diff --git "a/deduped/dedup_0935.jsonl" "b/deduped/dedup_0935.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0935.jsonl"
@@ -0,0 +1,45 @@
+{"text": "Migraine and tension-type headaches impose a tremendous economic drain upon the healthcare system. Intravenous and oral niacin has been employed in the treatment of acute and chronic migraine and tension-type headaches, but its use has not become part of contemporary medicine, nor have there been randomized controlled trials further assessing this novel treatment. We aimed to systematically review the evidence of using intravenous and/or oral niacin as a treatment for migraine headaches, tension-type headaches, and for headaches of other etiologic types.We searched English and non-English language articles in the following databases: MEDLINE (1966\u2013February 2004), AMED (1995\u2013February 2004) and Alt HealthWatch (1990\u2013February 2004).Nine articles were found to meet the inclusion criteria and were included in this systematic review. Hypothetical reasons for niacin's effectiveness include its vasodilatory properties, and its ability to improve mitochondrial energy metabolism. Important side effects of niacin include flushing, nausea and fainting.Although niacin's mechanisms of action have not been substantiated from controlled clinical trials, this agent may have beneficial effects upon migraine and tension-type headaches. Adequately designed randomized trials are required to determine its clinical implications. Migraines and tension-type headaches impose an important burden upon society and the working public. According to the National Headache Foundation, some 45 million Americans suffer from chronic, recurring headaches and 28 million of these suffer from migraine headaches annually . FurtherEven though advances have been made with regard to the treatment of acute migraine headaches , many patients often discontinue their migraine interventions due to treatment dissatisfaction . Among iOne novel, but not really new treatment option, is the administration of niacin (nicotinic acid) through intravenous and/or oral routes. Niacin is a well-known over-the-counter (OTC) supplement primarily used for its ability to favorably influence cholesterol levels. Recently, there have been anecdotal reports demonstrating the effectiveness of niacin for aborting acute migraine attacks , and forWe conducted a systematic search of English and non-English language articles in the following databases: MEDLINE (1966\u2013February 2004), AMED (1995\u2013February 2004) and Alt HealthWatch (1990\u2013February 2004). Articles were searched with the key search terms \"Migraine\" combined with the Boolean Operator \"AND \"Niacin\" OR \"Nicotinic Acid.\" Additional searches were conducted with the search terms \"Headache\" and \"Tension.\" To supplement the search, we searched through the references of the articles we found from the databases.To be included in our final review, articles had to report on the use and administration of niacin for migraine or any other types of headache. We included articles assessing original reports in both peer-reviewed and non-peer-reviewed journals.We determined the evidence grade of each report found, based on the hierarchy of evidence developed by the Oxford Centre for Evidence Based Medicine . Table 1A total of 14 articles were screened ,7,9-20. This case series of 21 patients was limited as it was uncontrolled and involved a small number of patients. The methods that were used to evaluate efficacy of the treatment were primarily based upon a subjective questionnaire or medical record. The results would have been more meaningful if all the patients used the questionnaire to evaluate their treatment responses. Finally, although the symptomatic changes were witnessed immediately following niacin injection, the lifestyle recommendations may have had therapeutic benefits as well.This study involved 100 patients having headaches of multiple etiologies. This study was not properly controlled, but did at least provide some comparison against a group of patients that were not administered the flush forms of intravenous niacin. The fact that the control group did not substantially benefit from the intravenous niacinamide lends more therapeutic efficacy to the ability of intravenous sodium nicotinate or niacin to have a marked therapeutic effect. The sample size was sufficient in number (n = 100), but the determination of therapeutic effectiveness was purely subjective and did not include any questionnaire or standardized method of evaluation.Side effects were minimal; 2 patients experienced mild abdominal cramps, 1 patient vomited but was suspected as having a pathologic condition of the stomach, and 1 other patient with migraine vomited forty-five minutes after the injection. A few patients found the treatment to be worse than their headaches. The authors concluded that the relief of headaches seemed to be correlated with the degree of flushing from the sodium nicotinate or niacin, and that this therapy was most useful among the migraine, spinal tap, and idiopathic groups.A number of shortcomings were evident in this article. The first of which was that the study was not properly controlled and did not contain a placebo group or a group of patients acting as self-controls. However, some of the patients were given intravenous treatments on more than one occasion. This procedure helped in determining treatment reliability and reproducibility since niacin appeared to achieve therapeutic benefits on several occasions. There were no standardized methods of evaluating efficacy since the treatment responses were based upon the medical record and subjective reports. The results would have been more meaningful if all the patients used a standardized questionnaire prior to and after each treatment. In addition, there was only one male subject and 14 females in the study.In this study of 35 patients were given treatments of intravenous dihydroergotamine methanesulfonate, intravenous niacin, or oral combination tablets of ergotamine tartrate and caffeine. Although no control group was used in this study, the patients were given multiple treatments on several occasions. This offered an interesting comparison to be made between niacin and other treatments. Since no control or placebo group was included, it cannot be determined if the therapeutic results were due, in part, to chance or placebo effects. The results might have been more meaningful if all the patients were given a standardized questionnaire prior to and after each treatment, and if an objective measure was incorporated to further substantiate patient responses.These cases reported were well described and clearly demonstrated therapeutic responses during the intravenous and oral niacin therapy. The results would have been more reliable if a comparison had been made to a control group or to a similar patient cohort that were not given the same treatments. Even if the patients served as self-controls, and were told to stop the niacin treatment for a specified period of time, more information could have been gained from their therapeutic responses to niacin. Overall, this report of five cases provides an interesting approach to patients having chronic tension headaches and depression. Its value is limited by the difficulty in extrapolating these findings to a greater number of patients.In this study involving 50 patients there was no data that listed pertinent identifying information, treatment response, past treatments, and duration of treatment for each patient. This would have strengthened the report by being more descriptive, and thus more amenable to critical analysis. If a comparison were made to a control group or a similar patient cohort not given the same treatments, more validity could be have been ascribed to this method of treatment. The patients could have also served as their own controls, thus providing more information about the therapeutic responses to niacin. It cannot be determined if the therapeutic results were due, in part, to chance or placebo. No method of evaluating efficacy was mentioned, except that the responses to niacin were \"very satisfactory\" in 44 of 50 cases. The results would have been more meaningful if all the patients were given a standardized questionnaire prior to and after each treatment, and if an objective measure was incorporated to substantiate their responses to niacin.In this report, Hall describes the use of niacin for his migraine headaches remarking that the migraines resolved when intense flushing occurred. According to Hall, niacin's benefits and side effects might be due to its ability to release serotonin and histamine from the stomach. There is no reason to doubt Hall when describing his therapeutic response to niacin. However, his report was brief, had no control and was entirely subjective as he was the participant as well as examiner.In this report of 2 cases, it was found that in both cases migraines were relieved with oral niacin. The report would have been more rigorous if the patients had acted as their own self-controls. The value of the report is further diminished by the difficulty in extrapolating these findings to a greater number of patients.This case report was of a 62-year-old woman with a 40-year history of migraine headaches. The patient never acted as her own self-control, which would have made the findings of the case report more meaningful. The fact that the patient's migraine headaches increased in severity after a reduction in dosage does lend more support to niacin as being a migraine preventive agent. The hypothesized increase in serotonin from niacin administration cannot be proven given the limited amount of data contained in the case report. Like all case reports, its value is diminished by the difficulty in extrapolating these findings to a greater number of patients.The results of this systematic review indicate that niacin may have a therapeutic effect on migraine headaches, tension-type headaches, and headaches of other etiologies. The quality of the evidence at this point, however, is only hypothesis generating, and randomized trials are required to determine the clinical implications of this novel treatment.There are several important limitations to consider in the interpretation of this review. We did not find any randomized or controlled trials of niacin on these headaches. We cannot determine to what extent publication bias has on the results of this review. We are unable to draw clinical inferences on the results of the included studies as they were of low quality and have a low level of external generalizability. Despite these limitations, we attempted to conduct an exhaustive search and included all reports of relevance.2 (PGD2) in the skin, leading to a marked increase of its metabolite, 9\u03b1, 11\u03b2-PGF2, in the plasma [-1 M aqueous methylnicotinate on the forearm, PGD2 is markedly released in the skin and its metabolite appears in high amounts in the plasma [2 causes vasodilation of the intracranial arteries, but niacin's ability to abort acute migraine headaches suggests that this might be what is occurring. Old reports cited by Bicknell and Prescott [Reasons for niacin's effectiveness can only be considered hypothetical, and require clarification from future randomized controlled trials. In acute migraine headaches some of the symptoms arise from activation of the trigeminovascular complex. Activation of this complex leads to intracranial vasoconstriction causing the migraine aura, followed by headache due to vasodilation of the extracranial vessels and activation of the perivascular nociceptive nerves . When tae plasma . When nie plasma ,23. It iPrescott , demonstIn terms of tension-type headaches, it appears that intravenous niacin is of benefit acutely due to its presumed central vasodilatory properties. Like migraines, part of the underlying pathophysiology of chronic tension-type headaches involves central mechanisms, such as the trigeminal system . ChronicSome of the reports did demonstrate prophylactic benefits when niacin was administered orally every day. It is now recognized that a deficit of mitochondrial energy metabolism  plays a role in the pathogenesis of chronic migraine headaches . Niacin Niacin might also prevent tension-type headaches by improving mitochondrial energy metabolism within the skeletal muscles, and by increasing blood flow and oxygenation to the skeletal muscles. The overall net-effect could be a reduction in lactic acid concentrations, leading to reduced episodes of muscular tension and soreness. Niacin may reduce lactic acid concentrations since supplemental niacinamide (the amide of niacin) has been shown to reduce blood lactate and pyruvate concentrations by more than 50% in a patient with MELAS  syndrome by the third day of treatment . This poThe side effects of intravenous niacin were found to be minimal from the summarized articles. The most common side effects were abdominal cramping, vomiting, and uncomfortable sensations of the skin and burning. A few of the patients described found the treatments to be worse than their headaches. In the articles where blood pressures were evaluated, little-to-no change occurred among the individuals treated with intravenous niacin. In a more recent study, parenteral niacin given to hypertensive and normotensive patients demonstrated a significant decrease in systolic, diastolic, and pulse pressures among the hypertensive subjects .With respect to the oral administration of niacin, very few patients reported side effects. Even though niacin was well tolerated orally, we previously reported in a randomized placebo-controlled trial examining the safety of immediate-release or crystalline niacin, that it can be associated with intolerable side effects . The mosThe side effects of greater concern from oral niacin have to do with sustained- or slow-release preparations. These preparations are better in terms of compliance since patients experience less cutaneous flushing with them. However, the use of these preparations have been associated with reversible hepatic toxicity in doses equal to or greater than 1500 mg per day with an acute onset of clinical symptoms of hepatitis in a relatively short period of time (2 days to 7 weeks) . Other rEven though niacin's mechanisms of action have not been substantiated from controlled clinical trials. It is possible that this agent has a beneficial effect upon migraine and tension-type headaches and the prophylaxis of these headaches. It is imperative that properly designed controlled trials are developed in order to determine niacin's true therapeutic effects and adverse effect profile. In terms of its ability to abort acute migraine headaches, a placebo-controlled trial of parenteral niacin and sumatriptan seems to be worthy of consideration. In terms of prophylaxis, a placebo-controlled trial of oral niacin and riboflavin or coenzyme Q10 also seems worthy of investigation.Dr. Jonathan Prousky is associated with Swiss Herbal Remedies, Ltd., a company that sells nutritional supplements including niacin. They had knowledge of this manuscript and have not seen this manuscript.JP wrote the manuscript. DS contributed to the text, revised the results section, and assisted with the tables."}
+{"text": "Chronic headaches from head trauma and whiplash injury are well-known and common, but chronic headaches from other sorts of physical traumas are not recognized.Specific information was obtained from the medical records of 15 consecutive patients with chronic headaches related to physically injurious traumatic events that did not include either head trauma or whiplash injury. The events and the physical injuries produced by them were noted. The headaches' development, characteristics, duration, frequency, and accompaniments were recorded, as were the patients' use of pain-alleviative drugs. From this latter information, the headaches were classified by the diagnostic criteria of the International Headache Society as though they were naturally-occurring headaches. The presence of other post-traumatic symptoms and litigation were also recorded.The intervals between the events and the onset of the headaches resembled those between head traumas or whiplash injuries and their subsequent headaches. The headaches themselves were, as a group, similar to those after head trauma and whiplash injury. Thirteen of the patients had chronic tension-type headache, two had migraine. The sustained bodily injuries were trivial or unidentifiable in nine patients. Fabrication of symptoms for financial remuneration was not evident in these patients of whom seven were not even seeking payments of any kind.per se can be discounted as the cause of the headaches. So can fabrication of symptoms for financial remuneration. Altered mental states, not systematically evaluated here, were a possible cause of the headaches. The overall resemblance of these headaches to the headaches after head or whiplash traumas implies that these latter two headache types may likewise not be products of structural injuries.This study suggests that these hitherto unrecognized post-traumatic headaches constitute a class of headaches characterized by a relation to traumatic events affecting the body but not including head or whiplash traumas. The bodily injuries  Chronic headaches from head trauma -4 and whThe 15 patients in this series were all those seen by the author from February 1997 through December 2001 for chronic headaches apparently related to traumatic events that involved the body but did not cause either head trauma or whiplash injury  ,13. The Detailed information had been systematically collected on the headaches' characteristics , duration and frequency (when episodic), and accompaniments , and on the patients' use of pain-alleviative drugs. With this information, the headaches were classified by the 1988 diagnostic criteria of the International Headache Society (IHS) , extant identifiable damage to a part of the body . All but two of the events  were sudden and unexpected.The physical traumas were very diverse Table . None ocwithin minutes , within hours , within days , and within weeks . The interval for the one patient who did not have an abrupt traumatic event (patient 8) was arbitrarily set as the interval between his hospital discharge and headache onset.The reported intervals between the traumatic events and the headaches' onsets are listed in Table chronic tension-type headache [migraine without aura, and one of them also had headaches fitting the criteria for migraine with aura [Thirteen of the 15 patients had serious continuous headaches of varying intensity. Among these, 11 patients had headaches that met the IHS's diagnostic criteria for headache  fully, with aura . Table 1new daily-persistent headache, which has the same features as chronic tension-type headache, but is distinguished from it by becoming daily and unremitting within three days of its onset [chronic tension-type headache is used herein.After the completion of this study, the IHS added a new primary headache class called ts onset . Many, iThe IHS's criteria for chronic tension-type headache and migraine without aura  are listHeadache frequency more than 15 days/month.At least 2 of the following pain characteristics:1. Pressing quality2. Mild or moderate severity3. Bilateral location4. No aggravation by routine physical activityBoth of the following:1. No vomiting2. No more than one of the following: Nausea, photophobia or phonophobiaHeadaches last 4 to 72 hours.Headache has at least 2 of the following characteristics:1. Unilateral location2. Pulsating quality3. Moderate or severe intensity4. Aggravation by routine physical activityDuring headache at least one of the following:1. Nausea and/or vomiting2. Photophobia and phonophobiaThis 46-year-old man was seen in 1999 for headache that began five days after an \"injury\" at work five months earlier. Ten minutes after forcefully yanking a wrench to loosen a rusted bolt, he felt pain in his neck and right shoulder. An urgent-care facility prescribed analgesics after taking (unremarkable) cervical radiographs. This pain disappeared before I saw him. The headache was a continuous dull to moderate ache mostly in the right cranium. It was unaffected by physical activities or neck movements, and was not nauseating. Neurological examinations were normal. Pressure on his posterolateral neck was not painful. A cranial CT was normal. His only other symptom was insomnia. Analgesics, taken just a few days per week, had little effect. Amitriptyline lessened the headache's intensity enough for him to return to work.This 48-year-old man with a neurologic impairment of gait was seen in 1999 for continuous headache that began a few hours after he fell while walking two months earlier and cut his face on the edge of a metal sign. His head was not struck and he was not stunned. He bled profusely from the laceration, which was closed with 26 stitches in the emergency room. His neurologist detected no new neurologic findings and a cranial CT was normal. His headache was a non-nauseating steady ache of mild to moderate intensity in his forehead, unaffected by exercises, brightness, or noise. Non-prescription analgesics and opioids had been ineffective and discontinued.This 40-year-old man was seen in 2000 for a continuous headache that began 10 months earlier soon after he awoke from anesthesia for a cystoscopy. When the urologist did not report the (negative) result of the procedure to him in the recovery suite, the patient became visibly angry and soon complained about his treatment to the health-care facility. His anger persisted and was expressed at his consultation. The headache was a steady non-nauseating pain that fluctuated from dull to moderate intensity at the vertex, temples, and posterior neck, and was unaffected by physical activities, brightness, or noise. He worked despite it and no longer took analgesics. A cranial MRI had been normal. A trial of amitriptyline had been unsuccessful. At his last report a month later he reported improvement on buspirone.This 47-year-old woman was seen in 2001 for symptoms that she attributed to a snowmobile accident seven weeks earlier. She was seated behind the driver when he mistakenly shifted into reverse sending the machine backwards five feet into a tree. At impact, he fell on top of her without hurting her or himself. She recalled no impact of her helmet against the tree or the snowmobile. She felt no pain, but was upset and asked to be taken home. On the next day, her neck ached. Cervical radiographs taken eight days after the accident were normal. Two days later, she developed severe headache, nausea, dizziness, and confusion. A cranial CT taken later that day was normal. Subsequent MRIs of her head and neck were normal.Headache soon became her most prominent pain. It was a continuous pressing ache of mild to moderate intensity in her temples and orbits, unaffected by physical activities. It was sometimes nauseating, without emesis. Brightness and noise bothered her. She also complained of dizziness and impaired thinking and memory. Infrequent doses of analgesics were not beneficial. She was unable to work. Neurologic examinations were normal. Preventive medications were refused. When seen next, by a colleague, two months after her visit with me, the headache and dizziness had lessened considerably, but her thinking difficulties remained disabling. Four months later, she reported continuing improvement.This 53-year-old man was seen in 2001 for a headache of six-months duration that began two days after he struck the right side of his chest against a rock without striking his head when he toppled over in a beach chair. His chest pain was extreme. He obtained a prescription for hydrocodone/acetaminophen tablets that day, but discontinued taking them after several doses because of side effects. Coughing, sneezing, and lying on his right side were excruciating. His physician diagnosed a fractured rib. Two days after the injury, he returned to work despite his chest pain and new headache. The chest pain disappeared in a few weeks, but the headache persisted. It was a continuous, non-nauseating, bifrontal \"tightness\" of dull to moderate intensity, unaffected by mild physical activities, brightness or noise. Amitriptyline and propranolol had been ineffective and produced side effects. When I saw him, he was taking only occasional doses of non-prescription analgesics. Neurological examinations and cranial MRI were normal. He declined other medications. Seven months later, he reported that his headache persisted.This 43-year-old man was seen in 2001 for a continuous headache that he first became aware of soon after discharge from hospital, in 1997, where he had undergone 25 days of intensive treatment for a high-voltage electrical injury that had necessitated amputation of his arms. Unconsciousness had been instantaneous, but brief, and post-traumatic amnesia lasted about ten minutes.His headache was a bi-occipital, non-pressing ache, usually of mild to moderate intensity, and only occasionally severe enough to force him to cease physical activities. Then it was nauseating, without emesis. Some loud noises, but not brightness, seemed to intensify it. He had been getting slight relief from a few doses of ibuprofen per week, but had received no preventive medications.His cognitive and emotional states and cranial MRI were unremarkable. He had been provided with prosthetic upper limbs with grasping hands. Amitriptyline decreased the headache slightly. The addition of progressively larger doses of dextroamphetamine limited the headache to only a few days per month.Thirteen of the fifteen patients had, besides headache, at least one other post-traumatic symptom of the type commonly seen after head trauma ,17,18. SSeven patients  were not seeking and could not seek financial compensation for their headaches. Three patients  were receiving Workers' Compensation (WC) payments for their headaches and other symptoms. One patient (number 15) was receiving both WC and Social Security (SS) disability payments. One other receiving WC payments was also seeking SS disability payments (number 1). One patient (number 8) was seeking SS payments only. One patient (number 2) was litigating for payment of medical bills. Only one patient (number 4) had pursued a lawsuit for monetary compensation for the symptoms, but he continued to experience headaches even after receiving the award.This report has presented evidence suggesting that traumatic accidents and other events without head trauma or whiplash injury but with other physical effects can induce chronic headaches. Such headaches have barely been alluded to before (see Background). The 15 patients presented here blamed their headaches and other symptoms on their traumas and are supported in this by the juxtaposition of their headaches to the traumas. Twelve of the 15 patients developed their headaches minutes, hours, or a few days afterwards  and thereby foster their investigation.Both head-trauma and whiplash headaches form clinical classes based on their preceding traumas, but the headaches of the present series have no single trauma to join them. They were, however, all related to acute and unexpected (with one exception) traumatic events that affected the patients physically. Hence, they could be designated The headaches themselves were serious chronic headaches. They had the features of continuous chronic tension-type headaches in 13 patients and frequent migraines in the other two ,16. ThisThe apparent overall likeness of the traumatic-event headaches to those after head and whiplash traumas suggests a pathogenic link between them. Such a link would be discredited if, as many believe, headaches after head and whiplash traumas are due to structural injuries to the brain and neck, respectively ,24,27-29This study indicates that chronic headaches similar to those after head trauma and whiplash injury can follow other types of acute and unexpected physically injurious traumatic events. The evidence suggests that these traumatic-event headaches are psychogenic. The occurrence of such headaches supports the concept that the chronic headaches after head trauma or whiplash injury may likewise not be products of structural injuries.The author(s) declare that they have no competing interests.DCH was the sole investigator and author.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2377/4/17/prepub"}
+{"text": "In the present study, we examined clinical and laser-evoked potentials (LEP) features in two groups of chronic tension-type headache (CTTH) patients treated with two different approaches: intra-oral appliance of prosthesis, aiming to reduce muscular tenderness, and 10 mg daily amitriptyline.Eighteen patients with diagnosed CTTH participated in this open label, controlled study. A baseline evaluation was performed for clinical features, Total Tenderness Score (TTS) and a topographic analysis of LEPs obtained manually and the pericranial points stimulation in all patients vs. healthy subjects. Thereafter, patients were randomly assigned to a two-month treatment by either amitriptyline or intra-oral appliance.Both the intra-oral appliance and amitriptyline significantly reduced headache frequency. The TTS was significantly reduced in the group treated with the appliance. The amplitude of P2 response elicited by stimulation of pericranial zones showed a reduction after amitriptyline treatment.Both therapies were effective in reducing headache severity, the appliance with a prevalent action on the pericranial muscular tenderness, amitriptyline reducing the activity of the central cortical structures subtending pain elaborationThe results of this study may suggest that in CTTH both the interventions at the peripheral and central levels improve the outcome of headache. Although tension-type headache is the most common type of primary headache, its pathophysiology is poorly understood. The best documented abnormality in patients with tension type headache is increased pericranial myofascial tenderness ,2. PericIn a recent study we examined features of Laser evoked potentials (LEPs) ,6, as weIn our previous study, we postulated that a cortical hyper-vigilance to the pericranial muscles was correlated with muscle tenderness, which may be aggravated or generated by a high level of cortical arousal . The rolAmitriptyline is the only established prophylactic treatment of CTTH ,13 and iIn a previous study we have described in brief form the effects of amitryptiline and intra-oral appliance on the clinical and LEPs features of CTTH patients . The aimEighteen outpatients attending the Headache Centre of the Neurology Clinic of Bari University, who fulfilled the criteria of CTTH associated with a pericranial muscles tenderness, according to International Headache Society (code 2.3.1) , particiThe clinical features of the patients are summarized in Table All patients gave their informed consent to the study, which was ethically approved by the of Neurological and Psychiatric Science Department of Bari University). The clinical examination and recording session were carried out between 12 and 55 hours after the end of the last headache (mean 23 \u00b1 12.2 hours), in the basal condition. The TTS was performed by manual palpation by one neurologist with experience in headache, who was experimentally blinded to the assigned treatment. The right frontalis, masseter, temporalis, pterygoid, sternocleidomastoid, and trapezius muscles, and the sternocleidomastoid and neck muscle insertions were examined using the TTS system. This method uses a combination of behavioural and verbal items, each of which is scored on a four-point Likert scale, defined as: 0 denial of tenderness, no visible reaction; 1 verbal report of discomfort or mild pain, no visible reaction; 2 verbal report of moderate pain, with or without visible reaction; 3 verbal report of marked pain and visible expression of discomfort, according to Langermark and Olesen . The LEP2 laser . The beam diameter was 2.5 mm and the duration of the stimulus pulse was 20 ms. Signals were recorded through 19 disk electrodes, according to the 10\u201320 International System (impedance below 5000 ohms), referring to the nasion with the ground at Fpz. Another electrode was placed above the right eye to record the electrooculogram (EOG). Signals were amplified, filtered (0.5\u201380 Hz), and stored on a biopotential analyser . Time analysis was for 1s, at a sampling rate of 512 Hz. Trials contaminated by ocular or muscle artefacts were excluded from the analysis. An automatic artefact rejection system excluded from the average all runs containing transient signals exceeding 65 mV on any recording channel, including the EOG.Each subject was seated in a comfortable chair positioned in a quiet room with an ambient temperature of 21\u201323 \u00b0C, in an awake and relaxed state, with eyes closed. Subjects and experimenters wore protective goggles during data acquisition. The pain stimulus was a laser pulse (wavelength 10.6 \u03bcm) generated by a COCutaneous heat stimuli were delivered to the dorsum of the right hand (RH), and to the skin above the right frontalis, masseter, temporalis, sternocleidomastoid, and trapezius muscles, and to the neck muscle insertions. The site of stimulation was visualized by a laser beam. The location of the impact on the skin was adjusted slightly between two successive stimuli to avoid the sensitization of the nociceptors and nociceptor fatigue. A 7.5-W laser intensity with 25 ms duration was used in each case . SubjectLEP recordings were analyzed by an investigator blind to the clinical conditions. Blocks of at least 15 trials free from artefacts were averaged offline. A grand average across the two series of stimuli was obtained for each patient. LEPs were identified based on their latency and distribution, and three responses, N1, N2 and P2, were labelled . AbsolutA basal evaluation of clinical features and TTS were performed in all patients. ; patients were then consecutively allocated to the two groups: one patient was allocated to the amitriptyline group for each one who entered the intra-oral appliance group Table . It was The comparison between the two treated groups was performed by the univariate ANOVA, using the conditions T0 and T1 and the type of treatment as factors and the frequency of headache, the TTS, the PR, the temporal N1 and the vertex N2 and P2 as variables.No patient reported significant side effects with the appliance: one of them experienced slight speech disturbance after a month, and the appliance had to be adjusted further. Two patients reported drowsiness due to the amitriptyline, but this did not interfere with their daily activities, and, therefore, continued with the medication regimen. All the clinical features were similar in the two selected groups and ANOVA was employed for treatment as a factor. Both the oral appliance and amitriptyline significantly reduced headache frequency Fig.: the twoThe pain rating of laser stimulus in the two treatments was not significantly different at any of the stimulated sites.The amitriptyline provoked a reduction of the vertex P2 Table . The oraA significant weakness of our study design was the lack of placebo. This was unavoidable due to the fact that we were unable to design a \"placebo\" intra-oral appliance. Instead we compared two different therapeutic approaches, one with a prevalent effect at the peripheral and the other at the central level. This method may be limited, because an oral device may produce a placebo effect, which acts at the central level producing an analgesic effect. A recent review stated that the gold standard of pharmacological research, the double blind placebo control trial, cannot readily be emulated in other forms of therapeutic design, as the behavioral therapy trials : in the The pericranial tenderness, whose generation, according to our studies, is favoured by cortical hyper-attention to pericranial sites ,14, may The results obtained within the experimental conditions of the present study indicate that intervention at both the peripheral and central levels may interrupt this reverberating circuit, improving the outcome of headache.'The author(s) declare that they have no competing interests.M D carried out conception and design, analysis and interpretation of dataMS and CP carried out acquisition of evoked potentials and clinical data.E S carried out the appliance design and acquisition of clinical data.D D carried out acquisition of clinical data.P L and P Li. approved the final version to be submitted"}
+{"text": "Few qualitative studies of headache have been conducted and as a result we have little in-depth understanding of the experiences and perceptions of people with headache. The aim of this paper was to explore the perceptions and experiences of individuals with headache and their experiences of associated healthcare and treatment.A qualitative study of individuals with headache, sampled from a population-based study of chronic pain was conducted in the North-East of Scotland, UK. Seventeen semi-structured interviews were conducted with adults aged 65 or less. Interviews were analysed using the Framework approach utilising thematic analysis.Almost every participant reported that they were unable to function fully as a result of the nature and unpredictability of their headaches and this had caused disruption to their work, family life and social activities. Many also reported a negative impact on mood including feeling depressed, aggressive or embarrassed. Most participants had formed their own ideas about different aspects of their headache and several had searched for, or were seeking, increased understanding of their headache from a variety of sources. Many participants reported that their headaches caused them constant worry and anguish, and they were concerned that there was a serious underlying cause. A variety of methods were being used to manage headaches including conventional medication, complementary therapies and self-developed management techniques. Problems associated with all of these management strategies emerged.Headache has wide-ranging adverse effects on individuals and is often accompanied by considerable worry. The development of new interventions or educational strategies aimed at reducing the burden of the disorder and associated anxiety are needed. Headaches are common, with almost everyone experiencing at least one during their lifetime . The lifMuch of our knowledge about the frequency and management of headache have come from quantitative studies. While these studies provide important information about the magnitude and impact of the problem, they are not able to examine unique aspects about the condition for individual patients. By contrast few qualitative studies of headache have been conducted and as a result we have little in-depth understanding of the experiences and perceptions of people with headache. An in-depth understanding of the experiences of people with headache is important if we are to develop new treatments, interventions or educational strategies that might reduce the burden of the disorder and qualitative studies of headache have been called for to address this gap . Such stParticipants were sampled from respondents to a population-based study ,19 conduA semi-structured interview schedule Table  was deveThe interviews were conducted by DAL between October and December 2002. All of the interviews took place in participants' homes except for one which took place on University premises at the participant's request. Informed consent was sought and granted in all patients interviewed and participants' anonymity and confidentiality were ensured. All interviews were audio-taped with the participants' permission and lasted an average of 45 minutes. Immediately after each interview, brief notes were made by DAL, detailing interesting points made, or behaviours displayed, by the participants. Within two days after the completion of the interview the tapes were transcribed verbatim by the interviewer. A sample of tapes and transcripts were reviewed by AME to check that the interviews had been accurately transcribed. Tapes and transcripts were marked with ID numbers to ensure anonymity and were stored securely to maintain confidentiality.The interviews were analysed using the Framework approach: a thematic analysis consisting of five stages . The firNineteen out of the thirty individuals contacted agreed to participate in the study, 5 respondents indicated that they did not wish to participate, and the remaining 6 did not respond. Reasons for non-participation were not sought. A total of 17 interviews were conducted. Mutually convenient interview times could not be arranged for the last two individuals within the timescale of the study.Table A number of interesting issues were raised throughout the interviews, many of which were inter-related and overlapping. However, three broad themes emerged: 'impact on life', 'knowledge and understanding', and 'management'. A summary of the themes and sub-themes emerging from the interviews is shown in Box 2.Almost every participant reported that various aspects of their lives had been adversely affected by their headaches including work, social and family life and mood.Most participants mentioned that it was difficult to carry out daily activities and that their headaches stopped them doing things to the best of their abilities. At work, several people found it hard to concentrate when suffering a headache and felt their performance had been limited. Most had experienced disruption to their work or careers in some way and taking time off was common. Some participants stated that their headaches had prevented them from being promoted and one reported that her constant headaches had not been compatible with her previous work, forcing her to change career. Accounts were also given of several ways in which family and social life was disrupted by an inability to function fully. Some people had been forced to give up hobbies for example reading and hill-walking and common daily activities like driving and sleeping were often affected. Several people spoke of wanting to be alone when suffering from a headache and not being bothered by anything or anyone. This appeared to be particularly problematic for those with more frequent headaches, and some expressed concerns about how this affected their relationships with family and friends.Several participants found that their headaches were unpredictable and said that they had a lack of control over the course of a headache which impacted on all aspects of their life. It was common for example for participants to have to be sent home from work because a headache had developed. Some participants reported that the unpredictability of headaches had also impacted on their family lives. For example, many spoke of incidents where their headaches had caused them to miss out on something they were looking forward to or had spoiled their enjoyment of an event. Those who had found effective ways of managing and coping with their pain were less troubled by the fact that their headaches could occur at any time.The headaches also affected participants' lives by negatively impacting on mood. Descriptions of the effects headaches had included feeling depressed or down, self-pity, aggression and embarrassment. Depression seemed to occur quite commonly among the participants and one man disclosed suicidal feelings because of his constant pain.In spite of the pain and their lives being adversely disrupted, some participants expressed the need to get on with things, stressing the importance of carrying on and not letting headaches govern them. Some participants went to work and attended social engagements when suffering a headache and spoke of persevering because they felt a responsibility to others. Some had begun to feel that their headaches were just part of their lives. This feeling seemed to be more common among those who had suffered headaches for many years.Participants had developed their own ideas about aspects of their headaches, often suffered from worry about their condition and were seeking additional information from a variety of sources.Most participants had formed their own ideas about different aspects of their headaches including diagnosis, underlying cause and severity. These ideas were often influenced by the experiences of friends and family or from articles they had read. Some participants had not received a formal diagnosis for their headaches but had come up with one themselves based on how their symptoms compared with others they knew or had read about. Patients who believed they had a stressful lifestyle for example diagnosed themselves with tension-type headache, while those with frequent severe headaches often believed they must be suffering from migraines. Several participants had also developed their own ideas on the cause of their headaches and many believed that the underlying cause of their pain was serious. Brain tumours, haemorrhages and strokes were mentioned as potential aetiologies. Many patients had also identified triggers for their headaches such as stress, diet and lifestyle factors. Patients were also trying to understand changes in the severity of their headaches. Reasons given for why headaches had improved included being more relaxed, changing diet, and getting older. Headaches which had deteriorated often caused worry and reinforced the belief of a serious underlying pathology.Many participants had searched, or were searching, for an increased understanding of their headaches to try to make sense of it all. In particular patients were looking for a diagnosis or explanation of the cause of their headaches. Some participants preferred to obtain advice directly from their general practitioners. GP's were often consulted for information, particularly about new treatments or details of drug side effects or interactions. Many participants reported that they had also read books, magazine articles or searched the Internet for information about headaches. Information was also sought from others such as friends and family. Most participants had obtained information from a variety of sources, and some considered themselves to be quite knowledgeable about their condition as a result.Several participants said that their headaches had, at some point, caused them constant and often substantial worry. Many had been worried and frightened when they first started suffering headaches, a particular concern being that the underlying cause might be serious. Others spoke of being greatly worried even though they had suffered headaches for years. Interestingly, receipt of a formal diagnosis from a GP did not seem to reduce worry in some participants and had triggered many to search for increased knowledge and understanding of the problem. It also resulted in a number of participants consulting their GP with the expressed wish for further diagnostic tests. The few participants who had received brain scans to rule out serious underlying pathology stated that they had been relieved to receive the \"all clear\" and their worry had reduced afterwards. Indeed, some reported that their headaches had diminished as a result.Most participants had used or were still using a variety of management strategies including conventional, complementary and personally developed management techniques.Nearly all participants used conventional medication. Participants who reported having migraines most often used drugs obtained by prescription, whereas those who had tension or sinus-related headaches generally reported using non-prescription treatments. Some individuals used medicines obtained by both routes, particularly those who experienced a variety of headache types or who had chronic daily headaches and many found non-prescription medication just as effective as that obtained on prescription. There were several positive comments made about medications, however, a number of individuals expressed concerns. The lack of effectiveness of medications, side effects and drug interactions were of most concern. Many of those who had been on medication for their headaches for a long time no longer found their medicines as effective as they had initially. A number of the participants who reported suffering from side effects also had relatives or friends who had experienced problems while taking medication. Drug interactions appeared to be a problem for a number of respondents particularly for those who took a number of different medicines. A number of people admitted to taking more tablets than they should because their headaches were so severe.Several participants had used complementary therapies, although only after conventional treatments had been tried first. Homeopathy and reflexology were the most frequently mentioned therapies. Most users were positive about their experiences, and most of the participants who had never tried them found the idea appealing. Many individuals had stopped using alternative therapies, despite finding them useful, because they cost too much while others had stopped using them because they simply didn't find them helpful.Most participants had consulted, or were still consulting their GP about their headaches. Many were satisfied with their care and generally had positive opinions of their doctors although some negative comments were made including that the GP was dismissive or disinterested in the problem. Reasons for seeking or not seeking help from a GP for headache were explored. Headache severity was a strong influence, with a change in, or worsening of, symptoms often the prompt for consulting. Effectiveness of management strategies also had a strong bearing on whether participants consulted: those who had already found an effective way of controlling their headaches reported visiting their GP less often than those who struggled to contain their symptoms. Some of the respondents who were no longer seeing their GP were using over-the-counter medicines for their headaches and appeared to have them under control so did not feel they needed to consult with their GP. Other reasons for not consulting included: belief that the doctor did not have enough time; previous bad experience with a doctor; being concerned about the expense of treatments; or worry about what the doctor might think about them.In addition to using medicines and consulting health professionals, participants described a number of other techniques that they had found helpful for alleviating their symptoms. Common strategies included lying down in darkened rooms, or using cold or warm compresses. However, some described less conventional techniques such as digging their fingers into their necks or banging their heads off walls.We found that headaches frequently adversely affect the lives of sufferers, with some wide-ranging effects on work, family life, social activities and mood. Many individuals had developed their own explanations for their headaches and many reported worry about the cause of the headaches. As a result most participants were searching for an increased understanding of their condition. Although the GP was seen as an important source of advice and treatment, many individuals were concerned about taking medication and many were trying complementary therapies or using their own management techniques.This study interviewed men and women from the general population who suffered from different types of headache with various causes, frequency and severity. It is one of the first qualitative studies to explore the experiences and perceptions of people with varying headache types and provides important in-depth understanding of the range of problems headache sufferers face including the impact of headaches, understanding and knowledge about headaches and experiences and expectations associated with healthcare and treatment. By studying the broad spectrum of headache types, rather than limit ourselves to one specific type, we were able to identify a range of issues relevant to headache and its impact. Although this approach means that some of our findings will not be relevant to all headache sufferers the approach has provided a useful insight into the differences in perceptions and experiences of headache sufferers. It has also highlighted some issues that will be worth exploring in sub-groups of individuals, particularly with a view to developing new treatments. Information on the cause of the head pain was not determined in the original cohort and so we do not know if the individuals interviewed in this study had a primary headache disorder or whether the headache was a result of some other cause such as trauma. Our results can only apply to the age range of individuals included in the sample. Specific issues important to groups outwith this age range will not have been identified. In addition, since participants were sampled from a group of individuals with self-reported chronic pain (pain persisting beyond three months), our findings may not reflect the experiences of people who's headaches have not persisted this long. Local availability of different services may have driven use of certain services, and this may vary by geographical location across the UK. The researcher's roles and opinions may have affected both the data collection and interpretation. This was minimised where possible by having checks on the data by a second member of the research team.Several important issues emerged from our study, some of which have been reported in previous studies and some of which have not been documented before. The impact of headaches on life emerged as a key theme in this study and has been well documented in previous quantitative studies -11 and iThe second theme to emerge from our study was knowledge and understanding about headaches which showed that many participants had formed their own ideas about their headaches, which had often led to considerable worry, and many were searching for an increased understanding of their headaches from a variety of sources. In a qualitative study of patients decision making for migraine and chronic daily headache management Peters et al  reportedThe third theme to emerge focussed on issues about management of headaches. We found that most participants had used or were still using a variety of management strategies including conventional, complementary and personally developed management techniques and that satisfaction with different management strategies varied widely. Our findings on issues related to management were largely consistent with previous studies ,17. CottAn in-depth understanding of the experiences of people with headache is important if we are to develop new treatment or interventions that might reduce the burden of the disorder. This study has highlighted some issues that require further investigation and provided useful information that might guide the development of such interventions. For example, the frequent wish to increase understanding of headache suggests that many people with headache could benefit from detailed information about the causes and management of headaches. Research is needed to determine whether such educational strategies result in beneficial health outcomes. Educational strategies are being developed for patients and health care professionals, particularly with reference to migraine ,29 and wThe author(s) declare that they have no competing interests.DAL participated in the design of the study, carried out the interviews, conducted the analysis and drafted the manuscript. AME conceived the study, and participated in its design and coordination and helped to draft the manuscript. PCH conceived the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Functioning is recognized as an important study outcome in rheumatoid arthritis (RA). The Comprehensive ICF Core Set for RA is an application of the International Classification of Functioning, Disability and Health (ICF) of the World Health Organisation with the purpose of representing the typical spectrum of functioning of patients with RA. To strengthen the patient perspective, persons with RA were explicitly involved in the validation of the Comprehensive ICF Core Set for RA using qualitative methodology. The objective of the study was twofold: to come forward with a proposal for the most appropriate methodology to validate Comprehensive ICF Core Sets from the patient perspective; and to add evidence to the validation of the Comprehensive ICF Core Set for RA from the perspective of patients. The specific aims were to explore the aspects of functioning and health important to patients with RA using two different focus group approaches (open approach and ICF-based approach) and to examine to what extent these aspects are represented by the current version of the Comprehensive ICF Core Set for RA. The sampling of patients followed the maximum variation strategy. Sample size was determined by saturation. The focus groups were digitally recorded and transcribed verbatim. The meaning condensation procedure was used for the data analysis. After qualitative data analysis, the resulting concepts were linked to ICF categories according to established linking rules. Forty-nine patients participated in ten focus groups (five in each approach). Of the 76 ICF categories contained in the Comprehensive ICF Core Set for RA, 65 were reported by the patients based on the open approach and 71 based on the ICF-based approach. Sixty-six additional categories  that are not covered in the Comprehensive ICF Core Set for RA were raised. The existing version of the Comprehensive ICF Core Set for RA could be confirmed almost entirely by the two different focus group approaches applied. Focus groups are a highly useful qualitative method to validate the Comprehensive ICF Core Set for RA from the patient perspective. The ICF-based approach seems to be the most appropriate technique. Functioning is recognized as an important study outcome in rheumatoid arthritis (RA). The number of clinical studies addressing functioning as a study endpoint in patients with RA has steadily increased during the past decade . These iThese instruments have also been developed according to the medical perspective and in line with the current concept in outcomes and quality-of-life research of condition-specific measures , that isThe bio-psycho-social model of Functioning, Disability and Health of the World Health Organization (WHO)  establisThis bio-psycho-social view guided the development of the International Classification of Functioning, Disability and Health (ICF), which was approved by the World Health Assembly (WHA) in May 2001. As the ICF has been developed in a worldwide, comprehensive consensus process over the past few years and was endorsed by the WHA as a member of the WHO Family of International Classifications, it is likely to become the generally accepted framework to describe functioning and health. The ICF is intended for use in multiple sectors that, besides health, include education, insurance, labour, health and disability policy, statistics, and so on. In the clinical context, it is intended for use in needs assessment, matching interventions to specific health states, rehabilitation and outcome evaluation. With the ICF, not only an etiologically neutral framework, but a globally agreed-on language and a classification is available to describe functioning on both the individual and population levels and from both the patient perspective and that of the health professionals. The ICF contains more than 1,400 so-called ICF categories, each allotted to the named components in the bio-psycho-social model with the exception of the component Personal Factors, which has not yet been classified. Each ICF category is denoted by a code composed by a letter that refers to the components of the classification  and is followed by a numeric code starting with the chapter number (one digit), followed by the 2nd level (two digits) and the 3rd and 4th levels (one digit each)  influencing their everyday life Table . In the The study was approved by the Ethics Commission of the Ludwig-Maximilian University, Munich.All patients with RA diagnosed according to the revised American College of Rheumatology Criteria  who had The sample size was determined by saturation . SaturatAll groups were conducted in a non-directive manner by the same moderator (MC) and one group assistant . Moderator and group assistants were psychologists with expertise in the ICF and in conducting group processes.The focus groups were conducted according to focus group guidelines, including open-ended questions and further instructions . At the beginning of each focus group, the procedure of the session was explained, and the concept of the ICF was presented in lay terms to all participants. Then one of the two different focus group approaches was performed (open approach or ICF-based approach). The open-ended questions or the titles of the chapters (ICF-based approach) were presented visually to the participants by a Microsoft PowerPoint presentation. At the end of each focus group, a summary of the main results was given back to the group to enable the participants to verify and amend emergent issues.The focus groups were digitally recorded and transcribed verbatim with an Olympus DSS system. The assistants observed the process within the group. Additionally, they filled in field notes according to a standardized coding schema. Field notes refer descriptive observations of the group interaction and of the topics of discussion. After each focus group a debriefing with moderator and assistant took place to review the course of the focus group.The two focus group approaches were conducted alternately.The meaning condensation procedure  was usedAccording to the purpose of multiple coding, the identified concepts were linked to the categories of the ICF by two health professionals  based on established linking rules ,7, whichIn this study saturation was defined as the point during data collection and analysis when the linking of the concepts of two consecutive focus groups reveals no additional 2nd level categories of the Comprehensive ICF Core Set for RA with respect to previous focus groups. Saturation was checked separately for the two approaches.An ICF category of the Comprehensive ICF Core Set for RA was regarded as confirmed if the identical or a similar category emerged from the focus groups . Since the ICF categories are arranged in a hierarchical code system, the 2nd level categories of the Comprehensive ICF Core Set for RA were considered confirmed when the corresponding 3rd or 4th level category of which they were a member had been named by the patients.To audit the accuracy of the analysis, 15% of the transcribed text was randomly selected, analyzed according to the meaning condensation procedure, and linked to the ICF by two health professionals (MC and TS) as a peer review. This process was performed in addition to the process described in the section 'Linking to the ICF'. The degree of agreement between the two investigators regarding the identified and linked concepts in this random selected text was calculated by kappa statistic with 95%-bootstrapped confidence intervals ,42. The n = 25; ICF-based approach, n = 24). Participants' characteristics are summarized in Table A total of 49 participants were included in the focus groups . These concepts were linked to 342 different ICF categories. For 155 of the 342 categories at the 3rd and 4th level of the classification, the corresponding 2nd level categories were considered (n = 66). Thus, the concepts were linked to a total of 253 2nd level categories. Fifty-two concepts named by the participants were more specific than the corresponding most specific ICF category . Regarding the categories of the chapter 'sensory functions and pain' (b2), for example, the participants reported several issues according to the pain quality , which are not specifically covered by the existing ICF categories. Therefore, all these concepts referring to different qualities of pain were linked to the ICF category 'b280 sensation of pain'.A total of 1,900 relevant concepts were identified in the two approaches . Fifteen of them could be allotted to the component Personal Factors, which has not yet been classified.n = 65; ICF-based approach, n = 71). All 2nd level categories of the components Body Functions (n = 15) and Body Structures (n = 8) that are included in the Comprehensive ICF Core Set for RA were reported by the patients in the ICF-based focus group approach  that are not included in the current version of the Comprehensive ICF Core Set for RA were identified in the focus groups  followed by Environmental Factors . Five additional categories in the open approach and eight additional categories in the ICF-based approach were reported by the participants as related to the component Activities and Participation. Two and four additional categories from the component Body Structures were reported in the open and the ICF-based approach, respectively.Sixty-six 2nd level additional categories  was 0.66. The 95%-bootstrapped confidence interval, which indicates the precision of the estimated kappa coefficient, was 0.61 to 0.73.The current version of the Comprehensive ICF Core Set for RA could be confirmed almost entirely from the patient perspective by the two different focus group approaches applied (open approach and ICF-based approach). This study also confirmed relevant outcomes of treatment in RA from the patient perspective  ,43,44. HSixty-six additional 2nd level categories that are not covered in the current version of the Comprehensive ICF Core Set for RA were raised. Most of the additional categories belong to the component Body Functions followed by the component Environmental Factors. Some of these additional ICF categories need special discussion.It is important to emphasize that several categories were named by the patients at a higher level of specification than the 2nd level of the ICF. Some of these more specific categories are included in the Comprehensive ICF Core Set for RA, and some are not . One of Numerous additional categories were related to side effects of medication, which are an important issue for satisfaction with treatment from the patient perspective ,43,50. TWithin the component Environmental Factors numerous categories not included in the current version of the Comprehensive ICF Core Set for RA were reported by the patients. There is no doubt that social support is an important Environmental Factor for patients with RA . SeveralThe category 'e165  assets', which is not included in the current version of the Comprehensive ICF Core Set for RA, was reported by the participants in the focus groups and in the ICF Core Set validation study using individual interviews  as a relWith both approaches used in this study, we found a broad range of themes that could be linked to the corresponding categories. Both approaches performed satisfactory results; however, it is important to mention that some patient-sensitive issues were only reported in the ICF-based approach, for example, 'b535 sensations associated with the digestive system', 'b610 urinary excretory functions', 'b620 urination functions', 'b640 sexual functions', and 'd530 toileting'. Issues concerning mood, disease management and coping were reported in detail in the open approach. Comparing the two approaches, the ICF-based approach seems to be the appropriate technique to confirm the Comprehensive ICF Core Set for RA, particularly with regard to the coverage of the components Body Structures and Body Functions.n = 49) was used to obtain the required level of rich and meaningful data. According to Curtis and colleagues [In qualitative research and studies with focus group methodology, sample sizes typically remain small because intensive data analysis is required ,32. A smlleagues , the smalleagues . The foclleagues . With a lleagues ,74.The characteristics of the sample in this study  are comparable to samples in other national ,75 and iThere are also some limitations of this study that need special mention. The sample consists only of German participants. We conducted this study as a pilot study to develop an appropriate method to validate ICF Core Sets from the patient perspective. Our suggestion is that our methods could be used in similar studies in other countries to establish a cross-cultural perspective. Secondly, the linking process was performed by two health professionals according to established linking rules ,7. HowevFurther research in the context of the development and confirmation of ICF Core Sets is needed. The results of this study will be presented at an international WHO conference and will be taken into account for the decision on the final version of the Comprehensive ICF Core Set for RA. In addition, using this study as a starting point, we are currently conducting further focus group studies with RA patients in other countries to implement the international perspective of the ICF Core Sets. Finally, the results of this study have also influenced the protocol that establishes the methods to developing ICF Core Sets. From now on the collection of data from the patient perspective will be implemented in the preliminary phase of the development of ICF Core Sets .It is extremely important to consider the patient perspective for the validation of the Comprehensive ICF Core Set for RA. The existing version of the Comprehensive ICF Core Set for RA with its selected categories could be confirmed almost entirely by the two different focus group approaches applied. Focus groups are a highly useful qualitative method to validate the Comprehensive ICF Core Set for RA from the patient perspective. The ICF-based approach, which uses the contents of the ICF Core Sets to structure the focus groups seems to be the most appropriate technique. Additional categories not represented in the Comprehensive ICF Core Set for RA emerged from the focus groups.ICF = International Classification of Functioning, Disability and Health; RA = rheumatoid arthritis; WHA = World Health Assembly; WHO = World Health Organization.The authors declare that they have no competing interests.MC conceived and organized the study and drafted the manuscript. TS participated in the development of the focus group guidelines, the drafting of the manuscript and was involved in the peer review. AC participated in the development of the study design and accompanied the study implementation. EA and BK shared the focus groups as assistants and undertook the task of linking the qualitative data to the ICF. GS was responsible for the overall design of the development and the validation of ICF Core Sets."}
+{"text": "The International Classification of Functioning, Disability and Health (ICF) is embraced as a framework to conceptualize human functioning and disability. Health professionals choose measures to represent the domains of the framework. The ICF coding classification is an administrative system but multiple studies have linked diverse clinical assessments to ICF codes. InterRAI-HC (home care) is an assessment designed to assist planning of care for patients receiving home care. Examining the relationship between the ICF and the interRAI HC is of particular interest because the interRAI assessments are widely used in clinical practice and research, are computerized, and uploaded to databases that serve multiple purposes including public reporting of quality in Canada and internationally. The objective of this study was to examine the relationship between the interRAI HC (home care) assessment and the ICF. Specifically, the goal was to determine the proportion of interRAI HC items that can be linked to each of the major domains of the ICF , the chapters and the specific ICF codes.Three coders who were familiar with both the home care assessment and the ICF independently assigned ICF codes to inter-RAI HC items. Subsequently, a series of teleconference meetings were held to reach consensus on the primary code and much later consensus was used to finalize codes for additional items added to the interRAI HC.Following exclusion of administrative and diagnostic sections, 175 interRAI items were examined for potential assignment of codes. Of these 52 were assigned codes related to body function, 43 to activities and participation, 34 to environment, 1 to body structure, 17 to not coded, and 26 to not defined. Considering all 3-digit ICF codes, interRAI items addressed 43.2% of Body Function and 50.6% of Activities and Participation codes.The conceptual overlap in content, offers an excellent opportunity to operationalize the ICF domains and the codes particularly in the areas of Body Function and Activities and Participation. Use of measures such as the interRAI assessments with common elements across settings facilitates standardized reporting for organizations, regions and nations. The concepts underlying the International Classification of Functioning, Disability and Health (ICF) are widely embraced by health professionals and educators. The framework, as shown in Figure The ICF belongs to the WHO family of classification systems which includes the International Classification of Disease (ICD), an international standard diagnostic classification for all general epidemiological and many health management purposes. Clinicians and researchers refer to the ICF framework in choosing measures to represent various domains  but therA key objective of the ICF is to improve communication among health professionals, administrators, governments and regions. This objective is shared by the interRAI \"suite\" of instruments which includes assessments for home care, post-acute care, palliative care, community health, long-term care and mental health. In contrast to the ICF classification, interRAI assessments have direct clinical utility for care and service planning, as well as having applications for outcome and quality monitoring and resource allocation. The assessment items, embedded scales, and quality indicators have been evaluated scientifically for reliability and validity -11. AlthThe Home Care instrument, RAI-HC  is widelThe objective of this study, therefore, is to examine the relationship between the ICF and the interRAI HC. Specifically, the goal is to determine the proportion of interRAI HC items that can be linked to ICF framework domains , to their respective chapters and specific codes. This information would provide evidence of the conceptual relationship between the ICF classification and the interRAI assessments, and would assist in determining the feasibility of using interRAI assessments to generate ICF codes.Three individuals with expertise in geriatrics, rehabilitation, and performance measurement were assigned the task of linking the ICF codes to interRAI items. They were familiar with the interRAI instruments and with the ICF and reviewed both the WHO textbook on the International Classification of Functioning, Disability and Health and the methods for linking health status measures to the ICF codes developed by Cieza and colleagues . The thrWhile this matching was being performed, there was ongoing development of the interRAI suite instruments prior to their release: certain items were dropped and others added. Coding of the new items was done by the lead author (KB) and submitted for verification to the original coders and to an outside expert in ICF coding. It was also decided that reporting of the ICF codes be limited to the primary code which was the one to which future qualifiers would be attributed. This was in contrast to the Cieza et al methodology  which suWe examined the distribution and type of ICF codes linked to the interRAI items as well as the number of interRAI items that linked to each ICF chapter.The ICF can be a companion to the ICD but is not intended for use only to describe deficits in function associated with disease. In contrast to the ICD which assigns codes when a disease or condition is present, the ICF permits the coding of both positive and negative features. All codes are written in neutral language, permitting consideration of deficits and strengths, barriers and facilitators. In total, there are 1,424 ICF codes within 30 chapters and four sections: Body Functions, Body Structures, Activities and Participation, and Environmental Factors, The codes are comprehensive, but there is no expectation that all areas for any one individual or group of individuals will be documented. \"Core sets\" have been identified that are condition-specific -18 and sThe classification is represented by an alphanumeric coding system with the letter \"b,\" \"s,\" \"d,\" and \"e\" referring to body function, body structure, activities and participation, and environmental factors respectively. These initial letters are followed by a numeric code that starts with the chapter number followed by 3 digits and 4 digit codes.Whereas the neutral language of the ICF codes permits consideration of strengths and weaknesses, barriers and facilitators, there is a downside. It is not sufficient to simply list a code; there is a need to apply qualifiers to denote the extent or severity of a problem. The general qualifiers for three components are: no problem, mild problem, moderate problem, severe problem, complete problem, not specified, and not applicable. The Activities and Participation codes can be scored separately for performance and capacity, and the codes for environmental factors can be considered as facilitators or barriers. Reliability studies of the qualifiers have demonstrated low to moderate agreement -23. TherThe interRAI home care assessment, like the other members of the interRAI family, is a multi-dimensional assessment that addresses potential problem areas faced by individuals receiving home care. The original development of the instrument was an international endeavor with extensive input from clinical experts and organizations . The assThe initial sections of the interRAI home care assessment include identification numbers, reason for assessment and reference date for the assessment as well as other items referring to personal factors for which the ICF has no codes. Therefore, we excluded the identification, intake and initial history, and other administrative sections of the instrument. We also excluded 23 diagnostic items that were more appropriately linked to the ICD and the 14 items that related to treatments and procedures such as oxygen therapy and ventilator use that were most probably covered by coding procedure manuals. In total, 175 interRAI Home Care items were examined for potential linkage to ICF codes. The three raters, operating independently and without discussion, demonstrated agreement on 46% of the items. They reached consensus on the remaining items in teleconference discussions.Figure All items in the interRAI HC must be assessed for each home care patient. In contrast, ICF codes are not intended to apply or rather to be used for each individual. Nonetheless, it was of interest to examine the degree to which the interRAI HC addressed the ICF chapters, domains and codes. In the domain of Body Structure, there was only one 3-digit code linked to the home care instrument. As regards the Body Function domain, interRAI HC assessment addresses 43.2% of the 74 ICF 3-digit codes (excluding non-specific/other). Calculation functions were not coded by the interRAI HC but they are subsumed in the evaluation of the instrumental daily living task, managing finances. Items related to functional vision and hearing are included in the interRAI assessment but not other sensory functions such as taste and smell. The home care assessment does not address voice, fluency or articulation functions. Within Activities and Participation, 50.6% of ICF codes were addressed by the home care assessment. All codes within the Self-care chapter were addressed by the interRAI assessment. Codes not addressed included: transportation by animal, assisting others, caring for household objects and numerous items relating to preschool, school, apprenticeship and work.The ICF codes and the interRAI HC include multiple codes or items relating to interpersonal relationships but there are different foci for each. Similarly in the Environmental Factors domain, there is a mismatch in specificity with regards to support and relationships. The ICF codes focus on type of relative providing support whereas the interRAI items focus on frequency of visits, and other interactions, regardless of type of relative. They include an element of time such as participation in activities of long-standing interest and change in social activities. In the area of social support and relationships, interRAI questions record the presence of primary caregiver feelings of distress, anger or depression and caregiver's inability to continue in caring activities. Although they include attitudinal aspects, the intent of the questions were to describe the availability of support and thus, were coded to the E3 chapter level. Similarly, the interRAI question of strong and supportive relationship with family  was coded only to the E3 chapter level. Overall, only 12.7% of the Environmental Factors were covered by the interRAI HC.Table As noted on Table Of the 130 items coded, fifteen were coded only to the chapter level. Three interRAI items \u2013 Timed Walk, Distance Walked and Distance Wheeled \u2013 each linked to Mobility, but were not defined beyond D4, the chapter level because they addressed additional dimensions that would influence any future qualification. These mobility dimensions of speed and distance are not captured by the ICF. Theoretically, future research could determine cut-points for speed and distance that correspond to ICF qualifiers but they would vary by population and setting.Twelve items were coded to E3, the environmental chapter related to social support and relationships. As mentioned above, there was a mismatch of specificity between the ICF codes and interRAI items. The ICF were very specific as regards the type of relative. For other concepts, the ICF coding is not specific enough, for example in classifying contact with health professionals. In the ICF, health care professionals are grouped and classified by three codes . The interRAI HC has separate items for key professionals in the home care setting.Although we tried hard to avoid use of 'other specified' and 'other unspecified' ICF codes, the interRAI communication item relating to making self understood over the past 3 days does not specify method of communication whereas the ICF codes distinguish between verbal, non-verbal and other methods. Thus, it was only linked to the \"other unspecified\" code of D349.There were challenges choosing the optimal ICF code for each item because interRAI items are defined relative to observable behaviours and functions and thus naturally link to multiple dimensions or concepts. For example, daily decision making, a core interRAI item can be linked to b110 consciousness functions, b164 higher level cognitive function, d 230 carrying out daily routine and d177 decision making. The optimal code chosen was d177 as this is the one which would be most meaningful when graded. . A history of pressure ulcers is also not included despite the fact that both history of falls and prior pressure ulcers place individuals at higher risk of future events in those areas. Similarly, recent change in mental status, decision-making, social activities and physical function are important markers of new problems and are predictive of outcomes. Wandering, a behavior associated with Alzheimer's, was also coded as NC. Other items not covered by the ICF include self-rated health and whether the person believes that he can improve in function, both of which would be considered personal factors. As yet, ICF codes for personal factors do not exist.The present study has demonstrated that the interRAI HC content relates well to the ICF conceptual framework and that substantial numbers of items fall within the domains of Body Function, Activities and Participation, and Environmental Factors. The ability to assign ICF codes to instruments in daily practice is one way to propagate the use of the ICF and achieve the goals set forth by the WHO in developing this classification system. Multiple instruments have been linked to ICF codes ,27, but There are two practical applications of our demonstration that there is an interrelationship between the ICF and interRAI HC. First, jurisdictions or organizations that currently use the interRAI instruments but who wish to report ICF codes for monitoring health status may chose to apply the codes to the interRAI instruments without the need for a parallel system of administrative coding. Second, organizations or clinicians may wish to use an interRAI instrument to represent the framework of the ICF without assigning specific codes. This situation would parallel clinical use where clinicians and researchers choose multiple measures to represent the framework.The idea of converting commonly used assessments to an international classification system for comparison is an attractive idea. However, it is important to note that how questions are asked or the method of assessment influence responses or scores . For exaJurisdictions have adopted interRAI assessments for multiple purposes, including resource allocation and funding, informing policy decisions based on the persons' characteristics and outcomes, monitoring and improving quality of services, and public accountability. Despite these important administrative applications, the primary purpose of the assessments is care/service planning and clinicians are encouraged to use the subscales and quality indicators to monitor outcomes and quality indicators at a clinical level. Completion of the assessments is intended as an essential aspect of routine clinical practice rather than an added burden. The concurrent use of the instrument by clinicians for care planning and monitoring of outcomes enhances the accuracy of the data needed by administrators and the policy makers. The WHO statement that \" the road leading to health for all passes through information\" has been further elaborated to include: \"a system of health statistics should both capture the current state of theory in the health domain and provide a framework for health information . Such a The reliability of the interRAI assessments has been facilitated by use of functional and behavioral items to represent constructs. There are specific descriptors associated with each response option, facilitating the understanding of the extent of the limitations and the strengths of the person, and the services provided. A training manual addresses intent, and definition, and provides examples for scoring items. The detailed descriptions of the items and the scoring instructions have contributed to the reliability of the instruments ,7,10. ThEven if the primary focus of an intervention targets aspects of Body Function, the ICF framework reminds clinicians and researchers to measure the benefits in terms of activities and participation and to consider the influence of environmental factors. The ICF framework is not intended to be addressed fully by any single assessment instrument nor is it necessary that any individual be scored relative to each ICF code. There are now several recommended Core Sets for different patient populations. It was beyond the scope of this study to compare content of the Core sets and the interRAI HC instrument. Many of the ICF Core Sets have approximately one third devoted to body structure. In contrast, interRAI assessments focus on functional implications such that impairment to the eye would be captured based on its influence on a person's functional vision.If a person is identified as needing an interRAI HC, all items must be completed. The focus is on function and behavior. Once problem areas or risk of problems are identified, health professionals are encouraged to do more in-depth assessment in that area. It can be argued that ICF codes not covered by InterRAI items are not applicable to all persons requiring home care. For example, mobility items referring to riding animals for transportation or kicking a ball do not seem essential. Another key difference between the approaches is the explicit decision not to focus on risk factors in the ICF classification. Clinical decision making is, however, largely based on prognostic factors that signal the need for care or service planning. The interRAI instruments have focused on comprehensive assessment with a specific emphasis on identifying potential problems that require further assessment or treatment.Electronic health record (EHR) can be seen as a core data set of the most relevant administrative, demographic, and clinical information facts about a person's health care. There are multiple purposes for such information, including sharing of information across settings and among professionals, and longitudinal monitoring and maintenance of health records by individuals. Longitudinal monitoring, in particular, requires reliable information to permit detection of clinically important information even if it is of small magnitude. Coding classifications such as the ICF are unlikely to detect small true changes in status especially if different assessments are used. Although it is theoretically possible to convert the interRAI instruments and other reliable, valid measures to ICF codes, valuable information may be lost. E-health records should retain the original measures to increase precision in identifying risk and assessing small but meaningful change over time. This caveat is also true for other applications that may arise from electronic records such as quality indicators. It is essential that administrators have reliable data on which to make evidence based policy decisions. Health professionals who have embraced reliable and valid outcome measures over the past 20\u201330 years should be cautious to distinguish their support for the ICF framework from potential implications for the re-coding of measures with good measurement properties into ICF codes. For example, gait speed a highly recommended indicator of mobility would be recoded to the coarse qualifier: no problem, mild problem, etc.The discord between the very specific ICF categories and the behaviorally structured interRAI questions created challenges and were likely responsible for the relatively low 46% level of agreement on the first round. For example, decisions had to be made as to whether calculation was a function that could be assigned a code because the Instrumental Activity of Daily Living (IADL) item, managing finances would presume the ability to calculate. Similarly, would the item Cognitive Skills for Daily Decision Making be only attributed to D177 or would it also cover higher thought functions.A limitation of the current study is that we undertook the conceptual linkage to ICF codes but did not attempt to provide meaning to the codes by determining the appropriate qualifier codes. As previously noted, the qualifier codes add meaning to the neutral wording of the ICF codes. InterRAI responses grade severity specific to the domain. Self care is graded based on level of independence in performance whereas behaviours are graded based on the frequency in the past 3 days. Each would have to be converted to the generic ICF coding. In situations where multiple interRAI items link to a single ICF code, empirical analyses could examine the optimal combination of responses to determine the appropriate qualifier. For example, tobacco and alcohol use, taking medications, exercise and preventive health activities may be explored in combination to represent D570- looking after one's health. For local or national reporting, existing interRAI scales can be explored to represent ICF domains.It is challenging to conclusively state the degree to which the interRAI (HC) covers the ICF. The method for assigning codes in this study focused solely on those items for which there was a reasonable expectation that a qualifier could be assigned. Other studies have advocated linkage to all possible concepts ,3. HowevIn summary, our objective to demonstrate compatibility between the ICF and the interRAI HC systems was primarily met. While assigning codes and achieving agreement between the coders was not straight forward, a consensus was reached. Future work would be required to convert interRAI response codes to ICF qualifier codes. Health professionals involved with interRAI assessments can be reassured that they cover substantial domains of the ICF, particularly in the domains of Activities/Participation and Body Function. The ability to cross-walk items and scales within the RAI-HC assessment to the ICF framework shows great potential for the systems to co-exist and complement each other to serve the common purpose of standardizing functional status information.The authors declare that they have no competing interests.KB was involved in the conceptualization, writing and analysis of the manuscript. All authors contributed to writing of the manuscript and critically revised the drafts of the paper. LR, KB and GT participated as raters, and were involved in editing of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Comprehensive ICF Core Set for CWP is an application of the International Classification of Functioning, Disability and Health (ICF) with the purpose of representing the typical spectrum of functioning of patients with CWP. The objective of the study was to add evidence to the validation of the Comprehensive ICF Core Set for CWP from the patient perspective. The specific aims were to explore the aspects of functioning and health important to patients with fibromyalgia, and to examine to what extent these aspects are represented by the current version of the Comprehensive ICF Core Set for CWP.Functioning is recognized as an important study outcome in chronic widespread pain (CWP). The The sampling of patients followed the maximum variation strategy. Sample size was determined by saturation. The focus groups were digitally recorded and transcribed verbatim. The meaning condensation procedure was used for qualitative data analysis. After qualitative data analysis, the identified concepts were linked to ICF categories.Comprehensive ICF Core Set for CWP were reported by the patients. Forty-eight additional categories that are not covered in the Comprehensive ICF Core Set for CWP were raised.Thirty-three patients participated in six focus groups. Fifty-four ICF categories out of 67 categories of the Comprehensive ICF Core Set for CWP could be confirmed from the patient perspective. However, several categories not included in the Core Set emerged and should be considered for inclusion.Most ICF categories of the existing version of the  The perspective of functioning, disability and health of the World Health Organization  establisBody Functions, Body Structures and Activities and Participation as well as the contextual factors Environmental and Personal Factors  and is followed by a numeric code starting with the chapter number (one digit), followed by the second level (two digits) and the third and fourth levels (one digit each)  they present a broad perspective that may reflect the whole health experience of patients.To address the issue of feasibility regarding the over 1,400 ICF categories, ICF Core Sets have been developed in a formal-decision-making and consensus-based process integrating evidence gathered from preparatory studies for a number of most burdensome, chronic health conditions. ICF Core Sets represent a selection of ICF categories out of the whole classification that can serve as minimal standards for the reporting of functioning and environmental factors for clinical studies and clinical encounters (Brief ICF Core Set) or as standards for multiprofessional, comprehensive assessment (Comprehensive ICF Core Set). Since the ICF Core Sets address aspects within all of the components of the ICF . A common musculoskeletal disorder, CWP is characterized by generalized muscular pain and tenderness at multiple sites. Clinical examinations reveal no disease in joints and muscles. Fibromyalgia (FM) is one of the most severe clinical manifestations of CWP. According to the American College of Rheumatology, patients with widespread pain for at least 3 months and tenderness in 11 out of 18 tender points on digital palpation are classified as suffering FM . An estiThe lack of standardized or validated outcome measures for FM has caused uncertainty regarding which key domains of the condition should be measured. This has been acknowledged by initiatives such as the Outcome Measures in Rheumatoid Arthritis Clinical Trials (OMERACT), the goal being to define what should be measured and how, across the spectrum of rheumatology intervention and observational studies . OMERACTComprehensive ICF Core Set for CWP describes the typical spectrum of problems in functioning among patients with CWP. Additionally, it provides an ideal basis from which to define theoretically sound models of functioning and disability in patients with CWP. The current version of the Comprehensive ICF Core Set for CWP includes 65 ICF categories at the second level and two ICF categories at the third level of the classification.The Comprehensive ICF Core Set for CWP is now undergoing worldwide testing and validation using a number of approaches, including an international multicentre validation study and a validation from the perspective of health professionals. Since patients were not directly included in the development of the ICF Core Sets, they are now explicitly involved in the validation of ICF Core Sets to establish the patient perspective in this process. As standards of functioning and health in research and clinical practice, the ICF Core Sets have to show that they address the perspective of those who experience the disease. Since FM is a very common CWP illness with clearly defined classification criteria, we decided to focus on FM patients to validate the ICF Core Sets for CWP.The Qualitative methodology provides the possibility of exploring the perspective of those who experience a health problem; that is, the patient perspective ,14. QualComprehensive ICF Core Set for CWP from the perspective of patients with FM. The specific aims were to explore the aspects of functioning and health important to patients with FM using focus group methodology and to examine to what extent these aspects are represented by the current version of the Comprehensive ICF Core Set for CWP.The objective of the present study was to add evidence to the validation of the We conducted a qualitative study with patients suffering from FM using focus groups. The study was approved by the Ethics Commission of the medical faculty of the Ludwig-Maximilian University, Munich.Persons with FM from three different sources \u2013 the FM day clinic of the Department of Physical Medicine and Rehabilitation of the Ludwig-Maximilian University Munich, the waiting list of the same clinic, and patients from a German self-help group of FM sufferers (Deutsche Rheuma-Liga e.V.) \u2013 were contacted and asked whether they would like to participate in the study. A sample was selected based on the maximum variation strategy  from theThe sample size was determined by saturation . SaturatParticipants filled out a patient questionnaire including sociodemographic and disease-related variables. An established topic guide with guidelines describing how to prepare and perform the focus group sessions as well as open-ended questions was applied . During All focus groups were conducted in a nondirective manner by the same moderator (RH) and one group assistant (MC). The moderator and group assistant were psychologists with expertise in the ICF and in conducting group processes.Comprehensive ICF Core Set for CWP were then presented one at a time. As each chapter was introduced, patients were encouraged to describe in their own words any problems they personally experienced related to each specific ICF chapter. To gain more information relevant to the participants, they were asked \u2013 after the presentation of all chapter titles of each of the ICF components \u2013 whether they thought anything important was missing  by a second health professional. The degree of agreement between the two health professionals regarding the linked ICF categories was calculated by kappa statistic with 95%-bootstrapped confidence intervals [To ensure the accuracy of data analysis, two strategies were conducted. First, ntervals . The valA total of 33 participants were included in six focus groups. Participants' characteristics are summarized in Table Personal Factors  and 90 concepts were not included in the ICF classification, and therefore were defined as not covered . Forty-four concepts were labelled not definable, which means that the concept is too unspecific to be assigned to a concrete ICF category .A total of 1,686 concepts were identified in the focus groups. These concepts were linked to 247 different ICF categories of the first to the fourth levels. There were 277 concepts that could not be linked to ICF categories. Of these, 143 concepts could be allotted to the component sensation of pain (b280).Some concepts named by the participants were more specific than the corresponding most specific ICF category. For example, the participants reported several issues pertaining to the pain quality  that are not specifically covered by the existing ICF categories at that level of detail. All of these concepts referring to different qualities of pain were therefore linked to the ICF category Comprehensive ICF Core Set for CWP, saturation of data was reached after conducting six focus groups , followed by Activities and Participation (n = 15). Ten additional ICF categories reported by the participants related to Environmental Factors. No additional ICF categories from Body Structures were identified.Forty-eight additional second-level ICF categories that are not included in the current version of the s Tables , 5 and 6Activities and Participation chapter Mobility , and the Body Functions chapters Mental functions  and Neuromusculoskeletal and movement-related functions .Twenty-two further third-level and fourth-level ICF categories emerged (data not shown), mainly from the The kappa coefficient for the agreement between the two investigators (peer review) was 0.76. The 95%-bootstrapped confidence interval was 0.70 to 0.82.Comprehensive ICF Core Set for CWP could be confirmed from the patient perspective by FM patients. Fifty-four ICF categories out of 67 categories of the Comprehensive ICF Core Set for CWP were reported by the patients. Forty-eight additional categories that are not covered in the Comprehensive ICF Core Set for CWP were raised. The present study also confirmed relevant outcomes of treatment in CWP and FM from the patient perspective, such as pain, fatigue, sleep disorders, psychological distress, lack of muscle power, difficulties changing and maintaining a body position, and difficulties carrying out a daily routine [sensation of pain (b280).Most ICF categories of the current version of the  routine ,30. Painattitudes (e4). Several studies report similar findings such as patients' experiences of stigma [Apart from pain, the most outstanding theme reported by participants was the attitude of others regarding FM. The patients describe often feeling left alone with their illness, due to a lack of understanding and acceptance from others. Several patients reported feeling as if FM is not accepted as a legitimate illness by some doctors and healthcare professionals and is often trivialized by friends, relatives and colleagues, thus adding to the burden of pain and exhaustion. Fifty-five concepts concerning negative attitudes of others regarding the illness were linked to the corresponding ICF Core Set categories . Forty-six additional concepts were linked to the first-level ICF category f stigma -34 and sf stigma -38.Comprehensive ICF Core Set for CWP were not at all mentioned by the focus groups. Most of the ICF categories belonged to Body Functions and included global psychosocial functions (b122), psychomotor function (b147), content of thought (b1602), proprioceptive function (b260) and haematological system functions (b430). Some categories were not confirmed but were linked to similar categories; for example, 18 concepts were linked to the category carrying out daily routine (d230) instead of undertaking multiple tasks (d220), and nine concepts were linked to intimate relationships (d770) instead of sexual functions (b640). Sometimes the participants made more specific statements that were linked to similar ICF categories; for example, although the ICF Core Set category societal attitudes (e460) was not linked, several statements were linked to categories e410 through e455 specifying individual attitudes .Thirteen ICF categories in the Comprehensive ICF Core Set for CWP were raised. Most of the additional ICF categories belong to Body Functions, followed by Activities and Participation and Environmental Factors. Some of these additional ICF categories need special discussion. Several concepts deal with difficulties in cognitive functioning. Thirty-two concepts were linked to the Body Functions category memory functions (b144). The patients reported problems with short-term and long-term memory such as absorbing, storing and recalling information. Learning and applying knowledge was also perceived as challenging for the participants. Difficulties acquiring skills, thinking, hearing, listening and reading were frequently reported by the focus group participants. Poor memory performance and problems in cognitive functioning in FM sufferers have been well documented and are in accordance with other studies [Forty-eight additional second-level ICF categories that are not covered in the current version of the  studies -42. Sens studies ,44.Comprehensive ICF Core Set for CWP that FM sufferers experience as very burdening. The participants reported difficulties in grasping, picking up and manipulating objects with their hands and pulling, reaching and turning or twisting the arms, making everyday activities and tasks very difficult to fulfil. Twenty-seven and 15 concepts were linked to fine hand use (d440) and hand and arm use (d445), respectively.The use of the hands and arms is a further topic not included in the Comprehensive ICF Core Set for CWP was functions of the digestive system. Such problems included difficulties with salivation, swallowing and digesting food. Urinal and intestinal irregularities were frequently reported and experienced as extremely hindering, affecting numerous activities and participation in sports and social engagements. Irritable bowel syndrome and urinary problems in FM sufferers are reported in other studies as well [not definable. Other topics concerned Environmental Factors not covered in the ICF classification (labelled not covered). Numerous patients mentioned the benefits of heat, such as using hot or warm water to sooth aching body parts. Several others recognized the importance of exercise in coping with pain and fatigue.An additional topic found among the participants but not included in the  as well -47. TwenThe characteristics of the sample in this study  are comparable with samples in other national  and intepeer review was included, as described earlier. The kappa coefficient of 0.76 (0.70 to 0.82) for the accuracy of the peer review is comparable with other studies reporting kappa statistics about the linking of categories [It is important to mention that several strategies were used to improve and verify the trustworthiness of the data analysis. Triangulationensured the comprehensiveness of data; we included data triangulation by using two data analysts (investigator triangulation: multiple coding) ,51. Secotegories ,52,53, aComprehensive ICF Core Set for CWP identified in the respective previous focus group. Participants in a seventh focus group might still report new themes and concepts not yet addressed.There are some limitations of the present study that need special mention. The sample consists primarily of German residents. To establish a cross-cultural perspective we suggest that our methods be used in similar studies in other countries. Second, FM is a subtype of CWP, and may not be representative of all CWP conditions. Other ICF categories may have emerged if focus groups had been conducted with other CWP illnesses such as chronic fatigue or Gulf War syndrome. The controversy concerning the existence, classification and acceptance of FM interferes with the patients' need to be recognized and taken seriously with their illness. This may exacerbate symptoms and add to the burden of pain and exhaustion. Third, the linking process was performed by two psychologists according to established linking rules . WhetherComprehensive ICF Core Set for CWP, which can in turn be used as a basis for the further specification of OMERACT domains and the development of new instruments to assess functioning for research. A further key research objective of the OMERACT initiative will be to include the patient perspective on what represents a clinically meaningful change in a domain or the syndrome as a whole. The present study can help enhance the knowledge of FM by including the patient perspective. Further research in the context of the development and confirmation of ICF Core Sets, however, is needed.Initiatives such as the OMERACT address the challenge of standardizing and improving the quality of outcomes research by finding a common terminology and a common model of functioning and disability. The OMERACT FM workshop agreed upon the most important key domains to measure in FM. Some of the key domains mentioned are pain, patient global sense of well-being, fatigue, multidimensional aspects of functioning, sleep, depression, and treatment side effects. These domains are included in the The results of the present study are comparable with the results of the validation of ICF Core Sets for rheumatoid arthritis. In line with the validation study of ICF Core Sets for CWP, most of the ICF categories included in the ICF Core Set for rheumatoid arthritis were also confirmed . In addiComprehensive ICF Core Set for CWP. Most ICF categories of the existing version of the Comprehensive ICF Core Set for CWP could be confirmed by focus groups with FM patients. Several additional categories not represented in the Comprehensive ICF Core Set for CWP emerged from the focus groups and should be considered for inclusion in the final version.It is important to consider the patient perspective for the validation of the CWP: chronic widespread pain; FM: fibromyalgia; ICF: International Classification of Functioning, Disability and Health; OMERACT: Outcome Measures in Rheumatoid Arthritis Clinical Trials.The authors declare that they have no competing interests.RH conceived and organized the study and drafted the manuscript. MC participated in the performance of the focus groups and the data analysis and was involved in the peer review. GS was responsible for the overall design of the development and the validation of ICF Core Sets. AW guided the study with his input on FM. AC participated in the development of the study design and accompanied the study implementation."}
+{"text": "Objective. Our aim was to evaluate the significance of homocysteine (Hcy) in Behcet's disease (BD) and the association of elevated Hcy levels associated with the indices of inflammation in BD. Methods. Untreated 70 patients with BD and 33 healthy individuals were included into the study. Hcy, tumor necrosis alpha (TNF-\u03b1), C-reactive protein (CRP), and erythrocyte sedimentation rate (ESR) were evaluated with respect to activity and specific individual clinical manifestations of the disease. Results. Hcy levels were found significantly elevated in active BD when compared to inactive BD and healthy controls. Hcy levels were found to have high correlation with the number of active clinical manifestations increased. A significant positive correlation was found between serum Hcy and TNF-\u03b1 levels, CRP, and ESR. Hcy was found to be the best predictor of TNF-\u03b1 among other parameters. Conclusion. Hcy may involve in the pathogenesis of BD by inducing inflammation. Curr \u03bcmol/L) . As many \u03bcmol/L) . Hcy is erate 31\u20130 \u03bcmol/L,Behcet'sdisease (BD), initially described by Behcet in 1937 , is a ch\u03b1) which is an important proinflammatory cytokine. Theresults were controlled with the healthy individuals.Thepresent study was conducted to evaluate serum Hcy as a serological marker forthe assessment of the activity of BD with respect to specific individual clinical manifestations. Serum levels of Hcy were compared with the values of C-reactive protein (CRP),an acute phase reactant, the erythrocyte sedimentation rate (ESR), and tumornecrosis alpha  fulfilling the international study group criteria for the Sinceaccepted specific clinical activity scoring system and laboratory screeningprofile for BD has not been performed so far, the activity of patients wasconsidered to have an active disease in case of the existence of two or moresymptoms with worsening of clinical symptoms and lack of wellbeing at the timeof the study. Behcet's diseaseactivity index (BDAI) was also performed on our patients according tothe method presented by Bhakta et al.  and descAll patients and healthy volunteers were examined carefullyfor vascular involvement. Either venous or arterial system involvement wasdefined as present when confirmed by Doppler ultrasonography, radioisotopevenography, magnetic resonance angiography, conventional angiography, or computerizedtomography.\u03bcmol/L andserum Hcy level is expected to be up to 10% higher than ethylenediaminetetraacetate (EDTA) plasma. Fivecc blood samples were drawn using a 25 gauge needle from a peripheralvein, avoiding haemolysis in the morning hours after an overnight fasting and30 minutes of supine rest and collected into 10 mL empty evacuated tubes withoutEDTA, heparin, or clot activators. Samples were centrifuged at 1000 \u00d7 g for 10minutes. The serum was separated in aliquots and immediately frozen and storedat \u221280\u00b0C within 60 minutes until use.Serum homocysteine levels in the study groups were determined by fluorescencepolarization immunoassay (FPIA) technique . FPIA was run on an IMx analyzer . The 95% confidence interval of plasma Hcylevel suggested by the manufacturer for healthy individuals is 4.45\u201312.42 \u03b1 level was measured with an enzyme-linked immunosorbant assay (ELISA) kitwith a detectable level set at 14 pg/mL. Five cc serum was separated bycentrifugation at 1000 \u00d7 g for 10 minutes and stored at \u221270\u00b0C until use.The TNF-CRP was measured by a highly sensitive turbidimetric method using conventionalbiochemical automatic analyzer. The upper limit of the normal range was 5 mg/L. The ESR was determined by the classic Westergren method.U test or Bonferroni corrected Mann-Whitney U tests were used for between-groupcomparisons as indicated. The relationship between variables was evaluated bySpearman correlation and regression analysis. Levels of significance set at0.05 but in Bonferroni corrected test the significance threshold of 0.05yielded to the value of 0.0167. Data are presented as median values and theirindividual ranges (in parenthesis).Results were analyzed using SPSS for Windows VER 11.5 . Each variant was evaluated by one sampleKolmogorov-Smirnov test for compatibilitywith normal distribution. As the data did not fit normal distribution, thenonparametric Kruskall-Wallis test for intergroups comparison and Mann-WhitneyP = .00), 23 with genital ulceration(32.85%), 18 with ocular involvement (25.71%), 37 with vascular involvement (52.85%),25 with arthritis (35.71%), and 31 with cutaneous lesions like erythema nodosum(EN) and papulopustular eruption (PPE) (44.28%). Thirty five patients (50%)were found to have positive pathergy test. According to our evaluation scale, 34patients were considered to have active disease with a median of 4 symptoms ranging between2 and 5 and 36 patients to have inactive disease with a median of 1 symptomranging between 1 and 2. Consistently, active group had a statisticallysignificant high BDAI score with a median of 16 ranging between 9 and 25compared to inactive group with a median of 2 ranging between 1 and 5 (P = .00). Accordi\u03b1, CRP, and ESR significant difference was detected foreach parameter (P = .00 for each parameter)  and the number of active clinicalmanifestations increased while ESR and CRP also showed a positive correlation with both parameters withrelatively less significance  . To deteactivity . Hcy anificance .P = .03),genital ulcer (P = .005), the presence of positive pathergy test (P = .007),ocular lesion (P = .00), and vascular lesion of high significance (P = .00). No asso\u03b1 were found to have strong association with oral ulcer (P = .00),genital ulcer (P = .00), the presence of positive pathergy test (P = .00),ocular lesion (P = .00), and vascular lesion (P = .000) (\u03b1 levelsand EN/PPE and arthritis.The serum levels of TNF- = .000) . NoassoP = .001), ocular lesion (P = .001),vascular lesion (P = .001), EN/PPE (P = .043), and the presence ofpositive pathergy test (P = .016) was found. No association was found between CRP levels and ocular lesion andarthritis , CRP  and ESR  (A significant positive correlation was found between serum Hcy and TNF-P = .00). Among pP = .00) .Serum levels of Hcy in active BD patients with vascular involvement were foundsignificantly increased when compared in patients with active BD withoutvascular involvement. In addition, serum levels of Hcy in inactive BD withvascular involvement were found significantly increased compared to inactive BD.Serum levels of active BD patients with vascular involvement, oral ulcer, arthritis/arthralgia,EN/PPE and the presence of positive pathergy test were found significantlyincreased compared to inactive BD patients with the same clinical symptoms.The mainpathology in BD is an inflammatory process of small arteries and veins andthrombosis as a result of vasculitis of the vaso vasorum . HyperhoThe main factor responsible for the increased frequency of thrombosis in BD is thoughtto be endothelial dysfunction caused by vascular inflammation , 15. TheIn our study, the evaluation of association between specific individual clinicalmanifestations and serum levels revealed increased Hcy levels in patients withoral ulcer, genital ulcer, the presence of positive pathergy test andparticularly with ocular and vascular lesions of high significance. No association was found between Hcy levels and EN/PPE andarthritis. Er et al.  showed t\u03b1,Interleukin-6 (IL-6), and Interleukin-8 (IL-8) in monocyte cultures obtainedfrom BD patients [Although the etiopathogenesis of BD has not yet been clarified, different immunologicalabnormalities have been reported and increased spontaneous secretion of TNF-patients . Necrotipatients . Histopapatients , 31. Sinpatients , 31. Altpatients . Aneuryspatients \u201319. Thatpatients . Furthepatients , 33, 34.patients , 16 but \u03b1 and CRP levels,and ESR with relatively less significance. Hcy was found to be the bestpredictor of TNF-\u03b1 among other parameters. In other words, Hcy was found toexplain 88% of TNF-\u03b1 change while CRP and ESR were found to explain 39% and 14%of TNF-\u03b1 change, respectively. The significance of Hcy in BD represents either vascular endothelium damaged by Hcy or immune systemstimulation by Hcy, our study may demonstrate the link between Hcy andinflammation pathways in BD. That is because TNF-\u03b1, CRP, and ESR are indicesof inflammation. Although there are conflicting results in the literature withrespect to the reliability of ESR and CRP as markers to detectthe activity of BD and they are currently not involved as criteria in BDAIscores [We found a significant positive correlation between serum Hcy, TNF-Iscores , CRP desIscores . We foun\u03b1 is a major factormodulating inflammatory responses which is known to be increased ininflammatory diseases. Recent studies showed increased TNF-\u03b1 level in BD patients,especially in the exacerbation period [\u03b1. This marks CRPas a precise objective index of inflammatory activity and surrogate ofunderlying cytokine stimulus and a sensitive marker of underlying systemicinflammation [\u03b1mediated induction of vascular cell adhesion molecule-1 (VCAM-1) in endothelialcells [\u03b1 and CRP,serum Hcy has been shown to contribute to innate immune response and to be adeterminant of TNF-\u03b1 in hypertensive patients [\u03b1 [Chemotactic and phagocytic activitiesof neutrophils in patients with BD have been reported to be high  and TNF-n period , 30. Synammation . It has ammation . CRP is ammation . Hcy is ammation , 36\u201338. ammation  and Hcy ammation . Hcy hasammation . Hcy wasammation . Adhesioammation . Hcy wasalcells . With repatients . The corpatients . Hcy ispatients . A studypatients . CRP hapatients . Hcy haspatients . Indeed,ients [\u03b1 . This is\u03b1, whichis known to increase chemotactic and phagocytic activities of neutrophils, endothelial-leukocyteinteraction, and CRP levels. We found a high correlation between serum levelsof Hcy and TNF-\u03b1 and Hcy was found to explain the wide clinical spectrum of theactivity of the disease and specific individual symptoms. Taking all thesefindings into account, a theory might be put forward which is open to furtherin vivo and in vitro studies; Hcy-induced inflammation may be responsible fortissue damage as well as endothelial dysfunction in BD and enhanced Hcy mayaccount for the differences observed between clinically distinct subgroups. Lowering Hcyby selected vitamin supplements or TNF blockade may be the futuredirection of prevention from developing the risk of thrombosis and vasculitisof different organ systems and thereby activation of BD disease.In summary, Hcyand CRP have effects into the mechanism linking inflammation and coagulationand Hcy is thought to induce proinflammatory cytokines including TNF-\u03b1 and positively correlated with inflammatory markers. Our findingssuggest that Hcy might contribute to the pathogenesis of BD by inducinginflammation. Further investigation in clinical and experimental studies is required toconclusively demonstrate the association between Hcy and inflammatory pathways.Our data identified Hcy as a risk factor for thedevelopment of not only vascular and ocular involvement but also most clinicalfeatures that are known to be associated with vasculitis in BD. In addition, serumHcy showed a strong association of disease activity and correlated with BDAIscores and the number of active clinical manifestations increased. Therefore, Hcy might be assumed as a reliablemarker for the activity of disease. Hcy was found to be the best predictor ofTNF-"}
+{"text": "DNMT3B. Characteristic of this recessive disease are decreases in serum immunoglobulins despite the presence of B cells and, in the juxtacentromeric heterochromatin of chromosomes 1 and 16, chromatin decondensation, distinctive rearrangements, and satellite DNA hypomethylation. Although DNMT3B is involved in specific associations with histone deacetylases, HP1, other DNMTs, chromatin remodelling proteins, condensin, and other nuclear proteins, it is probably the partial loss of catalytic activity that is responsible for the disease. In microarray experiments and real-time RT-PCR assays, we observed significant differences in RNA levels from ICF vs. control lymphoblasts for pro- and anti-apoptotic genes ; nitrous oxide, carbon monoxide, NF-\u03baB, and TNFa signalling pathway genes ; and transcription control genes (NR2F2 and SMARCA2). This gene dysregulation could contribute to the immunodeficiency and other symptoms of ICF and might result from the limited losses of DNA methylation although ICF-related promoter hypomethylation was not observed for six of the above examined genes. We propose that hypomethylation of satellite 2at1qh and 16qh might provoke this dysregulation gene expression by trans effects from altered sequestration of transcription factors, changes in nuclear architecture, or expression of noncoding RNAs.The immunodeficiency, centromeric region instability, and facial anomalies syndrome (ICF) is the only disease known to result from a mutated DNA methyltransferase gene, namely,  DNMT3B [DNMT3B mutations are usually missense changes within the coding portion of the gene [The immunodeficiency, centromeric region in stability and facial anomalies syndrome (ICF) is a rare recessive disease characterized by targeted chromosome breakage . The majDNMT3B \u20134. Thesethe gene \u20138. This ICF is an immunodeficiency disease that has been described in fewer than 50 patients world-wide , 10 sincDNMT3B, and why it is likely that ICF is actually due to loss of the enzymatic activity of DNMT3B and not to alterations in its specific protein\u2013protein interactions. The relationships of DNA hypomethylation and chromosome abnormalities in the ICF syndrome and in cancer will also be discussed. Lastly, the question of abnormal gene expression in ICF lymphoblastoid cells will be addressed in some detail with previously unreported data from an expression microarray analysis and an inferred model of how ICF-related DNA hypomethylation leads to the disease.In this review, we will briefly describe the ICF phenotype, the nature of known ICF-associated mutations in DNMT3B mutations [Dnmt3b is an essential gene for normal development [Dnmt3b or Dnmt1 results in prenatal death soon after implantation [Dnmt3a, death is observed several weeks after birth. In humans, if ICF-causing mutations in DNMT3B did not leave residual activity, embryonic lethality would probably result. This residual DNA methylation activity has been observed in vitro [in vivo mouse models [DNMT3B mutations would lead to spontaneous abortions.ICF patients with utations , 4, 10 autations . These putations , 6, 10. elopment . Insertiantation . In muriin vitro  and is ce models . Therefode novo methylation of DNA  [DNMT3B and DNMT3A are not redundant in terms of function [DNMT3B mutations suffice to cause ICF. They differ in expression patterns during murine development [in vitro toward DNA substrates in nucleosomes vs. naked DNA [DNMT3B/Dnmt3b and DNMT3A/Dnmt3 a gene products are the numerous isoforms that they encode, which show non-coordinate expression [Human DNMT3B and murine Dnmt3b (94% identity) and human DNMT3A and murine Dnmt3a (98% identity ) have prhylated) . These ahylated) , 21 althfunction , as valielopment  althoughelopment . They haelopment , 20, 25.aked DNA . Complicpression . For exapression .DNMT3B mutations [DNMT3B mutations are often missense mutations and are usually found in the part of the gene encoding the catalytically active C-terminal portion of the protein, namely, one of ten motifs conserved among all cytosine-C5 methyltransferases [ICF type 1 is the only form of ICF whose genetic etiology is known. It involves biallelic utations . Unless sferases , 15, 28.The involvement of DNA hypomethylation in the phenotype of ICF is supported at the cytogenetic level. ICF-specific rearrangements in mitogen-treated lymphocytes from patients are the same in frequency, spectrum and chromosomal specificity as those that we found in a normal pro-B lymphoblastoid cell line treated with the DNA methylation inhibitors 5-azacytidine or 5-azadeoxycytidine , 30. TheDNMT3B has repressor activity that is independent of its DNA methyltransferase activity . Accordiin vitro [The only ICF-associated missense mutation outside the catalytic C-terminal half of DNMT3B S282P) is within the PWWP domain and was found in both DNMT3B alleles in two related ICF patients 2P is wit. This rein vitro .The functional importance of the non-catalytic roles of DNMT3B/Dnmt3b was illustrated by studies of differentiation of rat pheochromocytoma cells (PC12) into neuronal cells. Induction of differentiation in PC12 cells mediated by nerve growth factor was inhibited by antisense or small interfering RNA (siRNA) for Dnmt3b . This inGenerally, mutant DNMT3B proteins from ICF cells are still able to engage in normal protein\u2013protein interactions . One excDNMT3B mutations (A766P and R840Q) that result in proteins with approximately wild-type basal methylation activity exhibit decreased association with DNMT3L and a strong decrease in stimulation by DNMT3L [There is a specific DNMT3L interaction domain located in the C-terminus of Dnmt3b/DNMT3B . DNMT3L y DNMT3L . These rDNMT3B [DNMT3B mutations, the most common isoform of DNMT3B RNA was still observed [DNMT3B, no mutations were found [DNMT3B was examined by RT-PCR with primers or amplicon sizes specific for several of the DNMT3B RNA splice variants 3B4, 3B3, and3B1 [About 40% of ICF patients have no mutations in exons of DNMT3B , 10. Theobserved , and forre found . Moreove, and3B1 . No evidDNMT3B coding region mutations seem to be derived from a different subtype of the disease. Lymphocytes or fibroblasts from all nine patients in this category displayed hypomethylation in satellite \u03b1  exhibit hypomethylation of centromeric satellite DNA  than in the DNMT3B-mutant ICF syndrome in humans, even when comparing the same DNMT3B mutations, and the nature of the immune dysfunction is different. These differences between species in a disease that most prominently affects satellite DNA-rich heterochromatin are not surprising. Mice do not have Sat2- or Sat3-like sequences in their genome, where so much of the ICF DNA hypomethylation is concentrated [As described above, only ICF Type 2 patients  [i [i hypomethylation is unlikely to be of biological significance because no gender-specific differences in symptoms have been reported for this disease, and, for Xi genes, the hypomethylation is often inconsistent from patient to patient. Analysis of methylation of imprinted genes in ICF has not revealed any gene region with consistent hypomethylation among examined patients [In addition to Sat2 and Sat3, satellite DNA at Yqh is hypomethylated in ICF cells , 60. A ni) , 64. Hypi) [i , 51, 63.patients . TherefoBy HPLC analysis of DNA digests, we demonstrated that the hypomethylation of the genome in ICF involves only arather small percentage of the 5-methylcytosine residues, namely 7% hypomethylation in brain DNA . W e conNormal human sperm display shypomethylation in juxtacentromeric Sat2 and Sat3, subtelomeric D4Z4 arrays, and acrocentric chromosomal NBL2 sequences as do ICF cells and somatic tissues , 65, 66.In mice, juxtacentromeric (major satellite) and centromeric (minor satellite) repeats are hypomethylated in both oocytes and sperm . ImprintGiven the involvement of DNMT3B in the ICF syndrome and ICF-linked hypomethylation of the above described tandem repeats, it is clear that this enzyme is necessary during development for normal methylation of these sequences in human somatic cells. The low but appreciable levels of methylation in these repeats in ICF somatic cells, which are higher than those of sperm, might be due to either DNMT3A and/or residual DNMT3B activity. The restructuring of chromatin composition during spermatogenesis  might inFrequent increases in methylation of some DNA sequences and decreases in methylation of others are seen in a wide variety of cancers . There iDiagnosis of ICF usually involves cytogenetic detection of chromosome rearrangements targeted to Sat2-rich 1qh and 16qh , 53 Fig. StandarThe decondensation of 1qh and 16qh in ICF lymphoblastoid cells is likely to be critical to the ICF-type rearrangements in these regions. Indirect evidence for more frequent somatic paring of 1qh and 16qh in ICF lymphocytes than in control lymphocytes was reported . In ICF DNMT3B co-localizes throughout mitosis with components of the chromosome condensation machinery  in HeL a cells . These pper se and ICF-type chromosomal abnormalities [Because a DNMT inhibitor can give distinctive ICF-like rearrangements in apro-B-cell line, including multiradial chromosomes , 30 and malities , 83 as dmalities , 14. Themalities , has notIn vitro mitogen stimulation of lymphocytes greatly increases the development of these aberrant chromosomes independent of its role in inducing cycling. A much higher frequency of juxtacentromeric (pericentromeric) rearrangements of Chr1 and Chr16 per metaphase is seen 72 or 96h after mitogen stimulation of ICF lymphocytes than at 48h, although the frequent abnormal decondensation of 1qh and 16qh can be observed in metaphases at 48 h [in vivo, but at a very low rate, as deduced from studies of micronucleus formation in unstimulated bone marrow and lymphocytes from ICF patients [Moreover, the cell type and cell growth conditions influence the association of rearrangements with Sat2 hypomethylation. While Sat2-hypomethylated chorionic villus cultures have an increased frequency of these rearrangements, they are only seen in a very low percentage of the metaphases in cultures at low passage numbers . That fr at 48 h , 53, 85.patients , 86. TheDnmt1 provide further evidence that DNA hypomethylation can predispose to chromosome rearrangements [ICF-type chromosome rearrangements have been seen in cancers . Chr1/Chngements .Studies from DNA-hypomethylated mice give evidence of a causal relationship between genomic hypomethylation and cancer, but only certain types of cancer , 94. AltBecause ICF patients can have very large decreases in specific serum immunoglobulins despite the usually normal levels of B cells , 10, traDNMT3B mutations and from controls, including phenotypically normal parents of the patients. In the first study, total RNA (cRNA) from ICF LCLs derived from five different patients and five control LCLs were examined on oligonucleotide arrays for \u223c8400 genes  [t-test) of P < 0.05 and FC > 2.0 or P < 0.01 and FC > 1.5. In the second experiment, eight ICF and seven control LCLs, including five and two from the first study, respectively, were analyzed on oligonucleotides arrays representing >33,000 genes (Affyarray U133A and B arrays). In this analysis, \u223c1% of the genes showed an FC > 2 (up- or down-regulation) and P < 0.01 for ICF-specific differences in RNA levels. Dysregulation involved 120 probesets that were down-regulated and 229 up-regulated.We did two microarray expression experiments on ICF and control LCLs. They involved B-cell lines from ICF patients with known and diverse ymetrix) . The folNR2F2 (COUP-TFII); SMARCA2 (BRM), encoding a SNF2 subunit of a chromatin remodelling complex; PRKCH and PTPN13 (FAP-1), which regulate apoptosis; GUCY1B3 and GUCY1A3, which encode the two subunits of a soluble guanylate cyclase, and CD44 and CKLF, which are implicated in the later stages of B-cell development. Although the terms up- or down-regulation are used, a caveat is that differences in post-transcriptional processing are sometimes responsible for changes in the steady-state levels of RNA, the parameter monitored in these studies.The summary data for 20 of these genes of interest from the second experiment are shown in RGS1, which displayed ICF-specific changes in its RNA levels only in the first microarray experiment, did not show significant differences in RNA levels in ICF vs. control LCLs by qRT-PCR (data not shown). Some other genes also displayed significant differences in RNA levels between ICF and control LCLs only in the first experiment [Twelve genes with significant differences from the microarray data between ICF and control LCLs were then tested by RT-PCR. Only one of these did not exhibit RT-PCR results concordant with the micro-array results (data not shown). In addition, one gene, periment . Howeverin vivo defects in B-cell activation in ICF patients and only asubset of B cells will be transformed. Nonetheless, we found much consistency in LCLs from eight unrelated patients and new insights into transcriptional regulation of the immune system.In view of the extreme scarcity of ICF patients and their median age of 8 years at death , we examNT5E, which was found to be expressed mostly in B cells, rather than T cells, and usually only after isotype switching [The most dramatic difference in RNA levels in ICF vs. control LCLs was seen for IGHG3 . This wawitching .+) to express cell-surface CD27 after stimulation [BTK, PRDM1, PAX5, IRF4, BCL6, XBP1, BACH2 and MAPBPIP.CD27, which plays a key role in T-cell memory and in the stimulation of B cells to produce immunoglobulins , had lowmulation  makes thmulation \u2013112 makeCASP1, BCL2L10, PTPN13, HMOX1, MAPK13 and PRKCH, which displayed ICF-specific differences in their RNA levels, might be involved in abnormal regulation of apoptosis or cell cycle arrest in lymphoid cells in ICF patients  pathway . HMOX1, PRKCH is highly tissue specific. Its expression primarily, but not exclusively, in epithelial tissues is probably due to an enhancer, a silencer and trans-acting factors [PRKCH are implicated in increasing the risk of rheumatoid arthritis and cerebral infarction [iNOS) [Another link to the NF-\u03baB signal pathways among the ICF-overexpressed RNAs involves the above mentioned protein kinase C family member, PRKCH. This calcium-independent, serine-and threonine-specific enzyme is activated by diacylglycerol to phosphorylate a wide range of cellular proteins and there by influence many aspects of physiology \u2013135. Un  factors . In skinfarction . Overexpfarction . PRKCH Rfarction . PRKCH Rfarction . A mong farction . PRKCH an [iNOS) .GUCY1A3 and GUCY1B3 are very close together on 4q32.1, they may not be regulated in a fully coordinate manner [The widespread signalling molecule NO is, in turn, related to GUCY1A3 and GUCY1B3, whose RNAs were upregulated in ICF compared to control LCLs as determined in both microarrays and by qRT-PCR . GUCY1A3e manner , as is ce manner . Anothere manner . ICF-relSome of the genes in in vitro differentiation of rat astrocytes [While the significantly altered RNA levels for some proteins in ICF vs. control LCLs, such as the CNN actin-binding protein, might have no biological consequences, others may be a factor in the nonimmune symptoms of ICF. Although we examined RNA only in BLCLs, abnormal RNA levels in the lymphoid cell lineage might be found in other lineages too and altered regulation in lymphocytes can sometimes mirror more physiologically important dysregulation in a very different tissue . Overexptrocytes . Moreovetrocytes  and CASPtrocytes .Upregulation of PRKCH  may explICF-associated upregulation of RNA for the chromatin remodelling protein SMARCA2 might impact 1qh and 16qh decondensation. SMARCA2 (BRM) is an important modulator of chromatin assembly . It coulGUCY1A3, PTPN13, NR2F2, SMARCA2 and CKLF (GUCY1A3) or upstream regions (for the other genes) were assayed for methylation in ICF and control LCLs as well as in several normal tissues by combined bisulfite restriction analysis (COBRA). COBRA allows quantitation of DNA methylation levels at restriction endonuclease sites in a given DNA sequence that is amplified by PCR [GUCY1B3 in ICF cells [We recently examined methylation of five genes with qRT-PCR-confirmed ICF-associated upregulation of their RNA, namely, and CKLF  and II. d by PCR . Genes wd by PCR . By COBRCF cells . Almost i. However, unconventional genes, whose broad biological influence has been appreciated only recently  [DNMT3B mutations in ICF patients is due to the hypomethylation of constitutive heterochromatin. This same explanation can be applied to patients with ICF type 2, who have no detected DNMT3B mutations but do exhibit the characteristic hypomethylation of juxtacentromeric satellite DNA [i. We favour the involvement of Sat2-containing 1qh and 16qh over Sat3-containing 9qh  , were nolite DNA . Becausening 9qh  because Evidence is mounting that constitutive heterochromatin is biologically important and not just an inert filler in the genome, as many previously thought. In fission yeast and drosophila, transcription of non-coding RNA is important for the establishment of constitutive heterochromatin \u2013155; thetrans [Besides constitutive heterochromatin yielding non-coding transcripts that might affect expression of protein-coding genes, its intranuclear location may help organize chromatin throughout the nucleus so as to modulategene expression in trans . Evidenctrans , 159. Thtrans . The imptrans . HypometRecently, one dramatic change in positioning of hypomethylated constitutive heterochromatin specifically in ICF lymphoblasts and lymphocytes has been described. It is the formation of agiant promyelocytic leukemia (PML) type nuclear body that correlated with under condensed 1qh or 16qh, but not 9qh, in a large percentage of ICF G2 nuclei , 40. Alltrans mediated by chromatin acting as a dynamic reservoir for storage and possibly delivery of transcription modulatory proteins, which in the case of ICF, might explain the life-threatening immunodeficiency.There are more and more examples of transcription control proteins that bind selectively to constitutive heterochromatin \u2013168. Fur"}
+{"text": "Acyrthosiphon pisum lacks genes thought to be crucial in other insects for recognition, signaling and killing of microbes.The genome of the pea aphid  Acyrthosiphon pisum), we conducted the first extensive annotation of the immune and stress gene repertoire of a hemipterous insect, which is phylogenetically distantly related to previously characterized insects models.Recent genomic analyses of arthropod defense mechanisms suggest conservation of key elements underlying responses to pathogens, parasites and stresses. At the center of pathogen-induced immune responses are signaling pathways triggered by the recognition of fungal, bacterial and viral signatures. These pathways result in the production of response molecules, such as antimicrobial peptides and lysozymes, which degrade or destroy invaders. Using the recently sequenced genome of the pea aphid (Strikingly, pea aphids appear to be missing genes present in insect genomes characterized to date and thought critical for recognition, signaling and killing of microbes. In line with results of gene annotation, experimental analyses designed to characterize immune response through the isolation of RNA transcripts and proteins from immune-challenged pea aphids uncovered few immune-related products. Gene expression studies, however, indicated some expression of immune and stress-related genes.The absence of genes suspected to be essential for the insect immune response suggests that the traditional view of insect immunity may not be as broadly applicable as once thought. The limitations of the aphid immune system may be representative of a broad range of insects, or may be aphid specific. We suggest that several aspects of the aphid life style, such as their association with microbial symbionts, could facilitate survival without strong immune protection. Aphids face numerous environmental challenges, including infection by diverse pathogens and parasites. These pressures include parasitoid wasps, which consume their hosts as they develop inside, and a variety of viral, bacterial and fungal pathogens. Both parasitoid wasp and fungal pathogens cause significant decline of natural aphid populations ,2, and hInsects have a number of defense mechanisms. First, many insects, including aphids, behaviorally avoid predators, pathogens, and environmental stressors -6. When Drosophila melanogaster, recognition of an invasive microbe leads to signal production via four pathways , c-Jun N-terminal kinase (JNK), and Janus kinase/Signal transducers and activators of transcription (JAK/STAT)) . Further investigations will be necessary to determine the activity and hypervariability of these genes and their transcripts in aphids.Complex alternative splicing of Dscam (Down syndrome cell adhesion molecule) generates diverse surface receptors sometimes employed in arthropod innate immune defenses -55. ThouDrosophila, deletion of many of the component genes leads to increased susceptibility to many Gram-positive bacteria and fungal pathogens , but this match was largely restricted to the leucine zipper region, and failed tests of reciprocity.While missing IMD-associated genes, pea aphids have plausible orthologs for most components of the JNK pathway Figure . In Dros healing , and has healing ,66. GeneDrosophila, the IMD signaling pathway leads to activation of components of the JNK signaling pathway , originally isolated from the shrimp Penaeus vannamei. The putative pea aphid Megourin , however, is highly diverged from that of M. viciae (31% identity) and, compared to its M. viciae counterparts, seems to have a shorter carboxy-terminal region containing a stop-codon . The highly divergent Penaeidin [GenBank: ACYPI37769] , diptericin (and other glycine-rich AMPs), drosomycin, metchnikowin, formicin, moricin, spingerin, gomesin, tachyplesin, polyphemusin, andropin, gambicin, and virescein also revealed no hits. Weak hits were found for genes that encode for two antimicrobial peptides in other invertebrates: megourin [UniProtKB: P83417], originally isolated from another aphid species, the vetch aphid Thaumatin homologs in the A. pisum genome that show overall sequence and predicted structure similarities to plant thaumatins  encodes N-acetylmuramoyl-L-alanine amidase, which is not a true lysozyme  but similarly degrades bacterial cell walls. While some of these bacteriolytic-related genes are highly expressed in the bacteriocyte, and lysozymes appear to be upregulated in response to some challenges , assays of bacterioltyic activity of hemolymph from immune-challenged aphids suggest that aphid hemolymph has weak to no lysozyme-like activity .Phenoloxidase-mediated melanin formation characteristically accompanies wound clotting, phagocytosis and encapsulation of pathogens and parasites . In inseNos is upregulated after both parasite and Gram-negative bacterial infection , we found some genes with similarity to proteases and protease inhibitors but few other immune-related proteins. Interestingly, SSH-based EST analysis failed to identify any PRRs, such as PGRPs or GNBPs, or any antimicrobial peptides  were identified, including antibacterial peptides and PRRs dCTP, and purified them using Quick Spin Column . After exposing blots for up to 24 hours to a Storm PhosphorImager imaging plate , we analyzed differential expression by comparison of band intensities between the two membranes. We did not, however, normalize the data, as we failed to see any signal from the Gapdh gene, though the same amount of each PCR product was loaded on both membranes.To analyze the differential expression status of each EST, we conducted a dot-blot experiment. Briefly, we amplified 344 ESTs from the SSH library by colony PCR with nested PCR primers 1 and 2R from the PCR-Select cDNA Subtraction Kit. We then spotted 10 \u03bcl from each PCR product onto two different membranes  using a E. coli strain Top10), Gram-positive bacteria (M. luteus) or fungal spores (A. fumigatus). For each microbial treatment, five hemolymph samples from 50 aphids each were collected at four times points .Aphids were challenged by abdominal puncture with triple-0 needles dipped in a solution of Gram-negative bacteria  live aphids through a 1 ml pipette tip and directly into 40 \u03bcl 0.1% trifluoractetic acid contaning 10 \u03bcl of saturated phenylthiourea (PTU) for phenoloxidase inhibition. Resulting samples were highly similar to pure hemolymph samples obtained by leg bleeding (>95% band identity by silver-stained SDS-PAGE).After initial collection, tips were removed and the samples were centrifuged for 5 minutes at 15,000 g. Following addition of 70 \u03bcl trifluoractetic acid 0.1%, the supernatant sat for 1 hour at 4\u00b0C to allow for protein precipitation prior to a final 10-minute centrifugation at 15,000 g to recover peptides. Samples were evaporated and stored at -20\u00b0C until use in HPLC. Chromatography was performed on standard peptide C18-300\u00c5 reverse phase columns using water acetonitrile gradients . For retAMP: antimicrobial peptide; EST: expressed sequence tag; GNBP: Gram-negative binding protein; HPLC: high performance liquid chromatography; HSP: heat shock protein; IMD: immunodeficiency; JAK/STAT: Janus kinase/Signal transducers and activators of transcription; JNK: c-Jun N-terminal kinase; PGRP: petidoglycan receptor protein; ProPO: prophenoloxidase; PTU: phenylthiourea; PRR: pathogen recognition receptor; SSH: suppression subtractive hybridization; TEP: thiolester-containing protein.NMG, SMB, and MG were group leaders for the project. NMG, BA, HA, SMB, MDV, EJD, JDE, AM, MG, IK, AN, BJP, MP, JSR, JT, DT, and CT designed and performed manual gene annotation. TG and SMB conducted phylogenetic analyses. BA and AV conceived of and conducted analyses of Thaumatin. SMB, NMG, CS and BJP performed experiments and analyses for the gene expression study. CA, AH, VPB, AM, and AL conceived of and conducted the SSH study, and CVM constructed the aphid gut libraries. YR conducted the HPLC study. The manuscript was prepared by NMG, SMB, CA, TG and YR with input from MDV, BA, AN, AV and AH. All authors have read and approved the final version of the manuscript.Table S1: pea aphid immune and stress gene list. Table S2: samples for quantitative PCR expression study. Table S3: primers for quantitative PCR expression study. Table S4: relative expression of recognition and signaling genes. Table S5: relative expression of response genes. Table S6: gut EST library statistics. Table S7: list of selected ESTs from the subtracted library. Figure S1: maximum likelihood phylogenies of selected immune and stress gene families. Figure S2: alignments of putative antimicrobial peptides megourin and penaeidin. Figure S3: survival curves for experimental infections associated with quantitative PCR study.Click here for file"}
+{"text": "The SARA trial recently demonstrated a non-inferior CD4 response, over median follow-up of 60 weeks, with a boosted protease inhibitor monotherapy (bPImono) maintenance second-line regimen compared with continuous combination therapy (CT), suggesting this approach could maintain effectiveness whilst improving tolerability and decreasing costs . Analysis of virological response and genotypic drug resistance is reported here.Eligible participants in the DART trial who received 24 weeks of lopinavir/ritonavir-containing second-line CT were randomised to maintain current CT or to reduce to bPImono within a nested pilot trial (SARA). No real-time virology was performed, but stored plasma samples from time at switch to second-line, randomisation after 24 weeks of second-line, and 24 weeks after randomisation were assayed for HIV-1 RNA viral load (VL) by Roche Amplicor v1.5. Genotypic resistance was assessed on samples with VL >1000 c/ml at this latest time point, along with paired samples at switch to second-line. All analyses are intention-to-treat.192 participants were randomised to CT (n=95) or bPImono (n=97). 77% (135/173) had VL<50 c/ml at randomisation. 44 (23%) participants were taking bPI with NRTI only, 29 (15%) with NNRTI only, and 119 (62%) with both. Virological suppression at week 24 was higher (trend test p=0.007) for participants on CT vs bPImono: 77% (70/91) vs 60% (56/94) had VL <50 c/ml, 90% (82) vs 74% (72) had VL <200 c/ml, and 94% (86) vs 84% (81) had VL <1000 c/ml. Restricting to patients with VL <50 c/ml at randomisation, 85% (57/67) vs 66% (43/65) had VL <50 c/ml at week 24. Of the 18 participants with VL >1000 c/ml at week 24, 12  have been assessed genotypically. IAS major PI mutations at week 24, not present at switch to second-line, were detected in 2 bPImono participants only. One participant (VL=3600 c/ml) had I54V only, the other (VL=1490 c/ml) M46IM+V82AV. Both isolates were considered fully susceptible to darunavir.In this study based on retrospective virological testing, bPImono following 24 week second-line induction was associated with an increase in low level viraemia, although generally in the absence of PI resistance. Longer-term trials are required before definitive conclusions can be drawn about the effectiveness of PI monotherapy in populations without access to virological monitoring."}
+{"text": "To investigate whether 4-hydroxynonenal (4-HNE) regulates asymmetric dimethylarginine (ADMA) metabolism through pathway independent of direct adduct formation with ADMA metabolizing enzyme and the involvement of microRNA (miRNA) miR-21 in human umbilical venous endothelial cells (HUVECs).DDAH mRNA and miR-21 expression in the HUVECs were determined by semi-quantitative real time PCR. DDAH1 and DDAH2 protein expression were analyzed by Western blot. ADMA in the cell medium and cell lysates were analyzed by ELISA. ADMA metabolizing activity of the cell lysates was also determined.Cultured HUVECs were treated with 4-HNE  or 1\u2030 DMSO (vehicle control) for 24 h. MiR-21 inhibitor  was transfected at 1 h before 4-HNE treatment. HUVECs were also transfected with miR-21 (at concentrations of 50 nM and 100 nM) and cultured for 12, 24, and 48 h, respectively. DDAH1 and DDAH2 expression and ADMA metabolic activity significantly, while increased intracellular ADMA accumulation significantly in HUVECs. 10 \u00b5M 4-HNE treatment for 24 h increased the expression of miR-21 and intracellular ADMA concentration, decreased the expression of DDAH1/2 mRNA and protein, decreased ADMA metabolizing activity of the cell lysates significantly. MiR-21 inhibitor reversed the inhibitory effects of 4-HNE on DDAH1 expression completely, and partially reversed the changes in ADMA metabolizing activity and intracellular ADMA accumulation challenged by 10 \u00b5M 4-HNE.MiR-21 decreased 4-HNE down-regulates DDAH1 expression and increases intracellular ADMA accumulation in HUVECs through a miR-21-dependent mechanism. Therefo4-Hydroxynonenal (4-HNE) is a major active product formed following lipid peroxidation. 4-HNE is highly lipophilic and can interfere with the functions of proteins by adduct-forming capacity with macromolecules In this study, we determined whether 4-HNE could influence intracellular ADMA levels through regulating DDAH1 expression and the contribution of miR-21 in cultured HUVECs. We found that both 4-HNE and miR-21 decreased DDAH1 expression and ADMA metabolizing activity in HUVECs. Meanwhile, 4-HNE up-regulated miR-21 expression, and the inhibitory effects of 4-HNE on DDAH1 expression was reversed by miR-21 inhibitor.2 flow and redissolved in 1% DMSO. Cells (1\u00d7105/mL) were seeded into 6-well plates and cultured in DMEM medium containing 10% fetal calf serum (FCS) in a humidified atmosphere under 5% CO2 for 24 h. Confluent cells were synchronized with 1% FCS for 24 hours, and were then treated with various concentration of 4-HNE  or vehicle (1\u2030 DMSO) for 24 h. To investigate the effect of miR-21 on DDAH expression, HUVECs were seeded into 6-well plates and cultured to 95% confluence. Cells were then washed with PBS and cultured in DMEM medium containing 10% FCS. Has-miR-21 mimic (50 nM and 100 nM) and/or inhibitor (100 nM)  were transfected by using the lipofectamine 2000 reagents . Cells and the medium were harvested at 12 h, 24 h, and 48 h, respectively, after miR-21 transfection. To investigate whether miR-21 inhibitor can reverse the 4-HNE induced increase in DDAH1 expression, has-miR-21 inhibitor was also transfected at 1 h before the addition of 4-HNE (10 \u00b5M). The medium was collected to detect ADMA concentration. Cells were harvested and the RNA and protein samples were extracted.The HUVECs cell line was purchased from ATCC CRL-1730. 4-HNE (10 mg/ml in 100% ethanol) was purchased from Cayman Chemical Co. , dried under a NDDAH1 and DDAH2 mRNA expression was detected by SYBR\u00aeGreen chemistry on an ABI 7300 real-time PCR system. Endogenous small nuclear RNA U6, 5S and GAPDH mRNA were determined to normalize miR-21, pri-miR-21, and DDAH1/2 mRNA expression, respectively. The primers used were as follows: DDAH1: 5\u2032-GCCTGATGACATAGCAGCAA-3\u2032 (sense) and 5\u2032-CCATCCACCTTTTCCAGTTC-3\u2032 (antisense); DDAH2: 5\u2032-ACAAGGACCCCCGCTAAAA-3\u2032 (sense) and 5\u2032-AAGGGAGTCCCCGTCTTCAA-3\u2032 (antisense); GAPDH: 5\u2032-CTGCACCACCAACTGCTTAG-3\u2032 (sense) and 5\u2032-AGGTCC-ACCACTGACACGTT-3\u2032 (antisense). Pri-miR-21: 5\u2032-GCCACCACACCAGCTAATTT-3\u2032 (sense) and 5\u2032-CTGAAGTCGCCATGCAGATA-3\u2032 (antisense); 5S: 5\u2032-GCCCGATCTCGTCTGATCT-3\u2032 (sense) and 5\u2032-AGCCTACAGCACCCGGTATT-3\u2032 (antisense). MiR-21 and the small nuclear RNA U6 quantitative PCR primers were purchased . Expression of miR-21 was normalized for endogenous U6. Expression of pri-miR-21 was normalized for endogenous 5S. PCR conditions were as follows: an initial denaturation at 95\u00b0C for 30s, followed by 40 cycles of denaturation at 95\u00b0C for 5s, and annealing at 60\u00b0C for 30s. All amplification reactions were performed in triplicate, and the averages of the threshold cycles were used to interpolate curves using the 7300 System SDS Software. Results were expressed as the ratio of DDAH mRNA to GAPDH mRNA, miR-21 to U6 RNA, and pri-miR-21 to 5S RNA, respectively.Total RNA was extract from HUVECs using Trizol reagent according to the manufacturer\u2019s protocol . RNA samples of 0.5 ug from each sample were used for reverse transcription. Semi-quantitative analysis of pri-miR-21, mature miR-21, HUVECs cells were collected and washed with PBS. Cells were treated with 200 \u00b5L of cell lysis buffer at 4\u00b0C for 30 min and then centrifuged at 1,2000 rpm for 10 min. The cell lysates were then stored at \u221280\u00b0C until analysis. An aliquot of 60 \u00b5g proteins from each sample were subjected to 10% SDS-PAGE and then transferred to PVDF membrane (Millipore Corp). Semi-dried transfer was carried out under 1 mA/cm2 flow in 50 min. The membrane was blocked with 5% non-fat dry milk for 2 h at room temperature, and then incubated with a rabbit monoclonal antibody (1\u22361000) against human DDAH1 , or a rabbit monoclonal antibody (1\u22361000) against human DDAH2 , or a mouse monoclonal antibody (1\u22361000) against human GAPDH  at room temperature for 1 h, followed by incubation at 4\u00b0C for 18 h. The membrane was washed thoroughly and then incubated with a peroxidase-conjugated mouse anti-rabbit or goat anti-mouse secondary antibody (1\u22365000)  for 1 h at room temperature. The membrane was washed, and DAB Horseradish Peroxidase Color Development Kit was used for develop . The band intensities were semi-quantified, DDAH1 or DDAH2 protein levels were expressed as the ratio of the band intensities of DDAH1 or DDAH2 to the endogenous control GAPDH.Cells and cellular medium were collected after treatment. Cells were washed with PBS, and then treated with 200 \u00b5L of cell lysates buffer at 4\u00b0C for 30 min, centrifuged at 1,2000 rpm for 10 min. Protein concentration of the cell lysates were determined. Cell Lysates and cellular medium were then stored at \u221280\u00b0C. An aliquot of 10 \u00b5L cell lysates was used to detect intracellular ADMA concentration. Human ADMA ELISA kit was used to analysis ADMA concentration in cell medium and the lysates according to the manufacturer\u2019s protocol . ADMA contents in the cell lysis were normalized by protein content.DDAH activity was determined by measurement of the amount of ADMA metabolized by the cell lysates as described elsewhere p<0.05 was considered to be statistically significant.Data were expressed as mean \u00b1 SEM. All statistical analysis were performed using the software SPSS, version 11.5 . Differences among groups were compared by using univariate analysis of variance (ANOVA), and comparisons between two groups were analyzed by the LSD test. Two-tailed p<0.01, respectively). The increases in intracellular miR-21 expression decreased gradually but were still significant at 24 h and 48 h, respectively, after transfection .Transfection of miR-21 at concentrations of both 50 nmol/L and 100 nmol/L increased miR-21 expression in HUVECs significantly since 12 h after transfection  but not at 12 h (p>0.05) after 100 nmol/L miR-21 treatment  30 min before the addition of 10 \u00b5mol/L 4-HNE. As compared with 10 \u00b5mol/L 4-HNE treated group, cells in the 4-HNE (10 \u00b5mol/L)+miR-21 inhibitor group showed significantly increased DDAH1 mRNA and protein expression  4-HNE is considered as a new atherogenic factor, and plasma 4-HNE level is suggested to be potential biomarker for AS related disease We observed that miR-21 inhibitor only partially reversed ADMA metabolizing activity of the cell lysates and intracellular accumulation of ADMA by 10 \u00b5M 4-HNE treatment. These findings indicate that miR-21-independent mechanisms are also involved in the regulation of ADMA metabolism under 4-HNE exposure. Direct inhibition of DDAH1 activity by 4-HNE may account for this phenomenom In conclusion, we find in this study that 4-HNE can dysregulate intracellular ADMA in HUVECs through miR-21 dependent pathway and involving inhibition of DDAH1 expression. We also suggest a positive regulation loop between miR-21 and the DDAH1/ADMA system. Our findings suggest that intervention with miR-21 expression may provide a new therapeutic target for the treatment of 4-HNE and ADMA related diseases such as atherosclerosis."}
+{"text": "Flag leaf is the most essential organ for photosynthesis in rice and its size plays an important role in rice breeding for ideal plant-type. Flag leaf size affect photosynthesis to a certain extent, thereby influencing rice production. Several genes controlling leaf size and shape have been identified with mutants. Although a number of quantitative trait loci (QTLs) for leaf size and shape have been detected on 12 chromosomes with different populations of rice, few of them were cloned.qFLW7.2, a new major QTL for flag leaf width, was fine mapped within 27.1\u00a0kb region on chromosome 7. Both qFLW7.2 and qPY7 were located in the interval of 45.30\u2009~\u200953.34\u00a0cM on chromosome 7, which coincided with the relationship between yield per plant (PY) and flag leaf width (FLW).The pair-wise correlation analysis was conducted on length, width and length-width ratio of the flag leaf, and yield per plant in the core recombinant inbred lines of Liang-You-Pei-Jiu (LYP9) developed in Hainan and Hangzhou. There were significant correlations among the three flag leaf size and shape traits. Interestingly, a positive correlation was found between flag leaf width and yield per plant. Based on the high-resolution linkage map we constructed before, 43 QTLs were detected for three flag leaf size and shape traits and yield per plant, among which 31 QTLs were unreported so far. Seven QTLs were identified common in two environments. And qFLW7.2, which explained 14% of the phenotypic variation, increased flag leaf width with 93\u201311 allele. Two candidate genes were selected based on sequence variation and expression difference between two parents, which facilitated further QTL cloning and molecular breeding in super rice. Rice is not only one of the most important food crops in China, but a staple food for more than half the world's population  and recombinant inbred lines (RILs) , FLW and flag leaf area (FLA) were controlled by two pairs of genes with at least more than 60% heritability. In recent years, with the rapid development of molecular markers and the increase in resolution of the linkage map, numbers of QTLs for flag leaf size and shape have been reported in rice. Li et al.  were mapped based on a high-density linkage map by resequencing the parents of LYP9 and 132 core RILs  were selected from a large RIL population, carrying approximately 484\u00a0kb heterozygous segment on the long arm of chromosome 7. Then phenotypic character was measured in F2 population including 1520 individuals derived from the RHL. Three insertion-deletion (InDel) and five single nucleotide polymorphism (SNP) markers were developed by comparing the sequences of the parents. Combining the genotype and phenotype of individuals, the QTL was delimited between two InDel markers INDEL7-2 and INDEL7-3 in 27.1\u00a0kb interval  based on Rice Genome Annotation Project Website (http://rice.plantbiology.msu.edu/). Sequence variations of those genes between two parents were identified and expressions at RNA level were analyzed in leaves of the parents at booting stage  and 93\u201311 revealed FLW was wider in 93\u201311 than in NIL-PA64s-1 and NIL-PA64s-2, while little difference found between 93\u201311 and two NILs in FLL . The gene Nal7, encoding a flavin-containing mono-oxygenase, were fine mapped on chromosome 3 and cloned with F2 population. The Nal1 gene located on chromosome 4, whose mutation affected lateral leaf growth and exhibited narrow leaf, encodes a plant specific protein of unknown biochemical function . It played an important role in molecular genetics and marker assisted selection (MAS) of flag leaf size and shape related traits. Here, PY and FLW were found significantly and positively correlated, which suggested that appropriate increase in FLW may raise PY correspondingly. Both 2 population derived from a RHL, qFLW7.2, a new major QTL for FLW, was fine mapped within 27.1\u00a0kb physical interval on chromosome 7. Two candidate genes were finally selected based on difference in genomic sequence and transcriptional expression. Because the significantly positive correlation between FLW and PY, together with common interval shared by QTLs for FLW and PY, appropriate increase in FLW may raise PY correspondingly during molecular breeding for ideal plant-type in rice.In this study, using high-density SNP linkage map, 43 QTLs were detected in Hangzhou and Hainan to control rice leaf morphology and yield per plant. Owing to the increased precision and sensitivity of detection, minimum QTL interval reached 0.19\u00a0cM and 31 QTLs were novel. With the FOryza sativa. indica cv. 93\u201311 and the maternal inbred Oryza sativa. javonica cv. Peiai 64\u00a0s (PA64s), a photo-thermo-sensitive male sterile line. The population was developed in the experimental fields at China National Rice Research Institute in Hangzhou, Zhejiang Province and in Lingshui, Hainan Province, China. After 12 generations of self-fertilization, genomic DNA samples of the F13 RILs were isolated for genotyping. High-density map of genome-wide graphic genotypes was constructed using single nucleotide polymorphism SNP markers as described previously  marker RM234  and flag leaf width  were measured on three tillers. One derived trait, the length-width ratio (LWR)\u2009=\u2009FLL/FLW, was calculated. The trait yield per plant  was also examined for the plants whose flag leaf size and shape had been investigated.Flag leaves of two parents were collected at heading stage and fixed in Formalin-Aceto-Alcohol (FAA). The samples were dehydrated through a graded ethanol series, then embedded in Paraffin (Surgipath\u00ae) and polymerized at 60\u00b0C. Finally, the materials were sectioned and stained with 1% toluidine blue before examination under an ECLIPSE 50i microscope (Nikon)  using Composite Interval Mapping (CIM). LOD threshold for each dataset was set based on a permutation test . It was considered as a major effect QTL when its LOD score was larger than 2.5. PEV was estimated by ANOVA. QTLs were named according to McCouch et al.  and SNPs identified between 93\u201311 and PA64s . DNase treatment, cDNA synthesis, primer design and SYBR Green I real time PCR were carried out as described (Vandesompele et al."}
+{"text": "P < 2.97 \u00d7 10\u221210). Among them, 12 eQTLs were associated with the expression of multiple histone genes. Transcriptome-wide association analysis using the identified eQTLs showed their associations with additional 80 genes (P < 4.75 \u00d7 10\u22126). In particular, expression of RPPH1, SCARNA2, and SCARNA7 genes was associated with 26, 25, and 23 eQTLs, respectively. This study suggests that histone genes shared 12 common eQTLs that might regulate cell cycle-dependent transcription of histone and other genes. Further investigations are needed to elucidate the transcriptional mechanisms of these genes.A genome-wide association study (GWAS) was conducted to examine expression quantitative trait loci (eQTLs) for histone genes. We examined common eQTLs for multiple histone genes in 373 European lymphoblastoid cell lines (LCLs). A linear regression model was employed to identify single-nucleotide polymorphisms (SNPs) associated with expression of the histone genes, and the number of eQTLs was determined by linkage disequilibrium analysis. Additional associations of the identified eQTLs with other genes were also examined. We identified 31 eQTLs for 29 histone genes through genome-wide analysis using 29 histone genes ( Histone mRNA transcripts and proteins are important for packing DNA into chromatin and are thus tightly regulated in most human cells . In humaWhile many efforts have been made to understand the mechanisms for the transcription of histone genes, they have not yet been well defined. Nuclear protein of the ataxia-telangiectasia-mutated locus (NPAT), which promotes the transcription of histone genes, is located near the Cajal body . Clusterhttp://www.internationalgenome.org/). This study utilized genotypic data at 5,796,145 SNPs after filtering out the SNPs with minor allele frequency\u2009<\u20090.05, with missing rate\u2009>\u20090.05, or in Hardy-Weinberg disequilibrium with P < 0.001.The subjects of this study were 373 Europeans including 95 Finnish in Finland, 94 British in England and Scotland, 93 Tuscans from Italy, and 91 Utahn residents with Northern and Western European ancestry from the CEPH collection. Their genotypic data were derived from the phase 1 dataset produced by the 1000 Genomes Project [http://www.geuvadis.org/web/geuvadis/rnaseq-project). The unit used for the mRNA expression level was reads per kilobase per million mapped reads (RPKM). Outliers were removed based on sample similarity, which was estimated by the Spearman rank correlation between RPKMs and the exon counts of the samples [Transcriptional data on 10,518 human genes were obtained in lymphoblastoid cells of the subjects by the Geuvadis RNA sequencing project ( samples . Sample  samples . For det samples .r). The significance of the correlation was determined by P < 0.05.We selected histone genes that were expressed simultaneously. Pairwise gene expression relationships were estimated using Pearson's correlation coefficient  between the identified SNPs was estimated using the HaploView program . The LD y\u2009>\u20090.05 .t-statistic was also applied with a significance threshold value of P = 4.75 \u00d7 10\u22126.The identified eQTLs were further analyzed for their associations with the expression of nonhistone genes throughout the genome. The Bonferroni multiple testing based on The functions of identified SNPs were examined using the Ensembl Variant Effect Predictor program  and ReguP < 0.05). Genome-wide association analysis showed that 74 SNPs were associated with the expression of the 29 histone genes .We observed numerous correlations amid the expression of the histone genes investigated in the current study . In partP < 4.75 \u00d7 10\u22126; Transcriptome-wide association analysis revealed 80 additional genes associated with the 31 identified eQTLs (r > 0.7), which likely provide a manageable unit for coordinating transcription.We analyzed the eQTLs for simultaneously expressed histone genes. We found significant correlations amid the expression of 29 histone genes, which were all clustered in chromosome 1 or 6. This clustered structure of the genes may serve to control simultaneous transcription, and this is supported by the observation that the expression of other histone genes not located on chromosome 1 or 6, including H1FX and H2A family members, was not correlated with those of the 29 selected genes. Furthermore, correlation estimates showed two subgroups nested within the large group  protein in various cells including LCLs. Klf4 was associated with chromosomal aberrations and can prevent cell proliferation by acting as a transcription factor . The abeTranscriptome-wide association analysis revealed that many nonhistone genes were also associated with the identified eQTLs. In particular, some genes were associated with 23 or more eQTLs. One was RPPH1, an RNA component of RNase P, which may assist in the cell cycle-dependent transcription of ribosomal RNAs (rRNAs) by associating with chromatin . The expInterestingly, many genes controlled by the same eQTLs as those for histones do not have polyadenylated structures . In partThe expressions of histone genes play an important role in controlling chromatin accessibility . ImpropeIn conclusion, we identified 31 eQTLs for histone genes. The eQTLs were also associated with nonhistone genes that exhibited both a cell cycle-dependent expression and a nonpolyadenylated RNA structure. Further investigations are required to understand the mechanisms regulating the transcription of the histone and nonhistone genes identified in this study and to appreciate their influence on cancer and other diseases. Moreover, identification of eQTLs using disease-specific cell types would provide resolute mechanisms by diseases.Table S1. Functional capability of eQTLs identified for histones using RegulomeDB."}
+{"text": "The present review aimed to assess the role of exosomal miRNAs in cancer-associated fibroblasts (CAFs), normal fibroblasts (NFs), and cancer cells. The roles of exosomal miRNAs and miRNA dysregulation in CAF formation and activation were summarized.All relevant publications were retrieved from the PubMed database, with key words such as CAFs, CAF, stromal fibroblasts, cancer-associated fibroblasts, miRNA, exosomal, exosome, and similar terms.Recent studies have revealed that CAFs, NFs, and cancer cells can secrete exosomal miRNAs to affect each other. Dysregulation of miRNAs and exosomal miRNAs influence the formation and activation of CAFs. Furthermore, miRNA dysregulation in CAFs is considered to be associated with a secretory phenotype change, tumor invasion, tumor migration and metastasis, drug resistance, and poor prognosis.Finding of exosomal miRNA secretion provides novel insights into communication among CAFs, NFs, and cancer cells. MicroRNA dysregulation is also involved in the whole processes of CAF formation and function. Dysregulation of miRNAs in CAFs can affect the secretory phenotype of the latter cells. MicroRNAs (miRNAs), a major class of small non-coding RNAs that mediate post-transcriptional gene silencing by binding to the 3\u2032-untranslated region (UTR) or open reading frames (ORFs) of target mRNAs, have been widely studied in various physiological and pathological processes , 2. SimiThe microenvironment consists of different types of normal cells, including fibroblasts, endothelial cells, pericytes, immune cells, and local or bone marrow-derived stromal stem and progenitor cells, and the surrounding extracellular matrix (ECM) . Tumor mAccumulating evidence suggests that miRNAs play a critical role not only in cancer cells but also in the tumor microenvironment . The dysThis review focused on the bridging role that exosomal miRNAs play among CAFs, NFs, and cancer cells, exploring how exosomal miRNAs and miRNA dysregulation activate CAFs. We also demonstrated that miRNA dysregulation mediates functional changes in CAFs.Previous studies demonstrated that CAFs and cancer cells regulate each other by secreting a variety of cytokines, chemokines, and extracellular matrix (ECM) \u201331. HoweExosomes contain a great variety of bioactive molecules, including signal peptides, microRNAs, lipids, and DNA . A recenStudies assessing the origin and activation of CAFs have been performed for several years, but the available data remain insufficient. MicroRNAs are dysregulated in several types of cancers , modulatPrevious studies demonstrated that pancreatic cancer cells secrete miR-155 to activate NFs. This phenomenon might be related to miR-155-mediated down-regulation of its target TP53INP1 . An innoA study of triple negative breast cancer revealed a CAF-like phenotype inducible by tumor cells through exosome-mediated delivery of miR-9. Interestingly, miR-9 is also released by NFs and transferred to tumor cells. Another study found that miR-9 stimulates tumor cell migration by reducing E-cadherin levels . Doldi eAs mentioned above, cancer cells and CAFs release exosomal miRNAs to promote CAF formation , 52\u201355. Our recent study demonstrated that miR-1 and miR-206 down-regulation and miR-31 up-regulation in NFs induce a functional conversion into CAFs and promote the migration, colony formation, and tumor growth of cancer cells, as well as tumor-associated macrophage (TAM) recruitment. Further studies demonstrated that miRNAs reprogram NFs into CAFs by mediating FOXO3a/VEGFA/CCL2 signaling . A similAnother study of esophageal cancer demonstrated that miR-27a/b mediates CAF formation, with increased production of TGF-\u03b2 leading to cisplatin resistance . It is wHelicobacter pylori infection potentially promotes the pro-tumor properties of stromal fibroblasts by silencing mmu-mir-149 and stimulating IL-6 production [MiR-21 binds to the 3\u2019UTRs of Smad7 mRNA and inhibits its translation. To reduce the competitive binding with TGFBR, Smad7 binds to Smad2, Smad3. Over-expression of miR-21 or Smad7 depletion promotes CAF formation, even without TGF-\u03b21 stimulation . Anotheroduction . Interesoduction .The above findings suggested that cancer development depends not only on malignant tumor cells, but also on CAF activation.Previous findings demonstrated that exosomal miRNAs can be taken up by neighboring or distant cells, subsequently leading to changes in gene expression; this suggests a cell-specialized role in physiological and pathological conditions . Here, wDrug resistance is a crucial factor affecting patient prognosis, and attracts increasing attention . AlthougA recent study demonstrated that fibroblast-derived exosomes induce cancer stem cells that contribute to chemoresistance . FurtherDysregulation of miRNAs in CAFs results in drug resistance. The low expression of miR-1 induced CAFs causes high secretion levels of SDF-1\u03b1. Meanwhile, SDF-1\u03b1 facilitates lung cancer cell proliferation and cisplatin resistance via CXCR4-activated NF-\u03baB and Bcl-xL . MicroR-Altered exosomal miRNA profiles during drug administration demonstrates that drug resistance is a complex and dynamic process. In recent years, studies revealed that drug resistance is not only related to genomic or epigenomic changes, but also highly regulated by altered tumor cell metabolism . TargetiExosomal miRNA-regulated cancer biology has been extensively assessed in recent years . HoweverJosson et al.  found thMiR-195 released by CAFs reduces cancer cell growth and invasion; indeed, miR-195 loaded EVs in rat models of cholangiocarcinoma (CCA) concentrate within the tumor, decrease tumor size, and improve survival in treated animals . These fMiRNA dysregulation often indicates an invasive phenotype in several cancer types through different signaling pathways . Shah etCancer metabolism alters tumorigenesis, which is vital for sustaining the proliferation and progression of cancer cells in order to support their escape from stringent regulation , 93. RedThese findings indicate that exosomal miRNAs play a bridging role in ECM cross-talks, providing deep insights into the communication between CAFs and cancer cells. Thus, targeting circulating miRNAs might be an attractive therapeutic approach for cancer in the future.In addition to exosomal miRNA association with interactions among CAFs, NFs, and cancer cells, miRNA dysregulation in CAFs mediates functional changes in CAFs. Most related reports demonstrated that dysregulated miRNAs are associated with tumor invasion, migration, proliferation, metastasis, and drug resistance. In addition, abnormal expression of miRNAs was found to be associated with poor prognosis, and could change the secretory phenotype of CAFs. The retrieved literature was sorted according to functional alterations.As mentioned above, CAFs and cancer cells regulate each other by secreting a variety of cytokines, chemokines, and ECM proteins \u201331. By aAnother study demonstrated that p16 and miR-146b-5p are down-regulated in breast cancer CAFS; p16 restitution suppresses IL-6 expression and secretion by up-regulating miR-146b-5p in breast cancer . MeanwhiMiR-21, which appears several times in this review, is associated with the formation and activation of CAFs, and exosomal miR-21 released by CAFs can lead to paclitaxel resistance by targeting APAF1 in ovarian cancer , 77, 91.As mentioned above, down-regulation of miR-200\u00a0s predicts a poor outcome in breast cancer patients via elevated expression of Fli-1 and TGF-\u03b2, contributing to ECM remodeling and triggering breast cancer cell invasion and metastasis both in vitro and in vivo .SATB2, although cell proliferation is not affected [Fgf-2 and its receptor Fgfr1 [The crosstalk between the matrix and cancer cells determines whether cancer cells remain stable or become invasive and metastatic tumors . MiR-106affected . In ER-paffected . Meanwhiaffected . Down-reaffected , 112. Sior Fgfr1 . Moreoveor Fgfr1 , 83, 88.Identifying effective prognostic biomarkers is extremely challenging. Interestingly, miR-21 expression in CAFs is associated with decreased overall survival (OS) in pancreatic cancer patients administered 5-FU but not gemcitabine . Naito eThis review summarized the recent research progress on exosome miRNAs in CAFs, NFs, and cancer cells, highlighting the complex roles of miRNAs in CAFs. First, cancer cells use exosomal miRNAs as signaling molecules to promote the formation of CAFs and modulate the functions of cancer cells. Secondly, miRNA dysregulation is closely related to CAF activation and formation, and affects the tumor-supportive capability of CAFs in vitro and in vivo.Exosomal miRNAs released by NFs and CAFs can alter migration, invasion, and metastasis in cancer cells, and induce drug resistance. They dictate an aggressive cancer phenotype. MiR-451, a tumor suppressor, is down-regulated in a variety of tumor types; conversely, CAFs use exosomal miR-451 as a signaling molecule to promote tumor cell migration and cancer progression . This alUsing pre-miRNAs or anti-miRNA inhibitors to restitute the abnormal expression of miRNAs in CAFs can significantly inhibit cancer progression and proliferation in animal models . MiR-195"}
+{"text": "At the end of the eleven-year conflict in Sierra Leone, a wide range of policies were implemented to address both demand- and supply-side constraints within the healthcare system, which had collapsed during the conflict. This study examines the extent to which households\u2019 exposure to financial risks associated with seeking healthcare evolved in post-conflict Sierra Leone.This study uses the 2003 and 2011 cross-sections of the Sierra Leone Integrated Household Survey to examine changes in catastrophic health expenditure between 2003 and 2011. An Oaxaca-Blinder decomposition approach is used to quantify the extent to which changes in catastrophic health expenditure are attributable to changes in the distribution of determinants  and to changes in the impact of these determinants on the probability of incurring catastrophic health expenditure (coefficient effect).The incidence of catastrophic health expenditure decreased significantly by 18% from approximately 50% in 2003\u00a0t0 32% in 2011. The decomposition analysis shows that this decrease represents net effects attributable to the distributional and coefficient effects of three determinants of catastrophic health expenditure \u2013 ill-health, the region in which households reside and the type of health facility used. A decrease in the incidence of ill-health and changes in the regional location of households contributed to a decrease in catastrophic health expenditure. The distributional effect of health facility types observed as an increase in the use of public health facilities, and a decrease in the use of services in facilities owned by non-governmental organizations (NGOs) also contributed to a decrease in the incidence of catastrophic health expenditure. However, the coefficient effect of public health facilities and NGO-owned facilities suggests that substantial exposure to financial risk remained for households utilizing both types of health facilities in 2011.The findings support the need to continue expanding current demand-side policies in Sierra Leone to reduce the financial risk of exposure to ill health. Direct payment made by patients at the point of care (out-of-pocket payment) is the major source of financing health care in low income countries . In addiIn recent years, the emphasis has shifted from simply estimating the extent of catastrophic health expenditure within populations to understanding socioeconomic factors that explain variations in households\u2019 exposure to healthcare financial risks. Studies using household-level data have consistently shown strong correlations between a range of household socio-demographic characteristics and the incidence of catastrophic health expenditure. For example, the incidence of catastrophic health expenditure is correlated with health care need \u2013 households with a larger proportion of elderly members or children under the age of five are more likely to incur catastrophic health expenditure \u201312. HousThese studies provide insights into factors that protect households or increase their vulnerability to catastrophic health expenditure and are useful in informing targeted policy decisions. Therefore, in addition to estimating trends in the incidence of catastrophic health expenditure, this paper quantifies the extent to which temporal changes in the determinants of catastrophic health expenditure, including household characteristics and healthcare-seeking behaviours, contributed to changes in the incidence of catastrophic health expenditure in Sierra Leone. Temporal changes in the incidence of catastrophic health expenditure can occur either through a change in the distribution of determinants or through a change in the impact of these determinants. The Oaxaca-Blinder decomposition approach , 19 is aHistorically, Sierra Leone has ranked as one of the poorest countries in the world, an economic situation made worse by the eleven-year 1991\u20132002) conflict. The conflict was characterized by extensive destruction of life and property, a contraction of the economy and the collapse of public infrastructure across the country. Approximately 2 million people were displaced during the conflict and at the end of the conflict in 2002, an estimated 50,000 people had been killed out of a population of 4.4 million 02 confli.Although Sierra Leone still lags behind other sub-Saharan African countries in terms of its health and economic indicators , some prIn the aftermath of the conflict, several policies were implemented to strengthen the health system. In order to increase responsiveness to local needs in pre-conflict marginalized areas, a Local Government Act was passed in 2004 to decentralize some central government functions  to local councils , 26. ThiIn 2006, a cost-recovery scheme was reintroduced following a failed attempt to fully implement one in 2002 . The aimIn 2010, the Government of Sierra Leone launched a Free Healthcare Initiative (FHCI) aimed at increasing access to health services among vulnerable populations . Under tThese reforms are likely to have important implications for households\u2019 healthcare-seeking behaviours and exposure to healthcare financial risks. For example, the reintroduction of the cost-recovery scheme and user charges in public health facilities can have an effect on households through two possible routes. First, the fall in the use of public healthcare services by some users as a result of higher charges , 31 reduTherefore this paper offers an advantage over previous studies by providing insights not only into the association between household characteristics and the incidence of catastrophic health expenditure but also into the extent to which wider healthcare sector reforms, implemented during the study period and affecting household healthcare-seeking behaviours, may have changed households\u2019 susceptibility to healthcare financial risks.The rest of the paper is organized as follows: section 2 outlines the SLIHS, study variables and the Oaxaca-Blinder decomposition approach; the results are presented and discussed in sections 3 and 4 respectively; and the final section concludes the paper.The SLIHS is a cross-sectional national representative sample of households in Sierra Leone conducted in 2003 and 2011 to track changes in household living standards and wellbeing. In both surveys, households were selected using comparable sampling strategies. Sierra Leone is divided into four provinces and 14 districts. Each district is in turn sub-divided into lower administrative units: first into local councils (19), then chiefdoms (149) and sections (1322). Each section is further sub-divided into area units known as enumeration areas (EAs), which formed the primary sampling unit of the SLIHS. Households were selected from a sample of EAs in a two stage-sampling process: first, EAs were stratified into rural and urban areas and a random sample of EAs selected to ensure a representative number of households from urban and rural areas. A random sample of households was then drawn from selected EAs.In 2011, approximately 6800 households were selected. However, due to financial and human resource constraints, a significantly smaller sample of households (approximately 3700) was interviewed in the 2003 survey.In both years, data on health expenditure were collected using a health questionnaire completed by heads of households on behalf of all household members. The health questionnaire collected data on the use of in- and outpatient health services from both formal and informal service providers as well as expenditure incurred in using these services. Heads of households were asked to report on the use of healthcare services by any household member in a two- or four-week periodIn both years, detailed information was collected on a wide range of food and non-food goods purchased by households. In 2003, household heads were asked to report on food and frequently purchased non-food goods bought in the 3\u201312\u00a0months period prior to the interview date. To limit recall bias, a different approach was adopted in 2011 to collect data for food and frequently purchased non-food goods. Each household received five visits at regular intervals over a one-month period. The monthly food and non-food expenditure for 2011 was estimated as the sum of all purchases made over the entire month.For infrequently purchased non-food goods and services, expenditure data were collected over a 12-month recall period in both 2003 and 2011  using purchasing power parity exchange ratesCatastrophic health expenditure is defined as health expenditure exceeding 10% of household total expenditure. First, health expenditure share of total expenditure is estimated for each household and then a binary variable is generated which equals one, when health expenditure share of total expenditure exceeds 10%.This study makes use of variables shown in previous studies to explain variations in households\u2019 exposure to healthcare financial risks. These include household size, proportion of household members below the age of 5\u00a0years and above the age of 65\u00a0years, household location  and proportion of unemployed adult household members. Head of household characteristics include age (and age squared), gender, marital status , religion  and education (no education to junior secondary education/some senior secondary education and above).In addition to household demographic characteristics, this study uses other previously identified determinants of catastrophic health expenditure. These include the proportion of household members reporting ill health as well as the proportion of household members utilising inpatient and outpatient healthcare services. To investigate differential effects of health facility-type, health service utilisation is disaggregated by type of service. This is identified using a combination of two variables available in SLIHS \u2013 the owner of the healthcare facility visited (public or private) and the health worker type consulted. For outpatient health care use, this includes use of informal healthcare services \u2009=\u20090\u00a0, the change in the incidence of catastrophic health expenditure,where The decomposition of approach , 33:3\\dowhere ion term , this stSecond, a detailed decomposition is performed to identify the contribution of each covariate to k represents the kth covariate and where d effect , 35.oaxaca\u2019, specifying a linear probability model [oaxaca\u2019 can support a probit or logit model specification, the linear probability model is used given that \u2018oaxaca\u2019 applies the decomposition to the linear predictions from the model [oaxaca\u2019 with a logit or probit model specification will not be expressed on a probability scale but in terms of log odds (in the case of a logit model) or z-scores (in the case probit models), resulting in difficulties interpreting the results of the decomposition analysis.The decomposition analysis is performed using the STATA user-written command, \u2018ty model . While \u2018he model . This meTable Positive improvements are also observed with health indicators. The proportion of household members reporting ill health decreased significantly by approximately 21 percentage points points. In terms of household healthcare-seeking behaviours, the proportion of household members utilising formal public outpatient healthcare services remained largely unchanged. However, a higher proportion of household members utilised informal healthcare services (an increase of approximately 1 percentage points) while utilisation of formal private as well as NGO/missionary healthcare services decreased by approximately 0.4 and 1 percentage points, respectively.A shift is observed in the distribution of households across Sierra Leone\u2019s four regions Table . The proTable Compared to households located in the Western region, households in other regions were more likely to experience financial risks associated with seeking healthcare. For example, the probability of incurring catastrophic health expenditure for households living in the Eastern region is approximately 7 percentage points higher than households in the Western region.The pooled cross-sections, while providing useful insights into the determinants of catastrophic health expenditure, mask important changes that occurred over time and the resulting implications for households\u2019 exposure to financial risks. A comparison of coefficient estimates between 2003 and 2011 shows that the magnitude and direction of effect vary between the two years . Similarly, the use of any healthcare facility is associated with a higher probability of incurring catastrophic health expenditure. However in 2011, the magnitude of this effect is higher for formal public outpatient healthcare services by approximately 0.3 percentage points.The Oaxaca-Blinder decomposition analysis Table  quantifiTotal distributional effect is largely driven by changes in the mean distributionTotal coefficient effect is largely driven by changes in the impact of ill health; however, regional variations in the incidence of catastrophic health expenditure as well as changes in the impact of public healthcare service-use have counteracting effects\u00a0Fig. .Fig. 1SiThe robustness of these findings is tested using different thresholds for defining catastrophic health expenditure Table . The CHEFollowing the end of the brutal civil conflict in Sierra Leone, the health sector underwent a series of\u00a0reforms aimed at strengthening both demand- and supply-side functions of the health system. These include the devolution of administrative responsibilities and funds to local councils in 2004; the reintroduction of the cost-recovery scheme and user fees in public health facilities in 2006; the Free Health Care Initiative (FHCI) in 2010 and the accompanying human resources for health (HRH) reformsand widespread reconstruction and refurbishment of public healthcare facilities nationwide \u201329. CoveChanges in both the distribution and coefficient\u00a0effect of ill health between 2003 and 2011 made the largest contribution to the CHE gap. Between 2003 and 2011, the proportion of household members reporting ill health decreased significantly, contributing to a reduction in the incidence of catastrophic health expenditure. Similarly, the impact of ill health on the likelihood of incurring catastrophic health expenditure reduced significantly between the two study years. In addition to severe disruptions to livelihood, conflicts have been linked to outbreaks of diseases, particularly infectious disease due to disruptions in safe drinking water sources and sanitation . The conThe distributional effect of household regional location provides further indication of general improvements in household economies\u00a0in the post-conflict period. The distributional effect of regional location, capturing the shift in populations from the least conflict-affected regions (the Western and Southern regions) to the worst affected regions (the Northern and Eastern regions) is indicative of regional economic growth as peace and security returned , 39. ThiBy contrast the regional coefficient effect, capturing regional variations in exposure to financial risk suggests that these positive changes may not have been felt equally across all regions. Compared to households living in the Western region, those in other regions were less likely to incur catastrophic health expenditure in 2003 but more likely in 2011. Changing population distribution and accessibility of health infrastructure is likely to explain this effect. For example, only 16 health facilities were functioning at the height of the conflict in 1996, with the majority of these located in the Western Region . TherefoThe distributional and coefficient effect of facility-type provides interesting insights into the evolution of health service provision in the post-conflict era. A statistically significant decrease in the use of private facilities including NGO and missionary-owned facilities is observed between 2003 and 2011 while an increase is observed in the use of public health facilities . In the aftermath of the conflict, NGOs and private actors played an important role in the provision of healthcare , fillingThe decrease in the use of formal private and NGO healthcare services significantly reduced households\u2019 exposure to financial risk. However, those who continued to use NGO-owned health facilities faced a higher risk of incurring catastrophic health expenditure in 2011 (captured in the coefficient effect). An increase in prices of healthcare services between 2003 and 2011 is likely to explain the observed coefficient effect of NGO- and privately-owned healthcare facilities. NGO-owned facilities in Sierra Leone largely operate on a similar basis to privately owned facilities, charging patients a fee-for-service at the point of care , 46. AltThe distributional effect of public health services suggests an increase in households\u2019 exposure to the financial risk of seeking healthcare. While this effect was not found to be statistically significant, the coefficient effect provides more insight into the implication of public health facility-use on households\u2019 exposure to financial risk. In both study years, the risk of incurring catastrophic health expenditure increased with the proportion of household members using public health services. However, this effect is significantly higher in 2011 suggesting higher financial risks faced by households. This effect may partly be explained by health financing reforms including the reintroduction of the cost recovery scheme and user fees in public health facilities in 2006 which would have resulted in higher out-of-pocket health expenditure for those utilizing these services in 2011 , 31. FurThese findings are in part, sensitive to the catastrophic health expenditure threshold. The CHE gap varies between 11 and 23%, depending on the threshold used for defining catastrophic health expenditure. Nevertheless, the proportionate contribution of the total coefficient and distributional effects to the CHE gap at each threshold are comparable. The detailed distributional effects appear robust to thresholds, while the coefficient effect varies in some cases. For example, the coefficient effect of ill health and public health facility-use is significant only at lower thresholds suggesting equal effects of these determinants in both years at higher thresholds.The robustness of our findings could be affected by the extent of measurement errors in household expenditure data. The precision of household expenditure estimates from survey data is subject to recall periods over which data are collected and the differences in how goods were itemised between the two study years . Given tFurthermore, differences in the recall periods over which health expenditure and other household expenditure were collected may have affected our estimates of the incidence of catastrophic health expenditure. Households are likely to recall and accurately report health expenditure occurring over a shorter recall period , 54. On The findings of this study illustrate an important limitation of this measure of catastrophic health expenditure. Catastrophic health expenditure is conditional on healthcare use and captures the financial risks associated with accessing care. This means that the measure of catastrophic health expenditure defined in this study captures only financial risks for those who seek health care but fails to account for those who do not seek health care when ill due to an inability to pay. Although we find some evidence that regional socioeconomic inequality may have accounted for higher catastrophic health expenditure in 2011, estimates of the concentration index in 2011 suggests that in the total population, catastrophic health expenditure was concentrated amongst those who potentially have the ability to pay for health care when needed. The situations where health care is not sought due to an inability to pay or when health care services are not available may be equally impoverishing \u2013 for example an unresolved health problem could prevent adults in a household from working, thus compromising household living standards. The catastrophic health expenditure measure defined in this study does not detect these and is an inevitably partial measure to understanding the links between health, health seeking behavior and impoverishment.The findings of this study suggest that while efforts have been made to address supply-side constraints to accessing healthcare in the years following the conflict in Sierra Leone , financiWhile rebuilding and refurbishing destroyed health infrastructure (supply-side initiatives) is a crucial element to improving access to quality healthcare services in the aftermath of conflict, for policy-makers, this study highlights the importance of complementary demand-side mechanisms aimed at protecting households, at a time when households are themselves recovering from severe losses. These demand-side mechanisms including health insurance schemes\u00a0and\u00a0partial or full health care fee waivers  have been shown to reduce out-of-pocket payments amongst the most vulnerable populations in other settings . Althoug"}
+{"text": "The finite-set statistics (FISST) foundational approach to multitarget tracking and information fusion was introduced in the mid-1990s and extended in 2001. FISST was devised to be as \u201cengineering-friendly\u201d as possible by avoiding avoidable mathematical abstraction and complexity\u2014and, especially, by avoiding measure theory and measure-theoretic point process (p.p.) theory. Recently, however, an allegedly more general theoretical foundation for multitarget tracking has been proposed. In it, the constituent components of FISST have been systematically replaced by mathematically more complicated concepts\u2014and, especially, by the very measure theory and measure-theoretic p.p.\u2019s that FISST eschews. It is shown that this proposed alternative is actually a mathematical paraphrase of part of FISST that does not correctly address the technical idiosyncrasies of the multitarget tracking application. The finite-set statistics (FISST) foundational approach to multitarget tracking and information fusion\u2014stochastic geometry, random finite sets (RFS\u2019s), belief-mass functions, and set derivatives and integrals\u2014was introduced in the mid-1990s ,3,4\u2014dateavoiding avoidable mathematical abstraction and complexity \u201d is false in actual engineering application. And, in any case, immediately after this claim was made all p.p.\u2019s were assumed to be simple.This is because X = {x1, \u2026, xn} then it has n! vector state representations X\u03d5\u03c0, =  \u2014whereas ideally there should be a one-to-one correspondence between physical states and their representations. (3) The goal of multitarget algorithms is to produce estimates of the multitarget state that are as close as possible to ground truth. A mathematical distance metric on multitarget states is required to do so. Assume that there exists a metric \u03c1 on vector states. It must be constant under permutation of the entries of \u03d51 and \u03d52\u2014in which case \u03c1 = \u03c1\u2032(\u03c7(\u03d51),\u03c7(\u03d52)) for some \u03c1\u2032, where \u03c7(\u03d5) denotes the set of entries in \u03d5. Let \u03c0\u03d5 = . Then \u03c1 = \u03c1 = 0 for permutations \u03c0 \u2260 \u03c0\u2032, contradicting the definition of a metric. That is: no metric on vector states exists. Finite sets have well-known metrics such as \u201cOSPA\u201d  for the construction of the regional statistics\u2026\u201d.  Here, \u201cregional statistics\u201d refers to the \u201cregional variance\u201d of Ref. \u2014i.e., th\u039e(S) \u201c\u2026is\u2026 not a measure\u2026 [and so it] does not necessarily admit a density in general\u2026 This fact motivates the measure-theoretical approach\u2026\u201d This is not the case, because  var\u039e(S) does admit a density.In Ref.  it was c\u039e(S) is not a measure, how can it motivate \u201cthe measure-theoretical approach\u201d? Sometimes \u201cmeasure\u201d has its usual meaning: a nonnegative set function \u03bc(S) such that \u03bc(\u222an\u22651nS) = \u2211n\u22651\u03bc(nS) for mutually disjoint nS. Other times, however, it means nonadditive set functions such as var\u039e(S).First, however, readers should be advised that the meaning of \u201cmeasure\u201d in Refs. ,13,14 isThe following subsections will address: the elements of FISST ; measuresingle-target statistics is the probability measure pX(S) = Pr(X \u2208 S) of a random vector X \u2208 \u2111 (not to be confused with the p.p. single-target state space X = \u2111). Single-target tracking requires the probability density of pX(S):pX(S) with respect to Lesbesgue measure \u03bb(S) on \u2111 \u2286 \u211cN. That is: fX(x) has the property that \u222bS fX(x)dx = pX(S) where \u222bS\u00b7dx = \u222b\u22c51S(x)d\u03bb(x) and 1S(x) is the indicator function of subset S \u2286 \u2111.This section is drawn from Ref. . The thereformulate multitarget tracking as a generalized single-target tracking problem, with RFS\u2019s \u039e taking the place of random vectors X. The theoretical basis of multitarget statistics is the probability measure p\u039e(O) = Pr(\u039e \u2208 O) over the Borel-measurable subsets O of the hyperspace whose elements are the finite subsets of single-target state space \u2111. (A \u201chyperspace\u201d is a space whose elements are subsets of some other \u201cbase space.\u201d) FISST avoids p\u039e(O) by equivalently replacing it with the stochastic-geometric belief measure (a.k.a. belief-mass function) \u03b2\u039e(S) = Pr(\u039e\u2286S)\u2014a conceptually simple generalization of pX(S) = Pr(X\u2208S).The goal of FISST was to Remark 4.\u00a0The belief measure can usually be avoided since it is usually necessary only for motion and measurement modeling\u2014see Section 7.1.multitarget probability density of \u03b2\u039e(S)\u2014i.e., the multitarget analog of Equation (2):set derivative of \u03b2\u039e(S) with respect to X = {x1, \u2026, xn} \u2286 \u2111. (x) = (\u03b4pX/\u03b4{x})(\u00d8)\u2014see Ref.  is characterized by its projection measures Pn)(\u03a6 denotes the nth-order Janossy measure\u2026and is defined as Jn)(\u03a6 (B1 \u00d7 \u2026 \u00d7 Bn) = n!Pn)(\u03a6(B1 \u00d7 \u2026 \u00d7 nB)\u2026 The probability density p\u03a6 (respectively (resp.) the nth-order projection density pn)(\u03a6) is the Radon-Nikod\u00fdm derivative of the probability distribution P\u03a6 (resp. the nth-order projection measure P(n)\u03a6, the nth-order Janossy measure Jn)(\u03a6) with respect to (w.r.t.) some reference measure\u2026 Throughout this article the exploitation of the Janossy measures will be preferred, for they are convenient tools in the context of functional differentiation\u2026\u201d.\u201cThe probability distribution   and its density mk) are also introduced \u2026 for practical applications\u2026\u201d Neither assertion is true: var\u039e(S) does admit a density  measures are \u201cconvenient tools\u201d for \u201cfunctional differentiation\u201d; and (b) the fact that var density ; and mea density .kk| at time kt can be represented by a single multitarget probability density function kfk|(X|Zk1:)\u2014i.e., the multitarget probability density function of \u039ekk|. The recent very fast implementations of the GLMB filter have been possible only because advanced stochastic sampling techniques can be applied to kfk|(X|Zk1:)\u2014see Ref. . Its density function can be shown to be f = \u03b4y(x)\u00b7Since Dirac deltas are density functions, even singular measures can have density functions. For example, consider the bivariate measure \u03bc\u039e(y). See also Equation (11).DJk) or Mk) for n \u2265 1, are mathematically equivalent to, but mathematically far more complicated than, the FISST multitarget density functions that they replace, such as f\u039e(X) and D\u039e(X). Consequently, replacing every FISST density with measures (or some other set function) produces a mathematically complexified mathematical paraphrase of FISST that is inappropriate for practical multitarget tracking since densities are unavoidable.For the purposes of multitarget tracking, families of multivariate measures, such as \u03b4X was described in d\u03bb(\u03d5) with respect to an unspecified \u201creference measure\u201d \u03bb   and f\u039e(X). A third fundamental statistical descriptor of \u039e, the probability generating functional (p.g.fl.), is:Xh was defined in Equation (5). For present purposes the \u201ctest function\u201d h will be assumed to be a nonnegative bounded function, in which case 0 \u2264 G\u039e[h] < \u221e. (FISST follows the practice in Ref. [h(x) \u2264 1.) Note that G\u039e[1S] = \u03b2\u039e(S).The statistics of an RFS \u039e are equivalently characterized by  in Ref.  of furthA great many generating functionals besides the p.g.fl. are used in p.p. theory: characteristic, Laplace, moment, factorial-moment, cumulant, factorial-cumulant, Khinchin, etc., . It was The p.g.fl. finds its greatest use in the derivation of approximate multitarget filters such as the PHD and cardinalized PHD (CPHD) filters. This, in turn, requires a differential calculus of p.g.fl.\u2019s\u2014the subject of the next two subsections.A, B be  topological linear spaces and let \u03c4: A \u2192 B be a transformation. Then the G\u00e2teaux differential is a simple and obvious generalization of the differential quotient of undergraduate calculus:Let a \u21a6 (\u03b4\u03c4) exists and is linear and continuous then (\u03b4\u03c4) is called the G\u00e2teaux derivative of \u03c4 at a\u2032.If the function defined by x\u2016 such that \u2016x\u2016 = 0 implies x = 0 and which satisfies the triangle inequality: \u2016x+y\u2016 \u2264 \u2016x\u2016+\u2016y\u2016.)Now recall that a Banach space is a normed topological linear space that is closed with respect to limits.  then so does the Frech\u00e9t derivative of (\u03c4\u2218\u03c8)(a) = \u03c8(\u03c4 (a)) at a\u2032 and it is:The Frech\u00e9t derivative admits a chain rule in the following sense. Let n\u03b5 \u2192 0 and na \u2192 a. If the chain differential exists then it is the G\u00e2teaux differential  is linear and continuous it follows that, intuitively speaking,g. If it exists, the quantityfunctional derivative of G\u039e[h] at x  with respect to \u2016\u00b7\u2016\u221e exists. If so, it is given by:In MPMT the space of test functions see Ref.  (p. 1326G\u039e[h] be the p.g.fl. of the RFS \u039e. Since (h + \u03b5g)X = \u2211W\u2286X hXW\u2212\u22c5\u03b5W||Wg (see Ref. [derivative since it is linear and continuous in g. Equation (37) can be rewritten asLet see Ref.  EquationX)\u03b4Xsee . This isX)dxsee . From EqhGD\u039e)[g] = (\u2202G\u039e/\u2202g)[h].That is: the G\u00e2teaux and functional derivatives of a p.g.fl. always exist. In As for the chain differential of a p.g.fl., it is easily shown see  that it S \u21a6 (\u2202G\u039e/\u22021S)[h] is the functional derivative. The following two points are therefore established:The general chain rule for p.g.fl.\u2019s is a consequence of the Frech\u00e9t derivative, not the superfluous chain differential.The general chain rule for chain derivatives is mathematically equivalent to the general chain rule for functional derivatives and thus produces nothing new.Thus, by Equation (30), the density of the authors\u2019 measure G\u039e[T[h]] = G\u03a8[h] for some RFS \u03a8. Then the chain rule for functional derivatives is Ref. . This formula was derived 14 years earlier in Ref.  (of the predicted multitarget distribution kfk\u22121|(X|Zk\u221211:)) in terms of the p.g.fl. k\u2212Gk\u221211|[h] of the prior distribution k\u2212fk\u221211|(X|Zk\u221211:), as follows  is identical to he; sG[h|\u22c5] is identical to 1 \u2212 Sp(\u22c5) + Sp((\u22c5)hp(\u22c5); and bG[h|\u22c5] is identical to hb. That is: Equation (51) is the result of a \u201cp.p.\u201d derivation that is nearly identical to the FISST derivation, and is exactly the same formula that was derived using FISST 14 years earlier.In Ref.   = \u2211n\u22650nxna. (x) of arbitrary order n exist, with (nfd/ndx)(0) = n!\u00b7na\u2014it should not be surprising that p.g.fl.\u2019s are analogously analytic.The theoretical results reported in this section are original. Even so, the results reported in  in Ref.  called a\u039e(S) to a functional as follows:We are to prove Equation (11). First extend var\u039e(S) = var+\u039e[1S]. Thus, from Equation (33) we get:It is easily seen that varBy Campbell\u2019s theorem  (Equatio\u03b4/\u03b4x1 and \u03b4/\u03b4x2 of Equation (56) with x1 \u2260 x2 we get:Taking functional derivatives The quadratic version of Campbell\u2019s theorem is   yields Equation (11).Given this and and since +\u039e(X) isWe are to prove Equation (12). From Equations (6) and (11) the set integral of varh = h\u2032 = 1S in Equation (58) results inSetting \u039e(S).Substituting this into Equation (62) we get, as claimed, varG\u039e[h] isWe are to prove Equation (37). By Equation (28) the G\u00e2teaux differential of h + \u03b5g)X = \u2211WX\u2286XhW\u2212\u22c5\u03b5W||Wg [Since (\u22c5\u03b5|W|gW  (EquatioFrom this Equation (37) immediately follows.We are to prove Equation (38). From the definition of a set integral, Equation (6), we see thatWe are to prove Equation (40). From Equations (65) and (66) and the definition of the chain differential, Equation (29),Equation (40) immediately follows from this.L\u221e norm \u2016h\u2016\u221e = supx\u2208X|h(x)|, the Frech\u00e9t derivative of a p.g.fl. exists. We know that if it exists then it must be equal to the G\u00e2teaux derivative, which by Equation (37) isWe are to show that, with respect to the Because of Equation (36) we are to show thatHowever, the left side is easily seen to beW = {x1, \u2026, xn} with |W| = n \u2265 2, the limit in Equation (76) isFor fixed The finite-set statistics (FISST) approach to multitarget tracking\u2014stochastic geometry, random finite sets (RFS\u2019s), belief-mass functions, and set derivatives\u2014was introduced in the mid-1990s ,3,4\u2014datekfk|(X|Zk1:) \u21d2 Radon-Nikod\u00fdm density kPk|(d\u03d5|Zk1:); set integral \u21d2 measure-theoretic integral; functional derivative \u21d2 chain differential; functional-derivative product rule \u21d2 chain-differential \u201cLeibniz\u2019 rule\u201d; functional-derivative chain rules \u21d2 chain-derivative chain rules; RFS multitarget motion model \u21d2 \u201cp.p.\u201d multitarget motion model; FISST predicted p.g.fl. \u21d2 \u201cp.p.\u201d predicted p.g.fl.; and so on.Finite set \u21d2 vector; RFS \u21d2 simple point process (p.p.); multitarget densities \u21d2 \u201cmeasures\u201d ; multitarget probability density \u21d2 family of Janossy measures; multitarget factorial-moment density \u21d2 family of factorial-moment measures; multitarget distribution Vector multitarget-state representation is a mathematically equivalent complexification of finite set representation that is inappropriate for practical multitarget tracking.A simple p.p. is a mathematically equivalent complexification of an RFS that is inappropriate for practical multitarget tracking.does admit a density\u2014thereby refuting the only evidence offered in Refs. [The \u201cregional variance\u201d of Ref.  does admin Refs. ,13,14 thThe measure-theoretic integral is a mathematically equivalent complexification of the FISST set integral that is inappropriate for practical multitarget tracking.When applied to practical multitarget tracking, the \u201cchain differential\u201d is a mathematically equivalent complexification of the FISST functional derivative.It was further demonstrated that each of these substitutions is an unnecessary mathematical complexification of the FISST component that it replaces. In particular: Beyond this, FISST is significantly more general than MPMT because it: (a) has an integro-differential calculus of nonadditive set functions and their densities; and (b) provides a provably Bayes-optimal unification of \u201chard + soft\u201d multitarget information fusion."}
+{"text": "The emergence of neurotropic Zika virus (ZIKV) raised a public health emergency of global concern. ZIKV can cross the placental barrier and infect foetal brains, resulting in microcephaly, but the pathogenesis of ZIKV is poorly understood. With recent findings reporting AXL as a type I interferon antagonist rather than an entry receptor, the exact entry mechanism remains unresolved. Here we report that cell surface sialic acid plays an important role in ZIKV infection. Removal of cell surface sialic acid by neuraminidase significantly abolished ZIKV infection in Vero cells and human induced-pluripotent stem cells-derived neural progenitor cells. Furthermore, knockout of the sialic acid biosynthesis gene encoding UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase resulted in significantly less ZIKV infection of both African and Asian lineages. Huh7 cells deficient in \u03b12,3-linked sialic acid through knockout of ST3 \u03b2-galactoside-\u03b12,3-sialyltransferase 4 had significantly reduced ZIKV infection. Removal of membrane-bound, un-internalized virus with pronase treatment revealed the role of sialic acid in ZIKV internalization but not attachment. Sialyllactose inhibition studies showed that there is no direct interaction between sialic acid and ZIKV, implying that sialic acid could be mediating ZIKV-receptor complex internalization. Identification of \u03b12,3-linked sialic acid as an important host factor for ZIKV internalization provides new insight into ZIKV infection and pathogenesis. Flavivirus with other vector-borne viruses significant to human health, such as dengue virus (DENV), yellow fever virus (YFV), West Nile virus (WNV), and Japanese encephalitis virus (JEV) [Aedes africanus mosquito in 1948 in Zika Forest, Uganda [Zika virus (ZIKV) is an arthropod-borne RNA virus in the genus us (JEV) . ZIKV wa, Uganda . ZIKV in, Uganda , French , Uganda . These Z, Uganda , 7.bona fide entry receptors for flaviviruses remain unknown, and many cell surface expressed molecules could contribute to infection. These include C-type lectin DC-SIGN, L-SIGN, and phosphatidylserine receptors such as members of the T-cell Ig mucin (TIM) family and the TYRO3, AXL, and MERTK (TAM) family [The ) family . The TAM) family , glial c) family , neural ) family ,12, and ) family . However) family , neural ) family . These cCell surface carbohydrates, especially heparan sulfate and sialic acid, are often utilized by viruses as attachment or entry receptors. Multiple flaviviruses, including DENV , WNV 1919, and JIn this study, we provide evidence that cell surface sialic acid facilitates ZIKV infection in Vero, Huh7, and induced-pluripotent stem cells (iPSC)-derived human neural progenitor cells. This result was observed across both African and Asian lineages of ZIKV.Aedes albopictus  cells were grown and maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS.African green monkey kidney , Vero clone E6 (ATCC # CRL-1586), human hepatoma (Huh7) cells, and Madin Darby canine kidney  cells were grown and maintained in Dulbecco\u2019s modified Eagle medium  supplemented with 10% FBS. Mosquito 2 for 2 days. Culture medium was replaced with mTesR1 (STEMCELL Technologies) on day 3. Medium was refreshed daily until human iPSC colonies were ready for isolation.Human iPSC was reprogrammed from human dermal fibroblasts using an episomal vector as previously described ,55. BrieInduction of human neural progenitor cells was performed as previously described . BrieflyZIKV strains PF13/251013-18 from French Polynesia , MR766 from Uganda (NCBI accession no. KX377335), Paraiba_01/2015 from Brazil  and ZKA-16-922 from National Public Health Laboratory, Ministry of Health, Singapore (NCBI accession no. MH255601) were propagated in Vero cells. PF13, Paraiba, and ZKA-16-922 are from the Asian lineage of ZIKV, while MR766 is from the African lineage. DENV-1 (EDEN2402), DENV-2 (New Guinea C strain), YFV (vaccine strain \u2013 17D), Pteropine orthoreovirus PRV3M (commonly known as Melaka virus) . InfluenPseudotyped MERS coronavirus was prepared by transfection of 10\u2005\u00b5g of pcDNA3.1-MERS-CoV Spike (EMC/2012 strain) and 10\u2005\u00b5g of pNL4.3-EGFP lentivirus vector into HEK293 cells using FuGene 6 (Promega) in a 10\u2005cm culture dish. Pseudotyped virus was harvested 48\u2005h post-transfection. Pseudotyped vesicular stomatitis virus (VSV) was prepared by transfecting 10\u2005\u00b5g of pCMV-VSV-G (Addgene) into HEK293 cells using FuGene 6 (Promega). At 24\u2005h post-infection, pCMV-VSV-G transfected cells were infected with VSV\u0394G-EGFP-VSV-G seed virus for 1\u2005h. Cells were washed twice with PBS and replenished with complete growth medium. At 48\u2005h post-infection, the pseudotyped VSV was harvested, clarified and kept in \u221280\u00b0C.Clostridium perfringens and Arthrobacter ureafaciens in serum-free DMEM for 1\u2005h at 37\u00b0C. Cells were washed twice with serum-free DMEM followed by ZIKV infection at an MOI of 0.1 for 1\u2005h at 37\u00b0C. The inoculum was removed and infected cells were washed twice with serum-free DMEM, and replenished with 2% FBS DMEM. Virus in the supernatant was titrated by plaque assay at 72\u2005hpi.Vero cells were grown in 96-well plates and incubated with increasing concentrations of neuraminidase from Vero cells in 96-well plates were pre-incubated with increasing concentrations of WGA and ConcA lectin for 1\u2005h at 37\u00b0C, followed by washing with serum-free DMEM. Lectin-treated cells were then infected with ZIKV at an MOI of 0.1 for 1\u2005h at 37\u00b0C. The inoculum was removed and infected cells were washed twice with serum-free DMEM, and replenished with 2% FBS DMEM. Viruses in the supernatant were titrated by plaque assay 72\u2005hpi.4\u2005cells/well) in a 24-well plate were infected with 10-fold serially diluted ZIKV or DENV for 1\u2005h at 37\u00b0C. After incubation, the inoculum was removed and cells were immediately replenished with plaque medium supplemented with 0.8% carboxylmethylcellulose (CMC). YFV-17D was titrated in Vero, clone E6 using 0.8% CMC. ZIKV and DENV-infected cells were incubated for 5 and 4 days in a CO2, respectively. ZIKV and YFV-17D infected cells were fixed and stained with 4% paraformaldehyde and 0.25% crystal violet, respectively. DENV-infected cells were fixed and immunostained with mouse anti-DENV envelope antibody followed by HRP-conjugated anti-mouse antibody. The foci were developed using TrueBlue peroxidase substrate .Overnight cultured Vero cells (5\u2009\u00d7\u2009105\u2005cells/well) in a 12-well plate were infected with serially diluted influenza viruses for 1\u2005h at 37\u00b0C. Following incubation, the inoculum was removed and replenished with DMEM supplemented with 0.3% BSA, 25\u2005mM HEPES, 1 \u00b5g/ml TPCK-treated trypsin and 0.8% Avicel. At 2 days post-infection, infected cells were fixed and stained with 4% paraformaldehyde and 0.25% crystal violet, respectively.For human influenza viruses, overnight cultured MDCK cells  at 1:1000 dilution and secondary NL-493-conjugated anti-mouse IgG antibody (R&D Systems) for 1\u2005h at room temperature. Cell nuclei were stained with Hoechst 33342 (Sigma) for 10\u2005min. Immunofluorescence was detected with a fluorescent microscope (Nikon).Maackia amurensis lectin II  and FITC-conjugated wheat germ agglutinin lectin  were used to stain \u03b12,6-linked, \u03b12,3-linked and total sialic acid, respectively. A final concentration of 20\u2005\u00b5g/ml of the lectins was added into fixed cells for 1\u2005h at room temperature. Streptavidin NL-493 (R&D systems) were added at 1:1000 dilution for 1\u2005h at room temperature. The nuclei were stained with DAPI (Sigma) and the fluorescence images were captured using Cytation 5 imager (BioTek).For sialic acid staining, cells were fixed with 4% paraformaldehyde for 10\u2005min. Biotinylated elderberry bark lectin , biotinylated Sialic acid-knockout cells were generated using the CRISPR-Cas9 gene-editing method by targeting a gene involved in sialic acid biosynthesis \u2013 UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase (GNE). Four sgRNA sequences  were cloTo generate \u03b12,3-linked sialic acid-knockout Huh7 cells, an sgRNA sequence targeting the ST3GAL4 gene was cloned into pSpCas9(BB)-2A-EGFP, and followed by transfection into Huh7 cells using Lipofectamine 3000 (Invitrogen). GFP-positive cells were sorted 24\u2005h post-transfection, and seeded into 96-well plates for clonal expansion. The knockout cells were validated by DNA sequencing and sialic acid staining using \u03b12,3-linked and \u03b12,6-linked sialic acid-binding lectins.NotI and NheI restriction sites. The clones were validated by DNA sequencing.Total RNA from Vero cells were extracted using E. Z. N. A Total RNA kit  according to the manufacturer\u2019s instructions. cDNA was synthesis was performed using gene specific primers targeting GNE mRNA using ImProm II reverse transcriptase (Promega). The GNE ORF was amplified using Q5 high-fidelity DNA polymerase (NEB) and cloned into pCAGGS expression vector at 5\u2005cells/well). 500\u2005ng of the pCAGGS-GNE were transfected into each well of the 24-well plate using Lipofectamine 3000 and P3000 reagents, according to the manufacturer\u2019s instructions. Medium change was performed 4\u2005h post-transfection and infection was performed 48\u2005h post-transfection using ZIKV MR766 at 5\u2009\u00d7\u2009104 PFU. At 1\u2005h post-infection, the infected cells were replenished with either serum-free DMEM or DMEM supplemented with 2% FBS. Virus titres were determined at 48 hpi by plaque assay.Vero\u0394GNE cells were seeded in a 24-well plate , followed by pronase (Roche) treatment at a final concentration of 1\u2005mg/ml in DPBS for 10 min at room temperature. Pronase-treated cells were washed five times with DPBS and the total RNA was extracted using E. Z. N. A Total RNA kit I (Omega BioTek).ZIKV and H1N1 genomic RNA and housekeeping  mRNA levels were determined by real-time PCR. In brief, cDNA was synthesized using the Quantitect Reverse Transcription kit (Qiagen) and real-time PCR was performed with CFX96 real-time PCR detection system (Bio-Rad) using SensiFast SYBR No-ROX kit (Bioline).t test. Statistical analyses were conducted with GraphPad Prism 8 (GraphPad). P values of < 0.05 were considered statistically significant.Statistical details of experiments are found in the corresponding figure legends. Viral titres in treated and untreated cells were analysed by the Student\u2019s C. perfringens  was shown to be more efficient than neuraminidase from A. ureafaciens  in Vero cells (Our previous findings suggested that ZIKV does not use cell surface heparan sulfate as an attachment receptor . To testC. perfringens for 1 hr at 37\u00b0C significantly reduced ZIKV infection in a dose-dependent manner (C. perfringens neuraminidase significantly reduced infection with both human influenza viruses H1N1 PR8 and A/NWS/33 (C. perfringens neuraminidase-treated Vero cells remain susceptible to PRV3M (commonly known as Melaka orthoreovirus) infection  was used as control. WGA exhibited significant inhibitory activity in a dose-dependent manner, with a 2.9 log PFU/ml reduction at 400 \u00b5g/ml , a precursor of sialic acid  and Asia  lineages. By using pronase to remove plasma membrane-bound but un-internalized virus particles , our datus study . Similarus study . The faius study . The binus study .It is known that sialic acid can be recycled from the internalized exogenous sialylated glycoprotein present in FBS by sialin (SLC17A5). Sialin, mainly found in lysosomes, is an anion transporter capable of transporting glucuronic acid and free sialic acid out of the lysosome after it is cleaved from sialoglycoconjugates . When thZIKV exhibits a broad tissue tropism and persistence in body tissues and fluids, including brain, placenta, eye, and testes . Initialin vivo investigation of the role of sialic acid in ZIKV infection in mice.Our data suggest that ZIKV and, most likely other flaviviruses, use \u03b12,3-linked sialic acid as an internalization factor. The exact mechanism underlying sialic acid-mediated internalization requires further investigation. To date, multiple receptors have been reported for flaviviruses . It is,"}
+{"text": "Nasolabial cysts are rare, non-odontogenic, soft-tissue cysts that develop between the upper lip and nasal vestibule with an overall incidence of 0.7% out of all maxillofacial cysts. The predominant presentation of a nasolabial cyst is a painless localized swelling with varying degrees of nasal obstruction. Several treatment modalities have described in the management of the nasolabial cyst. In this paper, we present a case of a nasolabial cyst in a 44\u2009years old man with discussions of the treatment modalities in the lights of the literature.We present a case of a nasolabial cyst in a 44-year-old man that slowly increased in size through a period of 3\u2009years, with associated mild pain and nasal obstruction. It had caused a mass effect upon the maxilla, resulting in scalloping. The cyst was excised entirely with no evidence of recurrence at the two months follow up.The nasolabial cyst is a rare soft-tissue cyst. Complete surgical excision using an open approach performed to our case, which considered with the complete endoscopic removal of the best treatment for the nasolabial cysts with a rare recurrence rate. Nasolabial cysts are rare soft tissue non-odontogenic cysts that develop between the nasal vestibule and upper lip . The incA 44\u2009years old medically free male began to complain of a right nasal swelling three years ago. It has fluctuated in size in the previous three years. Recently, it started to slowly increase in size with associated mild pain and nasal obstruction. The patient denied any history of medical disease, history of trauma or surgery.On examination: There was a right nasolabial mass, 3\u2009\u00d7\u20094 cm, round fluctuating, no discharge, or overlying skin change Fig.\u00a0.Fig. 1UThere was mild tenderness on palpation. The endoscopic examination showed a mass obstructing most of the right nasal aperture Fig.\u00a0.Fig. 2ECT scan done showed a right inferior nasal alar region space-occupying lesion, measuring 3.2\u2009\u00d7\u20092.2\u2009\u00d7\u20092.5cm, which exhibits isodense to hypodense texture. There was no enhancement or bone destruction. It was causing a mass effect upon the maxilla, causing scalloping  with goblet cells compatible with nasolabial cysts. Postoperatively, the patient had mild facial edema with numbness over the right upper lip and teeth. He was seen after two weeks to remove stitches and intranasal cavity wound healed well. Edema had subsided by then, while the patient still reported numbness in the right upper lip and teeth. Two months after surgery, he has seen with an improvement of the previously reported numbness and fourteen months follow up showed no recurrence of the mass Fig.\u00a0.Fig. 5TThere was no indication for radiological examination as there were no complications or recurrence of the lesion.The nasolabial cyst is a rare condition and accounts for about 0.7% of all cases of maxillofacial cysts, and only 2.5% of the maxillofacial non-odontogenic cysts . It\u2019s beUltrasonography could be used in an office-based diagnostic tool for the nasolabial cyst . DiagnosIn conclusion, nasolabial cysts are rare soft-tissue cysts. It is believed that its occurrence is more than that reported in the literature. Complete surgical excision using an open approach done to the patient and allowed for histological examination and considered the best treatment for nasolabial cysts. Furthermore, excluding complete surgical removal and endoscopic marsupialization, all other modalities are associated with a high recurrence rate."}
+{"text": "Our aim is to assess the safety and potential efficacy of a novel treatment paradigm in pulmonary arterial hypertension (PAH), immunomodulation by blocking interleukin-6 (IL6) signaling with the IL6 receptor antagonist, tocilizumab. Inflammation and autoimmunity are established as important in PAH pathophysiology. One of the most robust observations across multiple cohorts in PAH has been an increase in IL6, both in the lung and systemically. Tocilizumab is an IL-6 receptor antagonist established as safe and effective, primarily in rheumatoid arthritis, and has shown promise in scleroderma. In case reports where the underlying cause of PAH is an inflammatory process such as systemic lupus erythematosus, mixed connective tissue disease (MCTD), and Castleman\u2019s disease, there have been case reports of regression of PAH with tocilizumab. TRANSFORM-UK is an open-label study of intravenous (IV) tocilizumab in patients with group 1 PAH. The co-primary outcome measures will be safety and the change in resting pulmonary vascular resistance (PVR). Clinically relevant secondary outcome measurements include 6-minute walk distance, WHO functional class, quality of life score, and N-terminal pro-brain natriuretic peptide (NT-proBNP). If the data support a potentially useful therapeutic effect with an acceptable risk profile, the study will be used to power a Phase III study to properly address efficacy. From the perspective of identifying pathways that are targetable, IL-6 has emerged as a strong candidate. IL-6 has been well-characterized as raised in peripheral blood and within the lung in PAH16 and is an independent marker of prognosis outperforming traditional markers of cardiac function such as NT-proBNP.17 Over-expression of IL-6 in animal models using transgenic mice leads to pulmonary hypertension18 and in hypoxia, IL-6 deficient mice are protected.19 Administration of recombinant IL-6 to rats also recapitulates a PAH phenotype.20 Tocilizumab is an IL-6 receptor antagonist established as safe, well tolerated, and effective, primarily in RA,21 and has shown promise in scleroderma.22 In uncommon cases, where the underlying cause of PAH is an established inflammatory process such as SLE, MCTD, and Castleman\u2019s disease, there have been case reports of regression of PAH with tocilizumab.2325 We therefore propose a phase II open-label proof of concept study of tocilizumab in group I PAH.Pulmonary arterial hypertension (PAH) comprises a group of orphan diseases historically associated with a poor prognosis. In the last 20 years, four classes of drug therapy targeting vasoactive pathways have been studied in randomized controlled trials (RCTs) and licensed for the treatment of predominantly group 1 PAH. These therapies have demonstrated moderate success, with meta-analyses of all RCT data suggesting a short-term improvement in mortality at 14 weeks.Immunomodulation utilizing interleukin-6 (IL6) receptor antagonism is a novel treatment strategy for patients with group 1 PAH and will improve pulmonary hemodynamic parameters.Patients will be recruited from seven adult specialist PH centers in the UK: Papworth Hospital, Cambridge; Golden Jubilee Hospital, Glasgow; Freeman Hospital, Newcastle; Royal Hallamshire, Sheffield; Hammersmith Hospital, London; Royal Brompton Hospital, London; Royal Free Hospital, London; and Imperial College, London. We aim to recruit 21 patients with a 15% drop-out rate and with provision for replacement. Study entry criteria  and exclWe have taken a conservative safety-led open-label trial design approach . This haParticipants will be identified using data collected during their routine outpatient appointment at each of the pulmonary hypertension centers.a decrease in the 6-minute walk distance (6MWD) of at least 15% from baseline, confirmed by a second 6-minute walk test (6MWT) performed on a different day within two weeks;the need for additional treatment for PAH;worsening of symptoms of PAH includes at least one of the following: a change from baseline to a higher WHO functional class  and the appearance or worsening of signs of right heart failure that did not respond to oral diuretic therapy.IV therapy will be administered at a dose of 8\u2009mg/kg once monthly for six months. Other PAH therapies may not be added unless an individual has experienced a clinical failure event. A clinical failure event is defined as the following: worsening of PAH; initiation of treatment with intravenous or subcutaneous prostanoids; lung transplantation; or atrial septostomy or death from any cause up to the end of treatment. Worsening of PAH is defined by the occurrence of all three of the following:Safety assessment, primary and secondary outcome data will be undertaken as per the assessment schedule (data supplement). Primary and secondary endpoints are listed below.Safety as defined by the incidence and severity of adverse events5) measured using invasive hemodynamic assessment by right heart catheterPulmonary vascular resistance  PVRbaseline. Hence, the expected fold change is PVR6months/PVRbaseline\u2009=\u20090.7, or \u2212log(0.7)\u2009=\u20090.15 in the log scale (the sign is to make the number positive but has no effect on sample size). The standard deviation of log fold change after three months was 0.42. Therefore, the sample size (n) required to detect the aforementioned log fold change in PVR with 90% power and 5% statistical significance was 17. Accounting for approximately 20% of drop-outs, the final n was 21. N.B. The pwr package in R was used with the following command: pwr.t.test (d\u2009=\u2009\u2212log(0.7)/0.42, sig.level\u2009=\u20090.05, power\u2009=\u20090.9, type\u2009= \u201cone.sample,\u201d alternative\u2009=\u2009\u201ctwo.sided\u201d).This is a proof-of-concept study and the sample size has been determined with respect to safety (in terms of exposure to the drug and investigations) and feasibility (patient population). We have intentionally only powered the study to pick up large effect sizes. The primary outcome is PVR fold change from baseline after six months of treatment, i.e. PVRP values and rejection of a null hypothesis (H0). Statistically, a P value is the area of a theoretical distribution of a statistic under H0 beyond an observed value given data. Informally, a P value measures how compatible are the observed data with H0. Traditionally, a P value of\u2009\u2264\u20090.05 has been used as statistical evidence against H0, and as a consequence, of prove of an effect. However, Fisher never intended for it to be fixed at 5% and recommended each trial to gauge an appropriate value given for example the possible consequences of false positive findings.Classical hypothesis testing pioneered by RA Fisher hinges heavily on P values under the alternative hypothesis (H1) in trials with low power, e.g.\u2009\u2264\u200980%, is practically uniform regardless of the actual biological effect.26 This means that a P value of 0.05 or 0.0005, i.e. 100 times lower, are equally likely for the same effect. P values are therefore equivocal indicators of how strong effects are unless the power exceeds 90%. RCTs in rare diseases suffer from low statistical power given the limitations of finding enough patients. Under these circumstances, the Bayesian paradigm offers an additional advantage over the frequentist one: informative priors. In a Bayesian analysis, additional information not contained in the data can be brought in to enlighten the results and reduce uncertainty, unlike the classical statistical paradigm. This additional information is called the prior and refers to the possible distributional properties of any parameter that we may be interested in before considering the data.In rare diseases, RCTs are always of relatively small size. The distribution of 6months/PVRbaseline) follows a normal distribution with mean \u03bc and precision \u03c4 . A 95% credible interval, i.e. highest posterior density interval, for logPVRfc will be obtained using a flat uniform prior for \u03bc ranging from \u221210  to 10  and a vague prior for \u03c4\u223cGamma. In the absence of useful prior information, this choice of priors will ensure that the data defines the posterior distribution of logPVRfc.Primary outcome analysis will utilize a Bayesian analysis with a flat prior distribution. It is reasonable to assume that the log of PVR fold change . PVR before treatment was assumed to be distributed as a log-normal with mean log(300) and standard deviation log(3), whereas PVR after treatment was assumed to be distributed as another log-normal with mean log(200) and sd log(2) . Thirty-Here, the informative prior is obtained from the results observed with the flat prior. This serves to illustrate an advantage of incorporating good additional information in the form of informative priors: the 95% credibility interval  is narrower when using good informative priors indicating much more certainty around the true effect of tocilizumab. In practice, priors cannot be obtained from a prior Bayesian analysis under informative priors but from independent sources. Likewise, if prior and data disagree, the credibility interval can be larger than the confidence interval in a frequentist analysis. This is nevertheless not a disadvantage but a realistic picture of the effect of combining conflicting sources of information.P value of 0.018. It has detected a difference at 5% significance but it does not provide any further information into the effect of tocilizumab in PVR. In contrast, the most conservative Bayesian analysis with flat priors informs us that tocilizumab renders on average a fold change of 0.60  but that given 18 individuals and the distributions in In comparison, the Wilcoxon test outputs a statistic V\u2009=\u2009183, which is not intuitive, and a www.transform-uk.com). If we assume 21 patients completed treatment successfully and had PVR measures at baseline and after 24 weeks, a patient will be scored 1 if PVR reduced by at least 30% from baseline (success), otherwise he/she will be scored as 0. The question is: what is the probability of a successful treatment for a random individual with group 1 PAH? The Bayesian solution to this problem is to combine prior information summarizing all available knowledge of the effect of tocilizumab in PVR among PAH patients and new data from a trial to update our knowledge of the probability of success (P). Unlike frequentist analysis, the Bayesian solution is a distribution of possibilities for the parameter P, i.e. the posterior distribution. For example, the top left plot in P value\u2009<\u20090.05). A conservative approach to secondary endpoints will be presented with median and confidence intervals. The actual prior elicitation produced results shown in For comparison, paired changes in the primary endpoint PVR will be assessed using the Wilcoxon signed-rank test. (significance set at 27 and in atherosclerosis (CANTOS study: NCT01327846). This is not to downplay the implications. We acknowledge that to commit PAH patients to immunosuppression is a significant undertaking and we would not underestimate the potential effects of this. The side effect profile of most immunosuppressive therapy is a new area for PAH and cannot be ignored. For this reason, we feel that immunosupression should not be considered unless it is going to be transformative to patient outcomes. Our study is powered for large effects only in recognition of this.A trial of immunosuppression in PAH is now warranted. Over the last 20\u201330 years, evidence has accumulated to suggest that inflammation and autoimmunity play a role not just in CTD but also in IPAH, though the exact role is unclear and a significant question remains about how much is pathogenic and how much is inflammation related to chronic disease. The concept of immunosuppression in other vascular diseases is gaining momentum, even in the absence of autoimmunity. Examples of this include blocking IL-1 in acute coronary syndromes28 and PVR is not placebo responsive with the majority of trials reporting increases at four to six months. Given the lack of placebo effect on PVR, we feel the only likely impact of this therefore will be missing signal related to participants deteriorating, and there is a risk our study may underestimate effects. As the first trial of a new approach, we are also aware that a valid criticism is that we may not be enriching our trial for patients likely to respond. Given the novelty of this approach, we have chosen to start with patients who are relatively stable, predominantly on dual therapy and therefore a \u201cprevalent\u201d not \u201cincident\u201d population. In most autoimmune diseases, therapy works best in patients \u201cflaring\u201d or \u201cactive\u201d and at present this is not a traditional way of viewing the progress of pulmonary hypertension and we have no good biomarkers to help guide us. This may affect the power of the study. In part to address the low power issue we have adopted a Bayesian statistical approach. Classical hypothesis testing hinges heavily on P values and rejection of a null hypothesis (H0). Informally, a P value measures how compatible are the observed data with H0. In rare diseases, RCTs are always of small size. Halsey et\u00a0al.26 showed that the distribution of P values under the alternative hypothesis (H1) in trials with low power, e.g. 80% or less, is practically uniform regardless of the actual biological effect. RCTs in rare diseases suffer from low statistical power, and as we stratify our patients more carefully this will worsen. Given these circumstances, it may be wiser to move away from frequentist statistics and one option is to change over to the Bayesian paradigm. What is appealing in a Bayesian analysis is that additional information not contained in the data  can be brought in to enlighten the results. This approach may be of particular importance when considering mixed populations as we have in this trial of CTD, predominantly scleroderma, and IPAH where we may have significant variation in treatment responses. The authors of this manuscript are not frequentist or Bayesian but practical scientists that can work within either paradigm. Nevertheless, we recognize the potential benefits of using a Bayesian approach here.We have paradoxically excluded patients with SLE, MCTD, and Castleman\u2019s disease to minimize heterogeneity and the chance of a positive study being driven by response in rarer diseases. Additionally, the majority of these patients are already immunosuppressed. We believe a trial specifically looking at immunosuppression in CTD-PAH is overdue but the trial design would have to be different reflecting the availability of licensed and established immunotherapies. A trial only looking at these rare causes would require many more centers. The open-label nature of our study may be viewed as contentious. We have examined available PVR data from recent meta-analysesIn summary, we believe that the time is right for a trial of immunosuppression in PAH, that IL6 is an excellent starting candidate, with a well-established and well-tolerated therapy in tocilizumab. Immunosuppression is uncontroversial in our opinion in CTD but more controversial in IPAH; however, the preclinical evidence is compelling and it is now time to test hypotheses other than vasodilation. We have designed a small open-label investigator-led study utilizing Bayesian statistical methods to analyze and we think this trial design is potentially useful to the field to consider."}
+{"text": "Background: The micro-RNA miR-30b-3p has been reported to play a crucial role in several cancers. However, the biological function of miR-30b-3p in hepatocellular carcinoma (HCC) is still unknown.Methods: RT-qPCR was employed to determine the expression of miR-30b-3p in HCC tissues and cells. The MTT assay, colony formation assay, and cell migration and invasion assay were employed to evaluate the role of miR-30b-3p in HCC cells. A dual-luciferase reporter assay was employed to verify the target of miR-30b-3p. Western blotting was employed to determine the expression of key molecular signal transducers along TRIM27-PI3K/Akt axis.Results: Expression of miR-30b-3p was markedly decreased in HCC tissues and cells and positively correlated with higher overall survival. Moreover, miR-30b-3p overexpression significantly repressed cell viability, proliferation, migration, and invasion of HCC cells in vitro. Notably, we demonstrated that miR-30b-3p directly bound to the 3\u2032-untranslated region of tripartite motif containing 27 (TRIM27) mRNA by downregulating the expression of TRIM27, which was demonstrated to be negatively correlated with miR-30b-3p expression. TRIM27 was demonstrated to have an oncogenic role in HCC cells by enhancing cell viability, proliferation, migration, and invasion. Finally, the miR-30-3p-TRIM27-PI3K/Akt axis was shown to play a crucial role in HCC cells in vitro.Conclusion: Our results indicated that miR-30-3p might act as a new biomarker for the future diagnosis and treatment HCC. Hepatocellular carcinoma (HCC) is still one of the deadliest and most prevalent human malignant cancers worldwide. According to the global cancer statistics in 2018, HCC is estimated to be the fourth major cause of cancer death and the sixth most commonly diagnosed cancer . Statistvia binding to the 3\u2032-untranslated region (UTR) of target mRNA at the post-transcriptional level (via activation of the Akt pathway (MicroRNAs (miRNAs) are a class of non-coding RNAs approximately 19-22 nucleotides in length. Recent studies reported that miRNAs regulate gene expression al level . Increasal level . It has al level . Kung etal level . In addi pathway . HoweverIn this study, we explored the expression pattern of miR-30b-3p in HCC tissues and cell lines and investigated the function of miR-30b-3p in HCC cells. Furthermore, bioinformatics analysis and dual-luciferase reporter assay were used to identify potential targets of miR-30b-3p. Moreover, we found that miR-30b-3p inhibited the proliferation and invasion of HCC cells by suppressing TRIM27 expression to inactivate the PI3K/Akt pathway.The study included 50 paired HCC tissues and their matched non-tumour tissues that were collected form Zhuji People\u2019s Hospital of Zhejiang Province between July 2014 and July 2019. The ethics committee of the Zhuji People\u2019s Hospital of Zhejiang Province approved the study (No: 20180224). The tissue samples were snap-frozen in liquid nitrogen and stored at \u221270\u00b0C before use.2.Human HCC cell lines (Huh7 and HepG2) and a human normal liver cell line (LO2) were obtained from the American Type Culture Collection. Huh7, HepG2, and LO2 cells were cultured in Dulbecco\u2019s Modified Eagle Medium  containing 10% fetal bovine serum  and cultured in an incubator maintained at 37\u00b0C with 5% COThe miR-30b-3p mimics (5\u2032-CUGGGAGGUGGAUGUUUAUUC-3\u2032) or anti-miR-30b-3p (5\u2032-GAAGUAAACAUCCACCUCCCAG-3\u2032) and their negative control  or relative plasmids were transfected into HCC cells using Fugene HD (Roche) in OPTI-MEM media .Extraction of the total RNA of HCC tumour and normal tissue samples, as well as treated and non-treated HCC cells was performed by using TRIzol reagent . Then, the concentration of extracted RNA was determined using a NanoPhotometer spectrophotometer . For cDNA synthesis, 2 \u03bcg total RNA was added as a template for reverse transcription using a TRUEscript One Step RT-PCR Kit . An ABI7500 system was employed to quantify the levels of miR-30b-3p and TRIM27 in HCC tissues and cells by using PC60-2 x SYBR Green qPCR Mix (Low ROX) . The primer sequences used were as follows: GAPDH, F: 5\u02b9- CTGGGCTACACTGAGCACC -3\u02b9, R: 5\u02b9-AAGTGGTCGTTGAGGGCAATG-3\u02b9; U6, F: 5\u02b9- TGCGGGTGCTCGCTTCGGCAGC-3\u02b9, R: 5\u02b9- -CCAGTGCAGGGTCCGAGGT -3\u02b9, RT: 5\u2032-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC -3\u2032; miR-30b-3p, F: 5\u02b9- TGCGGAGAGGTTGCCCTTGGTGA \u22123\u02b9, R: 5\u02b9- TGCGGGTGCTCGCTTCGGCAGC -3\u02b9, RT: 5\u02b9- GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACGAATTCAC-3\u02b9; TRIM27, F: 5\u02b9- TGAGCCTAACCCAGATGGAGA-3\u02b9, R: 5\u02b9- GGCCAAGTCTAGCTCCTCAAG-3\u02b9. TRIM27 mRNA level and miR-30b-3p expression levels were normalized using GAPDH and U6 as the internal control, respectively. The 2\u2212\u0394\u0394Ct method was used to quantify the transcript level of TRIM27 and miR-30b-3p.Huh7 and HepG2 cells were transfected with miR-30b-3p mimics or anti-miR-30b-3p and their respective negative controls (miR-NC mimics and anti-miR-NC) or relative plasmids for 24 h. Then, cells were seeded in 96-well plates to obtain a cell density of 3 \u00d7 103 per well. Each group contained five duplicate wells. MTT  was then added to the 96-well plates to measure cell viability at 0, 24, 48 and 72 h, respectively. The absorbance (OD570) value was measured using a Microplate reader .2) that were transfected with relative miR-30b-3p mimics or anti-miR-30b-3p and their negative controls or plasmids were seeded into 6-well plates and incubated at 37\u00b0C for 2 weeks. Then, 4% formaldehyde was used to fix for 30 min and 0.25% crystal violet was used to stain the colonies. Colonies of more than 50 cells were counted under a microscope.HCC cells .The Transwell cell migration and invasion assay was employed to assess cell migratory and invasive abilities. Cells were seed into 24-well Transwell Boyden chambers  based on the manufacturer\u2019s instructions. Briefly, for the Transwell cell migration assay, 5 \u00d7 104) were transferred to 24-well plates and cultured for 24 h. The cells were then co-transfected with pRL-TK plasmid, pmir-luc-TRIM27-3\u2032-UTR, or pmir-luc-TRIM27-3\u2032-UTR mut plus miR-30b-3p mimics or inhibitors, and their corresponding negative controls. The luciferase reporter assay kit (Promega) was used to measure luciferase activity.Cells  containing protease inhibitor cocktail (Roche) was used to extract the protein from the harvested cells. Then, the protein samples were loaded onto 10% SDS-PAGE gels and transferred onto PVDF membranes . After blocking with 5% BSA, the PVDF membranes were incubated with primary antibodies overnight at 4\u00b0C and probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 2 h at room temperature. Thereafter, enhanced chemiluminescence (ECL)  was used to detect the protein bands. The following antibodies were included: GAPDH ; TRIM27 ; Akt ; p-Akt ; Goat Anti-mouse IgG H&L (HRP)  and Goat Anti-Rabbit IgG H&L (HRP) secondary antibody .2O2. Subsequently, the slides were incubated overnight at 4\u00b0C with antibodies against p-Akt . Slides were then incubated with Goat Anti-mouse IgG H&L secondary antibody coupled with biotin at room temperature for 15 min. Subsequently, the streptavidin-biotin complex and DAB were added to the slides. Finally, hematoxylin was used to counterstain the slides.Immunohistochemistry (IHC) was performed according to a previously reported method . Brieflyt test and ANOVA (with a Bonferroni post hoc test) were used to compare the mean values between the two groups and the mean values greater than or equal to three groups. Differences were considered statistically significant at P < 0.05.All experiments were repeated at least three times for statistical analyses. Data are presented as the mean \u00b1 SD. Student\u2019s http://kmplot.com/analysis/). As shown in To investigate the role miR-30b-3p in HCC, we first measured the expression of miR-30b-3p in HCC tumor tissues and cell lines by RT-qPCR. The results showed that miR-30b-3p was downregulated markedly in HCC tumour tissues compared with matched non-carcinoma tissues  mRNA has specific binding sites for miR-30b-3p seed sequences, indicating that TRIM27 might be a potential target of miR-30b-3p (To determine whether miR-30b-3p could affect HCC cell proliferation, migration, and invasion through inhibition of TRIM27 expression, we performed rescue experiments. Results of the MTT assay, colony formation assay, and Transwell migration and invasion assay revealed that HCC cells co-transfected with miR-30b-3p mimics plus a TRIM27 overexpression vector showed higher cell viability, a higher colony formation rate and greater Transwell migration and invasion ability, compared with the group co-transfected with miR-30b-3p mimics plus empty vector, indicating that the suppressive role of miR-30b-3p overexpression on the malignant phenotypes of HCC cells was partly counteracted by TRIM27 overexpression (Previous studies reported that TRIM27 functioned in an oncogenic role in colorectal cancer  and ovarIt was reported that TRIM27 promoted EMT through activation of p-Akt in colorectal cancer . The PI3An increasing number of studies have unveiled the crucial role of miRNAs in many human diseases, from cardiovascular diseases to cancers . EvidencHerein, we first demonstrated that miR-30b-3p repressed HCC cell proliferation, migration, and invasion in HCC cells. Further, we also uncovered the possible mechanism of miR-30b-3p in HCC cells. As we know, miRNAs usually performed their functions by binding to the 3\u2032-UTR of target genes. To verify the putative targets of miR-30b-3p, we performed the online bioinformatics software TargetScan Human 7.2 and dual-luciferase reporter assay and demonstrated that miR-30b-3p could directly target TRIM27, which has been further verified to be upregulated in 50 HCC tissues compared with that in their adjacent noncancerous tissues and negatively correlated with the levels of miR-30b-3p, suggesting that miR-30b-3p could inhibit HCC cell proliferation, migration, and invasion by downregulating TRIM27.TRIM27 was first characterised as an oncogene involved in activation of the RET proto-oncogene by DNA rearrangement . PreviouOur study demonstrated that miR-30b-3p was downregulated in HCC tissues and miR-30b-3p repressed HCC cell proliferation, migration, and invasion in HCC cells by repressing TRIM27/PI3K/Akt signaling. Our findings provide a potential diagnostic and therapeutic target for HCC treatment.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.The studies involving human participants were reviewed and approved by the Institutional Ethics Committee of Zhuji People\u2019s Hospital of Zhejiang Province. The patients/participants provided their written informed consent to participate in this study.DG designed the research, performed the experiments, and wrote the manuscript. ZZ and HH were responsible for data collection and statistical analysis.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Esophageal cancer is one of the most deadly malignant tumors. Among the common malignant tumors in the world, esophageal cancer is ranked seventh, which has a high mortality rate. Long noncoding RNAs (lncRNAs) play an important role in the occurrence and development of various tumors. lncRNAs can competitively bind microRNAs (miRNAs) with mRNA, which can regulate the expression level of the encoded gene at the posttranscriptional level. This regulatory mechanism is called the competitive endogenous RNA (ceRNA) hypothesis, and ceRNA has important research value in tumor-related research. However, the regulation of lncRNAs is less studied in the study of esophageal cancer.  The Cancer Genome Atlas (TCGA) database was used to download transcriptome profiling data of esophageal cancer. Gene expression quantification data contains 160 cancer samples and 11 normal samples. These data were used to identify differentially expressed lncRNAs and mRNAs. miRNA expression data includes 185 cancer samples and 13 normal samples. The differentially expressed RNAs were identified using the edgeR package in R software. Then, the miRcode database was used to predict miRNAs that bind to lncRNAs. MiRTarBase, miRDB, and TargetScan databases were used to predict the target genes of miRNAs. Cytoscape software was used to draw ceRNA network. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed using DAVID 6.8. Finally, multifactor cox regression was used to screen lncRNAs related to prognosis.  We have screened 1331 DElncRNAs, 3193 DEmRNAs, and 162 DEmiRNAs. Among them, the ceRNA network contains 111 lncRNAs, 11 miRNAs, and 63 DEmRNAs. Finally, we established a prediction model containing three lncRNAs through multifactor Cox regression analysis.  Our research screened out three independent prognostic lncRNAs from the ceRNA network and constructed a risk assessment model. This is helpful to understand the regulatory role of lncRNAs in esophageal cancer. Esophageal cancer (EC) is one of the most deadly malignant tumors. Among the common malignant tumors in the world, EC is ranked seventh, which has a high mortality rate . There aLong noncoding RNA (lncRNA) is defined as RNA transcripts with more than 200\u2009nt and no coding ability . There ilncRNAs can regulate tumor genesis in many ways. When located in the nucleus, they are mainly involved in the process of transcription and epigenetics. When located in the cytoplasm, they participate in posttranscriptional regulation mainly by forming specific protein complexes or as ceRNA . In 2011In our study, the expression data of lncRNAs, miRNAs, and mRNAs related to EC samples and normal samples came from TCGA database. The differentially expressed RNAs were selected. Subsequently, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were used to reveal the potential biological mechanisms of differentially expressed mRNAs. Then, we successfully constructed an lncRNA-related ceRNA network in EC after differential expression analysis and database comparison. Finally, univariate and multivariate COX regressions were used to find lncRNAs related to prognosis. Our research has found lncRNAs related to the prognosis of EC. These lncRNAs may become markers of EC prognosis.https://cancergenome.nih.gov/). RNA-seq data contains 160 cancer samples and 11 normal samples. These data were used to identify differentially expressed lncRNAs and mRNAs. MicroRNA data includes 185 cancer samples and 13 normal samples. Perl  was used for data processing. Ensemble database  was used for gene annotations and identification of lncRNAs and mRNAs. RNAs that have not been annotated by the database were excluded. Our research was conducted in accordance with TCGA publication guidelines. Therefore, the approval from the local ethics committee was not required.RNA-seq data, microRNA data, and the clinical data of EC were downloaded from The Cancer Genome Atlas (TCGA) database  . \u2223log2\u2009fhttps://david.ncifcrf.gov) was used for Gene Ontology (GO) enrichment analysis and Kyoto Gene and Genome Encyclopedia (KEGG) signal pathway analysis based on DEmRNAs. GO enrichment analysis can classify and annotate genes through three aspects: biological path (BP), cellular component (CC), and molecular function (MF). The KEGG signaling pathway was used to find important signaling pathways.DAVID 6.8 (http://www.mircode.org/) was used to predict miRNAs that bind to lncRNAs. MiRTarBase (http://mirtarbase.cuhk.edu.cn/), miRDB (http://www.mirdb.org/), and TargetScan (http://www.targetscan.org/) databases were used to predict the target genes of miRNAs [The miRcode database (f miRNAs \u201323. The https://string-db.org) database was used to construct a protein interaction network for differential genes in the ceRNA network, and the medium credibility (interaction score > 0.4) was the screening criterion [The STRING  . AIC is a standard used to measure the goodness of a statistical model. It is generally considered that the model with the smaller AIC value is the optimal model. The model expression formula is as follows:The \u201csurvival\u201d package in R software was used for survival analysis of DElncRNAs in the ceRNA network. The Kaplan-Meier method was used to draw survival curves, and the log-rank test was used to compare the differences between the two groups. \u201cCoe\u201d represents the regression coefficient of the multiple COX regression model, and \u201cExp\u201d represents the expression level of lncRNAs.According to the median value of risk score, EC patients were divided into high- and low-risk groups. Kaplan-Meier analysis was used to compare the overall survival rates of the two groups. The \u201ctimeROC\u201d package was used to plot the time-dependent receiver operating characteristic (ROC) curve, which can evaluate the value of the model prediction.The differentially expressed RNAs were identified by using the edgeR package in R software. \u2223log2\u2009fold\u2009change\u2009(FC) | >1 and false discovery rate\u2009(FDR) < 0.05 were the screening condition for differential RNAs. 1331 DElncRNAs (648 downregulated and 683 upregulated) and 3193 DEmRNAs (1753 downregulated and 1440 upregulated) were screened out of 160 EC samples and 11 normal samples. 162 DEmiRNAs (64 downregulated and 98 upregulated) were screened out of 185 cancer samples and 13 normal samples. The heat map of differential RNAs is displayed see . The volhttps://david.ncifcrf.gov) was used for Gene Ontology (GO) enrichment analysis and Kyoto Gene and Genome Encyclopedia (KEGG) signal pathway analysis based on DEmRNAs. GO enrichment analysis can classify and annotate genes through three aspects: biological path (BP), cellular component (CC), and molecular function (MF). Upregulated mRNAs were classified as 47 biological process (BP) terms, 20 cellular component (CC) terms, and 8 molecular function (MF) terms using GO enrichment analysis. Downregulated mRNAs were classified as 10 biological process (BP) terms, 12 cellular component (CC) terms, and 5 molecular function (MF) terms using GO enrichment analysis. The results of partial GO enrichment are displayed  was used to predict miRNAs that bind to lncRNAs. The Perl language was used to extract DElncRNAs and miRNAs combined with DElncRNAs in the miRcode database. Then, the DEmiRNAs and the miRNAs extracted from the miRcode database were intersected to obtain the miRNAs in the ceRNA network. The lncRNAs targeted by these miRNAs were the lncRNAs in the ceRNA. MiRTarBase, miRDB, and TargetScan databases were used to predict the target genes of miRNAs in the ceRNA network. After these target genes intersect with DEmRNAs, they were the mRNAs in the ceRNA network. In the end, 111 lncRNAs (62 downregulated and 49 upregulated), 11 miRNAs (8 downregulated and 3 upregulated), and 63 mRNAs (33 downregulated and 30 upregulated) were included in the ceRNA network. The lncRNAs, miRNAs, and mRNAs in the ceRNA network are displayed  was used to construct a protein interaction network of differential genes. Medium credibility (interaction score > 0.4) was used as the screening criterion, loose links and outliers were removed, and the PPI network was drawn. Cytoscape was used for PPI network visualization. The PPI network is displayed  database . The calibration curve was used to test the consistency between the model's predicted mortality rate and the actual mortality rate. The calibration curves of the 3-year overall survival rate  is one of the most deadly malignant tumors. The five-year survival rate of EC is only 15%-25% \u20136. TherelncRNAs can regulate the occurrence of diseases in a variety of ways. Existing studies have shown that lncRNAs can interact with epigenetics to regulate disease processes in the nucleus; these interactions include the interaction between lncRNAs and DNA methylation . lncRNAs\u03b2-catenin signaling pathway to promote HCC progression through the DSCR8/miR-485-5p/FZD7 axis [\u03b2-catenin pathway [More and more evidence has shown that lncRNAs participate in the regulation of EC through the ceRNA network mechanism. lncRNA MALAT1 can regulate miR-101 and miR-207 to affect the proliferation, invasion, and metastasis of ESCC cells . SNHG16,ZD7 axis . SimilarZD7 axis . In our ZD7 axis . LINC003 pathway . HoweverSubsequently, we constructed a prognostic model of EC through univariate and multivariate cox regression models. Three lncRNAs were included in the model. The prognostic model constructed by these three lncRNAs showed good predictive ability.Our research is based on TCGA database to screen differentially expressed lncRNAs, miRNAs, and mRNAs in esophageal cancer. Then, the ceRNA network containing lncRNAs was constructed, which was used to find seven lncRNAs that related to the prognosis of esophageal cancer. Finally, a prognostic model of esophageal cancer containing three lncRNAs was constructed. These lncRNAs may be used as prognostic markers of esophageal cancer. In conclusion, our research will provide new insights into the regulation of lncRNAs in esophageal cancer."}
+{"text": "Coronavirus disease (COVID-19) has expanded around the world, resulting in a pandemic with high morbidity and mortality. To date, no specific treatment or vaccine is available to treat or prevent this sudden and potentially deadly disease. Economic restructuring brings opportunities and challenges to integrative medicine treatment. In such complex situations, integrative medicine treatments are to be provided cautiously, and the shift from in-person visits to remote medical services might play an important role in how such services are delivered. Studies have indicated that its pathogens spread through populations by transmission through respiratory droplets, contact, and natural aerosols.2 Fever, tiredness, and dry cough are the most common signs and symptoms of patients with COVID-19, 25.9% of them will develop serious pneumonia requiring intensive care unit (ICU) admission and 20.1% may develop acute respiratory distress syndrome.3 Due to alarming levels of spread, and severity, the coronavirus outbreak has been declared as a global pandemic by the WHO on March 11, 2020.4 As of June 3, 2020, the virus has spread to 216 countries, areas, and territories, and 6,272,098 confirmed cases and 379,044 confirmed deaths have been reported to the WHO.5A 6 Given previous experience of management of Middle East Respiratory Syndrome Coronavirus and SARS-CoV, the WHO released infection control interventions recommendations to decrease the general risk of pathogen infection or transmission including wearing facial masks, regular hand cleaning, 6 feet social distance, and stay home policy. Furthermore, health care facilities should improve infection prevention and control practices in clinics and hospitals.3Patients with COVID-19 have been found to have higher transmissibility and greater pandemic risk than SARS-CoV.7 Remdesivir is only mentioned as 1 investigational therapy through either compassionate drug use or ongoing clinical trial.8 Currently, diagnosis and treatment protocols are developed based on patients from China and other countries around the world to better define this pandemic. Chinese National Health Commission & State Administration of Traditional Chinese Medicine has published the seventh-version Guideline of \u201cThe Chinese Clinical Guidance for COVID-19 Pneumonia Diagnosis and Treatment,\u201d which is widely used in clinical practice in China.9 The U.S. Centers for Disease Control and Prevention (CDC) published Interim Guidance on Management of COVID-19 to implement aggressive measures to stop the virus spreading in the United States.10 Since at the present time there is no vaccine available, the best way to prevent the spread of COVID-19 infection is to avoid being exposed to the virus. Sufficient medical quarantine to reduce exposure and limit transmission to others is a critical first step of COVID-19 prevention and control. Suspected patients need to be quarantined, confirmed patients are transferred to the same general ward, and severe cases should be admitted to the ICU as soon as possible.At present, except for supportive care, for example, oxygen therapy, mechanical ventilation, and fluid management, there are no clear or convincing evidence-based interventions known to be of benefit for COVID-19 patients.11Increasing social isolation and loneliness due to widespread outbreak of COVID-19 is inevitable strongly associated with public panic and adverse mental health consequences of psychologic distress and symptoms of mental illness such as anxiety, sadness, stress, depression, self-harm, and even suicide attempts, especially among vulnerable populations and health care workers.12Most COVID-19 patients initially suffer from fever, cough, dyspnea, anxiety, stress, and other symptoms including musculoskeletal pain, nausea, and diarrhea for which patients may first seek help using integrative medicine treatments. These can include diverse therapies such as herbal therapy, acupuncture, massage, mind\u2013body practice, and others. Many of these modalities require face-to-face contact and, therefore, the outbreak of COVID-19 has also posed a great challenge to the clinical practice of integrative medicine therapies.14 Fourteen patients with influenza A/H1N1 flu were reportedly cured with integrative treatment of Chinese herbal remedies in Beijing Ditan Hospital and Chengdu Infectious Diseases Hospital, China.13 Approximately 40%\u201360% of hospitalized SARS patients received an integrated approach of modern and Chinese herbs. Positive effects of Chinese herbal therapy as an adjuvant showed improvement of fever, chest infection, less steroids consumption, and immunologic boosters.14 Chinese National Health Commission & State Administration of Traditional Chinese Medicine released guidelines regarding systemic treatment with Chinese herbal remedies for COVID-19 patients in different stages. For example, in the seventh editions of Guidelines of Traditional Chinese Medicine treatment, Chinese herbal remedy Huoxiang Zhengqi capsule is advised for fatigue and gastrointestinal discomfort; Jinhua Qinggan granules, Shufeng Jiedu capsules, Lianhua Qingwen capsules, and Fangfeng Tongsheng pills for fatigue and fever of suspected patients; lung cleansing and detoxifying decoction and other herbal decoctions are recommended to confirmed cases; Xiyanping and other Chinese medicine injections are applied on severe and critical cases; and it seems that Chinese herbs may have positive effects on major symptoms such as fever, cough, and promote recovery. Further laboratory research and clinical trials with regard to the efficacy and safety of wide application of these herbal remedies on COVID-19 patients are urgently needed15\u201317  with a higher recovery rate and lower medical cost in China.ded15\u201317 .19 Mind\u2013body therapies could guide patients to nonpharmacologic approaches to manage their emotions and discomfort. Being simple and useful home-based workouts, Ayurveda, Yoga, Tai chi, or meditation have already played a major role in the prevention and postrecovery management of COVID-19.21 Remote instructions could be offered by health care providers even under a stay-at-home order. And the efficacy and safety of these modalities used in the treatment of emerging coronavirus infections will need to be evaluated in future studies.Psychologic factors are an essential component in the success of public health strategies used for the management of epidemics and pandemics. Studies indicate that subsyndromal psychiatric disorders such as anxiety, distress, and fear are a common response to the COVID-19 pandemic, particularly in the unemployed or vulnerable population, which potentially impact on the ongoing efforts of public communication, hygiene practices, social distancing, vaccination, and antiviral therapy. People with mental anxiety may engage in a variety of maladaptive safety behaviors, which includes compulsive hand washing, panic buying, and social isolation.Tuina, traditional physical exercise, and foot bath fumigation. Acupuncture with different acupoints combination for suspected, confirmed, and recovery of COVID-19 patients is recommended separately.22 Acupuncture-related therapies such as bloodletting of auricular and hand points for confirmed patients with repeated fever and moxibustion exerted for 10 to 15 minutes at each point for patients in recovery stage as well as other interventions such as scraping, point injection, Tuina and others are recommended. Self-interventions are advised to apply at home under the instruction of a physician.23 An exploratory study focused on acupuncture treatment in COVID-19 patients reported that Dr. Zhou, a critical care medical expert who supported Wuhan Leishenshan hospital, applied acupuncture on COVID-19 confirmed patients for shortness of breath, cough, dizziness, insomnia, restlessness, palpitations, diarrhea, and vomiting. In addition, Dr. Liu, a Traditional Chinese Medicine expert who also treated COVID-19\u2013infected patients in Wuhan with acupuncture, summarized that acupuncture could have positive effects in improving chest congestion, shortness of breath, abdominal discomfort, itchy throat, cough, dizziness, pain, and sweating.24China Association of Acupuncture-Moxibustion published \u201cGuidance for acupuncture and moxibustion interventions on COVID-19 (Second edition),\u201d which highlights the beneficial effects of Traditional Chinese Medicine interventions including acupuncture and other related therapies such as moxibustion, 25; and protecting the medical workforce is a critical challenge. During these pandemic outbreaks, severe health care provider infections and deaths have already been reported, making the staff vulnerable to significant psychosocial stress.27Acupuncture manipulated by licensed acupuncturists involves the insertion of metal needles and heat or cold stimulation into the precise acupoints on human bodies. Acupuncturists are at high risk of getting infected when they closely examine the patient and do acupuncture manipulations; personal protective equipment (PPE) is needed if they operate these treatments; however, a critical shortage of PPE has already posed a major risk of COVID-19 being spreadMoreover, it is very inconvenient to do the manipulations wearing triple layer protective gloves either. During the treatment, if medical provider's hand hygiene, PPE, or other infection prevention and control measures are not in place, they are at great risk of infection and possibly become the virus carriers to the other patients, family members, and the community.Possibly due to the mentioned limitations, during an acute COVID-19 outbreak, acupuncture-related in-person therapies should be cautiously performed since the high risk of possible virus spreading is much greater than any possible benefit. Possibly due to the mentioned limitations, related therapies, acupuncture-related therapies, which require in-person visits were not included in the diagnosis and treatment protocols as one of the first-line treatment options for COVID-19 published either by Chinese National Health Commission & State Administration of Traditional Chinese Medicine or by the U.S. CDC.Timely treatment and prevention of COVID-19 are paramount for public health and the well-being, whereas the economic impact on the society is another issue we should think about the fact that economic recession itself has a negative effect on health. To prevent the pandemic spread, expand health capacity to care, and to conserve adequate medical staff and supplies for COVID-19 patients, especially PPE, nonemergent, elective medical services, and treatment are limited, many economic policy tools have also been used for a response to the support of social distancing and hygiene. Therefore, in the United States, integrative medicine as a supplementary of conventional medicine is suspended or shut down in response to CDC guidelines, which resulted in an urgent shift from the traditional in-person service model to remote health care.28 Unemployment could influence both the physical and mental health, which might aggravate the negative consequences of the pandemic in a vicious circle. It is a great challenge to reopen some economies around the world. At present, in some areas with a low, or relatively low and stable incidence of COVID-19, medical facilities have allowed the flexibility to provide care for patients needing nonemergent non-COVID-19 health care.The continuing COVID-19 pandemic almost affects economic activities in every country on this planet. The global economy is in the deepest contraction since the great depression, a reduction in economic activity reduces the circulation of money, which results in a heavy hit to the middle-class people, salaried people, organized sector, etc.Economic recovery under COVID-19 is definitely a double-edged sword, by reopening the economy there is a potential risking of a second wave. Economic restructuring brings opportunities and challenges to integrative medicine treatments. In such a complex situation, integrated medicine treatments need to be cautiously provided with the premise of safety. The health care providers should weigh their own risk and comfort level when deciding whether to continue providing in-person integrative medicine services. No in-person visit is risk free, even if both patient and practitioner appear well. To prevent the spread of COVID-19, in-person integrative medicine appointment should be limited to patients with a clear and documentable urgent medical need. Further suggested safety recommendations during this pandemic include: prescreening each patient by phone before the consultation; staggering appointments so that patients do not overlap; adequate disinfection of any surfaces that may have been contacted, removing or recycling any nonessential items which could be a vector for virus transmission in the healthcare setting. With the adoption of telehealth medical care can safely be provided to patients in appropriate situations. The shift from in-person appointments to remote medical services might play a new important role in the future.The global pandemic of COVID-19 has become a public health emergency to the general public and health care providers. Our understanding of this sudden and lethal virus is still very limited. Safe effective antiviral medication and vaccine are still not available, the only thing we can do at this point is aggressively implement appropriate infection prevention and control measures to curb the spread of this virus transmission. Economic restructuring brings opportunities and challenges to integrative medicine treatment. Integrative medicine treatments are to be provided cautiously, and the shift from in-person visits to remote medical services might play a new important role in the coming medical services."}
+{"text": "Transitioning from hospital to home is an important healthcare system priority. This paper reports on the qualitative findings from a larger mixed methods study designed to examine the implementation and effectiveness of a new transitional care intervention (Community Assets Supporting Transitions [CAST]). The goal of the CAST intervention is to improve the quality and experience of hospital-to-home transitions for older adults (\u2265 65 years) with depressive symptoms and multimorbidity. Semi-structured interviews were completed with a sub-set of intervention group trial participants including 11 older adult participants and 1 caregiver, as well as 4 intervention nurses. A qualitative descriptive design was used to explore the perceived impacts of the CAST intervention on participants and their caregivers. Audio-recorded interviews were transcribed verbatim, with descriptive codes and themes generated using conventional content analysis. Patient participants indicated that the intervention resulted in improved access to information  and services  that enhanced their self-management. Participants felt that the home visits and phone visits were valuable and helped to improve their mental health. Intervention nurses described advocating for patients to help achieve their needs. For example, nurses advocated for physiotherapy services to provide additional education to support patient mobility. Understanding patient, caregiver, and provider perceptions of the impact of the CAST intervention will help to identify how to improve the delivery of this transitional care intervention, to bridge the gap between hospital and community care, and to positively impact patient health outcomes."}
+{"text": "We built a virtual reality (VR) application that runs on a commercially available standalone VR headset that allows patients to view a virtual simulation of themselves receiving radiotherapy. The purpose of this study was to determine if this experience can improve patient understanding of radiotherapy and/or reduce patient anxiety. We created software that reads data from our clinical treatment planning system and renders the plan on a life-size \u201cvirtual linear accelerator.\u201d The patient\u2019s CT simulation data is converted into a 3D translucent virtual human shown lying on the treatment table while visible yellow radiation beams are delivered to the target volumes in the patient. We conducted a prospective study to determine if showing patients their radiotherapy plan in VR improves patient education and/or reduces anxiety about treatment. A total of 43 patients were enrolled. The most common plans were 3D breast tangents and intensity-modulated radiotherapy prostate plans. Patients were administered pre- and post-experience questionnaires. Thirty-two patients (74%) indicated that they \u201cstrongly agree\u201d that the VR session gave them a better understanding of how radiotherapy will be used to treat their cancer. Of the 21 patients who expressed any anxiety about radiotherapy beforehand, 12 (57%) said that the VR session helped decrease their anxiety about undergoing radiotherapy. In our single-institution, single-arm prospective patient study, we found that the majority of patients reported that the personalized VR experience was educational and can reduce anxiety. VR technology has potential to be a powerful adjunctive educational tool for cancer patients about to undergo radiotherapy.The online version of this article (10.1007/s13187-020-01870-7) contains supplementary material, which is available to authorized users. Many cancer patients undergo radiotherapy as part of their treatment, a process which can be physically and psychologically demanding . Cancer Illustrating the objectives of radiotherapy and the process that takes place during treatment is difficult with existing visualization techniques . The goaVirtual and augmented reality technology can be more effective at conveying information that requires a three-dimensional understanding of an environment. This novel VR technology is starting to be used in various fields in medicine , includiThis VR technology is well suited for multiple applications in the field of radiation oncology, since the process of designing, planning, and delivering radiotherapy requires a detailed knowledge of 3D spatial relationships between radiation beams and tumor size and location and normal human anatomy. Others have shown that VR has great potential for use by radiation oncologists, medical dosimetrists, and medical physicists, for designing and planning radiotherapy plans .The purpose of this study was to determine if virtual reality technology can enhance education for cancer patients undergoing radiation therapy to improve their understanding of how radiotherapy will be used to treat their cancer. We sought to determine if a VR experience prior to starting radiotherapy could help them prepare in advance for what they will experience when receiving daily radiotherapy and potentially alleviate anxiety they may have regarding undergoing this treatment. We built an application that will allow patients to view an educational virtual reality (VR) experience showing the delivery of their radiotherapy treatment plan. With this system, a patient can get a preview of what it will be like before they begin their radiotherapy. The unique aspect of our approach is that the experience is personalized for each patient, allowing them to view a rendition of their own radiotherapy treatment in VR, and not just a generic treatment plan. We hypothesized that this VR educational tool will improve the patient\u2019s understanding of their radiotherapy treatment, improve physician-patient communication, decrease their anxiety level about undergoing radiotherapy, and improve overall patient satisfaction with their cancer care.We designed and built a novel virtual reality app that runs on the Oculus Quest , a commeSince the radiotherapy experience varies widely for each patient depending upon the type of radiotherapy plan, this program shows the patient the specific treatment they will be receiving to allow them to get a more realistic advance preview of what will be happening in the vault before their first day of treatment. When the patient dons the headset, they will feel as if they are actually in a radiotherapy treatment vault with a life-sized linear accelerator. Because the headset is untethered and uses room-scale VR, the user can walk around and view the radiotherapy treatment delivery from any perspective in the room. A full-scale 3D rendering of the relevant part of the patient\u2019s body is shown in position on the treatment table with a translucent body contour so that the target volume and internal normal organs can be seen. This allows the patient to see how the radiation beams are shaped and targeted specifically to the size, shape, and location of their tumor(s), conforming to the target volume of interest while avoiding adjacent normal structures in their body.We conducted a single-arm, single-institution prospective clinical trial to determine if showing patients a VR rendition of their RT treatment plan would improve understanding of their radiotherapy plan, improve physician-patient communication, or decrease anxiety about radiotherapy. This study was approved by our hospital\u2019s Institutional Review Board.Patients were recruited for participation via a research flyer from a single radiation oncology clinic. Patients over age 18 planning to receive radiotherapy were eligible candidates for this study. Patients were excluded if they had vision or hearing impairment or if they had a known history of vertigo, motion sickness, or vergence-accommodation conflict associated with 3D media headsets.Study patients participated in one research session which lasted about 30\u00a0min. The research session was usually scheduled about 1 to 2\u00a0days prior to the patient\u2019s radiotherapy treatment start date. The patient\u2019s treatment plan was loaded into the VR headset. A separate 2D monitor that mirrored the headset view was available in the room for family members and research staff to view what the patient was seeing in real time. The patient\u2019s treating radiation oncologist was present during the viewing to narrate and explain details to the patient in real time during the experience. Since the Oculus Quest is a standalone room-scale VR headset, ambulatory patients were encouraged to walk around the room to view the scene from different angles, and they could get up close to the treatment table to see details inside their translucent body while the yellow radiotherapy beams were being delivered. Patients with balance or mobility issues that were deemed a fall risk were asked to remain seated in a chair, and the research staff helped move the chair around so the patient could view the virtual scene from different vantage points around the room.t test and the Wilcoxon Rank Sum test were used to test statistical significance of differences for each question.We designed a questionnaire to ascertain each patient\u2019s current knowledge about their cancer, their understanding of how radiotherapy treatment works, and their anxiety level regarding the prospect of undergoing radiotherapy Table . We usedFrom September 2019 through March 2020, a total of 43 participants completed this study. Table t test and the Wilcoxon Rank Sum test showed statistically significant differences between the pre- and post-questionnaires for all questions.Table A total of 40 participants (93%) indicated that they \u201cagree\u201d or \u201cstrongly agree\u201d that the VR session gave them a better understanding of how radiotherapy will be used to treat their cancer. Of the 21 patients who expressed any anxiety about radiotherapy beforehand, 12 (57%) said the VR session helped decrease their anxiety about undergoing radiotherapy.After the VR session, 41 participants (95%) stated \u201cagree\u201d or \u201cstrongly agree\u201d that they had a good understanding of how they would feel when lying on the treatment table, compared with only 22 (51%) before the session.The number of participants indicating that they understood why radiation might cause them side effects increased from 33 (77%) to 40 (93%) after the VR session.After the VR educational session, more participants expressed an understanding of the size (42) and location (43) of their cancer compared with before the session .A diverging stacked bar graph comparing the pre- and post-survey results for each question is available in the There are several unique advantages of our approach.Unlike watching a traditional flat screen wearing 3D glasses \u20139, 23\u201326A unique feature of our approach is that we showed each patient their own actual radiotherapy plan, not a generic plan. This enables patients to personally identify with what they are seeing in the virtual treatment room. It allows them to see how the radiation beams are tailored to exactly conform to the size and shape of their own cancer and minimize exposure to their adjacent normal organs. We found that patients became more fully engaged when they realized they were actually seeing a life-sized virtual rendition of themselves on the treatment table and could see how the radiation plan was customized for them. Many patients commented on the size and location of their tumors when seeing this for the first time. We wrote custom software that takes a standard DICOM-RT export from our clinical treatment planning system and converts it into a format compatible with the VR headset. Our software automates the process of conversion and import so we were able to load the VR headset with patient-specific radiotherapy plans very quickly, allowing us to easily conduct multiple educational sessions in 1\u00a0day.Watching a virtual rendition of the radiotherapy process often triggered patients to think of additional questions to ask the staff. We found that the clinician narrator played an important role in explaining to the patient what they were seeing, such as how much dose is actually being received to adjacent organs at risk. Often, the clinician encouraged the patient to walk to a different vantage point to see from a different perspective or to approach closer to see small details such as the separation between beam edge and the heart, or the small amount of anterior rectal wall included in an IMRT beam arc. We found that the VR sessions improved communication by providing another valuable opportunity for additional dialog between physician and patient.Many platforms for virtual and augmented reality are currently commercially available, including Oculus Quest, Oculus Rift, Oculus Go, HTC Vive, and Windows Mixed Reality. For our research study, we selected the Oculus Quest because it is a standalone system, easily portable to any room, and uses room-scale VR, which allows the patient to walk around the virtual vault to see the ongoing treatment from any vantage point. Our system can be easily ported to other VR devices that use the Unity platform, such as the Oculus Rift or the HTC Vive.This study has several limitations.This was a small study that enrolled a limited number of patients from a single radiation oncology clinic.In the design of our study, we elected to have only a single intervention group and did not enroll a separate control group since this was a preliminary proof-of-concept study. Also, rather than restricting enrollment to just one cancer type, we decided to allow all disease sites in order to test out feasibility with a wide variety of radiotherapy plans. Consequently, it may be more difficult to draw generalizable conclusions from our results given the disparate cancer types studied. However, in our ad hoc subset analyses, there was no significant difference in understanding improvement or anxiety decrease when comparing by disease site  or radiotherapy plan type .We only administered the post-intervention survey at one time point\u2014immediately following the VR experience. Another option would be to survey patients repeatedly at multiple time points during and after their radiotherapy course to determine if this VR experience results in a more durable improvement over time compared with traditional patient education methods.At the start of the COVID-19 pandemic, our research project was temporarily paused as our hospital worked on establishing new guidelines for patient and visitor restrictions and sanitizing standards. In the next phase of this research project, the VR headsets will be cleaned and sanitized between patients using the new standards established at our hospital for cleaning hospital equipment for the COVID-19 era. In addition to standard face masks required for all patients entering our facility, patients will also wear single-use disposable VR face covers before putting on the VR headset. We use an untethered type of VR headset that uses a room-scale tracking design so that these educational sessions can be conducted in a large room allowing research staff and patients to remain 6\u00a0ft apart at all times.In our post-intervention survey, 30 (70%) participants stated that they would be very interested in having a downloadable version of this experience on their mobile device so that they could take it home and watch it again or show family and friends. We have created an augmented reality (AR) version that runs on iOS mobile platforms and have plans to introduce this alternate platform in our next clinical patient trial. This augmented reality version will allow the user to walk around the room with the mobile device and see a \u201cwindow\u201d into the life-sized 3D virtual radiotherapy treatment room and see the radiation being administered to their virtual body on the table. The advantage of this approach is that it does not require the use of a specialized VR headset and can be viewed on the patient\u2019s own mobile device such as an iPhone or an iPad, and patients would be able to download and keep a copy on their own mobile device to view again later or to show family and friends.In the future, we plan to conduct a larger study and include multiple institutions to assess the generalizability of this personalized VR approach to patient education. We also plan to measure whether this VR educational experience improves patient compliance during treatment  and poteIn conclusion, we have designed and built an application to render a 3D simulation of a patient\u2019s clinical radiotherapy treatment plan in a commercially available standalone virtual reality headset. This tool can be used to augment patient education for those about to start radiotherapy treatment. Our preliminary clinical patient trial demonstrates that this VR experience gives many patients a better understanding of how radiotherapy will be used to treat their cancer, and it can decrease their anxiety about undergoing radiotherapy treatment.ESM 1(DOCX 220\u00a0kb)"}
+{"text": "Do-It-Yourself) approach to data acquisition can reduce the cost of these environmental studies. In this paper, a low-cost DIY wireless wind data acquisition system is presented which reduces the cost barrier inherent to these types of studies. The system is deployed for the analysis of the foredune of Maspalomas, an arid dune field situated on the south coast of Gran Canaria , for the specific purpose of studying the dynamics of a dune type (tongue dunes), which is typical of this environment. The results obtained can be of interest for the study of these coastal environments at both the local level, for the management of this particular dune field, and at the general level for other similar dune fields around the world.Environmental studies on coastal dune systems are faced with a considerable cost barrier due to the cost of the instrumentation and sensory equipment required for data collection. These systems play an important role in coastal areas as a protection against erosion and as providers of stability to coastal sedimentary deposits. The DIY ( In recent decades, important environmental changes induced by human activities have been detected in coastal dune systems around the world, resulting in their degradation and, in some cases, their total destruction ,2. HowevDo-It-Yourself) sensors and instruments for wind data acquisition (speed and direction) in a coastal arid foredune system, and compare it with other approaches described in Data acquisition in extensive natural environments, as is the case of foredune systems, can be an expensive process due to the generally high cost of commercial instruments and sensors with an adequate spatial and temporal resolution. Hence, the main objective of this study is to present and use a set of affordable, low-cost DIY (Integrated Development Environment), based on C/C++, specifically designed for newbie programmers and electronic tinkering beginners. These platforms can also be easily integrated with all kinds of hardware, from sensors and actuators to communication hardware interfaces including serial buses  ases . In a more general sense, the DIY approach, with its open hardware and software nature, has the obvious advantage of a lower monetary cost compared to more expensive commercial instrumentation. At the same time, however, although they are free to use and modify, open hardware/software tools and libraries come with no guarantee or user support, and so DIY researchers need to invest time and effort to acquire enough knowledge and know-how to ensure their correct operation and behavior. Likewise, such tools and libraries are usually supplied with licenses, such as GPL and LGPL, which can be seen as restrictive in terms of commercial use . Even soEnvironmental monitoring is a field where the application of DIY approaches is particularly cost-effective, as it is usually necessary to deploy many sensor devices to adequately cover the area under study. In this context, the use of commercial devices is only affordable for research groups and institutions with substantial budgets, especially when many of them need to be deployed. There are several examples of recent DIY projects in this area of application. One is the Cave Pearl Data Logger , an ArduUsually, wind data acquisition in dune systems is carried out using 2D and 3D ultrasonic anemometers ,30,31,32Ammophila arenaria and Elymus farctus. When the vegetation density is low, a continuous linear dune field does not appear but rather a set of nebkhas [Traganum moquinii [In most sandy coastlines of temperate and tropical regions of the world, foredunes are continuous landforms aligned with the coastline. Plant species commonly found in these systems include the graminaceous  nebkhas ,37, a ty nebkhas . When fo nebkhas . However nebkhas ,39,40. Smoquinii ,42,43,44Traganum moquinii in the formation of foredunes in arid coastal dune systems of these regions was reported in a study of the relationship between specimens of this plant found in Playa del Ingl\u00e9s  and the wind dynamics, in which it was observed that the influence of these plants extends 20 m leeward of their placement [tongue dune [The role played by lacement , generatgue dune . The idegue dune . The chaTraganum moquinii in these spaces with a view to explaining the formation of tongue dunes. In order to achieve this goal, a DIY approach has been applied to wind data acquisition for the purpose of validating a theoretical model of this interaction using topography and wind data. As the foredune of arid dune fields has been little studied, the results of this study can be useful for the management of the Maspalomas dune field, as well as other coastal dune fields around the world.Considering these premises, this paper addresses the interaction of wind with specimens of Environmental monitoring of an area, in this case for the study of a dune field, requires the deployment and spatial distribution of a sufficient number of wind sensors over the study area to adequately sample aeolian conditions over the dunes at different heights. In other words, a large number of wind sensing devices is generally required. As the use of standard commercial scientific-grade sensors was not viable under our budget constraints, we decided to explore the construction of our own wind data acquisition system following a low-cost DIY approach. The system consists of a base station and several independent wireless wind sensing devices. Eleven of these devices were developed and built for the work described in this paper.Cost\u2003The funding available for developing the system was strictly limited. This was a requirement which affected all aspects of the design process. As our research interests were focused on strong or very strong wind conditions under which sand transportation occurs (more than 5 m/s), our field experiments did not require wind sensors of extreme sensitivity. However, a large number of sensors were needed, and we therefore decided to resort to a DIY approach and the use of low-cost electronics and instruments.Flexible parametrization system\u2003The final system should be flexible enough to parameterize the data structure, as for example the data sampling periods, log files, etc.Autonomy\u2003The system, and specifically each independent wireless sensor device, should have sufficient autonomy, in terms of energy consumption, to allow continuous on-field session measurements of at least 10 h.Temperature concerns\u2003The system needed to endure high temperatures during the day. A temperature control system for each wireless sensor device was therefore an important requirement during deployment, and especially when a complete on-field data acquisition session was being undertaken.Easy deployment and use\u2003Given the hard logistical conditions of the field where the system was to be used , the deployment of the data acquisition system needed to be as easy as possible. In addition, the system had to be user friendly given the multidisciplinary profiles of the people involved in the on-field measurement sessions.Wireless communications\u2003There are numerous advantages to the use of wireless communication links between the elements of the system as opposed to wired connections, especially in terms of transportation and on-field deployment. Given that the wind sensing devices basically only need to periodically transmit wind speed and direction data, which require only a few bytes, and some complementary information such as timestamps, high data rate communication was not a strict requirement. As the aim was for the wind sensing devices to have a high degree of autonomy, a further requirement was to choose a wireless technology which consumed as little power as possible.Reach\u2003The area to be covered in a typical data-acquisition task of this type is about 50 \u00d7 50 square meters. This was considered sufficient to study a whole foredune in the study area, as will be seen. Hence, the reach of the wireless communication system should at least cover these dimensions.Reliability\u2003The experiments would be carried out under demanding conditions of intense sand/dust transportation, high temperatures, and strong winds. The system therefore had to be able to alert the user in case any of the wind sensing stations stopped transmitting. In fact, this proved to be an extremely useful feature which ensured the quality of the data that was obtained. Moreover, it is important that the data acquired during an experimental session is observable on-site as it is collected, in addition to being saved in a secondary memory device for later analysis. The detection and on-site fixing of errors is an important advantage which is not possible in systems in which access to collected data are only possible once the experiment has concluded.The design of the wireless system was driven mainly by the following initial premises and requirements, determined principally by the task at hand:base station and several wireless wind sensing devices. Both types are briefly explained below.Base station\u2003The base station is a personal computer or similar device running GNU/Linux and equipped with an XBee communication link, which is used for system synchronization and monitoring during a data acquisition session. Usually, we deploy the base station running on a GNU/Linux Raspberry Pi based embedded computer device exporting its graphical environment via VNC  [mputing)  on a mobWireless wind sensing devices\u2003Each wireless wind sensing device is an independent, small Arduino-based embedded system for wind speed and direction data acquisition, which communicates periodically with the base station via XBee during a data acquisition session.libxbee3 [The software developed for the base station constitutes a visual interface to control and monitor the wireless wind sensing devices during an on-field data-acquisition session. This software has been developed in C++ under GNU/Linux, using GTK , as graplibxbee3 , a libralibxbee3 . The funa Wireless SD Shield  which ala wind sensor for measuring wind speed and direction comprising a cup anemometer  in each device\u2014which additionally would have provided a less precise positional accuracy\u2014was not required. No real-time clock (RTC) was integrated either, as real time is usually obtained from the GPS receiver, and it is possible to avoid clock drifting between different sensors using the PPS (Pulses Per Second) signal available in GPS receivers . In the As to the power autonomy of each wind sensing device, we experimentally determined an autonomy of slightly more than 30 h with fully charged batteries. This is well above the 8\u201310 h maximum duration of the experimental sessions with the wind data acquisition system. In any case, if necessary, the Lipo Rider Pro supply/charging board, integrated in each device, allows the batteries to be charged with a solar panel in the range of 4.8\u20136.5 v. and 400\u2013600 mA.xbee-arduino library [The embedded data acquisition software we developed for the wireless wind sensors runs on the Atmel ATmega328P microcontroller integrated on the Arduino UNO board. It was developed in C++ under GNU/Linux using the Arduino IDE , Arduino library . The floDuring a measurement session, the data acquisition system has the topology shown in register devices, The diagrams in vane calibration, vane homing, homed, the device sends a registration packet to the base station , which For this validation, we conducted a data acquisition experimental session in Arinaga, a windy zone located south of Gran Canaria\u2019s airport on the east coast of the island. In order to make a comparison between the wind sensing devices of our data acquisition system and those of AEMET, we applied a low-pass filter to cancel out any possible noise present in the two sets of data, wind speed and direction angle, respectively, for both types of sensors. The filter applied was a centered median filter, and, with a view to determining the most suitable filter length, we performed a frequency domain analysis with application of the discrete Fourier transform to both data sets. The development of this DIY data acquisition system has been motivated and driven by real scientific demands. This section describes the results obtained with it in the context of a specific environmental research study.The Maspalomas transgressive  dune fieTraganum moquinii. This species is responsible for the formation of nebkhas [Sands enter the system from the east, in Playa del Ingl\u00e9s (El Ingl\u00e9s beach), are transported in a NE-SW direction as free dunes at a mean rate of 7.93 m/year , and fin nebkhas ,75, typi nebkhas .For this experimental study, an area was selected in the mid-zone of the dune system, highlighted in the right-hand side image of Z was 1.420 m, based on the Mean Sea Level (MSL) of Puerto de La Luz y de Las Palmas, taken using a GPS device. The topographical method applied was an inverse intersection from distances. A larger number of points were collected in areas with higher geomorphological complexity to ensure a more accurate model. A total of 2100 points were acquired for the elaboration of a Digital Elevation Model (DEM) in vector format (TIN) and later in raster format  was displaying incorrect behaviour in the course of the offline processing of the collected wind data in the second data acquisition session, and for this reason has been omitted in As to the DIY data acquisition system we have designed, developed and deployed for this experimental study, and considering the initial design goals described previously in Finally, in In addition to the experimental study described above, another environmental analysis was performed in a different location within the same dune field and using the same DIY wireless data acquisition system. The purpose of this study was to analyse the influence of tourist facilities and buildings situated at the border limits of the dune field on the dynamics of the dune system, since they can modify the wind behaviour and have a significant impact on the area. The zone under analysis for this study was an area of 27.76 ha, with the wireless acquisition system deployed in several experimental sessions on 24\u201325 March 2017. In particular, five data acquisition sessions were carried out. For each session, ten wind sensing devices were deployed on five towers, each with a pair of devices at two different heights of 0.4 m and 2.1 m. Each experimental session covered one of the five transects into which the study area was split. The methodological approach used to deploy the system for each session was the same as described previously in this section, with the collected wind data integrated into a DEM of the terrain, obtained in this case using digital orthophotos from a photogrammetric drone flight on-site covering the whole area. In addition, the precision of the topographic data derived from the drone flight was tested using ground data collected on-site with a topographic total station. Further details can be found in .The development of a low cost and wireless wind data acquisition system that allows multiple synchronized wind measurement points enabled the data-intensive modelling of the interaction of an arid foredune system with its shrub vegetation. Wind data acquisition in dune field environments is usually expensive due to the high cost of the instrumentation used in this type of environmental study. In fact, the experimental study and modelling described in this paper would not have been possible with expensive standard research-grade sensors. However, it was possible to considerably reduce this fundamental cost barrier with the DIY data acquisition system which we designed and developed. The system was experimentally applied to the study of the genesis and dynamics of tongue dunes in the arid dune field of Maspalomas , a new finding which is of interest at a local level for the management of this dune field, and, at a general level, as knowledge that can be applied to other similar dune areas around the world. Given the scenario of global change, the monitoring of environmental aspects is very important in coastal areas as many of them present aeolian sedimentary environments in arid zones which need special protection. A more cost-effective approach to such environmental studies is of general interest, but is especially true for developing countries with less research funding . In a su"}
+{"text": "Leptomeningeal metastasis (LM) is a lethal complication in which cancer metastasizes to the meninges. Currently, there are neither definitive treatments nor diagnosis methods for LM patients. In this study, we suggest the examination of small non-coding RNA (smRNA) populations of extracellular vesicles (EVs) derived from the cerebrospinal fluid (CSF) as a potential vehicle for diagnosis and treatment strategies. Systemic and quantitative analysis of smRNA subpopulations from LM CSF EVs showed unique expression patterns between LM patients and healthy donors. In addition, LM CSF EVs smRNAs appeared to be associated with LM pathogenesis suggesting they may be viable targets for novel diagnostic and treatment strategies.Leptomeningeal metastasis (LM) is a fatal and rare complication of cancer in which the cancer spreads via the cerebrospinal fluid (CSF). At present, there is no definitive treatment or diagnosis for this deleterious disease. In this study, we systemically and quantitatively investigated biased expression of key small non-coding RNA (smRNA) subpopulations from LM CSF extracellular vesicles (EVs) via a unique smRNA sequencing method. The analyzed subpopulations included microRNA (miRNA), Piwi-interacting RNA (piRNA), Y RNA, small nuclear RNA (snRNA), small nucleolar RNAs (snoRNA), vault RNA (vtRNA), novel miRNA, etc. Here, among identified miRNAs, miR-21, which was already known to play an essential oncogenic role in tumorigenesis, was thoroughly investigated via systemic biochemical, miR-21 sensor, and physiological cell-based approaches, with the goal of confirming its functionality and potential as a biomarker for the pathogenesis and diagnosis of LM. We herein uncovered LM CSF extravesicular smRNAs that may be associated with LM-related complications and elucidated plausible pathways that may mechanistically contribute to LM progression. In sum, the analyzed smRNA subpopulations will be useful as targets for the development of therapeutic and diagnostic strategies for LM and LM-related complications. Leptomeningeal metastasis (LM) is a fatal and rare complication of cancer in which the cancer spreads to the meninges surrounding the brain and spinal cord via the cerebrospinal fluid (CSF) ,2. LM ocExtracellular vesicles (EVs) mostly consist of exosomes and microvesicles (MVs) of different origin; however, there are limitations in current techniques to completely separate the MV from the exosome since they are overlapped in size and share surface biomarkers ,10. EVs Most of the RNAs found in EVs are small non-coding RNAs (smRNAs) of less than 200-nucleotides (nt) in length . Recent miRNAs are considered to be strong prognostic markers and key therapeutic targets in various human diseases, especially cancer ,18. MoreIn this report, we describe for the first time a comprehensive smRNA profile from the EVs of LM patient CSF, as obtained via an unbiased polyadenylation-based smRNA library construction procedure and subsequent NGS analysis. We performed deep sequencing on a subpopulation of relatively well-characterized smRNAs found in CSF EVs from LM patients and healthy control donors (HCs). The significance of biased expression of smRNA subpopulations was extensively validated using various biochemical methods. Moreover, the functionality of miR-21, which was found to be the most essential among the LM CSF EV-relevant smRNAs, was verified using a newly developed multipurpose lentivirus-based miR-21 monitoring system and physiological cell-based approaches. Finally, we discuss the potential roles of miR-21 and other essential smRNAs in the progression of LM and their usefulness for diagnosing LM.Characteristics of the 19 LM patients and 16 HCs are summarized in The mean age of all patients was 59.97 years . Overall, 19 patients were female and 16 were male. Non-small cell lung cancer (NSCLC) was the most frequent primary cancer type among LM patients except LM8, 17, and 19 (breast cancer). To identify potential diagnostic small RNA (smRNA) biomarkers in LM patient CSF EVs, we first optimized a procedure for isolating EVs from a minimal amount of CSF A. All sap = 0.004) which showed a similar pattern as we previously reported [After removing cellular components and fragments, we measured the concentrations and sizes of the presumed EVs from LM CSF by nanoparticle tracking analysis (NTA) using a NanoSight NS300  was effective for RNA sequencing quality control and further library construction. As shown in From among the annotated smRNA populations, we identified and focused on well-known classes that were present and asymmetrically distributed in HC versus LM CSF EVs. The most abundant housekeeping RNAs and contaminating mRNA fragments were excluded from the comparison and further analysis. We determined the relative distributions of the ten most abundant classes between HC and LM EVs, which corresponded to 33.1% of all aligned reads. These RNA classes included miRNA, piRNA, Y RNA, snoRNA, snRNA, vtRNA, novel miRNA, and scRNA .The remaining aligned reads of EVs represented rRNA, tRNA, etc. All of the sorted and identified RNA classes exhibited differential distribution between HC and LM. Interestingly, as shown in p-value < 0.05. A total of 46 significantly differentially expressed miRNAs were identified, and hierarchical clustering showed that the miRNA expression profile of LM EVs was markedly distinct from that of HC  . We seleAs shown in Out of the 46 miRNAs classified herein, additional essential miRNAs, such as hsa-miR-191-5p and hsa-miR-93-5p, also showed higher expression in LM CSF EVs than HC and GBM EVs D. In conFurthermore, we visualized the expression of miR-21-5p using a well-established conventional biochemical approach. Splinted ligation demonstrated that our ddPCR and qRT-PCR results were not caused by non-specific amplification of unwanted RNA species. As shown in To investigate the predicted functions of the miRNAs that were differentially expressed in LM EVs and HC EVs, we used the Database for Annotation, Visualization and Integrated Discovery (DAVID) functional annotation tool to perform Gene Ontology (GO) analysis. The significantly enriched GO terms included biological processes and molecular functions .The 43 miRNAs upregulated in LM CSF EVs represented processes such as cellular response to hypoxia, positive regulation of cell proliferation, positive regulation of transcription, and positive regulation of gene expression in the biological process category. The selected miRNA, miR-21-5p, is involved in wound healing, cellular response to hypoxia, positive regulation of transcription, and negative regulation of apoptotic process.We also used a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis to examine the signaling pathways associated with each of the 43 miRNAs found to be differentially expressed in LM CSF EVs versus HC. Our KEGG analysis revealed that the pathways of glioma, small cell lung cancer, pathways in cancer, and miRNAs in cancer were particularly relevant. For miR-21-5p, the pathways of HIF-1 signaling, MAPK signaling, cancer and miRNAs in cancer were found to be significant.Renilla luciferase activity in a dual luciferase assay  and be functional within the miRNA machinery, we devised a lentivirus-based miR-21-sensing reporter. In this system, firefly luciferase is transcribed under the control of the cytomegalovirus (CMV) promoter and the translation of its mRNA is governed by five consecutive miR-21-targeting sites located in the 3\u2032UTR. The devised system offers the ability to easily monitor the positive role of miR-21-containing LM CSF. The expression of firefly luciferase can be easily normalized using human phosphoglycerate kinase 1 (hPGK) promoter-driven ssay see A. More dNext, to test the specific reactivity of luc-miR-21 sensor against LM CSF containing potentially functional miR-21s, we treated LM CSF directly onto luc-miR-21 sensor-bearing 293T cells. As shown in These data collectively demonstrated that LM CSF and LM CSF EVs contain functional miR-21, indicating that this miRNA is physically incorporated into the cellular miRISC. This event can potentiate downstream cellular oncogenic signal cascades triggered by miR-21, which may induce LM malignancy among targeted recipient cells in patients.To test whether miR-21 from LM CSF EVs can potentiate downstream cellular oncogenic signal cascades, we used a migration  assay. First, to elucidate the effect of miR-21 on the migration of A549 cells directly in vitro, we transfected the cells with synthetic miRNA mimics or negative control nucleotides and performed a migration assay. As shown in the Interestingly, NGS analysis of the LM CSF EVs revealed the biased expression of Piwi-interacting RNAs (piRNAs). piRNAs form RNA-protein complexes through interactions with Piwi-subfamily proteins. The piRNA complexes are mostly involved in the epi-genetic and posttranscriptional silencing of transposable elements . As far Another interesting smRNA species, Y RNAs, also showed markedly biased expression patterns between LM CSF EVs and HC. The members of this well-characterized smRNA subpopulation act as components of the Ro60 ribonucleoprotein particle, which is a target of autoimmune antibodies in patients with systemic lupus erythematosus . Y RNAs p-value < 0.05), with only nine exhibiting upregulation. This suggested that, except for the nine cases, most of the predicted novel miRNAs may play a role in LM progression, opposing the function of known miRNAs. Future work is warranted to examine whether these predicted novel miRNAs are expressed and functional. We used ddPCR to validate the highly ranked upregulated novel miRNA-973. As shown in We additionally identified meaningful and essential smRNA subpopulations that showed markedly biased expression in our NGS analysis of LM CSF EVs versus HC. As shown in Finally, we examined essential smRNAs, such as snRNA, snoRNA, vtRNA, and scRNA . We founLM is generally considered to be a late complication of solid tumors . LM causIn this study, we examined CSF smRNA levels in individual LM patients as potential markers for monitoring disease diagnosis. This is the first comprehensive and systemic analysis of the smRNA molecular profiling in a standard set of CSF samples from individual LM and non-LM patients. The identification of specific CSF smRNAs in this study suggests new ways to diagnose and monitor LM and may contribute to efforts to explore the mechanisms of LM.The use of smRNA as LM biomarkers could offer several benefits. First, smRNAs, essentially miRNAs, are functional in the biological system, and thus could be easily applied for biochemical and physiological assays ,20. HereOur approach and quantitative-qualitative analyses of the smRNAs from LM CSF EVs are superior to those of previous reports, as indicated by the following lines of evidence. First, in this study, we set up a small-scale (2\u20134 mL of CSF) pipeline for analyzing the entire small RNA transcriptome of CSF EVs. We successfully conducted RNA-sequencing of extravesicular smRNAs using 3\u2032-end polyadenylation-based SMARTer smRNA-Seq commercial kit. We tested around 10 other kits for total RNA isolation that did not pass library quality control and/or were not successful for library construction. In addition, this protocol, which does not require laborious ultracentrifugation or large volumes of CSF, may be practical in the clinical setting.Previous reports showed that conventional adaptor-based approaches yielded biased results for smRNA populations . CompareSecond, the biased expression of LM CSF extravesicular smRNA was systemically, biochemically, and functionally validated through various biochemical and cellular approaches. Interestingly, we found that the potential LM pathogenesis-related miRNAs were highly upregulated in LM CSF EVs. Our study also revealed that the ratios of different types of extravesicular smRNAs differed between LM patients and HC. Furthermore, identification of new smRNA population will increase our knowledge of LM.Finally, the presence of smRNAs separated and identified on a large scale was quantitatively confirmed using ddPCR  in the nucleus and the U1 spliceosomal RNA is recurrently mutated in multiple cancers ,52.A major obstacle in cancer treatment is the development of chemoresistance, and vtRNAs are known to play a role in this phenomenon. vtRNAs may facilitate the export of certain chemotherapeutic drugs through binding-site specific interactions. In addition, recent studies suggest that vtRNAs may inhibit drug activity through interfering with drug target sites; thus conferring drug resistance during chemotherapy of LM .With the exception of miRNAs, the smRNA subclasses have limited biochemical analysis tools and functional assays, making it difficult to functionally verify their cellular roles in LM. Furthermore, the lack of an animal model for LM further complicates the research. In the near future, we can hope that new proper model systems will be developed to facilitate the study of LM.g for 20 min for removing cells and cellular debris at room temperature. After first centrifugation, CSFs were further centrifuged at 10,000\u00d7 g for 30 min and kept frozen at \u221280 \u00b0C.CSF samples were collected after approval of Institutional Review Board in National Cancer Center, Korea (NCC2014-0135) in accordance with the ethical guidelines outlined in the Declaration of Helsinki. The informed consent was obtained from all patients. CSF samples were obtained from each patient before the lumbar, intraventricular, and cisternal puncture. Obtained CSF was centrifuged within 1 h at 2000\u00d7 The physical and biological properties of EVs in CSF samples were characterized by using ExoView R-100  and ExoView Tetraspanin kits (NanoView Biosciences) including anti-CD81, anti-CD63 and anti-CD9 immobilized chips, labeling agents, washing solutions (solution A and B) and blocking agent (NanoView Biosciences). The three-capture antibody spots in each tetraspanin case were arrayed in one chip thus, average and standard deviation could be measured in one chip. Briefly, the 35 \u03bcL of diluted sample with solution A was dropped on the ExoView Tetraspanin chip and incubated overnight (16 h) at room temperature (RT). After the incubation process, the sample loaded chip was washed by 1 mL of solution A for 3 min and this was repeated by three times. Subsequently, the EVs on the chip were labeled by using 250 \u03bcL of a mixture of anti-CD81/Alexa Fluor 555 (green), anti-CD63/Alexa Fluor 647 (red), and anti-CD9/Alexa Fluor 488 (blue) and incubated for 1 h at RT to measure the colocalization of tetraspanin on the surface of EVs. In this case, the fluorescein-labeled antibody was diluted in mixture of solution A and blocking solution with 1:600. Finally, the chip was rinsed by 1 ml of solution A and B and dried at RT. The EV captured chip was scanned by ExoView R-100 via nScan software (NanoView Biosciences) and data were analyzed through NanoViewer 2.9 software (NanoView Biosciences).g for 30 min at 20 \u00b0C, then the supernatant was removed.EVs were isolated from CSF of LM and HC individuals. The CSF samples were centrifuged twice and the cleared samples were used for the isolation of EVs with miRCURY Exosome Cell/Urine/CSF Kit  according to the manufacturer\u2019s instructions. In brief, CSF sample gently mixed Precipitation Buffer B, then the mixtures were vortexed and incubated for 60 min at 2\u20138 \u00b0C for precipitating exosome pellet. After centrifugation at 10,000\u00d7 EV RNA extraction was performed using the miRCURY RNA Isolation Kit - Cell & Plant  following the manufacturer\u2019s instructions. In brief, exosome pellet was lysed with the provided lysis solution supplemented with 96\u2013100% ethanol, and the mixture was loaded to the column. The EV RNA was washed and eluted with 15\u201350 \u00b5L of RNase-free water. The extracted RNA concentration was calculated by Quant-IT RiboGreen . RNA size was confirmed using Agilent RNA 6000 Pico Kit and Small RNA Kit on Agilent 2100 Bioanalyzer .The 10 ng of RNA isolated from each sample was used to construct sequencing libraries with the SMARTer smRNA-Seq Kit for Illumina (Takara Bio Inc.), following the manufacturer\u2019s protocol. Input RNA was first polyadenylated in order to provide a priming sequence for an oligo(dT) primer. cDNA synthesis was primed by the 3\u2032 smRNA dT Primer, which incorporates an adapter sequence at the 5\u2032 end of each first-strand cDNA molecule. In the template-switching step, PrimeScript Reverse Transcriptase utilized the SMART smRNA Oligo as a template for the addition of a second adapter sequence to the 3\u2032 end of each first-strand cDNA molecule. In the next step, full-length Illumina adapters (including index sequences for sample multiplexing) were added during PCR amplification. The forward PCR primer was then bound to the sequence added by the SMART smRNA Oligo, while the reverse PCR primer was bound to the sequence added by the 3\u2032 smRNA dT Primer. The amplified libraries were purified from 6% Novex TBE-PAGE gels (Thermo-Fisher Scientific) to excise the fraction over 138-bp (over than 18-bp of cDNA plus 120-bp of adaptor). The resulting library cDNA included sequences required for clustering on an Illumina flow cell. The libraries were gel purified, and validated by checking the size, purity, and concentration on the Agilent 2100 Bioanalyzer. The libraries were then quantified using qPCR according to the qPCR quantification protocol guide  and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies). The libraries were pooled in equimolar amounts, and sequenced on an Illumina HiSeq 2500  instrument to generate 101 base reads. Image decomposition and quality values calculation were performed using the modules of the Illumina pipeline. Adapter trimming was assessed using the Cutadapt program.p-value < 0.05. Distance matrices were processed by MDS to obtain a dimensionally reduced map of gene coordinates with distance between plots as a measure of similarity. All data analysis and visualization were performed using R 3.6.3 (www.r-project.org)  of extracted EV smRNA were performed by Macrogen . Various hierarchical clustering analysis was performed using complete linkage and Euclidean distance as measures of similarity in differentially expressed patterns of the smRNA with the criteria of |fold change|\u2265 2 and ect.org) .t-test with Welch\u2019s correction were used to compare significant differences in each smRNA expression between two groups according to the result of normality test (Shapiro-Wilk test). * p-value < 0.05, ** p-value < 0.01.Approximately 2 ng of purified total EV RNA was reverse transcribed to generate cDNA with TaqMan Advanced miRNA cDNA Synthesis Kit  according to the manufacturer\u2019s instruction. Four \u00b5L of cDNA was mixed ddPCR Supermix for Probes  and TaqMan Advanced miRNA Assay probes . Four \u03bcL of cDNA was mixed with the QX200 ddPCR EvaGreen Supermix  and oligomers for the following smRNAs; hsa-miR-423-5p, hsa-miR-1273g-3p, hsa-miR-4271, piRNA-33415, piRNA-36340, Y RNA-Y69, snRNA-200C70, vtRNA-6C57F3, novel miRNA-973, and scRNA-F3729 . Each 20The putative target genes of miRNA were searched from miRTargetLink  providinRenilla luciferase. The normalized quantification data was used in comparing the relative luciferase activities. Data are presented as the mean \u00b1 standard deviation determined from at least three independent experiments. Differences were assessed by two-tailed Student\u2019s t-test using Excel software . * p-value < 0.05, ** p-value < 0.01, *** p-value < 0.001; NS, not significant.Two luminescence-based miR-21 sensor-bearing cell lines (293T and A549) were established by lentiviral infection, and then harvested 16\u201320 h after treatment with designated CSFs or CSF EV concentrates. Cells were lysed with Passive Lysis Buffer , and the aliquot of lysates was analyzed by measuring luminescence signals with Dual-Luciferase Reporter Assay System (Promega) in a reader . The miR-21 sensor signal from firefly luciferase was normalized with that from 5 per well and cultured up to 80\u201390% confluence for 2 days before scratching. Then 4\u20136 lines were scratched in each confluent monolayer with a sterile 200 \u00b5L tip. Dislodged cells were removed by washing with warm Dulbecco\u2019s phosphate-buffered saline, and the remaining cells were replenished with fresh medium. A representative line with similar width were selected and photographed in each group at starting point, and then treated with concentrated EV dissolved medium or transfected with miR-21 mimics. After 24 h and 48 h, snapshots of the scratch were taken with the microscope (100\u00d7) .Human NSCLC A549 cells were plated on 6-well plates at a density of 6 \u00d7 10We reveal herein the molecular profile of CSF extravesicular smRNAs that are potentially associated with LM pathogenesis. We successfully identified various LM-associated smRNA populations that showed significantly biased expression patterns in LM. Our extensive NGS analysis and relevant biochemical and cell-based validations demonstrated that miRNAs and the other analyzed smRNA subpopulations may be useful targets for the development of therapeutic and diagnostic strategies for LM. Further investigation is critically needed to address the potential of extravesicular smRNAs as a novel pharmacological target for LM and LM-related complications. Additional experiments and bioinformatic analyses may reveal novel means to explore the underlying mechanisms of LM and provide additional promising targets for treating LM patients."}
+{"text": "Pancreatic ductal adenocarcinoma (PDAC) has little response to immune checkpoint inhibitors. An in-depth understanding of the immune microenvironment from a comprehensive and dynamic perspective is critical to generate effective therapeutic strategies for PDAC.G12D/+; Trp53R172H/+; Pdx1-cre) and human specimens. PD-L1\u2212/\u2212 mice were crossed with KrasG12D/+; Tgf\u03b2R2flox/flox; Ptf1a-cre mice to achieve early depletion of PD-L1 in pancreatic cancer. Combination therapy of Arginase-1 (Arg-1) inhibitor and anti-PD-1 mAb was validated in syngeneic mouse models.Using mass cytometry and immunohistochemistry, we explored the dynamic changes of tumor-infiltrating immune cells during the development of PDAC in a genetically engineered mouse model (Kras+ monocytes changed from a BST2+/MHC-II+ phenotype to an Arg-1+ phenotype over time during PDAC development. The late stage of immunosuppression thus featured the presence of a large number of myeloid suppressive cells together with a significant reduction of effector lymphocytes. Removal of PD-L1 from the beginning efficiently triggered anti-tumor immunity and significantly prolonged survival in PDAC-developing mice. Targeting Arg1+ macrophages with an Arg-1 inhibitor synergized with anti-PD-1 immunotherapy and led to PDAC-specific immune memory.Two different stages of immunosuppression with unique features were observed in both mouse model and human specimens. Early stage of immunosuppression featured highly abundant Tregs during acinar-to-ductal metaplasia, despite of a prominent and continuous presence of effector lymphocytes. The differentiation/activation branch of Ly-6CBy demonstrating the coevolution of histopathology and immunology in PDAC, this study highlights the necessity and value of early intervention and combinational approach in leveraging immunotherapy to treat pancreatic cancer.A full list of funding bodies that contributed to this study can be found in the Acknowledgements section. Most clinical trials involving patients with advanced pancreatic cancer have failed, which is often thought to be due to pancreatic cancer's immune desert microenvironment. Whether pancreatic cancer remains consistently \u201cnonimmunogenic\u201d is unclear. Resently, neoadjuvant immunotherapy for resectable pancreatic cancer has been reported to significantly induce T cell infiltration, activation and proliferation. Therefore, it is necessary to explore the dynamic changes of immune microenvironment in pancreatic cancer to determine whether there is a window period suitable for immunotherapy.This study demonstrated the dynamic evolution of the immune microenvironment during the development and progression of pancreatic cancer. The immunosuppression of pancreatic cancer gradually aggravates and eventually forms the myeloid cell-dominated immune microenvironment. Early pancreatic cancer still has a large number of active lymphocytes, which may be the window period for immunotherapy.This is the first study to delineate the dynamic immune landscape of pancreatic cancer, covering the entire histopathological progression. The changes of immune microenvironment in pancreatic cancer and the immune characteristics at different stages can provide a reference for the development of immunotherapy strategies.Alt-text: Unlabelled box,Pancreatic ductal adenocarcinoma (PDAC) is the most lethal form of cancer and the prognosis of PDAC patients has not substantially improved in recent decades.Both the local and systemic immune system are capable of clearing cancerous cells in immune competent individuals, and successful immunotherapy is dependent on the infiltration of sufficient effector cells.It is impossible to trace the dynamic changes in the tumor immune microenvironment from a normal pancreas to metastatic PDAC in human patients. Thus, we studied a spontaneous PDAC mouse model that harbors similar somatic alterations with human PDAC using mass cytometry (CyTOF), and verified the findings in human patients with different stages of the disease using immunohistochemistry (IHC). Our findings revealed that the immune landscape varied in mice exhibiting different histopathological stages, and we demonstrated that removal of programmed cell death-ligand 1 (PD-L1) signaling from the beginning effectively activated the anti-tumor immune response and prolonged survival time in PDAC-developing mice. Targeting myeloid-derived immunosuppression in PDAC with an arginase-1 (Arg-1) inhibitor demonstrated a profound synergy with immune checkpoint inhibitors. Additionally, we confirmed that there was a high consistency of immune variability in PDAC between the mouse model and human patients. Thus, the early intervention and combination strategy may also bring potential therapeutic enhancement to human patients. Overall, we uncovered the dynamic immune landscape that occurs throughout the development of PDAC and provides a fundamental reference of the immune characteristics at different stages of PDAC to develop promising immunotherapeutic strategies.G12D, LSL-Trp53R172HLSL-Kras, and Pdx1-Cre genetically engineered mice  were crossed as described in \u2212/\u2212 mice .The G12D/+; Trp53R172H/- by standard PCR. Mouse melanoma cell line B16F10 and PancO2 were purchased from the American type culture collection (ATCC) in 2017 and were validated by Short Tandem Repeat authentication. The cells were cultured in RPMI 1640 medium (KPC and PancO2) or DMEM medium (B16F10) with 10% fetal bovine serum and 1% penicillin-streptomycin.KPC tumor-derived cell line (KPC cell) was separated from spontaneous KPC tumor and was identified as a genotype of Kras5 KPC or PancO2 cells in 100\u00a0\u03bcL PBS were subcutaneously injected into the right flank of C57BL/6 mice. About 7 days post tumor injection, when the tumors grew to an average size of 35\u00a0mm3, the mice were randomly divided into 4 groups. Arg-1 inhibitor was administered daily by oral gavage at 30\u00a0mg/kg  and anti-PD-1 monoclonal antibody  was injected intraperitoneally twice per week. The control mice were treated with PBS and IgG isotype. Mice were euthanized when tumor necrotized or volumes reached 800\u00a0mm3.6-week old male C57BL/6 mice were purchased from Model Organisms . 5\u00a0\u00d7\u00a0106 cells in 100\u00a0\u03bcL PBS) subcutaneously in the left and right flank, respectively. Na\u00efve mice were engrafted with KPC and B16F10 cells in the same manner as a control. Tumor volumes were measured once every two days with a digital caliper.Mice which had rejected KPC tumor (the mice were free of tumor) after treatment with anti-PD-1 antibodies and Arg-1 inhibitor were rechallenged with KPC and B16F10 cells  samples were obtained from the Department of Hepatobiliary and Pancreatic Surgery, the First Affiliated Hospital of Zhejiang University School of Medicine (FAHZU). The pancreas samples were obtained from organ donors for liver transplantation, and the PDAC samples were obtained from patients who underwent surgical resection or an aspiration biopsy. The study was approved by the ethics committee of FAHZU, and all patients formally consented. The clinical information of the pancreas donors and PDAC patients was summarized in Tables S5 and 6. The disease stage was diagnosed according to the National Comprehensive Cancer Network Clinical Practice Guidelines for Pancreatic Adenocarcinoma (Version 1.2020).Judgement of the pathological stage of mouse pancreatic tissues was independently performed by two senior pathologists who specialized in PDAC. For the samples with inconsistent results, full discussion with another author was performed until the three experts reach a consensus. Briefly, a normal pancreas was defined when only a regular acinar structure was observed; acinar-to-ductal metaplasia (ADM) was confirmed with the pathological features of the remaining lobular contour of the pancreatic acinus and replacement of acinar structure by ductal structure without atypia; and pancreatic intraepithelial neoplasia (PanIN) was reported for a papillary sample, with a loss of polarity, pseudostratified, or stratified nuclei, cytological atypia, and mitosis. In the case of PDAC, local disease was defined as early stage, whereas late stage was diagnosed when the tumor involvement of the other organs was observed and histologically confirmed. In case that more than one morphology was observed, we would classify it as the more malignant stage . The timeline of PDAC development was established according to the histological results.6 cells per sample was obtained for subsequent staining and analysis. Either pre-conjugated or purified antibodies were purchased from Fluidigm . Purified antibodies were further conjugated using MaxPar X8 Polymer Kits (Fluidigm) according to the manufacturer's instructions. The mass cytometry antibodies for the 42 markers used in this study are listed in Tables S1 and S2.Murine samples were dissociated into small pieces using sterile scissors followed by enzymatical digestion with RPMI 1640 containing 2\u00a0mg/mL collagenase, 250\u00a0\u03bcg/mL hyaluronidase, and 20\u00a0\u03bcg/mL DNase I for 1\u00a0h at 37\u00a0\u00b0C. An average of 2\u00a0\u00d7\u00a0106 cells in each sample were blocked  and stained for cell surface markers in staining buffer (PBS containing 0.5% BSA and 0.02 % NaN3) for 30\u00a0min at 4\u00a0\u2103. For intracellular and intranuclear staining, the cells were fixed with fixation/permeabilization buffer for 15\u00a0min. The cells were then washed and stained in the transcriptional factor staining buffer according to the manufacturer's instructions . The samples were fixed again in 1.6% paraformaldehyde and stained with DNA intercalator iridium overnight at 4\u00a0\u2103. Cells were then acquired using a Helios instrument after adding normalization beads. FCS files were concatenated and normalized with beads using Helios software (Fluidigm).A total of 1\u00a0\u00d7\u00a010Mass cytometry data were de-barcoded using a doublet filtering scheme with mass-tagged barcodes. Live, singlet, and valid immune cells were manually identified. The X-shift (Phenograph) algorithm was run to obtain accurate immune subset information for all the samples. Markers used to identify the cell populations were summarized and listed in Table S3. GraphPad Prism 7 software  was used to perform the comparison and correlation analyses. A pseudotime analysis was performed using the Monocle3 R package. Some lineage-relative markers were used to create the trajectory graph.Slides were cut from FFPE samples at a thickness of 4\u00a0\u03bcm. After blocking endogenous peroxidase and antigen retrieval, the slides were then stained using anti-CD206 , anti-FoxP3 , anti-CD3 , anti-CD11b , anti-CD11c , anti-CD19 , and anti-CD163 . Corresponding secondary antibodies  were used to incubate the slides followed by chromogenic DAB staining . All slides were enclosed with neutral resin following nuclear staining and observed with an Axio Imager M2 microscope . The images were acquired with Zeiss ZEN software and the immune cells were quantified by counting three random high-power fields (400\u00d7) with relatively dense staining for each slice.All the animal experiments were performed in compliance with the Laboratory animal-Guideline for ethical review of animal welfare (GB/T 35892-2018) and were approved by the Animal Experimental Ethical Inspection of FAHZU. The use of patient samples was approved by the ethics committee of FAHZU, and all patients formally consented.t-test was used for comparisons between two groups. A one-way ANOVA was used to compare the differences among the five groups. A linear regression was used to fit the lines and quantify the relation degree of two variables. A Pearson's correlation coefficient was used to evaluate the correlation matrix. A Kaplan-Meier analysis was used to compute the patient survival curves and Log-rank tests were used to perform the comparison.A Student's Funders provide financial support for this study, and do not participate in study design, data collection, data analyses, interpretation, or writing of report.KRAS and TP53 are the most frequent somatic mutations in Chinese and Western cohorts of human pancreatic cancer.,G12D/+;LSL-Trp53R172H/+;Pdx1-CreLSL-Kras) (dx1-Cre) a. The KPdx1-Cre) b. CyTOF dx1-Cre) c and d. dx1-Cre) e and f. dx1-Cre) f. The prdx1-Cre) g. These + cells were manually gated and reclustered to detect 13 subclusters of CD8+ T cells and 12 subclusters of CD4+ T cells . Three of the largest CD8+ subclusters  were substantially decreased in both the ADM pancreas and late-stage tumors (RM) phenotype. The CD8_c11 and CD8_c13 subclusters expressed high levels of Ly6C and CD127 , which were phenotypically correspond to effector memory T cells (TEM).,+ subclusters  were not significantly different among the five stages .For a detailed analysis, we reclustered T cells, B cells a. All ofe tumors b\u2013d. The + T cells, the CD4_c10 and CD4_c12 subclusters increased in the ADM stage . Intriguingly, we found that the proportion of CD43+IgD\u2212 B cells increased in both the immunosuppressive stages in contrast to that of the CD43\u2212IgD+ B cells (\u2212IgD+ B cells (B cell_c10), which showed a low level in samples with ADM and late-stage tumor stages  dendritic cells (DCs); (2) macrophages; (3) CD69+ tissue-resident macrophages; and (4) monocytic MDSCs  (The reclustering of CD11bic MDSCs a. We ideCD172a+) b. All ofCD172a+) c. The DC\u2212Ly6C+MHC-II\u2212 (+MHC-II\u2212 (MDSC_c10 and c11) and F4/80+CD69+MHC II\u2212 (MDSC_c12-14), respectively. The other subclusters (MDSC_c1-4) were likely to be monocytes that expressed MHC-II, lymphocyte antigen 6 complex, locus C1 (Ly6C) and moderate levels of F4/80. Nearly all of the MDSC subsets rapidly accumulated after tumor formation  and Arg-1+   f and S2celopment g. In addentation g. Repres, and c9 h and i. + effector T cells and the CD4_c5 subcluster was identified as CD4+ effector T cells , CD43+IgD\u2212 na\u00efve B cells (B cell_c2 and c5-7), MDSCs and Tregs were negatively correlated with effector T cells (Teffs), whereas MHC-II+/BST2+ Macrophages , mature B cells and conventional DCs  were positively correlated with Teffs . These correlation analyses further supported that MHC-II+/BST2+ Macrophages, CD43\u2212IgD+ mature B cells, and cDCs might contribute to anti-tumor immunity, whereas Arg-1+ Macrophages, CD43+IgD\u2212 immature B cells, MDSCs, and Tregs may have immunosuppressive effects in PDAC. We also performed a correlation analysis on the immunotype of each mouse based on Pearson's correlation coefficient. Among the 22 mouse samples, we detected 100 pairs of samples that showed strong correlation with each other. Specifically, individuals within the normal and ADM stages were immunotypically well-correlated with each other (36 pairs upper left), as were individuals within PanIN and early-stage tumors (36 pairs lower right). 3 individuals correlated with both Normal/ADM groups and PanIN/ES Tumor gourps (highlighted with orange line), indicating that they may be in a transitional state. However, individuals within late-stage tumors were complicated and showed little similarity with each other (only 1 pair showed strong correlation), indicating the particularity and complexity of the immune microenvironment in late-stage PDAC .To further verify the precise role of the different types of immune cells in PDAC, we performed a correlation analysis based on all of the KPC mice involved in the current study. We combined several subclusters with similar features. For instance, the CD8_c6, c11, and c13 subclusters were recognized as CD8 T cells d and e. + macrophages+ macrophages in both early- and late-stage tumors, which resembled that of Arg-1+ macrophages detected by CyTOF  mice, which would develop PDAC with 100% penetrance and a median survival of 59 days,\u2212/\u2212 mice) to observe whether the immunosuppression in PDAC can be reversed by germline knockout of PD-L1. Both KTC and KTC;PD-L1\u2212/\u2212 mice developed palpable PDAC at about six weeks of age indistinguishably . However, the fraction of both CD4+/CD8+ T cells were not changed . We then studied the phenotype of both CD8+ T cells and non-Treg CD4+ T cells. CD4+/CD8+ T cells in the combined therapy expressed relatively high level of CD183  and CD127, suggesting an enhanced recruitment and memory feature  with anti-PD-1 antibody to treat KPC and PancO2 tumor-bearing mice. The combined therapy significantly inhibited KPC and PancO2 tumor growth a and S5and Tregs g and h.  feature i and S5g feature i. We alsrophages j, indica,,,36Under conditions of oncogenic mutation, sustained injury and environmental factors, patients can develop chronic pancreatitis resulting in infiltration of immune cells, desmoplasia and emergence of ADM.Kras and Trp53, and exhibits an extremely similar progression pathway from ADM, PanIN to invasive tumors and ultimately leads to death with or without metastasis.Since both tumor and immune cells co-evolve with tumor progression, investigating the dynamic immune landscape during tumor development is important for understanding the biological stages of the disease. Additionally, identifying the current immune microenvironment of the tumor is particularly essential for selecting the optimal immunotherapy. However, it is impractical and non-ethical to repeatedly obtain samples from patients. In addition, it is impossible to acquire ADM and PanIN pancreatic samples from humans. To explore the dynamic immune landscape of PDAC, we took advantage of the KPC mouse model, which has been proven to faithfully mimic the features of humans in PDAC studies. Similar to human PDAC, KPC mouse PDAC is also triggered by mutant + M2-like macrophages represent the main contributors of immunosuppression, which suggests impaired innate immunity at this stage. The difference between the two stages highlights the importance of correcting innate immunity in PDAC. Moreover, treatment with immune checkpoint inhibitors failed to show any efficacy in PDAC. Previous studies demonstrated that a low abundance of T cells was the primary reason for this effectAlthough PDAC has been described as an immunologically-cold tumor with limited immune cell infiltration,,Tumors with an immune-devoid phenotype characterized by low T and B cell infiltration have been found to indicate a worse prognosis.+ macrophages may participate in the reprogramming of the tumor microenvironment in PDAC. BST2, also known as tetherin or CD317, is an interferon-induced protein that inhibits the release of viral particles from infected macrophages.+/BST2+ macrophage) or immunosuppressive function (Arg-1+ macrophages). The cellular fate of Ly-6C+ monocytes changes from pro-inflammatory to immunosuppressive macrophages over time as PDAC progresses. This suggests that BST2 expression may represent a marker of anti-tumor macrophages in the PDAC microenvironment. Thus, redirecting monocyte/macrophage differentiation to the anti-tumoral branch may be a promising method of stimulating anti-tumor immunity. However, further studies on the induction and function of BST2 in macrophages are warranted to expand our understanding of the precise role of such macrophage subsets.Our study provides insight into several key components of intratumoral immune cells. To our knowledge, this is the first report demonstrating that BST2,\u2212IgD+ expression pattern was excluded in the immunosuppressive stages, concordant with CD4+ and CD8+ effector T cells, whereas the opposite was observed in the CD43+ IgD\u2212 B cell group. When the immunosuppression of tumor microenvironment was reversed either by PD-L1 depletion or Arg-1-targeted ICI combined therapy, B cells showed an obvious increase. Thus, we postulated that CD43\u2212IgD+ mature B cells may contribute to anti-tumor immunity and may promote immunotherapy in early pancreatic cancer. However, the precise role of B cells in PDAC remains largely unknown. Future studies are required to further classify B cells and elucidate their precise functions.We also observed that PDAC displayed a prominent presence of B cells, which are crucial for adaptive immunity. B cells have been reported to be either immunostimulatoryTrp53 allele. The difference in the timing and pattern of the Trp53 mutation may influence the tumor cell biology and be associated with a variable immune landscape. Furthermore, since no human pancreatic ADM and PanIN samples can be obtained, and immunohistochemistry is methodologically weak for the accurate differentiation of certain cell types, we can only infer dynamic changes in the immune microenvironment from the mouse model.There are some limitations associated with the current research. First, our sampling strategy cannot fully recapitulate the actual evolvement of local immunity in PDAC. Second, PanIN was not further divided into PanIN1, PanIN2, and PanIN3. Third, the number of mice in each group was relatively low. In addition, the timing of tumor initiation in KPC mice can vary slightly because it is dependent on the random loss of another Liang T and Zhang Q conceived the study; Yang J, Wang J, Hong Z, Wang J collected the samples; Wei S and Sun K analyzed the pathology; Yang J, Zhang Q, Lou Y, Chen Y, Sheng J and Su W analyzed the data; Yang J and Zhang Q drafted the manuscript. Liang T and Bai X supervised the study. All authors revised the manuscript and approved the final version of the manuscript.The datasets used and/or analysed during the current study are available from the corresponding authors on reasonable request.The authors declare no potential conflicts of interest."}
+{"text": "Several reviews on WO3 and its derivatives for various applications dealing with electrochemical, photoelectrochemical, hybrid photocatalysts, electrochemical energy storage, and gas sensors have appeared recently. Moreover, the nanostructured transition metal oxides have attracted considerable attention in the past decade because of their unique chemical, photochromic, and physical properties leading to numerous other potential applications. Owing to their distinctive photoluminescence (PL), electrochromic and electrical properties, WO3 nanostructure-based optical and electronic devices application have attracted a wide range of research interests. This review mainly focuses on the up-to-date progress in different advanced strategies from fundamental analysis to improve WO3 optoelectric, electrochromic, and photochromic properties in the development of tungsten oxide-based advanced devices for optical and electronic applications including photodetectors, light-emitting diodes (LED), PL properties, electrical properties, and optical information storage. This review on the prior findings of WO3-related optical and electrical devices, as well as concluding remarks and forecasts will help researchers to advance the field of optoelectric applications of nanostructured transition metal oxides.Tungsten oxide (WO Ko WO3 TFs . Mukherjansition f [59].3, despite its unique properties of high thermal stability, superior charge transport, tunable electrical properties, and high electron mobility, is not commonly used in the electrical device sector /Ag devices using Ag as an electrode. They found that the device maintained excellent stability for 100 cycles and had an on/off ratio of up to 333 at room temperature [3/WOx/W structure and observed the effects of post-annealing of metal on the behavior of shapeless resistance switch in this structure, especially the F-N tunneling effect after LRS and reset. Furthermore, for all nonlinear current-voltage switching characteristics, the authors have used simulations to account for SCLC conduction in low voltage field, F-N tunneling in high voltage field, and oxygen vacancy carbon fiber with a diameter of ~34 nm. This work will contribute to comprehend the switching mechanism of other similar RRAM structures and selector-free nanoscale crossover structures [Kozicki et al. demonstrated that low-power RRAM devices doped with copper WOocessing . On thisteristic ,102. Insperature . Similarructures .3/AZO resistance switching devices by a magnetron sputtering and observed that the devices have significantly enhanced resistance-switching memory behavior. The schematic diagram of the ITO/WO3/AZO device and I-V characteristic curve are shown in 3 NWs by the glancing angle deposition (GLAD) technique. The growth process of Ag-decorated WO3 NWs is shown in 10 eV\u22121 cm\u22122 at 1 MHz. It also exhibits an on/off switching time lasting up to 1500 cycles (3 s on/off resistance ratio (~245) [3 NWs based capacitive memory on Si substrates. Through the measurement and analysis of the device performance, the authors found that the memory exhibited a stable retention time (103) and a good endurance cycle of up to 100 [Recently, Sun et al. have fabricated ITO/WO0 cycles c and a so (~245) . Moreovep to 100 . These w3-related nanostructures in optical and electrical devices, such as photodetectors, LEDs, PL properties, electrical properties, and optical information storage devices. Although WO3 based devices exhibit good performance in the fields of various photoelectrical applications, it is also desirable to find new fabrication routes and the types of electrodes for these devices to improve the optical and electrical properties in the future. Modifying the electrode configuration of the device, controlling the variety of morphologies of WO3 nanostructures, and optimizing the preparation process could be the effective strategy for various futuristic photoelectrical applications. In order to better understand the physical transport mechanism of the devices, it is critical to use more relevant semiconductor theory and computational models for carrier transport research toward the development of WO3 devices.Recent research has significantly increased our knowledge of the features and uses of WO3 nanostructure related tunnel diode with negative differential resistance (NDR) investigation is scarcely researched, NDR is a non-linear carrier transport phenomenon, whereby the electrical current decreases with increasing bias voltage. N-WO3 semiconductor exerts degenerative features through heavy n-type doping and possibly displays a NDR phenomenon when combined with p-degenerative semiconductor. The NDR effect of WO3 will make an important contribution to the implementation of logic switches, oscillators, inverters, resistive switching memory, and radiation reliable device applications in the field of flexible electronics semiconductors.Up to present, the WO3 nanostructures that can operate in harsh environments (high temperature or strong radiation environments) is still challenging. It is also necessary to put further efforts to investigate WO3 related optical and electrical devices under extreme conditions such as high temperature, high pressure, and harsh environments. Diamond is an excellent semiconductor material for manufacturing high-performance electronic devices that are used in high temperatures and a strong radiation environment. Therefore, it is expected to fabricate WO3/diamond heterojunction device for providing the possibility of photodetectors, LEDs, PL properties, and optical information storage devices application at higher temperatures.Over the past decades, the development of the optoelectronic applications based on the WO"}
+{"text": "Genetics are a known contributor to differences in alcohol sensitivity in humans with fetal alcohol spectrum disorders (FASDs) and in animal models. Our study profiled gene expression in gastrulation-stage embryos from two commonly used, genetically similar mouse substrains, C57BL/6J (6J) and C57BL/6NHsd (6N), that differ in alcohol sensitivity. First, we established normal gene expression patterns at three finely resolved time points during gastrulation and developed a web-based interactive tool. Baseline transcriptional differences across strains were associated with immune signaling. Second, we examined the gene networks impacted by alcohol in each strain. Alcohol caused a more pronounced transcriptional effect in the 6J versus 6N mice, matching the increased susceptibility of the 6J mice. The 6J strain exhibited dysregulation of pathways related to cell death, proliferation, morphogenic signaling and craniofacial defects, while the 6N strain showed enrichment of hypoxia and cellular metabolism pathways. These datasets provide insight into the changing transcriptional landscape across mouse gastrulation, establish a valuable resource that enables the discovery of candidate genes that may modify alcohol susceptibility that can be validated in humans, and identify novel pathogenic mechanisms of alcohol.This article has an associated First Person interview with the first author of the paper. Editor's choice: RNA-sequencing in gastrulation-stage mouse embryos provides information about gene expression patterns during normal mouse development and evidence that pre-existing genetic variability mediates risk to prenatal alcohol-induced birth defects. Alcohol exposure during the first weeks of pregnancy is associated with significant birth defects involving the craniofacial region and central nervous system . Specifiin utero develop significant physical and cognitive deficits whereas others are relatively unaffected. While the dose and timing of alcohol exposure are certainly factors, it is known that environmental factors, such as stress or nutrition, and genetics can predispose an embryo to alcohol sensitivity or resistance. Studies using twins exposed to heavy prenatal alcohol revealed that dizygotic twins were less likely to both be diagnosed with FAS compared to monozygotic twins (Shh) (Cdon) (Gli2)  , the Shh) (Cdon) , 2013 or) (Gli2)  increaset manner . HoweverNnt gene, which encodes nicotinamide nucleotide transhydrogenase, an enzyme important for production of NADPH and removal of reactive oxygen species (ROS) from the mitochondria  strain obtained from The Jackson Laboratory and the C57BL/6NHsd (referred to as 6N) strain obtained from Envigo (formerly Harlan). Previous work has demonstrated that the 6J strain has a higher incidence of eye defects after prenatal alcohol compared to the 6N strain . These schondria . The mutchondria , impairechondria . Mutatiomutation . This muNnt and Rd8 mutation are two well-studied differences between the 6J and 6N strains, it is possible that other genetic variation is present during development that could modulate strain differences in risk and resilience to alcohol damage. In addition, it is unknown what effect these mutations have on gene expression during early embryonic development. The goals of this experiment were two pronged. First, we used the gathered transcriptome data to provide information about gene expression across gastrulation during normal mouse development. To this end, a web-based tool was created to allow gene-by-gene exploration of expression patterns across the first 12\u2005h of gastrulation in both the 6J and 6N strains. Second, we examined PAE-induced gene expression changes 6\u2005h and 12\u2005h after exposure , adding valuable information about the molecular targets of this mouse model of FASD.While the http://parnell-lab.med.unc.edu/Embryo-Transcriptomics/) was created for a gene-by-gene query of the transcriptomic data from both strains and from both control and PAE-treated embryos at each time point. Strain and prenatal treatment options can be toggled on or off to compare relative expression of a gene of interest in a single strain across time points, or between the 6J and 6N strains across time. For example, expression of Wdfy1 significantly differs between the strains across all time points but is not affected by PAE  using RNA sequencing (RNA-seq) A. We assd by PAE B. ConverJ strain C. The geFigs\u00a0S1-S7, and VST-normalized values for all significant genes are in Dataset\u00a01. We first focused on how 6J and 6N embryonic gene expression differs at E7.0 to establish a baseline and explore strain-dependent transcriptional differences prior to alcohol exposure. Eighty genes were identified as differentially expressed between the 6J and 6N strains at E7.0. Of these, 67 showed higher expression (83.8%) and 13 showed lower expression (16.2%) in the 6J relative to 6N strain (Table\u00a0S1).Gene expression across the first 12\u2005h of normal mouse gastrulation was compared between the 6J and 6N strains ], Ide, encodes an insulin-degrading enzyme that is known to degrade the B chain of insulin and amyloid beta   .de novo gene networks using the Ingenuity Pathway Analysis (IPA) database of known protein\u2013protein interactions. IPA allows insight into the functional relationships between differentially expressed genes that are not captured in the canonical terms and pathways used in the gene set enrichment analysis above. Six networks were dysregulated in the 6J relative to 6N (Table\u00a0S2A) related to immune signaling  and cell proliferation , supporting that baseline immune signaling differs between the strains. Differences in cell movement are likely to be linked to immune cell migration, although the source, type and function of these immune cells and related signaling molecules in the gastrulation-stage embryo is not yet clear. Overall, these genetic differences set the stage for the disparate responses to PAE observed in these two strains both hours . The top ten de novo networks were related to cell death, intercellular signaling, nutrient metabolism and embryonic development (Table\u00a0S2B). At E7.5, functional profiling of the upregulated genes indicated increased prostaglandin signaling and GPCR signaling (Table\u00a0S4). The downregulated pathways were again related to hydrolase and endopeptidase activity, consistent with the E7.25. De novo network analysis identified functions related to organ development, drug metabolism, protein processing and the cell cycle (Table\u00a0S2C).Functional profiling of genes from the E7.25 time point revealed only a small number of biological pathways that differed between the two strains, including altered hydrolase and endopeptidase activity and pathways related to cAMP signaling and apoptosis related to the downregulated genes , consistent with what was observed in these two strains at E7.0 prior to any injection. Efcab7, which had lower baseline expression in the 6J strain, exhibited the same effect at E7.25 (\u22121.78 Log2FC), but not at E7.5. The most upregulated gene in the 6J relative to 6N strain at E7.25 was Hist1h4m (H4c17), or histone cluster 1, H4m, a gene related to nucleosome assembly. This gene also showed a large upregulation at E7.5 and a small but statistically significant upregulation at E7.0. Interestingly, this gene was found to be downregulated in the hippocampus of fetal 6J mice (purchased from Orient Bio) following alcohol exposure from E8 to E12 , 810 genes were significantly differentially expressed between PAE and vehicle in the 6J strain, and 702 genes were differentially expressed between PAE and vehicle in the 6N strain. In the 6J strain, 355 genes were upregulated (43.8%) and 455 were downregulated (56.2%) A. In theTable\u00a0S5). Interestingly, we identified \u2018Activation, myristoylation of BID and translocation to mitochondria\u2019 as upregulated by PAE. BH3-interacting domain death agonist (BID) is a pro-apoptotic protein of the Bcl-2 family that is activated by the post-translational modification N-myristoylation. Activation of BID causes the insertion of Bax into the mitochondrial membrane and release of cytochrome C .Functional profiling of the genes upregulated following PAE in the 6J strain at E7.25 revealed that pathways related to catalytic activity  were dysregulated , a protein involved in glutathione cleavage, induction of oxidative stress-related apoptosis, and a negative regulator of Notch signaling , which is induced by NF-\u03baB signaling, creates a negative feedback loop controlling Atf4 activity in response to cellular stress and prevents apoptosis. Interestingly, Trb-3 has also been shown to block expression of Gamma-GCG . Similarly to in the 6J strain, PAE seemingly caused a reduction in cellular activity in the 6N strain. Alteration of methylation could have effects on gene expression and protein function; some of the specific methyltransferases targeted by PAE included Kdm1a, Kdm4b, Mettl3, Mettl4, Mettl16 and Prdm5, among others. Gene network analyses also revealed pathways related to organ and tissue disease, cell cycle/DNA replication and repair, and cell and tissue morphology (Table\u00a0S2E). The two most downregulated genes were Rsrp1, which encodes the relatively unknown protein arginine/serine rich protein 1, a target of heat shock protein 1 under certain conditions , the 6J strain continued to have more pronounced gene expression changes relative to the 6N strain; in fact, the number of differentially expressed genes increased over threefold in the 6J strain, whereas it remained relatively stable in the 6N strain. In the 6J strain, 2987 genes were differentially expressed 12\u2005h after PAE. Of these, 1641 were upregulated (54.9%) and 1346 were downregulated (45.1%) A. ConverTable\u00a0S7). One of the upregulated pathways we identified in 6J mice was \u2018Formation of xylulose-5-phosphate\u2019. Xylulose-5-phosphate is a ketose sugar known to promote gene t\u00adranscription through the ChREBP transcription factor (encoded by Mlxipl). This was interesting because Mlxipl was itself significantly upregulated in the 6J mice at this time point. ChREBP is part of the Myc superfamily and has been found to affect cell proliferation through regulation of transcription of cyclins in certain cell types .Functional profiling of the genes upregulated 12\u2005h following PAE in 6J mice revealed pathways related to intracellular signaling, protein transport and localization, and cell death . This gene had lower expression in the 6J strain relative to the 6N strain at E7.0 and E7.25, suggesting possible pre-existing differences between the strains; however, more work needs to be done to determine the exact role of Efcab7 during gastrulation and, in particular, in relation to Shh signaling. Another downregulated gene, Tcf21, encodes transcription factor 21, a protein with varied and important functions during lung, kidney, heart and gonadal development , the first of which was also one of the top upregulated genes in the 6N strain at E7.25. Fam46b (TENT5B in humans) has recently been shown to be highly expressed in undifferentiated embryonic stem cells, with a sharp drop in expression following cell differentiation . Increased Il17 signaling was also identified as an upregulated pathway in this dataset, further supporting that PAE is causing immune signaling activation, which could have downstream effects on cell survival and tissue growth. Multiple phenotypes related to hypoxemia were found to be upregulated in the 6N strain using the HPO database, indicating that PAE could be affecting cellular oxygen levels up to 12\u2005h later. Analysis of downregulated genes in the 6N strain revealed pathways related to overall cellular activity, DNA binding, and skeletal and neuronal development. Network analysis revealed that pathways related to cell morphology, embryonic development, cell death, cellular metabolism and inflammation were also altered by PAE in the 6N strain at E7.5 (Table\u00a0S2G).Analysis of upregulated genes in the 6N strain indicated that PAE caused an increased inflammatory signaling response in these embryos compared to controls, as well as catalytic activity and RAGE (AGER) receptor binding (Mef2c and Nkx2-5. Mef2c encodes the transcription factor myocyte enhancer factor 2C (Mef2c) important for skeletal muscle and central nervous system (CNS) development. Humans with mutations in MEF2C exhibit severe intellectual disabilities, loss of muscle tone, mild craniofacial dysmorphologies and severe seizures. Transgenic mice with knockout of Mef2c display disorganized vasculature and cardiovascular defects. Nkx2-5 encodes NK2 homeobox\u00a05, known to be involved in heart development and highly expressed in the cardiac crescent cells at E7.5. Knockdown of this gene is embryonically lethal at \u223cE9-E10 and causes growth retardation and heart defects.The top downregulated genes in the 6N strain at E7.5 were S100a9 and resistin-like gamma (Retnlg). S100a9 is a damage-associated molecular pattern molecule (DAMP) that makes a heterodimer with S100a8 to create calprotectin, a protein complex that produces pro-inflammatory activity when secreted from neutrophils, although cells from a neutrophil lineage are not known to be present in the embryo during gastrulation , a hormone released by adipose tissue.The top two upregulated genes were rulation . Increasrulation . S100a9 rulation . The funIn summary, while PAE affects pathways related to embryonic development in the 6N strain, these pathways do not seem to be as clearly linked to craniofacial development as those identified in the 6J strain, possibly contributing to the phenotypic differences observed between these strains following PAE.Fig.\u00a0S8). Three of these genes \u2013 Aven, Hist3h2a and Tbx1 \u2013 were strongly downregulated in both strains at both time points. Aven encodes the cell death regulator Aven protein, which inhibits apoptosis through suppression of pro-apoptotic Apaf1 and augmentation of anti-apoptotic BCL-XL activity and regulates the G2/M DNA damage checkpoint during cell cycle progression (Hist3h2a (H2aw), is translated into a core component of chromatin, histone H2A cluster 3. Chromatin dynamics regulate access of transcription factors to the DNA and control processes such as cell proliferation and differentiation. Hist3h2a was also found to be downregulated by neurulation-stage alcohol in a whole-embryo culture model derived from C57BL/6J mice , indicating altered mitochondrial function as a result of the Nnt mutation  (Oxidative stress can induce inflammation and expression of pro-apoptotic molecules NF-\u03baB and p53 and oxidative stress proteins HIF-1\u03b1 and PPAR-\u03b3 . The Nntin mice) , whereasin mice) , far aftin mice) , cell adin mice) . In addiMns1 results in increased incidence and severity of ocular and craniofacial defects following gastrulation-stage alcohol exposure (Table\u00a0S9). Immotile cilia, called primary cilia, are responsible for transduction of the Shh pathway, as Smo is trafficked into the cilia following binding of Shh to Ptch1, and the Gli transcription factors are processed within the cilia axoneme. In the 6J mice, multiple genes within the Shh pathway  were downregulated 12\u2005h after alcohol. This time point also coincided with a relatively large increase in the number of cilia genes dysregulated by alcohol in this strain compared to the 6N strain. Further investigation is needed to determine whether the cilia genes altered by alcohol exposure in the 6J strain are directly related to the downregulation of Shh pathway genes or are indicative of any significant motile or immotile cilia dysfunction.Motile and immotile cilia play important roles throughout embryonic development. Previous work from our laboratory has demonstrated that alcohol administered during neurulation alters over 100 cilia genes in the neural tube within the first 6\u2005h after exposure . During exposure , indicatexposure . GastrulLrat; +0.42 Log2FC in 6J mice at E7.25), retinoic acid receptor-\u03b1  and cellular retinoic acid binding protein 2 . However, interpretation of these single genes is difficult in the absence of other changes to the pathway. RA has been shown to be a regulator of Shh signaling , time elapsed between alcohol administration and tissue collection [e.g. 3\u2005h in ignaling , which wShh increases expression over time, Fgf5 shows reduced expression). The tool will also provide a valuable resource during experimental design, as there are significant differences in gene expression between the two strains that might support the use of one over the other for certain paradigms. The future directions of this study will explore the nuances of gene expression profiles in these two strains, including whether biological sex contributes to prenatal alcohol sensitivity. While all time points used in this study occur prior to gonadal sexual differentiation, differences in gene expression and growth rates have been reported between male and female pre-implantation embryos , this question needs to be fully explored. In addition, our study used whole embryo tissue, whereas newer sequencing technologies such as single-cell and spatial transcriptomics will allow for investigation of localized mRNA expression patterns, spatiotemporal cell\u2013cell interactions, and a direct link between gene expression and tissue morphology in the gastrulating embryo.These data provide information about gene expression patterns in two widely used strains of mice across normal gastrulation and in response to a teratogen. The web tool created to allow for exploration of the dataset visually demonstrates the dynamic nature of certain genes across gastrulation  were obtained. Males were housed singly and females were housed in groups up to five in standard polycarbonate cages with cob bedding, shelter and nesting material. Mice had ad libitum access to food  and water and were maintained on a 12:12\u2005h light/dark cycle. Up to two female mice were placed into the cage of a male for each 2\u2005h mating session. Upon discovery of a vaginal plug, E0 was defined as the beginning of the mating session  and C57BL/6NHsd  mice  in Lactated Ringer's solution 4\u2005h apart via intraperitoneal injection . This do2 followed by cervical dislocation, and embryos were dissected from the placenta. All extraembryonic tissue was removed and embryos were stage matched based on morphological assessment . All samples were run in triplicate (n=6/strain).RNA was collected from embryos either before alcohol administration (E7.0) or 6\u2005h or 12\u2005h after the first alcohol injection (E7.25 or E7.5) . Dams weA total of six samples per group were submitted for sequencing. Libraries for RNA-seq were prepared using the SMARTr Ultra Low Input RNA  and Nextera XT DNA  kits by the UNC High-Throughput Sequencing Facility. Samples were pooled only for sequencing, after RNA extraction and library preparation. For E7.0 samples , there were four samples per pool (two/group), three pools total, one pool per lane. For E7.25 and E7.5 samples (24 samples/time point), there were four samples per poll (one/group), six pools total, one pool per lane. Paired-end (50\u2005bp) sequencing was performed (Illumina HiSeq 4000).P-value threshold of 0.05. At the E7.5 time point, three outliers were detected and removed from the analysis: one from the 6J vehicle-treated group and two from the 6N PAE group. Final sample sizes are noted in the figure captions. We used gProfiler 0.1.6 . For the E7.0 time point, network analysis was limited to 35 molecules (genes/proteins/protein complexes) per network due to the small number of input genes. For the E7.25 and E7.5 time points, analysis was limited to 70 focus molecules per network. Networks were ranked by the \u2212log10 Fisher's exact P-value testing the likelihood of a similar network being formed by the same number (35 or 70) random molecules. Gene lists were also compared to the CiliaCarta compendium .The gene expression data browser web tool was developed using the R shiny framework hosted through the Apache"}
+{"text": "Pseudomonas aeruginosa is an opportunistic pathogen that often causes nosocomial infections resistant to treatment. Rates of antimicrobial resistance (AMR) are increasing, as are rates of multidrug-resistant (MDR) and possible extensively drug-resistant (XDR) infections. Our objective was to characterize the molecular epidemiology and AMR mechanisms of this pathogen.P. aeruginosa isolates collected in the Philippines in 2013\u20132014; derived the multilocus sequence type (MLST), presence of AMR determinants and relatedness between isolates; and determined concordance between phenotypic and genotypic resistance.We sequenced the whole genome for each of 176 blaVIM. Concordance between phenotypic and genotypic resistance was 93.27% overall for six antibiotics in three classes, but varied among aminoglycosides. The population of P. aeruginosa was diverse, with clonal expansions of XDR genomes belonging to MLSTs ST235, ST244, ST309 and ST773. We found evidence of persistence or reintroduction of the predominant clone ST235 in one hospital, and of transfer between hospitals.Carbapenem resistance was associated with loss of function of the OprD porin and acquisition of the metallo-\u03b2-lactamase (MBL) gene blaVIM-2), with differences in gene composition and synteny from the P. aeruginosa class 1 integrons described previously.Most of the ST235 genomes formed a distinct lineage from global genomes, thus raising the possibility that they may be unique to the Philippines. In addition, long-read sequencing of one representative XDR ST235 isolate identified an integron carrying multiple resistance genes (including The survey bridges the gap in genomic data from the Western Pacific Region and will be useful for ongoing surveillance; it also highlights the importance of curtailing the spread of ST235 within the Philippines. Pseudomonas aeruginosa is an opportunistic pathogen that often causes nosocomial infections , particularly in immunocompromised patients.  pneumonia cases, with the Philippines reporting P. aeruginosa as the most common etiological agent. . In contrast, resistance to aminoglycosides and fluoroquinolones remained relatively stable or decreased slightly in the same period . The ARSP has also reported multidrug-resistant (MDR) rates of 21\u201323% and possible extensively drug-resistant (XDR) rates of 13\u201318% in recent years.  for confirmation in 2013 and 2014, respectively, 179 isolates from 17 sentinel sites were selected for WGS, as previously described. , and isolates collected on hospital day 3 or later were categorized as hospital-acquired (HA). , ceftazidime (CAZ), ciprofloxacin (CIP), cefepime (FEP), gentamicin (GEN), imipenem (IPM), meropenem (MEM), tobramycin (TOB), and piperacillin-tazobactam (TZP) . DNA extracts were multiplexed and sequenced on the Illumina HiSeq platform  with 100-bp paired-end reads. Isolate 13ARS-VSM740 was also sequenced with the PacBio RSII platform (Pacific Biosciences). Raw sequence data were deposited in the European Nucleotide Archive (ENA) under the study accession PRJEB17615. Run accessions for Illumina data are provided on the Microreact projects. The PacBio data were deposited under run accession ERR3284501.A total of 179 P. aeruginosa strain LESB58 (accession FM209186), as previously described.  were determined from assemblies with Pathogenwatch (https://pathogen.watch/) and with MLSTcheck v1.007001, and from sequence reads with ARIBA  or NCGM2_S1 .  belonging to the same or to different hospitals, using a script from https://github.com/simonrharris/pairwise_difference_count. Maximum likelihood phylogenetic trees were generated with RAxML, (Evolutionary relationships between the 176 isolates were inferred from core single-nucleotide polymorphism (SNP). A core gene alignment was performed with Roary v3.11.3, using the mafft aligner option and minimum percentage identity for blastp of 90%. Evolutionary relationships between 169 isolates from groups 1 and 2 were inferred from SNPs by mapping the paired-end reads to the reference genomes of P. aeruginosa genomes with linked geographical and temporal information, collected mainly between 2007 and 2017, for which raw Illumina paired-end sequence data were available at the ENA. A tree of 904 genomes was inferred with FastTree  as a query, then translated in silico to inspect the integrity of the coding frames. A 444 or 442 amino-acid protein that included a START and a STOP codon was considered functional.Known AMR determinants were identified with ARIBA (The genomic predictions of AMR derived from the presence of known AMR genes and mutations (test) were compared with the phenotypic results (reference), and concordance was computed for each of six antibiotics . Isolates with either a resistant or an intermediate phenotype were considered non-susceptible. An isolate with the same outcome for both the test and reference (i.e. both susceptible or both non-susceptible) was counted as a concordant isolate. Concordance was the number of concordant isolates as a percentage of the total number of isolates assessed.All project data, including inferred phylogenies, AMR predictions and metadata were made available through Microreact.Ethical approval is not applicable. This study uses archived bacterial samples processed by the ARSP. No identifiable data were used in this study.P. aeruginosa isolates submitted for WGS, 176 passed quality control and were confirmed in silico as P. aeruginosa (n\u00a0=\u00a047) of the isolates from patients aged 65 years or older. Fifty-eight per cent (n\u00a0=\u00a0102) of the isolates were from HA infections. In terms of specimen type, 53% (n\u00a0=\u00a094) of isolates were from respiratory samples .Of the 179 Fig.\u00a01A-C, n\u00a0=\u00a0100), 10 isolates were susceptible to carbapenems but resistant to other antibiotics, and 66 isolates were susceptible to all nine antibiotics .Isolates were tested for susceptibility to nine antibiotics representing five classes . Among the 81 carbapenem-resistant isolates that were also resistant to third-generation cephalosporin ceftazidime and/or fourth-generation cephalosporin cefepime, 67 isolates carried acquired MBL genes blaVIM-2 (n\u00a0=\u00a061 genomes), blaVIM-6 (n\u00a0=\u00a01), blaIMP-26 (n\u00a0=\u00a04) or blaNDM-1 (n\u00a0=\u00a01), while five carried disrupted oprD genes plus acquired extended-spectrum \u03b2-lactamase (ESBL) genes blaPER-1 (n\u00a0=\u00a03), blaCTX-M-15 (n\u00a0=\u00a01) or AmpC-like gene blaDHA-1 (n\u00a0=\u00a01). The remaining eight isolates harboured other \u03b2-lactamase genes, but their carbapenem-resistance mechanisms remain uncharacterized. Of the 76 isolates susceptible to carbapenems, 75 carried either a full-length OprD porin (444 amino acids) without any known mutations, or a 442 amino acid-long OprD protein with an intact reading frame, while one isolate was missing the STOP codon in the oprD gene.Of the 18 isolates resistant to imipenem and meropenem but not to other \u03b2-lactam antibiotics, 17 carried both loss-of-function disruptions in the OprD porin, and disruptions or known non-synonymous mutations in the NalC  and/or NalD (S32N) regulators of the MexAB-OprM multidrug efflux pump, suggesting that their resistance is due to a combination of reduced influx and increased efflux of the carbapenem antibiotics  belonging to ST235, followed by ST309 , ST244 and ST773 . The majority of the STs  were singletons (represented by only one genome), most of which (n\u00a0=\u00a042) were contributed by the susceptible isolates. Indeed, the resistant isolates  exhibited less clonal diversity than the susceptible isolates . ST235 represented 43.6% (n\u00a0=\u00a048) of the resistant isolates but only 1.5% (n\u00a0=\u00a01) of the susceptible isolates, and was predominantly a nosocomial clone in the Philippines (36 HA vs 13 CA isolates), spread across 13 hospitals.A total of 79 STs were identified (n\u00a0=\u00a064) including PA14, group 2 (n\u00a0=\u00a0105) including PAO1 and the more distantly related group 3 (n\u00a0=\u00a07) including PA7 . All three groups included carbapenem-resistant isolates and susceptible isolates, though most isolates in group 2 were susceptible  and most in group 1 were resistant .The phylogenetic tree of 176 genomes from the Philippines comprises three major groups,  \u2013 found across multiple hospitals and resistant to multiple antibiotics. Most of the XDR isolates  were found in ST235, ST244, ST309 and ST773, and most  carried blaVIM , . Clade I (n\u00a0=\u00a010) was represented in five hospitals in the Luzon (north) and Visayas  island groups, while clade II (n\u00a0=\u00a039) was represented in 10 hospitals from north to south of the country. The phylogeographic structure of the tree and the relatedness between genomes showed evidence of dissemination of ST235 between hospitals. Within clade Ib , one genome from hospital NKI differed from two genomes from hospital BRH by seven and eight SNPs, respectively. Within clade IIb , the genetic differences between isolates from the same hospital  were not significantly different to those between isolates from different hospitals . The close relationships and the common repertoire of resistance genes between isolates from different hospitals support inter-hospital transmission.The higher prevalence of ST235 prompted us to look further at this clone. The phylogenetic tree of 49 ST235 isolates comprised two distinct clades with different geographic distribution (n\u00a0=\u00a024) formed at least three clusters within clade IIb, two of which exhibited discrete temporal distribution , suggesting that they could represent hospital outbreaks. In agreement with this, the genomes from different patients within clade VSM-3 differed by an average of 11.55 pairwise SNPs (range 0\u201324). We also identified isolates within VSM-3 that were collected nine or more months apart , suggesting that ST235 can either persist in or be reintroduced to the hospital environment.The genomes from the hospital VSM , revealed the acquisition of blaVIM-2, blaOXA-10, catB3, aadA1 (ANT(3\u201d)-Ia) and acc(6\u2019)-Ib within a class 1 integron integrated in the chromosome at position 977 774 . The ciprofloxacin resistance gene qnrVC and the rifampin-resistance gene arr-2 were located on a different class 1 integron elsewhere in the genome.The distribution of acquired resistance genes and mutations showed that resistance determinants differed between clades I and II, with patterns that were consistent with the acquisition of multiple genes simultaneously by mobile genetic elements. Long-read sequencing of isolate 14ARS-VSM0870, representative of the XDR resistant profile CAZ FEP IPM MEM TZP GEN TOB AMK CIP  and the United States of America (USA) (n\u00a0=\u00a0205). The Philippine genomes were found throughout the tree, indicating that the P. aeruginosa population captured in our survey largely represents the global diversity of this pathogen. Notably absent were the epidemic clones ST111 and ST175 , which, together with ST235, are responsible for MDR and XDR nosocomial infections worldwide.We placed the genomes from our retrospective collection in the global context of 904 contemporary n\u00a0=\u00a02); clade 2 showed the broadest geographic distribution across four continents and also included isolates from this study (n\u00a0=\u00a03); clade 3 comprised exclusively isolates from the Philippines , which raises the possibility that this lineage of ST235 is characteristic to the Philippines; however, introductions from the other globally dispersed lineages may also occur, as shown in clades 1 and 2.A more detailed tree of 96 ST235 genomes of global distribution showed three major clades: clade 1 was represented by isolates from Japan, the Philippines, Poland and Thailand , but an exhaustive search would require additional analyses. Second, the regulatory pathways of some mechanisms are not fully understood, such as those that regulate AmpC. (oprD gene.There are clear limitations in the genomic predictions of AMR for n\u00a0=\u00a049), found throughout the Philippines. ST235 is a well characterized international epidemic clone causing drug-resistant nosocomial outbreaks. (blaVIM-2 and belonging to ST235 were reported from Malaysia, the Republic of Korea and Thailand. (P. aeruginosa in a hospital in the United Kingdom of Great Britain and Northern Ireland. (The most prevalent clone in our data set was ST235 (27.8% of the isolates, P. aeruginosa, (P. aeruginosa, (It was previously proposed that ST235 emerged in Europe around 1984, coinciding with the introduction of fluoroquinolones, and then disseminated to other regions via two independent lineages, acquiring resistance determinants to aminoglycosides and \u03b2-lactams locally. (Country-specific ST235 lineages have been reported previously, (P. aeruginosa infections in the Philippines may be largely driven by a local lineage of the international epidemic clone ST235. A recent study in a hospital in Jakarta, Indonesia analysed the population composition of P. aeruginosa before and after a multifaceted infection control intervention, with the relative abundance of ST235 almost halved in the 10 months post-intervention. (In conclusion, our detailed description of the epidemiology and resistance mechanisms of ST235 in the Philippines suggests that the burden of XDR"}
+{"text": "Viburnum opulus fresh juice (FJ), phenolic-rich juice (PJ), and the bioavailable fractions (DFJ and DPJ). The data obtained indicate that the V. opulus samples achieved after in vitro digestion had an influence on cellular glucose and lipid metabolism. The bioavailable fraction of both digested juices stimulated glucose uptake and decreased lipid accumulation by L6 myoblasts and HepG2 hepatocytes. Both DFJ and DPJ reduced the secretion of inflammatory cytokines by 3T3-L1 adipocytes: interleukin-6 (IL-6) and tumor necrosis factor-\u03b1 (TNF-\u03b1). Simultaneously, DFJ and DPJ enhanced oxidative stress in MIN6 cells and decreased glucose-stimulated insulin secretion (GSIS). UPLC\u2013MS analysis revealed qualitative and quantitative changes in hydroxycinnamic acids. In particular, the content of chlorogenic acid decreased drastically; its content in the bioavailable fraction was almost 7 times and 30 times lower than in the FJ and PJ, respectively. Our results suggested that although the phenolic compounds of V. opulus juices undergo transformation during digestion, they are still potent antioxidant agents with biological activity.In the present study, an in vitro digestion method has been used to assay the influence of the physiological conditions in the mouth, stomach, and intestine on the stability and activity in different cell models of the main phenolic compounds from  Viburnum opulus L. belongs to the Viburnum L. genus from the Adoxaceae family and this shrub is common in natural habitats in Europe, North Asia, and North Africa, and also in the central zone of Russia. The fruit of V. opulus has a light red, red, or dark red skin, is bitter with a strong astringent taste, and is therefore not preferred for direct consumption [V. opulus fruits and fruit juice are widely used for medicinal purposes as a useful remedy against kidney and stomach problems, high blood pressure, cough and cold, tuberculosis, rheumatic aches, liver disease, and diabetes [V. opulus fruit and fruit juice have also been demonstrated in studies using various cell lines. For example, our previous study showed that V. opulus fruit components decreased the uptake of fluorescent glucose analogue 2-amino)-2-deoxyglucose by human adenocarcinoma Caco-2 cells [V. opulus fruit juice and juice enriched with phenolic compounds decreased glucose-stimulated insulin secretion, increased insulin secretion at a low glucose concentration, and intensified free fatty acid uptake and lipid accumulation in the mouse insulinoma cell line MIN6 [V. opulus fruit phytocompounds influenced the accumulation of lipids and expression of lipogenic proteins involved in metabolic disorders in HepG2 cells [V. opulus fruit juice decreased levels of intracellular reactive oxygen species (ROS) in mouse pancreatic beta MIN6 cells, as well as in mouse differentiated adipocytes 3T3-L1 and in human hepatoma HepG2 cells [V. opulus fruit inhibits the proliferation of human colon cancer cells DLD-1 and HT-29 by increasing DLD-1 cell apoptosis and cell cycle arrest at the G2 phase in HT-29 cells [sumption . Howeversumption ,3. In Tusumption . The V. diabetes . The pubdiabetes ,6,7, antdiabetes , anti-obdiabetes ,10, and diabetes ,12,13,14-2 cells . The nexine MIN6 . AdditioG2 cells . It has G2 cells ,10,16,1729 cells .V. opulus fruit. However, the physiological importance of an orally administered phytocompound depends on its availability for intestinal absorption and subsequent interaction with target tissues. During the digestion process, food components are transformed as a consequence of a variety of digestive enzymes, variance in the pH values, and other physical and biochemical aspects. However, the bioavailability of the active compounds is generally neglected in the vast majority of the in vitro studies. Our previous study identified V. opulus fruit juice as a rich source of phenolic compounds, with the highest content of chlorogenic acid, followed by flavanols and anthocyanins [V. opulus fruit extracts [V. opulus fruit), depending on the type of extract. Moreover, the cited studies showed lower free radical scavenging capacity and metal reducing capacity of serum available and colon available fractions than undigested extract.The demonstrated results of in vitro studies show the promising health benefits of ocyanins . To the extracts . The resV. opulus juice during in-vitro-simulated mouth and gastrointestinal digestion of fresh juice (DFJ) and phenolic-rich juice (DPJ). As a cellular model for biological study, different types of cells were chosen, whose activity may be influenced by the bioavailable fraction of extracts obtained after their digestion and absorption, i.e., myoblasts (L6 cell line), hepatocytes (HepG2 cell line), insulinoma \u03b2 cells (MIN6 cell line), and adipocytes (3T3-L1 cell line). These cellular models are commonly used in studies exploring the regulation of lipids and carbohydrate metabolism. Therefore, the research especially focused on the influence of digested and absorbed fractions of V. opulus preparations on cellular glucose uptake and lipid metabolism by L6 and HepG2 cells, the adipogenesis and secretion of pro-inflammatory cytokines by 3T3-L1 cells, as well as insulin secretion by MIN6 cells. To the best of our knowledge, this is the first study demonstrating the cell-based in vitro activity of V. opulus juice after digestion treatment, which additionally compares the effect of the digestion process on selected cellular effects.Therefore, the use of plant extracts as well as isolated bioactive compounds previously subjected to digestion in cell-based research is justified. Thus far, some studies have confirmed the effect of bioactive phytocompounds after the in vitro digestion process on their biological activity determined in cell models. Stanisavljevi\u0107 et al. showed that chokeberry juice digested in the presence of the food matrix markedly reduced the proliferative rate of Caco-2 cells . SimilarV. opulus preparations on metabolic activity allowed the determination of the maximum concentration without cytotoxic effect (IC0) on the metabolic activity of various types of cell lines, i.e., MIN6, 3T3-L1, and HepG2 [V. opulus for both juices was estimated at a concentration of 50 \u00b5g/mL for digested fresh juice (DFJ) and 12.5 \u00b5g/mL for digested purified juice (DPJ). The use of two-times-lower doses for digested samples resulted from the purification process of DFJ and DPJ, which caused a two-times reduction in their volume compared to undigested samples. As presented in V. opulus samples had no effect on the cell metabolic activity of HepG2 and L6 cells. Because the digested food reached the intestinal epithelium as the first target organ, the effect of samples on Caco-2 cells\u2019 metabolic activity was additionally studied  on the cellular antioxidant activity using a DCF probe and cellular FFA uptake  was determined.Reactive oxygen species (ROS) locally produced in the hepatic tissue seems to be involved in the pathogenesis of metabolic disorders . It is w0 decreased the intracellular ROS level by 10% for FJ and 25% for PJ compared to the control cells treated with the vehicle only  of oleic acid (OA) or/and palmitic acid (PA) for 24 h. Due to the fact that high levels of free fatty acids, especially palmitic acid, under steatosis conditions lead to insulin resistance and glucose uptake disturbance [To evaluate the cytoprotective potential of digested turbance ,26, in tAs presented in V. opulus juice samples on rat skeletal muscle L6 cells . In V. opulus juice samples on 2-NBDglucose analogue uptake in L6 under increased levels of OA and/or PA was evaluated. All of the tested V. opulus juice samples showed an ability to increase 2-NBDG uptake  was the most effective and reduced the ROS level by almost 25% in comparison to the control cells. Surprisingly, the digestion process deprived the preparation of the antioxidant activity in the studied cellular model. Whereas DFJ had no effect on the ROS level, the DPJ increased oxidative stress by at least 5%. Additionally, it was confirmed that PJ stimulated free fatty acid uptake by 7%, which can further lead to increased lipid accumulation and metabolism deregulation in \u03b2-cells  was determined. As presented in V. opulus samples had an inhibitory effect on GSIS, reducing the insulin level by 35\u201360% in comparison to high-glucose-treated cells. PJ was a stronger reducer of GSIS than FJ. On the other hand, DPJ had a 10% lower negative effect on insulin secretion than PJ. At a low-glucose concentration (2 mM), all samples showed increased insulin secretion by 10\u201320% and FJ was the strongest activator of this process.The MIN6 cell line displays characteristics of pancreatic \u03b2-cells insulin secretion in response to glucose . TherefoV. opulus juice samples was studied on the mouse 3T3-L1 preadipocytes. The adipogenesis process is connected to the differentiation of preadipocytes to mature adipocytes. As a result, the formation of lipid droplets within the cells occurs. As presented in 0 significantly reduced the accumulation of lipid droplets compared to the control cells by at least 20%. These data were confirmed by microscopic observation of cells with fluorescence dye that accumulates in lipid droplets  had potential lower by 5% than the undigested sample, the DPJ had a comparable effect to PJ. The same samples reduced the secretion of TNF-\u03b1 protein to 75\u201380% (V. opulus juice samples downregulated the secretion of IL-6 protein to 40\u201370%. The most intensive reduction was observed for PJ (by 60%) and FJ (by 20%), whereas the digested samples decreased the IL-6 level to 10\u201315% in comparable way  in DFJ was noted. The OUT fraction, representing bioavailable hydroxycinnamic acids, was characterized by a higher content of all identified compounds than the IN fraction (colon available). Their total content in the OUT fraction was 62.14% higher than in the IN fraction in the case of FJ and 4.5 times higher for the PJ.Both the V. opulus juice samples on biological activity was evaluated. The direct comparison was performed between fresh juice (FJ) and purified juice (PJ) and their corresponding bioavailable fractions (DFJ and DPJ) obtained after tree-step static in vitro digestion. The phenolic composition of FJ and PJ described in the previous article included hydroxycinnamic acids, flavanols, anthocyanins, and flavonols [V. opulus fresh fruits  and its isomers\u2014neochlorogenic (3-CQA) and cryptochlorogenic acids (4-CQA)\u2014were responsible for the presented activities. Chlorogenic acid itself is relatively stable in the stomach at low pH in humans and is hydrolyzed in the lower sections of the alimentary tract to caffeic and quinic acids [V. opulus caffeoylquinic acid derivatives.Analyzing the phenolic composition of the digested ic acids . Neverthic acids . It needic acids ,48,49 alic acids . Furtheric acids . Our resic acids . Due to V. opulus phenolics, especially the bioavailable fraction of DPJ, protected L6 myoblast cells against lipid accumulation and damage caused by ROS elevation. Some reports indicated that phenolic compounds from plant extracts have strong antioxidant activity in skeletal muscle cells [V. opulus phenolic compounds as cytoprotective agents against lipotoxicity induced by FFA in skeletal muscle cells. Ho et al. showed that cyanidin-3-O-glucoside, cyanidin-3-O-sambubioside, procyanidin B2, procyanidin C1, and some hydroxycinnamic acid derivatives extracted from elderberry had strong antioxidant activity and the ability to decrease oleic acid uptake, and they significantly increased glucose uptake by human skeletal muscle cells [V. opulus juice samples, after the in vitro digestion process, also improved muscle function by regulating mitochondrial function and cellular energy metabolism [V. opulus juice phenolic compounds as inhibitors of PPAR\u03b3 in 3T3L1 cells [V. opulus phenolic compounds [V. opulus juice in L6 cells against FFA-induced steatosis may be the reason for some of the molecular mechanisms involving the AMPK pathway or other protein factors involved in lipid and glucose metabolism. To prove this hypothesis, additional studies on protein expression must be performed in future research.Lipotoxicity, characterized by the accumulation of ectopic lipids in skeletal muscle, is a major factor in the etiologies of FFA-induced insulin resistance, type 2 diabetes, and other metabolic dysfunction in skeletal muscle . There ile cells ,53,54, wle cells . Howeverle cells . This retabolism ,57. Ong tabolism . In additabolism . Additiotabolism . Deng ettabolism . It is wL1 cells . A studyompounds . These rV. opulus fruit juice samples on adipogenesis regulation in 3T3-L1 cells was also studied. As shown previously, V. opulus phenolic compounds were able to decrease the differentiation of mouse preadipocytes [V. opulus juice samples  may be correlated with the presence of chlorogenic acid, which has been demonstrated as a reducer of the cellular release of TNF-\u03b1, IL-1, and IL-6 cytokine [V. opulus juice was observed in Saos-2 cells, therefore showing that the juice may be important not only for the metabolism of bone tissue but also may delay its demineralization resulting from obesity [V. opulus fruit juice\u2019s biological activity, there was one negative aspect determined. Previously, it was shown that V. opulus juice might induce MIN6 cells\u2019 functional failure through the increase of ROS generation, FFA uptake, and, finally, the reduction of GSIS [V. opulus juice could be involved in insulin resistance development and hyperglycemia elevation. Here, it was demonstrated that the digestion process of V. opulus juice had no protective effect on MIN6 cells\u2019 functionality in regard to the studied activities; therefore, pancreas damage may be caused by its elevated consumption.The effect of the digestion process of ipocytes ,10, whiccytokine . Increascytokine . The red obesity . Despite of GSIS . These rReference phenolic compounds  were obtained from Phytolab . Pancreatin from porcine pancreas (P1625), \u03b1-amylase from porcine pancreas (A3176-1Mu), pepsin from porcine gastric mucosa (P6887), mucin from porcine stomach (M2378), and bile from bovine and ovine (B8381) were provided by Sigma-Aldrich . All other reagents used in our study, if not stated otherwise, were also obtained from Sigma-Aldrich. All cell culture reagents were obtained from Life Technologies . Tissue culture plastics were supplied by Greiner Bio-One GmbH . All the experimental measurements, if not stated otherwise, were performed using the Synergy 2 BioTekMicroplate Reader .V. opulus L. fruits were obtained from Rog\u00f3w Arboretum, Warsaw University of Life Sciences  (account number 18162). The procedure for obtaining V. opulus fruit juices used in this study is described elsewhere [v/v) mixture at concentration 100 mg/mL.Fresh lsewhere . The fre3) and mixed with 10 mg of mucin and 20 mg of \u03b1-amylase. The mixture was incubated for 5 min in a shaking water bath at 37 \u00b0C. For the gastric digestion step, the pH value of the mixture was adjusted to 2 with 6 M HCl and 2 mg of pepsin was added, and then it was incubated for 2 h in the shaking water bath at 37 \u00b0C. For the small intestinal procedure, after adjusting the pH of the gastric digesta to 7.5 (1 M NaHCO3), 4.5 mL of pancreatin and bile salts mixture  was added, and the mixture was placed in a dialysis tube (molecular mass cut-off 12 kDa). Next, this cellulose dialysis tube was placed in a 150 mL glass beaker filled with 25\u201330 mL of the phosphate buffer (pH 7.5) , and the beaker was sealed with parafilm. Sample was incubated for 2.5 h in the shaking water bath at 37 \u00b0C. The dialysis tube content was considered the part of digesta that reach the colon (IN fraction), whereas the OUT fraction (phosphate buffer fraction), which contained the compounds capable of crossing the membrane, was considered the bioavailable fraction of the V. opulus juices. To ensure the inactivation of the enzymes, both fractions were heated in 78 \u00b0C for 10 min [The in-vitro-simulated digestion model consisting of a three-step procedure that simulated digestion in mouth, stomach, and small intestine was performed on FJ and aqueous PJ solution (1 mg/mL) as described previously ,64 with r 10 min . After tr 10 min . PhenoliV. opulus FJ and PJ before and after digestion process were analyzed for the composition of hydroxycinnamic acids using the Acquity ultraperformance liquid chromatography (UPLC) system coupled with a quadruple-time of flight mass spectrometry (Q/TOF-MS) instrument  equipped with an electrospray ionization (ESI) source as described previously [The eviously . SeparatHuman hepatoma HepG2 cell line was obtained from Leibniz Institute DSMZ\u2014German Collection of Microorganisms and Cell Cultures  and grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and antibiotics . Rat skeletal muscle myoblast L6 cell line was supplied by ECACC  and grown in Dulbecco\u2019s Modified Eagle\u2019s Medium (DMEM) with high glucose level, 10% fetal bovine serum (FBS), and antibiotics. The murine-adherent insulinoma MIN6 cells were kindly provided by Dr Jun-ichi Miyazaki from the Division of Stem Cell Regulation Research, Osaka University, Japan  and grow2 and 95% atmosphere at 37 \u00b0C. If not stated otherwise, after 24 h of cell seeding, the medium was changed into serum-free medium and tested V. opulus juice samples were added for another 24 h. For stimulation of steatosis of HepG2 and L6 cells, free fatty acids  were added at concentration of 300 \u00b5M for HepG2 cells and at concentration of 100 \u00b5M OA and 75 \u00b5M PA for L6 cells. Tested fatty acids were dissolved in 100% methanol at concentration of 100 mM and were further diluted with culture medium. Tested V. opulus juice preparations were dissolved in 50% DMSO in PBS at concentration of 200 mg/mL and further diluted with culture medium. The highest percentage of methanol and DMSO did not exceed 0.005% and did not affect the metabolic activity of cells.All cell culture experiments were performed in a humidified 5% COAll the experimental measurements were performed using the Synergy 2 BioTek Microplate Reader . Microscopic observations were performed using fluorescent microscope Nikon TS100 Eclipse  under 200\u00d7 magnification. All cell culture reagents were obtained from Life Technologies .4 cells/well density in complete medium and grown overnight and then incubated in the presence of studied V. opulus juice samples for another 24 h, if not stated otherwise. After this, fluorescent reagent was added for 30 min and fluorescent signal at F530/590 nm was measured.Metabolic activity was evaluated with fluorescent measurements with PrestoBlue  according to the manufacturer\u2019s instructions. Cells were seeded into 96-well plates at 1 \u00d7 10V. opulus juice samples on intracellular generation of reactive oxygen species (ROS) was investigated using dichloro-dihydro-fluorescein diacetate (DCFH-DA) chemical. Cells were seeded into a 96-well plate at a density of 1 \u00d7 104 cells/well overnight. After 24 h, tested preparations were added and cells were incubated with samples for another 24 h. After the cells\u2019 treatment with preparations, the cells were washed with phosphate-buffered saline (PBS) and incubated with 10 \u00b5M DCF for 30 min. For positive control, tert-BOOH (t-BOOH) was used at a concentration of 500 \u00b5M. Fluorescent signal at F485/530 nm was analyzed.The effect of 4 cells/well and grown to full confluence for each of experiment (2\u20133 days). After reaching confluence, cells were incubated in serum-free medium for 24 h with the V. opulus juice samples or/with the presence of tested fatty acid. After treatment, cells were washed with cold PBS, fixed in 5% paraformaldehyde for 30 min, and stained with Nile Red dye at the final concentration of 1 \u00b5g/mL for 40 min. The lipid-bound Nile Red fluorescent signal at F485/530 was measured. In regard to 3T3-L1 cells, the level of lipid accumulation was determined at the 7th day after adipogenesis induction. Fatty acid uptake was measured using Fatty Acid Uptake Kit . After the cells\u2019 treatment with V. opulus juice preparations, a fluorescent probe TF2-C12 was added to serum-free medium and the fluorescent signal at F485/530 nm was measured after 1 h incubation with fluorescent analogue.Cells were seeded into 96-well plate at a density of 2 \u00d7 104 cells/well and incubated for 24 h. Briefly, after 24 h of treatment with V. opulus juice samples or/with tested fatty acids in serum-free medium, 150 \u00b5M of fluorescent glucose analogue 2-NBDG amino)-2-deoxyglucose) was added in glucose- and serum-free medium. After 2 h of incubation with NBDG, cells were washed twice with serum- and glucose-free medium and fluorescent signal at F485/530 nm was measured immediately.Cells were seeded into 96-well plate at density of 1 \u00d7 105 cells/well and cultured 48 h before the experiment. Then, they were pre-incubated for 1 h with buffer . Subsequently, cells were incubated with V. opulus juice samples for 1 h, and buffer samples were collected. The same cells were incubated for another 1 h with fresh buffer containing 20 mM glucose tested preparations, and buffer samples were collected. The insulin secreted in buffers was measured with a Mercodia Mouse Insulin ELISA kit  according to the manufacturer\u2019s procedure. To normalize insulin level, in cell lysates obtained with 0.1% Triton X-100 with PBS, the protein content was quantified with a Bradford assay.Cells were seeded on 24-well plate at density 2 \u00d7 10p \u2264 0.05 was considered statistically significant.Unless stated otherwise, all the biological results are presented as means of 3\u20136 repeated experiments \u00b1 SEM. All calculations were evaluated for significance using one-way ANOVA followed by Dunnett\u2019s test with the GraphPad Prism 6.0 software . V. opulus fresh juice and in a phenolic-rich fraction obtained from the juice. The results demonstrated that the juice matrix is an important factor influencing the stability of hydroxycinnamic acids, quantitatively the main phenolic component of the tested samples. Additionally, the V. opulus digested juices revealed biological potential in all studied cellular models. After cells\u2019 treatment with the bioavailable juice fractions, the decrease in intracellular oxidative stress and the lipid accumulation were sustained, and an enhancement in glucose uptake was observed. The adipogenesis process was downregulated, which was followed by a reduction in the secretion of inflammatory cytokines. However, all studied juices, with or without digestion treatment, showed lipotoxic potential against pancreatic beta MIN6 cells, and they decreased the GSIS process. The observed in vitro biological activity clearly indicates the sustaining of the biological effectiveness of Viburnum opulus juice after its digestion process. However, due to V. opulus\u2019 cytotoxic potential against pancreatic cells, its usage as a dietary supplement component in metabolic disorder prevention needs further evaluation. Future studies should also focus on the activity of the colon available compounds (IN fraction) after their treatment with gut microbiota.In this study, we examined the effect of in vitro mouth\u2013gastric\u2013intestine digestion on the biological activity of phenolic components present in"}
+{"text": "Salvia miltiorrhiza, has shown various pharmacological properties. However, its effect on chronic unpredictable stress (CUS)-induced depression phenotypes and the underlying mechanism remain unclear. Therefore, the aim of this study was to investigate whether CPT could exert an antidepressant effect.Cryptotanshinone (CPT), a natural quinoid diterpene, isolated from We investigated the effects of CPT in a CUS-induced depression model and explored whether these effects were related to the anti-inflammatory and neurogenesis promoting properties by investigating the expression levels of various signaling molecules at the mRNA and protein levels.Administration of CPT improved depression-like behaviors in CUS-induced mice. CPT administration increased the levels of doublecortin-positive cells and reversed the decrease in the expression levels of brain-derived neurotrophic factor (BDNF)/tyrosine kinase receptor B (TrkB) signaling transduction, as well as the downstream functional proteins, phosphorylated extracellular regulated protein kinases (p-ERK), and cyclic adenosine monophosphate (cAMP)-response element-binding protein levels (p-CREB) in hippocampus. CPT treatment also inhibited the activation of microglia and suppressed M1 microglial polarization, while promoting M2 microglial polarization by monitoring the expression levels of arginase 1 (Arg-1) and inducible nitric oxide synthase (iNOS), and further inhibited the expression of proinflammatory cytokines, including interleukin (IL)-1, IL-6, and tumor necrosis factor-\u03b1 (TNF-\u03b1), and increased the expression of the anti-inflammatory cytokine IL-10 by regulating nuclear factor-\u03baB (NF-\u03baB) activation.CPT relieves the depressive-like state in CUS-induced mice by enhancing neurogenesis and inhibiting inflammation through the BDNF/TrkB and NF-\u03baB pathways and could therefore serve as a promising candidate for the treatment of depression. In receStudies have shown that neurogenesis and neuroinflammation play important roles in the pathogenesis of depression ,6,7. ChrNeuroinflammation is also a key cause of the onset, exacerbation, and recurrence of depression . A priorSalvia miltiorrhiza bunge, which has been shown to exhibit various pharmacological effects, including anticancer, anti-inflammatory, antibacterial, antioxidant, and neuroprotective effects [Cryptotanshinone (CPT) is a natural quinoid diterpene isolated from the dried roots and rhizomes of  effects ,23,24. F22.1ad libitum.Male C57BL/6 mice  were purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd.  20190003). The mice were bred under controlled temperature (22 \u00b1 2\u00b0C) and relative humidity (55 \u00b1 5%), with a 12\u2009h light\u2013dark cycle, and were allowed access to food and water Ethical approval: The research related to animals\u2019 use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. All animal experimental protocols were approved by the Animal Experimental Ethics Committee of Binzhou Medical University Hospital .2.2The experimental design and drug treatment schedule are shown in 2.3Anhedonia is one of the core symptoms of depression in humans. In this experiment, the sucrose preference experiment was primarily used to evaluate the degree of anhedonia in mice. During the entire CUS procedure, control and experimental mice were given two bottles of pure water for adaptation to avoid side preference. Water was restricted for 4\u2009h before the experiment, and the mice were kept in a single cage with access to two bottles: one with pure water and the other with 1% (w/v) sucrose solution. Fluid consumption was recorded by weight. Finally, the sucrose preference value was calculated using the following formula:2.4Mice were kept in glass cylindrical containers (25\u2009cm height \u00d7 10\u2009cm diameter) filled with tap water to a height of 15\u2009cm from the bottom (maintained at 24 \u00b1 1\u00b0C). Each mouse was recorded for 6\u2009min, and the time to first immobility during the first 2\u2009min and immobility in the last 4\u2009min were recorded. Immobility is defined as the state in which the mouse floated on the surface of the water, showing only slight movements necessary to maintain breathing and floating .2.5FUST is an experiment that measures reward-seeking behavior in rodents based on their interest in the urine odor of the opposite sex. The experimental procedure was performed as previously described . Briefly2.6The locomotor activity was measured in a SuperFlex Fusion open field cage . Individual mice was allowed to acclimate to the single cage for 2\u20134\u2009h prior to the test. The animals were gently placed in the center of the test apparatus (40\u2009cm \u00d7 40\u2009cm \u00d7 40\u2009cm) and allowed to explore the field for 30\u2009min. Locomotor activity of the mice was monitored and recorded with infrared motion sensors mounted on top of the cage. The total distance traveled was analyzed using Fusion software .2.7\u2212\u0394\u0394CT method [The total RNA was extracted from the tissue using a Total RNA Kit , according to the manufacturer\u2019s instructions. RNA was reverse transcribed to generate cDNA using the Reverse Transcription Kit . Q-PCR was performed using SYBR Green PCR Master Mix . Cycling conditions were 5\u2009min at 95\u00b0C, followed by 10\u2009s at 95\u00b0C and 30\u2009s at 60\u00b0C for 40 cycles; the primer sequences are listed in T method ,29.2.8g for 15\u2009min at 4\u00b0C, the supernatants were collected. The protein concentration of each sample was determined using the bicinchoninic acid protein assay kit to allow equal loading of total protein. Equal amounts of protein samples were loaded in 8\u201315% sodium dodecyl sulfate-polyacrylamide gel for electrophoresis, transferred to a PVDF membrane at 100\u2009V for 90\u2009min and then blocked with 5% nonfat dry milk for 2\u2009h at room temperature under shaking conditions. After three washes in TBST  buffer, primary antibodies anti-BDNF , anti-ERK1/2 , anti-p-ERK1/2 , anti-TrkB , anti-p-TrkB , anti-\u03b2-actin , anti-CREB , anti-cAMP-response element-binding protein levels , anti-arginase 1 , anti-inducible nitric oxide synthase , anti-NF-kB , and anti-p-NF-kB p65  were added and allowed to incubate at 4\u00b0C overnight with gentle rocking. The membranes were washed with TBST and incubated with goat anti-rabbit IR Dye 680LT  or goat anti-mouse IR Dye 800CW  fluorescent secondary antibodies for 90\u2009min at room temperature and visualized using an Odyssey Infrared Imaging System (Li-COR Biosciences).Total protein from hippocampal tissues was extracted using radio immunoprecipitation assays lysis buffer  containing the phosphatase inhibitor PhosStop  and protease inhibitor phenylmethyl sulfonylfluoride . Lysates were homogenized with a tissue homogenizer and incubated on ice for 30\u2009min. After centrifugation at 12,000\u2009\u00d72.9\u00ae 546 goat anti-rabbit IgG antibodies  or Alexa Fluor\u00ae 546 rabbit anti-goat IgG antibodies  for 4\u2009h at room temperature, and then stained with 4,6-diamino-2-phenyl indole for 15\u2009min and washed three times with PBS. The sections were mounted onto poly lysine-coated glass slides, cover-slipped using fluorescence mounting medium, and observed under a confocal fluorescent microscope and photographed. The immunofluorescent positive cells on both sides of the dentate gyrus (DG) were counted manually.IF experiments were performed as described previously . Brains 2.10F test were used to test the normality and equal variance assumptions. The two-tailed t-tests were conducted for normally distributed data; Mann\u2013Whitney U test was applied to analyze the nonnormally distributed data. The statistical significance of data over the three groups was performed using one-way ANOVA followed by Sidak post hoc tests. For exons or locomotor activity testing data, two-way repeated-measures ANOVA followed by Tukey\u2019s test was used. All variables are expressed as the mean \u00b1 standard error (sem). Statistical significance was set at p < 0.05.Statistical analyses were performed using GraphPad Prism 8.0. The Shapiro\u2013Wilk test and 33.1p = 0.279; t (14) = 0.221, p = 0.8286) and immobility time (t (14) = 0.179, p = 0.8608) were not significantly altered in the CPT-treated mice compared to the control mice  on the depression-related behaviors under basal conditions, and the results showed that CPT treatment has no obvious regulatory activity on the sucrose preference  = 5.377, p < 0.05), and a pronounced decrease in the percentage of sucrose preference in CUS-treated mice was found (p < 0.05) compared with control mice, and CPT injection significantly attenuated the CUS-induced decrease in sucrose preference (p < 0.05). FUST was used to evaluate the reward-category activity of CUS-induced mouse depression model mice. Our results indicated that there were significant effects on CPT treatment  = 6.520, p = 0.006), sniffing objects  = 67.530, p < 0.001), and treatment \u00d7 sniffing objects interaction  = 7.232, p = 0.004), and further analysis showed that CUS obviously decreased the sniffing duration (p < 0.001), which was restored by CPT (p < 0.001), whereas no differences in water sniffing time were observed between the three groups .Furthermore, as demonstrated in p < 0.01) and increased immobility time (p < 0.05) compared to control mice  = 6.017, p < 0.01). CPT treatment increased this latency time (p < 0.05) and decreased the immobility time  = 5.925, p < 0.01), indicating that CPT improved CUS-induced behavioral despair in the FST. Moreover, the locomotor activity was evaluated to exclude nonspecific motor activity, and the results indicated that there was no significant difference among the groups  = 0.377, p > 0.05; timepoint, F = 28.260, p < 0.001; treatment \u00d7 timepoint, F = 1.086, p > 0.05; and total distance, F = 0.377, p > 0.05).Meanwhile, as shown in 3.2p < 0.01), whereas the number of DCX + cells was increased significantly in CPT-treated mice (p < 0.05). These data revealed that CUS significantly decreased the number of DCX-positive cells in DG, which could be reversed by CPT  = 6.875, p < 0.01; Impaired adult hippocampal neurogenesis has been implicated in the pathogenesis of depression. Therefore, we evaluated the ability of CPT to recover impaired neurogenesis in a CUS-induced depression model. The number of cells in DG labeled with DCX, a neurogenesis marker used to visualize neonatal and immature neurons, was significantly lower in the CUS mice than in the control mice  = 7.929, p < 0.01). Further analysis showed that the exon I (p < 0.001), exon II (p < 0.01), exon IV (p < 0.01), and exon VI (p < 0.001) mRNA levels in the CUS + saline group were decreased compared to the control + saline group, whereas the expression levels of exon I (p < 0.01), exon IV (p < 0.05), and exon VI (p < 0.05) mRNA levels in the CUS + CPT group were significantly increased compared with the CUS + saline group except for exon II (p > 0.05)  = 12.580, p < 0.05; exons, F = 1.526, p > 0.05; and treatment \u00d7 exons, F = 0.841, p > 0.05). WB results further verified that the CUS significantly reduced the protein levels of the hippocampal BDNF (p < 0.01), whereas the expression levels of hippocampal BDNF was increased after treatment with CPT  = 8.053, p < 0.01). The biological actions of BDNF are transduced through TrkB receptor [p < 0.01), which was reversed by CPT treatment  = 11.960, p < 0.01).To investigate the signal transduction pathways mediating neurogenesis, further research focused on BDNF/TrkB signaling, which has been reported to be associated with the pathogenic mechanisms underlying depression. Therefore, we first measured the mRNA expression of receptor ,32. Therp < 0.05), whereas the level of p-ERK in the CPT treatment group increased  = 5.7460, p < 0.05). In addition, changes in p-CREB, a key transcription factor responsible for BDNF expression [p < 0.05), whereas the level of p-CREB was increased in the CPT treatment group  = 6.9270, p < 0.01).To confirm the activation of BDNF/TrkB signaling transduction, we further tested the activation of ERK, an important signaling transduction target of BDNF/TrkB . WB analpression , were al3.4p < 0.001), whereas the expression level of Iba-1-positive cells was obviously decreased after CPT treatment  = 9.815, p < 0.001). Similarly, the levels of Arg-1 and iNOS, markers of microglia/macrophage polarization, were measured to further elucidate the mechanism underlying the anti-inflammatory effect of CPT. As shown in p < 0.01 and p < 0.05) and a significant increase in iNOS expression (p < 0.01 and p < 0.05), whereas CPT treatment group reversed the changes in Arg-1 (p < 0.05 and p < 0.05) and iNOS  = 9.842, p < 0.01; protein, F = 5.970, p < 0.05; iNOS: mRNA, F = 8.665, p < 0.01; protein, F = 5.584, p < 0.05). This finding indicated that CPT increases the polarization of M2-type microglia/macrophages, decrease the prevalence of M1-type microglia/macrophages, and promoted the polarization of M1 microglia/macrophages to the M2 phenotype.Neuroinflammation is thought to be one of the key factors involved in the etiology of depression . The micF = 6.571, p < 0.05; IL-1: F = 10.18, p < 0.01; IL-6: F = 8.756, p < 0.01; TNF-a: F = 7.873, p < 0.01). Furthermore, to confirm the regulatory mechanism of CPT on the inflammatory mediators, the activity of NF-\u03baB, a central inflammatory and proinflammatory factor, was measured, and our results showed that the levels of p-NF-\u03baB were increased by CUS (p < 0.05), and this effect was attenuated by CPT  = 5.0050, p < 0.05).Moreover, the mRNA expression of IL-10, IL-1, IL-6, and TNF-\u03b1 in the hippocampus was measured, and it was found that CUS stimulation decreased the mRNA expression of the anti-inflammatory factors Arg-1 and IL-10, whereas increasing the expression of the proinflammatory factors IL-1, IL-6, TNF-a, and iNOS, while CPT treatment restored these abnormal changes . We found that CPT alleviated the CUS induced depression-related phenotypes by promoting neurogenesis and BDNF/TrkB signaling and inhibiting microglial activation and the release of proinflammatory factors in CUS mice.The hippocampus is a key brain region for mood regulation. At the same time, studies have shown that neurogenesis in the hippocampus is one of the most unique phenomena in the mammalian brain . NeurogeBdnf gene is controlled by nine different promoters, which results in the expression of different BDNF transcripts encoding an identical protein [Bdnf is regulated by individual exons/promoters [BDNF is highly expressed in the hippocampus and is sensitive to the stress response, which can be used as a biological marker of the pathogenesis and course of depression ,40. The  protein ,42. Underomoters . Some stromoters ,45,46. Mromoters , whereasromoters . The BDNromoters . The datThe relationship between neuroinflammation and depression has been widely recognized . MicroglIn addition to the previous affective factors of CPT, there are some other functional molecular pathways that may be implicated in the antidepressant mechanism of CPT. For example, the monoamine oxidases (MAO), regulating the function of neurochemistry by degrading monoamine neurotransmitters , were deeply considered to be related to the psychiatric disorders, including depression . In the In summary, our study identified that CPT can improve depression-like behaviors in CUS-induced mice. The mechanisms may involve the restoration of hippocampal neurogenesis mediated by the BDNF/TrkB pathway and related signaling proteins, as well as the regulation of the polarization of microglia from M1 to M2 by the NF-\u03baB signaling pathway, resulting in antineuroinflammatory activity. These results provide evidence for the underlying mechanism of the antidepressant-like effects of CPT and promote its consideration as a candidate drug for the treatment of depression and other related mental diseases.Arg-1arginase 1BDNFbrain-derived neurotrophic factorCPTcryptotanshinoneCREBcAMP-response element binding protein levelsCUSchronic unpredictable stressDCXdoublecortinDGdentate gyrusERKextracellular regulated protein kinasesFSTforced swim testFUSTfemale urine sniffing testIba-1ionized calcium-binding adaptor molecule-1ILinterleukiniNOSinducible nitric oxide synthaseMAOmonoamine oxidasesNF-\u03baBnuclear factor-\u03baBSPTsucrose preference testTrkBtyrosine kinase receptor BTNF-\u03b1tumor necrosis factor \u03b1"}
+{"text": "Posterior lumbar interbody fusion (PLIF) has become a classic treatment modality for lumbar degenerative diseases, with cage subsidence as a potentially fatal complication due to low bone mineral density (BMD), which can be measured by forearm T-score. Hounsfield units (HU) derived from computed tomography have been a reliable method for assessing BMD.To determine the accuracy of forearm T-score in predicting cage subsidence after PLIF compared with lumbar spine HU values.We retrospectively analyzed the clinical data of 71 patients who underwent PLIF and divided them into cage subsidence group and nonsubsidence group. The differences in preoperative HU value and forearm T-score were compared between groups, and the correlation between cage subsidence and clinical efficacy was analyzed.P\u00a0<\u20090.05). The forearm T-score  predicted cage subsidence more accurately than the mean global HU value . In logistic regression analysis, both forearm T-score and mean global HU value were found to be independent risk factors for cage subsidence (P\u00a0<\u20090.05).The subsidence rate for all 71 patients (31 men and 40 women) was 23.9%. There was no significant difference in age, sex ratio, body mass index, smoking status, follow-up time, spine BMD, and spine T-score between groups, except in the forearm T-score and lumbar spine HU values (Lower forearm T-scores and lower lumbar spine HU values were significantly associated with the occurrence of cage subsidence. Lower forearm T-scores indicated a higher risk of cage subsidence than lumbar spine HU values. Forearm T-score is more effective in predicting cage subsidence than spine T-score. Therefore, forearm dual-energy X-ray absorptiometry may be a fast, simple, and reliable method for predicting cage subsidence following PLIF. However, our results suggest that the degree of cage subsidence is not associated with clinical efficacy. Posterior lumbar interbody fusion (PLIF) is a classic surgical approach for the treatment of degenerative lumbar spine diseases, as it provides load burden on the anterior column of the spine, adequate decompression of nerve roots, and restoration of intervertebral space height , 2. HoweOsteoporosis is mainly diagnosed using dual-energy X-ray absorptiometry (DXA) by measuring the lumbar spine BMD. However, BMD is usually overestimated via lumbar DXA in patients with lumbar degenerative disease. The International Society for Clinical Densitometry 2019) recommends measuring BMD in the distal forearm when measurement or interpretation of the hip and/or spine is not possible. BMD of the forearm has higher accuracy and sensitivity in screening for osteoporosis than BMD of other sites \u20138. In co recommenThis study was approved by our Institutional Review Board. Clinical data of 71 patients admitted to an orthopedic department for PLIF combined with bilateral pedicle screw fixation between January 1, 2020, and June 30, 2021, were retrospectively analyzed. The inclusion criteria were as follows: (1) lumbar spinal stenosis  and degenerative spondylolisthesis; (2) PLIF combined with bilateral pedicle screw fixation only at the level of L4\u2013L5; and (3) complete imaging and clinical data, including lumbar spine X-rays before surgery, 1\u2009week after surgery, and last follow-up (at least 12\u2009months) and lumbar spine CT, forearm DXA measurements, and lumbar spine DXA measurements at the last follow-up (at least 12\u2009months). The exclusion criteria were as follows: (1) any history of spinal surgery; (2) history of spinal diseases such as spinal tuberculosis, spinal tumor, and ankylosing spondylitis; (3) DXA of the dominant hand forearm; (4) the presence of nondominant forearm and wrist fracture; and (5) history of surgery.2) of each patient at the distal 1/3 of the length of the ulna and radius of the nondominant forearm and the L1 vertebral body. Fixation was performed by a physician certified in International Clinical Bone Measurements. BMD was examined using the EXA-3000 Osteosys absorptiometry system (X-ray absorptiometry), which was preheated and calibrated before testing. The detection parameters included scanning current at 0.25\u2009mA and tube voltage at 80\u2009kV/55\u2009kV, and the parameters were set during the detection. According to the World Health Organization standard classification, osteoporosis is defined as T-score\u2009\u2264\u2009\u2212\u20092.5; osteopenia as \u2212\u20092.5\u2009<\u2009T-score\u2009<\u2009\u2212\u20091; and normal BMD as T-score\u2009\u2265\u2009\u2212\u20091.0.DXA was preoperatively performed to measure BMD (measured in g/cmAll computed tomography (CT) scans were performed using dual-source CT (SOMATOM Definition). As the CT window type does not change the HU value, preoperative CT was routinely used to calculate HU values. HU values were measured by placing an oval region of interest (ROI) on three images of the L1 to L5 vertebral body axially, slightly below the superior endplate, in the middle of the vertebral body, and slightly above the inferior endplate. For each measurement, the largest possible elliptical area of interest was drawn, and the cortical edge was excluded. The standard picture archiving and communication system (PACS) automatically calculates the average HU value for the ROI. The average HU values of the three regions of interest were obtained as the BMD of the corresponding vertebral trabecular bone ; three-dimensional CT was also performed at the last follow-up. The distance of cage subsidence on CT mid-sagittal images were measured. Considering that the cage may enter the endplate nonparallel to the intervertebral space, cage subsidence was defined as the maximum distance of displacement of the cage into the cranial or caudal endplate by >\u20092\u2009mm. Depending on whether the cage subsided by \u22652\u2009mm, the patients were divided into the subsidence (\u22652\u2009mm) and nonsubsidence (<\u20092\u2009mm) groups. All radiological parameters were measured by two independent observers (a researcher and an orthopedic surgeon) who were blinded to the patients\u2019 DXA measurements.The visual analog scale (VAS) scores of back and leg pain and lumbar spine Japanese Orthopaedic Association (JOA) scores were recorded before surgery, 1\u2009week after surgery, and at the last follow-up. The improvement rate of lumbar spine JOA score\u2009=\u2009(postoperative lumbar spine JOA score\u2009\u2212\u2009preoperative lumbar spine JOA score) / \u2009\u00d7\u2009100%.Statistical analysis was performed using SPSS version 26 . Continuous variables were analyzed using independent samples t-test, whereas categorical variables were analyzed using the chi-square test or Fisher\u2019s exact test. Binary logistic regression analysis was performed to determine the influencing factors of cage subsidence, and the results were expressed as odds ratios (ORs) with 95% confidence intervals. Intraclass correlation coefficients (ICCs) were used to assess the inter- and intra-observer reliability of HU and cage subsidence measurements (an ICC of \u22650.8 indicated excellent reliability). The receiver operating characteristic (ROC) curve and area under the curve (AUC) were used to determine the thresholds of factors influencing cage subsidence. Pearson correlation coefficient was used to analyze the correlation between the degree of cage subsidence and VAS score and improvement rate of lumbar JOA score. A two-sided significance level of \u03b1\u2009=\u20090.05 was considered.2, the mean follow-up time was 13.6\u2009\u00b1\u20095.1\u2009months, and the subsidence rate was 23.9% (n\u2009=\u200917). The main diagnosis was lumbar spinal stenosis and degenerative spondylolisthesis. Between the subsidence and nonsubsidence groups, there was no significant difference in sex ratio, BMI, smoking status, follow-up time, spine BMD, and spine T-score (P\u2009>\u20090.05). Demographic characteristics and bone density measured using DXA or HU value are summarized in Table\u00a0This study included 71 patients  who underwent PLIF treatment. The mean body mass index (BMI) was 25.8\u2009\u00b1\u20094.1\u2009kg/mP\u2009<\u20090.05). In the ROC curve analysis  were significantly different between the two groups (P\u2009>\u20090.05). In contrast, the forearm T-scores were significantly different . In the ROC curve analysis (Table P\u2009<\u20090.001).The spinal T-score was not significantly different between the two groups  (Table\u00a0The related factors with 5) Table\u00a0.Table 3LP\u2009>\u20090.05) (Table\u00a0P\u2009=\u20090.233), VAS score (leg) (P\u2009=\u20090.462) or the improvement rate of JOA score (P\u2009=\u20090.116). Thus, the VAS score and the improvement rate of JOA score were not significantly correlated with the degree of cage subsidence.Between the subsidence and nonsubsidence groups, no significant difference was noted in the VAS score and improvement rate of JOA score before surgery, 1\u2009week after surgery, and at the last follow-up (5) Table\u00a0. The PeaPLIF was first proposed by Cloward in the 1940s . Except At present, the definition of cage subsidence has not been fully standardized. Marchi et al.  graded cThe correlation between cage subsidence and postoperative clinical efficacy has been controversial. Cho et al.  conducteHU value can be used to selectively measure the bone density of cancellous bone to avoid the degeneration area, thereby improving the diagnostic accuracy. Zhou et al.  comparedP\u2009=\u20090.016 and 0.031, respectively). Compared with the post-PLIF subsidence rate (30.2%) reported by Cho et al. [In our study, logistic regression analysis revealed the forearm T-score and mean global HU value as independent risk factors for cage subsidence after PLIF (o et al. , the subOur study has some limitations. First, the single-center study design was retrospective in nature, the sample size was small, and follow-up time was short; thus, a large-sample long-term prospective study is warranted to validate our findings. Second, the study population included only patients with single-segment PLIF combined with bilateral pedicle screw fixation. Therefore, further investigation of patients undergoing other surgical modalities is required. Third, we did not discuss the correlation between cage size, cage position, intervertebral-space-correction height, and cage subsidence, many of which may lead to a mismatch between the vertebral endplate and cage, resulting in cage subsidence.Lower forearm T-scores and lower lumbar spine HU values were significantly associated with the occurrence of cage subsidence, with the lower forearm T-scores indicating a higher risk of cage subsidence than lumbar spine HU values. Forearm T-score is more accurate in predicting cage subsidence than spine T-score. Therefore, forearm DXA may be a fast, simple, and reliable method for predicting cage subsidence after PLIF. However, our results suggest that the degree of cage subsidence is not associated with clinical efficacy."}
+{"text": "We performed a systematic review of the literature and meta-analysis on the efficacy and safety of hydroxychloroquine to treat COVID-19 patients.versus placebo or standard of care. We also searched the WHO Clinical Trials Registry for ongoing and recently completed studies, and the reference lists of selected articles and reviews for possible relevant studies, with no restrictions regarding language or publication status. Random-effects models were used to obtain pooled mean differences of treatment effect on mortality, and serious adverse effects between hydroxychloroquine and the Control Group (standard of care or placebo); heterogeneity was assessed using the I2 and the Cochran\u00b4s Q statistic.We searched the Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, EMBASE, and LILACS (January 2019 to March 2021) for patients aged 18 years or older, who had COVID-19 and were treated with hydroxychloroquine versus 18.5%; pooled risk ratio 1.09; 95% confidence interval: 0.99-1.19). Also, the rate of serious adverse effects was similar between both Groups, Hydroxychloroquine and Control .Nine studies met the inclusion criteria and were included in the meta-analysis. There was no significant difference in mortality rate between patients treated with hydroxychloroquine compared to standard of care or placebo  under number CRD42020197070.( In addition, the medical principle \u201cfirst do not harm\u201d should be one of the first principles in any clinical study.Hydroxychloroquine (HCQ) has received worldwide attention as a potential treatment for coronavirus disease 2019 (COVID-19) because of positive results from small studies. However, there is a huge difference between what happens in vitro and in vivo. Moreover, the association of HCQ and other antimicrobial therapy, and the potential adverse events, have not been fully understood yet. Although we recognized that the topic has already been vastly explored in the literature, our approach is of merit as it was previously delineated in the early days of the COVID-19 pandemic (from a priori developed protocol), followed Cochrane collaboration standards for conducting systematic reviews and also included experts in the topic for the assessment of the studies and data analysis.There are several reports and studies on the potential effect of HCQ on inhibiting the action of various viruses, such as other coronaviruses , Ebola virus, HIV, influenza virus (H1N1) and hepatitis B and C viruses.We aimed to perform a systematic review of the literature and a meta-analysis and evaluate the effects of hydroxychloroquine prescription to treat adult COVID-19 patients, considering mortality and prevention of serious adverse events.,10 It included all randomized controlled trials (RCTs) published, which assessed COVID-19 patients aged 18 years or older, who were treated with chloroquine or HCQ, at any dose, and compared to a Control Group that received other standard of care treatment, supportive treatment or placebo. We excluded prevention or post-exposure prophylaxis studies.The systematic review of the literature was conducted in line with PRISMA guidelines and Cochrane handbook.We searched the Cochrane Central Register of Controlled Trials , MEDLINE, EMBASE, and LILACS (January 2019 to March 2021). We also searched the WHO Clinical Trials Registry for ongoing and recently completed studies, and the reference lists of selected articles and reviews for possible relevant studies, with no restrictions regarding language or publication status.In MEDLINE (PubMed), we combined the subject-specific search (((\u201ccoronavirus\u201d[mesh terms]) or (coronavirus*[title/abstract] or coronovirus*[title/abstract] or coronavirinae*[title/abstract] or coronavirus*[title/abstract] or coronovirus*[title/abstract] or wuhan*[title/abstract] or hubei*[title/abstract] or huaian[title/abstract] or \u201c2019-ncov\u201d[title/abstract] or 2019ncov[title/ab- stract] or ncov2019[title/abstract] or \u201cncov-2019\u201d[title/abstract] or \u201ccovid-19\u201d[title/abstract] or covid19[title/abstract] or \u201chcov-19\u201d[title/abstract] or hcov19[title/abstract] or cov[title/abstract] or \u201c2019 novel*\u201d[title/abstract] or ncov[title/abstract] or \u201cn-cov\u201d[title/abstract] or \u201csars-cov-2\u201d[title/ abstract] or \u201csarscov-2\u201d[title/abstract] or \u201csarscov2\u201d[title/abstract] or \u201csars-cov2\u201d[title/abstract] or \u201csars-cov-19\u201d[title/abstract] or ncorona*[title/abstract])) AND (((((((Hydroxychloroquine[MeSH Terms]) OR (Chloroquine[MeSH Terms])) OR (chloroquin*[Title/Abstract])) OR (Hydroxychloro- quin*[Title/Abstract])) OR (Oxychloroquin*[Title/Abstract])) OR ) OR )). Search strategies were adapted to The Cochrane Library (Wiley InterScience), EMBASE (Ovid Web), and LILACS.Two authors independently identified and selected potentially eligible studies for inclusion in the review. Any disagreements were resolved by discussion and consensus. A third author was included in the discussion, if needed. The review authors were not blinded to the journal or authors.Two authors independently extracted the following data using a specific extraction form: characteristics of the study including study design, duration of the study, if the protocol was published before recruitment of patients, funding sources, and details of trial registration; characteristics of the study including place of study, number of participants assigned, number of participants assessed, inclusion criteria, exclusion criteria and age; characteristics of the study interventions including timing and type of intervention and control, and any co-interventions; characteristics of the study outcomes including the length of follow-up, loss to follow-up, and outcome measures; and the methodological domains looking for risk of bias. Any disagreements were resolved by discussion. we assessed the following domains: random sequence generation; allocation concealment; blinding of participants and personnel; blinding of outcome assessment; incomplete outcome data; selective reporting; and other bias. Each of these criteria was evaluated using low risk of bias; high risk of bias; and unclear . Disagreements between authors regarding the risk of bias for the domains were resolved by discussion.The risk of bias of the included studies was assessed by two independent authors. As recommended by The Cochrane Collaboration Risk of Bias tool,The primary outcome was all-cause mortality. As second outcome, we evaluated serious adverse events of HCQ treatment . Other outcomes could not be assessed due to substantial heterogeneity between measurements and outcomes of the included studies. For rate comparisons, we calculated the risk ratio (RR) with a 95% confidence interval (95%CI) for individual studies. We pooled similar studies using a random-effects model, according to the Mantel-Haenszel method for estimating the RR and its 95%CI, and pooled data are shown in forest plots.We combined the results of the included trials by performing a meta-analysis, using the Review Manager version 5.0 (The Cochrane Collaboration), and a p<0.05 was considered significant.The unit of randomization for all trials included was the individual participant of study. There were no unit of analysis issues when considering cluster-randomized trials. Where appropriate, problems of unit of analysis with multiple reporting of outcomes, such as different follow-up times were solved by presenting these separately.2 value, and heterogeneity was considered present for I2>50%. Data from the systematic review were grouped, and the weighted average was calculated as the studies\u2019 summary measure. Funnel plots were obtained to estimate the publication bias.The presence of heterogeneity among the studies was estimated by the Cochran\u00b4s Q statistic and measured by the I Quality of evidence was categorized as \u2018high\u2019, \u2018moderate\u2019, \u2018low\u2019, or \u2018very low\u2019, depending on the presence and extent of five factors: risk of bias, inconsistency of effect, indirectness, imprecision, and publication bias.The GRADE approach was used to assess the quality of evidence related to two outcomes - mortality and serious adverse events.The main results of the use of HCQ to treat participants with COVID-19 are presented in a \u2018Summary of findings\u2019 table, which provides key information concerning quality of evidence, magnitude of effect of the interventions examined, and the sum of available data on the main outcomes.\u201322 were included, and eight, excluded.\u201330 The flowchart of article selection is available in The searches for this review identified a total of 3,014 articles for analysis, and 44 reports of potentially eligible studies, for which we obtained full reports, whenever possible. Of these, nine studiesThe number of subjects per study ranged from 19 to 1,561 participants in the Treatment Group, and from 11 to 3,155 in the Control Group. All studies included evaluated only HCQ in the intervention arm, as described in Overall quality of the trials was compatible with COVID-19 pandemic scenario and most fulfilled the expected standards. One important caveat to be pinpointed is the fact that most of the trials were designed to produce a more pragmatic than explanatory evidence . Trials failed most at blinding participants and personnel, and we had some special concerns regarding some underpowered trials, which we downgraded to the \u201cother bias\u201d section. Some other concerns are related to lack of standardization to define adverse effects and their stratification. These criteria had substantially varied between trials. versus standard of care in management of COVID-19 patients. We presented our results for two endpoints: mortality and serious adverse events.versus 18.5%; RR 1.09; 95%CI: 0.99-1.19; risk difference=0.00; 95%CI: -0.01-0.01), with no relevant heterogeneity across the studies, as demonstrated in Hydroxychloroquine did not significantly reduce the mortality rate of COVID-19 when compared to standard of care (Control Group) , with low heterogeneity across the studies (I2=28%), as shown in The rate of serious adverse effects was similar in both Groups HCQ and Control  virus, and that is why we chose to seek the best evidence, by using only RCTs in our meta-analysis. We also conducted a systematic review of the literature after one year of the COVID-19 pandemic, to have enough time for RCTs to be published. Previous reported systematic reviews and meta-analyses evaluated safety of HCQ in COVID-19, and focused only on adverse events, or included just a small portion of these RCTs, or also included unpublished clinical trial. Differently from them, we focused on investigating studies that evaluated mortality as outcome, reported severe adverse events associated to COVID-19.In clinical trials, the action of the drug studied is expected to bring some benefits for human beings, in terms of clinical outcomes. In other words, we need a drug that allows for longer survival, and avoid deaths. Furthermore, no adverse events are desired; however, if that is not possible, then let them be the fewer and the least harmful possible. All of these clinical outcomes should be evaluated in a clinical study. For drug evaluation, randomized studies are required. The good news is there are many ongoing studies on COVID-19. Based on this approach, our systematic review and meta-analysis only included RCTs. We also opted not to include non-randomized, quasi-experimental studies, which aim to demonstrate causality between an intervention and an outcome, and encompass a broad range of non-randomized intervention studies. These designs are frequently used when it is not logistically feasible or ethical to conduct a RCT.in vitro data and clinical trials. Hydroxychloroquine and chloroquine were shown to prevent viral infection in cell-culture systems; nonetheless, clinical trials in humans did not detect a significant improvement in COVID-19 patients treated with these drugs. Studies reported that HCQ and chloroquine slightly decreased the viability of Vero, TMPRSS2-expressing Vero and Calu-3 cells when introduced at the highest concentration. Hydroxychloroquine and chloroquine could block S-driven entry, but this inhibition is cell-line-dependent, and efficient inhibition has not been observed in TMPRSS2+ lung cells.,36The literature presents some misleading information on  had a large sample , (weight of more than 10%); both studies indicated no mortality benefit for HCQ use against COVID-19. Even including only RCTs in our meta-analysis, just two studies were double-blinded.,21 Double-blinded trials are thought to produce objective results since the expectations of researchers and participants about the experimental treatment, such as HCQ, do not affect the outcome. Although it does not reflect the real-life circumstances, and this may be one of the main reasons for most of these studies not adopting double-blind methods. Another important point was publication bias could not be properly addressed, since the number of included studies was small.Our analysis has some limitations. The interpretation of these findings requires caution due to substantial differences among the studies included. In addition, the population of these studies is heterogeneous, comprising hospitalized and non-hospitalized patients. It is important to emphasize this aspect because when we searched the number of deaths due to COVID-19, we attributed it as mortality in our meta-analysis but with no real-time definition of it. For analysis of serious adverse events, each study adopted a different definition. Moreover, the HCQ dose criteria were different among studies. Most of them considered a loading dose, and maintenance doses varying from 400-800mg/day; and total treatment time was also diverse. Considering sample size, the RECOVERY study New studies, such as the COPE-Coalition V, which recruited 1,372 non-hospitalized patients and assessed the risk of hospitalization, produced similar findings and are unlikely to change the magnitude and direction of our findings. From a global perspective, a lot of criticism was pointed out in trials conducted in the worst moments of the COVID-19 pandemic, which made researchers and policy advisors aware of actions to take in next pandemics.In the same scope of our study, one Cochrane Collaboration review reported similar results, and the authors highlighted the rates of adverse effects, pointing out that most of them were not serious.In conclusion, our systematic review and meta-analysis, exclusively with published randomized controlled trials, found treatment with hydroxychloroquine is not efficacious to reduce mortality of COVID-19 patients."}
+{"text": "The oxide particles inhibited the growth of recrystallized \u03b1-Al grains, leading to the formation of a microstructure consisting of coarse elongated grains with sizes of 420 \u03bcm and fine equiaxed grains with sizes of 10 \u03bcm. After T6 heat treatment, a microstructure with finer grains (grain sizes: 34 \u03bcm) formed due to further recrystallization induced by residual strain. The tensile mechanical properties testing results indicated that a good combination of strength (296 MPa) and ductility (7.6%) was achieved in the T6 heat treated samples, which were likely attributed to the high-quality inter-chip bonding, as well as the fine oxide particles which were small enough that further crack nucleation and growth around them were inhibited during tensile deformation. For the purpose of comparison, the microstructure and mechanical properties of the as-extruded and T6 heat treated samples produced by hot extrusion of the cast ingot of AA6061 aluminum alloy were also investigated. The lower tensile strength of solid-state recycled tube sample might be associated with the consumption of Mg atoms by the oxidation reaction, leading to the lower density of \u03b2\u2033 precipitates in precipitation strengthening.An AA6061 aluminum alloy tube was fabricated by compacting machining chips via thermomechanical consolidation, including hot pressing and hot extrusion. The microstructure evolution and formation of oxide particles were investigated in correlation to tensile mechanical properties. It was found that fine Al/Mg oxide particles were formed due to the fracture of oxide layers on the chips and the reaction between Mg and Al Aluminum alloys have been applied widely in the fields of aviation, aerospace, architecture, automotive, and other structural components due to their high specific strength and good corrosion resistance. The considerable energy consumption of primary aluminum production makes the recycling of aluminum alloy chips produced from machining and turning to be a concern ,2,3,4. I2O3 surface films into fine particles.It is well recognized that the plastic deformation introduced during solid-state recycling could induce the fracture of oxide films of the aluminum chips and dynamic recrystallization of \u03b1-Al grains. The extent of the fracture of oxide films and dynamic recrystallization is closely related to deformation temperature, strain rate, and extrusion ratio. Hasse et al.  found thThe mechanical properties of recycled aluminium alloy materials are closely related to their microstructures. Luo et al.  found thAs highlighted above, large amounts of previous works have shown that high-quality inter-chip bonding could be achieved by introducing plastic deformation during the consolidation of aluminium alloy chips, which facilitated the fragments of oxide layers on the chips and enhanced the atomic diffusion across the inter-chip boundaries. However, to the best of the author\u2019s knowledge, there is still a lack of investigation about the effects of oxide fragments on microstructure evolution and mechanical properties of solid-state recycled aluminum alloys. In this study, we primarily investigated the effects of oxide fragments on microstructure features and correlated them to the tensile mechanical properties and fracture behaviour of a tube fabricated by hot extrusion of AA6061 chips compact. Moreover, the tensile properties in both longitudinal and transverse directions influenced by the anisotropic microstructures have been studied as well. For comparison, a tube fabricated by hot extrusion of AA 6061 cast ingot was also investigated. This study establishes a deep understanding of good inter-chip bonding and anisotropic microstructure influenced by oxide layers/particles.3. The AA6061 chips were firstly washed in soap water to remove the residual lubricants, then they were dried at 55 \u00b0C for 5 h. The dried chips were dropped into a cylindrical H13 steel die and then heated by a ceramic heater band up to 400 \u00b0C (holding time: 10 min) under the protection of argon, followed by hot pressing (200 ton) for 5 min. The compact was then extruded at 480 \u00b0C with an extrusion ratio of 58:1 to produce a tube with an inner diameter of 15 mm and an outer diameter of 19 mm. After extrusion, the tube was quickly transferred into water to obtain the microstructure of extruded state. For the purpose of comparison, an ingot metallurgy tube produced by hot extrusion of AA6061 cast ingot was used as a counterpart. The as-extruded tubes were heat treated with standard T6 heat treatment procedures: solution treatment at 535 \u00b0C for 2 h, quenching into water, and then artificial aging at 177 \u00b0C for 8 h. The details of the fabrication processes and the corresponding sample notations are listed in The raw materials used in this study were AA6061 aluminum alloy machining chips. As shown in The chemical compositions of the tube samples were determined by an inductively coupled plasma (ICP) emission spectrometer . The oxygen contents were measured by a LECO TCH-600 nitrogen/oxygen/hydrogen analyzer, LECO, St. Joseph, IL, USA), which were 2.52 wt.% for the SSR tube sample and 0.45 wt.% for the IM tube sample. The microstructures of the tube samples were characterized by scanning electron microscopy (SEM) , electron backscatter diffraction (EBSD)  on SEM, and transmission electron microscopy (TEM) . The EBSD specimens were firstly cut along the longitudinal direction (extrusion direction) of the tube samples and then were processed by grounding, mechanically polishing, and electrolytically polishing using an electrolyte of 90% methanol + 10% perchloric acid with a parameter voltage of 25 V for 10 s. The TEM foils were prepared by twin-jet electrochemical thinning using an electrolyte of 70% methanol, + 30% nitric acid, with a voltage of 30 V at \u221220 \u00b0C.2 by wire-electrode cutting and then mechanically grounded to 2000 mesh abrasive paper. For preparing the transversal tensile test specimens, the tube samples were cut into two halves and then flattened into plates using a hydraulic press. The transversal tensile test specimens were dog-bone shaped with a gauge length of 10 mm and a cross-section area of 1.6 \u00d7 1.4 mm2. The tensile tests were performed using a Zwick/Roell Z100 testing machine  with a strain rate of 5 \u00d7 10\u22124 s\u22121. Extensometer was used to measure the elongation to fracture. The tensile test was performed based on GB/T 228-2002 standard . Three specimens were tested to ensure consistency.For the investigation of anisotropy of tensile mechanical properties, specimens along the longitudinal and transversal directions of the tube samples were prepared. According to the grain misorientation angle distribution of the as-extruded and T6 heat treated tube samples, it can be found that the fractions of high angle grain boundary (HAGB), low angle grain boundary (LAGB) and sub-grain boundary (SGB) were 53%, 5%, 42%, and 76%, 10%, and 14%, respectively, in the SSR and IM samples a,b. AfteAs shown in 2O4, which will be mentioned in the discussion section. Based on the particle size distribution shown in As shown in As shown in This study shows that a microstructure consisting of coarse elongated grains and fine equiaxed grains formed in the as-extruded SSR sample. The formation of the coarse elongated grains is likely due to dynamic recrystallization and following rapid grain growth induced by severe plastic deformation during hot extrusion. In contrast, the presence of fine equiaxed grains may associate with the pinning effect of oxide particles on grain boundaries which inhibited further growth of some recrystallized grains. It is noted that this microstructure is quite different from that of the IM sample produced by the extrusion of a cast ingot under the same condition. The latter demonstrates a homogeneous microstructure consisting of nearly full recrystallized equiaxed grains with the lack of oxide particles in the Al matrix, suggesting that the fine oxide particles have a significant influence on the microstructure evolution of the SSR sample.2O3 layers on the chips since the significant difference in Young\u2019s modulus between Al and Al2O3 , which causes stress concentration on the Al2O3 layers during hot pressing and hot extrusion. The high shear stress produced by plastic deformation during extrusion facilitates the breaking of the Al2O3 layers. In addition, it is believed that Mg atoms segregate from grain interiors to the inter-chip boundaries during extrusion at elevated temperatures, and the segregated Mg could react with Al2O3 layers through the following reactions due to the more negative free energy of formation of MgO than that of Al2O3 [It is believed that the fine oxide particles likely originated from the breaking of the Alof Al2O3 ,38,39:3M2O3 surface films by introducing shear stress as a result of volume change during the reactions [These reactions could also facilitate the breaking of the Aleactions . This fieactions  and 5083eactions  due to tIt is well recognized that the coarsening of the recrystallized grains usually occurs at high temperatures due to grain growth, which is confirmed by the EBSD results of the IM sample, demonstrating a significant increase of Al grain size from 35 to 60 \u03bcm after T6 heat treatment, as shown in It is reported  that theIt is noted that, after T6 heat treatment, the SSR samples showed nearly similar ductility with that of the IM tube samples, as reflected by the average elongation to fracture values of 9.0% and 9.8% in the samples tested along the longitudinal direction, and that of 7.6% and 8.6% in the samples tested along the transversal direction. This indicates that the inter-chip boundaries with a high level of atomic bonding are established in the SSR sample through the hot pressing of the chips followed by hot extrusion. Meanwhile, the fine oxide particles distributed along the inter-chip boundaries do not cause the ductility of the recycled material to deteriorate significantly, which is probably due to their small sizes of less than 2 \u03bcm. Since the oxide particles are so small, their spacing is large enough that the cavities between the oxide particles and matrix are unlikely to connect to each other for further crack nucleation and growth, which contributes to the good ductility of the solid-state recycled materials. This conjecture is supported by the SEM observations of the longitudinal sections of the fracture surfaces in the tensile test specimens of the SSR(L)-T6 and SSR(T)-T6 samples a,c. SimiIt is interesting to find that the tensile strengths of the T6 heat treated SSR samples tested along the transversal direction of the tube are better than those of the samples tested along the longitudinal direction of the tube . This de2O3 surface layers of Al7075 powder particles in Al7075/SiC composites prepared by powder metallurgy routine, and the consumption of some of the Mg element in the matrix, drastically reducing the number density of MgZn2 precipitates in this material.It is noted that the T6 heat treated SSR sample exhibited a lower tensile strength than that of the T6 heat treated IM sample . This ca2O3. Dynamic recrystallization of the Al grains and establishment of high-level inter-chip atomic bonding also occurred during the chip consolidation process. The fine oxide particles inhibited further grain growth of the recrystallized grains in the particle-rich zones, leading to the formation of a microstructure including coarse elongated grains with sizes of 420 \u03bcm, and fine equiaxed grains with sizes of 10 \u03bcm. T6 heat treatment caused an apparent Al grain refinement of the recycled tube sample with grain sizes of 34 \u03bcm, which was likely attributed to further recrystallization induced by residual strains around the oxide particles. The good tensile ductility of 7.6\u20139% in the T6 heat treated solid-state recycled tube sample was possibly related to the high-level inter-chip bonding and the fine oxide particles which were small enough that further crack nucleation and growth around them were inhibited during a tensile test. Compared to the ingot metallurgy sample, the lower tensile strength 276 MPa of the T6 heat treated solid-state recycled tube sample might be associated with the consumption of Mg atoms by the oxidation reaction, leading to the lower density of \u03b2\u2033 precipitates in precipitation strengthening.In the present work, a solid-state recycled AA6061 tube was successfully produced by hot pressing of chips to produce a chip compact, followed by hot extrusion of the chip compact. The hot extrusion resulted in the formation of fine oxide particles due to the breaking down of oxide layers on the chips and the reaction between Mg and Al"}
+{"text": "Pleurotus citrinopileatus could serve as a substitute for these animal-derived enzymes, thus offering vegetarian, kosher, and halal alternatives. However, the hydrolytic activity of this enzyme towards long-chain fatty acids is slightly too high, which may lead to off-flavors during long-term ripening. Therefore, an optimization via protein engineering (PE) was performed by changing the specificity towards medium-chain fatty acids. With a semi-rational design, possible mutants at eight different positions were created and analyzed in silico. Heterologous expression was performed for 24 predicted mutants, of which 18 caused a change in the hydrolysis profile. Three mutants  were used in application tests to produce Feta-type brine cheese. The sensory analyses showed promising results for cheeses prepared with the L305A mutant, and SPME-GC-MS analysis of volatile free fatty acids supported these findings. Therefore, altering the chain length specificity via PE becomes a powerful tool for the replacement of PGEs in cheese making.In traditional cheese making, pregastric lipolytic enzymes of animal origin are used for the acceleration of ripening and the formation of spicy flavor compounds. Especially for cheese specialities, such as Pecorino, Provolone, or Feta, pregastric esterases (PGE) play an important role. A lipase from  Parmigiano Reggiano or Provolone, the majority of character impact compounds are short- to medium-chain free fatty acids such as butanoic acid (C4:0), hexanoic acid (C6:0), octanoic acid (C8:0), or decanoic acid (C10:0) -ethanol (Triton X-100), tris(hydroxymethyl)-aminomethane , TRIS-hydrochloride (99%), dipotassium hydrogen phosphate (99%), potassium dihydrogenphosphate (98%), ROTI\u00ae mark standard, Rotiphorese\u00ae Gel 40, sodium chloride (99.8%), sodium deoxycholate (98%), sodium dodecyl sulfate (99%), sodium dihydrogen phosphate (98%), and sodium hydroxide were provided by Carl Roth . Ammonium persulfate (100%) and hexadecenoic acid (100%) were bought from Merck  and LB-SOC (Outgrowth medium) from New England BioLabs\u00ae . Isopropyl-\u03b2-d-thiogalactopyranoside (IPTG) was purchased from Serva Electrophoresis . Fastblue RR Salt, glycerol (99%), imidazole (99.5%), p-nitrophenyl acetate (98%), p-nitrophenyl butyrate (98%), p-nitrophenyl valerate (98%), p-nitrophenyl hexanoate (98%), p-nitrophenyl palmitate (98%), and l-(+)-arabinose (99%) were supplied by Sigma Aldrich . Gum arabic (X-E IRX 75200) was bought from Symrise  and hydrochloric acid (25%) from Th. Geyer . Helium (5.0) was purchased from Praxair  and nitrogen (5.0) from Air Liquide .Dodecanoic acid (99%) and tetradecanoic acid (99%) were obtained from Acros Organics . Butyric acid (99%), hexanoic acid (99%), Escherichia coli 10 beta cells were obtained from Zymo research Europe , and E. coli BL21 (DE3) cells were purchased from New England BioLabs\u00ae.3 [1 \u00c5 = 10\u221210 m]) to solvate them. Afterwards, a molecular dynamic (MD) simulation was performed with the NAMD program v.2.14  in combination with the CHARMM36 force field [Software Modeller v.9.25  was employed to build 3D structures of the PCI_Lip wild type (WT) and the mutants by homology modeling . The obt3 1 \u00c5 = \u221210 m) top-nitrophenol-(pNP)-esters with different chain lengths and the serine oxygen of S213 of the PCI_Lip active site was set as 6.5 \u00c5. Other parameters were set as defaults. Based on the cavities in the active site, eight positions were predicted, seven in the channel and one in the lid, and selected as relevant positions. Unbiased, all eight relevant positions were swapped in silico with all 19 other amino acids. Then, molecular docking was carried out to screen this virtual mutant library (VML) by docking the aforementioned pNP-esters, while the same parameters were used as for the PCI_Lip wild type (WT).Molecular docking was carried out by AutoDock Vina software package v. 1.2.3 . with the Broyden\u2013Fletcher\u2013Goldfarb\u2013Shanno (BFGS) method . The Aut3 [The structures of triglyceride ligands ) were generated based on the standard CHARMM36 force field. All micro-units were built by Packmol program v. 20.1.0, which was maintained by Leandro Mart\u00ednez , Jos\u00e9 Mario Mart\u00ednez  and Ernesto G. Birgin . The size of the water box was set as 90 \u00d7 90 \u00d7 90 \u00c53 ,22. The 3 . The MD E. coli zymo 10 beta cells with a codon-optimized synthetic gene encoding PCI_Lip  in the pET-28a(+) vector as described by Green and Rogers [\u00ae, Ipswich, MA, USA) were mixed and adjusted to a total volume of 50 \u03bcL. To perform the PCR at different temperatures, aliquots of 10 \u00b5L volume were separated. The reaction was performed using a T100\u2122 thermal cycler  with the following program: initial denaturation for 1 min at 95 \u00b0C, denaturation for 45 s at 95 \u00b0C, annealing for 45 s at 60 to 73 \u00b0C, extension for 5 min at 68 \u00b0C (30 cycles), and final extension for 7 min at 68 \u00b0C. In order to digest the remaining template DNA, the PCR tubes were pooled, 1 \u00b5L DpnI  was added, and the mixture was incubated for 2 h at 37 \u00b0C. The DpnI-digested PCR products were then directly used for the transformation of chemically competent E. coli 10 beta cells. The preparation of the competent cells and the transformation were performed as described by Green and Rogers [E. coli BL21 (DE3) as described above. For soluble protein expression, E. coli BL21 (DE3) cells were transformed with the chaperon plasmid pG-KJE8 from TaKaRa BIO INC.  for co-expression of the chaperones DnaK-DnaJ-GrpE and GroES-GroEL [v/v glycerol at \u221280 \u00b0C.After the transformation of chemically competent d Rogers , the plad Rogers . The traES-GroEL ,26. Cult\u22121 kanamycin and 20 \u00b5g mL\u22121 chloramphenicol were inoculated with 7.5 \u00b5L cryostock and incubated overnight at 37 \u00b0C and 180 rpm. For the main culture, 400 mL TB medium (with the same antibiotics and concentrations as in the overnight cultures) were inoculated with the whole overnight culture in a 2 L baffled shake flask. A total of 0.5 mg mL\u22121l-(+)-arabinose and 5 ng mL\u22121 tetracycline were added to induce the expression of chaperones. The culture was incubated at 37 \u00b0C and 180 rpm to an OD600 of 0.8. Subsequently, the expression of the target protein was induced by adding 0.5 mM IPTG, and the temperature was reduced to 20 \u00b0C. After 20 h of incubation, the culture was harvested by centrifugation . The E. coli pellets were washed twice with 25 mL 80 mM potassium phosphate buffer, pH 7.0, and stored at \u221220 \u00b0C.For the expression of the PCI_Lip WT and its mutants, 15 mL LB medium containing 25 \u00b5g mLE. coli pellets were resuspended in 5 mL 90% binding buffer (50 mM sodium phosphate buffer with 0.3 M sodium chloride at pH 7.5) with 10% elution buffer (binding buffer with the addition of 250 mM imidazol). After three times sonication for 2.5 min with a sonifier MS72  on ice, the suspension was centrifuged . The supernatant was again centrifuged  and subjected to immobilized metal ion affinity chromatography (IMAC). IMAC purification was performed at an NGC Quest 10 (Bio-Rad Laboratories) using a HisTrapTM High Performance 5 mL Ni-NTA column . The IMAC method comprises the application of one column volume (CV) sample with a flow rate of 1.5 mL min\u22121 prior to two washing steps with the first 5% elution buffer for four CVs and then at 30% for another four CVs. The target protein was eluted with 100% elution buffer for two CVs.The \u00ae Desalting columns (Cytiva Europe) with a CV of 5 mL each. Therefore, two CV desalting buffer  was used at a flowrate of 2 mL min\u22121. As the last purification step, a second size exclusion purification was performed in a centrifugal filter with a molecular mass cut-off of 30 kDa (Merck) by washing the samples up to ten times with desalting buffer. To control the successful expression of the PCI_Lip WT and the respective mutants, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of the purified enzyme fractions was performed according to Laemmli [After IMAC purification, the sample was desalted using three connected HiTrap Laemmli  with a 4v/v Triton X-100 (pNPA without Triton X-100) were mixed with 20 \u00b5L enzyme solution in a 96-well micro-plate. To start the reaction, 50 \u00b5L of substrate solution with 3.5 mM of one of the five pNP esters was added. The absorbance at 405 nm was measured for 10 min at 30 \u00b0C using a Synergy 2 reader . The lipase activity was measured similar to the esterase assay by using pNP-palmitate (pNPP) as the substrate. In this assay, 50 \u00b5L enzyme solution was mixed with 200 \u00b5L substrate solution  containing 0.4 mM pNPP. The reaction was performed at 37 \u00b0C for 15 min. One unit of enzymatic activity equals the amount of enzyme that produces 1 \u00b5mol of pNP per minute under assay conditions .The thermostability of the enzymes was examined by incubation of 100 \u00b5L enzyme solution at different temperatures for 60 min. Afterwards, the activity of the samples was measured in a photometric esterase assay using pNPO as the substrate. The measurements were performed in triplicates. The obtained Y-values were analyzed with a sigmoidal fit, whose turning point corresponds to the T\u22121; optiferm, Oy-Mittelberg, Germany) were produced. After pre-ripening for 45 min, calcium  and microbial rennet  were added. The coagulated mass was cut into hazelnut-sized pieces (cubes with an edge length of approximately 15 mm) using a cheese harp. Afterwards, the curd was stirred manually, placed in prewarmed molds, and turned periodically to drain the whey. After a resting period of 24 h, the cheeses were put into brine  for 50 min and drained. For conservation, the loaves were submerged into a natamycin bath  for 1 min and drained again. For ripening, the loaves were shrink-wrapped and stored at 13 \u00b0C for 30 d. All cheeses were sensorily examined after 30 d of ripening. The sensory analysis was performed by five trained panelists from optiferm, who performed a simple descriptive test according to DIN 10964:2014-11 (German Institute for Standardization). In this test, simple attributes for the appearance, texture, smell, and taste were listed by the panelists. The cheese was presented in 1 \u00d7 1 cm cubes with single-digit codes. One loaf of the respective cheese mutant was used for the sensory evaluation; the second loaf was used for the analysis of vFFA by means of solid phase micro extraction gas chromatography-mass spectrometry (SPME-GC-MS) as described below.Application tests of the PCI_Lip WT and the mutants F91L, L302G and L305A were carried out to examine the effects on cheese flavor. For this purpose, 3 L full-cream milk , which will result in two cheese loaves of approximately 200 g each, were mixed with cream until a fat content of 4.2% was reached. Subsequently, starter cultures of lactic acid bacteria  and 1 U of PCI_Lip WT or the respective mutant (except 0.7 for L302G) were added to the milk, which had been preheated to 33 \u00b0C. The PCI_Lip dosage of 1 U (0.7 U) corresponds to its activity towards pNPO in the esterase assay. In addition, reference cheeses without the addition of lipases and with the commercial PGE opti-zym z10uc (0.35 g (10 L)\u22121 to 240 \u00b0C (12 min); carrier gas: helium at 1.2 mL min\u22121 (constant)) was used. The GC system was connected to an Agilent 5975C mass spectrometer . For substance identification, obtained mass spectra and calculated retention indices according to van den Dool and Kratz [\u22121 in n-hexane) and the National Institute of Standards and Technology (NIST) MS Search (2011).To examine the effects of different PCI_Lip mutants on the aroma of the cheeses, the vFFAs of the cheeses were analyzed by headspace SPME-GC-MS. Therefore, 3 g of cheese was transferred into a 20 mL headspace vial. After the addition of 2 mL HCl (2 M), the mixture was carefully homogenized via a vortex-mixer. The samples were incubated for 10 min at 55 \u00b0C (250 rpm agitation rate) by means of an MPS 2XL multipurpose sampler  and subsequently extracted for 40 min  using a polydimethylsiloxane (PDMS)/divinylbenzene (DVB) SPME fiber . The analytes were desorbed in the GC inlet  at 250 \u00b0C for 90 s. After desorption, the SPME fiber was baked out for 5 min at 250 \u00b0C. For GC analysis, an Agilent  7890A gas chromatograph, equipped with a split/splitless  inlet and a polar VF-WAXms column , 5 \u00b0C minCandida rugosa lipase 2 (PDB code of the closed structure 1GZ7) [C. rugosa lipase 2, which has a substrate-binding pocket formed by the residues L127, L132, and G450 , and the entry of the hydrophobic channel is formed by the residues V296 and G344 (which correspond to I298 and H342 in PCI_Lip) [C. rugosa lipase 2. In 1GZ7, the lid domain is formed by a flap (residues P65\u2013D94) that lies flat on the protein surface, and an important aromatic ring of F69 is buried in the hydrophobic pocket, while in PCI_Lip, this residue corresponds to L73, which is farther away from the predicted lid region in PCI_Lip. Interestingly, in PCI_Lip, F91 is potentially covering this role, as it is in the lid region, and the aromatic ring of this residue is located towards the substrate channel  . The sub channel . The lidive site . UnbiaseFrom the 35 predicted mutants, 24 mutants were successfully heterologously expressed and purified . AfterwaMutations at the L300, L302, and L305 positions led to mutants with an improved hydrolysis profile, indicating that this part of the substrate channel is crucial for the chain length specificity of PCI_Lip. The L300R mutant showed an improved pNPO/pNPP ratio of 1.8 and an overall increase in activity, while the L300P and L300G mutants resulted in inactive or non-specifically hydrolyzing enzymes. The L302G and L302P mutants both revealed a decrease in activity against all tested substrates of about 50% compared to the PCI_Lip WT. These mutants had a major impact on the specificity of PCI_Lip. They showed almost no activity against pNPO and pNPP while having their highest activity against pNPH for the L302G and against pNPV for the L302P mutant. L305R had only a minor impact on the specificity as its hydrolysis profile mostly resembled that of the WT. The L305H and L305Y mutants showed a significant increase in hydrolytic activity against pNPP, leading to unfavorable pNPO/pNPP ratios of 0.6 for L305H and of 0.2 for L305Y (WT pNPO/pNPP: 0.9). Simultaneously, the overall activity was increased for the L305H mutant, while that of L305Y was decreased. More expedient changes in the hydrolysis profiles were observed for L305A, L305M, and L305N. All three mutants revealed an increased pNPO/pNPP ratio of 1.9 for L305A, 1.7 for L305M, and 1.6 for L305N. Similar to the L302 mutants, a decrease in the overall hydrolytic activities was observed in the esterase/lipase assays, with L305N showing the lowest activity. The I529A mutant showed little to no activity, while the I529D, I529G, and I529W mutants showed a comparable (I529G) or even increased (I529D/W) overall activity compared to the WT. The I529D and I529G mutants both showed a favorable increase in the pNPO/pNPP ratio of 2.4 for I529D and of 1.8 for I529G. Furthermore, these mutants showed increased selectivity for pNPH.In conclusion, the mutations in the substrate channel of PCI_Lip led to mutants with the desired chain length specificity. Especially L302G had a major impact on the hydrolysis profile by shifting the maximal activity from pNPO towards pNPH. L305A showed a less drastic shift in its hydrolysis profile but drastically reduced activity towards pNPP. F91L, L302G, and L305A were selected for further biochemical characterization and application experiments.5060). The obtained values  for these mutants, as well as those of the WT, are listed in The selected mutants F91L, L302G, and L305A were further characterized by means of Michaelis-Menten kinetics for selected substrates  and by thermostability experiments  for the F91L and L305A mutants was observed in the kinetic data. Investigation of the thermostability showed no significant changes in the T5060 values of the different mutants compared to the value of (31.5 \u00b1 0.7) \u00b0C of the PCI_Lip WT  of the crucial distances between the carboxyl carbon atom (from different fatty acid chains in triglycerides) and the hydroxyl group oxygen of S213 in WT PCI_Lip or L305A mutant were analyzed .Generally, the L305A mutant showed a higher binding affinity for the triglycerides than PCI_Lip WT, which was reflected by the number of suitable binding modes and residence time of fatty acid chains in the active center . For theAll three optimized mutants were used in a micro-scale approach to Feta-type brine cheese production, followed by sensory and SPME-GC-MS analysis. The cheeses were produced with the addition of 1 U PCI_Lip WT, F91L, L305A, and 0.7 U of L302G. The sensory evaluation after 30 days of ripening showed differences primarily regarding the taste category rather than in the texture or the smell . While aThe three cheeses produced with PCI_Lip mutants had different sensory properties among themselves and in comparison to the WT. While the WT was described as comparable to the opti-zym z10uc reference, the L305A mutant had a more intense taste and possessed a more pleasant acid profile than the cheeses produced with PCI_Lip or other mutants. Overall, the cheese with the L305A mutant was ranked as the best cheese in this initial trial. The SPME-GC-MS analysis revealed vFFA profiles that support the results of the sensory evaluation. Even though the differences between the WT and the mutants are smaller than indicated by the photometric assays, especially for F91L, shifts towards medium-chain vFFAs could be observed for L302G and L305A. The cheese produced with L305A showed a vFFA profile that resembles that of the reference cheese obtained with opti-zym z10uc regarding the ratios between the different vFFAs. These findings are consistent with the L305A mutant cheese being ranked as the most appealing during this study .The first approach of an engineered lipase from Basidiomycota to modulate the chain length specificity was demonstrated. Through a small but smart library, the effort of expression, purification, and characterization was reduced by 77% , while 18 mutants (roughly 50% based on the predicted) displayed a change in the hydrolysis profile, and 12 of these mutants (34%) had the desired effect of reduced activity against long-chain substrates. Three mutants that showed a drastic decrease in the activity towards long-chain substrates were subjected to cheese production and further analyzed. In initial application tests, the L305A mutant showed promising results to produce vFFA in brine cheese, based on the GC-MS measurements, similar to an animal PGE alternative. The cheese produced with L305A mutants was ranked the most appealing cheese in the sensory evaluation. Summarizing the results of this study, promising mutants of the PCI_Lip could be created. Especially the L305A mutant has a great potential to enable the production of cheeses, which have traditionally been produced with the aid of animal-derived lipases, under vegetarian, halal, or kosher conditions and, at the same time, to maintain their characteristic profile. Upcoming industrial pilot scale tests will have to validate the industrial usability of the novel enzyme."}
+{"text": "We are a product of the foods we chronically consume, and life expectancy correlates with the quality of our diet. What we eat influences the immune and cardiovascular systems, gut permeability and microbial dysbiosis, mental activity and health, and has long-term effects on fat storage. With rapid transformative advances to contemporary tools, how we study microbial ecosystems alters our perspective in both food and the gut. Sequencing technologies originally evolved from single gene profiles to complete genomic panoramas of microbial communities, where data acquisition is no longer the limiting factor for knowledge generation. Coupled with physical and biochemical techniques, this progress provides nano-resolution of food structure and microbial activity in the gut. A new frontier in current research that integrates information across fields alters and expands what is considered wholesome. Food, and the broader aspects of diet, are the primary modulator of the gut microbiota essential for homeostasis and prevention of chronic and infectious diseases. Understanding how food composition and structure alter the microbiota-host interaction is vital to engineering the next generation of foods that meet our nutritional needs while addressing safety and long-term well-being. This widening of scope bridges gaps between disciplines to improve the cross-feeding of ideas among experts interested in designing foods to be part of a diet that pushes the boundaries of current life expectancy. This Special Issue has collected studies from authors from five countries, providing insights into current research relating food ingredients with gut microbiota, whether healthy or not.\u201cProbiotics are live microorganisms that, when consumed in adequate amounts, confer a health benefit on the host\u201d . In ordeLactiplantibacillus plantarum over a two-week period stimulated the production of butyrate and led to higher levels of riboflavin than the control treatment consisting of a non-riboflavin producing strain of the same species. The strain-specific activity underscores the importance of probiotic validation studies for ensuring the selection of strains with a higher probability of conferring a measurable health benefit. In vitro gastrointestinal models have an important role in screening dietary components\u2019 effects on gut microbiota.In the study by Fan et al. , the entp-cresol) in the fecal slurries from chronic kidney disease (CKD) patients, while few differences were present in fecal slurries from healthy subjects. These in vitro results highlight the challenges confronting the formulation of effective synbiotic food products, providing a measure of confidence moving forward into in vivo studies. As another case in point for the vital contribution of in vitro models to screening processes, fecal slurries were employed by Vacca et al.  as a finTorres-Maravilla et al.  reviews Overall, this Special Issue has brought together quite distinctive viewpoints that we can expect to cross-feed ideas between researchers working with in vitro models, formulation of food components, live animals, and humans towards the common goal of improving our diets. We hope you enjoy reading this selection of papers."}
+{"text": "Mepiquat (Mep) is a contaminant produced by Maillard reaction with reducing sugar, free lysine and an alkylating agent under typical roasting conditions, particularly in the range of 200\u2013240 \u00b0C. It has been reported that exposure to Mep is harmful to rats. However, its metabolic mechanism is still not clear. In this study, untargeted metabolomics was used to reveal the effect of Mep on the metabolic profile of adipose tissue in Sprague-Dawley rats. Twenty-six differential metabolites were screened out. Eight major perturbed metabolic pathways were found, which were linoleic acid metabolism, Phenylalanine, tyrosine, and tryptophan biosynthesis, phenylalanine metabolism, arachidonic acid metabolism, Glycine, serine, and threonine metabolism, glycerolipid metabolism, Alanine, aspartate, and glutamate metabolism, and glyoxylate and dicarboxylic acid metabolism. This study lays a solid foundation for clarifying the toxic mechanism of Mep. Maximum residue limits (MRLs) for mepiquat in foods have been established in many countries or regions [Mepiquat  was used to detect changes of metabolites in adipose samples. In addition, we examined histopathological changes of adipose tissues in rats. The method was established to find more differential metabolites to comprehensively reveal the mechanism of Mep toxicity.Mepiquat (purity > 98%) was purchased from Sigma-Aldrich . Methanol was HPLC grade and obtained from Fisher . All standard compounds and 4-chloro-DL-phenylalanine were gained from Sigma or Sigma-Aldrich , Sigma-Aldrich also provided the derivatization reagent . All other chemicals were analytical grade.n = 10), low-dose group  and high-dose group . Rats were fed with standard laboratory feed and with ad libitum access to diet and water. One week later, the weight of rats was 200 \u00b1 15 g. LD50 of mepiquat is 464 mg/kg bw [This experiment was carried out in the SPF (Specific Pathogen Free) animal laboratory of animal center of Peking University Health Science Center . Conditions of the breeding environment were controlled as follows: 12 h dark/light cycle, temperature 22 \u00b0C \u00b1 1 \u00b0C, and relative humidity 60 \u00b1 5%. All experimental treatments were carried out according to the European Community guidelines for experimental animal use. The study plan was agreed by the Experimental Animal Protection and Use Committee of Peking University . Thirty male Sprague-Dawley rats aged 5\u20136 weeks were randomly divided into normal diet group . After centrifugation at 10,000 r/min for 5 min at 4 \u00b0C, supernatant was collected and the same procedure was used twice to extract the residue. The obtained complete supernatant was dried with nitrogen after being centrifuged for 5 min at 12,000 r/min. In total, 10 \u03bcL of 4-chloro-DL-phenylalanine (1.05 mg/mL in water) was added to each sample. Every sample was lyophilized and derivatized by adding 80 \u03bcL of MSTFA at 70 \u00b0C for 3 h. Every sample was mixed with 165 \u03bcL chloroform, vortexed, and centrifuged at 15,000 r/min for 15 min at 4 \u00b0C. Supernatant was transferred to GC-MS vials for analysis. Quality control (QC) samples were made by mixing the same volume (10 \u03bcL) of each sample. QC sample was run once every six samples during the assay [Fifty milligram white adipose tissue was homogenized in 2.0 mL of chloroform/methanol (he assay .m/z 50 to 650). Electron energy was 70 eV. Identification of compounds was carried out by authentic standards and the NIST library (2014)  [Agilent 7890A/5975C gas chromatography mass spectrometer was used with an HP-5 MS capillary column . The carrier gas was chromatographic grade helium, and the constant flow rate was 1.0 mL/min. The temperature program was set as follows: the initial temperature was 60 \u00b0C, held for 2 min, increased to 240 \u00b0C at a rate of 5 \u00b0C/min, then held for 3 min, and raised to 290 \u00b0C at a rate of 12 \u00b0C/min, maintained for 2 min. Injector temperature was set at 280 \u00b0C. Solvent delay was 5 min. Splitless injection mode was used. Injection volume was 1 \u03bcL. The mass spectrometry data were obtained in full scan mode  gained from the Mann\u2013Whitney U test in SPSS22.0 software . Metaboanalyst 5.0 ) and cytoscape software was utilized for metabolic pathway analysis.Data analysis was performed based on a previous research . The norThe ROC analysis was used for assessing the diagnostic ability of the differential metabolites to classify rats into a low or high Mep exposure. The area under ROC curve (AUC) from 0.5 to 1.0 showed diagnostic accuracy from no discrimination to good classification. The ROC analysis was completed by SPSS 22.0 software.p < 0.05), as shown in In this study, weight gained in Mep exposure groups were slower than that in the normal diet group. It indicated that Mep significantly inhibited the weight gain of rats (As shown in p < 0.05) of HD/ND in abundance. A total of twenty-six differential metabolites in adipose were quantified by normalization to 4-chloro-DL-phenylalanine . The relative levels of metabolites were shown as fold changes  = 77.7%, Q2 (cum) = 56.6%. In 2X (cum) = 76.7%, R2Y (cum) = 84%, Q2 (cum) = 73.3%. It showed that the two models have good quality and predictive ability. By performing a permutation test, it was verified whether the PLS-DA model was overfitting to evaluate the reliability of the model. The permutation experiment (number of permutations n = 999), R2 =  and Q2 = , proved that the model was not over fitted.Analytical testing for stability and reproducibility was performed with quality control (QC) samples. In p < 0.001) and isoleucine  increased in Mep-exposed groups; however, levels of octadecanoic acid  and glutamine  decreased in Mep-exposed groups  pathway library and the compound name of differential metabolites. The impact-value threshold obtained from pathway topology analysis was 0.10. Metabolic pathways with an impact value greater than 0.10 are linoleic acid metabolism, Phenylalanine, tyrosine, and tryptophan biosynthesis, phenylalanine metabolism, arachidonic acid metabolism, Glycine, serine, and threonine metabolism, glycerolipid metabolism, Alanine, aspartate, and glutamate metabolism, and glyoxylate and dicarboxylate metabolism. A summary of the pathway analysis was shown in KEGG database were used for analyzing metabolic networks related to differential metabolites. Metabolic network was formed in MetaMapp with integrating biochemical networks and chemical relationships. Metabolomics datasets were efficiently visualized as network graphs in Cytoscape using MetaMapp. In Leucine, isoleucine, and valine are three common branched-chain amino acids (BCAAs) in proteins. Elevated levels of BCAAs in adipose tissue may be due to decreased expression of BCAAs catabolic enzymes ,16. In aFatty acids affect the physiology of cells and tissues . ComparePyruvate can produce lactic acid by pyruvate dehydrogenase complex . The lacPentanedioic acid and acetamide showed good sensitivity and specificity. In the metabolism of amino acids, pentanedioic acid is naturally generated in the body. Defects in metabolic network of pentanedioic acid result in pentanedioic aciduria, along with accumulation of toxic by-products. It may induce severe encephalopathy . The masTo our knowledge, this is the first time that untargeted metabolomics study has been performed to investigate differential metabolites and possible toxic mechanism of Mep on adipose tissue. Twenty-six differential metabolites were screened. Levels of amino acids, such as glycine, valine, leucine, isoleucine, serine, proline, phenylalanine and alanine were higher in HD group than those in ND group. By contrast, contents of fatty acids including propanoic acid, hexadecanoic acid, octadecanoic acid, arachidonic acid, and oleic acid decreased in rats exposed to Mep. In comparison with ND group, levels of propionate, phosphoric acid, acetamide, creatinine, D-mannitol, pentanedioic acid, and acetic acid increased, while contents of lactic acid, urea, cholesterol, and glycerol decreased in the HD group. Eight major perturbed metabolic pathways were found with the exposure of Mep, which were linoleic acid metabolism, phenylalanine, tyrosine, and tryptophan biosynthesis, phenylalanine metabolism, arachidonic acid metabolism, glycine, serine, and threonine metabolism, glycerolipid metabolism, alanine, aspartate, and glutamate metabolism, and glyoxylate and dicarboxylic acid metabolism. This study lays a solid foundation for clarifying the mechanism of Mep toxicity."}
+{"text": "Hearing loss (HL) has been sporadically described, but not well characterized, in Generalized Arterial Calcification of Infancy (GACI), a rare disease in which pathological calcification typically presents in infancy.This study aims to describe the clinical audiologic and otologic features and potential etiology of hearing impairment in GACI and gain pathophysiological insight from a murine model of GACI.ENPP1asj/asj mutant compared to wild-type.Cross-sectional cohort study of individuals with GACI. Murine ossicle micromorphology of the Clinical research hospital; basic science laboratory.Nineteen individuals with GACI who met clinical, biochemical, and genetic criteria for diagnosis.Clinical, biochemical, and radiologic features associated with hearing status.Pure-tone thresholds could be established in 15 (n\u2009=\u200930 ears) of the 19 patients who underwent audiological assessments. The prevalence of HL was 50% (15/30) of ears, with conductive HL in 80% and sensorineural HL in 20%. In terms of patients with HL (n\u2009=\u20098), seven patients had bilateral HL and one patient had unilateral HL. Degree of HL was mild to moderate for 87% of the 15 ears with hearing loss. Of those patients with sufficient pure-tone and middle ear function data, 80% (8/10) had audiometric configurations suggestive of ossicular chain dysfunction (OCD). Recurrent episodes of otitis media (ROM) requiring pressure-equalizing tube placement were common. In patients who underwent cranial CT, 54.5% (6/11) had auricular calcification. Quantitative backscattered electron imaging (qBEI) of murine ossicles supports an OCD component of auditory dysfunction in GACI, suggesting loss of ossicular osteocytes without initiation of bone remodeling.Hearing loss is common in GACI; it is most often conductive, and mild to moderate in severity. The etiology of HL is likely multifactorial, involving dysfunction of the ossicular chain and/or recurrent otitis media. Clinically, this study highlights the importance of early audiologic and otologic evaluation in persons with GACI. Novel findings of high rates of OCD and ROM may inform management, and in cases of unclear HL etiology, dedicated temporal bone imaging should be considered.The online version contains supplementary material available at 10.1186/s13023-022-02410-w. ENPP1) leading to ENPP1 enzyme deficiency, and less commonly due to variants in ATP-binding cassette sub-family C member 6 (ABCC6)  is a commercially available murine model of ENPP1 deficiency developed by the Jackson Lab [To characterize mineralization changes that may account for HL, quantitative backscattered electron imaging (qBEI) of the ossicles from kson Lab . \u2018Asj\u2019 rp-values was set at\u2009<\u20090.05 and two-tailed, if applicable. Fisher\u2019s exact test was used to compare tympanic membrane findings on otoscopy with hearing status. Spearman correlation was used to evaluate intact and C-terminal FGF23, age of calcification onset, age of bisphosphonate (BP) initiation, duration of BP use, age of rickets treatment initiation, and number of hypertensive/heart failure medications\u2014all individually\u2014with the average of air conduction binaural 4F-PTAs.Descriptive and inferential statistical tests were completed using GraphPad Prism 8 for Windows, version 8.4.1 (GraphPad Software Inc). For comparative analyses, significance for ENPP1 or ABCC6 were referred for audiology testing; one was excluded from analysis due to cerumen impaction , and c.707T\u2009>\u2009C (p.Leu236Pro)).For ears with HL, the type was conductive in 80% (12/15 ears) and sensorineural in 20% (3/15 ears). A subclinical conductive component was present in a single ear. There were no patients with MHL. Degree of CHL was mild in 33.3% (4/12), moderate in 58.3% (7/12), and severe in 8.3% (1/12). SNHL was mild in one ear (1/3) and bilaterally profound (2/3) in one patient. This patient with profound SNHL had a diagnosis of enlarged vestibular aqueducts (EVA) and biallelic pathogenic variants in DPOAEs were assessed in 19 patients and were present in cases of normal hearing and absent in cases of SNHL or CHL, as expected. For four patients in whom pure-tone data could not be obtained, DPOAEs provided evidence of normal to near-normal hearing sensitivity.Tympanometry was performed in 19 patients , absent in 76.5% (n\u2009=\u200913), and elevated in 17.7% (n\u2009=\u20093). Six of the ears with absent or abnormal reflexes had normal hearing and normal tympanograms. Five ears with absent reflexes occurred in conjunction with CHL and normal tympanograms.Of 15 patients with pure-tone threshold data, 10 had sufficient data for OCD categorization; of these, 80% (n\u2009=\u20098) were categorized as having an audiometric pattern consistent with OCD in one or both ears Table . An examThirteen patients recalled the results of newborn hearing screening (NBHS): of these, nine patients passed and four did not pass Table . The fouOf the 20 GACI patients, five use hearing aids, four bilaterally and one unilaterally. The median age of initial hearing aid fitting was 9\u00a0months (6\u00a0months\u201324\u00a0years).Micro-otoscopy revealed abnormal tympanic membranes in 11 of 38 ears examined. Abnormal findings included retracted, thickened, thin/monomeric tympanic membranes and/or presence of serous otitis media Table . Of thosApproximately two-thirds of patients reported a history of recurrent otitis media (ROM) . Eleven had information regarding the most recent otitis media episode; of these, nine (81.8%) were in early childhood (<\u20096yo), and two (18.2%) were in adulthood (>\u200920\u00a0years old). Six individuals (31.6%) had a history of PET placement.Head CT was obtained, often for non-otologic reasons, in 11 patients. However, detailed description of the middle ear, ossicles, otic capsule, and inner ear morphology could not be adequately assessed in most patients due to thick section cuts (range 1.0\u20135\u00a0mm). In reviewing the imaging, 54.5% of patients (6/11) or 45.5% of ears 10/22) were observed to have auricular calcification  between biochemical\u00a0markers,\u00a0factors related to mineral homeostasis, and measures of cardiovascular burden of disease with the bilateral 4F-PTA. Details can be found in the supplemental materials.t-test, between ENPP1asj/asj and WT mice , and osteocyte characteristics of murine ossicles were analyzed by qBEI and compared via unpaired student\u2019s ice Fig.\u00a0A. VisualThis is the first study to systematically characterize hearing impairment in patients with GACI due to ENPP1 deficiency. HL was documented in 53.3% (8/15) of individuals and 50% (15/30) of ears by pure-tone thresholds. CHL occurred in 80% (12/15) and SNHL in 20% (3/15) of HL ears and was mostly mild to moderate in severity. The findings consistent with OCD and recurrent episodes of otitis media were common. In those with head CT imaging, more than half had the presence of auricular calcification.Of previously reported cases, 15 GACI patients have been noted to have hearing impairment  and increased frequency of PET placement (26.1%) in GACI vs. the general population 8.9%), highlighting clinically significant ROM necessitating intervention . These f%, highlissive HL , 30.Auricular calcification was observed in more than half of patients with head imaging, the most common CT finding in our cohort and previously observed in murine models .Strengths of this study include cohort size given disease rarity and the consistent and comprehensive audiologic and otologic evaluations performed at a single institution. Limitations include those inherent to retrospective studies of rare diseases, the cross-sectional design, and inadequate power for certain statistical analyses. It is thus possible that certain analyses for which we found no association could have reached statistical significance with a larger cohort of patients. Future animal studies could establish whether the administration of recombinant enzyme replacement therapy, shown to prevent the cardiovascular and skeletal complications of the disease, could prevent or improve hearing impairment , 29.Hearing impairment is frequent in patients with ENPP1-deficient GACI, ranging from mild to moderate CHL, and less commonly, SNHL. Novel findings of high rates of suspected OCD and ROM are consistent with a GACI murine model and suggest that patients with ENPP1-deficient GACI are at increased risk for progressive HL, warranting ongoing formal audiologic and otolaryngologic assessments. Early detection of HL may lead to timely treatment, minimizing speech and cognitive sequelae, especially in young patients. While HL from ROM could be treated with PET placement, HL from OCD may be managed with hearing aids and/or assistive listening devices. Select cases may benefit from surgical intervention to restore CHL, including ossicular chain reconstruction and bone conduction implantation. This study highlights the importance of early comprehensive audiologic evaluation with continued monitoring in individuals with GACI.Additional file 1: Table S1. Audiology interpretation criteria. 4F-PTA, four frequency  pure tone average; 3F-PTA, three frequency  pure tone average."}
+{"text": "Prior studies have found inconsistent results regarding the relationship between vitamin D status and Idiopathic Central Precocious Puberty (ICPP).To assess the role of serum 25-hydroxyvitamin D (25 [OH]D) levels in ICPP development.The authors retrospectively collected data from 221 girls with ICPP and 144 healthy girls between January 2017 and December 2019. The participants\u2019 serum 25(OH)D levels were measured using an automatic chemiluminescence method, and the association between serum 25(OH)D levels and the risk of ICPP was assessed using multivariate logistic regression analysis. Odds Ratios (OR) with 95% Confidence Intervals (95% CI) were calculated as effect estimates.Serum 25(OH)D levels in the ICPP group were significantly lower than those in healthy controls (p < 0.001). Multivariate analysis indicated that girls with insufficient vitamin D levels  and sufficient vitamin D levels  both had a lower risk of ICPP than girls with vitamin D deficiency. Moreover, the authors found that the height (p\u00a0=\u00a00.014), weight (p\u00a0=\u00a00.014), breast stage (p\u00a0=\u00a00.010), mother's height (p < 0.001), and luteinizing hormone/follicle-stimulating hormone ratio (p\u00a0=\u00a00.010) in girls with ICPP could be associated with levels of vitamin D.This study found that a low serum 25(OH)D level is an independent risk factor for ICPP, and several characteristics of girls with ICPP could be affected by their vitamin D status. This study was approved by the Institutional Review Board of the Ningbo Women and Children's Hospital ([2018] n\u00b0 26) and followed the STROBE Statement. All patients and their families were informed regarding the study, and written informed consent was obtained from all patients and their families. The definition of ICPP followed the 2015 guidelines of the Chinese Medical Association,,Girls were divided into the deficient, insufficient, and sufficient vitamin D groups, which were defined as serum 25(OH)D levels < 20 ng/mL, 20\u201330 ng/mL, and \u226530 ng/mL, respectively.A physical examination was conducted by a professionally trained pediatric endocrinologist. The heights and weights of the study participants were measured using standard methods similar to previous studies.The means (standard deviations) and events (frequencies) were used to describe continuous and categorical variables, respectively. Analysis of variance was performed to compare the differences in continuous variables among the three groups, while the differences among the groups for categorical variables were compared using the Kruskal-Wallis or Chi-Square test. The role of serum 25(OH)D levels in the development of ICPP was assessed by multivariate stepwise logistic regression, and the effect estimates were assessed using Odds Ratios (OR) with 95% Confidence Intervals (95% CI). All reported p-values were 2-sided, and the inspection level was 0.05. Statistical analysis was performed using SPSS software .The baseline characteristics of the participants are summarized according to vitamin D status in After adjusting for potential confounders, the authors noted that the insufficient  and sufficient  groups had a lower risk of ICPP than the deficient group. Moreover, a higher weight  and bone age/age ratio  were associated with an increased risk of ICPP .Table 2MThe clinical characteristics of the girls with ICPP according to vitamin D status are shown in Prior studies have demonstrated that early menarche is associated with an increased risk of obesity, type 2 diabetes mellitus, and cardiovascular disease.,,Several studies have previously illustrated the role of vitamin D in ICPP.,When assessing the role of vitamin D status with the characteristics of girls with ICPP, the authors noted that height, weight, breast stage, mother's height, and LH/FSH ratio could all be affected by the vitamin D status, which is inconsistent with a previous study conducted by B\u00e9naz\u00e9 et al.Several limitations of this study should be mentioned. First, selective or recall biases inherent to the retrospective nature of the present study could affect the reliability of the conclusions. Second, the number of girls in the vitamin D deficient, insufficient, and sufficient groups was not balanced, and the results were therefore not stable. Third, the severity of ICPP was not assessed, which may be related to vitamin D status, and could bias the potential role of vitamin D status in the risk or characteristics of ICPP. Finally, data on the participants\u2019 background consumption of vitamin D or calcium from dietary supplements were not available and should be considered in further studies.In summary, the authors found that vitamin D deficiency is an independent risk factor for ICPP in girls. Moreover, the weight and bone age/age ratio could affect the progression of ICPP. Furthermore, the vitamin D status in girls with ICPP may affect several characteristics, including their height, weight, breast stage, and LH/FSH ratio. Further large-scale prospective studies should be performed to verify the findings of this study in girls with specific characteristics.ICPP, Idiopathic Central Precocious Puberty; 25 [OH]D, 25-Hydroxyvitamin D; CPP, Central Precocious Puberty; HPG, Hypothalamic-Pituitary-Gonadal; E2, Estradiol; LH, Luteinizing Hormone; FSH, Follicle-Stimulating Hormone; BMI, Body Mass Index; IGF-1, Insulin-like Growth Factor 1; OR, Odds Ratios; CI, Confidence Interval; VDR, Vitamin D Receptor.All authors have read and approved the final version of this manuscript.The datasets used and analyzed in the present study are available from the corresponding author upon reasonable request.The authors can confirm that all methods were carried out in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. The authors confirm that written informed consent has been obtained from all participants from their parents and/or legal guardians. This study was approved by the Institutional Review Board of the Ningbo Women and Children's Hospital ([2018] n\u00b0 26) and followed the STROBE Statement.Not applicable.Dong-Mei Gan: Data curation, Writing \u2013 original draft, Visualization, Investigation. Jie Fang: Conceptualization, Methodology, Software, Data curation, Writing \u2013 original draft, Software, Validation, Writing \u2013 review & editing. Ping-Ping Zhang: Visualization, Investigation. Yu-Dan Zhao: Supervision. Ya-Nan Xu: Writing \u2013 review & editing.The authors declare no conflicts of interest."}
+{"text": "After doping with TiO2, a much more densely packed pellet with uniformly distributed porous structure is obtained. Changes in surface chemistry and local structure in the bulk are observed, which are believed to contribute to the improved ionic conductivity and higher critical current density of the TiO2\u2010doped NZSP. Stable cycling performance with reversible capacities based on different Na storage mechanisms are also demonstrated.Seawater batteries (SWBs) have gained tremendous interest in the electrochemical energy storage research field because of their low cost, natural abundance, and potential use for long\u2010duration energy storage. Advancing a SWB to demonstration projects is plagued by the poor electrochemical performance stemming from the poor interfaces of the solid electrolyte (SE), as well as the structural and chemical instabilities and sluggish ionic transport properties. In this study, the anode compartment of a surrogate SWB is constructed with a Na | SE | hard carbon configuration, and tailored dopants are introduced into the Nasicon\u2010type Na 2 can tune the structural and chemical properties and electrochemical performances of the Na3Zr2(SiO4)2(PO4) solid electrolyte to meet the requirements for seawater battery applications.TiO Global consensus suggests that the energy transition must rely on higher introduction rates of renewable sources to ensure a sustainable energy future. However, renewable energy sources such as wind or solar are intermittent in nature, and their distribution is less concentrated compared with fossil fuels. Thus, energy storage solutions are pursued to enable the wider acceptance and use of renewable energy sources in residential and commercial buildings, as well as offshore. Although most energy storage solutions suffer from deployment costs and performance issues, certain batteries suffer further from their reliance on critical materials and materials supply chain inconsistencies. Within this context, the concept of a seawater battery (SWB) recently emerged as a potential long\u2010duration energy storage solution because of the infinite supply of seawater.1 The 3Zr2Si2PO12 (NZSP) material, which has high ionic conductivity as a solid\u2010state electrolyte, has been proposed as a promising candidate for solid\u2010state Na batteries. However, solid\u2010state electrolytes often encounter issues such as dendrite growth and poor cycling, which ultimately lead to the failure of the cell. The failure mechanism is often associated with an unstable interface that can originate from the poor structural integrity, low ionic conductivity, chemical instability of the SEs, poor contact between the Na metal and SE, or a combination of more than one of these origins.The system uses earth\u2010abundant seawater and its alkali metal ions, such as Na, in one chamber as the active catholyte. The Na ion is transported from the cathode chamber through a ceramic electrolyte membrane into an anode chamber containing hard carbon (HC). The overall electrochemical reaction produces a cell voltage of 3.4\u00a0V as the result of the oxidation of the alkali metal ion at the anode and oxygen reduction reaction at the cathode, forming soluble metal chlorides. The system design constantly rejuvenates reactive components, which promises long life in practical cells. An appropriate anode is essential to ensure reversible Na ion storage, and the choice of the organic electrolyte has a great effect on the electrochemical performance and practicality of the SWB. The solid electrolyte (SE), which is the separation layer between the anode and cathode compartments, plays a crucial role because it should not only promote Na transport when being in contact with nonaqueous electrolytes but should also be stable against saline water and act as physical barrier between the aqueous and nonaqueous electrolytes. Nasicon Nathe cell.2 The 2O3 and TiO2 were introduced in the Nasicon NZSP to tune the chemical, structural, and electrochemical properties of the SEs for the SWB. Advanced characterizations were performed to investigate the morphology, porous structure, local surface and bulk properties, and ionic conductivities of the SE NZSP. Electrochemical performance for the pristine and doped NZSP were evaluated in both a Na | NZSP | Na symmetrical cell configuration and a Na\u00a0| NZSP | HC cell configuration to mimic the anode compartment of the cell. Results show that in the presence of TiO2 doping, NZSP could achieve higher ionic conductivity and enhanced surface stability and local structure. The TiO2\u2010doped NZSP (Ti\u2013NZSP) also exhibited the highest critical current density (CCD) in symmetrical cells and much better cycling performance in Na\u00a0|\u00a0NZSP\u00a0| HC cells.This study focused on the SE part of the battery as doping materials such as Al2Figure\u00a02O3 (Al\u2013NZSP) and TiO2 (Ti\u2013NZSP) are shown in Figures\u00a03Zr2(SiO4)2(PO4) NZSP as a Na+\u2010conducting SE material was first analyzed using a powder X\u2010ray diffraction (XRD) technique. The diffractogram of the material recorded in the 2\u03b8 range of 10\u00b0\u2013100\u00b0 is illustrated in Figure\u00a03Zr2(SiO4)2(PO4) material. All peaks are sharp and well defined, confirming the high degree of crystallinity in Na3Zr2(SiO4)2(PO4). Full pattern matching and refinement indicates that the material has a rhombohedral crystal structure with space group R3\u00afc, as indicated by the labeled peak positions and the magenta indexes below each pattern. The calculated lattice parameters for NZSP, Al\u2013NZSP, and Ti\u2013NZSP are summarized in Table 2 to the pristine NZSP led to a minor modification in the lattice constants without any impurity phases. However, for NZSP with 2% Al2O3, two phases\u2014Na3Zr2(SiO4)2(PO4) and NaZr2(PO4)3\u2014were observed, as well as minor modification in the lattice constants. In summary, densely packed pellets and high crystallinity were achieved for NZSP, Al\u2013NZSP, and Ti\u2013NZSP despite the formation of some pores for the NZSP pellet and some phase separation for the Al\u2013NZSP pellet.The SWB and its applications are schematically illustrated in 2 powder, ball\u2010milled TiO2\u2013NZSP powder, and the Ti\u2013NZSP pellet  after Al doping, which indicated that the Zr was in a Zr4+ state. However, for Ti\u2013NZSP, the Zr 3d3/2 and 3d5/2 peaks that shifted toward higher binding energies  indicated higher oxidation states were achieved for Zr. In comparison, Na 1s, Si 2p, P 2p, and O 1s spectra for the three NZSP pellets are shown in Figure\u00a0 For Al\u2013NZSP, no obvious changes in the binding energies were observed when compared with NZSP, since the introduction of Al2O3 led to a separate phase (NaZr2(PO4)3) that is segregated from the parent NZSP with identical (XO4)3 (X = P or Si) clusters. The binding energies for Na 1s, Si 2p, P 2p, and O 1s all shifted toward higher values for the Ti\u2013NZSP compared with NZSP, which can be attributed to Ti doping and associated local structure changes when TiO6 octahedron meets the NZSP lattice. However, no strong evidence was observed of Ti3+ existing on the surface of Ti\u2013NZSP based on the XPS results, which could indicate that a different compound might contain Ti4+ in a different local atomic arrangement, such as a distorted TiO6 octahedron on the surface of Ti\u2010NZSP.X\u2010ray photoelectron spectroscopy (XPS) analysis was performed to understand the oxidation states of each element on the surface of the samples. Titanium 2p spectra were collected for pristine TiOet Figure2A. AfteP Figure\u00a0. The ZirFigure\u22121, respectively, at 20 \u00b0C. At 70 \u00b0C, the Ti\u2013NZSP showed a conductivity of 4.20 mS cm\u22121 compared with 0.83 mS cm\u22121 for the Al\u2013NZSP and 1.45 mS cm\u22121 for the NZSP. From the Arrhenius plots of the conductivity measurements, the activation energy for Na ion migration was estimated to be 0.18\u00a0eV for Ti\u2013NZSP, 0.23\u00a0eV for NZSP, and 0.24\u00a0eV for Al\u2010NZSP. Transport in these crystalline materials is typically dictated by crystal structure, defect chemistry, and mobile charge concentrations. Sodium ions migrate through the tunnels made by the Si\u2013PO4 tetrahedron and ZrO6 octahedron. Titanium doping potentially disrupts the bond lengths in this octahedron and surrounding coulombic interactions, affecting activation energy and the conductivity for ion migration. Relatively similar activation energy of the Al\u2010NZSP system indicates that the ion transport pathway is potentially similar to the NZSP system, although with lower conductivity owing to potential secondary insulating phases formed (as seen from the XRD patterns). Subsequently, the CCD of the SEs was measured using symmetric Na | SE | Na cells. CCD is a measure of the maximum allowable current density that can be cycled through the SE prior to filament formation. The protocol employed transported a 0.2 mAh cm\u22122 charge in each half\u2010cycle between 0.1 and 7.5\u00a0mA cm\u22122 . For symmetric cells, the key changes in the spectra can be broadly described with two behaviors: 1) a sharp increase in the impedance consistent with physical voiding of the Na metal from the solid electrolyte interphase (SEI) and 2) a sharp decrease in the impedance consistent with the formation of filaments within the SE. To visualize this change better over the duration of cell cycling, the 3D spectra was projected on the  plane so the shifts in the real part of the impedance could be easily tracked , a change in the impedance profile was seen for the NZSP and Ti\u2013NZSP system, which might be related to Na diffusion kinetics at the applied stack pressure. Beyond that change, the NZSP system showed a sharp increase in a few cycles followed by signatures of soft shorting. Similar behavior was seen for Ti\u2013NZSP, but it was in later cycles. The impedance spectra are consistent with the voltage polarization profiles observed within the CCD measurements, where a flat polarization is seen for the lower current densities followed by gradual sloping and nonlinear behaviors at higher current densities. Notably, this analysis is purely qualitative in nature and was carried out to assess the relative behavior of the three material systems.The impedance of the symmetric cell was also tracked during cycling at the end of each plating and stripping step. A typical representation of the Nyquist diagrams is shown in Figure n the SE.7, 9Figure6 octahedron. This phenomenon could relate to the hypothesis proposed in Figure\u00a02 standard is at 4972\u00a0eV. Thus, peak shift toward lower energy was observed for spot 2 in comparison with the standard sample, which is likely because the coordination of Ti changed from sixfold to lower. Also, the XANES spectra for spot 2 looked similar to a rutile TiO2 standard. Although it is still unclear now what the exact local environment was within the Ti\u2013NZSP structure, the authors know that changes are associated with the TiO6 octahedron and Ti coordination, which are a result of the introduction of TiO2 into the Na3Zr2(SiO4)2(PO4) structure.To further characterize the bulk properties of the Ti\u2013NZSP pellets, synchrotron X\u2010ray absorption near edge structure (XANES) analysis was performed on the pellet. The penetration depth was \u224812\u00a0\u00b5m at 4966\u00a0eV (Ti K\u2010edge). From all the spectra that were collected, at least two different Ti local structures Figure5A were  To assess the microstructure of these SEs, synchrotron X\u2010ray tomography was performed on the sintered pellets. Binarization of the reconstructed images enabled researchers to visualize the porosity distribution in these SEs 2(PO4) and NaZr2(PO4)3 on the surface, and 2) the SEI formation during electrochemical testing when two drops of 1\u00a0m NaPF6 in diglyme were added to wet the Na | SE interface. Because of the phase separation in Al\u2013NZSP, the SEI can be kinetically and thermodynamically unstable for Na plating and stripping, which thus explains the poor CCD value obtained for Al\u2013NZSP in the galvanostatic plating/stripping test. XPS was also performed on cycled pellets, and the Zr 3d, Na 1s, and F 1s spectra are shown in FigurePostmortem characterizations were performed on cycled SE pellets. The SEM and EDX results of cycled NZSP, Al\u2013NZSP, and Ti\u2013NZSP are presented in 32 resulted in a much denser SE and a modified NZSP surface with oxidized elements. With Ti\u2010doping, the ionic conductivity of the Ti\u2013NZSP SE reached 4.20 mS cm\u22121. A high CCD of \u22482.5\u00a0mA cm\u22122 was realized in the Ti\u2013NZSP in Na | SE | Na symmetric cell configuration. For practical application, the SWB was mimicked with a Na | SE | HC cell configuration, and it demonstrated excellent cell performances based on storage or plating mechanisms. Postmortem characterization results indicated that a much more stable SEI can be formed on the surface of Ti\u2013NZSP. This work has provided engineering solutions toward SEs, which can pave the way for making better seawater batteries in the future.In summary, a Nasicon\u2010type SE was developed for SWB applications. Without producing a new phase, the introduction of TiO42O3 and TiO2 (Sigma Aldrich) were prepared by ball\u2010milling the appropriate quantities of the powders. The doping amount of Al2O3 and TiO2 was set at 2\u00a0wt%. Pellets of NZSP, Al\u2013NZSP, and Ti\u2013NZSP were made in a hydraulic press at 5 ton at 150 \u00b0C. The pellets were subsequently sintered at 1000 \u00b0C for 24\u00a0h to obtain the final pellets. The pellets were polished through 220 to 2000 and to 3000 grit sandpapers to get a smooth, mirror\u2010like surface for further evaluation. The pellets used for electrochemical testing had thickness of \u2248800\u00a0\u00b5m and a diameter of 10\u201312\u00a0mm. HC anode  was mixed with carbon black (Super C65) and polyvinylidene difluoride (Solvay 9300) in a weight ratio of 92:2:6 in an N\u2010methyl\u20102\u2010pyrrolidone solution before being casted onto Cu foil.Nasicon\u2010type NZSP was purchased from MSE Supplies LLC and used as is for making the baseline NZSP pellets. Mixtures of NZSP with AlThe pristine NZSP powder and the sintered pellets were characterized by powder XRD. XRD patterns were collected using a Panalytical Empyrean Diffractometer using a 60\u00a0kV Mo source and 40\u00a0mA beam current. The pattern data was collected between 10\u00b0and 70\u00b0 with a step size of 0.01\u00b0 at room temperature. HighScore Plus software was used to analyze all the results, and the Rietveld method was adopted to refine the XRD data using Jana2006 program package software. SEM measurements of the pristine and the electrochemically cycled pellets were carried out using a Zeiss MERLIN FE\u2010SEM. The SEM micrographs were collected at a nominal electron excitation of 5\u00a0keV. Energy\u2010dispersive spectrometry mapping of these pellets was carried out at 15\u00a0keV and a working distance of 8.5\u00a0mm.\u03c3 is the conductivity, R is the bulk resistance, t is the thickness of the sample, and A is the sample area. Conductivity measurements were performed between 20 and 70 \u00b0C, and the activation energy for the ion transport was estimated from these measurements using the Arrhenius Equation.Conductivity measurements of the sintered pellets were carried out using impedance spectroscopy measurements with silver blocking electrodes. Alternating current (AC) impedance measurements were carried out on a Biologic VSP 300 potentiostat between 1\u00a0MHz and 1\u00a0Hz with an amplitude of 50\u00a0mV. The impedance spectra were fit to appropriate equivalent circuits, and conductivity was estimated using the following equationm NaPF6 in diglyme) to mimic the SWB cell. The cells were allowed to stabilize at 70 \u00b0C prior to the initiation of the CCD measurement. The cells were cycled under a fixed protocol wherein a 0.2\u00a0mAh cm\u22122 charge was cycled in each plating/stripping cycle. CCD was defined as the current density where a sharp variation from the planar deposition/dissolution profile was observed. In addition to CCD, some Na | SE | Na cells were also cycled for long\u2010term plating/stripping behavior. The symmetric cell was subjected to 50 cycles of 0.2 mAh cm\u22122 electrodeposition and dissolution, 50 cycles of 0.5 mAh cm\u22122 electrodeposition and dissolution, and 50 cycles of 1 mAh cm\u22122 electrodeposition and dissolution at a current density of \u22481\u00a0mA cm\u22122.Symmetrical cells of Na | SE | Na were prepared in a coin cell configuration. For this configuration, NA was rolled into thin sheets and punched out to 6\u00a0mm diameter disks. Each Na | SE interface was wetted with two drops of Na liquid electrolyte  between 0.005 and 1.5\u00a0V. Subsequently, some cells were cycled within the storage region of the HC at the C/5 rate (between 1.5 and 5\u00a0mV cutoff). Alternatively, the plating stability of the Na | SE | HC cell was evaluated. After the formation cycle, the cell was allowed to discharge above the storage threshold of HC material (20\u00a0h at C/5 with \u22121\u00a0V cutoff). After that discharge, the cell was cycled at C/5 for 5\u00a0h between \u22121.5 and 1.5\u00a0V. After cycling, the cells were disassembled inside a humidity\u2010controlled dry room, and the SE pellets were taken out for ex situ characterization.HC anodes were punched out into 6\u00a0mm disks with \u22481.7\u00a0mg cm2O3 and TiO2 powders. All ex\u2010situ XPS were carried out on a SCALAB Xi+ spectrometer (Thermo Fisher Scientific) using a monochromatic Al K\u03b1 source operated at 200\u00a0W with a 650\u00a0\u00b5m beam size. The pass energy of the spectra was 40\u00a0eV.XPS spectra were collected on the pristine and electrochemically cycled pellets. XPS was also carried out on the pristine Al2. Under these experimental conditions, a single tomography scan took \u22487\u201310\u00a0min of acquisition time.Synchrotron tomography studies of the sintered pellets were carried out at beamline 2\u2010BM\u2010B of the Advanced Photon Source at Argonne National Laboratory. For these measurements, 3\u00a0mm pellets were separately pressed and sintered with the powders to ensure that the entire pellet could be captured in the field of view. A pink beam configuration was used to enable adequate transmission through the dense materials. In total, 1500 projections were captured during a 180\u00b0 rotation of the sample with a 100\u00a0ms exposure time for each projection. A forward\u2010looking infrared Oryx ORX\u201010G51S5M camera was used with a 2\u00d7 magnification objective lens. The resultant voxel size was \u22481.7\u00a0mm with a field of view of 3.4 \u00d7 3.6 mmTitanium K\u2010edge XANES spectra were collected at beamline 20\u2010BM at the Advanced Photon Source at Argonne National Laboratory using a Si (111) double\u2010crystal monochromator, which was detuned to 15% of its original maximum intensity to eliminate high\u2010order harmonics. The spectroscopic data were collected using a focused beam in fluorescence mode owing to the low concentration of the element of interest (Ti) within the sample pellet. The Rh\u2010coated harmonic rejection mirror was set to 5 mrad to cut off the high energy harmonics. Energy calibration was performed by using the first derivative point of the XANES spectrum of Ti (K\u2010edge = 4966\u00a0eV) of a metallic Ti foil recorded before and after the measurement.The authors declare no conflict of interest.Supporting InformationClick here for additional data file."}
+{"text": "Background: The increased focus on quality indicators (QIs) and the use of clinical registries in real-world cancer studies have increased compliance with therapeutic standards and patient survival. The European Society of Breast Cancer Specialists (EUSOMA) established QIs to assess compliance with current standards in breast cancer care. Methods: This retrospective study is part of H360 Health Analysis and aims to describe compliance with EUSOMA QIs in breast cancer management in different hospital settings . A set of key performance indicators (KPIs) was selected based on EUSOMA and previously identified QIs. Secondary data were retrieved from patients\u2019 clinical records. Compliance with target KPIs in different disease stages was compared with minimum and target EUSOMA standards. Results: A total of 259 patient records were assessed. In stages I, II, and III, 18 KPIs met target EUSOMA standards, 5 met minimum standards, and 8 failed to meet minimum standards. Compliance with KPIs varied according to the type of hospital (particularly regarding diagnosis) and disease stage. Although small differences were found in KPI compliance among institutions, several statistical differences were found among treatment KPIs according to disease stage, particularly in stage III. Conclusions: This study represents the first assessment of the quality of breast cancer care in different hospital settings in Portugal and shows that, although most QIs meet EUSOMA standards, there is room for improvement. Differences have been found across institutions, particularly between oncology centers and general hospitals, in diagnosis and compliance with KPIs among disease stages. Stage III showed the greatest variability in compliance with treatment KPIs, probably related to the lower specificity of the guidelines in this disease stage. In 2020, female breast cancer had a global incidence of 2.3 million new cases , ranking as the most commonly diagnosed cancer  3+ or in situ hybridization-positive) invasive carcinoma (T > 1 cm or node-positive) treated with chemotherapy received adjuvant trastuzumab.4.\u00a0Staging and follow-upHalf of patients with stage I disease did not undergo baseline staging tests during initial staging, as opposed to 90% of patients with stage III disease. Almost all patients were referred to nurse counseling at the time of the first visit or prior to the primary treatment with the purpose of being informed about day-to-day hospital functioning, assessment of body surface/surgical scars, and toxicities associated with the proposed treatment.After curative treatment, almost all patients underwent routine annual mammography surveillance and clinical evaluation with a periodicity of 6\u201312 months in the first five years after the primary surgery.KPI compliance with target EUSOMA standards in all localized disease stagesKPIs were assessed and compared with target EUSOMA standards. KPI compliance with minimum and target EUSOMA standards in stage I\u2013III breast cancer is detailed in As shown in DiagnosisFull compliance with EUSOMA standards was observed in women with breast cancer who preoperatively underwent mammography\u201499.5% (95% CI 97\u2013100%)\u2014and ultrasonography of both breasts and axillae\u201499% (95% CI 96\u2013100%). However, minimum standards were not met for physical examination.Full compliance with EUSOMA standards was also observed for preoperative histology- or cytology-confirmed malignant diagnosis\u201496% (95% CI 94\u201399%)\u2014as well as for descriptive histological parameters .Regarding the pathological report of the surgical specimen, histological type and grade met target standards\u201499.4% (95% CI 98\u2013100%) and 98.2% (95% CI 96\u2013100%), respectively\u2014while pathological stage  only met minimum standards. All the remaining parameters failed to meet predefined EUSOMA standards. For noninvasive cancers, only the dominant histological pattern reported met the target standard\u201498.3% (95% CI 95\u2013100%)\u2014with the remaining parameters falling below minimum standards.2.\u00a0TreatmentAll stage I\u2013III breast cancer cases were discussed in a multidisciplinary group meeting, which included surgeons, medical oncologists, pathologists, radiologists, radiation oncologists, geneticists, and nuclear medicine specialists. Considering surgical parameters, KPI compliance with standards was met for patients with invasive cancer and clinically negative axilla who underwent sentinel lymph node biopsy\u201490.6% (95% CI 86\u201396%)\u2014and for patients with invasive breast cancer pN0 who did not undergo axillary clearance\u201482.9% (95% CI 76\u201390%). Minimum standards were met for patients with invasive cancer who received a single surgery for the primary tumor\u201483.9% (95% CI 78\u201390%)\u2014and for patients with invasive breast cancer <3 cm in size (including DCIS component) who underwent breast-conserving treatment as primary treatment (excluding BRCA1 and BRCA2 patients)\u201465.7% (95% CI 58\u201374%). Patients with invasive cancer who underwent axillary clearance failed to meet the minimum criteria of at least 10 excised nodes.Regarding RT, the proportion of patients with pN2a involvement who received post-mastectomy RT to the chest wall and all unresectable regional lymph nodes met target EUSOMA standards\u201482.9% (95% CI 70\u201395%). However, the proportion of patients with invasive breast cancer who received postoperative RT after surgical resection of the primary tumor and appropriate axillary staging/surgery in the setting of breast-conserving therapy fell below minimum standards.For systemic therapy, two out of seven KPIs met target standards: proportion of patients with endocrine-sensitive invasive cancer who received endocrine therapy\u201497.4% (95% CI 95\u2013100%)\u2014and proportion of patients with HER2-positive invasive carcinoma (T > 1 cm or node-positive) treated with chemotherapy who received adjuvant trastuzumab\u201492% (95% CI 81\u2013103%). Compliance with minimum standards was met for the proportion of patients with HER2-negative invasive carcinoma (T > 1 cm or node-positive) treated with chemotherapy who did not receive adjuvant trastuzumab (96.3% [95% CI 93\u201399%]) and for the proportion of patients with ER-negative invasive carcinoma (T > 1 cm or node-positive) who received adjuvant chemotherapy (65.6% [95% CI 49\u201382]). The remaining three parameters evaluating systemic therapy failed to meet minimum standards.3.\u00a0Staging and follow-upRegarding staging and follow-up KPIs, the target standard was 99%, and the minimum standard was 95%. Except for women with stage I breast cancer who did not undergo baseline staging tests, all three remaining KPIs met minimum standards (two of which met target standards).KPI compliance with target EUSOMA standards according to disease stageKPI compliance with target EUSOMA standards according to disease stage was achieved for most KPIs. The analysis was not performed for some KPIs due to the small sample size for some disease stage parameters.Compliance with target EUSOMA standards in stage I disease was not achieved for the following KPIs: Proportion of patients with invasive cancer who underwent axillary clearance with excision of at least 10 nodes; proportion of patients with invasive breast cancer who received postoperative RT after surgical resection of the primary tumor and appropriate axillary staging/surgery in the setting of breast-conserving treatment; and proportion of patients with stage I breast cancer who did not undergo baseline staging tests .For invasive and noninvasive cancers with prognostic/predictive parameters recorded in the surgical specimen, not all parameters met target standards.In stage II disease, minimum EUSOMA standards were not achieved for the following KPIs: proportion of patients with invasive cancer with ER and PgR expression and HER2 amplification recorded in the surgical specimen, and proportion of patients with a report of peritumoral vascular invasion and distance to the nearest radial margin . The latIn stage III disease, the following KPIs failed to meet minimum EUSOMA standards: proportion of patients with invasive cancer with peritumoral vascular invasion and distance to nearest radial margin recorded in the surgical specimen; proportion of patients with noninvasive cancer with size and grade recorded in the surgical specimen; proportion of patients with invasive cancer and clinically negative axilla who only underwent sentinel lymph node biopsy; proportion of patients with invasive cancer who underwent axillary clearance with excision of at least 10 nodes; proportion of patients with invasive breast cancer who received postoperative RT after surgical resection of the primary tumor and appropriate axillary staging/surgery in breast-conserving treatment setting; and proportion of patients (excluding BRCA1 and BRCA2 cases) with invasive breast cancer no larger than 3 cm in size (including DCIS component) who underwent breast-conserving treatment .KPI compliance with target EUSOMA standards according to the type of hospital and disease stageThe analysis of KPI compliance with target EUSOMA standards according to type of hospital  and disease stage is reported in Although several studies have examined the quality of breast cancer care, many were conducted before 2003, when guidelines and treatments differed from those currently in use, with only a few recent studies conducted at a population level ,9,10,11.Assessment of the performance of the health system in breast cancer management requires measuring compliance with standards of care in real life. To our knowledge, the present multicenter study represents one of the very few in the literature evaluating QIs in breast cancer care. In 2019, three population-based studies focusing on EUSOMA QIs in breast cancer management were conducted in Slovenia, France, and Norway ,12,13. IThe seven hospitals included in this study had distinct typologies  and hence varied in organizational features and the number of patients with breast cancer annually admitted. The EUSOMA criteria for QIs are precise in their specifications and data selection regarding minimum and target standards . These sThe QIs selected in this study referred to screening, diagnosis, treatment, and follow-up. KPIs were mostly extracted and adapted from EUSOMA guidelines, but also from a study by Khare and colleagues addressing important QIs, including the proportion of patients with breast cancer discussed in multidisciplinary tumor boards at some point after diagnosis (as opposed to the stricter EUSOMA definition that restricts multidisciplinary boards to pre- and postoperative settings) ,3,14. InSome QIs were further divided into several KPIs, with the aim of retrieving more detailed information on how breast cancer care is provided in the hospitals included. For example, the \u201cproportion of women with breast cancer who preoperatively underwent mammography, physical examination, and ultrasound of both breasts and axillae\u201d was subdivided into three independent KPIs focusing on mammography, physical examination, and ultrasound.Overall, some unexpected and interesting results were found when analyzing the data retrieved from this study.Results from this study showed that approximately one-third of women were diagnosed through screening exams. However, it should be noted that data were collected regardless of patients\u2019 age , and hence a lower percentage than expected was retrieved.Overall, the proportion of invasive cancer cases for which the histological type, grade, ER and PgR expression, and HER2 amplification were reported was over 95%, which agrees with EUSOMA target standards. However, this was not observed for the surgical specimen. We believe this is in part because it is not mandatory to specifically repeat ER/PgR expression and HER2 amplification in the surgical piece for patients with previous assessment of these parameters in the biopsy. Pathological in situ data also failed to meet EUSOMA standards. However, while some parameters were considered risk factors in the past , reference to a free tumor margin is currently considered sufficient.The proportion of cancer cases preoperatively examined by MRI was considerably higher than EUSOMA target standards. However, we hypothesize that this proportion is overestimated, as all patients were included regardless of the therapeutic strategy . Additionally, approximately one-fifth of patients were referred for genetic counseling, when the EUSOMA target is 5%.EUSOMA standards for surgical procedures were globally met. The EUSOMA consensus was based on a meta-analysis, including 28,162 patients from 33 studies examining the relationship between margin width and local control . Two-thiThe proportion of patients with invasive breast cancer who received postoperative RT after surgical resection in the setting of breast-conserving therapy was below minimum EUSOMA standards, diverging from European studies, where higher rates (92\u201398%) were reported ,12,13. IConcerning antineoplastic endocrine therapy, the results here obtained agree with those from previous studies ,12,16,20Compliance with adjuvant chemotherapy recommendations was generally low, which can be partly explained by the use of neoadjuvant chemotherapy, which has been largely implemented in recent years, particularly in breast tumors with aggressive phenotypes (triple-negative or HER2-positive). This hypothesis is reinforced by the low number of patients eligible for KPI assessment. Furthermore, it also explains the low proportion of patients with HER2-positive disease treated with adjuvant chemotherapy. Compliance with adjuvant trastuzumab was high in this study (92%), as expected.The proportion of patients with inflammatory or locally advanced unresectable ER-positive carcinoma who received neoadjuvant chemotherapy was lower than expected.Although, in general, small differences were found in KPI compliance among institutions, several statistical differences were found in treatment KPIs according to disease stage. This is probably related to the variability of treatment options available for each breast cancer subtype, particularly in stage III disease, where treatment guidelines are less specific than in other disease stages and the variability of treatment options is greater.Due to the exceedingly low probability 0.3\u20131.2%) of distant occult metastases in stages I\u2013II \u20131.2% of . In the Regarding follow-up, a recent study indicated that although not all Portuguese institutions treating patients with breast cancer have an established written protocol for follow-up of breast cancer survivors, most follow and comply with international guidelines for that purpose , which jThe main differences in KPI compliance between general hospitals and oncology centers concerned diagnosis. These included, for instance, lower use of core biopsy and higher reporting of tumor grade, ER/PgR expression, and HER2 amplification, pathological stage, and distance to the nearest radial margin in noninvasive cancers in general hospitals compared to oncology centers. Treatment KPIs were generally similar between both hospital typologies, except for the proportion of patients with invasive cancer who received a single breast surgery (excluding reconstruction) for the primary tumor, which showed higher compliance with standards in general hospitals, reaching the target standard defined by EUSOMA.Differences in KPI compliance among hospitals may be related not only to patient and tumor characteristics but also to hospital and physician-related features. Indeed, diagnostic and surgical procedures may vary according to clinical practice and organizational factors. Regional differences partly determine differences in the type of hospital present in the region and in the provision of health care between hospitals, namely regarding screening, access to some treatments , and coordination of care. Patient characteristics and physician preferences may also partly explain some of the differences observed. However, compliance with quality standards of care should be met regardless of the number of patients referred to each hospital, the type of hospital, or the geographic region. In this study, differences in KPI compliance according to disease stage mainly concerned treatment, as different stages are treated differently. Additionally, as expected, most asymptomatic patients were associated with earlier disease stages.This study has limitations that should be acknowledged. Its retrospective nature limited data collection to what is documented in patients\u2019 clinical records. It would also have been desirable to have a higher number of clinical records included in the study to allow the analysis of disease stages according to individual hospitals, on the one hand, and enable comparisons between hospitals, on the other. The fact that only one private hospital was included also represents a study limitation, as it hampered the analysis of breast cancer management in the private sector. Consequently, it can be argued that results from this study should be adjusted for case mix (differences in patient populations) to validate comparisons. The fact that it was not possible to retrieve information on hereditary breast cancer or exclude these cases from the analysis may have had an impact on the study findings .The analysis of patients with metastatic cancer was another study limitation, as some were stage IV patients and others were primarily locally treated, later progressing to metastatic disease. The heterogeneity of this subgroup in the study hampered the interpretation of the results and the analysis of several treatment parameters. In Portugal, each institution provides its own palliative care and support for these patients, which always includes psychological and/or social support throughout the course of the disease. Some institutions provide this support from the moment of metastatic disease diagnosis, and others after the conclusion of targeted cancer therapy.Future studies with a larger sample size addressing the asymmetries reported in this study are required, as they may provide additional insights into which KPIs should be extensively explored and which measures should be implemented to improve KPIs by disease stage and hospital. The implementation of KPI measures on the National Oncology Registry  is of particular interest to retrieve a national picture of breast cancer management. The inclusion of a comprehensive patient population would enable measuring outcomes and their variation between hospitals according to compliance with QIs.Finally, future research directions should also be highlighted, such as research focusing on patient-centered care, shared decision-making, and personalized oncology.The findings of this study and their implications should be discussed in light of health policies in breast cancer management in Portugal.The relevance of monitoring the performance of breast-treating centers in disease management through a set of QIs is largely demonstrated by numerous initiatives undertaken at the national and international levels. EUSOMA QIs are a crucial aspect of the voluntary European certification process, based on EUSOMA \u2018Requirements of a Specialist Breast Centre\u2019.The present study provides the first comprehensive overview of the quality of breast cancer care at a national level in Portugal. Globally, QIs meet EUSOMA standards for the diagnosis and treatment of nonmetastatic breast cancer, but there is room for improvement. Regarding treatment, stage III disease shows the greatest variability in KPI compliance with EUSOMA standards, probably due to the low specificity of the guidelines at this stage. Due to methodological limitations, no conclusions can be drawn regarding metastatic disease.Relevant insights were retrieved on how breast cancer care in Portugal compares to European standards, which can be used as a starting point for further studies on how to improve the clinical practice of breast cancer management and update national guidelines. Clinical practice guidelines inform evidence-based cancer management, and their consistent adoption is crucial to standardizing the quality of cancer care. Implementing KPI assessment in the National Oncologic Registry (RON) can also provide more extensive and detailed data on the quality of breast cancer care nationally."}
+{"text": "Initially, through two parallel nucleophilic paths, DABCO and the secondary amine adds to the alkyl bromide and PITC, respectively. The process is followed by the combination of the two respective intermediates to produce the final products by forming a new C\u2013S bond with the expense of a C\u2013N bond cleavage. Consequently, various DABCO salts and secondary amines were tolerated well in this protocol to afford the isothiourea-ethylene-tethered-piperazine compounds in good to high yields.An efficient metal-free four-component approach for the synthesis of piperazine derivatives tethered to an isothiourea group through an ethylene link was developed. 1,4-Diazabicyclo[2.2.2]octane (DABCO) salts, generated  via an ethylene link was developed. Several derivatives of the target products are formed by combination of DABCO, alkyl bromides, secondary amines, and phenylisothiocyanate.A multicomponent synthesis of piperazines tethered to isothiourea group  Thus, there is an ongoing demand for further improvement of MCRs by designing new processes with lower overall costs, better selectivity, higher efficiency, enhanced environmental aspects, and improved atom-economy.Multicomponent reactions (MCRs) have emerged as a promising synthetic strategy in organic chemistry in recent decades, since they furnish one-pot routes to convert commercially available reactants to complex structures.10,11 biological,12,13 and agricultural chemistry.14,15 In addition, they are also employed as catalysts16,17 or reactive intermediates18 in other synthetic procedures. Illustrative related structures are highlighted in 19,20 while a few recent studies deal with three-component procedures. For instance, Sun et al. developed a three-component synthesis of isothioureas via the combination of isocyanides and amines with disulfides, where the latter component was initially activated by N-halogen succinimides using oxyl (TEMPO).21 Alternatively, Maes devised a copper(i) catalyzed three-component reaction between thiosulfonates, amines, and isocyanides, resulting in the synthesis of isothiourea derivatives.22 Other important related reports include a tandem process by Wu,23 a three-component reaction by Mishra,24 and a binuclear aluminium complex mediated synthesis of carbodiimides by Panda.25Molecules containing isothiourea moieties constitute important structures in medicinal,26,27 and heterocyclic chemistry,28,29 we would like to report a novel four-component procedure for the synthesis of a new series of isothiourea containing piperazines, as exemplified in 2NH), phenyl isothiocyanate (PITC), 1,4-diazabicyclo[2.2.2]octane (DABCO), and 1-bromo-2-methylpropane.Despite all the studies carried out on isothioureas, many traditional methods suffer from the use of complicated steps, toxic reagents or additives, and poor reactivity of the starting materials. Therefore, there is a need for further development of efficient and sustainable synthetic methods involving isothiourea chemistry. In the framework of our program on MCRs30\u201332 the current work is the first application of DABCO salts in the synthesis of the isothiourea functional group. For this purpose, we planned to use two very reactive species, the electrophilic isothiocyanate (PITC) moiety and the sterically hindered tertiary amine (DABCO), whose reactive natures can trigger parallel nucleophilic combinations of the reactants, which is a useful tool for launching multicomponent reactions. Consequently, this leads to a concurrent C\u2013N bond cleavage and C\u2013S bond formation reactions to produce the target products, in which the isothiourea and piperazine functional groups are placed in vicinity and would be interesting candidates for further biological studies.Although the use of DABCO bond cleavage for the synthesis of various piperazine derivatives has precedence,2NH 1a and PITC to combine with 2a under various conditions (2CO3 at refluxing temperature in THF after 5 h led to the formation of 3a in 93% yield (entry 1). In the absence of the base (entry 2) or at lower temperatures (entries 3\u20134), the yield was diminished even at a longer reaction time. Similarly, use of other inorganic bases (entries 5\u20138) did not led to higher conversion of the reactants to 3a. Alternatively, no better results were achieved for conducting the reaction in other protic (entries 9\u201311) or aprotic (entries 12\u201316) solvents, conveying that K2CO3/THF/reflux conditions would provide the highest conversion of the reactants to the desired product.For simplicity, we first synthesized the DABCO salts 2 separately to start the study with a three-component process. Thus, to optimize the reaction, we subjected Etnditions . Treatme2CHCH2Br, Et2NH, and PITC were reacted in this manner, 3a was produced after 12 h in 91% yield (entry 1). By using this approach, Et2NH and PITC reacted with other in situ generated derivatives of 2 to give 3b\u2013e efficiently (entries 2\u20135). Similarly, products 3f\u2013j were obtained in the same manner to emphasize the generality of the process (entries 6\u201310).With these results in hand, next we extended the process into a four-component combination by primarily subjecting DABCO to react with various alkyl bromides to provide the required salts 2 for the following steps . Consequvia a nucleophilic attack on the alkyl bromide moiety to produce 2, while in a parallel reaction, Et2NH adds to PITC. The two resulting intermediates of the initial steps then would combine through K2CO3-activated attack of the diethyl-phenylthiourea species to the DABCO salt to access to the final products. The stereochemistry of the isothiourea functional group was assigned as Z (as seen in 2Ph). Such assignment for similar molecules resulting from the same chemistry is reported before in the literature.15,33 To further support the assignment, we engaged molecular mechanics calculations to verify the proposed stereochemistry. The results arising from molecular mechanics (MM2) calculations using ChemSoft's ChemOffice Pro (version 20) clearly show that the Z configuration  as CDCl3 solutions using TMS as internal standard reference. Elemental analyses were performed using a Thermo Finnigan Flash EA 1112 instrument. MS spectra were obtained on a Fisons 8000 Trio instrument at ionization potential of 70 eV. TLC experiments were carried out on pre-coated silica gel plates using petroleum ether/EtOAc as the eluent. Starting materials and reagents were purchased from commercial sources.FT-IR spectra were recorded using KBr disks on a Bruker Vector-22 spectrometer. NMR spectra were obtained on a Bruker AMX (300 MHz for 2CHCH2Br (10.0 mmol), and the solution was stirred at room temperature for 12 h. A precipitate was formed, which was filtered, washed with ethyl acetate (10 mL) and dried under vacuum to get 2a.To a solution of DABCO  in THF (20 mL) was added Me2NH , PITC , and K2CO3  in THF (5 mL) was stirred at refluxing temperature for 5 h. After completion of the reaction, the solvent was evaporated under vacuum and the concentrated crude mixture was fractionated by column chromatography on silica gel  to afford the pure product. The isolated product was fully characterized by various spectroscopic methods.A mixture of 2a , Et2CHCH2Br (10.0 mmol), and the solution was stirred at room temperature for 12 h to get 2a. To this was added Et2NH , PITC , and K2CO3  in THF (10 mL) and the mixture was stirred at refluxing temperature for 5 h. After completion of the reaction, the solvent was evaporated under vacuum and the concentrated crude mixture was fractionated by column chromatography on silica gel  to afford the pure product. The isolated product was fully characterized by various spectroscopic methods.To a solution of DABCO  in THF (30 mL) was added Me1H NMR  \u03b4 7.21\u20137.16 , 6.92\u20136.86 , 3.54 , 2.47\u20132.41 , 2.38\u20132.29 , 2.04 , 1.70 , 1.17 , 0.85  ppm; 13C NMR  \u03b4 152.3, 149.8, 128.3, 121.4, 121.2, 66.5, 57.4, 53.1, 52.4, 44.0, 28.6, 25.0, 20.7, 20.6, 13.5 ppm; IR (KBr) \u03bd = 2953, 2807, 1568, 1227, 1112 cm\u22121; MS (70 eV) m/z 376 [M+], 235, 168, 125; anal. calcd for C21H36N4S: C, 66.97; H, 9.64; N, 14.88; S, 8.51. Found: C, 66.76; H, 9.80; N, 14.97; S, 8.67.1H NMR  \u03b4 7.29\u20137.23 , 6.97\u20136.91 , 3.53 , 2.78 , 1.69\u20131.58 , 1.43\u20131.36 , 1.10 , 0.99  ppm; 13C NMR  \u03b4 153.2, 150.3, 128.6, 121.5, 121.1, 68.1, 49.8, 48.7, 30.7, 29.7, 29.6, 20.1, 14.0 ppm; IR (KBr) \u03bd = 2954, 2809, 1577, 1227 cm\u22121; MS (70 eV) m/z 362 [M+], 279, 248, 192; anal. calcd for C20H34N4S: C, 66.25; H, 9.45; N, 15.45; S, 8.84. Found: C, 66.14; H, 9.23; N, 15.60; S, 9.05.1H NMR  \u03b4 7.21\u20137.15 , 6.94\u20136.84 , 3.53 , 2.45\u20132.40 , 2.38\u20132.33 , 2.31\u20132.24 , 1.53 , 1.36\u20131.29 , 1.16 , 0.86  ppm; 13C NMR  \u03b4 152.5, 149.9, 128.4, 121.4, 121.1, 57.4, 56.7, 53.0, 52.4, 44.1, 35.6, 28.7, 26.5, 22.6, 13.7 ppm; IR (KBr) \u03bd = 2953, 2808, 1578, 1227, 1112 cm\u22121; MS (70 eV) m/z 390 [M+], 350, 318, 214, 182; anal. calcd for C22H38N4S: C, 67.64; H, 9.81; N, 14.34; S, 8.21. Found: C, 67.82; H, 10.08; N, 14.58; S, 8.05.1H NMR  \u03b4 7.21\u20137.15 , 6.92\u20136.86 , 3.54 , 2.48\u20132.36 , 2.36\u20132.19 , 1.47\u20131.37 , 1.33\u20131.27 , 1.17 , 0.88  ppm; 13C NMR  \u03b4 152.6, 149.9, 128.4, 121.5, 121.3, 58.3, 57.4, 52.9, 52.4, 44.1, 28.8, 28.7, 20.6, 13.8, 13.6 ppm; IR (KBr) \u03bd = 2957, 2808, 1577, 1227 cm\u22121; MS (70 eV) m/z 376 [M+], 264, 168, 125; anal. calcd for C21H36N4S: C, 66.97; H, 9.64; N, 14.88; S, 8.51. Found: C, 66.77; H, 9.83; N, 14.99; S, 8.43.1H NMR  \u03b4 7.36\u20137.30 , 7.25\u20137.20 , 6.95\u20136.93 , 3.58 , 3.52 , 2.57\u20132.37 , 1.21  ppm; 13C NMR  \u03b4 152.8, 150.0, 129.3, 128.7, 128.2, 127.1, 121.7, 121.5, 121.3, 62.9, 57.5, 52.7, 52.4, 44.3, 28.8, 13.7 ppm; IR (KBr) \u03bd = 2931, 2807, 1578, 1227 cm\u22121; MS (70 eV) m/z 410 [M+], 264, 202, 175, 146; anal. calcd for C24H34N4S: C, 70.20; H, 8.35; N, 13.64; S, 7.81. Found: C, 70.41; H, 8.57; N, 13.49; S, 7.95.1H NMR  \u03b4 7.22\u20137.17 , 6.91\u20136.87 , 3.48 , 2.46\u20132.41 , 2.36\u20132.35 , 1.62\u20131.52 , 1.48\u20131.36 , 1.34\u20131.22 , 0.92 , 0.89  ppm; 13C NMR  \u03b4 153.1, 150.0, 128.5, 121.5, 121.2, 58.3, 57.4, 53.0, 52.4, 49.7, 30.5, 28.8, 28.7, 20.6, 19.9, 13.9, 13.8 ppm; IR (KBr) \u03bd = 2930, 1578, 1376, 1161 cm\u22121; MS (70 eV) m/z 432 [M+], 261, 207, 168, 125; anal. calcd for C25H44N4S: C, 69.39; H, 10.25; N, 12.95; S, 7.41. Found: C, 69.19; H, 10.41; N, 13.08; S, 7.57.1H NMR  \u03b4 7.34\u20137.30 , 7.25\u20137.19 , 6.95\u20136.89 , 3.52 , 3.51 , 2.53\u20132.45 , 2.45\u20132.35 , 1.60 , 1.32 , 0.95  ppm; 13C NMR  \u03b4 153.3, 150.1, 134.0, 129.3, 128.6, 128.2, 127.1, 121.6, 121.4, 62.9, 57.5, 52.7, 52.4, 49.9, 30.7, 20.1, 14.0 ppm; IR (KBr) \u03bd = 2941, 2808, 1578, 1159 cm\u22121; MS (70 eV) m/z 466 [M+], 320, 265, 202, 146; anal. calcd for C28H42N4S: C, 72.06; H, 9.07; N, 12.00; S, 6.87. Found: C, 71.90; H, 9.15; N, 12.11; S, 6.97.1H NMR  \u03b4 7.21 , 6.94 , 6.87\u20136.84 , 3.69 , 3.59 , 2.53\u20132.47 , 2.38\u20132.34 , 2.28\u20132.24 , 1.46\u2013136 , 1.27 , 0.87  ppm; 13C NMR  \u03b4 154.9, 149.2, 128.4, 121.3, 121.0, 66.4, 58.2, 57.6, 52.8, 52.4, 48.5, 28.9, 28.7, 20.5, 13.9 ppm; IR (KBr) \u03bd = 2955, 2807, 1582, 1158 cm\u22121; MS (70 eV) m/z 390 [M+], 336, 281, 168, 125; anal. calcd for C21H34N4OS: C, 64.58; H, 8.77; N, 14.34; S, 8.21. Found: C, 64.62; H, 8.91; N, 14.27; S, 8.40.1H NMR  \u03b4 7.24 , 7.25 , 6.81\u20136.88 , 3.71 , 3.63 , 2.56\u20132.51 , 2.52\u20132.34 , 2.05 , 1.77 , 0.88  ppm; 13C NMR  \u03b4 154.8, 149.2, 128.3, 121.9, 121.0, 66.5, 66.3, 57.6, 53.0, 52.5, 48.4, 28.9, 25.0, 20.6 ppm; IR (KBr) \u03bd = 2953, 2807, 1583, 1159 cm\u22121; MS (70 eV) m/z 390 [M+], 249, 189, 168, 125; anal. calcd for C21H34N4OS: C, 67.58; H, 8.77; N, 14.34; S, 8.21. Found: C, 67.65; H, 8.89; N, 14.47; S, 8.39.1H NMR  \u03b4 7.35\u20137.31 , 7.29\u20137.24 , 7.02 , 6.92\u20136.90 , 3.76 , 3.65 , 3.53 , 2.59\u20132.54 , 2.49\u20132.40  ppm; 13C NMR  \u03b4 155.2, 149.5, 129.3, 128.7, 128.2, 127.1, 122.3, 121.5, 121.3, 66.7, 62.9, 57.8, 52.7, 52.5, 48.7, 29.1 ppm; IR (KBr) \u03bd = 2934, 2807, 1581, 1156 cm\u22121; MS (70 eV) m/z 424 [M+], 278, 202, 146; anal. calcd for C24H32N4OS: C, 67.89; H, 7.60; N, 13.20; S, 7.55. Found: C, 67.70; H, 7.81; N, 13.32; S, 7.74.In summary, we developed a method for the synthesis of a novel series of isothiourea-ethylene-tethered piperazine derivatives. The process can be performed in the same vessel using all the four required reactants in a one-pot manner. The operation is convenient, the process is multicomponent and atom economy, no expensive reagent is required, and each reaction gives a sole product in good yields. The products are expected to exhibit biological properties and would be assessed accordingly in due course.Conceptualization, study design, data validation, supervision, project administration, and funding acquisition: Mohammed M. Mojtahedi; methodology; investigation, resources, software, formal analysis, and data curation: Fatima Hajizadeh; writing, original draft preparation, review and editing: M. Saeed Abaee. All authors have read and agreed to the published version of the manuscript.There are no conflicts to declare.RA-013-D3RA06678A-s001"}
+{"text": "The results revealed that foliar spraying of ZnO NPs increased the number of spikelets per spike and the thousand-grain weight by 7.4% to 9.2% and 4.2% to 7.1%, respectively, resulting in a substantial increase in rice yield. Furthermore, it led to a reduction in chalky white and chalky whiteness by 6.23% to 23.6% and 2.2% to 27.9%. ZnO NPs effectively boosted zinc content in rice grains while decreasing the phytic acid to zinc ratio, indicating improved zinc enrichment. Remarkably, protein and amylose content remained unaffected. These findings underscore the potential of ZnO NPs as a foliar fertilizer to enhance rice production, quality, and zinc enrichment. Further research can explore optimal application strategies and long-term effects for sustainable rice production.Zinc deficiency in rice can lead to reduced nutritional value and taste. This study investigates the potential of zinc oxide nanoparticles (ZnO NPs) as a foliar fertilizer during the jointing stage to improve rice yield, quality, and grain zinc enrichment. Over a two-year field experiment (2019\u20132020), six doses of ZnO NPs (ranging from 0 to 12 kg hm Rice serves as a vital staple food for approximately 70% of the global population . It prov\u22121 of zinc, considerably lower than other plant foods like wheat, corn, and soybeans. Prolonged consumption of rice places individuals at a higher risk of zinc deficiency. Consequently, fortifying rice with zinc through agronomic methods emerges as the most cost-effective, efficient, and practical solution to combat insufficient zinc intake. Moreover, zinc plays a vital role as a micronutrient for plants, participating in numerous critical cellular functions such as enzyme activation, metabolic processes, physiological functions, and ion balance [Zinc is an indispensable mineral for human health, and its deficiency can result in various health issues, including reproductive abnormalities, stunted growth, cognitive impairments, compromised immune function, and even susceptibility to tumors. Approximately 20% of the global population, particularly in developing nations, is at risk of inadequate zinc intake. This risk is primarily attributed to the fact that plant-based foods, which constitute a major energy source in developing countries, contain significantly less zinc compared to animal-based foods. Rice, a staple food for millions worldwide, contains an average of 16 mg kg balance . Neverth balance . The dir balance .4, Zn-EDTA, and Zn-Gly, have been developed and implemented. These fertilizers exhibit high absorption efficiency and significant potential for zinc fortification. However, they still exhibit certain limitations, including low utilization rates, inadequate leaf nutrient adherence, considerable environmental impacts, and the potential to induce leaf burning [Numerous studies have provided compelling evidence that the judicious application of zinc fertilizer can result in increased rice yields, enhanced rice quality, and elevated zinc levels in rice grains ,10,11,12 burning .Zinc nanoparticles have garnered significant attention in agricultural applications owing to their expansive specific surface area and active surface characteristics, which facilitate crop absorption and utilization ,15. Rese4 hills per hectare on 12 June 2019, 13 June 2020 respectively. Harvesting took place on 19 October 2019, 20 October 2020, corresponding to the respective planting dates.The rice variety used in this study was Nanjing 9108, a commonly cultivated rice variety in the middle and lower regions of the Yangtze River. This rice variety has a growth cycle spanning 150\u2013155 days. The seeds were sown on 18 May 2019, 19 May 2020 respectively. After 25 days of growth, the seedlings were transplanted into the field at a density of 133.33 \u00d7 102 for each plot. A control group was sprayed with water (referred to as CK), while five different dosages of zinc oxide nanoparticles (ZnO NPs) were applied at rates of 0.75 (T1), 1.50 (T2), 3.00 (T3), 6.00 (T4), and 12.00 (T5) kg per hectare (hm2). Each treatment was replicated three times, resulting in a total of 18 blocks. The ZnO NPs used in this experiment were procured from Shanghai Chaowei Nanotechnology Co., Ltd., located in Shanghai, China. These nanoparticles were confirmed to be spherical in shape with an average size of approximately 50 nm, as determined through SEM and TEM characterization , situated at coordinates 32\u00b023.4\u2032 N and 119\u00b025.2\u2032 E in Jiangsu Province, China. This study spanned two rice growing seasons in 2019 and 2020. The soil used in the experiment had a sandy loam texture and contained 24.40 g kg\u22122 of nitrogen was administered in this study. This nitrogen was divided into three applications: 30% was applied during the transplanting period, another 30% was applied as tillering fertilizer seven days after transplantation, and the remaining 40% was applied as panicle fertilizer. Urea, which contains 46% nitrogen, served as the nitrogen source. Additionally, all treatment groups received phosphorus and potassium at rates of 135 and 270 kg hm\u22122, respectively. These nutrients were supplied in the form of calcium superphosphate and potassium chloride during the initial fertilizer application. The overall crop management practices, including irrigation, disease control, pest control, and weed control, adhered to the guidelines provided by local government agencies.A total of 270 kg hmUpon reaching maturity, the rice from each plot was harvested and underwent manual threshing. Subsequently, it was sun-dried until it reached a moisture level of approximately 14% to determine the grain yield. The number of panicles per hill was determined by counting the panicles from 20 randomly selected rice plant hills across each plot. Additionally, representative samples were collected from 12 hills of rice plants for the purpose of measuring and calculating spikelets per panicle, the seed-setting rate, and the 1000-grain weight.Grain quality analysis adhered to the national standards of the China (GB/T 17891-2017)  via iodi3 solution (imported nitric acid) was introduced, and the mixture was allowed to stand for a duration of 24 h. Following this period, 8 mL of ultra-pure water was added, and the mixture underwent filtration using slow-speed filter paper. The resulting filtrate was subjected to dilution, and the zinc content was quantified employing an iCAP 6300  atomic absorption meter.A 0.1 g dried sample was carefully weighed and deposited into an Abe bottle. Subsequently, it was subjected to ashing in a muffle furnace at 480 \u00b0C for approximately 14 h. After cooling, 2 mL of 15% HNO3 and sulfosalicylic acid) and compared against a standard solution prepared with sodium phytate. The absorbance value was measured at 500 nm, enabling the calculation of the rice\u2019s phytic acid content. To determine the molar ratio of phytic acid to zinc, the millimoles of phytic acid were divided by the millimoles of zinc.The method employed to determine the phytic acid content was adapted from Vaintraub and Lapteva\u2019s (1988)  protocolp < 0.05) among treatment means.The data were presented as mean \u00b1 SD. Statistical analyses were conducted using SPSS Statistics software . One-way analysis of variance (ANOVA) was used to determine statistically significant differences . The Zn content in brown rice and milled rice displayed a parabolic trend with increasing levels of ZnO NP application, reaching the highest value in T4  and Dimkpa et al. (2020) ,27, highAdditionally, our study demonstrated that the application of ZnO NPs had a notable impact on the taste quality of rice. It was found to reduce the hardness of rice and enhance its appearance, viscosity, and balance. This enhancement can primarily be attributed to the role of zinc in regulating flavor enzymes in rice. Zinc facilitates the hydrolysis of flavor substances during the steaming process, ultimately resulting in an improved taste profile ,28,29. TEfficient protocols for applying zinc may increase the zinc content in grains but don\u2019t necessarily guarantee higher zinc bioavailability in the final food products derived from them . Brown r\u22122.The findings in this study highlight the benefits of applying ZnO nanoparticles during the rice spikelet stage. This application improved rice yield and quality while effectively increasing the zinc content in the edible part of the rice kernel. Specifically, the use of ZnO NPs resulted in increased spikelets per spike, higher grain filling rates, and greater 1000-grain weights, all contributing to higher yields. Furthermore, it significantly enhanced rice processing, appearance, flavor, and cooking qualities. Additionally, the application of ZnO NPs led to a notable increase in zinc content in both semolina and brown rice, along with a reduction in the phytic acid to zinc molar ratio. This indicates that zinc enrichment in the edible part of rice grains was effectively achieved. The optimal amount of ZnO NPs spray during the rice jointing period was estimated to fall within the range of 3 to 6 kg hm"
\ No newline at end of file