group comparisons, see n = 253) mean score on the PHQ-9 scale was 5.02 (SD = 4.14). 11.9% of the participants had a score of 10 or above and thus can be considered having clinically relevant depressive symptoms. PHQ-9 mean scores differed significantly in comparison to the non-chemsex group, with higher scores for the chemsex group. The groups did not differ regarding the distribution of clinically relevant symptoms.The PHQ-9 scale has a maximum score of 27, with higher scores indicating higher levels of depressive symptoms. The chemsex sample's (n = 242) mean score on the GAD-7 scale was 3.81 (SD = 3.79), and 8.3 % of the sample had a score of 10 or above, suggesting clinically relevant anxiety symptoms. GAD-7 mean scores were significantly higher in the chemsex group, the distribution of clinically relevant symptoms did not differ between the groups.The GAD-7 scale has a maximum score of 21, with higher scores indicating higher levels of anxiety symptoms. The chemsex group participants' (n = 252) PHQ-15 mean score was 5.14 (SD = 3.79), and 13.5% of the sample showed clinically relevant symptoms as indicated by a score of 10 or higher. There were significantly higher PHQ-15 mean scores in the chemsex group than in the non-chemsex group. The groups did not differ regarding the distribution of clinically relevant symptoms.The PHQ-15 scale has a maximum score of 30, with higher scores indicating higher levels of somatization symptoms. The chemsex sample's (n = 237) reported experiencing at least one potentially traumatizing event from a list of twelve. Most commonly, these were a serious accident (36.9%), a life-threatening illness (36.4%), physical violence from an unknown person (36.9%) or physical violence from a known person (34.3%). The mean number of events experienced by the chemsex group was 1.87 (SD = 1.70), and 11.6% show clinically relevant symptoms of PTSD, as indicated by a score of 3 or above in the PTSD primary care screener. Participants from the chemsex group reported having experienced a traumatic event significantly more often than those from the non-chemsex group. The groups did not differ regarding the distribution of clinically relevant symptoms of PTSD.76.8% of all the chemsex group (n = 251) reported having planned for suicide at least once in their lifetime, 9.6% had actively attempted suicide at least once. The groups did not differ regarding suicide plans or attempts.12.7% of participants from the chemsex group (n = 233), 47.2% reported having experienced their sexual partners not respecting their boundaries, which differs significantly from the non-chemsex group . 15.5% of men engaging in chemsex (n = 233) reported the experience of violence in a sexual setting, which is not significantly different from the non-chemsex group . 17.7% of the chemsex group (n = 234) reported that sexual partners had administered drugs to them without their consent.In the chemsex group (n = 199) reported being HIV positive, 2.0% reported being infected with hepatitis C. Significantly more men from the chemsex group were HIV-positive than those from the non-chemsex group. There were no differences for the rates of unknown current HIV-status between the groups, as for the rates of hepatitis C-infections.41.2% of the chemsex group (n = 280) reported a loss control during or after a chemsex session in the last 12 months, meaning that they either spent more time or money on chemsex than they originally intended or that they could not entirely remember the event. 33.6% stated that they have been missing work or other appointments after a chemsex session or that they were still under the influence of drugs when working. 13.2% reported hearing voices or having paranoid experiences after engaging in chemsex. 2.9% have assaulted another person as an after-effect of a chemsex session.49.6% of participants from the chemsex group , 0.092 (missing work or other appointments), 0.078 (hearing voices or having paranoid experiences), and 0.056 (spending more time or money or loss of memory). In all models, only two predictors turned out to be significant: clinically developed somatization symptoms predicted assaults  and anxiety symptoms predicted missing work or other appointments or going to work while still under the influence of drugs .Logistical regression analyses were conducted to determine whether those who show clinically relevant symptoms of depression, anxiety, somatization or PTSD are more likely to show any of the adverse consequences. For each model, the adverse consequence was taken as the outcome variable with the clinically developed symptoms as dichotomous predictors. None of the models showed a good fit, with Nagelkerke's With regard to mental health measures, a direct comparison of the chemsex and non-chemsex group, found significant differences for the mean scores of depression, somatization, and anxiety, as well as lifetime number of traumatic events experienced, which were all higher for the chemsex group. No differences between the groups for the rates of clinically developed symptoms were found. Those who practice chemsex reported significantly more incidences of violation of their sexual boundaries as well as a higher rate of HIV infections, compared to those who do not practice chemsex.All mean scores of mental health measures were significantly higher for the chemsex group, but these differences show only small effect sizes, pointing to a weak interrelation. Comparing the distribution of clinically relevant symptoms between the different groups, there were no significant differences.The prevalence rate of 11.9% for clinically relevant symptoms of depression in the chemsex group is almost twice that of the general male population in Germany (6.1%) , but comThe number of lifetime suicide attempts reported by those engaged in chemsex was 9.6%. A recent study from Sweden found a percentage of lifetime suicide attempts for gay men of 10.0%, whereas merely 2.2% heterosexual men attempted suicide in their lifetime . In concWe can observe some strain on those who practice chemsex compared to those who do not, as suggested by heightened mean scores for depression, somatization and trauma events. However, these differences are not reflected in the rates of clinically relevant symptoms. Overall, it seems that the chemsex group does not differ much from other MSM groups that aren't solely comprised of men who engage in chemsex. Previous research has suggested a complex interplay between substance use, sexual behavior and mental health measures, with various factors impacting on and influencing each other. There is no information about the sample's rate on substance dependency, which has a negative impact on mental health . The ratIt has also been shown that those who practice chemsex have closer ties to the LGBT community than other MSM , 19, 42,About half of the participants that practice chemsex have experienced a loss of control during or after a chemsex session in the last 12 months, meaning that they either spent more time or money on chemsex than they originally intended or that they could not entirely remember the event. This adverse outcome could not be predicted by clinically developed symptoms of depression, anxiety, somatization, or PTSD. About a third stated that they have been missing work or other appointments after a chemsex session or that they were still under the influence of drugs when working. Clinically developed symptoms of anxiety showed to be a significant predictor for this outcome. About one in ten men reported hearing voices or having paranoid experiences after engaging in chemsex. This outcome could not be predicted by any clinically developed symptoms. Three percent of participants have assaulted another person as an after-effect of a chemsex session. This outcome could be predicted by clinically developed symptoms of somatization.Overall, all models predicting negative outcomes showed low models-of-fit. Even though two significant predictors could be identified, the results have to be interpreted cautiously, since the rates of clinically relevant symptoms for all measures were lowly pronounced in this particular group, so the distribution is uneven. The rates of the adverse outcomes of assaulting someone and having paranoid experiences or hearing voices were also quite unevenly distributed, which further limits the models' explanatory power.46.6% of chemsex users report non-consensual acts during sex, and violence during sex was experienced by 16.8%. Significantly more experiences of non-consensual acts were reported in the chemsex group compared to the non-chemsex group, of which 28.0% reported such incidents. A small effect size shows for this result. There were no significant differences regarding the experience of violence during sex for the different groups. A recent study from the UK that chose a similar sampling approach as this study, recruited MSM participants via Grindr, a dating app that is often used by MSM to find sex partners . Of thesAccording to a recent study the experience of non-consensual sex is far more common for MSM, with a rate of 22.8%, compared to 4.3% of men that have sex exclusively with women .The study by Bourne et al. from 2014 regarding chemsex in the UK found anecdotal evidence of non-consensual sex associated with substance use, particularly in cases that men had accidentally overdosed. Interviewees in this study reported that there \u201cwas a particularly blurry line regarding consent in the context of chemsex\u201d [, so the high HIV rate in the sample might be a sampling effect. The study was targeted at substance users and advertised, respectively, so drug use was high overall throughout the sample and the findings should not be used to estimate a prevalence of substance use in the German MSM population.Even though not all users reported consuming in a sexual setting, the identified non-chemsex group that did not practice sexualized drug use may still not be comparable to other non-chemsex MSM samples. There have also been found some demographic differences between the groups, which could put some restrictions on the comparison between the chemsex group and the non-chemsex group. The non-chemsex group was found to be younger with a higher rate of university students and people with low income. There were also more people not born in Germany in the chemsex sample. Since there was a dropout rate of 37.5% in the chemsex group and 22.2% in the non-chemsex group and all demographic data was retrieved at the very end of the study, there might be a bias concerning the demographic data.For future research, it would be useful to study a more diverse group in terms of socio-economic status. Additionally, more research would be necessary to determine complex interrelations between the different factors, in order to assess which are risk factors for poor mental health, and in which situations. Another topic that would be useful to explore and study further is the relation between chemsex and non-consensual sex.Support and treatment options for MSM who practice chemsex and want to reduce or quit their substance use are sparse so far. In previous studies, men have reported a hesitancy to attend regular drug counseling services or programs out of fear not be understood . There iThe datasets generated for this study are available on request to the corresponding author.The studies involving human participants were reviewed and approved by Ethics Committee of the Medical Department of the University of Duisburg-Essen, approval nr. UDE-18-8209-B0. The patients/participants provided their written informed consent to participate in this study.AB article writing, data analysis, and literature search. HS study conceptualization, data analysis, and article writing. FO survey programming and data analysis. DS study conceptualization. TK consulting data analysis. NH and NS editing article. DD study conceptualization and editing article. All authors contributed to the article and approved the submitted version.NS received honoraria for several activities  by AbbVie, Hexal, Janssen-Cilag, MSD, Medice, Mundipharma, Reckitt-Benckiser/Indivior, and Sanofi-Aventis. During the last 3 years, he participated in clinical trials financed by the pharmaceutical industry. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "This study explored the impact of gold nanoparticles on the metabolic activity and morphology of human pulmonary endothelial cell monolayers. We developed a gold nanoparticle library of three different sizes and two surface chemistries that include anionic citrate and the cationic polyelectrolyte poly. The nanoparticles were characterized in cell culture medium to assess how their physical properties are altered after exposure to biological fluids. A bovine serum albumin pretreatment protocol was developed to stabilize the nanoparticles in cell culture medium. Results of this study show that an 18\u00a0h exposure of human pulmonary artery endothelial cells to the different nanoparticles modestly affects cellular metabolic activity. However, nanoparticle exposure perturbs the cortical actin networks and induces the formation of intercellular gaps. In particular, exposure to the poly-coated particles reduces the area of cell\u2013cell junctions\u2014a change that correlates with increased leakiness of endothelial barriers. The presence of excess polyelectrolyte capping agents in the supernatant of poly-coated nanoparticles significantly impacts endothelial morphology. Pretreatment of the particle supernatant with bovine serum albumin mitigates the negative effects of free or bound polyelectrolytes on endothelial cell monolayers. Many applications of NPs are already in the clinic, including drug carriers, imaging agents, and photothermal therapeutics10. Outside of these applications, NPs in the environment are a subset of particulate matter (PM) with a diameter of less than 2.5 microm (PM 2.5), and have shown adverse effects on human health, especially in the lung13. Following inhalation, these NPs can penetrate into lung tissue, at times causing inflammation and oxidative stress15.The increased use of nanoparticles (NPs) in a wide range of applications including antimicrobial agents16. Endothelial cells that line the vasculature not only act as a barrier between blood and the surrounding tissue, but also restrict entry of NPs into the bloodstream. Specifically, lung alveoli are surrounded by vascular endothelial cells, and NPs must cross this bilayer of cells to enter the circulatory system. Several prior studies have reported observations regarding the effect of NPs on cell biology. Lin et al. highlights that NPs interrupt the epithelial cellular barrier by disrupting intercellular junctions17. Ma et al. reported endothelial cell morphology changes that are induced by NP treatment18. Liu et al. concluded that changes in actin morphology following NP treatment result in endothelial barrier dysfunction19. In addition, NP induced morphological changes correlated with increased vascular leakiness have been reported by Setyawati et al.20 Endothelial cell\u2013cell junctions require vascular endothelial (VE)-cadherin adhesion molecules linked to the actin cytoskeleton of each cell21. Disruption of these VE-cadherin junctions results in leakage across this barrier. Recent studies focused on the impact of NPs on endothelial barrier leakiness due to the disruption of these VE-cadherin interations22. The NP induced leakage is a possible route for undesired paracellular transport of inhaled NPs to the circulatory system. Moreover, others have designed NPs as tools to facilitate endothelial leakiness for controlled drug delivery23. In contrast, work reported here focuses on the potential impact that environmental exposure to NPs can have on human tissue.Whether NPs enter the body through inhalation or intravenous administration, the circulatory system will be one of the first barriers with which NPs interact24. The NP aggregation state can be altered in the presence of biomolecules \u2013 for instance, proteins have been found to stabilize colloidal NPs, while protein-free biological fluids induce NP aggregation25. Linse et al. defined the presentation of proteins on a particle surface as the protein corona26. While coating NPs with a protein corona can lead to off target or undesired biological responses, Chen et al. were the first to develop a pre-formed protein corona to achieve safe biomedical and environmental effects of ZnO NPs29. Therefore, developing processing protocols for maintaining NP colloidal stability in complex biological media is desirable.Importantly, exposure to biological fluids alters the physical properties of NPs, due to the adsorption of proteins and other biological macromolecules present in biological fluids31, as well as our ability to tune their size, shape, and surface chemistry. Outlining a bovine serum albumin (BSA) pretreatment protocol, we developed pre-formed protein coronas to stabilize AuNPs in biological media. Overall, this study compares the effects of NP surface coating, size, and dose on the metabolic activity, cytoskeletal organization, and morphology of pulmonary endothelial cells.To reveal the environmental impact of NPs on the human lung, we report the acute impact of gold nanoparticles (AuNPs) on the metabolic activity of primary, human pulmonary artery endothelial cells (HPAECs) and on the endothelial monolayer integrity. We chose AuNPs as a standard due to their well-characterized optical and photothermal propertiesWe built a AuNP library to study how AuNP dose, size, and surface chemistry affect the metabolic activity and morphology of HPAECs. We investigated three AuNP sizes with either of two surface coatings, citrate or poly (PAH) Fig.\u00a0. We thenAfter synthesis, a broad range of methods was used to characterize the NPs in aqueous solutions and in cell culture medium. Data were collected from AuNPs in water and AuNPs in 50/50 medium with and without BSA pretreatment. UV\u2013Vis-NIR spectra of citrate-coated AuNPs (citrate-AuNPs) and triple-coated PAH AuNPs (PAH-AuNPs) are shown in Fig.\u00a033. Compared to 18-nm NPs, citrate-AuNPs of 40\u00a0nm aggregated less when directly added to the 50/50 medium. Their average hydrodynamic size increased slightly from 103.9\u2009\u00b1\u20090.8\u00a0nm to 129.9\u2009\u00b1\u20092.5\u00a0nm without BSA pretreatment. There was a minor peak present in addition to the maximum plasmon band in the UV\u2013Vis-NIR spectrum , and then were suspended in 50/50 medium. The characterizations of NPs with different sizes were done in different concentrations in order to keep all NP absorbance of UV\u2013Vis-NIR spectra the same. The concentrations used for 18, 40 and 80\u00a0nm of AuNPs were 0.80, 0.030, and 0.0063\u00a0nM, respectively. All NP characterizations, including hydrodynamic sizes, zeta potentials and UV\u2013Vis-NIR spectra were collected by this way. Table p\u2009=\u20099.2\u2009\u00d7\u200910\u22124 relative to the control, KWANOVA). Exposure to 80\u00a0nm citrate-AuNPs decreased the metabolic activity to 92\u2009\u00b1\u20092% . Many papers have shown size-dependent nanoparticle uptake, with 40\u201370\u00a0nm having higher rates of endocytosis than smaller particles, which may explain these results34. Overall, exposure to 40 and 80\u00a0nm citrate-AuNPs did have a statistically significant effect on HPAEC metabolism, but the decrease was modest, compared to the control.The effect of an 18\u00a0h AuNP exposure on the metabolic activity of HPAECs was determined with the MTT assay. As outlined in the Methods sections, background subtraction was utilized for all conditions to account for NP interference in the colorimetric MTT assay. Reported results are normalized to the control (no AuNP treatment). HPAECs were exposed to 40\u00a0\u00b5g/mL of citrate-AuNPs with diameters of 18, 40, and 80\u00a0nm. The 18\u00a0nm, citrate-AuNPs had no observed effect on HPAEC metabolic activity, compared to the control, with the metabolic activities being 102\u2009\u00b1\u20092% and 100\u2009\u00b1\u20091% respectively Fig.\u00a0a. Comparp\u2009=\u20097.9\u2009\u00d7\u200910\u20133 relative to the control, KWANOVA). Exposure to 40\u00a0\u00b5g/mL of 40\u00a0nm, citrate-AuNPs\u2014did have a statistically significant effect on HPAEC metabolism, but the decrease was modest, compared to the control.To study how AuNP doses affect HPAEC metabolism, 5 to 40\u00a0\u00b5g/mL of 40\u00a0nm, citrate-AuNPs were used Fig.\u00a0b. At conp\u2009=\u20097.9\u2009\u00d7\u200910\u20133 relative to the control, KWANOVA), while BSA-citrate-AuNPs decreased the metabolic activity only slightly to 97\u2009\u00b1\u20092%. BSA-PAH-AuNPs and PAH-AuNPs, at a concentration of 16\u00a0\u00b5g/mL, did not have statistically significant impacts on metabolic activity, with viabilities being 101\u2009\u00b1\u20093% and 96\u2009\u00b1\u20092%, respectively. We attribute the citrate-AuNP and PAH-AuNP modest impact on endothelial metabolic activity to the knowledge that bulk gold is chemically inert and safe at low doses35. Similarly, Liang et al. showed that treating human umbilical endothelial cells with 50\u00a0nm AuNPs did not decrease cell viability at low doses18. Overall, the data from HPAECs treated with citrate-AuNPs and PAH-AuNPs, with and without BSA pretreatment, suggest that 18\u00a0h AuNP treatment has modest effects on cell metabolic activity.Next, we studied the effect of surface chemistry and BSA pretreatment of 40\u00a0nm AuNPs on the HPAEC metabolic activity Fig.\u00a0c,d. Comp37. We thus used centrifugation38 to remove the free polymers after coating the AuNPs. Following centrifugation, the amount of PAH in the supernatant of PAH-AuNP preparations was determined to be 0.4\u2009\u00b1\u20090.2\u00a0mg/mL. We tested the impact of the PAH-AuNP supernatant on metabolic activity. We also tested how the free polyelectrolytes affects cell metabolic activity, by exposing cells to solutions of comparable PAH concentrations. Similarly to the AuNPs, we treated the supernatant and the free PAH solution with the BSA pretreatment. Like the PAH-AuNPs, the supernatant had no impact on the HPAEC metabolic activity  and to 4.5\u2009\u00b1\u20090.4% , respectively. In summary, although the PAH-AuNP supernatant had no impact on metabolic activity, the free PAH negatively impacted cell metabolism.The LBL technique used to wrap the AuNPs requires an excess of polyelectrolytes; however, free polyelectrolytes can be cytotoxic39. This cortical actin remodeling is more pronounced following PAH- and BSA-PAH-AuNP treatment, compared to citrate- and BSA-citrate-AuNP treatment. Taken together, our findings indicate that, although the different NP preparations used in this study only modestly alter metabolic activity of endothelial cells, AuNP exposure alters the actin organization and interendothelial integrity, as assessed by the radial actin fibers and prevalence of intercellular gaps. These results are in agreement with prior work by others. For example, Ma et al. reports human umbilical vein endothelial cell morphology changes induced by polymer-coated, anionic AuNP (Au-PMA NPs) treatment18. Similarly, Wang et al. report that negatively charged AuNPs target human microvascular endothelial cell junctions40. And Liu et al. conclude that changes in actin morphology following AuNP treatment result in human umbilical vein endothelial cell barrier dysfunction19.Next we investigated the changes in cell morphology upon exposure of HPAECs to 40\u00a0nm, citrate- (40\u00a0\u00b5g/mL) and PAH- (16\u00a0\u00b5g/mL) AuNPs, with and without BSA pretreatment. We chose to study the impact of 40\u00a0nm AuNPs on endothelial morphology because 40\u00a0nm AuNPs had the greatest impact on metabolic activity (vide supra). In addition, we established protocols for BSA pretreatment for 40\u00a0nm AuNPs. After 18\u00a0h of treatment with AuNPs, AuNP uptake correlated with cytoskeletal remodeling . This decrease in VE-cadherin area may indicate increased endothelial permeability43. Similarly, work by Setyawati et al. focused on the impact of titanium dioxide nanomaterials on human microvascular endothelial cells barrier leakiness by disrupting VE-cadherin interations.22 Other work has shown that barrier dysfunction induced by AuNPs is dependent on the NP size44. Our findings that PAH-AuNPs reduced pulmonary endothelial cell junction areas, indicative of reduced barrier function, are consistent with these other reports that AuNPs can increase vascular leakage.As mentioned in the Introduction, VE-cadherin is an intercellular adhesion molecule that localizes to cell\u2013cell contacts and regulates actin organization at cell\u2013cell junctions.rea Fig.\u00a0a. Repres.\u00a02 Fig.\u00a0b,c. Citr.\u00a02 Fig.\u00a0b. BSA-PA2 , while treatment with supernatant reduced the junction area to 1\u2009\u00b1\u20091 \u00b5m2  and thus completely disrupted the cell monolayer. Similarly, the HPAECs treated with the BSA-PAH exhibited a decrease in junction area to 300\u2009\u00b1\u200970 \u00b5m2 , while the PAH treatment resulted in a decrease in junction area to 13\u2009\u00b1\u20097 \u00b5m2 . Interestingly, the BSA pretreatment of both the supernatant and soluble PAH led to increased junction area per field, compared to untreated supernatant. This finding suggests that the formation of complexes between PAH and BSA-FAF/FBS proteins46 reduces the negative effects of free polyelectrolytes, and in particular of free PAH. Work by Ball et al. shows that PAH and BSA interactions are endothermic resulting in enthalpically driven binding and the formation of large coacervate complex structures45. Furthermore, excess cytotoxic polyelectrolyte (PAH) in the PAH-AuNP supernatant negatively impacts endothelial cells, but BSA pretreatment can mitigate those negative impacts by forming complexes with the otherwise toxic PAH in the PAH-AuNP supernatant.The PAH-AuNP supernatant also induced a significant decrease in the junction area Fig.\u00a0c. RepresOur results show that exposure of primary vascular endothelial cells with citrate- or PAH-AuNPs results in cortical actin remodeling and an increase in intercellular gap formation. These morphological effects are more prevalent following PAH-AuNP treatment compared to citrate-AuNP treatment. With this we conclude that the morphological effects resulting from PAH-AuNP treatment are mainly attributed to excess polyelectrolyte capping agent present in the supernatant of the PAH-AuNPs, rather than to effects of the AuNPs itself. While AuNP treatments alter cell morphology on varying degrees, AuNPs only modestly affect endothelial metabolic activity. If we extrapolate to the organism level, our results suggest that exposure of the lungs with AuNPs may lead to undesired endothelial permeability from the circulatory system to surrounding lung tissue. However, the here-introduced BSA pretreatment is used to improve AuNP colloidal stability in biological cell medium, as well as to mitigate the negative effects of the polyelectrolytes on endothelial cells. An interesting avenue of research that we are currently pursuing is to determine the impact of AuNPs on the permeability of co-cultures of lung endothelial and differentiated epithelial cells.4 3H2O, \u2265 99.9%), sodium citrate tribasic dihydrate  hydroquinone (\u2265 99%), poly , poly solution , fluorescamine (\u2265 98%), fetal bovine serum (FBS), bovine serum albumin-fatty acid free , bovine serum albumin (BSA), Triton X-100, and 4\u2019,6-diamidino-2-phenylindole, dihydrochloride (DAPI) were purchased from Sigma-Aldrich . Sodium chloride (ACS grade) was acquired from EMD Chemicals . Acetonitrile (\u2265 99.9%) and hydrochloric acid were purchased from Fisher Chemical . 3--2,5-diphenyltetrazolium bromide (MTT assay), 48-well BioLite plate, Dulbecco\u2019s Modified Eagle Medium phenol-red-free (DMEM), Rhodamine Phalloidin, and ProLong Gold antifade mountant-was purchased from Thermo Fisher Scientific . Human pulmonary artery endothelial cells and endothelial cell growth medium-2 (EGM-2) were from Lonza , while small airway differentiation medium (PneumaCultTM-ALI) was purchased from Stemcell Technologies . Immunostaining antibodies vascular endothelial (VE)-cadherin (C-19) goat polyclonal IgG antibody, donkey anti-goat IgG-CFL 647 were from Santa Cruz Biotechnology, Inc . Phosphate buffered saline (PBS) solution and 96 well plate , proteomics grade sodium dodecyl sulfate , #1.5 German cover glass , and #1 Micro coverglass\u201412 mm diameter  were obtained from their respective manufacturers. All chemicals were used as received without further purification. Glassware was cleaned by aqua regia (a mixture of nitric and hydrochloric acids with a molar ratio of 1:3) and then water prior to synthesis. Water with a resistivity of 18 M\u03a9 * cm (ultrapure water) was used for NP solution preparation and synthesis.Chloroauric acid  HAuCl4\u00b73H2O was prepared. Next, the solution was stirred and brought to a rolling boil. Once the solution was boiling, 3.6 mL of 1.0 wt% sodium citrate was added. The temperature of the solution was reduced to prevent further boiling, but the solution was continuously heated for an additional 10 min. After 10 min, the heat was turned off and the solution was cooled naturally to room temperature (~ 1 h). To purify the AuNP seeds, the solution was centrifuged at 11,000\u00d7g for 20 min. The supernatant was removed, and the pellet was dispersed in ultrapure water.Larger AuNPs were synthesized by a seed-mediated growth method developed by Perrault and Chan.4\u00b73H2O, and 0.030 M hydroquinone were freshly prepared. First, 1.0% (w/v) HAuCl4 3H2O was centrifuged at 18,000\u00d7g for 60 min to remove any aggregates present in the solution. The supernatant was collected for further use and the pellet was discarded. Next, a growth solution containing 10 mL of 1.0% (w/v) HAuCl4\u00b73H2O and 0.95 L of ultrapure water was prepared, and the solution was stirred rapidly at room temperature. Hydroquinone-reduced AuNPs with diameters of ~\u00a040 and ~\u00a080 nm were obtained by varying the amount of gold seeds added to the growth solution. To synthesize ~\u00a040 nm diameter AuNPs, 36 mL of 1.7 nM of the gold seed solution, 2.2 mL of 1.0 wt% sodium citrate and 10 mL of 0.030 M of hydroquinone were added in sequence to the growth solution and the solution was kept stirred for ~\u00a040 min. After 40 min, the solution was centrifuged at 5,000\u00d7g for 20 min. The supernatant was removed, and the pellet was dispersed in ultrapure water. AuNPs of ~\u00a080 nm diameter were prepared by the same procedure described above, except for a few differences: 8.0 mL of 1.7 nM of the gold seed solution was added to the growth solution, the growth solution was stirred for 60 min, and the growth solution was centrifuged at 1,000\u00d7g for 20 min. All particles were passed through surfactant-free, 0.22-\u00b5m filters prior to cell studies.To make hydroquinone-reduced AuNPs with diameters of ~\u00a040 and ~\u00a080 nm, aqueous stock solutions of 1.0% (w/v) HAuCl50 To deposit the first layer of PAH onto ~\u00a040 nm citrate-AuNPs, a solution of 0.010 M NaCl and 10 mg/mL of PAH (1:2 in volume) was prepared. For an 1 mL scale polyelectrolyte wrapping, 0.3 mL of the NaCl and PAH solution was added to 0.90 mL of 0.1 nM AuNPs and the solution was gently shaken for 2 h. Following the 2 h incubation, the solutions were centrifuged at 4,900\u00d7g for 20 min. The supernatant was removed, and the pellet was dispersed in 0.81 mL of ultrapure water. Then, the deposition of PAA was initiated by adding 0.54 mL of 0.010 M NaCl and 10 mg/mL of PAA (1:2 in volume) to 0.81 mL of AuNPs. The solution was gently shaken for 2 h. After 2 h incubation, the solution was centrifuged at 4,900xg for 12 min. The supernatant was removed, the pellet was dispersed in 0.90 mL of ultrapure water. The procedure was repeated to prepare the final PAH layer: 0.30 mL of the mixed NaCl and PAH solution was added to 0.90 mL of AuNPs and the solution was gently shaken for 2 h. After 2 h incubation, the solution was centrifuged twice at 4,900\u00d7g for 12 min twice. The supernatant was removed, the pellet was dispersed in ultrapure water. All particles were passed through surfactant-free, 0.22-\u00b5m filters prior to cellular studies.Positively charged, PAH-AuNPs were prepared by our previous method with the following modifications.38 to quantify the amount of free PAH in the AuNP suspension using a fluorescence assay. Fluorescamine, a non-fluorescent compound, produces fluorophores when reacting with primary amines. To establish a calibration curve to determine the amount of PAH present in the AuNP suspension, 0.1% (w/v) of fluorescamine in acetonitrile and an aqueous standard solution of 0.2 mg/mL of PAH were prepared. Aliquots of 20-100 \u00b5L of 0.2 mg/mL of PAH were added to a 96-well microplate and each well was diluted with ultrapure water to 120 \u00b5L. Then, 120 \u00b5L of ultrapure water was added to each well. The supernatant isolated from 40 nm PAH-AuNPs was diluted to 10 times by ultrapure water and 120 \u00b5L of the diluted supernatant was added to each well. All wells were prepared in triplicate. Next, 60 \u00b5L of 0.1% (w/v) of fluorescamine was added to each well. After 15 min incubation at room temperature, the fluorescence intensity was determined by a fluorescence plate reader with Eex/Eem\u00a0=\u00a0425 nm/480 nm. We used ultrapure water as a negative control to correct the fluorescence intensity of the standard PAH solutions and the AuNP supernatant.The supernatant from the second run of centrifugation was used to quantify free PAH present in the 40 nm, PAH-AuNP suspension (synthesis described above) and served as a free polyelectrolyte control for cell studies. We modified the procedures developed by Qiu et al.TM-ALI Complete Base Medium)), AuNPs were first incubated with bovine serum albumin-fatty acid free  in 20 mM HEPES buffer) at room temperature. Citrate-AuNPs were incubated with 1% (v/v) of BSA-FAF and PAH-AuNPs were incubated with 5% (v/v) of BSA-FAF. After 45 min incubation, 1% (v/v) of fetal bovine serum (FBS) was introduced to the solution and followed by another 45 min incubation. Finally, 50/50 medium was added to the incubated AuNPs to make the desired AuNP concentration. The mixture of AuNPs and 50/50 medium was used in the following experiments after at a least 1 h incubation. All solutions were used within the same day of preparation. This stabilization protocol worked for citrate-AuNPs of all sizes and tested for concentrations between 5 and 40 \u00b5g/mL. For 40 nm PAH-AuNPs, the stabilization protocol worked for concentrations between 5 and 16 \u00b5g/mL. Following BSA pretreatment, AuNPs, citrate-AuNPs, and PAH-AuNPs are abbreviated as BSA-AuNPs, BSA-citrate-AuNPs, and BSA-PAH-AuNPs.To prevent destabilization of AuNPs in 50/50 medium  FBS) and 50% epithelial differentiation medium .Hydrodynamic diameters and zeta potentials of AuNPs were determined with a ZetaPALS Particle Size and Zeta Potential Analyzer . UV\u2212Vis\u2212NIR spectra were measured with a Cary 5000 UV\u2212Vis\u2212NIR spectrophotometer . TEM of AuNPs was collected by a JEOL 2010 LaB6 or a JEOL 2100 Cryo electron microscope . Average core diameters of AuNPs were determined by ImageJ software . At least 300 particles were counted to determine the diameters of AuNPs. The fluorescence intensity of the fluorescamine assay was determined by Tecan Infinite\u00a02 and passaged every 2\u20133 days. HPAECs between passages 7\u20139 were used for all experiments.Primary HPAECs were cultured in complete endothelial cell growth medium EGM-2 with 10% (v/v) FBS in a humidified incubator at 37 \u00b0C with 5% COTM-ALI Complete Base Medium); referred to as 50/50 medium. 50/50 medium was chosen, instead of pure endothelial growth medium, because the BSA pretreatment protocols were developed for further AuNP barrier studies with co-cultures of lung endothelial and epithelial cells.Exposure of HPAECs to AuNPs was achieved by incubating cells with the medium consisting of a mixture of equal parts of endothelial culture medium  FBS) and epithelial differentiation medium (PneumaCult51. HPAECs (passage 7\u20139) were seeded at a density of 20,000 cells/well in culture medium. On day 2 when HPAEC layer was visually confluent under Nikon Eclipse TS100  microscope, AuNPs were suspended in 50/50 medium at the desired concentration and incubated for 18 h. Treatment of 40 nm, citrate-AuNPs, with and without BSA pretreatment, was completed at a concentration of 40 \u00b5g/mL. Treatment of 40 nm, PAH-AuNPs and supernatant, with and without BSA pretreatment, was completed at a concentration of 16 \u00b5g/mL. For control conditions, HPAECs were incubated with 50/50 medium and no AuNPs. Following incubation cells were rinsed with PBS and replaced with 20 \u00b5L of MTT (5 mg/mL in PBS) and 180 \u00b5L phenol red-free DMEM with 10% (v/v) FBS. After 2 h of MTT incubation, the 20 \u00b5L of SDS solution (10% (w/v) SDS in 0.01 M HCl) was added to each well to solubilize the formazan dye and incubated again for 2 h. Background subtraction wells, with no formazan formation, were measure to account for metallic NP interference in colorimetric MTT assay. For AuNP background subtraction wells, cells were rinsed with PBS and replaced with 180 \u00b5L of phenol red-free DMEM with 10% FBS (v/v) after 18 h AuNP incubation. After 2 h cell medium incubation, 20 \u00b5L of MTT (5 mg/mL in PBS) and 20 \u00b5L of SDS solution (10% (w/v) SDS in 0.01 M HCl) was added to each well and incubated again for 2 h, in order to prevent formazan formation from occurring. Absorbance was measured with a microplate reader Tecan Infinite M200 Pro  at 570 nm, which is the peak absorbance for formazan, and 680 nm. The A570 was referenced to A680 for each individual sample  Triton X-100 in PBS for 10 min at 37 \u00b0C, and non-specific antibody binding blocked by 1% (w/v) BSA for 1 h. Primary antibody staining by anti-VE-cadherin (C-19) goat polyclonal IgG antibody (1:100 dilution) was performed for 1 h. Secondary antibody staining was performed with donkey anti-goat IgG-CFL 647 (1:200 dilution) to image VE-cadherin and Rhodamine Phalloidin (1:200 dilution) to image F-actin for 1 h. Samples were mounted with DAPI (1:1000 solution) in Fluoromount-G, covered with a glass coverslip, and were dried overnight and stored at 4 \u00b0C until imaging. Samples were imaged using a Multiphoton Confocal Microscope Zeiss 710 . All fluorescence images were taken using a 63\u00d7 oil immersion objective with same intensity and exposure time. Fluorescence visualized immunostaining and the reflectance mode of the confocal microscope provided high scattering cross sections of the AuNPs (559\u2013566 nm). When capturing each single layer image for analysis, the microscope was focused on the cross section with clear definition in VE-cadherin. The example of an image captured and used for analysis, compared to the corresponding z stack projection is presented in Fig. HPAECs (passage 7\u20139) were seeded in 35 mm glass bottom dishes with 13 mm wells and #1.5 German cover glass at a density of 60,000 cells/well in the 13 mm glass slide portion in EGM-2 with 10% (v/v) FBS. On day 2 when HPAEC layer was visually confluent under Nikon Eclipse TS100  microscope, all the wells were rinsed with PBS to remove dead cells or debris and treated with AuNPs suspended in 50/50 medium at the desired concentration. Treatment of 40 nm, citrate-AuNPs, with and without BSA pretreatment, was completed at a concentration of 40 \u00b5g/mL. Treatment of 40 nm, PAH-AuNPs and supernatant, with and without BSA pretreatment, was completed at a concentration of 16 \u00b5g/mL. The plates were incubated in a humidified incubator at 37 \u00b0C with 5% CO2). Each condition had two independent experiments and 4\u20135 images were taken per experiment (dish); therefore, a total of 9\u201310 images were collected per condition. Average number of nuclei per image for all conditions is presented Fig. Image analysis was performed with ImageJ software 1.52b . To define the area of endothelial junctions, VE-cadherin images (8-bit) were used. A rolling ball radius of 22\u00a0nm (100 px) was chosen to perform a background subtraction. In order to accurately define the junctions and exclude cytoplasmic background, the threshold was adjusted from 0\u201350. Any remaining fluorescent regions of the cytosol were cropped out manually, leaving behind only junctions. Junction areas (pixels) were then quantified using the \u2018Analyze particles\u2019 tool in ImageJ. This area was converted and reported as junction area per field . Normality Test was used to identify normally distributed data. Grubbs Test was used to identify and remove outliers in not normally distributed data. Statistical significance for normally distributed data was determined using a one-way ANOVA. Kruskal\u2013Wallis ANOVA (KWANOVA) was used to determine significance for not normally distributed data. A significance level of \u03b1\u2009=\u20090.05 was chosen. All data are reported as mean\u2009\u00b1\u2009standard error of the mean, unless otherwise stated. The number of independent experiments and replicates performed for quantifying cell metabolic activity, immunostaining and imaging, and quantifying the area of endothelial cell\u2013cell junctions can be found in respective Methods sections.Supplementary Information."}
+{"text": "In the past three decades, we have witnessed unprecedented progress in wireless implantable medical devices that can monitor physiological parameters and interface with the nervous system. These devices are beginning to transform healthcare. To provide an even more stable, safe, effective, and distributed interface, a new class of implantable devices is being developed; injectable wireless microdevices. Thanks to recent advances in micro/nanofabrication techniques and powering/communication methodologies, some wireless implantable devices are now on the scale of dust (<\u20090.5\u2009mm), enabling their full injection with minimal insertion damage. Here we review state-of-the-art fully injectable microdevices, discuss their injection techniques, and address the current challenges and opportunities for future developments. Implantable medical devices (IMDs) encompass a wide range of applications such as neural network modulation  technology for highly miniaturized and low-power integrated circuits, novel micro/nanofabrication techniques, and superior wireless links together provide an opportunity to eliminate batteries and to create implantable microdevices that integrate all the components needed to interface with the nervous system and monitor a wide variety of physiological parameters. These wireless free-floating implantable devices have been referred to as wireless motes, dust, and microdevices. In the field of neural interfaces, they represent the latest generation of electrodes as shown in Fig.\u00a0Ability to choose from a wide range of configurations and site locations. For instance, microdevices can be distributed injected across multiple regions in the brain and reach areas inaccessible to conventional IMDs , providing clinicians and researchers higher specificity in their treatments or experiments.Microdevices allow minimally-invasive implantation techniques  which is expected to significantly reduce the immune or foreign body response (FBR) as they avoid the risks of surgical complications associated with open craniotomy and extensive dissection  around the implant  and injectable using appropriate injection tools.They must be microscale  SiXNY, and SU-8 (together a few \u03bcm thick) were used for encapsulation. While this simple construction makes the integration fabrication easier, such amplitude modulation leads to a high noise floor and is also prone to environmental fluctuations. Its injector tool is a micromachined silicon microneedle that securely holds the implant in a recess with polyethylene glycol (PEG) as a temporary adhesive. Once inside the brain, the PEG is dissolved by intercellular fluid, and the OWIC is mechanically pushed out by a secondary needle  filled with PBS for injection delivery.Shi, et al. have also demonstrated a microdevice for temperature sensing Fig. . This 0.Munjeeb-U-Rahman et al. have reported a miniature CMOS-based glucose sensor Fig. . The subThe Microbead is an example of a stimulating microdevice  for encapsulation as in OWIC and achieve several months of lifetime in the mouse brain. For manipulation, the authors use pulled micropipettes (\u03bc-pipettes) in conjunction with a nanoinjector. A MOTE, once dispersed in a solution  post-fabrication, is pulled in by a \u03bc-pipette. After the solution in the \u03bc-pipette dries, the MOTE is pushed out by the nanoinjector needle. Because the MOTEs are made to be sharp-edged, MOTEs can penetrate the dura. In other words, the incision damage is not limited by the insertion tool  dimension, but by the size of the MOTE itself.The MOTE is a neural recording microdevice that has an AlGaAs \u03bcLED integrated on 180\u2009nm CMOS Fig. . By utilTable While there are several other examples of wireless implants that have been aggressively miniaturized  more floating microdevices to be concurrently inserted into the nervous system, ii) higher precision in targeting specific brain regions or nerve fiber bundles, iii) better compatibility with minimally invasive implantation procedures, leading to faster recovery time and lower risks, and iv) a reduction in FBR. Unfortunately, the development of these ultra-small devices is a laborious interdisciplinary endeavor that requires an intimate interplay between multiple engineering and science disciplines. In this section, we outline some of the challenges and progress towards developing future wireless microdevices.The major technological bottleneck in miniaturizing microdevices is the inevitable decrease in power transfer efficiency (PTE), which limits the implantation depth and/or requires large transmitted power. Furthermore, as the microdevice volume continues to shrink, the energy harvested will decrease, leading to the reduction in the supply voltage. This challenge is more pronounced in stimulating implants that require a certain voltage across their electrode pair. With the limited area, stimulating electrodes will have to utilize novel rough materials with large charge-injection capacity and small impedance . Another solution is to place the surface microelectrodes on the lateral surface  in the CMOS chip. Conventional established techniques either significantly increase the total volume of the microdevice or hampers their wireless link. Fortunately, new packaging solutions that are biocompatible and offer ultra-thin encapsulation have recently been demonstrated such as: silicon carbide by PECVD deposition  to create a distributed sensing/actuating network. These multidimensional physiological signals can constitute big data on human physiology to make truly personalized healthcare  possible and to enable long-term human model studies  that current clinical trials cannot provide.While the latest injectable wireless microdevices show great promise in developing a research platform for animal models, significant technological challenges must be addressed before they could become applicable for clinical applications. Future efforts should focus on characterizing, in terms of efficacy, efficiency, and safety, the injection techniques presented in this review. There is also a lack of safety evaluations and chronic studies on injectable microdevices. Addressing these would bring the technology one step closer to clinical trials, and 1 day such microdevices would be able to change our healthcare landscape by revolutionizing therapeutics and diagnostics frameworks in humans."}
+{"text": "NLGN1 (neuroligin 1) containing a conserved-HMR between human and pig. Our results revealed the similarities and diversity of sperm methylation patterns among three commercial pig breeds and between human and pig. These findings are beneficial for elucidating the mechanism of male fertility, and the changes in commercial traits that undergo strong selection.Identifying epigenetic changes is essential for an in-depth understanding of phenotypic diversity and pigs as the human medical model for anatomizing complex diseases. Abnormal sperm DNA methylation can lead to male infertility, fetal development failure, and affect the phenotypic traits of offspring. However, the whole genome epigenome map in pig sperm is lacking to date. In this study, we profiled methylation levels of cytosine in three commercial pig breeds, Landrace, Duroc, and Large White using whole-genome bisulfite sequencing (WGBS). The results showed that the correlation of methylation levels between Landrace and Large White pigs was higher. We found that 1,040\u20131,666 breed-specific hypomethylated regions (HMRs) were associated with embryonic developmental and economically complex traits for each breed. By integrating reduced representation bisulfite sequencing (RRBS) public data of pig testis, 1743 conservated HMRs between sperm and testis were defined, which may play a role in spermatogenesis. In addition, we found that the DNA methylation patterns of human and pig sperm showed high similarity by integrating public data from WGBS and chromatin immunoprecipitation sequencing (ChIP-seq) in other mammals, such as human and mouse. We identified 2,733 conserved HMRs between human and pig involved in organ development and brain-related traits, such as  Pigs are an important source of fats, proteins, and human biomedical models . After aDNA methylation is the most stable and commonly studied epigenetic marker , which pSperm is an important heritable lineage. The comparison of sperm DNA methylomes in the whole genome across different pig breeds is unknown. Thus, to fill this gap, we conducted WGBS of sperm DNA samples from different pig breeds to explore the potential genetic mechanisms of phenotypic diversity and male fertility. Duroc, Landrace, and Large White are three common commercial pig breeds known for their excellent production performance under long-term artificial selection. Comparing breed-specific epigenomic markers in three commercial pig breeds helps us to understand how epigenetic regulation leads to phenotypic changes during evolution.This study aimed to: 1. Investigate the sperm DNA methylomes using WGBS and analyze DNA methylation variation in three pig breeds\u2014Landrace, Duroc, and Yorkshire; 2. Excavate breed-specific hypomethylated regions and identify genes that are enriched by lineage-specific hypomethylated regions around promoters; 3. Further identify the epigenetic biomarkers by integrating public reduced representation bisulfite sequencing (RRBS) data in pig testis; 4. Combine public data from WGBS and chromatin immunoprecipitation sequencing (ChIP-seq) in other mammals, the changes in sperm DNA methylation across mammalian evolution, and the epigenetic mechanism of pigs as human medical models .Six sperm samples were collected from three pig breeds in Landrace, Duroc, and Large White . The pigs were raised using the same feed type on the same farm. Semen samples were collected by professional artificial insemination personnel according to a standardized procedure with artificial vaginas. Genomic DNA was extracted using a salt-fractionation protocol. DNA quality was assessed using a 2,100 Bioanalyzer  and a spectrophotometer . The qualified genomic DNA were spiked with unmethylated lambda DNA and fragmented into 200\u2013300 bp, followed by terminal repair, the addition of 3\u2032 A and adapter ligation. The DNA fragments were treated twice with bisulfite using an EZ DNA Methylation-Gold\u2122 kit , under the manufacturer\u2019s instructions. Then the DNA fragments were amplified by PCR to screen the qualified library and sequenced using a paired-end 150 bp flow cell on an Illumina HiSeq X Ten machine .https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and Trim Galore v 0.4.0  was used to assess the quality of the sequence data and filter low-quality reads (q < 30), respectively. The cleaned data were then mapped to the respective reference genomes: sscrofa11.1 (pig), hg38 (human), and mm10 (mouse), using bowtie2 under the Bismark software (0.14.5) with default parameters (The public WGBS data used in this study included human sperm (GSE30340 and GSE57097)  and mousrameters . FurtherCpG sites with coverage greater than five were used for the HMR analysis. We used tools from the MethPipe package to identify HMRs, as described previously . HMRs weThe conservation and variability of HMR was analyzed using BEDTools (version 2.26.0) . This stThe transcriptomes of pig testes (PRJEB33381) and human sperm (PRJNA573604) were collected from a public database. Thereafter, the RNA-seq reads were mapped to the respective reference genomes of pigs (sscrofa11.1) and human (Hg38) using the HISAT2 software . Finallyp < 0.05.DNA motif enrichment analysis of breed-specific HMRs was conducted in three pig breeds. Moreover, we identified overrepresented DNA sequences using MEME suite 5.0.5 with the following parameters:\u2019 -dna -minw 8 -maxw 20 -mod zoops -objfun de -nmotifs 10\u2019 . In addihttp://broadinstitute.github.io/picard/) was used to remove duplicated reads with parameters \u2018REMOVE_DUPLICATES = true\u2019. Histone peaks were obtained using the MACS2 software. The overlap between the HMR datasets and five histone modifications was identified using BEDTools, as previously described.Histone data were downloaded from the SRA dataset, including five histone modifications: H3K27me3, H3K4me1, H3K4me3, H3K36me3, and H3K27ac (PRJNA173071 and PRJNA281061). First, we obtained clean reads using the Trim Galore software. The clean reads were mapped to hg38 (human) using the Bowtie2 software. Then, the Picard tool . Genes with promoter HMRs were annotated using the online software DAVID (http://metascape.org/). Significant GO terms and pathways were identified based on p < 0.05. GO terms were visualized using the R package GOplot (version 1.0.2) (https://www.string-db.org/) and identified hub genes with a higher degree of connectivity using CytoHubba under the Cytoscape software  . Thereafsoftware .In this study, we conducted WGBS of individual sperm DNA samples from three commercial pig breeds\u2014Landrace, Duroc, and Large White. We obtained 204 to 307 million unique mapped reads with an average coverage from 12.21 to 18.43\u00d7 . An overr = 0.64). Principal component analysis (PCA) also demonstrated this phenomenon  for all samples , which wenomenon . PC1 sucTo study the evolution of DNA methylation among the three porcine breeds, we further investigated the promoter methylation levels of different breeds. A promoter region was defined as the segment 1.5\u00a0kb upstream and 0.5\u00a0kb downstream of transcription start sites (TSSs) . The hiep < 0.001; 1,000 times of permutation test) (Hypomethylated regions (HMRs) are associated with gene activation and coincided with gene regulatory elements, including gene promoters and enhancers ; therefoon test) . The disn = 1800) with breeds-conserved HMRs in the promoters were engaged in basic cell function and fertilization, including energy homeostasis, cell proliferation, multicellular organism growth, and binding of sperm to the zona pellucida (HSPA1L (heat shock protein family A member 1 like), SPA17 (sperm autoantigenic protein 17), ZPBP (zona pellucida binding protein), and ZPBP2 (zona pellucida binding protein 2). HSPA1L has also been shown to be related to spermiogenesis in cattle, human, and mouse  breeds-conserved HMRs, containing a region that is hypomethylated in all breeds, and 2) breed-specific HMRs, which are regions that are hypomethylated in one breed compared to the other two breeds. As expected, most HMRs were conserved in the three porcine breeds, with an average of 76.3% in each breed . Moreoveellucida . In the nd mouse . This imnd mouse .FOXJ3 and MYBL1.We identified 1,580 Duroc-specific, 1,666 Landrace-specific, and 1,040 Large White-specific HMRs . The genn = 691) from the Pig QTL database . We observed that Duroc-specific HMR had higher overlapping QTL signals of production traits, meat, carcass traits such as body weight (birth) QTL, and backfat above muscle dorsi QTL. In addition, Duroc and Landrace had specific HMRs overlapping with muscle protein percentage QTL and backfat weight QTL  of traits (ight QTL . These rn = 1743) in sperm were common to the testis  and HSPA9 (heat shock protein family member 9) have been suggested to play important roles in male germ cell development  of HMRs were conserved between humans and the other two species  of the conserved HMRs across the three pig breeds were conserved in human  of conserved HMRs between human and pigs overlapped with H3K4me3 marks, which is in accordance with the antagonistic relationship between DNA methylation and H3K4me3. In contrast, less conserved HMRs were enriched for H3K4me1 (n = 90) and H3K36me3 (n = 17) (n = 0).In addition to DNA methylation, chromatin states also play an important role in spermiogenesis, fertilization, and development. Then, we analyzed the chromatin states of the conserved HMRs between human and pigs using five histone marks . We found that 75.01% ((n = 17) . In addin = 669) were simultaneously marked by H3K4me3 and H3K27me3  at a high resolution and investigated the relationship between pig and human with DNA methylation and histone modifications. In addition, the evolutionary properties of HMR in three commercial pig breeds, which may play an important role in embryonic developmental traits and adaptive traits, were analyzed. Our results also showed that most genes with conserved HMRs at promoters between human and pig are in the poised chromatin state , which are involved in brain-related traits.Based on the comparison of sperm DNA methylome variation across three commercial pigs, our results showed that the divergence of sperm DNA methylomes fully recapitulates phylogenetic relationships, as previously reported for DNA sequences . PrincipIn primate, the majority of species-specific DMRs locate outside promoters and have similar transcriptional potential as promoter DMRs . In thisEXOSC10 and HSPA9. EXOSC10 is a well-known target of autoantibodies in patients with systemic sclerosis (scleroderma)   . Recent elopment . This stsed size . HSPA9 hmily G2) . These rBy analyzing the divergence of sperm DNA methylomes in three mammalian species: human, mouse and pig, we found that DNA methylomes were more highly conserved in pig and human than in human and mouse. Moreover, conserved HMRs between human and pig are also associated with GO terms related to development functions, particularly brain-related traits. This may be explained by brain-associated genes under strong selective constraints during the evolution of species . For insThis study is the first to report a genome-wide comparative DNA methylation map of adult pig sperm in three commercial pig breeds using WGBS technology. Our results showed that sperm HMRs were highly conserved in the three commercial pig breeds. Moreover, our results indicated that breed-specific HMRs are related to phenotypic changes and economically complex traits for each breed. The conserved HMRs between pig sperm and testis close to or located in the promoter regions of important genes are mainly involved in DNA repair and spermatogenesis. Additionally, we found considerable similarities in DNA methylomes between pig and human sperms. The conserved HMRs between human and pig are related to brain-associated genes. In summary, our study of sperm methylomes in three commercial pig breeds contributes to understanding the mechanism of complex traits  undergoing selection, further supporting pigs as human medical models from an epigenetic standpoint."}
+{"text": "This paper explores the determinants of debt financing choices among small-scale manufacturing enterprises in Ethiopia\u2014with special focus on the role of government policies. The study exploits survey data gathered from 1321 enterprises in the Amhara region of Ethiopia and employs conditional mixed process (CMP) system estimation technique to test the effect of public policy on firm debt levels. The relevant econometric findings confirm that policy activism through the provision of training and related intervention schemes boosts debt utilization in startup finance mix while it lowers the probability of firms' falling into higher debt levels over time. The results also show that enterprises that had some debt mix in their startup capital are more likely to be in higher debt categories than those enterprises that kick start exclusively with their own internal resources. In addition, the findings also reveal that self-reported profitability, firm age, and ownership structure have strong effects on the degree of firms\u2019 indebtedness. One major bottleneck to the survival and growth of SMEs is their relatively large default rates. One strand of the existing literature shows that firm default rates are strongly correlated with debt levels. As default rates driven by high debt levels have devastating implications for creditors, debtors, and regulators, it is very important to understand the determinants of debt levels. This study is the first to apply conditional mixed process system estimation on firm level data from Ethiopia to test the effects of government policies on debt level choices. Debt financing; Small-scale enterprises; Ordered probit; Conditional mixed process; Ethiopia. Micro, Over the past couple of decades, the government of Ethiopia has given considerable attention to small-scale enterprises in general and to manufacturing firms in particular as an important instrument of poverty reduction and job creation in urban areas. For instance, the Central Statistical Agency of Ethiopia  reportedth pillar components that capture financial system development show a rank of 103/141 for domestic credit to private sector as percentage of GDP; 114/141 for access to SME financing and 124/141 for soundness of banks  indicated that Ethiopia's overall competitiveness rank was 126 out of 141 countries. In addition, the report's 9of banks . Ethiopiof banks .Currently, the financial system in Ethiopia is dominated by banks, insurance companies and microfinance institutions without functioning stock markets. The banking sector is characterized by dormantAnother important bottleneck to the survival and growth of SMEs is their relatively large default rates. While there is mounting evidence about the positive effects of debt financing on several metrics of firm growth  theory that suggests that financing options are haunted by the need to ponder the relative costs and benefits of utilizing external financial resources. The model views a firm's choice of optimal debt-equity mix as a function of three parameters: taxation, liquidation risks, and conflicts among key agents. If the firm decides to use debt, for instance, it enjoys reduction in its corporate tax obligations and boosts the after-tax income at its disposal. In consequence, tax advantage and the market value of the firm co-move in the same direction as a result of firms' efforts to align the tax advantages of more debt with increasing probability of bankruptcy risks .The third major framework in the capital structure literature is the pecking order theory (POT) that was introduced by 2.2Empirically numerous studies have examined the sources, patterns and implications of different financing preferences of firms. Concentrating on Brazilian small and medium firms, In the context of developing countries, Beyond the standard determinants, some scholars have accentuated the importance of owner-manager specific characteristics. For instance, in a study of small and medium enterprises in Malaysia, Still very important, the policy environment in which firms operate can also shape their financing choices. For instance, it is now widely recognized that tax policy considerations and probability of bankruptcy risks influence firm financing choices . OverescIn Ethiopia, federal and local governments provide several financial and non-financial support packages as part of an effort to encourage small-scale enterprise development as a tool for poverty reduction and job creation. These packages include training, technology transfer, and related business development services (BDS) as well as organizational support to the youth by the government during business formation process . These gH1Access to business development services (BDS) has no effect on debt financing level.H2Government support in group business formation process has no effect on debt financing level.In addition to the inconclusive nature of the existing evidence on the debt-policy nexus, there are very few studies on determinants of leverage in low-income economies in general and in Ethiopia in particular. The only study we are aware of is In light of the above discussion, the major hypotheses the study aims to test are the following:33.1The data used in this paper is part of a broader dataset collected in 2016/17 fiscal year as part of a mega research project to assess the status of small and micro manufacturing enterprises in the Amhara region of Ethiopia. Available information was collected by administering structured questionnaires to focal persons (including owners and managers) in 1381 small and micro manufacturing enterprises. These enterprises were scattered across eleven zonal capital towns of the same region. Ultimately 1321 enterprises filled in and returned the distributed questionnaires giving rise to a response rate of about 96 percent. The available information was gathered from the owners/managers of the target firms by employing multi-stage stratified simple random sampling techniques. In the first stage, the Amhara region was selected as this region housed the university that supported the specific research as part of an effort to understand the socio-economic problems and contribute to the local community development needs. Inclusion of other regions in the country was not possible because of financial constraints. In the second stage, the team leaders decided to cover all the eleven zonal capital towns of Amhara region as the vast majority of the small and micro manufacturing enterprises was concentrated in those towns. In each town, the enumerators contacted the concerned technical, vocational, and enterprise development office personnel for lists of the target firms. In the final stage, the questionnaires were distributed to proportionally allocated and randomly selected enterprises to make sure that each sub-sector receives fair representation in the total sample.3.2Drawing on Many previous studies e.g.  studied In 3.33.3.1Several studies have used level categories to study degree of indebtedness among individuals, households, and firms e.g. . In this3.3.2This study incorporates numerous independent variables drawing from the existing literature. In order to capture potential effects of government policy, the study includes two proxy variables, namely, access to government-provided training, technology transfer and related business development services (BDS) and existence of local government initiative in organizing job seekers to form groups and start business. Finally, the study includes other standard control variables that affect current degree of firms\u2019 indebtedness (see 44.1Descriptive statistics of the major model variables are presented in debt inertia in the sense that those enterprises that get into business with some liability are more likely to have access to credit market and to maintain a certain degree of indebtedness over time.Stylized facts on the sampled firms\u2019 financing profiles4.24.2.1Firm age (with those below three years as a benchmark) has non-linear effect on leverage positions of target firms. For instance, those firms older than 8 years have about 12% additional probability of being in no-debt category while the corresponding probabilities for being in moderate and high levels of leverage decline by about 8% and 3.4%, respectively. The marginal effects are significant at 95 percent confidence level. These findings indicate that maturity has inverse relationship with the likelihood of using higher levels of debt in clear contrast with the prediction of the POT. The present finding is inconsistent with the findings of The marginal effects in 4.2.2The marginal effects presented in The results in Second, the sign and significance of startup financing mix, firm age, and profitability are also preserved in the system estimation results. Third, the ownership variable, which was insignificant so far, now enters significantly at 95 percent confidence level. This specific result confirms that individually owned firms see lower probabilities of being in higher debt levels. The correlation between ownership structure of the firm and financing patterns was also confirmed by previous studies e.g. .Finally, firm size, ownership structure, government support in business formation process, education attainment, and perception about the role of rental cost are significant drivers of the mix of startup finance. For instance, having college education raises the probability of using debt in startup financing by about 37%, a result significant at 95 percent confidence level. This implies that education affects leverage level indirectly through its effect on the choice of startup finance mix. This contradicts the results of single equation studies that showed that education has direct effect on firm debt levels .5Understanding the patterns and drivers of firm balance sheet composition is important from macro- and micro-economic points of view. This paper explores the determinants of debt levels among small-scale manufacturing enterprises in Ethiopia. The study relies on survey data gathered from Amhara region during 2016/17 fiscal year and employs descriptive and conditional mixed process (CMP) estimation techniques to isolate the effects of both standard and heterodox factors on firm financing preferences. The relevant econometric findings confirm that policy activism through the provision of training and related intervention schemes lower the probability of firms' falling into higher debt levels. The results also show that enterprises that had some debt mix in their startup capital are more likely to be in higher debt categories than those enterprises that kick start exclusively with their own internal resources. In addition, the findings also reveal that self-reported profitability, firm age, and ownership structure have strong effects on the degree of firms' indebtedness. Since policy activism was found to have significant negative relationship with the likelihood of falling into higher debt levels, concerned policymakers should strengthen existing financial and non-financial policy intervention packages in order to lower the probability of firms\u2019 falling into destabilizing debt levels.Wondemhunegn Ezezew: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data.Ermias Berihun: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Fentahun Baylie and Derbew Kenubeh: Analyzed and interpreted the data; Wrote the paper.10.13039/501100007861University of Gondar, Gondar, Ethiopia.This research was supported by the Data will be made available on request.The authors declare no conflict of interest.No additional information is available for this paper."}
+{"text": "M = 3.789), (b) behavioral intention for participation in sport (M = 4.056), and (c) infection anxiety from others (M = 3.548), but showed a relatively lower (a) risk perception of COVID-19 (sensitivity) (M = 3.494). The results of this study could be utilized as valuable data to minimize the gap between the relaxation of government quarantine policy and perceptions of COVID-19 among the general public in sports, which have not yet been clarified.Although an increasing number of people are getting vaccinated for COVID-19 and quarantine policies are easing owing to fatigue from high-intensity social distancing, people\u2019s fear remains. This study attempted to determine the appropriateness of quarantine policies that are gradually easing by comparing and analyzing sports participation and respiratory infection perception recognized by sports participants according to vaccination status. Data were collected from 302 ordinary Korean citizens aged 20 or older for three months from November 2021 in the Republic of Korea. From the survey respondents, data on the main factors of this study included (a) demographic information, (b) vaccination, (c) loyalty in sports, (d) behavioral intention to participate in sports, (e) infection anxiety from others, and (f) risk perception of COVID-19. As a result, the survey respondents, subdivided into an unvaccinated group (Group 1) and a vaccinated group (Group 2), derived statistically significant results on sports participation and respiratory infection perception. Specifically, survey participants who had completed all secondary vaccinations showed a relatively higher (a) loyalty in sport ( In December 2019, COVID-19, a new type of virus, appeared worldwide . By 7 FeIn addition to the global spread of COVID-19, the nationwide spread of COVID-19 has caused various changes in daily life . First, After two years, the new virus is still ongoing, but exhausted people prepare to coexist with COVID-19, although they risk falling ill with it. This is because the spread of vaccines worldwide has become smooth, and the Omicron mutation, which is highly contagious but has a lower fatality rate than other mutations, is dominant. Infectious disease experts have argued that it is impossible to \u201cend\u201d COVID-19 in the form of complete eradication on earth and have agreed that humanity should prepare for a \u201ccoexistence\u201d that lowers the risk of COVID-19 to a manageable level. However, there are still many processes to overcome, and it is never an unsafe situation. This is because the COVID-19 situation, which showed a lull for a while owing to active participation in social distancing, vaccination, and efforts by quarantine and medical authorities, has shown fierce momentum and proved its presence with stronger explosive power .Loyalty, which can be seen as a rather abstract concept, might have originated from the concept of organizational identification, that is, the concept of identification between teams and fans in terms of sports. According to Kelman ,23, the Consideration of participation intention precedes intention. Intention means that each individual\u2019s beliefs are transferred to concrete actions toward the planned future . The terThe prevalence of new respiratory infectious diseases, such as COVID-19, has increased infection anxiety. In fact, 55.8% of people in the Republic of Korea felt somewhat or seriously anxious or depressed owing to the spread of COVID-19 . ConsideRespiratory infectious diseases are rapidly or chronically transmitted from person to person by pathogens, causing great confusion in society and a very high risk of infection and spread . To prevThe government may find it difficult to continue maintaining a strong quarantine system when people\u2019s fatigue from quarantine measures has reached its peak. However, in various overseas cases, quarantine regulations have been eased, and the spread has significantly increased . People n = 302), estimated through the G*power program for a multivariate analysis of variance (F test), including four variables with two groups.Despite the recent development of and inoculation with vaccines, COVID-19 is spreading owing to the development of mutant viruses. In this situation, this study attempted to determine the appropriateness of quarantine policies that are gradually easing by comparing and analyzing sports participation  and respiratory infections (infection anxiety from others and risk perception of COVID-19) perceived by sports participants according to vaccination status. To achieve this research purpose, among Korean adults aged 20 years or older in the Republic of Korea, sports participants who were enjoying leisure sports for more than a year since the COVID-19 outbreak formed the inclusion criteria. The data collection process was conducted in two universities located in the Republic of Korea from 5 November 2021 to 9 January 2022. Moreover, the procedure adopted a quantitative research design; a convenience sampling via intercept survey technique was applied to comply with the qualifications of accurate survey participants and proceed with data collection. Both online and offline survey methods were adopted at the level of compliance with the government quarantine policy. Google\u2019s survey platform was used for online surveys. The survey respondents read a brief explanation of the purpose of this study and completed the survey according to their choice (online/offline) using a self-administration method based on voluntary participation. A total of 350 questionnaires were distributed, and 309 were returned (approximately 88.3% response rate). After excluding seven incomplete questionnaires, 302 were finally used for the analysis of this study. The sample size met the statistical criteria  was collected, and additional surveys related to leisure sports  were also conducted. In addition, the questionnaire was preceded by a question (What is your vaccination status?), which is a key independent variable in the comparative analysis of this study. To answer this question, survey respondents had to choose one of the following: (a) unvaccinated, (b) primary vaccination completed, or (c) secondary vaccination completed. Based on the government\u2019s quarantine guidelines, only those who had completed all secondary inoculations were classified as inoculators. Specifically, the survey participants were subdivided into an unvaccinated group (Group 1) and a vaccinated group (Group 2). Detailed descriptive statistics of the survey respondents are reported in \u03b1 = 0.89), (b) behavioral intention for participation in sport, (\u03b1 = 0.63), (c) infection anxiety from others, (\u03b1 = 0.91), and (d) risk perception of COVID-19, . Nevertheless, this study tested the validity and reliability of all instruments again. The questionnaire items used in this study consisted of a 5-point Likert scale ranging from 1  to 5 (\u201cvery much\u201d).To secure content validity and improve the readability of the scale applied in this study, the researchers sent the instruments to a panel of experts, including five faculty members specializing in sports management or physical education. Feedback from the panel of experts was assessed, and minor modifications were made as follows. This study modified the instruments developed in James\u2019s study  to measuThe survey scales utilized in this study have already been tested for satisfactory validity and reliability in various previous studies on the sports industry and respiratory infectious diseases. However, as the scales were revised and supplemented based on the research topic and purpose of this study, a confirmatory factor analysis (CFA) was conducted with all five variables. All statistical results for scale validity in this study met the statistical standards. Additionally, the goodness-of-fit test showed satisfactory results .\u03b1 = 0.817; behavioral intention for participation in sport, \u03b1 = 0.869; infection anxiety from others, \u03b1 = 0.889; risk perception of COVID-19 (sensitivity), \u03b1 = 0.862; and risk perception of COVID-19 (seriousness), \u03b1 = 0.803. Thus, all the instruments exceeded satisfactory statistical reliability. All the detailed results of the CFA and Cronbach\u2019s alpha are shown in Next, the reliability of the survey items as factors was analyzed by applying Cronbach\u2019s alpha, and a satisfactory statistical cutoff value of 0.70  was applM = 137.958, F = 8.988, p < 0.001). Statistically significant differences between the two groups were found . As shown in A one-way MANOVA for the comparative study was implemented to verify the differences in loyalty to sports, behavioral intention to participate in sports, infection anxiety from others, and risk perception of COVID-19 in sports depending on vaccination status in the era of COVID-19. First of all, three statistical assumptions  were ensured. Moreover, to check another assumption of equal variance, the homogeneity of covariance was tested  loyalty to sports, (b) behavioral intention to participate in sports, (c) infection anxiety from others, and (d) risk perception of COVID-19 in the current situation where quarantine policies are easing.First, among the results of this study, statistically significant differences in the factor of loyalty to sports were found according to vaccination status. Specifically, survey participants who had completed all secondary vaccinations showed a relatively high loyalty to participate in physical activities. The term \u201cloyalty\u201d has been defined as a measure of continuous participation and interest ,42,43; tStatistically significant results were derived from the factor of the behavioral intention to participate in sports. The concept of \u201cintention\u201d could be analyzed slightly differently from the aforementioned \u201cloyalty\u201d because the \u201cintention\u201d implies a slightly more active individual will. Specifically, since the term means that each individual\u2019s beliefs are transferred to specific actions , behavioIn addition, the results of the vaccinated group were high in the factor of infection anxiety from others, a factor related to the threat of COVID-19. These results contradict the expected results. Even if vaccination is aimed at lowering the risk of infection from the virus itself and preventing it from serious post-infection outcomes , the vacAt a time when risks and uncertainties have become commonplace owing to the prolonged spread of COVID-19, the vaccination rate continues to increase, but the number of confirmed cases is also increasing exponentially. This study attempted to determine the appropriateness of quarantine policies that are gradually easing by comparing and analyzing sports participation  and respiratory infections (infection anxiety and risk perception) recognized by sports participants according to vaccination. Although this study found significant results, there are also research limitations.First, the age of the survey participants was not adopted as an important variable despite the presence of various variables, such as fear, anxiety, and risk perception of the COVID-19 virus, which can be fatal to elderly sports participants. In this way, given that the segmentation of survey participants was limited, it would be essential to analyze sports participants of various groups by applying additional potential variables  against COVID-19 in future studies.In addition, other various sports were not included in the survey because of restrictions on the use of many sports facilities owing to social distancing. Since COVID-19 is likely to coexist with daily life rather than be completely extinguished in the future, it is necessary to analyze the effect of COVID-19 on the sports industry from a more expanded perspective. Therefore, a research design that considers more diverse variables and situations should be required in future research."}
+{"text": "The thermal relaxation time of the DPGs is within 103\u2013104\u00a0s. This work shows that a systematic scan of DPG data at frequencies <\u20090.1\u00a0mHz may help shed light on patterns of internal wave propagation in the deep ocean, especially in multi-scale arrays.Temperature is used to trace ocean density variations, and reveals internal waves and turbulent motions in the deep ocean, called \u2018internal motions.\u2019 Ambient temperature detected by geophysical differential pressure gauges (DPGs) may provide year-long, complementary observations. Here, we use data from four DPGs fixed on the ocean bottom and a high-resolution temperature sensor (T-sensor) 13\u00a0m above the seafloor as a square-kilometer array deployed offshore ~\u200950\u00a0km east of Taiwan facing the open Pacific Ocean to examine the impact of temperature on DPG signals related to internal motions. The DPG signals correlate with T-sensor temperature variations between 0.002 and 0.1\u00a0mHz, but have time shifts partially caused by slow thermal conduction from the ambient seafloor to the DPG chamber and partially by internal motion propagation time across the array. Applying beamforming-frequency-wavenumber analysis and linear regression to the arrayed T-sensor and DPG data, we estimate the propagating slowness of the internal motions to be between 0.5 and 7.4\u00a0s\u00a0m Temperature and pressure are relatively easily observed, but until now density has been unobservable and salinity can only be indirectly obtained by combining measurements of temperature and conductivity and to a lesser extent pressure. Combining measurements from different instruments with different characteristics sometimes deteriorates the precision of the quantity to be observed. To convert temperature to density, shipborne conductivity-temperature-depth profile measurements are used to build the local temperature-density relationship. Thus, temperature observations can be used as a tracer for density variations in the ocean at known pressures if the relationship is tight, e.g., van Haren and Gostiaux2. Compared with near-surface ocean waters, deep-ocean waters demonstrate relatively small temperature variations <\u20090.5\u00a0\u00b0C. However, slight changes of the temperature in the deep ocean may indicate internal waves and turbulent motions that may help to transport energy, suspended matter and nutrition for deep-ocean life, e.g., Thorpe3.Temperature is a crucial parameter to trace density variations in the ocean. Dynamical ocean internal motions and vertical turbulent water mixing are closely related to density distributions. However, density distributions are difficult to measure directly. As ocean density variations are a function of temperature, salinity, and pressure, these measurable parameters could be used to track density4. The periods of internal waves range from several minutes, depending on the stratification, to a few days, depending on the latitude5. From short to long periods, internal waves can be induced by buoyancy oscillations, tides, and inertia-related geostrophic adjustments of passing atmospheric disturbances and Earth\u2019s rotation. Among them, horizontal wavelengths of the longest-period inertial internal waves are observed O (10\u00a0km)6, related to the strength of the density stratification7.Internal waves, which propagate three-dimensionally in the ocean\u2019s stable vertical density stratifications, induce temperature fluctuations in the deep-sea environment. These waves are ubiquitous in the ocean. Depending on their frequency and the rate of stratification, they can freely propagate, reflect, and scatter off seafloor topography8.When moored on the seafloor, temperature sensors (T-sensors) help to observe long-term internal motions in deep-sea environments. The time-series profiles from a moored vertical T-sensor string (T-string)\u00a0are able to image vertical structures of the internal motions and to estimate the vertically spatial scale and energy of turbulent mixing induced by breaking of internal waves, e.g., van Haren10, tsunami propagation12, earthquake seismology14, and ocean surface infragravity waves15. The Cox-Webb differential pressure gauge (DPG)16 is a high-sensitivity pressure sensor usually integrated with an ocean bottom seismograph (OBS) for studying seafloor seismology. For example, seafloor compliance can be derived using data from co-installed DPGs and OBSs on the same frame to quantify how much seafloor ground displacement is induced by ocean surface waves, allowing us to study the rigidity of subsurface sediments20.In geophysical research, seafloor pressure measurements from absolute and differential gauges have been applied to study seafloor geodesy21 found that the local environment of the deployment sites leads to variations in the response function, and in-situ calibration of DPGs helps to obtain accurate response information, which performs better than a general response function. However, this may limit the utility of the DPG data due to inaccurate quantification of pressure. Why an in-situ calibration is needed is an active research topic. In addition, pressure measurements of silicon oil-filled DPG sensors at frequencies below 3\u00a0mHz are sensitive to temperature changes16. The thermal effects from pressure-driven adiabatic processes and external temperature-induced conductive heat flow through the chamber walls can influence long-period DPG signals >\u2009300\u00a0s16. There are several useful designs to avoid temperature effects in high-frequency pressure measurements16. An oil-filled acrylic plastic jacket surrounding the reference chamber contributes to thermal insulation for pressure signals at frequencies >\u20093\u00a0mHz, and a slow leak releases excessive pressure from the reference chamber about every 60\u00a0s to avoid large non-ambient-pressure-induced fluctuations in the chamber. Thus signals at >\u20093\u00a0mHz, typical for most earthquake seismological studies, e.g., An et al.22, are less affected by temperature. However, the impact of seafloor ambient temperature on field DPG signals at <\u20093\u00a0mHz has not been systematically documented so far.Despite wide applications of DPGs in seismology, amplitudes of the recorded signals are sensitive to the instrument response function that converts raw digital counts to physical units of pressure. Doran et al.\u20135\u00a0s\u22121\u2009\u2248\u20090.77\u00a0cpd (cycle per day), approximately 0.0089\u00a0mHz. We analyzed the DPG variations at <\u20093\u00a0mHz with the data from a T-sensor at 3131\u00a0m to see how ambient temperature affects DPG waveforms, and to document temperature-induced variations from DPG records. We used DPG-derived \u2018temperature signals\u2019 in this spatially dense array to study events with significant internal motions, and to calculate the propagation speed and direction of the internal waves using beamforming-frequency-wavenumber (beamforming-FK) analysis24, henceforth \u2018FK-analysis\u2019 in short, and a linear regression method. In addition, the thermal relaxation time, the time for thermal conduction from a temperature pulse in the ambient environment to propagate to the DPG reference chamber, is estimated by temperature time delays between the T-sensor and four DPGs.In this paper, we use data from a DPG array with a 1\u2009\u00d7\u20091\u00a0km footprint, in addition to high-resolution T-sensor data from a mooring, to study DPG measurements of temperature fluctuations induced by deep-sea internal waves. The multi-instrument array was deployed on slopes at depths between 3000 and 3200\u00a0m offshore ~\u200950\u00a0km east of Taiwan , the double inertial (2f), and the semidiurnal (M2) frequencies, as well as the local buoyancy frequency N\u2009\u2248\u20090.1\u00a0mHz25. Although the bandwidth for coherence >\u20090.1 decreases as the DPG is further away from the T-sensor  related to ocean surface tides are generally much greater than the pressure induced by internal tidal waves O (102\u00a0Pa) in the deep ocean. However, surface tidal motions were barely visible in the DPG-T data. The different time/phase shifts among the DPGs also demonstrate that the DPG variations were not generated by ocean surface waves. The free propagating surface tidal waves, which have larger horizontal scales (O (103\u00a0km)) and higher phase speed (O (102\u00a0m\u00a0s\u22121)), could arrive the DPG stations almost in-phase. Thus, we propose that the long-period DPG-T variations were related to the local environmental temperature, instead of ambient pressure variations. The time series at P1, which is the closest station to the T-sensor, has the highest correlation coefficient with the temperature variations, but the smallest time shift is found at P2. The correlation coefficients between the T-sensor and the DPGs decrease with increasing distance between them. Using the T-sensor data as a reference, we removed the time shifts from the cross correlations, and found that the DPG-T variations  to filter the time series of the T-sensor and the DPG data for the following analysis. The DPGs are sensitive to the time derivative of temperature field for periods >\u2009300\u00a0sThe total time shifts between T-sensor and DPG-T data may be caused primarily by thermal relaxation time, the slow response of the DPG system to the ambient temperature, and partially by internal-motion propagation. The thermal relaxation time takes hours while the internal wave propagation across the array takes from 12 to 30\u00a0min. Such time shift relationships can be described as a simple equation of time shifts see \u201c\u201d section25. The time series of back azimuths (BAZs) and slowness from the FK analysis show that the internal waves were found to mainly come from the north to northeast of the array ) and thermal relaxation times (O (103\u00a0s)) are of the same magnitude as those calculated using the FK analysis  pressure measurements of DPGs. This thermal effect can be caused not only by pressure-driven adiabatic processes but also by thermal conduction from the ambient environment exterior to the reference chamber. Applying the array analysis to T-sensor and DPG-T data, we can estimate the DPG thermal relaxation time caused by such thermal conduction. However, small-scale environmental difference and individual DPG configuration may cause uncertainties in quantifying accurate thermal relaxation time and a response transfer function between DPG-T and temperature data.16, there is about 1\u00a0Pa error if the temperature of the reference fluid and chamber changes by 0.8\u00a0\u03bc\u00b0C assuming that the ambient pressure remains constant. Thus, the 0.1\u00a0\u00b0C difference from the typhoon-induced inertial motions in the deep-sea  horizontal separation, i.e. a multi-scale array, to cover a broader range of frequencies of internal waves and their associated turbulent motions. Nevertheless, the weighted average slowness and BAZs from the FK-analysis, which represent the main propagating internal waves, are of the same order of magnitude and consistent in direction with those calculated from the regression method.Sloshing waves and turbulence from waves breaking in the array may violate the plane wave assumption and cause changes in propagating speeds and directions of internal waves during the events. Compared to the overall \u2265\u20093-day duration of the internal motions fitted by the linear regression, the shorter duration of the 1.5-day time window with 103\u2013104\u00a0s). The periods of the DPG-T variations we analyze here are longer than the instrumental thermal relaxation time, demonstrating that the DPG may detect temperature fluctuations from internal waves.For the regression analysis, because the horizontal scale of the internal motions is much larger than the vertical scale, we assumed that the internal waves are 2D plane waves instead of 3D waves in reality. However, this assumption may underestimate the slowness of the internal waves, so that the thermal relaxation times may be overestimated using the equation of time shifts. However, the varying thermal relaxation time in the events range over the same orders of magnitude  may include a non-ambient-pressure-induced response Fig. , e.g., t28. Here, we used data from the T-sensor at 3131\u00a0m, just 13\u00a0m above the seafloor, to minimize the influence of high-frequency temperature fluctuations caused by turbulent disturbances higher in the water column.The T-string had 101 T-sensors at 2-m intervals between 2937 and 3137\u00a0m that sampled data at a rate of 0.5\u00a0Hz and a Nortek AquaDopp acoustic current meter with pressure sensor at 2936\u00a0m sampling every 10\u00a0min. The T-sensors, with precision <\u20090.0005\u00a0\u00b0C and noise level <\u20090.0001\u00a0\u00b0C, were built by the Royal Netherlands Institute for Sea Research (NIOZ)The total time shifts between T-sensor and DPG-T variations can be described simply by the following equation:Fifteen internal wave events Table  were ide4-s window shift.Beamforming-FK analysis transforms waves to frequency-wavenumber relations before \u2018beams\u2019 and stacks them over a predefined grid for slowness points. It then calculates the power of a beam with different slowness and BAZs of an assumed incoming plane wave crossing the array, allowing us to find the preferred model of apparent slowness and BAZs. The slowness and BAZs of the internal waves in each event were calculated from the long-period DPG-T variations using a 1.5-day time window, which includes the inertial and tidal periods, and a 10Root-mean-squared linear regression of the distributions of Supplementary Information."}
+{"text": "In living organisms, proteins are organized prevalently through a self-association mechanism to form dimers and oligomers, which often confer new functions at the intermolecular interfaces. Despite the progress on DNA-assembled artificial systems, endeavors have been largely paid to achieve monomeric nanostructures that mimic motor proteins for a single type of motion. Here, we demonstrate a DNA-assembled building block with rotary and walking modules, which can introduce new motion through dimerization and oligomerization. The building block is a chiral system, comprising two interacting gold nanorods to perform rotation and walking, respectively. Through dimerization, two building blocks can form a dimer to yield coordinated sliding. Further oligomerization leads to higher-order structures, containing alternating rotation and sliding dimer interfaces to impose structural twisting. Our hierarchical assembly scheme offers a design blueprint to construct DNA-assembled advanced architectures with high degrees of freedom to tailor the optical responses and regulate multi-motion on the nanoscale. Creation of high-order architectures using DNA devices is of interest for increasing the complexity of synthetic systems. Here, the authors, inspired by biological oligomers, create DNA dimers and oligomers that combining rotation and walking to make high-order systems with more complex conformational changes. For instance, a GTPase called dynamin is at the heart of endocytic vesicle fission. The dynamin unit is an antiparallel dimer, which can oligomerize into a helical polymer. The ratchet model proposes that GTP hydrolysis powers the relative sliding of the helical turns, giving rise to twisting of the helix and eventually membrane fission4. Such a self-association mechanism through dimerization and oligomerization not only enables new functions at the intermolecular interfaces but also elicits a wealth of structural and functional advantages. This offers a blueprint to create mimics that can collectively operate to define functions in artificial machinery.Cellular life functions through a collection of highly-controlled dynamic processes involving the self-assembly and organization of diverse molecular building blocks. These biological constructs optimized through billions of years of evolution provide us with the inspiration to create artificial systems, which emulate the structural and functional features of their natural counterparts. In particular, oligomerization is essential in many protein-involved cellular processes17 represents a unique tool to build bio-inspired artificial systems, taking advantage of the precision, addressability, and programmability of DNA on the nanoscale. A variety of DNA-based dynamic devices21 that mimic motor proteins22 in living cells has been accomplished, including walkers30, rotors36, sliders40, and assembly lines41. Recently, efforts to constructing bio-inspired DNA-assembled systems are taking a step forward from monomeric to high-order structures53 and from simple to complex motion57. Here, we demonstrate a DNA-assembled building block with rotary and walking modules, which can form dimeric structures to execute sliding, as well as subsequent higher-order architectures linked through dimer interfaces of the rotary and walking modules for controlled multi-motion. The monomeric building block is a chiral system59, which consists of two interacting gold nanorods (AuNRs) templated by DNA origami63. The two AuNRs can carry out the rotation and walking, respectively. Through dimerization, the walking modules are merged into a sliding module, imposing relative movements between two building blocks. Further oligomerization leads to higher-order structures with alternating dimer interfaces for collective rotation and sliding, imposing structural twisting. Our work delineates one of the rudimentary steps towards self-assembled artificial structures that imitate the collective motion of protein complexes, with the ultimate goal to build and engineer cellular mimics with fully operational structural and functional features de novo. Although it is an incredible adventure, fortunately, we will be able to look at the solutions provided by nature for every problem we encounter.Among different state-of-the-art techniques, DNA nanotechnologyFigure\u00a08, respectively  and removal (rR1\u2013rR5) strands are utilized for activation and deactivation of rfh1\u2013rfh5, respectively. As shown in Fig.\u00a030. Blocking (wBa\u2013wBf) and removal (wRa\u2013wRf) strands are utilized to control the accessibility of wfha\u2013wfhf. As shown in Fig.\u00a0The reversible rotation and walking mechanisms are displayed in Fig.\u00a059. These different states can be optically discriminated against by circular dichroism (CD) spectroscopy64. The CD spectra  is depicted in Fig.\u00a0Os are presented in Supplementary Fig.\u00a0Os. The OLIGOMERs can reconfigure from state O-5I-IV5 to state O-3II-V3, and then to O-2I-IV2 through simultaneous rotation and sliding processes  was purchased from tilibit nanosystems. Staple, blocking, and removal strands were purchased from Sigma-Aldrich. Agarose for electrophoresis and SYBR Gold nucleic acid stain were purchased from Life Technologies. Uranyl formate for negative TEM staining was purchased from Polysciences, Inc.65. It consisted of a 10-helix bundle, a 6-helix arc, and a double-layer plate arranged in a \u2018honeycomb\u2019 lattice, which was connected through scaffold crossovers . The DNA origami structures were purified by 0.7% agarose gel electrophoresis in a 0.5\u00d7 TBE buffer with 11\u2009mM MgCl2 for 3\u2009h at 8\u2009V/cm.The UNIT was designed using caDNAno software30. Basically, thiolated DNA strands were incubated with TCEP [tris(2-carboxyethyl)phosphine] for 2\u2009h. The ratio of DNA: TCEP was 1:200. Second, the AuNRs  were spun down and the supernatant was removed. The AuNRs were then mixed with thiolated DNA strands . In total, 845\u2009\u03bcL modification buffer (0.59\u00d7 TBE (tris-(hydroxymethyl)-aminomethane, borate, ethylenediaminetetraacetic acid, 0.023% SDS, pH\u2009=\u20093) was added. 10\u2009mL, 5\u2009M NaCl was added every 10\u2009min for nine times. 10\u2009mL, 5\u2009M NaOH was added subsequently to adjust the pH value to ~8, and the final concentration of NaCl reached 0.5\u2009M. The AuNRs functionalized with DNA were then purified by centrifugation. Five times of centrifugations at a rate of 8000\u00d7g for 30\u2009min were carried out. Each time, the supernatant was carefully removed and the AuNRs were resuspended in a 0.5\u00d7 TBE buffer containing 0.02% of SDS. The supernatant was then removed. AuNPs were purchased from Sigma-Aldrich (Cat no. 741957). Functionalization of the AuNPs with thiolated DNA was carried out following a well-established procedure37. Basically, after reduced\u00a0with TCEP, thiol-modified DNA and BSPP-modified AuNPs were incubated at a molar ratio of DNA: AuNPs of 300:1 in a 0.5\u00d7 TBE buffer solution overnight at room temperature. The concentration of NaCl was slowly increased to 500\u2009mM in the subsequent 24\u2009h. The AuNPs functionalized with DNA were then washed using a 0.5\u00d7 TBE buffer solution in 100\u2009kDa (molecular weight cut-off) centrifuge filters to remove the free DNA strands. DNA-functionalized AuNRs or AuNPs were mixed with the DNA origami structures in a ratio of 10:1. The mixtures were annealed with the procedure of 35\u2009\u00b0C 2.5\u2009h, 34\u2009\u00b0C\u201329\u2009\u00b0C\u2009\u22121\u2009\u00b0C/3\u2009h, 28\u201326\u2009\u00b0C\u2009\u22121\u2009\u00b0C/1.5\u2009h, and held at 25\u2009\u00b0C. Gel electrophoresis was used to purify the UNITs under the same condition for the purification of the DNA origami template structures.AuNRs were purchased from Sigma-Aldrich (Cat no. 716812). Functionalization of the AuNRs with thiolated DNA was carried out following a low pH procedure250\u2009\u03bcM 0.4\u2009\u03bcL wfha strands were added in the purified UNITs  and the mixture was annealed with the procedure of 30\u2009\u00b0C\u201328\u2009\u00b0C\u2009\u22121\u2009\u00b0C/6\u2009h, 30\u201326\u2009\u00b0C\u2009\u22121\u2009\u00b0C/6\u2009h, and held at 25\u2009\u00b0C. Afterward, 250\u2009\u03bcM 0.4\u2009\u03bcL wfhb strands were added to the OLIGOMERs and the mixture was incubated overnight at room temperature. Gel electrophoresis was used to purify the DIMERs under the same condition for the purification of the DNA origami template structures. The dimerization yield was 68.7% . All measurements were carried out at 25\u2009\u00b0C. The concentrations of the blocking and removal strands were 250\u2009\u03bcM.2O was added, if no DNA strands were added. After each addition, the samples were incubated at 25\u2009\u00b0C for about 1\u2009h. The final concentrations of the AuNRs in all the systems were about 1\u2009nM.For the CD spectral measurements in Fig.\u00a0The time-course measurements for the UNITs were carried out as follows. Two hundred microliter was used for each UNIT sample. The CD signals at 721\u2009nm were monitored using the time-scan acquisition mode with a data pitch of 1\u2009s. The respective blocking and removal strands were added to enable programmed routes  to form the OLIGOMERs and the mixture was annealed with the procedure of 30\u2009\u00b0C\u201328\u2009\u00b0C\u2009\u22121\u2009\u00b0C/6\u2009h, 30\u2009\u00b0C\u201326\u2009\u00b0C\u2009\u22121\u2009\u00b0C/6\u2009h, and held at 25\u2009\u00b0C. Finally, 250\u2009\u03bcM 0.4\u2009\u03bcL wfhb strands were added to the OLIGOMERs and the mixture was incubated overnight at room temperature.The purified DNA origami templates for UNITFor regulation of the OLIGOMERs Fig.\u00a0, one samSupplementary InformationSupplementary Data 1"}
+{"text": "Emerging and reemerging plant diseases can be defined as those diseases caused by new or reappearing pathogens which, due to their intrinsic characteristics, have the ability to spread rapidly and cause epidemics in certain agro-climatic contexts. In recent years, both DNA and RNA viruses have been implicated in important disease outbreaks in plants. The different forms of mutation, recombination and other types of genetic exchange, considered as the basis of the evolutionary forces of viruses, have undoubtedly given rise tothe genetic diversity found in plant virus populations. In this context, environmental factors play an important role in driving virus evolution. In addition, the rapid expansion of human activity in the world of commerce, agriculture, anthropization of natural ecosystems and climate change have further contributed to the instability between hosts and virus populations, favouring the emergence of viruses with mutant and/or recombinant forms, with potentially negative impacts on plants, vectors and ecosystems.Lal et\u00a0al.), an important group of emerging viruses with a destructive potential on many crops; capable of causing serious social and economic losses , currently causing major losses in rice production mainly in sub-Saharan Africa (SSA). This review deals with the molecular characteristics of RYMV: the genomic structure, function and gene diversity, and RYMV-host interactions. In particular, the review sheds light on mechanisms related to the qualitative resistances, controlled by three recessive genes RYMV1, RYMV2 and RYMV3, and quantitative resistances, with the description of several QTLs found in Oryza germplasm. Finally, since RYMV shows high genetic variability and some Oryza germplasm has low or non-durable resistance, the review suggests possible genetic improvement strategies for a significant enhancement of rice protection through the use of assisted selection with molecular markers and by employing genome editing to impair susceptibility.The second review addresses the problem of yellow mottle rice virus (YMRV) , with particular reference to the contribution provided by high-throughput sequencing (HTS). The work takes into consideration the period 2011-2020, during which 45 new viruses have been described in tomato, 14 of these identified by HTS. Based on the data present in the literature and in the databases, the authors list 312 viruses, satellite viruses, or viroid species (in 22 families and 39 genera) identified in tomato. This represents the highest number of viral and viral-like agents described in a single botanical species. The work also underlines the importance of the application of HTS for epidemiological studies, in particular for the identification of the virome of weeds and other wild plants, or for the identification of viruses in vectors, irrigation water or wastewater and soil. The HTS analysis of environmental samples helps to greatly improve the understanding of epidemiology and ecology of tomato-infecting viruses and can facilitate virus disease forecasting in order to prevent virus disease outbreaks in tomato. Finally, the review outlines the main tomato viruses, highlighting their potential threat and impact. Newly emerged viruses, such as tomato brown rugose fruit virus (ToBRFV), are capable of overcoming the Tm-22 resistance gene used to contain tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) infections in greenhouse tomatoes. Tomato spotted wilt virus (TSWV) easily overcomes the resistance mediated by the Tsw hypersensitivity gene in pepper with increasing temperatures. A group of emerging geminiviruses, of subtropical and tropical origins, including tomato leaf curl New Delhi virus (ToLCNDV) and tomato leaf curl virus (TYLCV), mostly are virulent at high temperatures. Their vector, Bemisia tabaci, is notoriously thermophilic and a highly invasive species.The final review concerns the progress on tomato virome research . The work also highlights progress in the detection of ToBRFV, mainly regarding sensitivity, compared to previous methods. This paper also emphasizes the practical advantages deriving from the use of LAMP, since it can be applied by poorly equipped laboratories and unskilled persons at official country points of entry, providing a new diagnostic tool for phytosanitary investigations and management of ToBRFV. The second work describes an RT-qPCR assay for the diagnosis of parietaria mottle virus (PMoV), based on a specific TaqMan\u00ae probe ,. PMoV is considered an emerging pathogen in the Mediterranean basin on tomatoes and peppers. This virus has recently expanded its natural host range  assays, both real time and visual, for the diagnosis of ToBRFV on leaf samples and seeds of tomato and bell pepper  and desmodium leaf distortion virus (DesLDD) and two deltasatellite. This is the first report of (i) a monopartite New World begomovirus found in a host other than tomato and (ii) deltasatellites found in C. siliquosus, thus extending the host and helper virus ranges of this recently recognized class of DNA satellites.The paper of Crinivirus, family Closteroviridae) (ToCV) is expanding its geographical and host ranges associated with the emergence of whiteflies of the Bemisia tabaci complex  (genus Fabavirus in the family Comoviridae), an emerging virus in economically important crops worldwide. They investigated the BBWV2-pepper (Capsicum annuum L.) pathosystem, using two distinct BBWV2 strains, PAP1 (a severe strain) and RP1 (a mild strain). Upregulation of several genes associated with pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and ethylene signaling were associated only with the severe PAP1 strain, with high ethylene emission detected. Authors conclude that the activation of PTI-associated defense responses increase symptom development during BBWV2 infection in a virus strain-specific manner.Tomato chlorosis virus (genus  complex . Fortes Phaseolus vulgaris L.) in the North-Western Himalayan region of India by Rashid et\u00a0al. Three viruses were identified: bean common mosaic virus (BCMV), bean common mosaic necrosis virus (BCMNV), and clover yellow vein virus (ClYVV), with BCMV more widespread and BCMNV and ClYVV new records from India. In another paper , applied HTS to characterize the virome of Pseudostellaria heterophylla, generated data on three novel carlaviruses and one novel amalgavirus.HTS analysis has been applied to study the diversity of virus(es) associated with common bean  and papaya ringspot virus (PRSV) in cucurbits with a novel recombination pattern detected in the HC-pro. Despite the origin from interspecific recombination, they proposed that these viruses still belong to ZTMV according to their genome characteristics; their results provide insights into the prevalence and evolution of ZTMV and PRSV in cucurbits.Vo et\u00a0al.). ToLCNDV-ES hardly infects tomato and some isolates would not at all. Nonetheless, ToLCNDV-ES in the presence of TYLCV proves to be able to multiply and infect tomatoes. In addition to the known risk of formation of recombinants between geminiviruses, this work highlights the risks of a possible expansion of the natural hosts for this group of emerging viruses thanks to the phenomena of assistance and complementation between viruses.The last paper concerns a complementation phenomenon between TYLCV and ToLCNDV-ES, first observed in the field and then demonstrated in the laboratory with agro-inoculations of infectious clones (Emerging and Reemerging Viruses in the Context of Global Change. We are deeply grateful to all the authors and reviewers who with their exceptional work have made possible the realization of this special issue. We believe that this collection will increase knowledge and awareness about the importance of emerging and reemerging viral diseases in order to improve the monitoring and the possible control that derives from them, with the aim to prevent epidemics in agricultural crops.In summary, this Research Topic provides cutting-edge methodologies, research, observations and knowledge on the current scenario of All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication."}
+{"text": "The purpose of the study aims to understand the regeneration process and its cytology mechanism in economic echinoderms.Apostichopus japonicus was investigated by immunohistochemistry and the cell proliferation was detected by immunofluorescence and flow cytometry. Fibroblast growth factor 4 of A. japonicus (AjFGF4) was screened by RNA\u2010seq analysis and validated to regulate cell proliferation by siAjFGF4 and recombinant\u2010AjFGF4 treatment. The binding and co\u2010localization of AjFGF4 and AjFGFR2 were verified by Co\u2010IP, GST\u2010pull down, and immunofluorescence. Then, the AjFGF4\u2010AjFGFR2\u2010ERK\u2010cell cycle axis was examined by western blot, immunofluorescence, and flow cytometry techniques.The intestine regeneration process of The mesentery was served as the epicenter of intestinal regeneration via activating cell proliferation and other cellular events. Mechanically, AjFGF4\u2010mediated cell proliferation was dependent on the binding to its receptor AjFGFR2, and then triggered the conserved ERK\u2013MAPK pathway but not JNK and p38 pathway. The activated ERK\u2013MAPK subsequently mediated the expression of cell cycle regulatory proteins of CDK2, Cyclin A, and Cyclin B to promote cell proliferation.We provide the first functional evidence that AjFGF4\u2010AjFGFR2\u2010ERK\u2010cell cycle axis mediated cell proliferation was the engine for mesentery\u2010derived intestine regeneration in echinoderms. Mesentery served as the epicenter of intestinal regeneration to form a new intestine mainly via cell proliferation. Fibroblast growth factor 4 (AjFGF4) was found to regulate cell proliferation by specifically binding to AjFGFR2, and then triggered the conserved ERK\u2013MAPK pathway but not JNK and p38 pathway. The activated ERK\u2013MAPK subsequently mediated the expression of cell cycle regulatory proteins of CDK2, Cyclin A, and Cyclin B to promote cell proliferation. However, the intestine regeneration ability varies from species to species. For example, in widely studied mammals, the epithelial lining of the intestine is renewed continuously to repair local damage.Apostichopus japonicus) is an essential commercial Holothuroidea species in Asia aquaculture, and its annual worldwide trade has exceeded 15 billion US dollars. Like many other holothurians, A. japonicus has the capability to regenerate its lost digestive tract under suitable breeding conditions. However, such a spontaneous intestine remodeling process is an additional energy expenditure that diverts nutrients from growth and development, negatively affects body weight and reproduction, and sometimes even affects the function of the defense system, which is a bottleneck for the development of its commercial and subsistence fisheries.A. japonicus have focused on the morphological formation of the new intestine post\u2010self\u2010evisceration, while little is known about the cellular characteristics and molecular signaling mechanisms in the process of intestinal regeneration.A. japonicus. Impressively, we observed that the thickening of the free end of the mesentery was crucial to the formation of the intestine and such a process was always accompanied by a massive cell proliferation, which might supply additional cells necessary for the formation of new tissue. Then, RNA\u2010seq technology was conducted to identify the potential molecules for cell proliferation regulation in the process of intestinal regeneration, and a possible candidate gene fibroblast growth factor 4 (AjFGF4) was found significantly enriched during all the regeneration stages. Further assays confirmed that the AjFGF4\u2010mediated cell proliferation was facilitated by binding its receptor AjFGFR2, specifically activating the ERK\u2013MAPK pathway and promoting the expression of cell cycle\u2010related protein  during intestine regeneration. Taken together, our work not only emphasized the importance of mesentery in intestinal regeneration and uncovered a previously unrecognized mechanism of the mesentery AjFGF4\u2013AjFGFR2\u2013ERK pathway modulates intestinal regeneration via targeting cell cycle in echinoderms, but also provides a reference for the exploration of internal organ regeneration in humans.Sea cucumber (22.1A. japonicus (average weight: 100\u2009\u00b1\u20095\u00a0g) were collected from a farm in Dalian, Liaoning province, China. They were quarantined in oxygen\u2010supplying natural seawater , and fed daily with mixed feed for 1\u00a0week before treatment. After acclimation, these organisms were treated to induce evisceration by intra\u2010coelomic injection of 0.35\u2009M KCl (3\u20135\u00a0ml) and left in seawater aquaria to undergo intestinal regeneration.Healthy sea cucumbers 2.2The regeneration tissues including mesentery and/or intestinal rudiment were sampled at 2, 7, 12, 20, and 28\u2009days postevisceration (dpe) treatment. The regeneration tissues of healthy sea cucumbers without any treatment were also sampled and served as the control. These sampled tissues were fixed in Bouin's fluid for 24\u2009h and dehydrated in a graded series of alcohol (70%\u2013l00%), cleared in xylene, and infiltrated in molten paraffin. Subsequently, transverse tissue sections (5\u20136\u00a0\u03bcm) were prepared using a rotary microtome , stained by hematoxylin and eosin, and examined using light microscopy. The digital images were then taken by an Axio Vert A1 microscope (ZEISS).2.3http://rsbweb.nih.gov/ij/). At least three non\u2010consecutive tissue sections were evaluated to obtain the average of intestine rudiment area per animal. For flow cytometry assay, the single\u2010cell suspensions of each regenerated stage's tissues were harvested by digestion with collagenase type iv and trypsin (Gibco). These cell suspensions were then pelleted by centrifugation for 5\u2009min at 800g and resuspended in 4% formaldehyde for 10\u2009min. After three washes with PBST, these cells were incubated with EdU click reaction solution (Beyotime) for 30\u2009min at room temperature in dark. After the last wash in a triple, the percentage of proliferation activity of these cells (105 cells) was measured by a flow cytometer (Miltenyi Biotec). The data were analyzed using FlowJo software v10.6.1 (BD Biosciences).5\u2010Ethynyl\u20102\u2032\u2010deoxyuridine (EdU)\u2010based immunohistochemistry and flow cytometry methods were performed to detect the tissue distribution characteristics and quantitative dynamic trend of cell proliferation during intestinal regeneration. EdU was injected intraperitoneally 24\u2009h in advance at each sampling time point of intestinal regeneration. For immunohistochemistry, a dorsal incision of sea cucumber was made to expose its internal cavity and facilitates the separation of the mesentery from the body wall and intestine. In the case of non\u2010eviscerated sea cucumbers, the mesentery attached to the intestine and body wall was stripped away using small surgical scissors. The full length of mesentery from the anterior end (next to the esophagus) to the posterior end (next to the cloaca) of sea cucumbers were sampled and embedded in the frozen section compound  and stored at \u221280\u00b0C. Then, continuous 6\u2010\u03bcm thick frozen sections of these tissues were performed using a Leica CM1900 cryostat at \u221220\u00b0Cand immersed with pre\u2010cooled (4\u00b0C) acetone for 15\u2009min. Following washed in PBST (PBS containing 0.5% Tween 20) for 10\u00a0min, the sections were permeabilized with a harsh detergent like Triton X\u2010100 (0.5 and 0.05%) for 30\u2009min. After being washed again, the sections were thereafter incubated with EdU click reaction solution for 30\u2009min at room temperature in dark. Finally, the sections were stained with Hoechst 33342 to visualize the nucleus for 10\u2009min at room temperature and observed by a fluorescence microscope (ZEISS). The size of the regenerative tissues was calculated by the ImageJ software (2.4A. japonicus genome (MRZV00000000.1) using HISAT2. Potential novel transcripts were evaluated by StringTie and CPC2 v1.0.1.p\u2009<\u20090.05 and FoldChange >2).The regeneration tissues from nine individuals were respectively sampled at each sampling time point as described above and combined as one specimen for transcription sequencing. Total mRNA was performed following the protocol described by Sun et al.2.5A. japonicus  were inserted into the expression vector pGEX\u20104\u00a0T\u20102 (Novagen) and then were transformed and induced in Escherichia coli Rosetta (DE3) by 0.5\u2009mM isopropyl\u2010\u03b2\u2010D\u2010thiogalactopyranoside at 18\u00b0C overnight. The gene\u2010specific primers were listed in Table\u00a0Fibroblast growth factor 4 sequences of The antibodies used in this study were all listed in Table\u00a02.6g for 20\u2009min at 4\u00b0C, the supernatants of the cell lysates were immunoprecipitated using Protein A/G magnetic beads  which were bound with anti\u2010flag  or anti\u2010GFP antibodies  and rotated slowly at 4\u00b0C overnight. The precipitates were washed 10 times with lysis buffer and then eluted by boiling the pellets with 5\u2009\u00d7\u2009SDS PAGE loading buffer. Finally, the eluted samples were analyzed by immunoblotting with the indicated antibodies.The full\u2010length open reading frame of FGF4 1\u2013352 aa) and the IG2 and IG3 domain regions (81\u2013431 aa) of FGFR2 were respectively cloned and inserted into the pcDNA3.1\u2010EGFP and pcDNA3.1\u20133\u2009\u00d7\u2009flag expression vector (Invitrogen) to construct the following plasmids: pcDNA\u2010flag\u2010FGF4, pcDNA\u2010flag\u2010FGFR2, and pcDNA\u2010EGFP\u2010FGFR2. The primers used to amplify the gene fragments were listed in Table\u00a0\u2013352 aa a2.7E. coli Rosseta cells harboring induced expression of GST\u2010tag labeled AjFGF4 or GST\u2010tag were pelleted by centrifugation and lysed in lysis buffer via ultrasonication. After centrifugation at 13,000g at 4\u00b0C for 15\u2009min, the GST\u2010tag and GST\u2010tag\u2010labeled AjFGF4 protein was purified by anti\u2010GST magnetic beads  and used for pull\u2010down assays. Subsequently, the GST magnetic beads were washed five times with lysis buffer to remove unbound proteins and were then used to incubate with HEK\u2010293T cell lysate overnight which was transfected with pcDNA\u2010flag\u2010FGFR2 plasmids. Finally, the beads were washed five times with 10 resin\u2010bed volumes of RIPA buffer for 10\u00a0min and then analyzed via immunoblot analysis to detect the flag\u2010FGFR2 proteins using an anti\u2010flag antibody .To further explore the direct combination relationship of AjFGF4 and AjFGFR2, the pull\u2010down assay was performed as previously reported with minor modifications.2.86 cells in each group) and fixed in 4% paraformaldehyde for 15\u2009min. After washing three times with PBS, the fixed cells were then pre\u2010incubated with 0.5% Triton\u2010X\u2010100 in PBS for 10\u00a0min, then blocked with 5% bovine serum albumin (BSA) in PBS for 90\u2009min at room temperature. Next, the four groups of cells were respectively incubated with the pre\u2010immune mouse sera (1:200 dilution), and the pre\u2010immune rabbit sera (1:200 dilution), the mouse anti\u2010FGFR2 antibody (1:200 dilution) and the pre\u2010immune rabbit sera (1:200 dilution), the rabbit anti\u2010FGF4 antibody (1:200 dilution), and the pre\u2010immune mouse sera (1:200 dilution), and the mouse anti\u2010FGFR2 antibody (1:200 dilution) and rabbit anti\u2010FGF4 antibody (1:200 dilution) as the primary antibodies in a moisture chamber at 37\u00b0C for 90\u2009min. After washing three times with PBST, the cells were first incubated with FITC\u2010conjugated goat anti\u2010mouse IgG  as the secondary antibodies at 37\u00b0C for 90\u2009min. After another three washes with PBST, Cy3\u2010conjugated goat anti\u2010rabbit IgG (H1L)  was then incubated with the cells at 37\u00b0C for 90\u2009min. Then, the nuclei were stained in DAPI  for 10\u00a0min at room temperature. Images were captured using a laser scanning spectral confocal microscope (ZEISS).The immunofluorescence analysis was performed to detect the subcellular localization of AjFGF4 and AjFGFR2 in sea cucumber coelomocytes. The single\u2010cell suspensions of regenerating tissues at 12 dpe were prepared by digestion with collagenase type iv and trypsin (Gibico) for 1\u2009h at 4\u00b0C. Cells were divided into four groups , cells were resuspended in Leiboviz's L\u201015 cell culture medium (Invitrogen) containing penicillin (100\u2009U/ml) and streptomycin sulfate (100\u2009mg/ml). Next, for RNA interference, siAjFGF4, siAjFGFR2, or siRNA\u2010NC transfected with Lipofectamine 6000 (Beyotime) according to the manufacturer's recommended conditions. At 48 and 72\u2009h post\u2010interference, the cells were collected and used to analyze the protein and phosphorylation levels of p38, JNK, and ERK.The specific interference oligonucleotides targeting AjFGF4 (siAjFGF4\u20101 and siAjFGF4\u20102), AjFGFR2 (siAjFGFR2\u20101 and siAjFGFR2\u20102), and its negative control siRNA (siNC) were designed and synthesized by the GenePharma Company  is a type of ERK inhibitor, which inhibited the kinase activity of ERK1 and ERK2, with Ki values of 0.31 and 0.14\u2009\u03bcM, respectively.2.11A. japonicus through AjFGFR2, the eviscerated\u2010sea cucumbers were transfected with siAjFGFR2 for six times in every 2\u2009days and supplemented it with 5\u00a0\u03bcg rAjFGF4 or BSA at 24\u2009h post\u2010siAjFGFR2 transfection, and the cell proliferation levels and the size of regenerative tissues were detected. For exploring whether AjFGF4/AjFGFR2\u2010mediated cell proliferation through the ERK\u2013MAPK pathway during intestinal regeneration, the single\u2010cell suspension of the mesentery at the stage of 12 dpe was cultured, treated with specific inhibitor FR180204 for ERK and its control DMSO for 24\u2009h, and further supplemented it with 500\u2009ng rAjFGF4 to detect the cell proliferation levels by the EdU staining assay. To address whether the cell proliferation could be regulated by the AjFGF4/AjFGFR2\u2010ERK axis through the expression of cell cycle\u2010related proteins, the eviscerated\u2010sea cucumbers were transfected with FR180204 for six times in every 2\u2009days and supplemented with the 5\u00a0\u03bcg rAjFGF4 or BSA at 24\u2009h post\u2010siAjFGFR2 transfection, and the cell proliferation levels and the protein expression level of CDK2, Cyclin A, and Cyclin B were detected.The purified and refolded rAjFGF4 were prepared as described above. For verifying whether AjFGF4 mediates the intestinal regeneration in 2.12p\u2009<\u20090.05, **p\u2009<\u20090.01, ***p\u2009<\u20090.001, ****p\u2009<\u20090.0001.All statistical analyses were performed using GraphPad Prism program . One\u2010way analysis of variance (ANOVA) was applied to discern significant differences between the control and experimental groups for the percentage of EDU\u2010positive cell population. These results were representative of at least three independent experiments and were presented as mean\u2009\u00b1\u2009standard deviation (SD) and significance levels were defined as *33.1A. japonicus following spontaneous evisceration, the morphological changes of internal organs during the period of self\u2010evisceration and regeneration were observed for 28\u2009days. Our result showed that only a part of the esophagus, cloaca, and a continuous mesentery remained in the body cavity left after evisceration . More interesting was that the muscle layer disappeared from the growth along the mesentery up to its tip , which might involve a fate transition of cell dedifferentiation. Subsequently, the first indication of swelling of the distal mesentery was observed at the stage of 7 dpe . The muscle layer gradually disappeared from the free end of the mesentery, and only a little was observed near the end of the body cavity wall . In the following days (12 dpe), there was significant growth in the size of the thickening that would form the intestinal rudiment. This rudiment acquired an elongated oval morphology composed of a large number of cells within an inner connective tissue and starts, although in some cases or sections the growth could be somewhat irregular . In the late stage of regeneration (28 dpe), the intestinal rudiment continued to grow and acquired a digestive tract shape . As noted above, our results confirmed that the mesentery played an important role in the process of intestinal regeneration and the new intestinal rudiment was a swelling developed at the free edge of the mesentery in A. japonicus, which might involve a series of cellular events .To investigate the intestine regeneration process of n Figure\u00a0. Notablye Figure\u00a0, and inge Figure\u00a01. The mr Figure\u00a0. At the r Figure\u00a0, and ther Figure\u00a01. In the Figure\u00a0. The inte Figure\u00a01. As no3.21\u20133\u2013f1\u20133) were sampled as shown in Figure\u00a01\u2013b3). Then, at the stage of 7 dpe, the number of EdU\u2010labeled cells increased in all areas of the intestinal rudiment, especially at the free end of the mesentery, which correlated with an increase in its size . From the 12 dpe, the cell masses were observed in all samples in the form of thickenings at the free end of the mesentery. At this time, a very narrow cavity was found in the anterior regenerated primordium, which was near the end of the esophagus. The distribution of EdU\u2010labeled dividing cells was somewhat heterogeneous with more labeled cells found in the mesothelial layer and luminal epithelium of the distal mesenterial area. However, during this period, the regeneration primordia of the medial and posterior sides were smaller than that of the anterior side, and no cavity formation was observed. The proliferating cells of the mesentery were distributed in the mesothelial layer at the end of the mesentery . At the stage of 20 dpe, except for the regenerated primordia in the middle, cavities were formed in both the front and rear ends, and proliferating cells exploded in large numbers, and were distributed in the cavities of the terminal enlargement, which seemed to prepare for the formation of intestinal epithelial cells . Afterward, in the later stages of intestinal regeneration (28 dpe), the entire intestinal rudiment including the anterior, middle, and posterior had formed a cavity, and EdU\u2010labeled dividing cells were mainly distributed in the mesothelial layer and the epithelial layer that has formed folds .According to our histochemical results described in Figure\u00a0e Figure\u00a0, c1\u2013c3. y Figure\u00a0, d1\u2013d3. s Figure\u00a0, e1\u2013e3. s Figure\u00a0, f1\u2013f3.We also performed EdU\u2010based flow cytometry to detect the changes in cell proliferation during intestinal regeneration under the same conditions. As shown in Figure\u00a03.3p\u2009<\u20090.05) at the stage of 2\u2010, 7\u2010, 12\u2010, 20, and 28 dpe, respectively. In view of the fact that the cell proliferation of 2 dpe is not obvious in the results  were used to investigate the underlying molecular pathways involved in cell proliferation during intestine regeneration. The raw data has been uploaded to NCBI Sequence Research Archive under accession number SAMN29388289. The result showed that 14,763, 13,037, 13,990, 12,856, and 11,516 DEGs were detected , a total of four FGFR candidates were found, including AjFGFR1 , AjFGFR2 , AjFGFR3 , and AjFGFR4 . First, the AphaFold2 was used to predict the protein structure prediction.https://zdock.umassmed.edu/) was performed to identify the possible binding partners of these four AjFGFR candidates to AjFGF4.In higher vertebrates, FGFs function by interacting with their specific receptors (FGFRs) to activate different signals in various cells.3.5A. japonicus.To further explore whether AjFGF4 mediated intestinal regeneration by recognizing AjFGFR2, we investigated the changes in the levels of cell proliferation during intestinal regeneration post\u2010siAjFGFR2\u20101/ siAjFGFR2\u20102 or siRNA\u2010NC treatment. As shown in Figures\u00a0A. japonicus through AjFGFR2, we transfected siAjFGFR2 in eviscerated\u2010sea cucumbers six times every 2\u2009days and then supplemented it with the same dose of rAjFGF4 or BSA at 24\u2009h post\u2010siAjFGFR2 transfection. As shown in Figure\u00a0To further verify that AjFGF4 mediated the intestinal regeneration in 3.6The MAPK signaling pathway was reported to be closely associated with cell survival, proliferation, and differentiation during regeneration in several animals, such as hydra and zebrafish.3.7In mammals, the complex of cyclins and CDKs could drive cell from one stage to another during cell proliferation.4A. japonicus).A. japonicus. Notably, an increase in cellular proliferation was also observed closely with the size of the initial intestinal rudiment on the edge of the mesentery. Mechanically, we reported mesentery AjFGF4\u2010AjFGFR2\u2010ERK axis was involved in regulating intestinal regeneration via targeting cell cycle proteins in echinoderms. We found that AjFGF4 regulated A. japonicus cell proliferation depending on the recognition of AjFGFR2 during intestinal regeneration. Moreover, AjFGF4/AjFGFR2 modulated intestinal regeneration by promoting the expression of the cell cycle\u2010related proteins  by specifically activating the ERK\u2013MAPK pathway, but not the JNK and the p38 pathway , Natural Science Foundation of Zhejiang Province (LZ19C190001), Research and Innovation Fund of Ningbo University (IF2022151) and the K.C.Wong Magna Fund in Ningbo University to Chenghua Li. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.The authors declare no conflict of interest.Data S1 Supporting informationClick here for additional data file."}
+{"text": "ATP binding to NBS1 is likely maintained along several transport cycles. Asymmetric NBD behaviour is ensured by lower signal transduction from NBD1 to the rest of the protein owing to the absence of ball-and-socket conformation between NBD1 and coupling helices. Even though surrounding lipids play an active role in the allosteric communication between the substrate-binding pocket and NBDs, our results suggest that lipid composition has a limited impact, mostly by affecting transport kinetics. We believe that our work can be extended to other degenerate NBS ABC proteins and provide hints for deciphering mechanistic differences among ABC transporters.Multidrug resistance-associated proteins are ABC C-family exporters. They are crucial in pharmacology as they transport various substrates across membranes. However, the role of the degenerate nucleotide-binding site (NBS) remains unclear likewise the interplay with the surrounding lipid environment. Here, we propose a dynamic and structural overview of MRP1 from  Molecular dynamics simulations of multidrug resistance protein 1 (MRP1) with varying membrane composition suggest that the composition has limited impact on the structures, but rather affects the conformational transitions and kinetics of substrate transport. ABC transporter structures are made of at least two transmembrane domains (TMDs) consisting of six transmembrane helices (TMHs). TMDs are bound to two nucleotide-binding domains (NBDs) which are evolutionarily conserved over species. ABC transport cycle requires the binding of two ATP molecules and the energy released from the hydrolysis of at least one of them7. ATP molecules bind at the interface of the NBD dimer which adopts a non-covalent pseudo-symmetric head-to-tail arrangement; enabling the formation of two nucleotide-binding sites (NBSs). Both NBSs are formed by the conserved Walker A- and B-motifs, the A-, Q- and H-loops of one NBD and the ABC signature sequence and the X-loop of the other NBD8.ATP-binding cassette (ABC) transporters belong to one of the largest trans-kingdom protein superfamilies. The structural resolution of several ABC transporters has led to different conformations , which illustrate the alternating access as the most likely model to rationalise substrate translocation along the transport cycle10, eukaryotic ABC transporters are exporters, i.e., they extrude substrates to the extracellular compartment. Eukaryotic ABC transporters used to be classified into type I  and type II  families. Recently, the structural and functional diversities of ABC transporters have led to a new folding-based classification3 in which the previous type I and type II exporters adopt the type IV and V folding, respectively.Except for a few members 8. In the non-canonical NBS1, the Walker B catalytic glutamate, the A-loop tyrosine, and the first glycine residue of the ABC signature motif are mutated into aspartate, tryptophan, and valine residues, respectively. These mutations were associated with significantly lower ATPase activity and higher ATP-binding affinity for the degenerate NBS17. These observations have recently led to the development of a new asymmetric model for NBD function which may affect the dynamics and function of the whole transporter7. The function and kinetics of bovine ABCC1/MRP1 (bMRP1) were extensively and thoroughly investigated by combining structural information from cryo-electron microscopy (cryo-EM) experiments and single-molecule F\u00f6rster Resonance Energy Transfer (smFRET)5. Despite the robust insights provided by the resolution of bMRP1 structure, unexplained differences between ABCB and ABCC exporters were observed, partially due to the non-native detergent-based environment used for bMRP1 experiments11.Multidrug resistance-associated proteins (MRPs) are NBS degenerate ABC transporters12. Over the past decades, ABCC transporters, in which MRPs are included, have gained a growing interest owing to their role in pharmacology including patient inter-individual responses to treatments. For instance, investigations on ABCC2/MRP2 and ABCC4/MRP4 have been recommended by the ITC to retrospectively provide a mechanistic explanation of clinical observations regarding drug dispositions13. Given the role of MRPs in local pharmacokinetics and pharmacodynamics relationships (PK/PD) and therefore in local drug bioavailability14, there is still a need to decipher in situ MRP transport cycle to provide a comprehensive overview of xenobiotic membrane crossing events. This is particularly relevant for MRPs located in proximal tubular kidney cells and liver hepatocytes since kidneys and liver are involved in the elimination of most worldwide used xenobiotics15.ABC transporters play a crucial role in pharmacology by transporting a tremendous variety of substrates, including xenobiotics and endogenous compounds, across cell membranes. For instance, their pharmacological role has been stressed by the International Transporter Consortium (ITC) which draws out a list of transporters of \u201cemerging clinical importance\u201d for which interactions with new xenobiotics have to be investigated in drug development16 has been proposed for which the computational resolution precludes functional investigations or thorough structural dynamics. However, several conformations of bMRP1 transporter have been resolved by cryo-EM8. Given the high sequence similarity to the human ortholog hMRP1 (91%) as well as within other human MRPs (ca. 40\u201350%), the use of bMRP1 structures as prototype appears relevant for investigating MRP transporter dynamics and functions3. MRP1 exporter adopts the type IV folding; however, it has an extra N-terminal TMD made of five TMHs. The so-called TMD0 was shown not to play a role either in ABC ATPase activity or substrate transport8. Therefore, a TMD0-less MRP1 model can be used as a prototype for ABCC exporters even for those which do not possess this domain . TMD0 is connected to conventional ABC TMDs by a linker (L0) which was shown to be mandatory for both trafficking and function17. The L0 sequence is conserved in all members of the ABCC subfamily even in absence of TMD08. It is important to note that since the present model does not include TMD0, the standard TMH labelling for ABC type IV will be used in the present manuscript, i.e., TMH1 to TMH12.Unfortunately, there is no experimentally resolved structure for human MRPs yet. An MD-refined protein threading MRP4 structure18 of MRP1 considering different bound states  highlighting the importance of asymmetry in ABC domains. Furthermore, given the importance of surrounding lipids in the ABCC transport cycle19, the interplay between the lipid bilayer and protein dynamics was also investigated. This was achieved by using different computational symmetric membrane models made of (i) pure POPC , (ii) pure POPE , (iii) POPC:POPE (3:1), (iv) POPC:Chol (3:1) and (v) POPC:POPE:Chol (2:1:1); the last being the closest to mimic in situ MRP1 dynamics. All-atom unbiased microsecond-scaled molecular dynamics (MD) simulations were conducted to address the objectives.The present work aims to map the ABC conformational spacebMRP1, different structural descriptors were considered according to previous studies18. Namely, intracellular (IC) and extracellular (EC) angles were monitored for TMDs while NBD distance and NBD rocking-twist angle were used for NBDs 2 displayed minor openings of the EC gate as compared to bMRP1 OF cryo-EM structures, suggesting the existence of a slightly more open state. However, calculated EC angles remained small (lower than 20\u00b0 in POPC:POPE:Chol (2:1:1), see Fig.\u00a01.To examine the conformational space sampled during the simulations in POPC:POPE:Chol 2:1:1) accounting for bound states of :1 accounBDs Fig.\u00a0; the lation Fig.\u00a0. Averagents Fig.\u00a0. On the bMRP1-LTX-(ATP)2) tend to populate the ABC conformational subspace of OF conformation 2 state are similar to OF ABC conformations. However, NBD distances remain larger than for resolved substrate-free OF ABC structures and OF bMRP1-(ATP)2 simulations. Distances between C\u03b1 atoms of the ABC signature motif serine and a Walker A glycine were monitored 2 and OF bMRP1-(ATP)2, respectively) suggest that a conformational transition of NBD dimer is required prior to the substrate translocation event. Such transition from the so-called \u201cnon-competent\u201d to \u201ccompetent\u201d NBD dimer conformations is likely to trigger TMD conformational transitions suggesting that it might be the limiting step for IF-to-OF transition.Even though trajectories performed with the pre-translocation state 2 in the upper leaflet 2\u2009>\u2009IF bMRP1-(LTX)\u2009\u2248\u2009IF bMRP1-LTX-(ATP)2\u2009>\u2009OF bMRP1-(ATP)2. This is in line with the role of substrate which was shown to bind TM bundles in ABC transporters18, including bMRP15. In contrast to IC angle and NBD distance which tend to rapidly decrease in early stage of MD simulations, TM pore radii at selected depths in lipid bilayer remain relative constant along simulations.7, NBD2 being more flexible than NBD1. For each system, backbone-based principal component analyses (PCA) were conducted. Only the three first largest principal components were considered, revealing 85.6% to 95.9% of the overall structural variabilities depending on the system 2 and bMRP1-LTX states 2 even though ATP molecules were expected to maintain interactions at the NBD dimer interface. In presence of both substrate and ATP molecules, only the closed population was observed picturing the information transduction from the TMD substrate-binding pocket to NBDs in order to likely decrease the energy barrier for IF-to-OF transition in type IV folding ABC transporters21.The asymmetric behaviour was also pictured by the supramolecular arrangement between NBD1 and NBD2 for which two main subpopulations were observed for apo, tes Fig.\u00a0. Interes21. Natively, ABC transporters exhibit four coupling helices linking intracellular domains of TMH2/TMH3, TMH4/TMH5, TMH8/TMH9, and TMH10/TMH11. The so-called CH2-3 and CH10-11 are in contact with NBD1 while CH4-5 and CH8-9 interact with NBD2  for which only a few contacts were observed. On the other hand, the so-called \u201cstrong CH\u201d  exhibited more contact with the NBD and for which the \u201cball-and-socket\u201d arrangement is significantly more pronounced than for the \u201cweak CH\u201d. Interestingly, in mammalian MRP1, the NBD1 sequence exhibits a 13-aminoacid deletion which is associated with fewer contacts and significantly weaker interactions between CH2-3 and CH10-11 as compared to CH4-5 and CH8-9 for NBD2  to be responsible for the aforementioned NBD asymmetric opening and (ii) to preclude the information transduction between TMDs and NBD18.In order to explain the asymmetric behaviour of NBDs, particular attention was paid to coupling helices (CH) which ensure the signal transduction from TMDs to NBDsBD2 Fig.\u00a0. ContactBD2 Fig.\u00a0. Interes22. Taking advantage of our extensive unbiased MD simulations, explored conformational subspaces were featured in terms of free energy using the InfleCS clustering methods23 . Given the amphiphilic feature of leukotriene C4, Coulomb and H-bond networks have been shown to be central for substrate-binding8. MD simulations highlighted the same key residues which were experimentally observed 2 and bMRP1-LTX or bMRP1-(ATP)2 remained low, they suggest a distant effect between NBSs and the substrate-binding pocket. Allosteric effect was assessed between the substrate-binding pocket and NBS1 and NBS2, independently 2, and bMRP1-LTX-(ATP)2 as well as OF bMRP1-(ATP)2 2 Fig.\u00a0, other sBSs Fig.\u00a0. However28 and membrane proteins, lipid-dependent protein dynamics and lipid-protein interactions were investigated. This was achieved by carrying out MD simulations in different lipid bilayers, namely POPC, POPC:Chol (3:1), POPC:POPE:Chol (2:1:1). IF apo bMRP1 and OF bMRP1-(ATP)2 systems were also considered in unrealistic POPE and POPC:POPE (3:1) lipid bilayers.As nowadays more attention has been paid to the interplay between the surrounding lipid environmentbMRP1 structures in different lipid bilayer models, they did not sufficiently picture the dynamic variability over MD simulations and replicas . It suggests a limited impact of cholesterol on the opening of bMRP1 EC gate. However, the presence of PE lipids slightly shifted the calculated minima toward more opened OF structures, from 13.9 to 18.5\u00b0. Tilt angles between TMHs and lipid bilayer normal were measured in order to unravel slight differences between the distinct lipid bilayer compositions  for palmitate and oleate tails  as compared to other lipid bilayer membranes. Lipid order calculations also suggest a weak impact of protein dynamics on lipid bilayer structures. Indeed, IF apo and OF bMRP1-(ATP)2 MD simulations exhibited slightly less ordered lipid tail profiles than IF bMRP1-LTX, bMRP1-(ATP)2 and bMRP1-LTX-(ATP)2. This may be explained by larger variability of intracellular and extracellular openings for IF and OF conformation, respectively, which in turn is likely to lead to more pronounced displacements of surrounding lipids. Membrane free energy deformations30 were also assessed to document the impact of bMRP1 conformations onto lipid bilayer structures  in which membrane is stabilised in presence of bMRP1  are involved in the regulation of potassium channels32. Over the past decade, particular attention has been paid to MRP transporters including MRP1, MRP2 and MRP4 given their clinically and pharmacologically relevant roles in drug disposition as pointed out by the ITC13. In contrast to its cousin ABCB1/P-gp, knowledge about MRP1 dynamics and functions still remains fragmented although it has been resolved in multiple states, such as IF apo and substrate-bound states8 and two OF states under pre-4 and post-hydrolysis5 conformations, respectively bound to either two ATP molecules or to ADP/ATP pair. In the present work, an extensive set of all-atom MD simulations were performed in order to capture conformational dynamics of bMRP1 in different states considering different mixtures of lipid bilayer models including PC and PE lipids as well as cholesterol. We propose an MD-based computational approach in order to (i) complete the experimental observations made in detergents and (ii) highlight structural patterns which might be extended to, at least, other ABC C-family transporters.7 that wide-open IF structures may be unlikely in native membrane environments. Wide-open structures observed in cryo-EM experiments are thus believed to be due to artifacts owing to the use of non-physiological environments for structure resolution7, in agreement with structural differences observed e.g., for P-gp reconstituted either in detergents or in nanodiscs11. The NBD1 13 amino-acid deletion, such as the absence of the \u201cball-and-socket\u201d structure for NBD1, might weaken the coupling between NBD1 and TMH10/TMH11. In absence of substrate, this is associated with larger translational flexibility regarding NBD1 leading to the opening of NBD dimer. However, in presence of ATP molecules and substrate, only close NBD dimer conformations were observed  shows significant variations of IF structures with respect to cryo-EM structures. In IF states, spontaneous closing of NBDs was systematically observed regardless of the presence of ATP molecules as pictured by IC angle and NBD distance values which all converged toward the same subspace. Regarding ABC conformational space, the presence of either ATP molecules in both NBSs or substrate in the TMD binding pocket mostly shifts the dynamics of NBD dimerisation by modulating the NBD twist value Fig.\u00a0. Therefoved Fig.\u00a0 highlighved Fig.\u00a0. This mi2. In agreement with structural observations, substrate access directly from either high- or low-density lipid tail regions of the membrane is very unlikely owing to the absence of an access channel in the lipid bilayer contrary to P-gp8. However, amphiphilic substrates might partition in the high-density polar head region. Therefore, MRP1 substrate access is expected to occur either directly from the cytoplasm or from the high-density polar head region, for which access might be possible via TMH4 and TMH6  which was shown to be required for the MRP1 transport function17. Even if the role of lipids might sound limited on MRP1 as compared to other membrane receptors and channels, more attention should be paid to lipid-protein interactions, not only regarding the biophysical impact on the protein dynamics but also as transport modulator as recently proposed for P-gp11.Out of the physical role of lipid bilayer on protein dynamics, our results support that lipid components also play an active role in transporter function. In line with computational observations made on other membrane proteinsThe present work provided structural insights into the function and the lipid-protein interplay of NBS degenerate ABCC transporters for further investigations such as the role of MRPs in local pharmacokinetics, including e.g., the impact of rare mutations/polymorphism as well as disease-based membrane lipid imbalance toward personalised medicine.bMRP1, different conformations and bound states were considered in the present study: IF apo bMRP1, IF bMRP1-(ATP)2, IF bMRP1-LTX, IF bMRP1-LTX-(ATP)2 and OF bMRP1-(ATP)2. The cryo-EM structures were used as starting structures for IF (PDB ID: 5UJ98 and 5UJA8) and OF conformations (PDB ID: 6BHU4). OF conformation was resolved using E1454Q mutant which was shown to lower the rate of ATP hydrolysis thus promoting OF structure determination4. This mutation was reverted manually for the present study. The so-called TMD0 was not included in the present models as it has already been shown not to affect the substrate transport8. However, it was shown that the so-called pre-TMH1 lasso domain (L0) is mandatory for MRP1 function while it was not totally resolved in any cryo-EM MRP1 structures17. Missing parts of L0 domain was modelled using either I-Tasser (Iterative Threading ASSEmbly Refinement) server36 or modeller v9.2337 for IF and OF conformations, respectively. Indeed, I-Tasser initially failed to predict consistent L0 domain for OF bMRP1-(ATP)2 state as compared to IF model. Therefore, for sake of consistency, OF bMRP1-(ATP)2 L0 domain was built using modeller v9.23 based on the sequence but also IF L0 domain model as template 2-bound states while OF conformation was solely constructed in the ATP2-bound state. IF bMRP1-(ATP)2 and IF bMRP1-LTX-(ATP)2 were constructed by superimposing separately NBD of 5UJ9 and 5UJA, respectively onto the NBDs of OF conformation in which both ATP molecules and Mg2+ are bound to NBSs. All final models were shortly minimised in vacuum using the Amber18 package39 to avoid unphysical steric clashes.IF conformations were built in different bound states, namely apo, ATP41 was used to embed the different bMRP1 models into different lipid bilayers, namely pure POPC, POPC:Chol (3:1) and POPC:POPE:Chol (2:1:1) taking advantage of bMRP1 coordinates obtained from the OPM (Orientations of Proteins in Membranes) database42. IF apo bMRP1 and OF bMRP1-(ATP)2 structures were also embedded into pure POPE and POPC:POPE (3:1) lipid bilayers in order to specifically investigate lipid-protein interactions with PE lipids. The resolved cryo-EM structure of OF bMRP1-(ATP)2 also includes three resolved cholesterol molecules which were kept during all simulations in order to investigate their importance. From these different lipid bilayer compositions, POPC:POPE:Chol (2:1:1) mixture appeared the most relevant to model cell membranes. The other types of membranes were considered to help understand the role of each lipid in protein dynamics. The original total size of every system was ca. 120\u2009\u00d7\u2009120\u2009\u00d7\u2009180\u2009\u00c53 . Regarding ATP2- and LTX-bound systems, substrate, nucleotides and Mg2+ ions were added after building protein-lipid systems; therefore, neutrality was ensured by randomly removing the corresponding number of counterions. Amber FF14SB46, Lipid1747 and the modified DNA.OL1549 force fields were used to respectively model protein residues, lipids and ATP molecules. Water molecules, Mg2+ ions and counterions were modelled using the TIP3P water model45 as well as the corresponding monovalent and divalent ion parameters from Joung and Cheatham51. LTX (Leukotriene C4) substrate parameters were derived from the Generalised Amber Force Field version 2 (GAFF2)52 using the Antechamber software53. LTX partial atomic charges were derived from quantum mechanical based calculations at the HF/6-31G* level of theory, using the R.E.D. server54. Each system was simulated with periodic boundary conditions. The cutoff for non-bonded interactions was 10\u2009\u00c5 for both Coulomb and van der Waals potentials. Long-range electrostatic interactions were computed using the particle mesh Ewald method55.CHARMM-GUI39 using CPU and GPU PMEMD versions. Minimisation was carried out in four steps by sequentially minimising: (i) water O-atoms ; (ii) all bonds involving H-atoms ; (iii) water molecules and counterions  and (iv) the whole system . Each system was then thermalized in two steps: (i) water molecules were thermalized to 100\u2009K during 50\u2009ps under  ensemble conditions using a 0.5\u2009fs time integration; (ii) the whole system was then thermalized from 100\u2009K to 310\u2009K during 500\u2009ps under  ensemble conditions with 2\u2009fs timestep in semi-isotropic conditions. Then, each system was equilibrated during 5\u2009ns under  ensemble conditions with 2\u2009fs timestep in semi-isotropic conditions, using Berendsen barostat. Production runs were then carried out at the microsecond scale with 2\u2009fs integration timestep under  ensemble conditions with semi-isotropic scaling. Temperature was maintained using the Langevin dynamics thermostat56 with 1.0\u2009ps\u22121 collision frequency. Constant pressure set at 1\u2009bar was maintained with semi-isotropic pressure scaling using either Berendsen barostat57 for IF apo bMRP1 and OF bMRP1-(ATP)2 or Monte Carlo barostat for IF bMRP1-(ATP)2, IF bMRP1-LTX and IF bMRP1-LTX-(ATP)2. The latter was used to speed up computational time.Minimisation and thermalisation of the systems and MD simulations were carried out with Amber18 and Amber20 packages58. Shortly, a set of distance-based restraints were applied between the A-loop tryptophan/tyrosine residues  and corresponding ATP purine moiety. Mg2+-ATP-NBD arrangement was maintained by applying restraints between Mg2+ ions and ATP phosphate groups as well as between Mg2+ ions and Walker A serine and Q-loop glutamine residue . Moreover, ATP phosphate moieties were also restrained with surrounding Walker A residues. All distances were restrained using harmonic potentials for which minimal distances and force constants are reported in Supplementary Tables\u00a02+ ions were kept during the whole simulation.In order to ensure the ATP docking into NBS, restraint-MD simulations were carried out using a similar approach as proposed by Wen et al.Snapshots were saved every 100\u2009ps. For each system, three replicas were performed to better sample the local conformational space. Each production run was carried out for 2.0\u20132.5\u2009\u03bcs and 1.5\u20132.0\u2009\u03bcs, respectively for IF and OF models . The so-called ABC structural parameters  were calculated using the same definition as proposed by Hofmann et al.1 for IC angle, EC angle, EC distance and NBD distance or Moradi et al.18 for NBD twist. Shortly, IC angle describes the IC opening of substrate entry and is defined by the angle between two vectors; both starting from the centre-of-mass of the whole extracellular region and directed toward either the IC region of TMH1, TMH2, TMH3, TMH6, TMH10 and TMH11 or the IC region of TMH4, TMH5, TMH7, TMH8, TMH9 and TMH12. Likewise, EC angle describes the EC opening for substrate release and is defined by the angle between two vectors starting from the centre-of-mass of both NBDs and directed toward either the EC region of TMH1, TMH2, TMH9, TMH10, TMH11, and TMH12 or the EC region of TMH3, TMH4, TMH5, TMH6, TMH7, and TMH8. EC distance was defined as the distance between the EC regions of TMH1, TMH2, TMH9, TMH10, TMH11, and TMH12 and the EC region of TMH3, TMH4, TMH5, TMH6, TMH7, and TMH8. NBD distance was defined as the distance between the two NBD centres-of-mass. Since these definitions were applied to the present MD models of bMRP1 but also to available resolved structures of other ABC transporters, intracellular and extracellular regions were defined based on the membrane thickness proposed in the OPM database42. Residue selections for each system and each structure parameter are reported in Supplementary Table\u00a064. Structural parameters  were taken to monitor the free energy landscape using a grid size set at 80, from 2 to 12 gaussian components for each GMM obtained by a maximum of 20 iterations. The relevance of InfleCS approach strongly relies on the quality of sampling during MD simulations. In the present work, InfleCS only pictures the free energy landscape around the local minima sampled during our MD simulations. Furthermore, MD sampling and relevance of InfleCS for the present systems were ensured by calculating the convergence profiles for each structural parameter separately  by bootstrapping every 100\u2009ns along MD trajectories (i.e. 10 snapshots\u2009\u00d7\u20093 replica each 100\u2009ns). Profiles were then averaged and PC P atom z-density profiles were used to define the centre of the lipid bilayer membrane (z\u2009=\u20090). Regarding tilt angles, all systems were aligned to the OF bMRP-(ATP)2 model embedded in POPC:POPE:Chol (2:1:1). Lipid distributions were obtained using the CPPTRAJ59 package. Lipid occupancies were calculated for each polar head  or whole cholesterol molecule around the protein, considering threshold occupancies at 50 or 80%. Leaflet dependent lipid densities were calculated using the grid keyword in CPPTRAJ focusing on polar head lipids (PE or PC) or cholesterol OH-group. Focus was paid only to the high-density polar head region obtained by monitoring z-dependent density peaks of phosphate atoms for PC and PE lipids or O-atom for cholesterol molecules. Membrane thicknesses were obtained using the MEMBPLUGIN for VMD66. Free energy deformation was assessed by calculating the free energy cost of membrane deformation in presence of bMRP1 as well as the free energy references for flat membranes, using the CTMDapp software30. All parameters used for these calculations are reported in Supplementary Table\u00a0The water pore profile of 59 package, focusing on the ABC core, defined by backbone atoms of TMH1 to TMH12, NBD1 and NBD2. System variabilities were investigated by carrying out independent PCA for each system for which each replica was aligned to an average structure of the system. Network analyses were performed using the VMD Network Analysis plugin67. Dynamic cross-correlation matrices (DCCM) were calculated separately for each replica on which C\u03b1-atoms were selected as nodes and all the default restrictions  were applied. Communities were then calculated using gncommunities67. Allostery network pathways were determined using the recent Allopath approach developed by Westerlund et al.27. Shortly, the distant \u201ccommunication efficiency\u201d between two domains was obtained from the contact map and the mutual information matrix of protein residues as well as non-protein interactors such as surrounding lipid and bound molecules . Such an approach also provides a betweenness profile which pictures the involvement of each component . For each lipid molecule, three nodes were defined corresponding to the polar head group and the two lipid tails 2, bMRP1-LTX-(ATP)2 and OF bMRP1-(ATP)2) and lipid bilayer membranes , and POPC:POPE:Chol (2:1:1) for all states but also pure POPE and POPC:POPE (3:1) for IF apo bMRP1 and OF bMRP1-(ATP)2). In other words, 19 systems were considered, for 57 simulations. Analyses were systematically performed considering each system independent. Averages and standard deviations were generally obtained by pulling data from each replica altogether to display the sampling conformational variability. For H-bond analyses, free energy deformation and allosteric communications, results were calculated for each replica separately and average and standard deviations and errors were obtained over the three replicas treated independently.For all MD analyses described in this paper, data were derived from Further information on research design is available in the\u00a0Peer Review FileSupplementary InformationReporting Summary"}
+{"text": "DNA-hydrolyzing catalytic IgGs have caspase-dependent cytotoxic effects in autoimmune diseases. Recently, DNA-hydrolyzing IgGs have been discovered in schizophrenia. However, their cytotoxic properties have not been studied.To assess the effect of serum IgGs with DNA-hydrolyzing activity of schizophrenia patients on the cell viability of the SH-SY5Y human neuroblastoma cell line.Serum of 8 patients with paranoid schizophrenia in the acute phase and 7 mentally and somatically healthy persons were used. IgG was purified from serum by affinity chromatography on Protein-G-Sepharose columns. The DNA hydrolyzing activity of IgG was assessed by the degree of hydrolysis of the pBluescript plasmid. The cell viability of the SH-SY5Y human neuroblastoma cell line after exposure to purified IgG preparations was assessed by high-throughput screening on the CellInsight CX7 platform  using the fluorescent dyes propidium iodide and Hoechst.Of the 8 IgG preparation obtained, 4 drugs had high DNA-hydrolyzing activity. All tested IgG preparations from healthy donors were inactive. One-way ANOVA analysis of the proportion of dead cells of the SH-SY5Y line after exposure to antibodies (0.1 mg/ml) showed no significant differences in the proportion of dead cells . Similar results were obtained at a higher concentration of antibodies - 0.2 mg/ml.in vitro that IgGs isolated from the serum of schizophrenia patients with or without DNA-hydrolyzing activity does not exhibit cytotoxic properties against the SH-SY5Y human neuroblastoma cell line. Support by Grant of RSF \u2116 18-15-00053P.Thus, it has been shown No significant relationships."}
+{"text": "ZIKV) is the most abundant protein on the virus surface and it is the main target of the protective immune response. EZIKV protein contains the central domain (EDI), a dimerization domain containing the fusion peptide (EDII), and a domain that binds to the cell surface receptor (EDIII). In this study, we performed a systematic comparison of the specific immune response induced by different EZIKV recombinant proteins  in two mice strains. Immunization induced high titers of E-specific antibodies which recognized ZIKV-infected cells and neutralized the virus. Furthermore, immunization with EZIKV, EDI/IIZIKV and EDIIIZIKV proteins induced specific IFN\u03b3-producing cells and polyfunctional CD4+ and CD8+ T cells. Finally, we identified 4 peptides present in the envelope protein , capable of inducing a cellular immune response to the H-2Kd and H-2Kb haplotypes. In summary, our work provides a detailed assessment of the immune responses induced after immunization with different regions of the ZIKV envelope protein.Recent outbreaks of Zika virus (ZIKV) infection have highlighted the need for a better understanding of ZIKV-specific immune responses. The ZIKV envelope glycoprotein (E Unlike other flaviviruses, ZIKV transmission was also observed through non-vector transmission 5. ZIKV infection in pregnant women has been associated with congenital malformations , characterizing the congenital Zika syndrome (CZS)9, while in adults it is associated with Guillain-Barr\u00e9 syndrome (GBS)11. The rapid global spread of ZIKV and the suspected association with serious neurological implications have led to the urgent need for an effective vaccine and specific treatment against the virus. Even with scientific efforts, little is known about the ZIKV-specific immune response and there are still no licensed therapeutic or prophylactic vaccines against ZIKV.Research on the immune response to the Zika virus (ZIKV), a mosquito-borne flavivirus, has increased after recent outbreaks13. The envelope protein mediates viral assembly, binding to cell receptors and is essential for the subsequent fusion of the membrane involved in virus entry into the target cell14. Similar to other flaviviruses, the ZIKV E protein contains three distinct domains: the central domain (EDI), the domain responsible for dimerization that contains the fusion peptide (EDII), and the domain that binds to the cell surface receptor (EDIII)15.ZIKV has an 11\u00a0kb positive-sense single-stranded RNA (ssRNA) genome that encodes a single polyprotein that is cleaved into three structural proteins (Capsid (C), Premembrane/Membrane (prM/M) and Envelope (E)) and seven non-structural proteins  involved in virus replication and assembly17 that also confer protection in animal models of infection19. Several E-specific monoclonal antibodies (mAbs) inhibited ZIKV infection22. In addition, passive transfer of E-specific mAb reduced vertical transmission and mortality in mice17. Although antibodies are the main correlates of protection against ZIKV infection, T cell immunity also plays an important role in controlling virus replication23. It has already been demonstrated that the absence of CD8+ T cells during ZIKV infection is capable of increasing mortality in mice24. CD4+ T cells also participate in the generation of protective immunity, since their depletion reduced the induction of anti-ZIKV antibodies26 and CD8+ T cell responses27.Regarding the humoral immune response induced by flaviviruses, several studies have shown that protein E is highly immunogenic. Furthermore, protein E is the main target of several ZIKV-specific neutralizing antibodiesZIKV) and its domains (EDI/IIZIKV and EDIIIZIKV). We observed that immunization with EDI/IIZIKV and EDIIIZIKV proteins induced high titers of specific antibodies, which recognized ZIKV-infected cells and neutralized the virus. In addition, immunization with the proteins was able to induce specific IFN\u03b3-producing cells and polyfunctional CD4+ and CD8+ T cell responses. We also mapped immunodominant epitopes in ZIKV-envelope region, and identified four peptides  capable of inducing specific T cells to the H-2Kd and H-2Kb haplotypes.In this study, we investigated the induction of humoral and cellular immune responses after immunization of BALB/c and C57Bl/6 mice with the ZIKV-envelope protein (EZIKV) (amino acids 291\u2013690) and its domains EDI/IIZIKV (aa 291\u2013600) and EDIIIZIKV (aa 601\u2013690)   showed that sera from mice immunized with different ZIKV envelope proteins recognized ZIKV-infected cells  Fig.\u00a0a. Fourte:C) Fig.\u00a0b and C57:C) Fig.\u00a0c strainslls Fig.\u00a0d. In conlls Fig.\u00a0b,c and wlls Fig.\u00a0d.Figure ZIKV or EDIIIZIKV in the presence of poly (I:C). The lowest NT50 values were observed in the groups immunized with EDI/IIZIKV. For C57Bl/6 mice, we observed a similar profile, but immunization with EDIIIZIKV led to a higher production of neutralizing antibodies when compared to immunization with EZIKV. In contrast, the na\u00efve or adjuvant group did not display significant neutralizing antibodies against the virus. So far, our data demonstrate that the EDIII component induces the most robust humoral immune response against ZIKV.To evaluate the quality of the antibodies generated, we performed standard plaque reduction neutralization testing (PRNT). In BALB/c mice, we observed that the serum of all immunized groups reduced ZIKV infection Fig.\u00a0e. HoweveZIKV, EDI/IIZIKV and EDIIIZIKV mixed with poly (I:C) in BALB/c and C57Bl/6 mice would induce cellular-mediated immunity. Splenocytes harvested fifteen days after boost were incubated with recombinant ZIKV envelope proteins to assess specific cytokine production. Figure\u00a0ZIKV\u2009+\u2009poly (I:C) presented IFN\u03b3-producing cells when stimulated with all recombinant ZIKV proteins. On the contrary, splenocytes from mice immunized with EDI/IIZIKV\u2009+\u2009poly (I:C) or EDIIIZIKV\u2009+\u2009poly (I:C) only induced IFN\u03b3-producing cells against EZIKV and EDI/IIZIKV or against EZIKV and EDIIIZIKV, respectively. We also observed a lower number of IFN\u03b3-producing cells in splenocytes from BALB/c mice stimulated with EDI/IIZIKV when compared to the entire protein or domain III  presented IFN\u03b3-producing cells to peptides presented in pools 1, 5, 6 and 8  also showed an IFN\u03b3 response against pool 4  presented a higher number of IFN\u03b3-producing cells when stimulated by pools 1, 6, and 8  induced an IFN\u03b3-response against pools 5 and 8  were synthetized comprising the ZIKV E protein sequence (aa 291\u2013690) conserved among 69 ZIKV isolates (GenBank accession numbers available at Supplementary Table 1\u201320), ZIKV 2 (E11\u201330), ZIKV 5 (E41\u201360), ZIKV 6 (E51\u201370), ZIKV 25 (E241\u2013260) and ZIKV 27 (E261\u2013280)) and ectodomain III: (ZIKV 33 (E321\u2013340), ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380)) were individually tested  induced IFN\u03b3-producing cells against two peptides present in domain I/II (ZIKV 1 (E1\u201320) and ZIKV 6 (E51\u201370)) and two present in domain III (ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380)) in both BALB/c  or EDIIIZIKV\u2009+\u2009poly (I:C), the response was mainly directed against ZIKV 1 (E1\u201320) and ZIKV 6 (E51\u201370) or ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380), respectively. The most immunogenic peptides in the ZIKV envelope amino acid sequence, ZIKV 1 (E1\u201320), ZIKV 6 (E51\u201370), ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380) are represented in Supplementary Fig.\u00a0From those results, we selected a total of 9 out of 39 potential peptides for further evaluation. ZIKV peptides from ectodomain I/II:  and ZIKV 6 (E51\u201370)) and domain III (ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380)). The proliferation of CD4+ and CD8+ T cells in mice immunized with the domains (EDI/IIZIKV and EDIIIZIKV) was specific, i.e., targeted to the EZIKV protein and to the domain used in immunization. The same phenomenon was observed for CD4+ , ZIKV 6 (E51\u201370), ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380)). As expected, immunization with the EDI/IIZIKV and EDIIIZIKV domains was able to induce a polyfunctional response only against the recombinant protein EZIKV or the specific domains used in the immunization. In contrast, the group immunized with the adjuvant alone did not induce a significant frequency of CD4+ and CD8+ T cells that proliferated or produced cytokines. These data suggest that immunization with ZIKV envelope proteins was able to induce specific T cell responses. Furthermore, this result suggests the ability of ZIKV 1 (E1\u201320), ZIKV 6 (E51\u201370), ZIKV 36 (E351\u2013370) and ZIKV 37 (E361\u2013380) peptides to bind to H-2Kd and H-2Kb haplotypes and induce T cell immunity.Subsequently, we analyzed the cytokine profile of specific T lymphocytes. In both BALB/c  to induce humoral and cellular immune responses in two different mouse strains. C57Bl/6 and BALB/c mice were immunized with equimolar amounts of the recombinant proteins in the presence of the adjuvant poly (I:C).Recent outbreaks of ZIKV and the possible sequelae due to neurological morbidity in newborns and adults29. In flaviviruses, E protein, prM, and NS1 are the main targets of the antibody response30. We observed that the proteins EZIKV, EDI/IIZIKV and EDIIIZIKV were highly immunogenic, inducing specific antibodies that neutralized the virus. However, antibodies induced after boost with EZIKV or EDIIIZIKV displayed greater neutralizing capacity when compared to anti-EDI/IIZIKV antibodies. Previous studies demonstrate that domain III of the envelope protein is the main target for neutralizing antibodies 36. In addition, domain III does not induce antibody-dependent enhancement (ADE) and protected mice after challenge with ZIKV35. Furthermore, we observed that antibodies generated against immunization with the recombinant protein EZIKV were able to recognize the EDI/IIZIKV and EDIIIZIKV domains, with higher titers against domain I/II when compared to domain III. Sera from animals immunized with EDI/IIZIKV or EDIIIZIKV specifically recognized the same administered protein as well as the entire EZIKV protein but were unable to recognize the distinct domain. Within the E-specific response, the relative proportion of DI/II versus DIII antibodies showed considerable variability in serological studies with West Nile and Dengue (DENV) viruses, with an overall prevalence of antibodies against domains I/II40.The development of antibodies is considered fundamental against viral infections41. Here, sera from EDIIIZIKV-immunized mice presented greater ability to neutralize ZIKV than those induced after immunization with EZIKV or EDI/IIZIKV in the C57Bl/6 strain. However, for BALB/c mice, sera from EZIKV or EDIIIZIKV mice showed the same neutralization capacity. In fact, protective anti-ZIKV antibody titers have already been observed in BALB/c mice after immunization with a truncated EZIKV protein 42. Likewise, C57BL/6 mice immunized with EDIIIZIKV showed protective humoral immunity35. Yang et al. demonstrated that immunization with virus-like particles (VLP) containing EDIIIZIKV in the presence of poly (I:C) induced a strong humoral response in C57BL/6 mice36.During ZIKV infection, although there is a prevalence of antibodies against domains I/II that reach a peak during the beginning of the infection and fall over time, antibodies generated against domain III are more neutralizing and persist for a long period of time+ T cells during ZIKV infection increases mortality in mice24. DENV-specific CD8+ T cells induce cross-protection against ZIKV infection, including during pregnancy27. CD8+ T cells were shown to be essential to control yellow fever virus (YFV) and ZIKV infection in mice deficient in B lymphocytes44. CD4+ T cells also participate in the generation of protective immunity, as their depletion reduced the generation of anti-ZIKV antibodies26 and CD8+ T cell responses27. Recently, CD4+ T cells and IFN\u03b3 signaling have been shown to play a central role in protection during Zika virus infection45. Transfer experiments revealed that CD4+ T cells are required to protect against lethal challenge by ZIKV46. Furthermore, in a murine model of neuroinvasive ZIKV infection, the absence of CD4+ T cells leads to more neurological sequelae and increased viral titers in the central nervous system46. Indeed, the presence of polyfunctional CD4+ T cell responses is also implicated in protection against Japanese encephalitis virus (JEV) infection47, and is a hallmark after effective YFV vaccination49. We observed that immunization with EZIKV, EDI/IIZIKV and EDIIIZIKV proteins induced specific IFN\u03b3-producing cells and polyfunctional CD4+ and CD8+ T cell responses.Several studies demonstrated the important role of the cellular immune response against flaviviruses. The absence of CD8+ and CD8+ T cells during flavivirus infections, particularly in DENV infection50. In DENV-infected patients and participants vaccinated with a live attenuated tetravalent vaccine, T cell epitopes were mapped in several regions of the DENV proteome, although CD8+ T cells preferentially recognized NS3, NS5, and NS4b regions, while CD4+ T cells tended to recognize structural proteins and NS155. Similarly, the same profile was detected in JEV infection47 and YFV vaccination56. In patients infected with ZIKV, CD4+ T cells target structural and nonstructural proteins in equal proportions, while CD8+ T cells preferentially focus on structural proteins50. In the context of previous exposure to DENV54, the CD8+ T cell response is modulated towards nonstructural proteins. A study with a DENV-na\u00efve/ZIKV-infected patient, CD4+ and CD8+ T cell responses target preferentially NS2A and envelope proteins, respectively57. Furthermore, murine models have been instrumental not only in understanding the role of cellular immunity during flavivirus infections, but also in determining the epitopes recognized by T cells. Immunization of AG129 mice  and human HLA class II transgenic mice revealed that CD4+ T cell responses were directed to NS1, NS3, NS5 and envelope proteins58. A similar profile of CD8+ T cell responses was detected in infected C57BL/6 mice24. In this work, we identified four peptides present in the envelope region of the virus (ZIKV1(E1\u201320), ZIKV6(E51\u201370), ZIKV36(E351\u2013370) and ZIKV37(E361\u2013380)), capable of inducing a cellular immune response to the H-2Kd and H-2Kb haplotypes. Previous work58 mapped different ZIKV-immunodominant epitopes in HLA class II transgenic mice after immunization and the peptide ZIKV1(E1\u201320), the same we mapped  (IGVSNRDFV and SNRDFVEGM), two in ZIKV6 (E51\u201370) region (TTVSNMAEV and RSYCYEASI) and one in the ZIKV36 (E351\u2013370) region (MAVDMQTLTPV). In addition, one CD4-immunodominant peptide25 was also mapped in the middle of ZIKV36 (E351\u2013370) and ZIKV37 (E361\u2013380) peptide regions (PVGRLITANPVITES)  sequence (aa 291\u2013690 of the ZIKV polyprotein) was generated using 69 Brazilian ZIKV sequences by the software ClustalW (GenBank accession numbers are available at Supplementary Table ZIKV). Then, the EDI/IIZIKV ectodomain (aa 291\u2013600) was amplified by PCR  (primers sense 5\u2032-GGGCTAGCGCGTTCACCTTTACCAAAATT-3\u2032 and antisense 5\u2032-GGCTCGAGCCAGTGGTGGGT-3\u2032) using Phusion High Fidelity DNA Polymerase (New England Biolabs) as recommended by the manufacturer. The PCR product was cloned into the pJET1.2/blunt vector (Thermo Fisher Scientific), digested with endonucleases NheI and XhoI (New England Biolabs). We purified the digested fragment using PureLink Quick Plasmid DNA kit (Invitrogen) and then cloned in the pET21a vector using T4 DNA ligase enzyme (New England Biolabs).The alignment of ZIKV envelope  RIL strain was cultured at 37\u00a0\u00b0C under agitation (200\u00a0rpm). After addition of 0.01\u00a0mM isopropyl \u03b2-d-1 thiogalactopyranoside  the bacterial pellet was suspended and lysed in a high-pressure system. The recombinant proteins were purified using a nickel affinity chromatography Ni-Sepharose histidine-tagged resin  as recommended by the manufacturer. Analysis of purified recombinant EZIKV, EDI/IIZIKV and EDIIIZIKV proteins were performed by electrophoresis using 15% SDS-PAGE gel under reducing conditions.EZIKV, EDI/IIZIKV and EDIIIZIKV proteins (500\u00a0ng) were submitted to 15% SDS-PAGE electrophoresis under reducing conditions and then transferred to a nitrocellulose membrane . Next, membranes were blocked with PBS containing Tween 20 (PBST) (0.05% v/v), non-fat milk (5% w/v) and BSA (2.5% w/v), overnight at 4\u00a0\u00b0C. After each step, the membranes were washed 3 times with PBST. Then, the membranes were incubated with anti-his 6\u2009\u00d7\u2009tag (1:5000\u2014Thermo Fisher Scientific) for two hours at room temperature (rt). Nitrocellulose membranes were then incubated with HRP-labeled goat anti-mouse IgG  at rt for 1\u00a0h. We used a chemiluminescence kit  to develop the reaction as recommended by manufacturer\u2019s instructions and analyzed by Alliance 4.7 software .Purified recombinant EZIKV, EDI/IIZIKV, EDIIIZIKV and BSA (Bovine Serum Albumin) were added on nitrocellulose membrane (1\u00a0\u03bc\u03b3) in total volume of 10\u00a0\u00b5L. After the membranes were completely dry, the following steps were performed as described above with just a minor modification. The primary antibody used was the anti-flavivirus 4G2 (1\u00a0\u03bcg/mL).Purified recombinant proteins EZIKV (10\u00a0\u03bcg), EDI/IIZIKV (7.78\u00a0\u03bcg) or EDIIIZIKV (2.44\u00a0\u03bcg) in the presence of poly (I:C) adjuvant  in a total volume of 100 \u03bcL at the base of the tail (subcutaneously). The mice were bled by submandibular vein after each dose and were euthanized fifteen days after the second dose.Female BALB/c or C57Bl/6 mice (6- to 8-weeks-old) were bred at Centro de Desenvolvimento de Modelos Experimentais para Medicina e Biologia (CEDEME)\u2014UNIFESP. All mice were housed at Division of Immunology\u2014UNIFESP. The experiments were approved by the UNIFESP Institutional Animal Care and Use Committee (IACUC) (protocol number #2020100418), in accordance with the recommendations of the Federal Law 11.794 (2008) and the Guide for the Care and Use of Laboratory Animals of the Brazilian National Council of Animal Experimentation (CONCEA). Mice were immunized with two doses, fifteen days apart, with equimolar amounts of EZIKV, EDI/IIZIKV or EDIIIZIKV diluted in 50 \u03bcL/well of PBS 1x. After each step the plates were washed with PBS Tween 20 (PBST) (0.02% v/v). Then, the plates were blocked for 2\u00a0h at rt with 150 \u03bcL of PBST, BSA (1% w/v) and non-fat milk (5% w/v). Next, serum from mice immunized were serially diluted and 100\u03bcL were applied to each well for 2\u00a0h at rt. Plates were then incubated with horseradish peroxidase-labeled goat anti-mouse IgG  for 2\u00a0h at rt. The enzymatic reaction was developed with 1\u00a0mg/mL of o-phenylenediamine  diluted in phosphate\u2013citrate buffer (0.2\u00a0M Na2PO4 and 0.2\u00a0M C6H807), pH 5, containing 0.03% (v/v) hydrogen peroxide and was stopped with 4\u00a0N H2SO4. We used a ELISA reader  to read plates at 492\u00a0nm (OD492). The antibody titer was determined by the highest dilution of serum that presented an OD492nm between 0.1 and 0.2.For ELISA, 96-well plates  were coated at rt overnight with 250\u00a0ng/well of EBR), described by Cugola et al.60, was amplified in Vero E6 cells (ATCC CRL-1586) in complete MEM medium (supplemented with 10% FBS and 1% penicillin/streptomycin (GIBCO)) for 96\u00a0h. For the neutralization assay, 1\u2009\u00d7\u2009105 Vero CCL-81 cells (ATCC CCL-81) were plated in 24-well plates (Costar) in complete MEM medium and incubated overnight at 37\u00a0\u00b0C with 5% CO2. The following day, serum samples from immunized mice were previously inactivated for 30\u00a0min at 56\u00a0\u00b0C and incubated in the presence of 100 Plaque Forming Units (PFU) of ZIKV. Then, serum samples were serially diluted in 2% MEM medium ) and then incubated with 100 PFU of ZIKV per well, for 1\u00a0h at 37\u00a0\u00b0C with 5% CO2. In addition, we added a dose test (DT)\u2014which corresponds to 100 PFU; DT50 (50 PFU), mock (cell only), serum from non-immunized control mouse and from ZIKV-infected patient. Then, cells were incubated with a mixture containing the serum-virus for 3\u00a0h at 37\u00a0\u00b0C. Subsequently, the cells were overlayed with MEM medium with CMC  containing 10% FBS, 1% penicillin/streptomycin, 0.05% Amphotericin B ) and incubated at 37\u00a0\u00b0C. After 4\u00a0days, the medium with CMC was completely removed and washed twice with PBS1X. Cells were then fixed with 4% paraformaldehyde (Sigma), stained with crystal violet  for half an hour and the excess dye was removed with distilled water.A ZIKV isolate from Brazil  and incubated at \u2212\u200920\u00a0\u00b0C for 30\u00a0min. After each step, wells were washed 3\u00d7 with PBS 1X. Following incubation for 30\u00a0min with primary antibody , goat anti-mouse IgG conjugated with FITC  was added for 30\u00a0min. Immunofluorescence assay was performed using fluorescence microscopy (Olympus BX21) and the images were captured by CellSens software.The immunofluorescence assay was performed as described previouslyl-glutamine, 1% v/v non-essential aminoacids solution, 1\u00a0mM sodium pyruvate, 1% penicillin/streptomycin and 5\u2009\u00d7\u200910\u20135\u00a0M of 2-mercaptoethanol .After euthanasia (2\u00a0weeks after the last dose) the spleens were aseptically removed, and ammonium chloride potassium (ACK) was used to lyse red blood cells. Splenocytes were resuspended in RPMI medium supplemented with 10% of fetal bovine serum, 40\u00a0\u03bcg/mL of gentamicin, 1% v/v vitamin solution, 2\u00a0mM DeconvoluteThis! Software as described previously28.A peptide library (39 peptides) comprising the ZIKV envelope protein consensus sequence was synthesized (GenScript USA Inc) with purity more than 75% (20 amino acids overlapping 12-mer). Peptides were resuspended in DMSO (10\u00a0mg/mL) and stored at \u2212\u200920\u00a0\u00b0C and organized into an optimized matrix (Supplementary Table 5 cells) were added and incubated with pooled or individual peptides (10\u00a0\u03bcg/mL); equimolar amounts of recombinant proteins  or R10 (negative control). We used the AID ELISpot Reader System  to count the number of spots. The number of IFN\u03b3 producing cells from stimulated wells were subtracted from the non-stimulated wells.IFN\u03b3 producing cells were assessed using IFN\u03b3 ELISpot Ready-SET-Go! Kit (eBiosciences) as recommended by the manufacturer instructions. Briefly, ELISpot plates  were coated with IFN\u03b3-capture antibody. After washes and blocking, splenocytes , pouring the tube every two minutes for 10\u00a0min at 37\u00a0\u00b0C. Cells were then washed, resuspended and cultured for 5\u00a0days in the presence of the different stimuli. After 5\u00a0days, cells were first washed with buffer containing PBS with 0.5% BSA and 2\u00a0mM EDTA (FACS Buffer) and then stained with anti-mouse CD3-APCCy7 (clone 145-2C11), CD4-Pacific Blue (clone RM4-5) and CD8-APC (clone 53\u20136.7). For specific intracellular cytokine detection, splenocytes were cultured with the same antigens in the presence of anti-CD28  for second activation signal and Brefeldin A GolgiPlug\u2122 (BD Pharmigen) for protein transport inhibition. Next, cells were washed with FACS buffer and stained with anti-mouse CD3-APCCy7 (clone 145-2C11), CD4-PerCP (clone RM4-5) and CD8-Pacific Blue (clone 53\u20136.7). Cells were then fixed and permeabilized using Cytofix/Cytoperm\u2122 kit (BD Pharmigen) and washed with Perm/Wash buffer (BD Pharmigen). Cells were stained with anti-mouse TNF\u03b1-PECy7 (clone MP6-XT22) and IFN\u03b3-APC (clone XMG1.2). All antibodies used for flow cytometry were from BD Pharmingen. The samples were acquired using the FACSCanto II flow cytometry (BD Biosciences) and analyzed using FlowJo software (Tree Star). To allow proper compensation, unstained and all single-color controls were performed. The frequency of proliferating cells was calculated by subtracting the values from unstimulated cells.To assess ZIKV-specific T cell proliferation, isolated splenocytes were labeled with carboxyfluorescein succinimidyl ester (CFSE), as previously describedp-values) was calculated by One-way or Two-way ANOVA followed by Tukey honestly significantly different (HSD) post hoc test. Statistical analysis and graphical representation were performed using GraphPad Prism version 9.0 software.Data normality tests were performed in GraphPad Prism including Shapiro\u2013Wilk and D\u2019Agostino-Pearson omnibus tests. Statistical significance (https://arriveguidelines.org). The protocol (number 2020100418) was approved by the UNIFESP Animal Care and Use Committee (IACUC).This study was carried out in compliance with the recommendations of the Federal Law 11.794 (2008), the Guide for the Care and Use of Laboratory Animals of the Brazilian National Council of Animal Experimentation (CONCEA) and the ARRIVE guidelines (Supplementary Information."}
+{"text": "NCT04405076). Neutralizing antibody (nAb) titers against wild-type SARS-CoV-2 at 1 month after the booster were 1.7-fold : 1.5, 1.9) higher than those at 28 days after the second injection of the primary series, which met the pre-specified non-inferiority criterion (primary immunogenicity objective) and might indicate a memory B cell response. The nAb titers against the Delta variant (B.1.617.2) (exploratory objective) at 1 month after the booster were 2.1-fold  higher than those at 28 days after the second injection of the primary series. The seroresponse rate (95% CI (four-fold rise from baseline)) was 100%  at 28 days after the booster compared to 98.3%  after the primary series. The higher antibody titers at 28 days after the booster dose compared to 28 days after the second dose in the phase 3 COVE study were also observed in two assays for anti-spike IgG antibody measured by ELISA and by Meso Scale Discovery (MSD) Multiplex. The frequency of solicited local and systemic adverse reactions after the booster dose was similar to that after the second dose in the primary two-dose series of mRNA-1273 (50\u2009\u00b5g or 100\u2009\u00b5g); no new signals were observed in the unsolicited adverse events; and no serious adverse events were reported in the 1-month follow-up period. These results show that a booster injection of mRNA-1273 more than 6 months after completing the primary two-dose series is safe and elicited nAb titers that were statistically significantly higher than the peak titers detected after the primary vaccination series, suggesting that a booster dose of mRNA-1273 might result in increased vaccine effectiveness against infection and disease caused by SARS-CoV-2.Rising breakthrough infections of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in previously immunized individuals have raised concerns for the need for a booster vaccine dose to combat waning antibody levels and new variants. Here we report the results of the open-label, non-randomized part B of a phase 2 trial in which we evaluated the safety and immunogenicity of a booster injection of 50\u2009\u00b5g of the coronavirus disease 2019 (COVID-19) vaccine mRNA-1273 in 344 adult participants immunized 6\u20138 months earlier with a primary series of two doses of 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273 ( A third dose of the COVID-19 vaccine mRNA-1273 is safe and boosts SARS-CoV-2 neutralizing antibody titers almost two-fold higher than the peak levels observed after completion of a two-dose series, highlighting the potential clinical benefit of a booster dose. In several countries worldwide, BNT162b2 has been authorized for use for primary vaccination in individuals older than 5 years of age3, and mRNA vaccines have been authorized for primary vaccination in individuals older than 12 years of age. Both vaccines have also been authorized as a three-dose primary series for immunocompromised populations, and the use of boosters in adults (mRNA-1273 and BNT162b2), as well as in adolescents and some children (BNT162b2), has also recently been authorized.Several vaccines for SARS-CoV-2 have been authorized worldwide for emergency use, and the mRNA vaccines have been approved for the primary series by the US Food & Drug Administration (FDA) for immunization to prevent COVID-19 disease 5 and have proven safe and very efficacious in preventing hospitalizations and deaths due to COVID-19 (refs. 8). mRNA-1273 is a lipid nanoparticle-encapsulated messenger RNA encoding the spike protein of the Wuhan-Hu-1 isolate with two proline mutations introduced to stabilize the spike protein into the pre-fusion conformation. Vaccination with two doses of mRNA-1273 has shown immune responses against SARS-CoV-2, efficacy against COVID-19 disease in adults and adolescents and an acceptable safety and tolerability profile in several clinical trials12. Based on a primary vaccine efficacy of 94.1% against COVID-19 after a median follow-up of 64 days6, as shown in the phase 3 COVE study, mRNA-1273 received emergency use authorization from the FDA in December 2020, for use in adults 18 years of age or older2. Recently, the final efficacy analysis of the blinded part of the COVE study showed a vaccine efficacy of 93.2% over 5.3 months of follow-up13.SARS-CoV-2 vaccines have been administered worldwide to billions of people14. Variants such as Delta (B.1.617.2) caused substantial outbreaks of COVID-19 in 2021 and 2022; and the Omicron variant (B.1.1.529), a highly transmissible variant of concern, has increased in prevalence in 2022 (refs. 16). The Omicron variant causes many infections but fewer hospitalizations and less severe disease than previously circulating variants20. nAb titers against Omicron were low several months after the primary series with SARS-CoV-2 vaccines compared to the titers against the ancestral virus29. However, administration of a third dose of an mRNA vaccine has been shown to increase nAb titers against Omicron29. Furthermore, a third dose of an mRNA vaccine has been shown to decrease hospitalizations, death rates, symptomatic infections and emergency department and urgent care encounters during periods of Delta and Omicron infections32.There are concerns that the efficacy of the SARS-CoV-2 vaccines might decrease due to waning antibody levels and/or emerging viral variants. Variants of SARS-CoV-2 with amino acid changes in the spike protein and elsewhere in the viral genome are circulating around the world33). An interim analysis reported that a booster dose of 50\u2009\u00b5g of mRNA-1273 increased nAb titers against the Beta, Gamma, Delta, Epsilon and Iota variants33. In a large observational study performed by the Mayo Clinic, the mRNA vaccines were less effective against SARS-CoV-2 infections at a time when the Delta variant was prevalent34. In an exploratory analysis of the ongoing COVE trial during the open-label phase, lower incidence rates of COVID-19 and fewer severe cases of COVID-19 cases were observed during July\u2013August 2021, when the Delta variant was dominant, compared to participants vaccinated more recently35. A decline in mRNA vaccine effectiveness against SARS-CoV-2 infection was observed in nursing home residents during the time period of 21 June\u20131 August 2021, when the Delta variant was prevalent; in frontline healthcare workers; and in a real-world effectiveness study in Qatar38.With respect to the Delta variant, a small study showed that immunity against variants waned in vaccinated individuals such that approximately one-half did not have detectable nAbs to the Delta variant 6 months after vaccination with mRNA-1273 (ref. 33). Preliminary results of part A showed robust immune responses through 1 month after the second injection of mRNA-1273 and an acceptable safety profile in healthy adults aged 18 years and older33. In part B, the open-label, interventional phase of this study, participants who received a two-dose (50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273) primary series in part A were offered a single booster dose of mRNA-1273 (50\u2009\u03bcg). Here we report the immunogenicity, safety and reactogenicity after the booster dose as well as antibody persistence before the booster dose (approximately 209 days after the primary series).These findings with variants and waning immunity after two doses of mRNA vaccines suggest that a booster vaccine injection might be beneficial. We previously reported the results from the blinded portion (part A) of this phase 2 trial of mRNA-1273 at eight sites in the United States in which participants received two injections of placebo or 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273 (ref. NCT04405076) comprised 600 participants who enrolled and received placebo or 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273 from 29 May 2020 to 8 July 2020. Of the 344 participants who enrolled and received a booster dose in part B from 28 January 2021 to 27 April 2021, 173 received two doses of 50\u2009\u00b5g of mRNA-1273 and 171 received two doses of 100\u2009\u00b5g of mRNA-1273 6\u20138 months earlier in part A  and the group in the phase 3 COVE trial that received two doses of mRNA-1273 Fig. . The incThe most common local adverse reaction was injection site pain, which was reported in 86.3% of those in the pooled group who received the 50\u2009\u00b5g and 100\u2009\u00b5g prime and in 88.3% of those in the phase 3 COVE trial  in the D614G pseudovirus nAb assay at day 57 (28 days after the second injection of mRNA-1273 during the primary series) were 629.2  in the group that received the primary series of 50\u2009\u00b5g of mRNA-1273 and 1,268.0  in the group that received the primary series of 100\u2009\u00b5g of mRNA-1273  titers at 28 days after the booster dose of mRNA-1273 in participants in part B of this study were also higher than those at 28 days after the second dose of mRNA-1273 in participants in the pivotal phase 3 COVE trial (Table 5)  (Table The nAb 50% inhibitory dilution (IDSeroresponse rates (assay-specific definition) (95% CI) were 93.5%  and 98.9%  in the pooled phase 2 part B booster group (compared to pre-boost) and after the primary series in the phase 3 COVE trial, respectively (Table n\u2009=\u2009293) met the definition of a seroresponse to the Delta variant using a four-fold increase from pre-booster baseline. Administration of the mRNA-1273 booster (50\u2009\u00b5g) induced a 17.3-fold rise in neutralizing titers against the Delta variant compared to pre-booster titers in the 100-\u00b5g prime group (geometric mean fold rise (GMFR)\u2009=\u200917.3; 95% CI: 14.4, 20.8; Supplementary Table In the group previously primed with two doses of 100-\u00b5g mRNA-1273, the nAb GMT versus the Delta variant was 47.9  before the booster and 827.8  at 28 days after the booster (Supplementary Table 39. Both co-primary immunogenicity objectives were met for the pooled group that received a booster (part B) compared to the group in the phase 3 COVE trial that received two doses of mRNA-1273. nAb titers (pseudovirus) against the D614G strain of virus at 28 days after the booster injection were higher than the titers at 28 days after the second dose of mRNA-1273 during the primary series in the COVE study. This higher level of antibody after the booster injection compared to that obtained after the second injection is suggestive of a robust memory response, likely due to stimulation of memory B cells43. It is also important to note that the results in this study using a validated pseudovirus neutralization assay showed that the GMTs after the second dose of mRNA-1273 were higher at 1 month after the second dose in the 100-\u00b5g group compared to the 50-\u00b5g group  achieved by the mRNA-1273 booster, measured by the Delta variant pseudovirus assay  enrolled 600 participants to receive placebo or 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273 2, and 554 participants were unblinded in part B at least 5.9 months or more after enrollment in part A of the study. In total, 173 or 171 participants who had initially received two injections of 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273, respectively, then received a single booster of 50\u2009\u00b5g of mRNA-1273.Preliminary immunogenicity and safety results were previously reportedEligible participants in part A were male or female, 18 years of age or older at screening and in good general health according to the investigator. For part B, participants must have been previously enrolled in the mRNA-1273 phase 2 study. Exclusion criteria were pregnancy or breastfeeding, acute illness or febrile (body temperature \u226538.0\u2009\u00b0C/100.4\u2009\u00b0F) 24\u2009hours before or at screening or current treatment with investigational agents for prophylaxis against COVID-19.There were two age cohorts in this phase 2 study: participants \u226518 to <55 years old in cohort 1 and participants \u226555 years old in cohort 2. Within each age cohort, approximately 300 participants were randomized in a 1:1:1 ratio to receive 50\u2009\u00b5g of mRNA-1273, 100\u2009\u00b5g of mRNA-1273 or placebo in part A. The randomization was performed in a blinded manner using a centralized Interactive Response Technology. Vaccine dose preparation and administration during part A were performed by unblinded pharmacy personnel who did not participate in any other aspects of the study. A limited number of the sponsor team and the clinical research organization (CRO) were unblinded to enable the primary analysis at 1 month after the second dose of mRNA-1273 in part A. All study staff, participants, the CRO and sponsor personnel remained blinded to dosing assignment until the study was unblinded, upon implementation of part B of the study, following emergency use authorization of mRNA-1273 in the United States.n\u2009=\u20091,080) were randomly selected from the phase 3 COVE trial participants in the mRNA\u20111273 group to form an immunogenicity subset that was subsequently used as the historical comparator arm for the phase 2 part B immunobridging analysis. Of the 1,080 selected participants from the phase 3 COVE trial mRNA-1273 group, 25 were further excluded from the per-protocol immunogenicity subset for the following reasons: had HIV infection (18 participants), received dose two outside of the pre-specified window (five participants), did not receive dose two per schedule (one participant) or had major protocol deviations (one participant). Thus, 1,055 participants were included in the per-protocol immunogenicity subset from the phase 3 COVE trial.Participants with negative baseline SARS-CoV-2 status . In part B, 50\u2009\u00b5g of mRNA-1273 was administered intramuscularly in the deltoid as a single booster injection at OL-D1 (pre-booster) to the treatment groups originally vaccinated with either dose regimen of mRNA-1273. The volume administered in both part A and part B in each injection was 0.5\u2009ml containing 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273 or saline (placebo).The mRNA-1273 vaccine is a lipid nanoparticle containing an mRNA that encodes the SARS-CoV-2 spike glycoprotein of the Wuhan-HU-1 isolate1. The primary safety objective of part B was to evaluate the safety and reactogenicity of 50\u2009\u00b5g of mRNA-1273 administered as a single booster dose 6 months or more after a priming series of 50\u2009\u00b5g or 100\u2009\u00b5g of mRNA-1273. The primary safety endpoints were solicited local and systemic adverse reactions through 7 days after each injection; unsolicited TEAEs through 28 days after each injection; and MAAEs and SAEs throughout the entire study period.Details regarding the design of part A of the study were previously published50 titers were the primary focus of this analysis. Both ID50s and ID80s have been correlated with protection4. ID50s and ID80s are two highly correlated reportable read-outs from the same assays and samples. The ID50 provides a practical advantage of allowing for a wider linearity range and, thus, was preferred for this analysis. ID80s and ID50s have similar GMFRs in pseudovirus neutralization assays before the booster and 28 days after the booster , as assessed by the level of SARS-CoV-2-specific nAbs. The ID50 titer in the pseudovirus nAb assay) was defined as a change from below the LLOQ at pre-booster (or pre-dose 1) to equal to or above the LLOQ at 28 days after the booster (or 28 days after the primary series) or at least a 3.3-fold rise at 28 days after the booster (or 28 days after the primary series) if the pre-booster (or pre-dose 1) titer was equal to or above LLOQ; (2) seroresponse (four-fold rise) was defined as a change of titer from below the LLOQ at pre-booster (or pre-dose 1) to equal to or above 4\u00d7 LLOQ at 28 days after the booster (or 28 days after the primary series) or a four times or higher ratio in participants with titers above the LLOQ at pre-booster (or pre-dose 1); and (3) seroresponse (four-fold rise from baseline) was defined as a change of titer from below the LLOQ at baseline (pre-dose 1 in the primary series) to equal to or above 4\u00d7 LLOQ at 28 days after the booster (or 28 days after the primary series) or a four times or higher ratio in participants with titers above the LLOQ at pre-dose 1. Definition (3) was applied only to participants in the phase 2 study (primary series in part A and booster in part B).The co-primary endpoints for non-inferiority were (1) GMTs of serum nAb and (2) seroresponse rates for nAb based on the pseudovirus nAb assay. The secondary immunogenicity objective was to evaluate the immunogenicity of 50\u2009\u00b5g of mRNA-1273 vaccine administered as a single booster dose as assessed by the titers of broadly neutralizing antibody (bAb). Levels of SARS-CoV-2-specific bAbs were measured by ELISA and a SARS-CoV-2 MSD 3-PLEX assay on OL-D1 (pre-booster) and OL-29 (28 days after the booster injection). Seroresponse was defined in three ways: (1) seroresponse  and to mRNA-1273 100\u2009\u03bcg primary series (P301)\u2019, version 2.0, 6 August 2021).Solicited local and systemic adverse reactions were recorded daily by participants in an electronic diary during the 7 days after vaccine administration. Any solicited adverse reaction that persisted beyond day 7 was reported in the electronic diary until resolution. Oral body temperatures were measured daily. If applicable, the size of injection site erythema and swelling/induration were measured and recorded. In part B, trained site personnel called trial participants every 4 weeks to assess safety beginning 3 months after the booster dose.5. During assay development, it was quickly demonstrated that the D614G variant behaved in the pseudo-neutralization assay in an indistinguishable manner when compared to the original Wuhan spike protein. The pseudovirus neutralization assay was formally optimized; qualified and validated for accuracy, sensitivity, specificity, linearity, range, precision, limits of quantitation and robustness6; and approved by the FDA. The assay uses a full-length spike protein with no cytoplasmic tail deletions. The spike protein in the assay does not contain the two proline mutations in the vaccine spike that stabilize the protein in a pre-fusion conformation.This validated assay quantifies SARS-CoV-2 nAbs by using lentivirus particles that express SARS-CoV-2 full-length spike proteins ) on their surface and contain a firefly luciferase reporter gene for quantitative measurements of infection by relative light units (RLU)50) or 80% (ID80) relative to mean RLU in virus control wells (cells + virus but no control antibody or sample) after subtraction of the mean RLU in cell control wells (cells only).The pseudoviruses were applied to transduced 293T cells expressing high levels of ACE2 (293T/ACE2 cells), with or without pre-incubation with antibodies (control antibodies or serum samples); the presence of nAbs reduced infection and resulted in lower RLUs. Serial dilution of antibodies or serum samples were used to produce a dose\u2013response curve. Neutralization was measured as the serum dilution at which the RLU was reduced by 50% (IDThis quantitative electrochemiluminescence (ECL) method is an indirect binding ECL method designed to detect SARS-CoV-2 antibodies (SARS-CoV-2 full-length spike (Wuhan-Hu-1 isolate including D614G), nucleocapsid (N) and receptor-binding domain (RBD) antibodies) in human serum. The assay is based on the MSD technology that employs capture molecule MultiSPOT microtiter plates fitted with a series of electrodes. Using an MSD MESO SECTOR S 600 detection system, an electrical current was applied to the custom microtiter plates, leading to a light emission by SULFO-TAGTM through a series of oxidation-reduction reactions involving ruthenium and tripropylamine (TPA). A plate reader measured the intensity of emitted light to provide quantitative measures of analytes in samples.For this bio-assay, a ten-spot custom SARS-CoV-2 3-PLEX plate coated with SARS-CoV-2 antigens (S (containing D614G), N and RBD) was used. Anti-SARS-CoV-2 antibodies present in the test sample bound to the antigen-coated plates and formed antibody\u2013antigen complexes. These complexes were detected by adding SULFO-TAGTM-labeled antibodies, which bind to the antibody\u2013antigen complexes. Addition of TPA in a buffer solution resulted in ECL that was measured in RLU using the MSD SECTOR S 600 plate reader. Antibody concentrations were determined by interpolating their ECL response using the standard curve generated from a serially diluted reference standard.\u22121) was determined by interpolation from a standard curve analyzed on each assay plate.This validated assay uses microtiter plates coated with commercially available SARS-CoV-2 full-length spike glycoprotein (Wuhan-Hu-1 isolate including D614G). Serum containing the SARS-CoV-2 IgG antibody was added to the plates. Bound antigen\u2013antibody complex was detected using purified goat anti-human IgG horseradish peroxidase conjugate. Color development occurred with the addition of 3,3\u2032,5,5\u2032-tetramethylbenzidine substrate, and color intensity was measured spectrophotometrically (450\u2009nm). The intensity of the color was directly proportional to the IgG antibody concentration. Quantitation of the human IgG antibody to SARS-CoV-2 or antibody concentration  in part A, received a booster injection during part B and contributed any solicited adverse reaction data . The solicited safety set was used for the analyses of solicited adverse reactions. The per-protocol set for part B booster consisted of all part B booster participants who had both pre-booster and post-booster immunogenicity assessments at OL-D1 (pre-booster) and OL-D29 (28 days after the booster injection)); who did not have evidence of past or current SARS-CoV-2 infection at OL-D1 for part B, where SARS-CoV-2 infection was defined as a positive RT\u2013PCR test for SARS-CoV-2 and/or a positive serology test based on bAbs specific to SARS-CoV-2 nucleocapsid (as measured by Roche Elecsys Anti-SARS-CoV-2 assay); and who had no major protocol deviations that affected immune response during the period corresponding to the immunogenicity analysis objective in part B. The per-protocol immunogenicity set for the booster in part B served as the primary population for the analysis of immunogenicity data in part B.The GMTs of bAb or nAb titers with corresponding 95% CIs are provided at each time point. The GMFR of bAb or nAb titers and the corresponding 95% CIs are also provided. The 95% CIs were calculated based on the t-distribution of the log-transformed values or the difference in the log-transformed values for GMT and GMFR, respectively, and then back-transformed to the original scale for presentation. For calculation of GMTs and GMFRs, antibody values reported as below the LLOQ were replaced by 0.5\u00d7 LLOQ. Values that were greater than the upper limit of quantification (ULOQ) were converted to the ULOQ if the actual values were not available. Missing results were not imputed.To assess the magnitudes of the differences in immune response 28 days after a single booster dose of 50-\u03bcg mRNA-1273 and the immune response 28 days after the completion of the primary series of 100-\u03bcg mRNA-1273 in the phase 3 COVE study, an analysis of covariance (ANCOVA) model was used. The model included log-transformed antibody titers at D29 after booster in this phase 2 study and D57 in the COVE study as the dependent variable and treatment groups  as the explanatory variable, adjusting for age groups (<65 years and \u226565 years\u2014age groups used in the COVE study). The geometric least squares mean (GLSM) and corresponding two-sided 95% CI for the antibody titers for each treatment group are provided. The GLSM and the corresponding 95% CI results in log-transformed scale estimated from the model were back-transformed to obtain these estimates in the original scale. GMR, estimated by the ratio of GLSM and the corresponding two-sided 95% CI, was provided to assess the treatment difference.The primary immunogenicity objective in part B was considered met if the non-inferiority based on both GMTs and seroresponse rate at 28 days after the booster in part B compared with 28 days after the second dose in the phase 3 COVE trial was demonstrated, at a two\u2011sided alpha of 0.05. The null hypotheses based on GMTs and seroresponse rate and the criterion of success included: non-inferiority based on the GMR  was pre-defined with a non-inferiority margin of 1.5 and a point estimate of GMR\u2009\u2265\u20091; and non-inferiority based on difference in seroresponse rate  was pre-defined with a non-inferiority margin of 10%.All analyses were conducted using SAS version 9.4 or higher.Further information on research design is available in the Any methods, additional references, Nature Research reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41591-022-01739-w.Supplementary InformationSupplementary Information: List of Investigators, Supplementary Tables 1\u201310, Supplementary Figs. 1\u20135, Protocol Amendment Summary of Changes and ReferencesReporting SummarySupplementary DataA phase 2a, randomized, observer-blind, placebo-controlled, dose-confirmation study to evaluate the safety, reactogenicity and immunogenicity of mRNA-1273 SARS-CoV-2 vaccine in adults aged 18 years and older"}
+{"text": "Real-world data on heterologous boosting with messenger RNA (mRNA)-1273 (Moderna) after inactivated COVID-19 vaccination are limited. We report mRNA-1273 boosting in heavily SARS-CoV-2\u2013exposed Indonesian health-care workers who received a two-dose CoronaVac 6 months prior. Between August and November 2021, we measured SARS-CoV-2 spike-specific IgG binding antibody (Bab) titers in all 304 participants, and neutralizing antibody titers in a random subset of 71 participants, on stored paired serum samples taken before and 28 days after a full-dose (100-\u03bcg) mRNA-1273 booster. At the time of the mRNA-1273 boost, 107 participants (35.2%) were not previously infected (naive vaccinated), 42 (13.8%) were infected before CoronaVac (infected vaccinated), and 155 (51.0%) were infected after CoronaVac . At time of the mRNA-1273 boost, neutralizing antibodies could still be detected in 83% of participants (59 of 71) overall, 60% of naive-vaccinated participants (15 of 25), 95.7% of vaccinated-infected participants (22 of 23), and 95.7% of infected vaccinated participants (22 of 23). After the mRNA-1273 boost, 100% of participants (71 of 71) had neutralizing antibody activity, with increases in median Bab and neutralizing antibody serum titers of 9.3- and 27.0-fold overall, 89.1- and 2,803.4-fold in naive-vaccinated participants, 15.9- and 19.9-fold in infected-vaccinated participants, and 2.2- and 18.4-fold in vaccinated-infected participants. In the multivariable analysis, Bab titers after the mRNA-1273 boost were greatest in individuals who had a previous virus breakthrough post-CoronaVac, and when a longer time period (> 4 months) had elapsed since the most recent prior \u201cspike antigen exposure\u201d (either second CoronaVac or virus breakthrough). Overall, adverse reactions were mild and short-lived. In conclusion, a full-dose mRNA-1273 booster after CoronaVac was well tolerated and immunogenic after 28 days, including in those with very low antibody levels. To date, eight COVID-19 vaccines have received an Emergency Use Listing by the WHO,\u2013,\u2013,CoronaVac , an inactivated whole-virus vaccine that received WHO Emergency Use Listing on June 1, 2021,\u2013CoronaVac has been the predominant vaccine rolled out in Indonesia\u2019s countrywide mass vaccination campaign, which has seen the second highest number of COVID-19 cases  and deaths  in Asia .We therefore established the Indonesia Vaccine Immunity & Infection Evaluation (INVITE) study, which included an assessment of a full-dose (100-\u03bcg) mRNA-1273 booster dose given 6 months after two-dose CoronaVac among heavily SARS-CoV-2\u2013exposed health-care workers in Jakarta, Indonesia. We documented the antispike (anti-S) IgG binding antibody (Bab) and neutralizing antibody (Nab) responses and reactogenicity of this booster, and examined the effects of previous SARS-CoV-2 infections occurring before or after primary CoronaVac vaccination.The INVITE study is a longitudinal observational cohort that includes health-care workers  who are 18 years or older at St Carolus and Pasar Minggu hospitals in Jakarta. We enrolled participants consecutively on the day they received their government-provided 100-\u03bcg mRNA-1273 booster dose at their own hospital, between August 5 and October 15, 2021. Eligible staff for the booster were those who had completed their two-dose primary vaccination at least 6 months prior, had no known recent (< 3 months) SARS-CoV-2 infection, and had no other contraindication for vaccination. Our analysis included all study participants for whom a paired pre- and postbooster serum sample was available. All participants provided written informed consent.Supplemental Figure 1).Basic demographic and clinical data were captured on an online case report form. Solicited signs of local or systemic reactogenicity during the 7 days after the booster dose were recorded in a daily patient diary and, after study physician verification, were graded for severity . Previous COVID-19 was defined as a documented polymerase chain reaction\u2013confirmed SARS-CoV-2 infection, and participants were thus categorized as not previously SARS-CoV 2-infected (na\u00efve vaccinated), SARS-CoV-2\u2013infected before the CoronaVac primary vaccination (infected vaccinated), or infected after the CoronaVac primary vaccination . Venous blood samples were drawn on the day of the booster dose before administration and 28 (+ 10) days thereafter  on the Architect i2000sr platform in accordance with the manufacturer\u2019s instructions, and expressed in WHO International Standard binding antibody units (BAU) per milliliter using the manufacturer\u2019s conversion factor (1 BAU/mL = 0.142 \u00d7 arbitrary units/milliliter) and seropositivity defined as \u2265 7.1 BAU/mL.10 titers were expressed using the Spearman coefficient (rs). Multivariable ordinal  logistic regression was performed to assess factors associated with pre- and postboost log10-transformed Bab titers (categorized in quartiles). Multivariable logistic regression was performed to assess factors associated with occurrence of any severe or disrupting adverse reactions. The independent variables included in the analysis were age, gender, previous SARS-CoV-2 infection, timing of previous SARS-CoV-2 infection before or after CoronaVac primary vaccination, any comorbidity , preboost Bab titer, time interval between the first and second CoronaVac dose, and time interval between the second CoronaVac and mRNA-1273 booster dose. A two-sided P < 0.05 was considered significant. Statistical analyses were performed with Stata/IC version 15.1 .Paired comparisons of Bab and Nab titers before and after the mRNA-1273 booster dose were performed using the Wilcoxon matched pairs signed-rank test. Correlations of logThere were 304 of 353 participants (86.1%) with complete pre- and post-booster sample pairs who were included in the analysis. The median age was 31 years , 235 (77.3%) were women, and 61 (20.1%) had one or more comorbidities, including obesity, cardiovascular disease, diabetes mellitus, and asthma . One hunn = 293) before receiving the mRNA-1273 booster  to 100% (n = 304) after boosting (P < 0.001) after. Naive-vaccinated participants had a 89.1-fold increase , infected-vaccinated participants had a 15.9-fold increase , and vaccinated-infected participants had a 2.2-fold increase  . Supplemental Figure 2 and Supplemental Table 1 summarize pre- and post-mRNA-1273 boost titers by previous SARS-CoV-2 infection, age, gender, and presence of any comorbidity.The proportion of Bab-seropositive participants increased from 96.4% (boosting . After rP < 0.0001) after (N = 71). Naive-vaccinated participants (n = 25) had a 2,803.4-fold increase , infected-vaccinated participants (n = 23) had a 19.9-fold increase , and vaccinated-infected participants (n = 23) had a 18.4-fold increase  , in 60% of the naive-vaccinated (15 of 25), 95.7% of the vaccinated-infected (22 of 23), and 95.7% of the infected-vaccinated (22 of 23). After receiving the mRNA-1273 boost, 100% (71 of 71) had Nab activity, and the Nab titer increased 27.0-fold overall\u2014from 1,127.6 IU/mL  before to 30,400.0 IU/mL  .10 range), and were greater in those previously infected  for Babs and 968 and 432,880 IU/mL (2.65 log10 range) for Nabs .Pre-mRNA-1273 boost Bab titers varied widely, from 0.97 to 21,466 BAU/mL  and infected-vaccinated participants , but not in vaccinated-infected participants . Post-mRNA-1273 boost Bab titers correlated, although insignificantly, with Nabs in naive-vaccinated participants , but did not correlate in infected-vaccinated participants  and vaccinated-infected participants  .Pre-mRNA-1273 boost Bab titers correlated significantly with Nab in naive-vaccinated participants  and, as expected, pre-mRNA-1273 boost Bab titers were lower when a longer period of time (> 3 months) had elapsed since the most recent prior spike antigen exposure (either the second CoronaVac dose or a breakthrough infection) compared with a more recent exposure.In multivariable analysis, previous SARS-CoV-2 infection either before or after the CoronaVac primary vaccination was strongly associated with a greater preboost Bab titer , and when a longer period of time (> 4 months) had elapsed since the most recent prior spike antigen exposure (either the second CoronaVac dose or a breakthrough infection) compared with more recent exposure. Age, gender, comorbidity, and time interval between the first and second CoronaVac dose were not associated with the pre- or post-mRNA-1273 boost Bab titer; and pre-mRNA-1273 boost Bab titer and previous SARS-CoV-2 infection before CoronaVac were not associated with the post-mRNA-1273-boost Bab titer .n = 300), 96.4% (n = 293) for any local reaction (injection site pain and swelling most frequent), and 90.8% (n  =276) for any systemic reaction . Most solicited local and systemic adverse reactions were mild  or moderate , whereas severe  or those disrupting ADLs  were less common . All adverse reactions were short-lived and none required hospitalization. Severe or ADL-disrupting adverse reactions were associated with a longer interval between the second dose and the mRNA-1273 booster  and were inversely associated with older age . Gender, comorbidity, previous SARS-CoV-2 infection, time interval between the first and second dose, and pre- and postboost Bab titers were not associated with any adverse reactions .The 304 participants reported a total of 300 adverse reactions within 7 days after receiving the mRNA-1273 booster. The percentage of participants with any solicited adverse reaction was 98.7%  booster dose, which was generally safe and well tolerated, with only slightly more frequent adverse reactions compared with the 50-\u03bcg dose.\u2013,Our study findings add to current evidence on the use of mRNA booster vaccines in three main ways. First, it established that heterologous mRNA vaccine boosting with mRNA-1273 (Moderna) after CoronaVac is immunogenic and well tolerated in a highly virus-exposed population reflecting real-world conditions.,There are some limitations to our study. First, we did not assess anti-N IgG, Nabs against Delta and Omicron variants of concern, or cellular immunity. Although accumulating evidence suggests that the anti-S IgG Bab and Nab responses correlate with protection against infection,In conclusion, our real-world data indicate that, after a primary course of two-dose CoronaVac inactivated vaccine, a heterologous, full-dose mRNA-1273 booster was immunogenic after 28 days of follow-up and was well tolerated among heavily SARS-CoV-2\u2013exposed health-care workers, even in those with very low preboost antibody titers. Further trials on clinical end points of optimized booster doses and variant-specific or multivalent vaccines in response to decreased susceptibility to neutralization of emerging SARS-CoV-2 variants of concern are warranted.Supplemental materials"}
+{"text": "The scaffold of gelatin and polycaprolactone was synthesized, and a gelatin solution containing cerium oxide nanoparticles was attached to the scaffold. For the animal study, 40 male Wistar rats were randomly divided into 4 groups (n\u2009=\u200910): (a) Control; (b) Spinal cord injury (SCI); (c) Scaffold (SCI\u2009+\u2009scaffold without CeO2 nanoparticles); (d) Scaffold-CeO2 (SCI\u2009+\u2009scaffold containing CeO2 nanoparticles). After creation of a hemisection SCI, scaffolds were placed at the site of injury in groups c and d, and after 7 weeks the rats were subjected to behavioral tests and then sacrificed for preparation of the spinal cord tissue to measure the expression of G-CSF, Tau and Mag proteins by Western blotting and Iba-1 protein by immunohistochemistry. The result of behavioral tests confirmed motor improvement and pain reduction in the Scaffold-CeO2 group compared to the SCI group. Decreased expression of Iba-1 and higher expression of Tau and Mag in the Scaffold-CeO2 group compared to the SCI group could be the result of nerve regeneration caused by the scaffold containing CeONPs as well as relief of pain symptoms.Since the CNS is unable to repair itself via neuronal regeneration in adult mammals, alternative therapies need to be found. The use of cerium oxide nanoparticles to repair nerve damage could be a promising approach for spinal cord reconstruction. In this study, we constructed a scaffold containing cerium oxide nanoparticles (Scaffold-CeO Damage to the central nervous system (CNS), including the brain and spinal cord due to physical injury is one of the leading causes of death and chronic disability in humans. Spinal cord injury (SCI) is typically caused by axonal damage, resulting in nerve cell and glial cell death \u20133. SeconComplementary therapeutic approaches, including cell therapy , 8, gliaOne of the most important features of successful implant integration in damaged spinal cord tissue, is its optimal mechanical strength. If the biomaterial is too rigid, it can compress the regenerating axons and create additional secondary cavities between the implant and the surrounding spinal tissue . The bioDifferent types of scaffolds, including electrospun nanofibers, can act as a substrate for nerve cell differentiation and growth, and allow new cell-cell and cell-matrix interactions \u201322. NanoElectrospun nanofibers have been widely used for skin , 25, bonth cervical level in rat spinal cord. In this study, aligned axon regeneration was observed as early as one week after injury, and no excessive inflammatory response and scar tissue formation was triggered [The effectiveness of three-dimensional aligned nanofibers based on poly(\u03b5-caprolactone) was evaluated in a hemi-incision model at the 5riggered . In anotriggered .The effects of electrospun poly(\u03b5-caprolactone)/type I collagen nanofiber conduits on the repair of peripheral nerve damage in rats treated with these electrospun nanofibers showed, no serious inflammatory reactions were observed in the hind limbs and the morphology of myelin sheaths in the injured sciatic nerve was close to normal and rats that underwent repair with electrospun nanofiber conduits tended to have greater sciatic nerve function recovery .3+ and Ce4+ states [2-nanofibers was effective in cellular differentiation [Recently, study of metal nanoparticles has become the focus of intense research due to their unusual properties compared to bulk metals, especially since they are used either to inhibit the growth of microorganisms \u201335, canc+ states . Cerium + states . Because+ states , antican+ states  and also+ states , 48. Attntiation . Ciofanintiation .2 nanostructures administrations for SCI therapies have greatly suppressed oxidative stress and induced anti-inflammatory action, which leads to prospective therapeutic benefits of spinal cord regeneration [Dong et al. in 2020, in an in-vitro spinal cord model system demonstrated the biofabricated nano-cerium oxide loaded poly (e-caprolactone) (PCL)/resveratrol (RVL) treatment significantly preserved hydrogen peroxide and also good catalytic performance . In studneration .2) implanted at the site of injury on nerve cell growth and pain relief in a SCI animal model.Kim et al. also showed that CeONPs had an antioxidant effect in spinal cord injury and subsequently improved the functional recovery in rats after mild traumatic brain injury . In last2O, pH~ 4, ID: 796077) in gelatin-acetic acid was electrosprayed onto the scaffold with 60% power for 1\u2009h according to the following protocol. The gelatin solution containing the nanoparticles was rotated at 30\u2009\u00b0C using a voltage of 20\u2009kV, a flow of 10\u2009\u03bcL/min and a nozzle distance of 10\u2009cm to produce fibers on the scaffold. A fixed axis was used to concentrate the fibers at one point. The Scaffold-CeO2 was characterized via Energy Dispersive X-ray (EDX) and Scanning electron microscopy (SEM). After coating the samples with gold, the final Scaffold-CeO2 structure was imaged using a scanning electron microscope . Energy Dispersive X-ray (EDX system Kevex) spectroscopy was performed to identify the elements in the nanofiber.Chloroform (8\u2009mL) and 0.4\u2009g of PCL were combined and then mixed with 0.16\u2009g of gelatin and 2\u2009mL of 80% acetic acid. The resulting solution was mixed for 3\u2009h to form a jelly-like structure. The mixture was then refrigerated for 48\u2009h to obtain a flexible integrated scaffold. The dissolved CeONPs  on days 1, 3, 5, 7, and 9. Experiments were performed in triplicate.Investigation of the release of CNPs from the Scaffold-CeO article . In summ2 were implanted in rats suffering from spinal cord lesions. In this study, male Wistar rats weighing about 200\u2013250\u2009g were used and randomly divided into 4 groups (n\u2009=\u200910). The animal experiments were approved by IRAN University of Medical Sciences ethics approval center with COD number IR.IUMS.REC.1398.318Control; without any surgery or treatmentSCI; Spinal cord injury induced without any treatmentScaffold; SCI group with an implant of scaffold without CeONPs2; SCI group with an implant of scaffold containing CeONPsScaffold-CeOScaffold-CeO2. At 7 weeks, motor function and behavioral experiments were performed on the animals. According to other studies, 7 weeks is sufficient time to investigate the regeneration of axon and glial cells after SCI [To induce the SCI hemisection model, the animal was anesthetized and after locating the desired site at T12 to T13 vertebral level which is equal L2-L3 of the spine, the skin and muscle were separated and the vertebrae were broken with rongeur in this location. After observing the spinal cord, the upper layer of the spinal cord was cut with microdissection scissors for creating the hemisection model. The gap produced had a width of 2\u2009mm and was removed with a 22-gauge needle . The remfter SCI , 57. PerThe animals were placed in a circular space one meter in diameter and their behavior was studied for 4\u2009min. This test was performed by two blinded investigators weekly. In summary, the motor behavior of the animals included the following components: hind limb movement, animal weight bearing, limb coordination, and walking. According to the instructions, the animals were given grades from 0 to 21 .The sole of the rat foot was used to measure the heat pain threshold. For this purpose, the animals were placed in a plexiglas container and infrared radiation was delivered through the bottom of the container onto the animal paw. The animals were given 15\u2009min to adjust to the environment, and then infrared was irradiated onto the bottom of the animal paw. Removing the paw automatically stopped the heat generated by the infrared source. To prevent burn damage, a cut-off of 25\u2009sec was used by the observer. This test was performed 3 times on each paw at intervals of at least 1-minute, and the average of the obtained numbers was calulated as a response.Von Frey filaments were used to measure mechanical allodynia . For thiThe animals were placed in special cages with a net floor that was 30\u2009cm above the bench surface. Fifteen minutes after placing the animal in the cage, a drop of acetone was injected into the sole of the animal foot, and the animal reaction, including the foot reflex, licking, or foot shaking was examined. This procedure was performed 5 times for each leg at intervals of at least one minute, and finally the animal reaction was calculated as a percentage .Rats were anaesthetized with . Transcardial perfusion was used to fix the spinal cord. First, normal saline was injected into the heart to remove blood from the spinal cord, and then 4% paraformaldehyde in 0.1\u2009M phosphate buffer (pH\u2009=\u20097.2\u20137.4) was perfused to fix the spinal cord. The fixed spinal cord was dissected and post-fixed in 4% paraformaldehyde for 48\u2009h, and then blocked with paraffin. Section 5\u2009\u03bcm in thickness were cut for tissue staining .n\u2009=\u20093 per group). For this reason, the sectioned were deparaffinized and rehydrated by a series of graded alcohols and stained with H&E stain according to the manufacturer\u2019s guidance [To determine the cavity size in the spinal cord after injury by Hematoxylin and Eosin staining (H&E), the longitudinal sections of the spinal cord on the site of injury were stained by H&E staining  was added to the slides and incubated in a humidified container at room temperature for 12\u2009h. After washing, 100\u2009\u03bcL of diluted horseradish peroxidase-conjugated secondary antibody was added and incubated in a humid chamber at room temperature for 30\u2009min. The slides were washed and then 100\u2009\u03bcL of Diaminobenzidine (DAB) solution and 0.05\u2009mL Hn\u2009=\u20093 in each group) were anesthetized with ketamine and xylazine. Radio immunoprecipitation assay (RIPA) buffer was added to the tissues. Tissues were centrifuged  and supernatants were isolated for Western blotting. The lysates containing 50\u2009\u03bcg of protein were electrophoresed on a sodium dodecyl sulfate acrylamide gel and the proteins were transferred to polyvinylidene-fluoride membranes (PVDF). After blocking, the membranes were exposed to primary antibodies including anti-GCSF antibody , total Tau antibody , total MAG , and \u03b2-actin antibody . The membranes were then washed with TBST and incubated with horseradish peroxidase conjugated goat anti-IgG . Protein bands were detected by enhanced chemiluminescence (ECL). The results were quantified by Image J software [Seven weeks after injury, the animals . Also, if the data were parametric, one-way ANOVA parametric tests were used for statistical analysis. Data obtained from various experiments were analyzed by SPSS 21 software. The data were expressed as mean\u2009\u00b1\u2009SEM. 2 are shown in Fig. 2. Only difference between the scaffolds after the nanoparticle is sprayed on, is the presence of nanofibers with very thin diameters, which makes the surface of the substrate brighter than before. Peaks in Energy-dispersive X-ray spectroscopy (EDX) confirmed the presence of CeONPs  and continued until the end of the study (6.3\u2009\u00b1\u20090.26) compared to the control group (p\u2009<\u20090.0001). The BBB score after 7 weeks in scaffold-receiving rats (6.8\u2009\u00b1\u20091.8) was similar to the untreated SCI animals (6.3\u2009\u00b1\u20090.26)  was similar to the SCI (3.8\u2009\u00b1\u20090.) and Scaffold groups (6.0\u2009\u00b1\u20091.1) up until the fourth week (p\u2009<\u20090.001). But from the fifth week onwards, a significant improvement in movement and BBB score was observed compared between the SCI (4.2\u2009\u00b1\u20091.0) and Scaffold-CeO2 groups (8.4\u2009\u00b1\u20091.2). In the sixth and seventh weeks, movement in the Scaffold-CeO2 group was significantly improved compared to the SCI group . In the seventh week, in addition to the difference between the Scaffold-CeO2 group (11.2\u2009\u00b1\u20091.1) compared to the SCI group (5.5\u2009\u00b1\u20091.1) (p\u2009<\u20090.001), there was also a difference in the BBB score between the Scaffold-CeO2 group compared to the Scaffold group (6.8\u2009\u00b1\u20091.8) (p\u2009<\u20090.01).In the present study, seven weeks after Scaffold-CeO26) Fig. . The movp\u2009<\u20090.0001). In the Scaffold and Scaffold-CeO2 groups, motor improvement was seen from the first week to the end of the study. In the seventh week, only the SCI group was different from the control group) p\u2009<\u20090.001) and there was no difference in the movement of the other groups (Scaffold and Scaffold-CeO2) compared to the control group.Although SCI induction was performed on the left side of the animal spinal cord, the result of functional recovery testing on the right side was also affected and reduced movement was observed . Significant reduction in motor function in the right paw of all SCI animals continued until the end of the study compared to the control group (p\u2009<\u20090.001). Significant reduction of the thermal pain threshold in SCI animals started from the first week  and continued until the end of the study compared to the control group . In the group treated with Scaffold, pain was observed from the first week compared to the control group , which was similar to the SCI group with an increasing slope until the end of the study. In the first week after surgery, animals receiving Scaffold-CeO2 experienced more pain (13.1\u2009\u00b1\u20091) than SCI . However, from the fourth week onward, an improvement in the pain threshold was observed in the Scaffold-CeO2 group (15.3\u2009\u00b1\u20091.4). In the fifth week (15.2\u2009\u00b1\u20091.4) until the end of the study (16.1\u2009\u00b1\u20091.8), a significant difference was observed between both groups receiving Scaffold and Scaffold-CeO2 and the SCI group. However, the pain threshold did not reach the level in control rats at the seventh week (p\u2009=\u20090.001). . Also, in the other treatment groups, more pain was observed during the study compared to the control group (p\u2009<\u20090.001). In the Scaffold-CeO2 group, pain decreased in the seventh week (18.6\u2009\u00b1\u20091.3) compared to SCI group (12.8\u2009\u00b1\u20091.1) and the Scaffold-treated group (13.1\u2009\u00b1\u20091.8) (p\u2009<\u20090.01).Removal of the left side of the spinal cord caused hyperalgesic pain in the right side of the spinal cord, which was sinusoidal in all groups . Pain was observed in the SCI group during the study compared to the control group (p\u2009<\u20090.0001). However, both Scaffold (4.6\u2009\u00b1\u20093.3) and Scaffold-CeO2 (17.0\u2009\u00b1\u20098.0) treatment reduced the cold threshold in the seventh week close to the control group, and the difference between them was not significant.The results of cold allodynia (acetone test) Fig.  of the lp\u2009<\u20090.001) . At the end of the seventh week, no significant cold allodynia pain was observed in the Scaffold group (5.6\u2009\u00b1\u20095.8) compared to control in right paw. The course of regaining pain tolerance in the Scaffold-CeO2 transplant animals was similar to the Scaffold group, except that the pain relief began from the fifth week.In the first week after induction of SCI, pain from cold allodynia was observed in right paw of the SCI group (84.4\u2009\u00b1\u200996.0) and reduced to the end of the study (28.7\u2009\u00b1\u20099.3) (p\u2009<\u20090.0001)  and continued until the seventh week (p\u2009<\u20090.0001). In the Scaffold group (14.7\u2009\u00b1\u20090.2), a significant difference was observed in the seventh week compared to the SCI group (8.03\u2009\u00b1\u20091.4) (p\u2009<\u20090.001).The mechanical allodynia test showed that SCI reduced the left paw withdrawal threshold (01) Fig. . Von Frep\u2009<\u20090.001) . This pain was evident up to the end of the study. However, in weeks 5 and 7, the pain intensity decreased slightly and was different from the control group (p\u2009<\u20090.01). The use of Scaffold (12.5\u2009\u00b1\u20091.1) alone and Scaffold-CeO2 (14.6\u2009\u00b1\u20090.3) could reduce mechanical hyperalgesia in seventh week.Induction of SCI in the left side of the spinal cord caused mechanical allodynia in the right paw of animals compared to the control group (p\u2009=\u20090.0170). The transplanted animals showed a smaller cavity in the spinal cord compared to the SCI group (p\u2009<\u20090.02). The mean cavity size in the transplanted group was 4.94\u2009\u00b1\u20090.8 %  group the number of dead cells was significantly lower than the SCI group.The results of the Nissl staining in Fig. + cells increased in the SCI (53.1\u2009\u00b1\u20093.1) and Scaffold (57.2\u2009\u00b1\u200914) groups, while the expression level in the Scaffold-CeO2 group (18.3\u2009\u00b1\u20092.0) decreased and was similar to the control group (13.8\u2009\u00b1\u20092.4). Inside the spinal cord of the control animals, Iba-1+ cells were present throughout the white and gray matter either individually, or in the form of branched cells. In the SCI group, due to the immune response (immune-reactivity) small accumulations of Iba-1+ cells in the white matter were created. These clusters did not show the usual branching appearance, but had a large cytoplasm with globoids.As shown in Fig. p\u2009<\u20090.001) and Scaffold-CeO2 animals (1.1\u2009\u00b1\u20090.2) were significantly lower compared to the control group (1.8\u2009\u00b1\u20090.05). The GCSF protein expression levels were significantly increased in Scaffold (2.2\u2009\u00b1\u20090.1) (p\u2009<\u20090.01) compared to the SCI group (0.8\u2009\u00b1\u20090.1) (p\u2009<\u20090.01)  (01) Fig. .Fig. 6Wep\u2009<\u20090.05). The level of Tau expression in animals in the Scaffold-CeO2 group (1.1\u2009\u00b1\u20090.2) increased significantly compared to the SCI group (0.8\u2009\u00b1\u20090.1) (p\u2009<\u20090.05), and there was no significant difference compared to the control group (1.77\u2009\u00b1\u20090.1)  compared to the control group (1.77\u2009\u00b1\u20090.1) (.1) Fig. .Fig. 7We2 group (1.1\u2009\u00b1\u20090.2) compared to the SCI group (0.8\u2009\u00b1\u20090.1)  compared to the control group (1.8\u2009\u00b1\u20090.1), and MAG expression was higher in the Scaffold-CeO.1) Fig. .2) on motor recovery and pain relief after SCI. Behavioral changes related to movement and pain in both legs were reported separately. Evaluation of motor changes showed that the right paw was also affected by the left side spinal cord injury and its movement was reduced, which is consistent with previous studies [2 significantly improved the left paw movement compared to the SCI and Scaffold groups, although this improvement did not reach the level of the control group. This result is consistent with the results of other studies that showed injection of cerium oxide nanoparticles has helped to improve motor function after spinal cord injury [In this study, SCI on the left side was induced by removing a piece of spinal cord. We investigated the effect of gelatin-PCL containing CeONPs  also showed the right and left paw of treated animals improved in the seventh week, which indicated the positive effect of Scaffold and Scaffold-CeO2 in reducing pain. Our study for the first time showed the effect of CeO2NPs in pain relief after spinal cord injury in rat model.The result showed at the end of the seventh week, thermal hyperalgesia improved in the left paw, which could indicate the analgesic effect of the Scaffold-CeO2 helped to improve movement in both the injured and the healthy paw, but the scaffold alone did not have this effect on the injured paw. In tolerating heat-induced pain, Scaffold-CeO2 treatment also helped significantly in relieving pain, but the Scaffold alone was not able to do this. In mechanical and cold allodynia, the effect of Scaffold-CeO2 and Scaffold treatment was similar in both paws and showed a significant difference compared to the SCI group, while it was no different from the control group. Scaffold alone had a positive effect on reducing cold and mechanical pain, but had no effect on improving functional recovery and heat pain tolerance, and the addition of CeO2 nanoparticles to the scaffold, in addition to improving cold and mechanical pain tolerance, also improved functional recovery and heat pain tolerance.Overall, based on the behavioral experiments, Scaffold-CeO2 group, it returned to normal, indicating tissue repair. In the spinal cord of control animals, Iba-1-positive cells were ubiquitous throughout the white and gray matter as single cells with a ramified appearance. Analysis of the injured spinal cord showed increased immunoreactivity in addition to small clusters of 3\u20135 Iba-1-positive cells in the white matter. These aggregates lacked the typical branched appearance and had large and globoid cytoplasmic staining.Microglia play an important role in CNS defense and tissue repair. In activated microglia, the expression of Iba-1 is increased . Macroph+ glial cells and pain relief [2 treatment is a good sign that recovery is progressing.Spinal microglial activation plays a major role in producing neuropathic pain following SCI. Evidence has shown that an elevated expression of Iba-1 as a microglial marker persists for at least 14 weeks after L5 spinal hemisection model, while mechanical hypersensitivity decreased. These results indicated that microglia play a role beyond the pain hypersensitivity phase . Other sn relief . In our n relief , 69. The2 group, which is not possible to justify with the current knowledge of the researchers of this experiment and requires more observations for conclusion and interpretation.G-CSF is produce by monocytes, fibroblasts and endothelial cells. G-CSF was initially identified as a major regulator of neutrophil and granulocyte production and modulates the proliferation, survival, maturation and functional activation of these cells . G-CSF p2 group the amount of Tau was not significantly different from the control group, which indicates the restoration of axonal stability. MAG is a membrane glycoprotein expressed in the oligodendrocyte axon membrane between axons and the inner myelin sheath, and acts to maintain myelinated axons in the adult nervous system. It is interesting to note that MAG plays an important role in axonal growth which depends on the growth stage of the neurons studied. MAG stimulates the growth of immature neurons while preventing the growth of older neurons [One of the most important microtubule-associated proteins that contributes to a number of cellular processes, including axonal trafficking, myelination, and synaptic plasticity, and which is also involved in pain perception is Tau protein \u201374. Foll neurons , 79. +a  neurons . On the  neurons . Therefo2 nanoparticles coated on a gelatin- poly (\u03b5-caprolactone) polymer scaffold after SCI, improved motor function, and provided pain relief in animals receiving Scaffold-CeO2. Decreased expression of Iba-1 and GCSF and higher expression of Tau and Mag in the SCI Scaffold-CeO2 group compared to the SCI group could explain the nerve regeneration as well as pain relief symptoms.The use of CeOSupplementary Information"}
+{"text": "Alzheimer\u2019s disease (AD) is the leading cause of dementia. The relationship between AD and sleep dysfunction has received increased attention over the past decade. The use of genetically engineered mouse models with enhanced production of amyloid beta (A\u03b2) or hyperphosphorylated tau has played a critical role in the understanding of the pathophysiology of AD. However, their revelations regarding the progression of sleep impairment in AD have been highly dependent on the mouse model used and the specific techniques employed to examine sleep. Here, we discuss the sleep disturbances and general pathology of 15 mouse models of AD. Sleep disturbances covered in this review include changes to NREM and REM sleep duration, bout lengths, bout counts and power spectra. Our aim is to describe in detail the severity and chronology of sleep disturbances within individual mouse models of AD, as well as reveal broader trends of sleep deterioration that are shared among most models. This review also explores a variety of potential mechanisms relating A\u03b2 accumulation and tau neurofibrillary tangles to the progressive deterioration of sleep observed in AD. Lastly, this review offers perspective on how study design might impact our current understanding of sleep disturbances in AD and provides strategies for future research. Alzheimer\u2019s disease (AD) is the most common cause of dementia, with an estimated global prevalence of 32 million cases . AlthougIn AD, amyloid beta  containing Swedish (K670N/M671L) mutation. APP23 mice display memory deficits as early as 3\u2009months , severalPrior to the presence of A\u03b2 pathology, APP23 mice were found to display a significant increase in wake duration along with an increase in wake beta power compared to wild type mice . During NL-G-F knock-in line is a recently developed mouse model of AD containing a knocked-in human APP gene with the Swedish, Beyreuther/Iberian (I716F) and Arctic (E693G) mutations driven by the endogenous human APP promoter  mutations with transgene expression driven by the PDGF-\u03b2 promoter. Punctate A\u03b2 can be identified in the hippocampus of these mice as early as 1\u2009month , followeThe first changes in sleep behavior of J20 mice occur at 11\u201312\u2009months, after extensive amyloid pathology and cognitive impairment. However, it is possible that sleep research on J20 mice has yet to be conducted at an earlier age. Sleep changes at 11\u201312\u2009months are limited to a reduction in REM sleep during the second half (6-h bin) of the 12-h light phase, as well as decreased NREM delta power, increased NREM theta and sigma power and time-dependent alterations in NREM gamma power compared to wild type littermates .The PDAPP mouse model is among the earliest mouse models of AD. This mouse model overexpresses hAPP containing the Indiana mutation, utilizing the PDGF-\u03b2 promoter . From anSleep dysfunction in PDAPP mice begins at approximately the same age as cognitive and memory decline, as previously reported. Young PDAPP mice, aged 3\u20135\u2009months, display a partial decrease in REM sleep duration, isolated to specific segments of the light/dark phase . Young PThe Tg2576 mouse line utilizes a hAPP transgene with the Swedish mutation, driven by the hamster prion protein (PrP) promoter. This mouse model generates a reduction of outer dentate gyrus layer and hippocampal dendritic spine density at 4 and 4.5\u2009months of age, respectively . Tg2576 Contrasting these findings, a study conducted by The TgCRND8 mouse model overexpress hAPP containing the Swedish and Indiana driven by the PrP promoter, which leads to the ~5x overexpression of mutant hAPP . TgCRND8TgCRND8 mice appear to demonstrate their first evidence of sleep impairment at 3\u2009months in the form of increased hyperarousal and reduced NREM sleep compared to wild type mice . TgCRND8The 5XFAD mouse model is among the most established animal models used AD research . This doTwo studies  utilizinswe/PS1\u2206E9 line is a double transgenic model containing the chimeric mouse/human APP transgene with the Swedish mutation and the human PS1 gene with a deletion of exon 9. Among the earliest reported AD pathologies in this mouse model are impaired synaptic plasticity and reduced transient LTP starting at 3\u2009months  mutation and human PS1 with an A246E mutation, with both transgenes driven by the Thy1 promoter. One study reports that these mice demonstrate indications of poorer recognition memory at early as 3\u2009months  bout lengths despite maintaining comparable SWS durations compared to wild type mice . At thisThe PLB1 mouse line is a triple transgenic model of AD containing hAPP with the London and Swedish mutations, human PS1 with an A246E mutation and human microtubule-associated protein tau (MAPT) P301L and R406W mutations . PLB1 miStudies examining EEG spectra output of PLB1 mice have slightly varying results. A study conducted by The CVN-AD mouse model is a bigenic line that incorporates the hAPP transgene with the Swedish, Iowa (D694) and E693Q mutations, under the control of the Thy1 promoter, with mouse nitric oxide synthase (NOS2) knocked-out. These mice demonstrate an early onset of amyloid plaques at approximately 3\u2009months, and behavioral changes, loss of hippocampal cells, and phosphorylated tau between 5.5 and 8\u2009months . CVN-AD p\u2009=\u20090.087) reduction in sleep duration during the dark phase  was designed to model the effects of tauopathy through the progression of AD. This mouse model utilizes a human MAPT transgene containing the P301S mutation. P301S Tau mice develop microgliosis in the hippocampus as early as 3\u2009months followed by NFTs in the neocortex, amygdala, hippocampus, and other regions of the brain by 5\u2009months . SynaptiThe first indications of sleep impairment in the P301S Tau mouse model occur at 6\u2009months. At this age, transgenic mice demonstrate an apparent increase in NREM delta power compared to wild type mice . By 9\u2009moThe rTg4510 mouse model expresses human tau containing the P301L mutation. This mouse model does not generate A\u03b2 pathology. rTg4510 mice begin to demonstrate gliosis  and spatUnlike the APP, PSEN and tau transgenic models, the Senescence Accelerated Mouse-Prone 8 (SAMP8) mouse model is a spontaneously occurring mouse line that exhibits characteristics of accelerated aging with relevance to the altered gene expression and protein abnormalities observed in AD . ReactivWith regards to sleep disturbance, SAMP8 mice demonstrate decreases in NREM and REM sleep durations at 4\u2009months. These reductions are isolated to the light phase .NL-G-F, TgCRND8, A\u03b2PPswe/PS1\u2206E9, PLB1, and APP23 mice among others , medial septum, laterodorsal tegmentum (LDT), pedunculopontine tegmentum (PPT) or others . The REMNL-G-F/NL-G-F, J20, A\u03b2PPswe/PS1\u2206E9, Tg2576 and others, generate various forms of progressive sleep deterioration while lacking aberrant or modified tau expression.While soluble and insoluble A\u03b2 are often suspected of being primary contributing factors towards progressive sleep deterioration in AD, it is important to consider mouse lines that exhibit sleep impairment despite the lack of A\u03b2 pathology, such as the P301S Tau (PS19) and rTg4510 mouse models . Both mo\u2206E9, PLB1, and SAMP8 demonstrate altered sleep behavior prior to the appearance of plaques  period . TherefoVigilance states are identified based on the dominant EEG frequency bands, thereby making changes in power spectra a useful tool for diagnosing neurodegeneration . EEG of AD pathology can progress rapidly within a short period of time. Therefore, constructing a single group of mice with widely varying ages (by 1.5\u2009months or more) may result in the combination of mice at different stages of AD pathology. Mice of such widely differing age ranges may exhibit dissimilar sleep patterns.The EEG/EMG combination is a well-established technique for sleep analysis because it can differentiate between all 3 vigilance states identified in mice, detect NREM markers such as K-complexes and sleep spindles, detect pathological markers such as interictal spikes, and can be utilized to generate power spectral data. However, EEG/EMG requires highly invasive surgery and the mouse must be tethered throughout the duration of the recording, which may influence sleep behaviors. While the EEG/EMG system for remains the gold standard for sleep scoring , the pieWhile females are at greater risk of developing AD in humans than males , mouse mMethodological variation is an important component of sleep research. However, a standardized system of measurement is necessary for the reproducibility and comparability of scientific results. Therefore, the implementation of standardized frequency band ranges and epoch definitions may help improve the quality and consistency of sleep studies. Shorter epochs reflect transitions between sleep states with greater accuracy. Furthermore, factors such as the mouse model genetic background, sex and age, as well as the sleep recording system, and recording period should be taken into account when designing or interpreting sleep research using transgenic mouse models of AD. Reducing the age variation within individual groups of mice may reduce the likelihood of a group containing mice at different stages of the disease.AD mouse models exhibit the potential to reproduce a wide range of sleep dysfunctions observed in AD. The most frequently observed sleep impairments in AD mice are reductions in NREM and REM sleep duration. The reduction of REM speed duration, specifically, is the most consistent form of sleep deterioration in AD mice. Interestingly, many mouse models demonstrate hyperactivity during dark phase, reminiscent of Sundown syndrome observed in AD patients. Of the mouse studies that provide data on vigilance state durations and bout lengths, changes in durations either precede or coincide with changes in bout lengths at least one vigilance state (not necessarily the same one). Generally, mice display fewer wake, NREM sleep and REM sleep bouts with the progression of AD pathology. REM slowing  is commonly identified in mouse models of AD. Nevertheless, no trend in altered power spectra can be determined consistent across all models or frequencies, likely due to the variation in mouse pathologies and experimental parameters.Decoding the links (likely more than one) between AD and sleep deterioration presents a multi-variable challenge. Soluble and insoluble A\u03b2, hyperphosphorylated tau and NFTs, and sex- and age-associated factors may each contribute, separately or in conjunction, to the mechanisms underlying sleep impairment. Plausible mechanisms include the inhibition or destruction sleep-regulating neurons, such as the VLPO, medial septum or the cholinergic neurons of the LDT/PPT. Damage to the brainstem or medial septum by the formation of plaques or synaptic interference by the accumulation of soluble A\u03b2 may be responsible for the observed reductions in REM sleep, as well as associated cognitive declines.Given the growing population of patients with dementia and the potential for sleep augmentation to decelerate the progression of AD, detailed studies examining the chronology of sleep impairments in individuals with AD are needed. Such studies would provide a road map to which mouse models best emulate specific stages of AD. This knowledge may guide more fruitful investigations into mechanisms elucidating which AD biomarkers of AD would be best targeted for future therapies.VJD contributed to the original conception and design of the manuscript, constructed all tables and figures, as well as compiled and organized the data necessary to construct the tables. CW and TK revised and made significant contributions to the content and formatting of the manuscript. All authors contributed to the article and approved the submitted version.This work was supported by Ministry of Health & Welfare (HI22C0467 and HU22C0150 to TK) and Ministry of Science & ICT (NRF-2022R1A2C3009749 to TK).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Adiponectin (ADIPO) and interleukin-8 (IL-8) are proteins that play a significant, albeit opposing, role in metabolic syndrome (MetS). The reported data on the effect of physical activity on the levels of these hormones in the population of people with MetS are conflicting. The aim of the study was to evaluate the changes in hormone concentrations, insulin-resistance indices and body composition after two types of training. The study included 62 men with MetS , randomly assigned to: an experimental group EG1 (n = 21) with aerobic exercise intervention, an experimental group EG2 (n = 21) with combined aerobic and resistance exercise intervention, both for 12 weeks, and a control group CG (n = 20) without interventions. Anthropometric measurements and body composition , as well as a biochemical blood analysis  and homeostatic model assessment\u2014triglycerides (HOMA-TG) were performed at baseline, and at 6 and 12 weeks of intervention and 4 weeks after the intervention (follow-up). Intergroup (between groups) and intragroup (within each group) changes were statistically evaluated. In the experimental groups EG1 and EG2, no significant changes were observed in the ADIPO concentration, but a decrease of GYNOID and insulin-resistance indices was confirmed. The aerobic training led to favorable changes in IL-8 concentration. The use of combined resistance and aerobic training led to improved body composition, decreased waist circumference and better insulin-resistance indices in men with MetS. The criteria of metabolic syndrome (MetS) include central obesity, high blood pressure, lipid disorders and hyperglycemia . MetS leThe process of MetS and obesity treatment begins with lifestyle modification ,11. The Both the adipose tissue and skeletal muscles are endocrine organs that conduct a specific dialogue, releasing cytokines, adipokines and myokines\u2014hormones that reach their receptors, playing an important role in the homeostasis of the body ,17. TheyAn example of information transferred from the adipose tissue to skeletal muscles is the production of adiponectin (ADIPO)\u2014synthesized mainly in adipose tissue, whose Adipo1 receptors are located in the skeletal muscles. ADIPO also journeys to the Adipo2 receptor located in the liver . It is rAs a marker of adipose tissue dysfunction, an index based on the ADIPO/LEP ratio (ADIPO/LEP ratio) has been introduced . To calcThe cytokine interleukin-8 (IL-8), responsible for the increase of pro-inflammatory macrophages (M1) in adipose tissue, acts in opposition to ADIPO . IL-8 isCurrent knowledge on the impact of physical activity on the level of ADIPO, AD-IPO/LEP ratio and IL-8 does not give clear conclusions and requires more studies, preferably clinical, randomized and with a group of more than 20 people . Based oThe study was designed as a randomized, prospective controlled study. A detailed description of the research methods was presented in previous papers ,42. The The process of assigning to groups was carried out randomly; each of the study participants chose an opaque envelope with the group number. During the statistical analysis of the results and the performance of the biochemical determinations, the staff were unaware of the group assignment. Due to the form of the intervention or its absence, no blind trial was used.The study involved 62 Caucasian men aged 30 to 45 (mean age 36.6 \u00b1 6.9) who met the main selection criterion, concerning an increased waist circumference (WC) above 94 cm (which is one of the criteria for the diagnosis of MetS) and two of the other four MetS criteria for men: systolic (SBP) \u2265 130 mmHg or diastolic (DBP) \u2265 85 mmHg; HDL C < 1.03 mmol/L; triglycerides > 1.7 mmol/L; fasting plasma GL \u2265 5.6 mmol/L or drug treatment for the disorder presented  .Experimental group: EG1 of men (age: 34.21 \u00b1 6.06) with MetS (n = 21) performing aerobic exercise ;Experimental group: EG2 of men (age: 37.37 \u00b1 7.08) with MetS (n = 21) performing combined aerobic\u2013resistance exercise ;Control group: CG of men (age: 38.26 \u00b1 7.43) with MetS (n = 20) who did not engage in any physical activity .Participants were randomly assigned to 3 groups:There were no differences between age and basic somatic parameters before the interventions.Apart from being male and meeting the MetS diagnosis, the following criteria were included in the study: age 30\u201345, medical certificate of no contraindications to undertake aerobic\u2013resistance health training, and written consent for voluntary participation in the research project.The exclusion criteria for the research project comprised: medical contraindications to resistance and aerobic training, too-low attendance at trainings in intervention groups (minimum attendance above 90%) and others, thoroughly presented in a previous paper .The volunteers underwent training and received a written description of the objectives, procedures and the planned course of the research project. Each of the participants could withdraw from the study at any time without any consequences. During the project, there were situations leading to a reduction in the number of study participants. The main exclusion factor was absence during control measurements\u20149 participants. As a result of introducing excessive changes in diet , 2 participants were excluded; as a result of infectious diseases, 3 participants were excluded; and as a result of too-low attendance during training, 3 patients were excluded (<90% attendance).All subjects were trained by the same personal coach and asked not to change their diet, not to undertake physical activity other than with a trainer, and to maintain their regimen of medications and dietary supplements during the observation. All participants of the study gave written consent to the processing of personal data, voluntary participation in the study and the use of the obtained results for scientific purposes. The research project was approved by the Ethics Committee of the District Medical Chamber in Krakow (90/KBL/OK/2020). The studies were registered in the register of clinical trials on the ANZCTR  platform: ACTRN 12622001394730. The flowchart of the study is presented in The research project took 16 weeks, during which the evaluation was carried out 4 times: before the intervention, after 6 weeks of training, after 12 weeks of training and after 16 weeks of the project\u2014the last 4 weeks was the period of observation without scheduled training. The following parameters were assessed during the control weeks.2] was calculated.Body mass (BM) [kg], body height (BH) [cm] and waist circumference (WC) [cm] were used in the study. BM, BH and WC were measured in a standing position, in underwear, with the head in the Frankfurt plane. BM was measured with a medical scale  with an accuracy of 50 g. BH was measured with an accuracy of 1 mm with a stadiometer . Waist circumference (WC) was measured last during free exhalation using an anthropometric tape, between the upper edge of the iliac crest and the lower edge of the costal arch. Based on the obtained BM and BH, the body mass index (BMI) [kg/mDual-Energy X-ray Absorptiometry (DEXA) was applied to assess body composition: fat-free mass (FFM) [%], body fat (BF) [%] and gynoid body fat (GYNOID) [%]. Evaluation of body composition was carried out with the Lunar Prodigy Primo PR+352163  device according to the manufacturer\u2019s guidelines.\u00ae system, F.L. Medical, Torreglia, Italy) by experienced nurses. The collected blood was centrifuged (RCF 1.000\u00d7 g) immediately after collection for 15 min at 4 \u00b0C  and serum was collected and stored at \u221280 \u00b0C until further study .Fasting blood samples were collected after a one day break from workout, in the morning, from the basilic, cephalic or median cubital vein into test tubes (VacumedThe concentrations of adiponectin (ADIPO), leptin (LEP) and interleukin-8 (IL-8) were measured using commercially available ELISA kits according to the manufacturer\u2019s protocol. The human Adiponectin ELISA Kit  was purchased from Mediagnost . The human Leptin Sandwich ELISA Kit  was purchased from DRG Instruments GmbH . The IL-8 ELISA kit  was purchased from DRG Instruments GmbH . An ELx 808 spectrophotometric microplate reader  was used to determine the optical density at 450 nm. Marking was performed in the Laboratory of Genetics and Molecular Biology at the Department of Physiology, Jagiellonian University Medical College, Cracow, Poland.Index of adiponectin-to-leptin ratio (ADIPO/LEP ratio) was calculated based on the formula:Fasting plasma glucose (FPG) [mmol/L] was determined via the enzymatic method using a Cobas c701/702 biochemical analyzer . Serum insulin concentration (INS) [\u00b5IU/mL] was determined via the electrochemiluminescence method (ECLIA) using the Cobas e801 apparatus . The determinations were performed in accordance with the manufacturer\u2019s instructions using reagents dedicated to the GLUC3 and Elecsys Insulin analyzers, respectively.Using the specifications of the Architect ci-4100 clinical chemistry analyzer (Abbott Laboratories), serum triglyceride (TG) [mg/dl] levels were determined via spectrophotometry.Evaluation of sensitivity to insulin was performed with the use of the homeostatic model assessment\u2014adiponectin (HOMA-AD)  and homeThe International Physical Activity Questionnaire (IPAQ)  was emplTo evaluate the energy value of the participants\u2019 diets, a clinical dietician conducted a 24 h nutrition interview using the nutrition record method. The data were analyzed using the DietaPro program  to quantitatively assess the nutrition habits and monitor any changes in the diet during the intervention. Based on the obtained results, a report of dietary nutrients was generated: proteins [g], carbohydrates [g] and fats [g].The exercise interventions were conducted at a fitness club and supervised by a personal coach. The training sessions were carried out at the same time of day  by the same personal coach, in a room with consistent temperature (22 degrees Celsius) and humidity. Adherence to the intervention was monitored using a session attendance checklist, and participants who dropped out from more than 10% of the training sessions for 12 weeks were excluded from the analysis.Individualized planning and monitoring of aerobic and resistance training intensity were based on the guidelines of the American College of Sports Medicine . The OneThe intervention aimed to achieve 3 training sessions per week, which resulted in 3 \u00d7 5.5 MET for a week equivalent to resistance training, and 3 \u00d7 6 MET for running .The aerobic training intervention  involvedNext, the participants increased the intensity of their workout to 70% HR max by adjusting their velocity or angle on the treadmill, resistance on the upright bikes  or range of motion or resistance on the x-trainer . The aerobic exercises mainly consisted of fast walking or jogging on the treadmill; however, in the case of reporting pain from the musculoskeletal system, the participants had an option to change the device. The training was continuous and maintained a steady HR, with a duration of 45 min. Following the aerobic training, participants stretched the muscle groups they had engaged for 10 min.The aerobic\u2013resistance intervention  was condThe initial resistance training comprised three complex exercises involving the whole body, such as one-arm dumbbell row, squats and push-ups, with four sets and 120 s breaks between them. Due to the body\u2019s adaptation to training, in the second week of intervention, the resistance training procedure was changed to push\u2013pull and the training volume was changed to 3 sets of 6 exercises with 90 s breaks. After 3 weeks of intervention, the training was performed in 3 series of 9 exercises with 60 s breaks. The load was gradually increased from the first week, from 50% 1RM to 70% 1RM in the second and the remaining 10 weeks of intervention . The proAfter resistance exercises, there was an aerobic training element: the participants trained with an intensity of 50% HR max in the first week and 70% HR max from the second week of intervention on a treadmill , upright bike  or x-trainer . To avoid overloading the joints of the lower extremities, the subjects could use these three devices alternately.The duration of the resistance training sessions was 30, 35 and 40 min, respectively, followed by 20, 15 and 10 min of aerobic training, respectively. The training session ended with the stretching phase (5 min).The Shapiro\u2013Wilk test was used to examine the distribution of the variables being analyzed. To compare the effects of an intervention on changes in the analyzed variables in the experimental groups and control group, the one-way ANOVA test with repeated measures and post hoc comparison (Tukey\u2019s test) was employed. Homogeneity of variance within the groups was tested with Levene\u2019s test.\u019e2\u00a0coefficient, which is the ratio of the sum of squares (SS) for the effect to the total sum of squares (SS). The squared eta coefficient interpretation follows Cohen\u2019s guidelines: 0.1 \u2264 0.3 (low effect), 0.3 \u2264 0.5 (moderate effect) and \u22650.5 (high effect)  was confirmed between the initial measurements and measurements in the 6th (p < 0.001) week of intervention  and in EG2 (p = 0.03). No significant changes were found in TEE in CG. A significant difference in TEE between the intervention groups and the CG in the 6th week of observation was confirmed (p = 0.03).After performing health training intervention both in EG1 (rvention . In the p < 0.001), but a visible increase in consumption occurred only at the follow-up stage (p = 0.01). CG confirmed the variability in protein intake between measurements (p = 0.04).When analyzing the balance of nutrients during the study, no changes in the level of protein supplied in the diet in the EG1 group were confirmed . In EG2,p = 0.04) (p = 0.01).In the EG1 and EG2 intervention groups, carbohydrate consumption increased between measurements ( = 0.04) . In bothp = 0.03) and CG (p = 0.01) were confirmed. The increase in fat consumption was noticeable in the EG2 group after 6 (p = 0.04), 12 (p = 0.03) and 16 (p = 0.01) weeks compared to the measurement before the intervention. Similar relationships were observed in the CG group; despite the lack of intervention, fat consumption increased in the 6th (p = 0.03), 12th (p < 0.001) and 16th (p = 0.04) weeks of observation ; after 16 weeks, the observed increase was 5.8% (p < 0.001).Analyzing the body composition of the people participating in the study, the most beneficial changes regarding FFM increase, GYNOID and WC decrease were confirmed in the EG2 group . No chanp = 0.03) (p < 0.001), in which decreases in GYNOID levels were confirmed after 6 (p = 0.02) and 16 (p < 0.001) weeks. No significant changes were observed in the CG group.In the case of GYNOID, it decreased after 6 weeks of intervention in the EG1 group ( = 0.03) . A signip < 0.001) and in each of the analyzed measurement moments (p = 0.01). The decrease in WC was 3.8 cm after 12 weeks of intervention (p = 0.01).After the WC analysis, changes in EG1 and CG were not confirmed . Howeverp = 0.02) in HOMA-AD values in the EG2 group were confirmed (p = 0.03), followed by a decrease in HOMA-AD in subsequent measurements. No significant changes in HOMA-AD values were observed in the EG1 and CG groups.By analyzing changes in insulin resistance indices, changes between measurements (onfirmed . There wp = 0.04) and EG2 (p = 0.03) intervention groups were confirmed (p = 0.04). There were no significant changes in the CG.In the case of the HOMA-TG index, changes between measurements in the EG1 (onfirmed . The grep < 0.001) and after 6 (p = 0.01) and 16 (p < 0.001) weeks.Observations of ADIPO fluctuations did not confirm significant changes in the concentration of the analyzed hormone both within groups and between groups . Howeverp = 0.04). In contrast, in CG there was a significant increase in IL-8 concentration (p = 0.01) between measurements of 36% over 16 weeks. Additionally, at week 16, a significant difference in IL-8 concentration between CG and EG1 was confirmed (p = 0.03)  .Significant correlations  were conp < 0.001). The variability of ADIPO was explained by the analyzed variables in 36%  (The applied multiple regression model demonstrated that both HOMA-AD and GYNOID were significantly connected with the concentration of ADIPO ( = 0.36) .The aim of the study was to compare the 12-week effect of two types of physical training on ADIPO and IL-8 concentrations and carbohydrate metabolism indices in men with MetS compared to men with MetS not undertaking physical activity, and to evaluate changes in these parameters after 4 weeks of observation without scheduled training. Training interventions over 12 weeks did not change the concentration of ADIPO, but significant correlations were observed between ADIPO and HOMA-AD and GYNOID. The applied multiple regression model showed that both variables explained 36% of ADIPO variability. Aerobic exercise was associated with a decrease in IL-8 concentration after 6 weeks of intervention in men with MetS. The use of a combined resistance and aerobic training led to a significant increase in FFM, a decrease in GYNOID and WC and a reduction in the level of insulin resistance in the group of men with MetS.In a meta-analysis of studies on people with pre-diabetes or diabetes, in which the participants were overweight or obese and often had MetS, it was observed that physical exercise increased the concentration of ADIPO. Furthermore, it was emphasized that the results in improving the concentration of ADIPO were observed in studies using aerobic exercise, whereas other forms of physical exercise did not bring such results . SimilarOur study confirmed changes in the level of GYNOID, achieving a significant reduction after 6 weeks in both intervention groups. We also observed a correlation between ADIPO and GYNOID in the intervention groups, which may suggest that while achieving greater beneficial changes in body composition, the concentration of ADIPO could increase to obtain significant differences. Moreover, there have been reports that ADIPO is negatively correlated with the level of android and total adipose tissue and positively correlated with insulin sensitivity .Our study confirmed significant correlations between ADIPO and two indices of insulin resistance: HOMA-AD and HOMA-TG. Khan et al.  proposedThe processes that can occur under the influence of training sessions should be analyzed in detail in order to properly understand the relation between ADIPO, insulin resistance and physical activity in males with MetS and obesity. Skeletal muscles are the main area of carbohydrate metabolism in the human body; moreover, they are also the main area of insulin resistance development . ChronicIn obesity, transcription factors such as SERBP1c may lead to the development of lipotoxicity in skeletal muscles through the deposition of triglycerides, acyl-CoA, phosphatides, diacylglycerols (DAG) and ceramides . In our Our results showed that the ADIPO/LEP ratio decreased significantly after 6 weeks of aerobic intervention. The occurring relation resulted from a significant increase of LEP level, presented in our previous work  and the In our study, a significant 35% decrease in IL-8 concentration was observed after the first 6 weeks of intervention in the group using aerobic training. Decreased concentration of IL-8, in relation to the initial concentration, was observed until the end of the research project in the group with aerobic training, but no such dependencies were found in the group with aerobic\u2013resistance training. The results presented in the meta-analysis show that the physical activity of people with MetS leads to a decrease in the concentration of IL-8 . HoweverIn our study, in the group without physical activity, a gradual increase in IL-8 concentration between measurements was observed and the cytokine level was 45% higher in the control group compared to the group with aerobic intervention. According to paper Bruun et al.,  high levCurrently, the physiological function of IL-8 in skeletal muscle is still unknown; thus, further research is needed to identify the potential of IL-8 as a diagnostic biomarker.The current study has some limitations. The participants of the project increased their nutrient intake despite recommendations to maintain their current diet. Determination of specialized biochemical indicators, e.g., the level of glycated hemoglobin (HbA1c) could allow for a better determination of the level of insulin resistance and give the possibility of a more precise description of the correlation and assessment of modified HOMA indices.In conclusion, undertaking a 12-week aerobic\u2013resistance training program, despite the lack of significant changes in the level of ADIPO, led to a decrease in insulin resistance expressed as HOMA-AD and HOMA-TG. In the aerobic training group, no significant changes were observed in the ADIPO concentration, but a decrease in insulin resistance expressed in HOMA-TG was confirmed. The level of ADIPO was significantly related to the level of GYNOID and HOMA-AD. Under the influence of aerobic\u2013resistance training, there was a significant increase in FFM and a decrease in GYNOID and WC. Aerobic training led to a decrease in IL-8 after 6 weeks of intervention. The use of aerobic training, as well as a combination of aerobic and resistance training, brought health benefits to men with MetS. In our study, a combination of aerobic and resistance training resulted in more benefits. More tests are recommended in order to select the correct training method in the treatment of MetS."}
+{"text": "Ubiquitin\u2010conjugating enzyme E2S (UBE2S), an E2 enzyme, is associated with the development of various tumors and exerts oncogenic activities. UBE2S is overexpressed in tumors, including hepatocellular carcinoma (HCC). However, the key molecular mechanisms of UBE2S in HCC still need additional research. The aim of this study was to explore the role of UBE2S in HCC.The expression levels of UBE2S in HCC tissues and cells were detected by western blot analysis, quantitative real\u2010time polymerase chain reaction analysis (qRT\u2013PCR), and immunohistochemistry (IHC). A 3\u2010\u20102,5\u2010diphenyl\u20102H\u2010tetrazolium bromide (MTT) assay, wound healing assay, colony formation assay transwell assay, and animal models were used to detect the proliferation and migration ability of HCC cells. Western blot analysis, qRT\u2013PCR, immunofluorescence, small\u2010interfering RNA (siRNA), and plasmid transfection and coimmunoprecipitation (Co\u2010IP) assays were performed to detect the interaction among UBE2S, von Hippel\u2013Lindau (VHL), hypoxia\u2010inducible factor 1\u2010alpha (HIF\u20101\u03b1), Janus kinase\u20102 (JAK2), and signal transducer and activator of transcription 3 (STAT3).In this study, we found that high UBE2S expression was associated with poor prognosis in HCC patients. In addition, UBE2S expression was upregulated in HCC tissues and cell lines. Knockdown of UBE2S inhibited the proliferation and migration of HCC cells in vitro and in vivo by directly interacting with VHL to downregulate the HIF\u20101\u03b1 and JAK2/STAT3 signaling pathways. Accordingly, overexpression of UBE2S significantly enhanced the proliferation and migration of HCC cells in vitro via VHL to upregulate HIF\u20101\u03b1 and JAK2/STAT3 signaling pathways. Furthermore, we found that downregulation of UBE2S expression enhanced the sensitivity of HCC cells to sorafenib in vivo and in vitro.UBE2S enhances malignant properties via the VHL/HIF\u20101\u03b1 and VHL/JAK2/STAT3 signaling pathways and reduces sensitivity to sorafenib in HCC. The findings of this study may open a new approach for HCC diagnosis and provide a potential option for the treatment of HCC. Among them, 49 pairs of tumor and paired peritumoral liver tissues were collected to detect the mRNA levels of UBE2S, and 8 of 49 were collected to detect protein levels of UBE2S. None of the patients received any other antitumor treatment before surgery such as chemotherapy, radiotherapy, targeted therapy. The use of human tumor samples was approved by the Ethics Committee of the Affiliated Drum Tower Hospital of Nanjing University Medical School.2.22 (human embryonic liver) cell line and the Huh7 (human HCC) cell line were purchased from the Cell Bank of Xiangya Central Laboratory, Central South University. Three liver cancer cell lines, HCCLM3, MHCC\u201097 L, and MHCC\u201097H, were gifts from the Liver Cancer Institute, Zhongshan Hospital, Fudan University. SMMC\u20107721, HepG2, Bel\u20107402, Hep3B, PLC, and Li\u20107 cell lines were obtained from the cell bank of the Chinese Academy of Sciences. HCCLM3, MHCC\u201097 L and MHCC\u201097H, HepG2, Hep3B, SMMC\u20107721, PLC, Huh7, and Li\u20107 cells were cultured in complete DMEM . LO2 and Bel\u20107402 cells were cultured in complete RPMI\u20101640 medium . All cells were supplemented with 10% fetal bovine serum  at 37\u00b0C in a humidified incubator with 5% CO2.The LO2.3Cells were lysed with NP40 solution (Beyotime Biotechnology) containing 1% protease inhibitors (Thermo Fisher Scientific). A BCA protein assay kit (Thermo Fisher Scientific) was used to quantify proteins. Subsequently, the proteins were boiled in loading buffer, fractionated by sodium dodecyl sulfate\u2013polyacrylamide gel electrophoresis (SDS\u2013PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membranes. After that, they were stained with primary antibodies overnight at 4\u00b0C, and the protein bands were incubated with horseradish peroxidase (HRP)\u2010conjugated secondary antibody and detected using enhanced chemiluminescence  with a Tanon 5200 Chemiluminescent Imaging System . Antibodies against UBE2S, cyclin B, P\u2010CDC20, CDC20, E\u2010cadherin, N\u2010cadherin, vimentin, Snail, JAK2, p\u2010JAK2, STAT3, p\u2010STAT3, and p21 were purchased from Cell Signaling Technology. Antibodies against VHL and HIF\u20101\u03b1 were purchased from Proteintech . Antibodies against cyclin A and cyclin E2 were purchased from Santa Cruz Biotechnology (Santa Cruz Biotechnology). The dilution of the primary antibodies was 1:1000. The dilution of anti\u2010GAPDH  was 1:10,000.2.4\u2212\u0394\u0394Cq method with GAPDH.The primer sequences of human UBE2S and GAPDH were as follows: UBE2S: (5\u2032\u20103\u2032) CGACACGTACTGCTGACCAT, (5\u2032\u20103\u2032) GCCGCATACTCCTCGTAGTT, and GAPDH: (5\u2032\u20103\u2032) CCATGTTCGTCATGGGTGTGAACCA, (5\u2032\u20103\u2032) GCCAGTAGAGGCAGGGATGATGTTC. Total RNA was extracted through TRIzol\u00ae reagent  and converted to cDNA with PrimeScript RT Master Mix . SYBR Premix Ex Taq II  was used to detect the relative mRNA expression levels, which was calculated by the 22.5n\u2009=\u200957) and the low UBE2S expression group . The primary antibodies used for IHC were anti\u2010UBE2S , anti\u2010p\u2010JAK2 , anti\u2010VHL , anti\u2010HIF\u20101\u03b1 , anti\u2010p21 , anti\u2010Ki67 , and anti\u2010p\u2010STAT3 . The secondary antibody for IHC was Super Sensitive TM IHC Detection System Kit . The integral optical density (IOD) from IHC staining of anti\u2010VHL, anti\u2010HIF\u20101\u03b1, anti\u2010p21, anti\u2010Ki67, anti\u2010p\u2010STAT3, and anti\u2010p\u2010JAK2 was calculated using Image\u2010Pro Plus software, and three samples were used for statistics.Protein levels were detected by IHC as previously described.2.63 cells/well for equal amounts of cell seeding. After culturing for 48, 72, and 96\u2009h, MTT solution  was added to each well for 4\u2009h. Then, 150\u2009\u03bcL of DMSO was added to each well to dissolve the insoluble crystals. A spectrophotometer was used to measure the absorbance at 570\u2009nm. Each assay was carried out at least three times.Cells were plated into 96\u2010well plates at the same concentration of 5\u2009\u00d7\u2009102.7Cells were seeded into 6\u2010well plates (500 cells/well) for 2\u2009weeks. After colony formation, the medium was discarded. After washing with PBS three times, the cells were fixed with methanol and stained with crystal violet for 15\u2009min. The cell colonies were photographed and counted.2.8Wound healing culture inserts (Ibidi) were used to count migration capacity. First, the cells were seeded into each well of a culture insert . After incubation overnight, the culture insert was removed and were carefully washed with PBS. Then, they were cultured with DMEM or RPMI\u20101640 medium without FBS. The cells migrated into the cell\u2010free area, and the migration was monitored and photographed with an Olympus BX51 microscope at 24, 48, and 72\u2009h. ImageJ software was used to calculate the wound closure rate. All experiments were repeated three times.2.9Transwell inserts (Merck Millipore) were used to detect the migration capacity. The upper chamber with or without Matrigel (354230) coating (BD) for 30\u2009min at 37\u00b0C for invasion and migration tests, respectively, was seeded with 20,000 HCC cells resuspended in DMEM without FBS. Then, the lower chamber was added with 0.8\u2009mL DMEM supplemented with 10% FBS. At the end of the experiment, the medium was removed. The upper chamber membrane was fixed with methanol. The cells on the upper side were removed via a cotton swab. Then, the transwell inserts were stained with crystal violet. The cells on the opposite side of the membrane were photographed and counted in six random fields with an Olympus BX51 microscope.2.10Round coverslips were placed into 24\u2010well plates, and cells were seeded onto the coverslips. After 24\u2009h, the cells were fixed with 4% formaldehyde and permeabilized for 30\u2009min. Then, they were washed with PBS three times, and 500\u2009\u03bcL of 0.2% Triton X\u2010100 was added to the 24\u2010well plate for 15\u2009min. After the cells were blocked with 1% BSA for 1\u2009h, they were incubated with primary antibody overnight at 4\u00b0C. Then, they were washed with PBST three times, and the cells were incubated with FITC\u2010conjugated goat anti\u2010rabbit IgG  for 2\u2009h. After washing with PBS three times, the cells were incubated with DAPI (Thermo Fisher Scientific) for 15\u2009min before being mounted with ProLong Gold Antifade Reagents. Finally, the cells were photographed through a fluorescence confocal microscope . The primary antibodies used for immunofluorescence were anti\u2010VHL , anti\u2010HIF\u20101\u03b1 , anti\u2010vimentin , and anti\u2010E\u2010cadherin .2.11The sequences of human UBE2S siRNA (siUBE2S) and VHL siRNA (siVHL) were as follows: siUBE2S sense (5\u2032\u20103\u2032): GACACGUACUGCUGACCAUTT and siVHL sense (5\u2032\u20103\u2032): CCAAUGGAUUCAUGGAGUA, which were purchased from GenePharma. Lipofectamine\u00ae RNAiMAX (Thermo Fisher Scientific) was used to transfect cells according to the manufacturer's instructions.The pcDNA3.1\u2010UBE2S, \u2010VHL, and \u2010p21 plasmids were synthesized by GeneChem . The pcDNA3.1 empty vector was used as a negative control. The plasmids were delivered into cells via Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific). The cells were transfected at a density of 80%\u201390%.2.125) were seeded into 6\u2010well plates. The cells were harvested and fixed with cold 70% ethanol overnight at \u221220\u00b0C after 24\u2009h. Then, after washing with PBS, they were stained in a solution with propidium iodide (PI) (0.5\u2009mg/mL) and RNase A (10\u2009mg/mL). Flow cytometry  was used to confirm the cell cycle qualitatively.Cells (5\u2009\u00d7\u2009102.136) were seeded into 6\u2010well plates. After 24\u2009h, the cells were collected including apoptotic, dead, and adherent cells. Then, the cells were washed with cold PBS and resuspended in annexin V\u2010FITC binding buffer. Apoptosis was detected by flow cytometry  after incubation with annexin V\u2010FITC/PI. A TUNEL Apoptosis Assay Kit (Roche) was used for TUNEL staining according to the manufacturer's instructions.Cells . Transfection efficiency was detected via GFP in the lentiviral vectors. Cells were transfected with constructs of the UBE2S firefly luciferase reporter for 48\u2009h in order to stably knockdown or overexpress corresponding genes. After approximately 80% of the cells were transfected, puromycin (1\u2009\u03bcg/mL) was added to the cells for approximately 2\u2009weeks to generate stably transfected cells.2.15For Co\u2010IP, the cells were lysed with NP40 (Beyotime Biotechnology) solution containing 1% protease inhibitors. Then, the cell lysates were incubated with antibodies against UBE2S, VHL, or IgG at 4\u00b0C overnight, and then incubated with protein A\u2009+\u2009G Sepharose beads (Beyotime Biotechnology) for another 1\u2009h. Eluted proteins were resolved via 12% SDS\u2013PAGE, and detected by western blotting with antibodies of UBE2S, VHL, or IgG.2.166 cells in 200\u2009\u03bcL of PBS per mouse). The longest (L) and shortest (W) tumor diameters and mouse body weights were measured. Tumor volume (mm3)\u2009=\u20091/2\u2009\u00d7\u2009L\u2009\u00d7\u2009W2. All mice were sacrificed 25\u2009days after the subcutaneous HCCLM3 cell injection and 16\u2009days after the subcutaneous Bel\u20107402 cell injection, and the tumor weights were measured. The tumors were fixed in 10% phosphate\u2010buffered formalin for IHC staining. For sorafenib treatment, there were three groups . Seven days after the subcutaneous cell injection, the control\u2010shRNA+sorafenib and UBE2S\u2010shRNA+sorafenib groups were intraperitoneally injected with sorafenib (50\u2009mg/kg) daily for 4\u2009weeks. 0.4% dimethyl sulfoxide (DMSO) in PBS was used as negative control. The volumes were measured every 7\u2009days, and after 35\u2009days, all mice were sacrificed.All animal experimentation were approved by the Animal Care Committee of Nanjing University in accordance with the guidelines of the Institutional Animal Care and Use Committee. The subcutaneous xenograft model in nude mice was performed as previously described.Orthotopic xenograft tumor models were created as previously described.2.17Lungs obtained from the subcutaneously transplanted tumor model were fixed in 4% paraformaldehyde. The tissue sections were embedded in paraffin and stained with H&E as previously described.2.18https://gdc.cancer.gov, up to January 28, 2016). The microarray datasets  were downloaded from GEO (http://www.ncbi.nlm.nih.gov/geo/). The level of UBE2S was analyzed by a log2\u2010fold\u2010change. Average gene expression was calculated for all involved genes for one sample to analyse the expression level of the pathway gene. The average value represents the sample's average gene expression of the pathway as previously reported.The RNA\u2010seq and clinical data of different cancer categories were obtained from the TCGA database \u2009>\u20091, was detected in 29 of 42 (69%) HCCs Figure\u00a0. The uprs Figure\u00a0. In conc3.2To further investigate the role of UBE2S in HCC cell proliferation, migration, and invasion, we downregulated the expression level of UBE2S through siRNA transfection (siUBE2S and sicontrol) and overexpressed UBE2S via plasmid transfection (pUBE2S and MOCK). The choice of those specific cells to perform UBE2S downregulation or upregulation depended on the UBE2S levels in the HCC cell lines Figure\u00a0. HCCLM3 3.3To evaluate the effect of UBE2S on HCC progression in vivo, HCCLM3 cells with stable knockdown of UBE2S expression (named UBE2S\u2010shRNA HCCLM3) and Bel\u20107402 cells with stable overexpression of UBE2S (named UBE2S\u2010 overexpression Bel\u20107402) were established via lentivirus transfection. Then, we used UBE2S\u2010shRNA HCCLM3 cells and control\u2010shRNA HCCLM3 cells to establish subcutaneous xenograft tumor models and orthotopic xenograft tumor models. The results showed that downregulation of UBE2S significantly inhibited tumor size Figure\u00a0. The tumIn addition, in liver orthotopic xenograft tumor models, the results were consistent with those of subcutaneous xenograft tumor models, which indicated that knockdown of UBE2S could inhibit tumor growth in vivo Figure\u00a0. In addi3.4To explore the molecular mechanism of downregulation of UBE2S\u2010mediated inhibition of HCC growth, gene set enrichment analysis (GSEA) was conducted based on TCGA data. The results showed that the G2/M checkpoint signaling pathway was upregulated in HCC patients with high expression of UBE2S mRNA Figure\u00a0. Then, tMany studies have shown that the p21 protein is a regulator of the cell cycle at the G2/M checkpoint.3.5Previous studies have shown that UBE2S can regulate tumor development through the VHL/HIF\u20101\u03b1 signaling pathway.In addition, we tried to explore the direct interaction between UBE2S and VHL in HCC cells by co\u2010IP. First, HCCLM3 cells were transfected with the UBE2S plasmid and then incubated for 12\u2009h in the presence of 10\u2009mM MG132, a proteasome inhibitor, and the cell lysates were immunoprecipitated with anti\u2010UBE2S antibodies. Then, western blotting was used to detect the expression level of VHL. The results showed that VHL was contained in the cell lysates immunoprecipitated with anti\u2010UBE2S antibodies Figure\u00a0. SimilarIt has been reported that VHL can regulate the transduction of JAK/STAT signaling.In conclusion, UBE2S may regulate HCC growth and metastasis by inactivating not only VHL/HIF\u20101\u03b1 signaling but also the VHL/JAK2/STAT3 pathway.3.6Because downregulation of UBE2S increases VHL protein levels, we questioned whether the effect of downregulation of UBE2S in HCC is attributable to the enhancement in VHL stability. We cotransfected a lentivirus to generate stable UBE2S knockdown and siVHL in HCCLM3 cells and examined cell proliferation and migration. The influence of VHL on cell proliferation at 96\u2009h was detected by MTT assays Figure\u00a0. In FiguIn addition, we also checked whether overexpression of VHL could reverse the accelerated cell proliferation, migration, and invasion mediated by UBE2S overexpression. UBE2S\u2010overexpressing Bel\u20107402 cells were cotransfected with pVHL, and cell proliferation and migration were examined. pVHL reversed the enhancement of cell proliferation and migration mediated by UBE2S overexpression in Bel\u20107402 cells Figure\u00a0. We furtThe data suggested that VHL plays a key role in UBE2S\u2010mediated HCC development, in which UBE2S could bind VHL and promote VHL degradation to activate VHL/HIF\u20101\u03b1 signaling and the VHL/JAK2/STAT3 pathway.3.750) of sorafenib in HCCLM3\u2010control\u2010shRNA cells and HCCLM3\u2010UBE2S\u2010shRNA cells were 10.57\u2009\u03bcM and 8.68\u2009\u03bcM, respectively. In addition, upregulation of UBE2S enhanced sorafenib resistance in Bel\u20107402 cells , ubiquitin\u2010conjugating enzyme (E2), and ubiquitin ligase (E3). UBE2S is an E2 enzyme, which can elongate the ubiquitin chains on target proteins.p\u2009=\u20090.014 and 0.036, respectively), which indicated that UBE2S in HCC is associated with poor prognosis. Overexpression of UBE2S in HCC cells markedly promoted cell proliferation, migration, and invasion, while knockdown of UBE2S had the opposite effects in vitro. Our study was similar to Pan's report and strongly indicated that UBE2S is a tumor oncogene in HCC and may be a novel potential therapeutic marker for HCC. In addition, we further measured the role of UBE2S in HCC cell proliferation, migration and invasion, as well as the underlying mechanism in vivo, and first found that downregulation of UBE2S could induce cell cycle arrest at G2/M phase in HCC cells. In our data, cell cycle analysis of HCC cells indicated that downregulation of UBE2S suppressed HCC cell proliferation by arresting HCC cells in the G2/M phase rather than inducing cell apoptosis. In addition, the p21 protein levels were significantly increased after downregulation of UBE2S in HCC cells, and overexpression of p21 reversed the upregulation effects of UBE2S on HCC cell proliferation. More importantly, the experiment showed that downregulation of p21 reverses the effect of arresting HCC cells in the G2/M phase after inhibition of UBE2S in HCCLM3 cells. Based on these results, our results confirmed that downregulation of UBE2S arrests HCC cells in the G2/M phase, resulting in decreased cell proliferation by decreasing p21 degradation.In the present study, our data indicated that HCC patients with high expression level of UBE2S had shorter disease\u2010free and overall survival via Kaplan\u2013Meier analyses ; formal analysis ; methodology ; software ; writing \u2013 original draft ; writing \u2013 review and editing . Xiangjie Xu: Formal analysis ; methodology . Shasha Wu: Data curation ; investigation . Weiwei Shi: Data curation ; formal analysis . Guang Zhang: Data curation ; methodology ; project administration . Yin Cao: Data curation . zhongxia wang: Conceptualization ; data curation ; funding acquisition . junhua wu: Conceptualization ; formal analysis ; writing \u2013 review and editing . chunping jiang: Conceptualization ; formal analysis ; funding acquisition ; investigation ; project administration .This work was supported by the National Natural Science Foundation of China ; the Research Project of Jinan Microecological Biomedicine Shandong Laboratory ; Shandong Provincial Laboratory Project (SYS202202); the Primary Research & Development Plan of Jiangsu Province (BE2022840); the Startup Fund for scientific research, Fujian Medical University (2018QH1112); and the Open Project of Chinese Materia Medica First\u2010Class Discipline of Nanjing University of Chinese Medicine (No. 2020YLXK007).The authors declare that they have no conflicts of interest.Human liver cancer tissue specimens were obtained following the guidelines approved by the ethics committee of the Affiliated Drum Tower Hospital of Nanjing University Medical School, and all patients gave written informed consent used for research purposes. All animal protocols were approved by the Animal Care Committee of Nanjing University in accordance with the guidelines of the Institutional Animal Care and Use Committee.Table S1.Click here for additional data file."
\ No newline at end of file