diff --git "a/deduped/dedup_0539.jsonl" "b/deduped/dedup_0539.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0539.jsonl"
@@ -0,0 +1,37 @@
+{"text": "After reading the Learning Forum by Fleming and Lynn (1) Morphology: the essential point of dermatological diagnosis is morphology, a low tech, but hard to master, skill. Dermatological diagnosis, as any other medical diagnosis, starts by collecting adequate information from the patient, and follows by its elaboration. Many doctors consider that dermatological diagnosis can be made on a quick recognition basis, but an ordered and syndromic approach is essential to get to an adequate diagnosis. I think that most dermatologists would agree that a good description of a patient by an experienced colleague is a better starting point for diagnosis than many pictures. I would describe the lesions seen in Figure 1 of [1] not simply as shallow ulcers, but as clearly polycyclic erosions (a finding highly suggestive of herpetic infection).PLoS Medicine, with many readers in less developed countries, this test should not be forgotten.(2) Indicated investigations: Tzanck test is the microscopic evaluation of cell morphology on a cutaneous smear. It can be done in about 15 minutes, requiring a microscope and a trained doctor. Access to this test is probably much easier than to viral cultures or polymerase chain reaction tests. In this setting, a positive Tzanck test would be enough to confirm the clinical diagnosis at a minimum cost. Considering the widespread audience of (3) This case, and the suspicion about systemic manifestations of skin disease, is a wonderful opportunity to disseminate an old concept, very frequently forgotten in medical literature: the skin is an organ, in fact, the biggest one in the body. Its main functions are to act as a barrier, to control temperature, to serve immunological and hormonal roles, and, physiologically less important but very important for patient well-being, to participate in personal relationships. When these functions are not adequately performed, skin failure appears, exactly as is the case with heart or renal failure. Skin failure can have many manifestations, including noninfectious fever, bacteremia, or sepsis. As is the case with renal or cardiac failure, it is easier and more practical to learn about this syndrome than to discuss the systemic manifestations of the many diseases that can cause it. I would highly recommend the following references for doctors interested in the subject: ,3."}
+{"text": "The high cost of oil makes ethanol and other alternative fuels increasingly attractive. Proponents of ethanol point to corn, wheat, and other food crops as renewable feedstocks for producing the fuel. However, critics contend that diverting food crops for ethanol production is economically unsound, and that the irrigation, pesticides, and diesel fuel used to produce these crops poses an environmental burden. A new solution converts agricultural waste such as cornstalks and wheat straw into ethanol. Molecular biologist Nancy Ho of Purdue University\u2019s Laboratory of Renewable Resources Engineering spent 20 years perfecting the method, which has been nonexclusively licensed to Canadian enzyme manufacturer Iogen to make ethanol in an environmentally friendly plant.Saccharomyces\u2014used for centuries to make wine, beer, and bread\u2014is the most efficient microorganism for fermenting glucose to ethanol. Food crops such as corn and wheat are especially suitable for ethanol production because the glucose in their kernels is readily fermentable by Saccharomyces. In contrast, the cellulose found in cornstalks and other types of cellulosic biomass contains not only glucose, but also the sugar xylose, which Saccharomyces cannot convert to ethanol because it lacks the enzymes to do so.Ethanol is produced through fermentation of the glucose found in plant matter. The yeast Glucose and xylose can be fermented separately, but it\u2019s a costly process. Some manufacturers do convert just the glucose in waste feedstocks to ethanol, but production is very low. If the xylose fermentation hurdle could be overcome, the waste material left in the cornfield after harvest could produce 4\u20135 billion gallons of ethanol annually, says Ho.Saccharomyces that simultaneously ferments both glucose and xylose to ethanol. Some bacteria contain the enzyme xylose isomerase, which ferments xylose to ethanol in one step. In the 1980s, Ho first cloned and inserted a bacterial gene for xylose isomerase into Saccharomyces, only to discover that the enzyme did not function inside the yeast. Her second approach proved successful, but required several enzymes and complex steps\u2014in short, Ho cloned three genes from another yeast and inserted them into Saccharomyces. They act in a pathway to convert xylose into xylitol, xylulose, and xylulose-5-phosphate, before eventually producing ethanol. Ho also tinkered with the enzymes to make them operate faster. This work is described in the spring 2004 issue of Applied Biochemistry and Biotechnology.Ho\u2019s solution was to create a genetically modified strain of The novel method raises the yield of ethanol by 40%, compared to fermenting only the glucose in cornstalks and related materials. One of the resulting recombinant yeasts, named 424A(LNH-ST), is now being used by the Ottawa-based Iogen to produce ethanol using wheat straw obtained from nearby farms. The fuel is sold under the trade name EcoEthanol\u2122.Iogen had tried recombinant yeasts and bacteria designed by other scientists, but they performed poorly when scaled up for industrial production. \u201cThe Purdue yeast is the best we\u2019ve tested,\u201d says chemical engineer Jeff Tolan, Iogen\u2019s manager of process research and development. \u201cThe Purdue yeast is as easy to work with as making bread at home.\u201d Although the Iogen plant has used only wheat straw as a feedstock, the Purdue yeast could efficiently convert xylose from cornstalks, wood chips, and cardboard to ethanol in their processing facility.The Iogen plant makes about 75 gallons of ethanol per ton of straw. About two-thirds of the straw is fermented to ethanol. The remainder, which is primarily lignin, is burned for fuel at a local pulp mill. For a full-scale ethanol plant, the lignin could be used to generate power for the plant. \u201cA full-scale plant could be run without any net burning of fossil fuel,\u201d says Tolan. In addition, EcoEthanol reduces the net generation of greenhouse gases, because the plants being grown for feedstock recycle the carbon dioxide released into the atmosphere when the fuel is burned. Iogen plans to build a full-scale commercial facility that will produce 50 million gallons of EcoEthanol yearly."}
+{"text": "Retrovirology Prize.Ben Berkhout wins the 2008  Retrovirology inaugurated an annual prize to recognize the achievements of a deserving retrovirologist [Prize is supported in part by the Ming K. Jeang Foundation, a philanthropic charity based in Houston, Texas, which has provided for scholarships at Houston schools, at the University of Arizona, and at the Johns Hopkins University School of Medicine. Previous winners of the Retrovirology Prize include Stephen Goff [Retrovirology Prize is to identify an outstanding mid-career scientist who is close to the peak of his/her productivity and who is expected to have many future years of high achievement.Four years ago, rologist . The Prihen Goff , Joseph hen Goff , and Karhen Goff . A goal Retrovirology selected Ben Berkhout as the recipient of the Retrovirology Prize  for reverse transcription, the description of the fitness defects in drug-resistant HIV-1 variants, the first description of the To understand Ben's career development and his motivations in science, I had an opportunity to converse with him regarding his views on several questions. His responses to a dozen of my queries are below.KTJ: Today's young people consider many other careers to be more attractive than science. Tell us a bit about what motivated and attracted you to science?BB: During my chemistry study at the University of Leiden, I performed a traineeship in the Biochemistry department where they worked on the mechanism of mRNA translation in Escherichia coli. This was old-fashioned biochemistry, ribosome isolations on Monday morning in the cold room etc. It was fascinating to me that by mixing several ingredients in a test tube you could learn something about this invisible process of nature. A little later the introduction of molecular biology techniques greatly accelerated this field, and our favorite model system was the RNA bacteriophage MS2, one of the first viruses for which an infectious cDNA clone had been generated. I also performed my thesis work in Leiden, with Jan van Duin, learning a few molecular RNA-tricks that are used by the MS2 virus to regulate its gene expression.KTJ: You didn't start by studying HIV; what changed your mind during your postdoc days to turn to this field?BB: I received a 1-year fellowship from the Dutch Cancer Society to perform post-doctoral research at the Dana Farber Cancer Institute of the Harvard Medical School. I stayed there almost 3 years and learned a lot on the topic of T cell immunology, but slowly came to realize that I was missing RNA molecules, and viruses in particular. I guess immunology remains too descriptive for me; at the end of the day I want to learn something in molecular terms that no one else knows. After a focused search, I decided in 1988 to move into the HIV-1 field and ended up in the laboratory of Kuan-Teh Jeang, by then a young group leader at the National Institutes of Health in Bethesda. That was the start of a very exciting and productive period. After a 5-year stay in the USA, my HIV-1 research was continued at the University of Amsterdam, where I still reside.KTJ: You are perhaps best known for your paper on TAR as a nascent RNA target for Tat [ for Tat . Walk usBB: The expertise of the laboratory was on HIV-1 and HTLV-I, but mostly on the process of transcriptional regulation by the LTR promoters. The TAR RNA hairpin motif immediately attracted my interest, and the initial mutants I generated were the ones that ended up in that 1989 Cell paper. In fact, I designed a way to specifically mutate structured RNA signals and not the underlying DNA sequences, an idea that is largely based on a natural mechanism of regulated gene expression in bacteria that was worked out by Charles Yanofsky at Stanford University. This method also allows you to address kinetic aspects, and that is how we ended up talking about the nascent RNA transcript. We did not dare to use the word \"RNA enhancer\" in that paper, but this term was subsequently coined by Phil Sharp in an accompanying commentary. Looking back, the combination of my RNA expertise and the transcriptional focus of the lab turned out to be key in this break-through. We have since kept an interest in the functions of the TAR motif and the Tat protein.KTJ: Who are the scientists who have influenced your career and how?BB: Jan van Duin taught me how to design experiments and how to think carefully and critically about the generated data. Kuan-Teh Jeang guided me on how to be incisive and how to present results in writing and at meetings. But in fact, many people have shaped my thinking and the direction of my research.KTJ: HIV research has been going on for more than a quarter century, and a Nobel prize was just awarded for the discovery of HIV-1. What do you see as the most important question still facing HIV-1 research and what are your thoughts on why we haven't made better progress?BB: The one thing that is badly needed is an effective and cheap vaccine that protects against HIV-1 transmission. It is clear that there are currently no vaccine candidates that look promising, and we should thus maximize the available possibilities for prevention. It is obvious that the relatively simple vaccination strategies that work for other pathogens do not work for HIV-1. Despite all the funds that have been available for HIV-1 vaccine research, it is also fair to say that only a few approaches have been seriously tried. The failure of these initial attempts, that is the envelope protein and adenovirus-based vaccines, has recently led to the suggestion to diversify our vaccination approaches. I could not agree more, and we should be on the lookout for young researchers with fresh ideas.What went wrong? This is an interesting question that may provide us with some important lessons for the future. It may be that a \"too early\" focus on a certain vaccine candidate, which in itself is worth testing but certainly not worth putting all the money on. In fact, I think that this is a particular problem of a densely populated research area such as the HIV-1 field. The scientific crowd usually follows a few leaders, without too much critical thinking, and it may mean that momentum is built around a track that turns out to be the wrong one. Diversification and special focus on researchers that are new to the field will be important. We have a few unique vaccine projects running in the lab. I am not saying they will be successful; it is all high-risk, but they are for sure different from mainstream approaches. Let's hope that one of these \"crazy\" ideas will lead the way to that protective vaccine.KTJ: You have been an editor of Retrovirology for the past 5 years. What do you see in the future for Open Access publishing and what do you consider as the advantages/disadvantage of Open Access versus the traditional subscription based publishing?BB: From the start, I truly liked the basic idea that results presented in an Open Access journal are available to the reader anywhere on the globe without any financial or other barrier other than access to the internet. A major motivation for most authors to publish in an Open Access journal is increased visibility and ultimately a citation advantage. There is some research indicating that Open Access articles are cited more frequently or earlier than non-Open Access articles. I do not see any major disadvantage, and note that some of our traditional journals have successfully moved to the Open Access format (e.g. Nucleic Acids Research). The future is with Open Access journals.KTJ: You have published several notable papers in Retrovirology [Retrovirology? For the future direction of this journal, what would you try to improve?virology -11. How BB: As member of the editorial board of Retrovirology, we of course wanted to present some of our own studies in this new journal, although in the beginning Retrovirology like all upstart journals was without an official impact factor. But, it was rewarding to see that when the first official impact factor for Retrovirology was released it was a very respectable number, 4.04 in 2007. This number ranked the journal second on the Impact Factor list for virology journals that publish original research articles . Indeed, over the last few years, virologists around the world have increasingly embraced Retrovirology, and we now receive many more submissions than we can publish. I look forward to further enhancing the quality threshold needed for publishing in Retrovirology.KTJ: We are perhaps at a tipping point in the globalization of science. There are some predictions that by 2040, China and India will be in the top three of world economic powers. How (what) do you think that American and European science should do (more) to engage science/scientists from the emerging economies?BB: Science is of course an international activity and we usually meet our colleagues from all over the world at meetings, and many promising collaborations do exist. However, more should be done in particular with respect to the training of young scientists. We are used to the  brain drain of European post-docs to the USA, but one should recognize the importance of such training programs on a worldwide scale, and going in all directions. A continuous dialogue between Western and Eastern countries (and others) is very important to appreciate the differences in cultural background that underlie differences in perception of scientific issues, and to start building bridges from there.KTJ: Several recent articles have been written about the aging of Western scientific leadership and the difficulties confronted by younger scientists in garnering support. What are your thoughts on these issues?BB: The aging issue in itself should not be a problem, as I know many sharp scientists with grey hair. Being a mid-career scientist, at least according to the rules of the Retrovirology Prize, I do indeed realize that it is of utmost importance to facilitate the career of promising younger colleagues. In my own laboratory, I have witnessed over the last few years that younger colleagues do take opportunities provided to them to lead and supervise individual studies. For these studies, they should claim and do become the last (senior) author for the published papers. This is the correct thing to do, and senior authorship is a critical factor in their attempts to compete for funding. We should get rid of the automatic last authorship for professors and departmental heads that usually lasts till their retirement or even thereafter. Special funding possibilities for young scientists are obviously important. We have such a funding scheme in the Netherlands for promising post-docs (Veni-Vidi-Vici program), and the EU has the Marie Curie fellowship program.KTJ: One of the goals of the Retrovirology Prize is to promote the visibility of an outstanding mid-career scientist so that he/she could do more over the next few years. What are the next big ideas and projects that you would like to pursue?BB: We have over the years built a rather big research lab with a core of basic HIV-1 studies and a few exciting applied projects. The vaccine candidate that is based on a conditionally replicating HIV-1 variant is now in macaque studies (in a SIV version) and our antiviral gene therapy based on RNA interference has recently moved into a pre-clinical humanized mouse model. Thus, we have exciting times ahead of us. We obviously will also continue the basic HIV-1 replication studies, with a focus on understanding bits and pieces of the structure and function of the HIV-1 RNA genome. Last but not least, we will continue some of the intriguing HIV-1 evolution studies that my lab is well-known for. This theme fits with 2009 as the bicentennial of Charles Darwin's birth and the 150th anniversary of the publication of his seminal work 'On the origin of Species'.KTJ: In my office there is a quotation by Edmond Burke 'All that is necessary for the triumph of evil is that good men do and say nothing'. If there is one thing that you think needs to be said or done in science (or in society at large), what would that be?BB: It is obvious that large-scale approaches to scientific discovery have arrived over the recent years, and these are particularly powerful to address certain research questions. There is also a trend among funding bodies to specifically ask for large, multidisciplinary consortia. I am not saying these recent trends are necessarily bad, but one should not forget the individuals and smaller groups with a strong track record, as they are frequently key in big discoveries.KTJ: With the understanding that it will be a long time in the future, what would you like your headstone to read?BB: How about \"He was privileged to be paid to execute his hobby\"?"}
+{"text": "Endometrium acquires structural and functional competence for embryo implantation only during the receptive phase of menstrual cycle in fertile women. Sizeable data are available to indicate that this ability is acquired by modulation in the expression of several genes/gene products. However, there exists little consensus on the identity, number of expressed/not-detected genes and their pattern of expression (up or down regulation).Literature search was carried out to retrieve the data on endometrial expression of genes/proteins in various conditions. Data were compiled to generate a comprehensive database, Human Gene Expression Endometrial Receptivity database (HGEx-ERdb). The database was used to identify the Receptivity Associated Genes (RAGs) which display the similar pattern of expression across different investigations. Transcript levels of select RAGs encoding cell adhesion proteins were compared between two human endometrial epithelial cell lines; RL95-2 and HEC-1-A by quantitative real time polymerase chain reaction (q-RT-PCR). Further select RAGs were investigated for their expression in pre-receptive (n\u200a=\u200a4) and receptive phase (n\u200a=\u200a4) human endometrial tissues by immunohistochemical studies. JAr spheroid attachment assays were carried out to assess the functional significance of two RAGs.http://resource.ibab.ac.in/HGEx-ERdb/) helped identification of 179 RAGs, of which 151 genes were consistently expressed and upregulated and 28 consistently not-detected and downregulated in receptive phase as compared to pre-receptive phase. q-RT-PCR confirmed significantly higher (p<0.005) expression of Thrombospondin1 (THBS1), CD36 and Mucin 16 transcripts, in RL95-2 as compared to HEC-1-A. Further, the pretreatment with antibodies against CD36 and COMP led to a reduction in the percentage of JAr spheroids attached to RL95-2. Immunohistochemical studies demonstrated significantly higher (p<0.05) expression of endometrial THBS1, Cartilage Oligomeric Matrix Protein (COMP) and CD36 in the receptive phase as compared to pre-receptive phase human endometrial tissues.HGEx-ERdb (HGEx-ERdb is a catalogue of 19,285 genes, reported for their expression in human endometrium. Further 179 genes were identified as the RAGs. Expression analysis of some RAGs validated the utility of approach employed in creation of HGEx-ERdb. Studies aimed towards defining the specific functions of RAGs and their potential networks may yield relevant information about the major \u2018nodes\u2019 which regulate endometrial receptivity. Endometrium, the inner lining of the uterus, is receptive to the embryo only during a defined period in the menstrual cycle. This period called as the \u2018receptive phase\u2019 or the window of implantation, is marked by structural and functional maturation of endometrium In recent years, several microarray based investigations have been undertaken to identify the genes/proteins which are expressed in human endometrium during the receptive phase in silico investigation derived the source data from 7 microarray based studies but focussed on the identification of transcription factors, which bind to the regulatory sequences of differentially expressed genes in the receptive phase endometrium http://www.endometrialdatabase.com) and SCCPIR Endometrium Database Resource (http://edr.research.bcm.edu/edr/ui-linksseams). The former is a catalogue of the investigations on natural and stimulated cycles; endometrial receptivity, implantation and endometrial disorders. It allows the queries by gene ID but does not provide structured data on the menstrual cycle phase specific gene signatures. SCCPIR  supports an online public database- Endometrial Database Resource (EDR), which provides information on the genes, reported to be expressed in the uterus in human, mouse, rat, cow, guinea pig, pig and sheep. EDR provides \u201cgene specific\u201d information in the context of uterus. However, it does not allow a user to retrieve \u201ccondition specific\u201d gene signatures. The mammalian uterus database-MGEx-Udb In recent years, a few attempts have been made to assimilate the information on global gene expression profiling of human endometrial tissues as research resources in the form of either isolated reports or databases. Diaz-Gimeno et al. In the present study, existing data on the context specific endometrial expression profiling was manually curated and a database created. Further the database was screened to identify the genes which display a similar trend of expression during the receptive phase in different datasets. Select genes were validated for their expression pattern in two human endometrial epithelial cell lines, differing in their adherence to embryonic cells and thus partially simulating receptive and non-receptive endometrium. Select genes were also investigated for their protein expression in pre-receptive and receptive phase human endometrial tissue sections. Efforts were also made to assess the functional significance of two RAGs in the embryo-endometrial adhesion.The strategies for creation of HGEx-ERdb are outlined in http://www.ncbi.nlm.nih.gov/geo/, http://www.ebi.ac.uk/] and EDB, Endometrial database  were screened for the gene signatures of human endometrium in native  or pathological or experimental (in vivo or in vitro hormone/anti-hormone/gonadotropin stimulation) conditions. The lists of genes were collected along with information (datasets) about following parameters, in a specific format, and uploaded into a MySQL database:Gene Expression Omnibus (GEO), Array Express  Values were expressed as RE \u00b1 SEM. For MUC16, CD36 and TSP1, HEC-1-A was considered as the control sample and for SPP1 and DPP4, RL95-2 was considered as the control sample.2O2 in methanol for 30 min. For localization of THBS1, CD36 and COMP, the sections were blocked with 1% horse or goat serum in phosphate buffered saline (PBS) for 1 hr. and then incubated with the respective primary antibodies, diluted at 0.2 \u00b5g/ml for TSP1 and at 0.25 \u00b5g/ml for CD36 and COMP for 16 hrs at 4\u00b0C. In the negative controls, rabbit and mouse IgGs replaced respective primary antibodies. Sections were washed twice in PBS and incubated with 1\u2236100 dilution of respective secondary biotinylated antibodies  prepared in blocking solution for 2 hrs at RT. As per the manufacturer's instructions, solution A (avidin) and solution B (biotinylated horseradish peroxidase) were diluted 50 times in PBS. The sections were incubated in avidin-biotin-horseradish peroxidase complex (Vector Laboratories) for 30 min followed by addition of 1 mg/ml diaminobenzidene  prepared in 0.001% H2O2 in PBS for 10 min. The immunostained sections were counterstained with hematoxylin and then gradually dehydrated, cleared in xylene and mounted in DPX (Distyrene Plasticizer and Xylene).Endometrial sections of 5 \u00b5 thickness were deparaffinised in xylene and rehydrated through descending grades of methanol. Endogenous peroxidase activity was quenched by treating the sections with 0.3% HThe staining intensities for immunoreactive antigens in the endometrial epithelium and stroma were determined using the image analysis software Aperio Image scope version v11.2.0.780 . Briefly, six to seven areas encompassing epithelial or stromal cells from each section were randomly selected. The integrated optical density (IOD) value for each selected area was calculated using the software.Statistical analyses to determine the significance of difference in the transcript levels between RL95-2 and HEC-1-A and also to determine that in the intensities of immunoreactive antigens on pre-receptive and receptive endometrial tissues were carried out using unpaired Student's t test. Analyses were carried out using GraphPad Prism . The level of significance was set at p<0.05.The database HGEx-ERdb currently contains 19,285 genes and is open for deposition of additional data by other investigators. The database can be queried to retrieve the expression status of the gene of interest in different stages of the menstrual cycle and various other conditions such as chemical or hormone treatment, gestation, contraception or pathologies. In addition, HGEx-ERdb provides information about the molecular features of genes or their cognate proteins .Analysis of 84 data sets 24 studies) available on the human endometrial gene expression revealed expression of 12,099 genes during the receptive phase . In cont4 studiesAnalysis of the available two data sets of endometrial gene expression in ten women, who had previously experienced IVF failure, indicated that 12,799 genes were transcribed and 6486 appeared to be not detected. In these women, 13 genes were found to have lesser expression during the receptive phase, compared to healthy women  .RAGs were classified with Gene Ontology (GO) analysis according to molecular function, biological process and cellular component using DAVID tool. The \u2018molecular functions\u2019 found associated with the Up-Ex RAGs included calcium ion binding, glycosaminoglycan binding and cytoskeletal protein binding . The majUp-Ex RAGs could be functionally clustered into 33 groups and Down-Nd RAGs into 5 clusters , S3. Majin silico analysis was carried out using GATHER GeneMANIA analysis demonstrated co-expression (89.99%) and co-localization (6.69%) as major relationships amongst Up-Ex RAGs The majority of Up-Ex RAGs had TFII, AP1, NFkB, CDX2 and CEBP binding sites, thereby suggesting the possibility of activation of these TFs during the receptive phase. TFII transcription factor binding site was found in the promoters of 125 of Up-Ex RAGs, while AP1, NF\u03baB, CDX2 and CEBP in the promoters of 113, 107, 93 and 43 of Up-Ex RAGs respectively. HNF4 transcription factor binding site was present in 27, PAX6 in 20, NFY or the nuclear factor Y binding site was found in 17 of 28 Down-Nd RAGs . InteresAs acquisition of the adhesiveness is a primary feature of the receptive endometrium, we focussed on validating the expression of those RAGs which encode cell adhesion proteins. Among the Up-Ex RAGs, THBS1, COMP, CD36, MUC16, SPP1, and DPP4 were chosen because of their established role in cell adhesion and also because of their high reliability scores. Further the majority of these genes (except SPP1 and MUC16) have not been investigated previously for their association with endometrial receptivity. Lower levels of COMP and MUC16 in women with IVF failure (as per HGEx-ERdb) also prompted us to select these two RAGs.RL95-2, a more adhesive cell line, had significantly higher (p<0.05) levels of THBS1, CD36 and MUC16 as compared to HEC-1-A, a less adhesive cell line . HoweverImmunohistochemical localization of THBS1,CD36 and COMP proteins demonstrated immunopositivity in the cytoplasmic compartment of the glandular epithelium and stroma of human endometrium . HoweverConfocal microscopy analysis revealed presence of CD36 and COMP on the cell surface of RL95-2 and HEC-1-A . FurtherEmbryo implantation is one of the most crucial steps that dictate the outcome of reproduction and hence has attracted the attention of several researchers engaged in pregnancy research. It is well established that embryo implantation is initiated only when the endometrium of uterus is hormone primed and appropriately transformed at structural and functional levels HGEx-ERdb provides information about the expression of 19,285 genes in human endometrium. For the creation of this database, 312 data sets were retrieved from online resources such as GEO and 51 peer reviewed publications. HGEx-ERdb is a catalogue of all the genes, reported till date for their expression or repression in human endometrium, during various phases of the natural menstrual cycle or in other conditions including stimulated cycles.HGEx-ERdb is the first database that stores endometrial gene expression data, particularly in the receptive phase, and allows context-specific queries. The database can be used to retrieve the following information/data:Expression status (in isolation or in comparison) of the gene of interest in endometrium.List of all the genes reported to be expressed in human endometrium in different phases of the menstrual cycle.Alterations in endometrial gene profile  in response to hormone, chemical, COS cycle, IVF treatment or other disorders.Cellular localization, molecular function and role of the select gene in biological processes.Protein, transcript, promoter and protein- protein interactions of the selected gene.Reliability score forms a semi quantitative method of deriving a consensus across different datasets irrespective of the technology, platform and availability of raw and processed data Querying the HGEx-ERdb for endometrial gene signatures yielded 12,099 genes which are expressed and 7289 genes appear as not detected in the receptive phase endometrium. Out of these, 151 genes (Up-Ex) displayed the similar pattern of expression (upregulation) in the receptive phase as compared to pre-receptive phase across different datasets. Further, 28 genes (Down-Nd) were found to be downregulated in the receptive phase, when compared to pre-receptive phase.The functional annotation clustering pointed that 62.25% of the Up-Ex RAGs encode the extracellular and plasma membrane proteins. This reinforces the relevance of optimal expression of cell surface and extracellular matrix proteins in endowing the endometrium with receptivity, as these proteins may be of prime importance in embryo adhesion and attendant signal transduction pathways.Up-Ex RAGs are known to regulate cytokine-cytokine interaction pathway, complement and coagulation cascades, ECM-receptor interaction and inhibition of matrix-metalloproteinase pathway. Activation of these pathways during the receptive phase may equip the endometrium for structural and functional modifications, required for embryo attachment and growth.In the list of Down-Nd RAGs, predominant were the genes associated with cell cycle regulation. This was implicative of decreased mitotic activity in the endometrium during the receptive phase. It is well established that endometrial receptivity is marked by cellular differentiation of the functional layer of endometrium. This probably explains downregulation in the expression of genes associated with cell cycle regulation during the receptive phase. An interesting observation was the downregulation of many members of the S100 protein family, during the receptive phase. S100 proteins, small acidic proteins of 10\u201312 kDa with calcium binding EF hand (helixE-loop-helixF) motifs, regulate variety of cellular functions such as cell growth and differentiation, cell cycle progression, protein phosphorylation and secretion etc. Analysis of transcription factor binding sites (TFBS) in the regulatory regions demonstrated overrepresentation of TFII, AP1, NFkB, CDX2, CEBP binding sites in Up-Ex RAGs and that of HNF4, NFY, PAX6 in Down-Nd RAGs. Tapia et al Endometrium acquires adhesiveness to an embryo only during the receptive phase and hence it was not surprising to note that most of the RAGs encode extracellular and plasma membrane proteins. This was implicative of the critical role played by genes which encode adhesive proteins. THBS1, CD36, COMP, SPPI, DPP4 and MUC16, all known for their role in cell adhesion, were chosen for the experimental validation using two human endometrial epithelial cell lines RL95-2 and HEC-1-A. Although these immortalized cell lines do not truly represent pre-receptive and receptive phase primary endometrial tissues, these were selected as experimental cell models for the validation of transcription pattern of RAGs, for two reasons. First, these cell lines are known for their differential adhesiveness to embryonic cells and second, human endometrial RNA samples were not available. Further THBS1, CD36 and COMP were selected for validation in tissues (stored paraffin sections of human endometrium) by immunolocalization, as these have not been investigated previously for their expression at protein level during the receptive phase.Interestingly, 3 members of the thrombospondin family i.e. THBS1, THBS2 and THBS5 (COMP) appeared as Up-Ex RAGs in the present study. Thrombospondins (TSPs) are modular proteins which contain globular domains at their amino and carboxyl terminals, EGF like type 2 and calcium binding type 3 repeat domains Interacting partners or receptors of THBS1 include structural proteins like collagen, fibronectin, cell surface receptors- integrins, syndecans, enzymes like elastase and cytokines such as TGF\u03b21, in addition to CD36 or fatty acid translocase (FAT). THBS1 binds to surface receptors such as CD36 and initiates signalling to inhibit angiogenesis and cell migration Osteopontin 1 (SPP1) and Dipeptidyl Peptidase (DPP4) scored high, as adjudged by their reliability score, for consensus on their higher expression during the receptive phase. Unexpectedly their transcript levels were found lower in more adhesive RL95-2 cell line as compared to less adhesive HEC-1-A cell line, both of epithelial origin. It may be hypothesized that the endometrial expression of SPP1 and DPP4 is increased during the receptive phase, in response to signalling from the stromal compartment of endometrial tissue. On the other hand, it may also be inferred that SPP1 and DPP4 are not the absolute determinants for the embryo adhesiveness. Indeed, no significant difference has been found in the expression of SPP1 and its receptor between fertile and infertile women It was also observed that 13 out of 151 Up-Ex RAGs are downregulated in the endometrium of the women who experienced IVF failure during the receptive phase. This suggested that optimal expression of these 13 genes (or some of these) in the endometrium may be crucial for embryo attachment. Indeed there exist several reports demonstrating the seminal role of some of these genes (such as LIF) in the initiation of pregnancy MUC16 gene which encodes an anti-adhesive protein, it may be hypothesized that either its anti-adhesive property is modulated during the receptive phase or it performs functions other than anti-adhesion. Different domains of MUC16 protein are known to serve different functions. The cytoplasmic tail of MUC16 may mediate certain signalling functions required for embryo implantation. Endometrial MUC16 transcripts were found to be lower in the women who undergo IVF failure . The study also identifies a set of receptivity associated genes. Some of the RAGs may have subjugate role and their expression may be critical for endowing the endometrium with the receptivity , while others may have redundant role. Investigations using human endometrial epithelial cell lines as experimental models and endometrial tissues proved association of some of these RAGs with receptivity. Figure S1Percentage JAr spheroids attached to RL95-2 and HEC-1-A cells. Please note differential adhesiveness of RL95-2 and HEC-1-A to JAar spheroids. (*** p<0.0001).(TIF)Click here for additional data file.Figure S2Relationship among Up-Ex (A) and Down-Nd (B) RAGs as predicted by GeneMANIA.(TIF)Click here for additional data file.Figure S3Confocal microscopic analysis showing Z optical sections of immunoreactive CD36 (A) and COMP (B) in RL95-2 and HEC-1-A Magnification: 63x; DIC images shown as insets.(TIF)Click here for additional data file.Table S1Genes displaying suboptimal endometrial expression during the receptive phase in women who undergo IVF failure.(DOCX)Click here for additional data file.Table S2Genes displaying suboptimal endometrial expression during the receptive phase in women who undergo IVF failure.(DOCX)Click here for additional data file.Table S3Functional annotation of Down-Rep Down-Nd RAGs using DAVID software.(DOCX)Click here for additional data file."}
+{"text": "Moreover, myofibroblasts expressing \u03b1-smooth muscle actin (\u03b1-SMA), fibroblast expansion and epithelial-mesenchymal transition (EMT) are critical to the pathogenesis of idiopathic pulmonary fibrosis (IPF). Our aim was to investigate the expression of COX-2 and PGE2 in human lung myofibroblasts and establish whether fibroblast-myofibroblast transition (FMT) and EMT are associated with COX-2 and PGE2 down-regulation.Prostaglandin E2 (PGE2 secretion and cell proliferation were measured after IL-1\u03b2 and PGE2 incubation.Fibroblasts obtained from IPF patients (n\u200a=\u200a6) and patients undergoing spontaneous pneumothorax  and alveolar epithelial cell line A549 were incubated with TGF-\u03b21 and FMT and EMT markers were evaluated. COX-2 and \u03b1-SMA expression, PGE2 secretion and \u03b1-SMA expression after IL-1\u03b2 addition. The latter decreased proliferation in fibroblasts but not in myofibroblasts. A549 cells incubated with TGF-\u03b21 for 72 h showed down-regulated COX-2 expression and low basal PGE2 secretion in response to IL-1\u03b2. Immuno-histochemical analysis of IPF lung tissue showed no COX-2 immuno-reactivity in myofibroblast foci.Myofibroblasts from both control and IPF fibroblast cultures stimulated with IL-1\u03b2 showed no COX-2 expression. IPF fibroblasts showed increased myofibroblast population and reduced COX-2 expression in response to IL-1\u03b2. TGF-\u03b21 increased the number of myofibroblasts in a time-dependent manner. In contrast, TGF-\u03b21 induced slight COX-2 expression at 4 h (without increase in myofibroblasts) and 24 h, but not at 72 h. Both IPF and control cultures incubated with TGF-\u03b21 for 72 h showed diminished COX-2 induction, PGE2 production, which could be crucial in IPF development and progression.Myofibroblasts are associated with COX-2 down-regulation and reduced PGE Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal interstitial lung disease of uncertain etiology, characterized by the histopathological pattern of usual interstitial pneumonia. This fibrotic process involves the loss of lung architecture through increased epithelial cell apoptosis and abnormal wound healing, followed by the formation of fibroblast foci and excessive collagen deposition. In this context, the crucial role of myofibroblasts in tissue remodeling has been well described 2) is derived from the metabolism of arachidonic acid by cyclooxygenase enzymes 2 enhances epithelial-mesenchymal wound healing since it improves epithelial cell survival 2 synthesis as a result of down-regulation of cyclooxygenase-2 (COX-2) has been described in IPF 2 synthesis has been associated with increased fibroblast proliferation and alveolar epithelial cell apoptosis An imbalance between pro-fibrotic and anti-fibrotic mediators appears to exist in IPF. Numerous pro-fibrotic factors such as transforming growth factor (TGF)-\u03b21 2 in IPF. We hypothesized that the increase in myofibroblast and mesenchymal myofibroblast-like cell population observed in IPF could be related to the down-regulation of COX-2 expression and reduced PGE2 synthesis. Therefore, our aim was to study COX-2 regulation and PGE2 production in myofibroblasts and in FMT and EMT processes.No studies to date have reported any connection between the myofibroblast phenotype and the lack of PGEWe obtained pulmonary biopsies from patients suffering from IPF (n\u200a=\u200a6). The diagnosis of IPF was established according to the American Thoracic Society/European Respiratory Society Consensus Statement 2 humidified atmosphere at 37\u00b0C. Fibroblasts were grown to subconfluence and subcultured by 0.05% trypsin-0.02% EDTA treatment. Fibroblasts were studied at passage 5 to 6. Culture characterization was performed by immunofluorescence for vimentin (Invitrogen) and pan-cytokeratin , as indicated elsewhere Primary fibroblasts were isolated from the lung biopsies, using previously described methods The A549 human lung adenocarcinoma epithelial cell line  was cultured in RPMI 1640 media (Lonza) with 1 mM L-Glutamine (Lonza) and supplemented as mentioned above.In all the experiments, the medium was removed when the cell cultures reached 80% confluence and the cells were incubated in serum-free medium for 24 h. Three experimental models were then performed.In the first set of experiments, fibroblasts were treated with or without IL-1\u03b2 , a well-known inducer of COX-2 expression in vitro model of FMT and EMT by incubating fibroblasts and A549 cells, respectively, with TGF-\u03b21 for 72 h. EMT was also characterized by the expression of E-cadherin and immunofluorescence.In a second set of experiments, we studied the effect of TGF-\u03b21  in control and IPF cultures for 4, 24 and 72 h. We measured COX-2, \u03b1-SMA and collagen I\u03b11 expression. With these experiments, we established an 2  for an additional 24 h. The reasons for the use of a different concentration of IL-1\u03b2 are firstly based on the literature 2 levels in both cells using those concentrations, allowing the comparisons between cell types. Additional TGF-\u03b21 for 4 h and 24 h and the selective COX-2 inhibitor Celecoxib  were also tested. In this set of experiments TGF-\u03b21 was removed at 72 h and fresh culture medium was added with stimuli. We measured COX-2, COX-1, \u03b1-SMA, PGE2 secretion and proliferation. We also compared these experiments with an early treatment of TGF- \u03b21 at 4 h. The experiments were carried out on 6 tissue samples for each group, unless otherwise indicated. The experiments on A549 cells were performed in quadruplicate, at the very least.In a third set of experiments on cells treated with TGF-\u03b21 for 72 h, we studied the effect of IL-1\u03b2 (10 ng/ml for fibroblasts and 1 ng/ml for A549 cells) and PGE2-diameter culture dishes were washed twice with ice-cold phosphate buffer saline (PBS). Cells were lysated directly with 200 \u00b5l of RIPA buffer [TrisHCl 50 mM, NaCl 150 mM , 1% NP40 Igepal, 1% Triton X-100, 0.1% SDS and 5 \u00b5l/ml of a protease inhibitor cocktail (Sigma). The lysate was maintained for 20 min on ice and was then collected and frozen at \u221280\u00b0C. Samples were thawed, sonicated twice for 15 s in a Sonifier  and immediately centrifuged at 20,000 g for 10 min at 4\u00b0C for protein measurement. 12.5\u201330 \u00b5g of protein from fibroblasts and A549 cells were denaturalized in a thermocycler  in loading buffer (NuPAGE LDS sample buffer), loaded on 7% Tris-Acetate gels and run  in a Novex XCell \u0399\u0399 Mini-Cell . The proteins were then transferred to a nitrocellulose membrane and non-specific binding sites were blocked using blocking buffer . Membranes were incubated overnight at 4\u00b0C with 1\u22361.000 dilution in blocking buffer of the primary antibodies against COX-2 , COX-1 (Santa Cruz Biotechnology), \u03b1-SMA (Sigma), E-cadherin  or p44/42 MAPK (Erk1/2)  and 1\u223610.000 dilution for \u03b2-actin (Sigma). Blots were then washed in 0.5% Tween 20 in PBS (T-PBS) and subsequently incubated for 2 h at room temperature with an appropriate horseradish peroxidase-labeled secondary antibody diluted 1\u22363,000 in blocking buffer. After washing with T-PBS, blots were incubated with an enhanced chemiluminiscent substrate . Quantification of protein expression was carried out using a CCD Camera System LAS 3000  and densitometry was performed by Image gauge v.4.0 software. For the fibroblast Western blots, results were presented as a ratio to the expression of \u03b2-actin. To check for equal loading in A549 cells, results were expressed as a ratio of band density to total p44/42 MAPK (Erk1/2) since the levels of \u03b2-actin underwent changes after TGF- \u03b21 treatment (data not shown).After treatment, cells plated on 90 cmCells grown in 4-well CultureSlides\u00ae were fixed with cold 4% paraformaldehyde for 15 min and then permeabilized with 0.5% Triton X-100 for 30 min. Once blocked with 1% bovine serum albumin-PBS for 1 h, primary antibodies against \u03b1-SMA  or COX-2  were added for 1 h at 37\u00b0C. Secondary antibodies or Phalloidin-TRITC (Sigma) were also incubated for 1 h. Cells were counterstained with DAPI (1\u223610.000) and were mounted with Prolong\u00ae Gold antifade reagent .For double-staining experiments, COX-2 antibody and its corresponding secondary antibody were first incubated for 45 min each, and thereafter \u03b1-SMA and its secondary antibody were incubated for another 45 min each. This order was established empirically in a set of experiments and demonstrated very low cross-reactivity between antibodies. Phalloidin also showed no cross-reactivity with COX-2 primary and secondary antibodies and was incubated together with COX-2 secondary antibody. Epifluorescence microscopy  was used to analyze preparations at \u00d7200 or \u00d7400 magnification. Positive cells for \u03b1-SMA and COX-2 were counted in 12 random fields.Histological sections were obtained from paraffin-embedded biopsies of control (n\u200a=\u200a5) and IPF patients (n\u200a=\u200a5). Paraffin was removed and sections were heated at 80\u00b0C for 40 min in citrate buffer  for the antigen retrieval process. Then, samples were blocked in PBS, 0.05% v/v Triton X-100, 3% goat serum (Sigma) for 30 min at room temperature. Primary antibodies against COX-2 (Santa Cruz Biotechnology) and \u03b1-SMA (Sigma) diluted 1\u22361000 in blocking solution were incubated overnight at 4\u00b0C. The next steps were performed using EnVision\u2122 Detection Systems Peroxidase/DAB, Rabbit/Mouse kit , according to the manufacturer\u2019s instructions. Nuclei were contrasted with Gill I Hematoxylin for 1 min. Sections were mounted using Glycergel\u00ae Mounting Medium (Dako).A commercial kit was used, based on the incorporation of EdU (5-ethynyl-2\u2032-deoxyuridine), a modified nucleoside that is incorporated during DNA synthesis . After treatment, cells grown in 90-sq.-cm dishes were incubated with 10 \u00b5M EdU for 2 h before being harvested them for flow cytometry measurements . The next steps were performed in accordance with the manufacturer's instructions. The technique was validated with a set of experiments incubating cells with increasing concentrations of serum. Results were presented as percentage of cells incorporating the modified nucleoside EdU. Negative control was also measured to establish positive criteria.Total RNA was isolated with the RNeasy mini kit  according to the instructions of the manufacturer. One \u00b5g of RNA was reverse-transcribed into cDNA with the High Capacity cDNA Reverse Transcriptase kit with RNase Inhibitor  using random primers, optimized RT Buffer, dNTP\u2019s and MultiScribe\u2122 MuLV reverse transcriptase. cDNA was subjected to amplification by real-time PCR  using TaqMan\u00ae Gene Expression Assays (Applied Biosystems) for collagen type I, alpha 1  and RNA polymerase II, polypeptide A  as a constitutive endogenous gene. Data were calculated using the \u0394\u0394Ct method and the results expressed as fold-change related to control samples at time 0 h.Total soluble collagen in cell culture supernatants was quantified using the Sircol collagen assay . Briefly, 500 \u00b5l of fibroblast culture supernatant were collected and concentrated overnight using the kit\u2019s concentration reagent. 1 ml of Sirius red dye was added and incubated with gentle rotation for 30 min at room temperature. After centrifugation at 12,000 g for 10 min, the collagen-dye pellet was washed with 750 \u00b5L of cold Acid-Salt Wash Reagent and centrifuged again. The pellet was re-dissolved with 250 \u00b5L of 0.5 M NaOH, and absorbance at 540 nm was measured by microplate ELISA reader. The results are presented as total \u00b5g Collagen secreted/\u00b5g total protein content.2 Assay was performed in cell culture medium using Prostaglandin E2 EIA Kit . Supernatants were filtered through 0.22 \u00b5m filter (BD Biosciences) and stored at \u221280\u00b0C. The measurement was performed according to the manufacturer\u2019s instructions. Results are presented as total pg PGE2 secreted/\u00b5g total protein content.PGEp-values were below 0.05.All statistical analyses were performed with SPSS 14.0 . Data are expressed as median and 25th to 75th percentile. Immunofluorescence cell count results are presented in tables as mean values \u00b1 SD. The non-parametric statistical Mann-Whitney U-test was used for control and IPF group comparisons and the Wilcoxon test was used for paired comparisons. Parametric statistical analyses for A549 cells experiments were performed with ANOVA followed by Dunnett\u2019s multiple comparison post hoc tests. Differences were considered to be significant if IPF cultures showed increased population of myofibroblasts (\u03b1-SMA positive cells) basally and reduced population of COX-2 positive cells in response to IL-1\u03b2 (10 ng/ml for 24 h) compared with control cells, as observed by immunofluorescence . As descIn order to induce myofibroblasts in our cultures, we used TGF-\u03b21 (5 ng/ml). This treatment provoked a significant increase in myofibroblasts (\u03b1-SMA-positive cells) in a time-dependent manner, reaching statistically significant values at 24 and 72 h in both cultures . InteresIn the control fibroblasts, TGF-\u03b21 stimulated COX-2 expression slightly at 4 h and more markedly at 24 h but no COX-2 expression was observed at 72 h. In IPF treated fibroblasts, no COX-2 expression was observed after TGF-\u03b21 treatment . ConsequWe also performed Sircol assay in order to measure the secreted collagen in IPF and Control fibroblast cultures under the same experimental conditions. The results are presented as total \u00b5g Collagen secreted/\u00b5g total protein content. Although the same pattern found in collagen mRNA expression was observed, no significant differences were found between control and IPF fibroblasts. . . N\u200a=\u200a6 each. We found Sircol analysis insufficiently sensitive to find these differences in our samples.We studied COX-2 and \u03b1-SMA expression in the myofibroblast-enriched cultures obtained as described in Consequently, an increase in \u03b1-SMA positive cells was associated with a decrease in COX-2 positive cells induced by IL-1\u03b2 . Cells pCOX-1 expression increased after TGF-\u03b21 treatment only in IPF fibroblasts , whereasImmunofluorescence revealed that cells positive for COX-2 presented a thin fibroblast-like shape and \u03b1-SMA negativity. Consequently, myofibroblasts (\u03b1-SMA positive cells) showed no positive staining for COX-2 , Table 2Re-stimulation of myofibroblasts with TGF-\u03b21 for additional 4 and 24 h produced no COX-2 expression, as expected .We studied EMT by treating A549 cells with TGF-\u03b21 , as described above. Epithelial-specific marker E-cadherin dramatically decreased in treated A549 cells . ImmunofUnlike fibroblasts, A549 cells expressed COX-2 in the absence of IL-1\u03b2 stimulation . Interes2 levels in culture supernatants of control, IPF fibroblasts (2 secretion in fibroblasts and A549 cells. This effect was diminished in TGF-\u03b21 pretreated cells (2 secretion.We examined PGEroblasts  and A549roblasts  treated ed cells . The res2 in myofibroblast-enriched culture proliferation by the Click-iT\u00ae technique. Fibroblasts and A549 cells were incubated with IL-1\u03b2 (10 ng/ml and 1 ng/ml respectively), PGE2 (5 ng/ml) and the selective COX-2 inhibitor Celecoxib (10 \u00b5M) for 24 h.We studied the role of COX-2 and PGE2 completely abrogated cell proliferation and the addition of Celecoxib reversed the IL-1\u03b2 effect. IPF fibroblasts presented a diminished proliferation compared with control fibroblasts, but similar effects were observed after incubation with IL-1\u03b2, PGE2 and Celecoxib. Moreover, TGF-\u03b21 treatment induced a decrease in control fibroblast proliferation but no differences were observed in IPF fibroblast cultures. Interestingly, the inhibitory effect on proliferation associated with IL-1\u03b2 exposure was annulled in TGF-\u03b21 treated cells .To gain insight into the relationship between myofibroblast phenotype and COX-2 regulation, the myofibroblast numbers were increased by inducing the transition of fibroblast into myofibroblast with TGF-\u03b21. As previously described, we observed that TGF-\u03b21 myofibroblast induction was time and dose-dependent 2 synthesis in fibroblasts over short periods (2\u201324 h) Previous reports have demonstrated that TGF-\u03b21 increases COX-2 expression and PGEConsequently, the number of cells expressing COX-2 after stimulation with IL-1\u03b2 after 72 h of TGF-\u03b21 decreases in parallel with the increase in the number of fibroblasts transformed into myofibroblasts. In addition, re-incubation with TGF-\u03b21 for an additional 4 and 24 h only induced COX-2 if the culture was not enriched with myofibroblasts see , discard2 in myofibroblast-enriched cultures. PGE2 secretion induced by IL-1\u03b2 in TGF-\u03b21-treated fibroblasts was strongly reduced in both the control and IPF patients, as a result of the inhibition of COX-2 caused by long-term exposure to TGF-\u03b21.With long-term studies we confirmed our previous observations linking down-regulation of COX-2 with the myofibroblast phenotype. We also investigated the secretion of PGEThe incubation of TGF-\u03b21-treated cells with IL-1\u03b2 provoked a reduction in \u03b1-SMA positive cells, suggesting that IL-1\u03b2 not only inhibits myofibroblast cell transition but also promotes the disappearance of myofibroblasts in culture. Interestingly, COX-1 expression only increased significantly after TGF-\u03b21 treatment in fibroblasts obtained from IPF patients. Since the reduction of COX-2 in IPF fibroblast cultures is notable, we are tempted to speculate that these cells may respond to TGF-\u03b21 treatment by increasing COX-1 expression to maintain basal COX metabolism.2 levels paralleled COX-2 expression. Therefore, the EMT process leading the myofibroblast-like phenotype could also contribute to the down-regulation of COX-2 and PGE2 observed in IPF.We studied A549 cells, which are widely used as a model of EMT 2 in proliferation once the cells were transformed into myofibroblasts. Interestingly, treatment with IL-1\u03b2 decreased proliferation in control fibroblasts. This effect may be mediated by COX-2 activation, since the selective COX-2 inhibitor Celecoxib completely restored cell proliferation. In contrast, the anti-proliferative effect of IL-1\u03b2 was lost in myofibroblasts from both the control and the IPF patients. The lack of any effect of IL-1\u03b2 on myofibroblasts appears to be the result of impaired COX-2 induction. Consequently, the exogenous addition of the COX-2 metabolite PGE2 decreased cell proliferation not only in fibroblasts but also in myofibroblasts. Our findings agree with reports of the anti-proliferative effects of PGE2 in various cell types We also examined the interrelationship between TGF-\u03b21, IL-1\u03b2, COX-2 and PGE2, since the COX-2 inhibitor Celecoxib did not restore proliferation and PGE2 treatment had no inhibitory effect on cell proliferation. Our results suggest that PGE2 may modulate cell proliferation specifically in FMT but not in EMT, and they point to PGE2 as a potential therapeutic treatment for IPF, largely on account of its targeting of myofibroblasts. A recent report has demonstrated that PGE2 deficiency in IPF results in increased alveolar epithelial cell apoptosis and reduced sensitivity of fibroblasts to apoptosis 2 may also regulate apoptosis differentially in fibroblasts and epithelial cells.The incubation of A549 cells with TGF-\u03b21 may inhibit epithelial cell proliferation We also studied histological slides of control and IPF human lungs. In line with previous reports 2 has shown potent anti-fibrotic properties in several studies 2 could easily be linked to the development of fibrotic processes. Further studies are needed to clarify whether the abrogation of COX-2 in the myofibroblasts of IPF is irreversible.The mechanisms of COX-2 inhibition in the myofibroblast phenotype remain unknown. Recent findings suggest that defective histone acetylation in the COX-2 promoter may be responsible for the diminished COX-2 gene transcription observed in IPF fibroblasts 2. These events could be crucial in IPF development and progression. Finally, our results suggest that targeting COX-2 and/or PGE2 could be a potential therapy for IPF.The myofibroblast phenotype is associated with a down-regulation of COX-2 and, consequently, a reduced production of its main metabolite PGEFigure S1Expression of COX-2, COX-1 and \u03b1-SMA in control (n\u200a=\u200a5) and IPF (n\u200a=\u200a5) fibroblasts basally and induced by IL-1\u03b2 (10 ng/ml) for 4 and 24 h. (A) Representative image of a Western blot and (B) densitometric analysis of COX-2 expressed as ratio versus \u03b2-actin expression. *P<0.05 compared to respective untreated cells, #P<0.05 compared to control group in same conditions.(TIF)Click here for additional data file.Figure S2Protein levels of COX-2, COX-1, \u03b1-SMA and \u03b2-actin in control and IPF fibroblasts stimulated for 4 h. Cells were incubated in the presence or absence of IL-1\u03b2 (10 ng/ml) and/or TGF-\u03b21 (5 ng/ml) for 4h. (A) Representative image of a Western blot. (B) Densitometric analysis of COX-2 expressed as ratio versus \u03b2-actin expression. * P<0.05 compared to respective untreated cells, \u2020 P<0.05 compared to IL-1\u03b2 treated cells in the same group.(TIF)Click here for additional data file.Figure S3Absence of COX-2 expression in control cells stimulated for 72 h with TGF-\u03b21 and further incubation for 4 or 24 h with renewed TGF-\u03b21. Cells were incubated in the presence or absence of TGF-\u03b21 (5 ng/ml) for 72 h and for additional 4 or 24 h of fresh TGF-\u03b21 (5 ng/ml). Representative Western blot of a control fibroblast culture.(TIF)Click here for additional data file."}
+{"text": "CAP2 gene was found to be conserved across all the genotypes. Among 10 candidate genes, the maximum number of SNPs (34) was observed in abscisic acid stress and ripening (ASR) gene including 22 transitions, 11 transversions and one tri-allelic SNP. Nucleotide diversity varied from 0.0004 to 0.0029 while polymorphism information content (PIC) values ranged from 0.01 (AKIN gene) to 0.43 (CAP2 promoter). Haplotype analysis revealed that alleles were represented by more than two haplotype blocks, except alleles of the CAP2 and sucrose synthase (SuSy) gene, where only one haplotype was identified. These genes can be used for association analysis and if validated, may be useful for enhancing abiotic stress, including drought tolerance, through molecular breeding.Chickpea is an important food legume crop for the semi-arid regions, however, its productivity is adversely affected by various biotic and abiotic stresses. Identification of candidate genes associated with abiotic stress response will help breeding efforts aiming to enhance its productivity. With this objective, 10 abiotic stress responsive candidate genes were selected on the basis of prior knowledge of this complex trait. These 10 genes were subjected to allele specific sequencing across a chickpea reference set comprising 300 genotypes including 211 genotypes of chickpea mini core collection. A total of 1.3 Mbp sequence data were generated. Multiple sequence alignment (MSA) revealed 79 SNPs and 41 indels in nine genes while the  Cicer arietinum L., 2n = 16), a self-pollinated, diploid annual species which ranks second worldwide as a food legume crop, is primarily a crop of developing countries contributing to a larger part of human food and animal feed in these areas. Chickpea is a major source of nutrients to a vegetarian diet as it contain 20\u201330% protein, ~40% carbohydrates and is also a good source of several minerals like calcium, magnesium, potassium, phosphorus, iron, zinc, and manganese. Global chickpea production is 11.6 million t from 12.3 million ha area with an average yield of less than one t/ha  is C. arietinum , amino-aldehyde dehydrogenase (AMADH), abscisic acid stress and ripening (ASR) gene, a homolog of the DREB2A gene, known as the CAP2 gene, dehydrin (DHN), drought responsive element binding protein (DREB), ERECTA, Myb transcription factor (MYB), sucrose phosphate synthase (SPS), and sucrose synthase (SuSy).Although several genes have been found to be involved in abiotic stress tolerance in other crops, few studies have been carried out in chickpea. Candidate genes can be selected on the basis of prior knowledge from mutational analysis, biochemical pathways or linkage analysis of the trait of interest  gene belongs to the CDPK\u2013SnRK superfamily, which serves as important regulators modulating fundamental metabolic pathways in response to nutritional and environmental stresses in plants , various abiotic stresses including water stress and during the process of fruit ripening  are among the most commonly observed proteins induced by environmental stress associated with dehydration or low temperature  clade of the APETALA2 (AP2) family are distinctive to plants. Transcription factors DREB1A/CBF3 and DREB2A were identified as cold and drought stress\u2013responsive genes expressed in Arabidopsis thaliana . The Myb transcription factor family constitutes the largest and diverse class of DNA-binding transcription factors in plants  and other crop species (Glycine max and Medicago spp.) were chosen based on available literature   and 0.25 U of Taq polymerase (Ampli Taq Gold). PCR cycles comprising of denaturation of 94\u00b0C for 5 min, followed by 40 cycles of 94\u00b0C for 30 s annealing at temperature specific for each target gene for 40 s and 72\u00b0C for 1 min 30 s and a final extension was carried out at 72\u00b0C for 20 min. The amplified product (about 2 \u03bcl) was loaded on 1.2% agarose. The remaining PCR amplicons were purified using 1 unit of Exonuclease I and 1 unit of shrimp alkaline phosphatase (SAP) per 5 \u03bc l of PCR product. The Exo/SAP added PCR products were incubated for 45 min at 37\u00b0C followed by denaturing at 80\u00b0C for 15 min in the thermal cycler for deactivating unused exonuclease enzyme. The Exo/SAP treated amplicons were mixed with 1 \u03bc l of BigDye Terminator V3.1 , 2 \u03bc l of 5X sequencing dilution buffer and 3.2 \u03bc M of primer  and the volume was made to 10 \u03bc l by adding water. The sequencing PCR profile included an initial denaturation of 96\u00b0C for 30 s, followed by 60 cycles of 96\u00b0C for 10 s, 50\u00b0C for 5 s, and 60\u00b0C for 4 min. The PCR products were stored at 4\u00b0C until further use. Before sequencing, the PCR products were treated with 2.5 \u03bc l of 125 mM EDTA and 25 \u03bc l of absolute ethanol and incubated for 15 min at room temperature to precipitate the DNA. The plate containing the PCR product was centrifuged at 4000 rpm for 30 min at 4\u00b0C. The ethanol/ EDTA mix was poured off by inverting the plate, without losing the pellet. To each well, 60 \u03bc l of 70% ethanol was added and again spun at 4000 rpm for 20 min at 4\u00b0C. The ethanol was poured off as earlier. The plate was air-dried and 10 \u03bc l of HiDi formamide  was added and the products were denatured  and sequenced using an ABI3700/ABI3130 automated sequencer .In order to amplify these candidate genes and confirm their presence, a pilot experiment was set to sequence amplicons from eight diverse genotypes of chickpea consisting of Annigeri, ICCV 2, ICC 4958, ICC 1882, ICC 283, ICC 8261, ICC 4411, and ICC 10029. PCR was set up with 20 \u03bcl reaction mixture comprising 5 ng of template DNA, 5 picomoles each of forward and reverse primers, 2 mM dNTP, 20 mM MgClhttp://www.ebi.ac.uk/Tools/clustalw2/index.html). Multiple sequence alignment (MSA) files and fasta files were further used for identifying equence related parameters such as number of genotypes sequenced; length of sequences; number of indels; indel frequency; number of SNPs and their types (transition or transversion); SNP frequency; nucleotide and haplotype diversity and polymorphic information content (PIC) of SNPs and haplotypes using an in-house tool developed at ICRISAT called \u201cDIVersity ESTimator\u201d module (DIVEST) . The sequences of each candidate gene were aligned using CLUSTALW (AKIN homolog was amplified using the gene specific primer pair designed considering unigene sequence showing match with Arabidopsis AKIN (SNF-1 related protein kinase). The approximate amplicon size of AKIN was ~800 bp. Amplification of an AMADH homolog yielded a product of ~900 bp. The ABA stress and ripening (ASR) gene was isolated using the heterologous primers derived from Medicago sequence AC152054. A single amplicon of 700 bp was obtained for the chickpea genotypes used. A DREB2A homolog  and its promoter (CAP2 promoter) were amplified using a primer pair as described by Nayak et al. (CAP2 gene was 1000 bp while the CAP2 promoter was ~700 bp. A dehydrin homolog of chickpea was amplified using a primer pair designed for known dehydrin gene using chickpea unigene. The approximate amplicon size of dehydrin gene was ~380 bp. A DREB1 (Dehydration response element binding) homolog in chickpea was also amplified using a primer pair designed using unigene showing match against DREB1 gene. The approximate amplicon size of the DREB1 gene was ~800 bp. About 4300 bp long ERECTA gene fragments were isolated from eight chickpea genotypes using consensus primers. An ~350 bp long MYB gene was amplified using unigene sequence having match against Glycine max Myb transcription factor. For isolating the SuSy gene in chickpea, heterologous primers were designed from Medicago sequences TC95820 (homolog to SUS2 Pea) and AJ131964 (Medicago truncatula SUS1 gene). An ~1500 bp amplicon was obtained for TC95820- derived sequences, while a 900 bp amplicon was obtained with AJ131964- derived sequences. Heterologous primers designed using Medicago sequence BQ137986 and CB893717 were used to isolate SPS in chickpea. Amplification across eight genotypes in chickpea yielded products of 400 bp in both cases  to 236 genotypes (SPS gene), out of the 300 genotypes. Diversity analysis of the candidate genes using the DIVersity ESTimator (DIVEST) tool is presented in Table Forward and reverse sequences for all 10 abiotic stress responsive candidate genes and the ASR gene, amongst which 22 were transitions, 11 were transversions and one was tri-allelic. Apart from SNPs, two indels were also detected. The CAP2 gene was found to be conserved across all 227 genotypes with no SNPs and indels. In the case of CAP2 promoter, one SNP was found (which was the same observed when eight chickpea genotypes were sequenced as a pilot experiment). For the ERECTA gene, two fragments obtained from 7f-5r and 8f-8r primer pairs were sequenced. In total, 13 SNPs (9 transitions and 4 transversions) and one indel were obtained for ERECTA 7f-5r fragments while 20 SNPs (10 transitions and 10 transversions) were observed for ERECTA 8f-8r gene fragments. One indel and 3 SNPs were observed across SPS gene sequences. The AKIN gene showed the presence of two SNPs and two indels. A total of 13 SNPs (6 transitions and 7 transversions) and 3 indels were identified in the AMADH gene, while in the DHN gene 7 SNPs (five transitions and two transversions) were identified among 198 sequences analyzed. For the MYB gene only 6 SNPs (one transition and five transversions) and 2 indels were found in 200 Myb sequences under study. No nucleotide diversity was observed for the CAP2 gene and promoter while in the case of AKIN it was 0.0004 and 0.0029 for both ERECTA fragments. The average polymorphic information content (PIC) value of SNPs ranged from 0 (CAP2 gene) to 0.43 (CAP2 promoter). Haplotype diversity ranged from 0.019 (AKIN) to 0.879 (DREB1). Average (PIC) of haplotypes values ranged from 0.019 (AKIN) to 0.874 (DREB1) , and ERECTA (8f-8r), there was no clear distinction between the origin of the genotypes and the haplotype information. Haplotype network analysis for the AKIN gene reported three haplotypes, including one major (H2) and two minor haplotypes (H1 and H3)  is connected to eight other haplotypes  was connected to three minor haplotypes  with one SNP and another haplotype (H6) with three SNPs which was further connected to one minor haplotype (H4) with one SNP  defined by 10 SNPs and two minor haplotypes (H3 and H4) defined by single SNP were derived from major haplotype H2  two haplotypes (H1 and H2) derived from H3 with 6 and 13 SNPs respectively  are connected to four minor haplotypes with 1\u20132 SNPs  Figure . The AMAs Figure . There wr Figure . DHN genP Figure . The DREs Figure . Three ms Figure . Similar2 Figure . In the y Figure . Haplotys Figure . SPS gens Figure . AccessiThe present study was initiated with the objective of the identification of favorable alleles in abiotic stress responsive genes in the chickpea reference set. These gene-based SNPs may be used to identify the suitable allele of a gene that enable the plant to survive in a stress environment. Due to lack of genome sequence information of the chickpea genome until recently . Putative candidate genes in chickpea namely ASR, SuSy and SPS were isolated using respective sequence information obtained from the Medicago candidate gene sequences. In addition, the remaining abiotic stress responsive genes  were identified using a sequence similarity approach against the homolog genes present in model crops like Arabidopsis and Medicago. A large body of evidence demonstrated that the Snf1-related protein kinases (AKIN) serve as important regulators modulating fundamental metabolic pathways in response to nutritional and environmental stresses in yeast and mammalian cells  domain and regulatory domain (highly divergent). In the present study, the AKIN gene was found to be mostly conserved except two unique alleles each reported in specific genotype, which indicates that in the present study we were able to amplify the conserved part of AKIN gene, i.e., catalytic kinase. Researchers can target the divergent regulatory domain to identify the SNPs actively involved in abiotic stress response. Similarly, a protective/curative role of the AMADH gene in response to stress events caused by mechanical injury was reported by Petrivalsk\u00fd et al.  across the chickpea mini core collection.Most of the genes analyzed here, have not been previously studied in chickpea. Therefore, systematic efforts by using comparative genomics and bioinformatics approaches were made to determine the corresponding gene sequences in chickpea. For instance, a  Hardie, . To idenna Table . Researc\u00fd et al.  in pea sce Table . Over exASR gene is regulated by water stress, salt stress and plant hormone ABA. Over-expression of the ASR gene in transgenic plants is known to induce water- and salt- stress tolerance  showed 34 SNPs and two indels, highest among the candidate genes studied in the present study. The nucleotide diversity was found to be 0.0014 while haplotype diversity was 0.833. Cort\u00e9s et al. . This study provided a thorough description of the organization of the ASR family, and the nucleotide and haplotype diversity of four ASR genes in O. sativa  and its promoter, known to enhance tolerance to dehydration and salt stress, were isolated, characterized and expression studies were carried out in transgenic tobacco  of the genes at the promoter region and regulate the expression of downstream genes. The DRE containing core sequence A/GCCGAC was identified as a cis-acting promoter element, which regulates gene expression in response to drought, high salinity and cold stresses in Arabidopsis   making 7 haplotypes (4 in ERECTA-7f-5r and 3 in ERECTA-8f-8r) were observed. Nucleotide diversity was found to be 0.0029 which was high compared to all other candidate genes under study. The sequence diversity studies across the reference set of chickpea, provides the insights regarding existing haplotypes, which could be involved in drought tolerance mechanism. The role of plant Myb-proteins has been well characterized by using different genetic approaches. In most of the cases, the Myb domain binds to a specific DNA sequence (C/TAACG/TG) to facilitate transcriptional activation . Among the 114 SNPs detected, 66 SNPs regions were transitions, whereas the other 49 were transversions, and one SNP was reported tri-allelic. The nucleotide diversity across the chickpea mini core collection ranged from 0.0004 to 0.0022 with overall mean diversity of 0.0015. The possibilities of association mapping can be explored further by linking sequence diversity with the phenotype diversity in order to identify favorable alleles or haplotypes conferring drought tolerance in chickpea.The The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The present work effectively highlights the utilization of Dynamic Covalent Chemistry (DCC) principles in conjunction with the keto\u2013enol tautomerism to synthesize useful, stable, crystalline and porous Covalent Organic Frameworks (COFs) in water, which thereby merits over the conventional solvothermal COF synthesis protocol with its simpler and greener appeal. The formation of keto-enamine based crystalline, porous polymers in water is investigated for the first time. Facile access to the Schiff base reaction in water has been exploited to synthesize stable porous structures using the principles of Dynamic Covalent Chemistry (DCC). Most credibly, the water-based Covalent Organic Frameworks (COFs) possess chemical as well as physical properties such as crystallinity, surface area and porosity, which is comparable to their solvothermal counterparts. The formation of COFs in water is further investigated by understanding the nature of the monomers formed using hydroxy and non-hydroxy analogues of the aldehyde. This synthetic route paves a new way to synthesize COFs using a viable, greener route by utilization of the DCC principles in conjunction with the keto\u2013enol tautomerism to synthesize useful, stable and porous COFs in water. The \u03c0\u2013\u03c0 stacking distance between the successive COF layers was found to range between 3.8 and 4.4\u2005\u00c5, as calculated using the d spacing between 001 planes. The FT\u2013IR spectra indicated the disappearance of the N\u2014H stretching frequency  and the carbonyl stretching frequency  in all the COFs synthesized in water. In addition, the appearance of peaks corresponding to the stretching of the \u2014C=C\u2014 and \u2014C\u2014N\u2014 bonds confirmed the successful formation of COFs in water . The enol\u2013imine tautomerism was further confirmed using 13C CP-MAS solid-state NMR spectra. In accordance with their seal-tube synthesized counterparts, the 13C NMR of the trialdehyde showed a prominent carbonyl peak at \u03b4 192\u2005p.p.m. , while that of the resulting COF indicated the presence of the carbonyl peak at \u03b4 172\u2013188\u2005p.p.m. (corresponding to the \u2014C=O keto group). The absence of the signal corresponding to aldehydic carbon thereby certifies the completion of the reactions in water, thus signifying the ability of water to potentially bring about such reactions .The PXRD patterns of the as-synthesized COFs (TpPa-1 and -2) showed an intense first peak at 2\u03b8 4.7, whereas for TpBD, TpBpy, DAAQ and TpFn it appeared at 2\u03b8 3.4, both corresponding to the 100 plane reflection Fig. 1b, signiFigs. S7 and S9). However, the increase in the 001 plane peak intensity in a few of the COFs (corresponding to the \u03c0\u2013\u03c0 stacking in COFs) hints at the possible exfoliation of the COF sheets during the chemical treatment. Accordingly, the FT\u2013IR spectra also indicated the retention of the \u2014C=C and \u2014C\u2014N stretching peaks after the chemical treatment . The TGA profile of TpFn indicated thermal stability up to \u223c\u2005300\u00b0C, after which a gradual weight loss up to \u223c\u200560% was observed . Furthermore, the porosity and the surface area of activated COFs was evaluated using the Brunauer\u2013Emmett\u2013Teller (BET) model. The newly introduced TpFn COF showed a Type II N2 adsorption isotherm with a surface area of 302\u2005m2\u2005g\u22121. The surface area of TpPa-1, TpPa-2, TpBD, TpFn, TpBpy, DAAQ was found to be 633, 530, 601, 354, 1140 and 489\u2005m2\u2005g\u22121, respectively . In the study, it can be explicitly observed that the surface areas of the COFs constructed in water are relatively lower compared with their solvothermal counterparts. This is believed to be a direct consequence of the effect of reactant solubility on the framework formation. This effect is very much evident in cases of TpBpy and TpBD, wherein the 2, 2\u2032 positions of the biphenyl ring (in TpBD) are replaced by N atoms (in Bpy). The presence of such nitrogen atoms in the ligand backbone is very much known to favour hydrogen-bonding interactions with acids . The poor solubility of the corresponding amines, 2,7-diaminofluorene (Fn) and 2,6-diaminoanthraquinone (AQ) in aqueous medium is believed to decrease the crystallinity and henceforth the surface area in the case of TpFn and DAAQ COFs. The pore size distribution of COFs indicated the presence of narrow sized pores ranging between 1.4 and 2.0\u2005nm . The TEM and the SEM analysis revealed the presence of well isolated sheet-like structures in the case of TpPa-1 and TpPa-2 with no observable agglomeration. DAAQ, TpBD and TpBpy had pronounced fibrillar morphology, similar to their solvothermal-synthesized counterparts. The newly synthesized TpFn revealed the formation of petal-shaped structures with an average length of 600\u2005nm and width 220\u2005nm . Among all, TpBpy showed a maximum H2 uptake of 108\u2005cm3\u2005g\u22121 at 77\u2005K and 1\u2005bar pressure . The hydrothermally synthesized COFs showed considerable ability to uptake CO2 at 273\u2005K: TpBpy (73\u2005cm3\u2005g\u22121), DAAQ (82\u2005cm3\u2005g\u22121) and TpBD (95\u2005cm3\u2005g\u22121) .The chemical stability of each of the COFs was checked in 9\u2005N HCl and 3\u2005N NaOH for 3\u2005d. It was observed that all the PXRD peak positions were retained and no extraneous peaks were observed, indicating the retention of the framework structure after the chemical treatment  does not hamper the proceedings of the reaction as the product formed is water stable as well as water insoluble. In order to investigate the mechanism of the imine and keto-enamine bonded COF formation in water, the time-dependent UV\u2013vis spectroscopic study of the monomer formation was carried out using benzene-1,3,5-tricarbaldehyde and its hydroxyl analogue 2,4,6-trihydroxybenzene-1,3,5-tricarbaldehyde . Both the precipitates were collected and washed thoroughly using ethanol. The UV\u2013vis spectra of the benzene-1,3,5-tricarbaldehyde and aniline reaction mixture did not show the appearance of any product peaks even after 10\u2005h of reaction time . This indicates the sluggishness of the Schiff base condensation reaction towards the formation of -N,N\u2032,N\u2032\u2032-)trianiline (monomer 1) in water. On the other hand, its hydroxyl analogue i.e. 2,4,6-trihydroxybenzene-1,3,5-tricarbaldehyde reacted readily with aniline to form -2,4,6-tris\u00ad((phenylamino)methylene)cyclohexane-1,3,5-trione (monomer 2) in water. The UV\u2013vis study showed the disappearance of the peaks corresponding to the starting materials  with the appearance alongside of a new peak at 396\u2005nm, indicating the formation of monomer 2  of keto-enamine could also be observed . In addition, the spectrum also showed the coupling between the enamine proton and \u2014NH2. The sluggishness in the rate of monomer 1 formation is possibly due to the reversible nature of the imine bond, which makes it extremely sensitive to water. The presence of a large volume of solvent water molecules in the system is believed to severely retard monomer 1 formation . It is worth noting that as the next in line the tautomerization process consumes the Schiff base intermediates formed during the first step of the reversible reaction; the forward reaction is accelerated in accordance with Le Chatelier\u2019s principle. This thereby drives the system towards the second irreversible step involving keto tautomerism. In the case of a hydroxy-containing aldehyde, the insolubility of the resulting monomer 2 is believed to instigate the progress of the reaction in water.It is important to note that the concept of aqueous synthesis cannot be generalized to COFs derived e Figs. 4a and b.me Fig. 4c. This ed Fig. 4e. In adFig. S17). It was observed that TpPa-1 formation was initiated after 6\u2005h of heating the mixture containing 1,3,5-triformylphloroglucinol and p-phenylenediamine. After 18\u2005h, the PXRD pattern distinctly showed the presence of the first peak corresponding to the 100 plane of TpPa-1 with the disappearance of the reactant peaks in the mixture, thereby confirming the completion of the reaction. The acetic acid used for the COF synthesis essentially lowers the pH of the medium thereby increasing the solubility of the diamines and eventually enhancing the reaction rate. Thus, the overall retention in the crystallinity, surface area and porosity of the hydrothermally derived COFs may be attributed to the improved solubility of the precursor amines in the reaction medium and also to the hydrogen-bonding environment provided by the acetic acid\u2013water medium, which is well known to favour reversible dynamic covalent bonding, a factor very necessary for the COF formation.The PXRD spectra were recorded at regular intervals to monitor the completion of the COF formation in water  COF-Benzidine_AA_vasp-PBE. DOI: 10.1107/S2052252516013762/yc5008sup2.pdfSupporting figures and tables. DOI:"}
+{"text": "Paget-Schroetter syndrome is thrombosis of the axillary-subclavian vein that is associated with strenuous and repetitive activity of the upper extremities. Overuse of the arm coupled with external compression results in microtrauma in the intima of the subclavian vein, resulting in the activation of the coagulation cascade. Diagnosis is usually made by Doppler ultrasound and the treatment involves thrombolysis, while routine surgical decompression of the thoracic outlet is controversial. In this report, we present a case of a patient who presented with a second episode of spontaneous right upper extremity deep venous thrombosis. The first episode was inadequately treated with oral anticoagulation alone. During the second episode, Paget-Schroetter syndrome was diagnosed, after careful review of his occupational history. He subsequently underwent angioplasty and decompression of thoracic outlet with no recurrence of thrombosis in a 12-month follow-up period. Paget-Schroetter syndrome (PSS) or \u201ceffort\u201d thrombosis of the axillary-subclavian vein is an uncommon cause of deep vein thrombosis (DVT) seen in physically active and otherwise healthy individuals. It was first described by Paget in 1875 and Von Schroetter in 1884 and was named the \u201cPaget-Schroetter syndrome\u201d by Hughes in 1949 . DespiteA 38-year-old male patient was admitted with a two-week history of painful swelling of the right upper extremity. He denied any history of fever, rash, joint pain, or insect bite. He gave a history of a right UEDVT, diagnosed one year ago, treated with six months of oral rivaroxaban with no subsequent follow-up visits. On examination, he had a temperature of 37.5\u00b0C, a blood pressure of 128/78\u2009mmHg, a pulse rate of 76 beats/minute, a respiratory rate of 18 breaths/minute, and an oxygen saturation of 98% on room air. On inspection, he had noticeable swelling and redness extending from his right wrist to the shoulder, and there was no superficially engorged vein on the arm or the chest. On palpation, he had mild tenderness of the affected area. All peripheral pulses were palpable and capillary refill time at right thumbnail was <2\u2009sec. There was no palpable lymphadenopathy. All of his laboratory workup, including the complete blood count and coagulation profile, was unremarkable. A Doppler ultrasound of the right upper limb showed thrombosis of the right axillary, subclavian vein, and brachial veins Figures . The AngUpper extremity DVT can have a primary etiology, which accounts for about 20% of cases and includes either acquired or congenital anatomical anomalies. The remainder, 80% cases, are caused by secondary factors including the use of central venous or dialysis catheter, pacemaker insertion, and parenteral nutrition. Other secondary causes are the use of oral contraceptive pills, hypercoagulable state, and surgery on the upper arm . Upper e"}
+{"text": "Inflammatory mechanisms are implicated in the pathology of Alzheimer\u2019s disease (AD). However, it is unclear whether inflammatory alterations are a cause or consequence of neurodegeneration leading to dementia. Clarifying this issue would provide valuable insight into the early diagnosis and therapeutic management of AD. To address this, we compared the mRNA expression profiles of cytokines in the brains of AD patients with \u201cnon-demented individuals with AD pathology\u201d and non-demented healthy control (ND) individuals. \u201cNon-demented individuals with AD pathology\u201d are referred to as high pathology control (HPC) individuals that are considered an intermediate subset between AD and ND. HPC represents a transition between normal aging and early stage of AD, and therefore, is useful for determining whether neuroinflammation is a cause or consequence of AD pathology. We observed that immunological conditions that produce cytokines in the HPC brain were more representative of ND than AD. To validate these result, we investigated the expression of inflammatory mediators at the protein level in postmortem brain tissues. We examined the protein expression of tumor necrosis factor (TNF)\u03b1 and its receptors (TNFRs) in the brains of AD, HPC, and ND individuals. We found differences in soluble TNF\u03b1 and TNFRs expression between AD and ND groups and between AD and HPC groups. Expression in the temporal cortex was lower in the AD brains than HPC and ND. Our findings indicate that alterations in immunological conditions involving TNFR-mediated signaling are not the primary events initiating AD pathology, such as amyloid plaques and tangle formation. These may be early events occurring along with synaptic and neuronal changes or later events caused by these changes. In this review, we emphasize that elucidating the temporal expression of TNF\u03b1 signaling molecules during AD is important to understand the selective tuning of these pathways required to develop effective therapeutic strategies for AD. The molecular mechanisms underlying Alzheimer\u2019s disease (AD) pathogenesis have not yet been elucidated. Numerous inflammatory mediators have been identified in AD brains but were not detected in non-demented elderly control individuals. This suggests that various inflammatory mechanisms are involved in the process of AD \u20133. An im11C-deuterium-L-deprenyl (11C-DED) in asymptomatic carriers of autosomal dominant AD with increasing A\u03b2-plaque load during disease progression. Such alterations in MCI and asymptomatic carriers of AD suggest that inflammatory events may precede the clinical development of AD [Anti-inflammatory therapies, which are described in detail below, using non-steroidal anti-inflammatory drugs (NSAIDs) should prevent cognitive impairment in AD if inflammatory and immunological alterations precede AD dementia. Increasing reports have demonstrated alterations in the expression of inflammatory mediators in peripheral blood mononuclear cells, cerebrospinal fluid (CSF), plasma, and serum of mild cognitive impairment (MCI) individuals \u201323. MCI nt of AD ,23 and tnt of AD . Howevernt of AD , has notnt of AD ,27,28. Fnt of AD ,29\u201331. Int of AD  prospectnt of AD .It remains to be determined whether inflammatory alterations are the cause or consequence of neurodegeneration that leads to overt AD dementia, and whether anti-inflammatory therapy reduces cognitive impairment in AD patients in very early or preclinical stages. To address this issue, we compared the expression profiles of several cytokines in the temporal cortex of postmortem AD and control individuals . There wOur previous study  comparedSome object to the use of HPC individuals as an intermediate subset between AD and ND (LPC) because HPC subset may imply a different pathogenesis from that of AD group. This is because HPC individuals meet the pathological criteria for AD but show no antemortem symptoms of dementia. However, HPC cases are not only intermediate between AD and LPC in terms of A\u03b2 plaques or NFTs, but it is also intermediate in terms of the cortical cholinergic deficits \u201356. In aWe have previously investigated the expression of the following cytokines : (i) IntWe have investigated the cytokine expression profiles in the brain using real-time PCR techniques . Brain tThe cerebellum generally lacks A\u03b2 deposits in the AD brain, despite A\u03b2 production in all brain regions . SynaptiOur previous study  has demoTo date, cytokine expression profiles have not been investigated at the protein level in HPC individuals . A limitMany types of inflammatory mediators are involved in AD pathogenesis ,8,18,58.CD59 is expressed in the brain ,93. DecrThe elevation of glucocorticoids (GCs) secreted by the adrenal glands upon chronically stressful stimuli that occurs during aging may accelerate the progression of brain aging, particularly the hippocampus. Although under physiological stress GCs generally exert anti-inflammatory effects in the CNS, the chronically elevated GC levels under stressful stimuli can potentiate neuroinflammation and increase the expression of proinflammatory cytokines, such as IL-1\u03b2 and TNF\u03b1, which in turn activate many signaling pathways, including nuclear factor kappa-B (NF-\u03baB), and microglia function ,98. As aHippocampal changes arising from chronic stress via the long-term elevation of GC signaling are also evident in AD-associated processes, including aging ,97. IndeAisen et al.  suggesteNSAIDs reduce neuroinflammation, A\u03b2 levels, AD-like brain pathology, and behavioral impairments in mouse models of AD via several pathways \u2013110. BecAccording to Weggen et al. , the nonKotilinek et al.  proposedin vitro [AD is a multifactorial neurodegenerative disease, and inflammation is an integral part of its pathogenesis ,8. A hosin vitro ,135. Thein vitro ,124,129.in vitro , and intin vitro ,136.Talbot et al.  demonstrTNF\u03b1 is centrally involved in the pathogenesis of AD \u2013142 and in vitro, when applied either alone or together with A\u03b2. Janelsins et al. [TNF\u03b1 signals exert bidirectional effects of being supportive and harmful to neuronal function . TNF\u03b1 iss et al.  demonstrs et al. . Inhibits et al. . Inhibits et al. .On the other hand, Chakrabarty et al.  reportedThese findings show that excess TNF\u03b1 signaling has detrimental and beneficial effects on neurons. This depends on many factors, including the presence or absence of A\u03b2 ; aging ; the typSeveral cytokines including TNF\u03b1 are expressed in a disease progression-dependent manner; that is, they increased steadily or peaked when MCI progressed to AD, and therefore, may represent suitable molecules for disease prediction . In a liTNF\u03b1 is produced as a membrane-bound precursor molecule (mTNF\u03b1) of 26 kDa, which is cleaved by TACE to produce a soluble 17 kDa mature cytokine (sTNF\u03b1) . Both foIn this section, we present our data on TNF\u03b1 expression normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and \u03b2-actin, in the AD brain. These were compared to levels in the brain of HPC and ND individuals. Expression was measured in the temporal cortices and cerebella of autopsied brain samples from five AD patients, and five age and gender-matched HPC and ND individuals each. The demographic characteristics were similar to those shown in Table S1. Brain samples were provided by the BSHRI brain bank. The postmortem intervals (PMIs) averaged less than 4 hrs.Mature sTNF\u03b1 and precursor mTNF\u03b1 were recognized with the anti-TNF\u03b1 antibody  as positive bands at approximately 17 kDa and 26 kDa , respectOur data indicate that TNF\u03b1 protein expression was lower, not higher, in the vulnerable temporal cortex of AD patients compared to HPC or ND individuals. Previous findings regarding TNF\u03b1 expression in the AD brain have been inconsistent. Lanzrein et al.  reportedThe biological effects of TNF\u03b1 are exerted by its binding to TNFR type 1 (TNFR1) and TNFR type 2 (TNFR2) . TNFR1 iThe main receptor for TNF\u03b1, TNFR1 can trigger two signaling pathways, leading to survival and death. Survival signaling begins with complex I formation, consisting of TNFR1, TNFR-associated death domain protein (TRADD), receptor-interacting protein 1 (RIP1) and TNFR-associated factor 2 (TRAF2), followed by the activation of NF-\u03baB, which leads to the transcriptional activation of pro-survival genes, such as those encoding cIAP1/2, Bcl-2, Bcl-xL, and FLICE-like inhibitory protein (FLIP). Death signaling is initiated by recruitment of TRADD and RIP1 to TNFR1, which bind to the Fas-associated death domain protein (FADD) after the dissociation from TNFR1. This recruits and activates caspase-8 to finally form complex II in instances where the complex I or NF-\u03baB fails to be activated ,175,176.In general, TNFR2 is believed to mediate its effects by intensive crosstalk with TNFR1 signaling pathways and ligand passing to neighboring TNFR1 ,160,162.Signaling pathways initiated by TNFRs may either cooperate or counterbalance each other . TNF\u03b1 biOf interest, TNFRs can have counteracting functions, at least in neural tissues . FontainMice that globally lack both TNFRs showed exacerbation of excitotoxic and ischemic neuronal injuries accompanied by a reduced response of microglia to excitotoxins and ischemia, indicating a neuroprotective role of TNF\u03b1 signaling . Long-teDetrimental and neuroprotective roles have been reported for TNF\u03b1 signaling, illustrating the complexity of these signaling pathways . TNFR1 dMontgomery et al.  demonstrWe demonstrated that expression of cytokines including sTNF\u03b1 in the HPC brain was closer to ND than AD brains. We next compared TNFR1 and TNFR2 expression in the brains of AD patients and compared this to HPC and ND brains. This study used postmortem tissue samples from the vulnerable temporal cortex and resistant cerebellum of ten AD patients and ten age and gender-matched HPC and ND individuals each. Demographic characteristics were similar to those shown in Table S1. The brain samples were provided by the BSHRI brain bank. PMIs averaged less than 4 hrs. The anti-TNFR1  and anti-TNFR2  antibodies were used for Western blot analyses. TNFR protein levels in vulnerable brain areas, including the frontal and temporal cortices and the hippocampus of AD and ND individuals have already been reported using autopsied human tissues ,184. HowTNFR1 and TNFR2 were detected as single bands at approximately 55 kDa and 75 kDa, respectively . In the Our study is the first to investigate TNFR protein expression in HPC cases. We demonstrated lower levels of both TNFRs in AD, but not HPC individuals, compared to ND individuals. This means that alterations in immunological conditions involving TNFR signaling are not the primary events initiating AD pathological changes such as A\u03b2 plaque and NFT formation but may be either early events occurring along with synaptic and neuronal changes or later events occurring as a secondary response to synaptic loss and neuronal death. As shown in There are many therapeutic targets in the neuroinflammation-related pathological processes leading to AD. These include cytokines, the complement system, GCs, IR signaling, glial activation, and other inflammatory mediators. Therefore, a multicomponent treatment approach (polypharmacy) may be required . In eachTNF\u03b1 is associated with pathological mechanisms that participate in neurotoxicity and neuronal damage in AD, implicating anti-TNF-\u03b1 agents in AD therapy ,160,162.Anti-TNF\u03b1 agents, including infliximab and etanercept, have been developed to specifically inhibit TNF\u03b1 ,147,162.Etanercept is a recombinant dimeric fusion protein comprising the extracellular ligand-binding portions of soluble human TNFR2 linked to the Fc fragment of human IgG1. It binds to mTNF\u03b1 and trimeric sTNF\u03b1, and inhibits signaling through both TNFRs ,162,187.Non-specific inhibitors of TNF\u03b1, such as thalidomide and minocycline, have been tested in AD treatment ,191\u2013193.Blocking all effects of TNF\u03b1 by anti-TNF\u03b1 treatment can be counter-productive. A more effective therapeutic approach is the selective blocking of TNF\u03b1 signaling; therefore, specifically targeting TNFR1 or TNFR2 as a new therapeutic approach is now being considered ,194,195.Increasing evidence suggests that inflammatory mediators, including TNF\u03b1 and its receptors, are involved in the pathogenesis of AD. However, findings regarding their function and expression in AD have been inconsistent. NSAIDs may provoke the contrasting effects of neuroinflammatory molecules at different stages of AD pathogenesis. Different AD stages may have different detrimental and protective factors. These illustrate the complexity of signaling pathways in the CNS, where neuroinflammatory signaling leads to either protective or detrimental outcomes, depending on a variety of conditions. To better define signaling mechanisms and therapeutic strategies for AD, temporal expression profiles of signaling molecules need to be elucidated in ND (LPC), HPC, early stage AD, and late stage AD brains. Expression also needs to be compared between vulnerable and resistant brain areas.Very recently selective amplification of regulatory T cells by low-dose IL-2 treatment was shown to increase the number of plaque-associated microglia and restore cognitive function in APP/PS transgenic mice . To date"}
+{"text": "We found that maturation of diffuse into cored plaques correlated with increased A\u03b21\u201340 deposition. Using spatial in situ delineation with imaging MS (IMS), we show that A\u03b21\u201340 aggregates at the core structure of mature plaques, whereas A\u03b21\u201342 localizes to diffuse amyloid aggregates. Moreover, we observed that diffuse plaques have increased pyroglutamated A\u03b2x-42 levels in s-AD but not CU-AP, suggesting an AD pathology\u2013related, hydrophobic functionalization of diffuse plaques facilitating A\u03b21\u201340 deposition. Experiments in tgAPPSwe mice verified that, similar to what has been observed in human brain pathology, diffuse deposits display higher levels of A\u03b21\u201342 and that A\u03b2 plaque maturation over time is associated with increases in A\u03b21\u201340. Finally, we found that A\u03b21\u201340 deposition is characteristic for cerebral amyloid angiopathy deposition and maturation in both humans and mice. These results indicate that N-terminal A\u03b2x-42 pyroglutamation and A\u03b21\u201340 deposition are critical events in priming and maturation of pathogenic A\u03b2 from diffuse into cored plaques, underlying neurotoxic plaque development in AD.Amyloid-\u03b2 (A\u03b2) pathology in Alzheimer's disease (AD) is characterized by the formation of polymorphic deposits comprising diffuse and cored plaques. Because diffuse plaques are predominantly observed in cognitively unaffected, amyloid-positive (CU-AP) individuals, pathogenic conversion into cored plaques appears to be critical to AD pathogenesis. Herein, we identified the distinct A\u03b2 species associated with amyloid polymorphism in brain tissue from individuals with sporadic AD (s-AD) and CU-AP. To this end, we interrogated A\u03b2 polymorphism with amyloid conformation\u2013sensitive dyes and a novel  The conspicuous phenotypic variability of AD4\u2013Morphologic heterogeneity of A\u03b2 plaques has been linked to the structural and chemical diversity of amyloid fibrils that consist of different A\u03b2 peptide isoforms . These pPlaque polymorphism, attributed to differing fibrillary components, has been shown to correspond to distinct spectral emission upon luminescent conjugated oligothiophene (LCO)-based fluorescent amyloid staining \u201312. Spec\u201313\u201316\u2013SWE)  and CU-AP individuals as well as in a transgenic AD mouse model (tgAPPSWE) .SWE mice, such structural transition of the fibrils underlying those A\u03b2 plaques likely reflects plaque maturation.The results obtained here provide evidence for a relationship between A\u03b2 peptide species ratio and A\u03b2 plaque morphotypes (diffuse and cored), as indicated by conformational characteristics of A\u03b2 plaques and the underlying peptide aggregates. Furthermore, as revealed by experiments in transgenic tgAPPStructural polymorphism of A\u03b2 plaque pathology can be delineated in an unbiased way by using novel, fluorescent amyloid probes based on LCOs. These probes have different binding affinities to different amyloid structures as well as different electro-optic properties due to their flexible backbone, allowing these molecules to adopt different backbone structures. Different LCOs can therefore be delineated using hyperspectral detection in fluorescent microscopy .Table S1) as well as in transgenic AD mice (tgAPPSWE).To understand how A\u03b2 plaque polymorphism is related to distinct A\u03b2 peptide content, we investigated structural and chemical characteristics of individual plaques in post-mortem human brain tissue from the temporal cortex of sporadic AD in the dementia stage and CU-AP cases (A and A and B)Fig. S1 . This hyperspectral imaging paradigm was used for unbiased annotation of structurally distinct plaque morphotypes (i.e. cored and diffuse plaques) . The aim was then to characterize the corresponding A\u03b2 peptide profile by isolating these plaques using laser microdissection with pressure catapulting (LMPC) followed by immunoprecipitation and mass spectrometric analysis .To delineate spectral characteristics of A\u03b2 polymorphism in human and mouse brain tissue, we used a double-stain strategy with two LCO-based amyloid probes, tetra- and heptameric formyl-thiophene acetic acids (q- and h-FTAA)  -positive, A\u03b2 fibrils as well as immature fibrillary intermediates of A\u03b2 aggregation that are not detectable by thioflavin S or Congo red as described previously  .A.I and A.II). In contrast, morphologically diffuse plaques in s-AD showed a homogeneous emission profile at 540 nm across the entire plaque area, indicating h-FTAA binding (A.III and A.IV)  , 11, 13.A.V and A.VI).In contrast to s-AD pathology, brain tissue from CU-AP cases showed almost exclusively diffuse plaque morphotypes that exhibited emission profiles similar to the diffuse plaques observed in s-AD cases (D).Given the spectral difference that we observed for the different plaque morphotypes, we sought to quantify differential LCO-binding in all plaques. For this, we calculated the mean emission ratio at 500 nm/540 nm, corresponding to the ratio of bound q-FTAA/h-FTAA . The resFig. 1AFig. S2).Complementary, co-staining experiments of the LCOs with thioflavin S and Congo red as well as birefringence spectroscopy of CR show that q-FTAA\u2013positive aggregates as observed in cored plaques are more fibrillar in structure as compared with h-FTAA\u2013positive diffuse amyloid structures . We extracted and selectively enriched A\u03b2 species from the collected plaques, using a two-step immunoprecipitation approach . The individual A\u03b2 species in the precipitate were then characterized using MS , resulting in chemically specific MS peak data (B and C), allowing for relative quantification of individual A\u03b2 species in the plaque extracts (E). Further, the detected mass signals were verified by high-resolution MS and MS/MS To characterize the A\u03b2 composition pattern of these different plaque types, we isolated hyperspectrally annotated A\u03b2 plaque morphotypes using laser microdissection  and 7-fold higher than in the diffuse plaques found in the CU-AP group . We observed a similar pattern for A\u03b24\u201340 and A\u03b24\u201342, the N-terminally truncated isoforms of A\u03b21\u201340 and A\u03b21\u201342 . Here, A\u03b24\u201342 was the most dominant peak in the MS spectrum of all plaque types . The A\u03b24\u201340/A\u03b24\u201342 ratio was 4-fold higher in cored plaques than in diffuse plaques in s-AD and 20-fold higher than in diffuse plaques present in CU-AP . These results suggest that A\u03b21\u201340 and A\u03b24\u201340 are associated with formation of cored plaques and more mature A\u03b2 fibrils in heterogeneous plaque pathology observed in AD dementia brains, whereas, as mentioned previously, CU-AP brains contained almost exclusively diffuse plaques that consist mostly of A\u03b21\u201342 and A\u03b24\u201342, respectively .Our results showed that the A\u03b21\u201340/A\u03b21\u201342 ratio was 3.5-fold higher in cored plaques than in diffuse plaques in the s-AD group . This indicates a positive association of A\u03b21\u201340 with q-FTAA fluorescence and of A\u03b21\u201342 with h-FTAA fluorescence. The correlation results for the ratio of the corresponding N-terminally truncated species, A\u03b24\u201340/A\u03b24\u201342, showed the same positive associations with 500 nm/540 nm . This suggests that A\u03b2x-40 species are associated with cored plaque areas, whereas A\u03b2x-42 peptides correlate with diffuse A\u03b2 structures.Given this pronounced increase of A\u03b21\u201340 and A\u03b24\u201340 in cored plaques, we investigated whether the relative amounts of these A\u03b2 species correlated with the hyperspectral LCO signals. The results showed that A\u03b21\u201340/A\u03b21\u201342 correlated significantly with 500 nm/540 nm  species of A\u03b21\u201342 (A\u03b2pEx-42).C.II and E.II). We observed a similar pattern for A\u03b2pE11\u201342, where the A\u03b2pE11\u201342/A\u03b21\u201342 ratio was 2 times higher in both cored and diffuse plaques in s-AD as compared with diffuse plaques present in CU-AP . Similarly to the A\u03b21\u201340/A\u03b21\u201342 ratio data, we asked whether the relative amounts of the A\u03b2pE species correlated with the hyperspectral LCO signals. The results showed that both A\u03b2pE3\u201342/A\u03b21\u201342  and A\u03b2pE11\u201342/A\u03b21\u201342  correlated significantly with 500 nm/540 nm. These results suggest that pyroglutamate modification of A\u03b21\u201342 is associated with Alzheimer-specific A\u03b2 pathology.Our results showed that the A\u03b2pE3\u201342/A\u03b21\u201342 ratio was 2-fold higher in diffuse plaques in s-AD than in diffuse plaques in CU-AP and 3 times higher in cored plaques in s-AD than in the diffuse plaques found in the CU-AP group  on s-AD and CU-AP tissue to resolve the localization of distinct A\u03b2 peptides within single plaques and to delineate how these correlate with the LCO staining results (A). Here, we observed that the A\u03b21\u201340 signal was primarily localized to the center of cored plaques in s-AD brain tissue but was not detected in diffuse plaques in s-AD and CU-AP as visualized in the single ion images (A.I\u2013A.III). In contrast, A\u03b21\u201342 distributed to the periphery of cored plaques (A.IV and A.VII). Further, A\u03b21\u201342 was strongly localized to diffuse plaques in both s-AD (A.V and A.VIII) and CU-AP (A.VI and A.IX). These results are well in line with our LMPC-IP-MS data  is associated with mature A\u03b2 fibrils and q-FTAA staining, respectively, whereas A\u03b21\u201342 ) is associated with diffuse, monofilamentous, protofibrillar A\u03b2 assemblies that are found in diffuse plaques both in s-AD and CU-AP. Further, in line with the full-length A\u03b21\u201342, the corresponding pE species, A\u03b2pE3\u201342 and A\u03b2pE11\u201342, showed localization to diffuse areas of cored plaques  as well as diffuse plaques in s-AD  and CU-AP .Whereas the LMPC-IP\u2013based  results A. Here, -MS data  and furtSWE mice that displayed heterogeneous plaque pathology, including cored, diffuse plaques and cerebral amyloid angiopathy (CAA) (A and B.I)  A and B.Iand B.I) .A and B.II). This is in line with previous findings in different transgenic mouse models carrying the Swedish double mutation of APP. These studies have reported an initial formation of smaller cored A\u03b2 deposits at 10\u201312 months, followed by rapid and exponential growth of both cored and a few diffuse plaques, until full-blown plaque pathology is reached at 18 months (\u2013B.II). The emission profile across the center of these early small, compact plaques showed, however, a more heterogeneous blue shift (B.III), as compared with the spectral data observed for cored plaques in s-AD.In 12-month-old mice, we observed deposition of small compact plaques that primarily localized to the cortex, whereas almost no plaque formation was observed in the hippocampus . At this age, the majority of plaques did exhibit a Congo red\u2013positive, core structure observed in bright field and birefringence microscopy  (B.IV and B.V). In contrast, diffuse plaques showed a homogeneous emission profile at 540 nm across the plaque area, corresponding to h-FTAA (B.VI and B.VII). Further, the emission wavelength ratio, 500 nm/540 nm (q-FTAA/h-FTAA) (C).In 18-month-old mice, we observed A\u03b2 plaque pathology with heterogeneous morphology and LCO-annotated optical properties in both the cortex and hippocampus. Here, we detected two major subpopulations of plaque morphotypes in both the cortex and hippocampus, including cored plaques and diffuse plaques, as observed for s-AD (B and C)  together/h-FTAA) , was 60%/h-FTAA) C.D). Our results showed that there was no difference in A\u03b21\u201340/A\u03b21\u201342 ratio between cored plaques in 12-month-old mice and diffuse plaques in 18-month-old mice (E.I), In contrast, the A\u03b21\u201340/A\u03b21\u201342 ratio in cored plaques in older mice was 2 times higher than in cored plaques in 12-month-old mice (E.I).We then determined the A\u03b2 peptide profiles of all plaque types in all mice at both ages, using laser microdissection and IP-MS for relative quantification of the individual A\u03b2 species based on their MS traces D. Our reold mice E.I, In cold mice E.I.D and E.II). Similar to the human data, we found that the spectral emission ratio, 500 nm/540 nm, correlated significantly with the A\u03b21\u201340/A\u03b21\u201342 peptide ratio in both the cortex  and the hippocampus . This indicates that, in accordance with the plaque characteristics observed in human A\u03b2 pathology, q-FTAA binding correlates with A\u03b21\u201340 levels and that A\u03b21\u201340 is associated with formation of cored plaques.In 18-month-old animals, the A\u03b21\u201340/A\u03b21\u201342 ratio in cored plaques was also 2 times higher as compared with diffuse plaques, which was consistent in both the cortex and the hippocampus (A and B). The results showed localization of A\u03b21\u201340 to core structures for small cored plaques in 12-month-old mice, whereas A\u03b21\u201342 displayed a more heterogeneous localization, as illustrated in the individual ion images (A.I\u2013A.III).To confirm the localization of A\u03b21\u201340 to cored plaque structures, we further verified these results for LCO-outlined plaques using MALDI IMS on adjacent tissue sections , A and BSWE mice, our MALDI IMS experiments showed peptide localization patterns similar to the findings observed in human tissue. Here, A\u03b21\u201340 localized predominantly to the central core structures of cored deposits (B.I). In contrast, A\u03b21\u201342 localized primarily to diffuse plaques and diffuse peripheral structures of cored deposits (B.II and B.III).For 18-month-old tgAPPdeposits B.I. In cThis suggested that the LCO spectral pattern and the associated increase in A\u03b21\u201340/A\u03b21\u201342 peptide ratios are comparable between cored plaques observed in human AD as well as in the transgenic mouse model of AD. Moreover, these results show an age-associated change of spectral characteristics toward q-FTAA emission at 500 nm along with an increase in A\u03b21\u201340/A\u03b21\u201342 ratio. Overall, this suggests that plaque maturation associated with AD pathogenesis is associated with conformational rearrangement from diffuse to cored deposits  and thatSWE mice.CAA is another characteristic in AD amyloid pathology and is suggested to be associated with the presence of cored amyloid deposits . Similar30\u2013A.I and A.II). IP-MS of laser microdissected CAA from s-AD tissue showed a dominant signal for A\u03b21\u201340 and A\u03b24\u201340, whereas no A\u03b21\u201342 was detected (data not shown). This was verified with MALDI IMS of individual CAA in human s-AD brain tissue, where A\u03b21\u201340 was found to localize within the rim of CAA deposits (B.I). In contrast, no A\u03b21\u201342 was found to localize to CAA deposits (B.II and B.III).Our results showed that CAA in s-AD patients showed a strong q-FTAA\u2013positive, blue emission across the vessel wall of individual CAA deposits (deposits B.I. In cA.III\u2013A.VI). Spectral analysis of LCO-stained brain tissue showed different cross-sectional emission profiles with increasing age. In 12-month-old mice, vascular amyloid deposits showed strong h-FTAA emission across their surface area (A.III and A.IV). In 18-month-old mice, we observed a blue shift at the center of the vessel wall in these CAA structures, indicating a more mature A\u03b2 aggregation state (A.V and A.VI). IP-MS of laser-microdissected CAA from transgenic mice showed that the A\u03b21\u201340/A\u03b21\u201342 ratio was 5 times increased in CAA in 18-month-old animals as compared with CAA in 12-month-old mice (C).In transgenic mice, CAA formation was observed in the cortex of 12-month-old mice and in the cortex and hippocampus in older animals at 18 months  and A\u03b21\u201342 (B.V) localize to CAA pathology (B.VI). In 18-month-old mice, we observed a strong localization of A\u03b21\u201340 to CAA (B.VII), whereas the signal for A\u03b21\u201342 showed only a weak localization to CAA (B.VIII and B.IX). Taken together, the data obtained for plaque pathology in transgenic mice suggest that increased A\u03b2x-40 deposition plays a crucial role in maturation of both vascular amyloidosis and extracellular amyloid plaques and core formation, respectively.To further verify the change in A\u03b21\u201340/A\u03b21\u201342 ratio, we performed MALDI IMS on CAA in tgAPPh A\u03b21\u201340 B.IV and d A\u03b21\u201342 B.V localathology B.VI. In 0 to CAA B.VII, whIn this study, we investigated whether structural polymorphism of A\u03b2 plaque morphotypes is associated with distinct A\u03b2 chemistry. Our results show that cored plaques in s-AD are characterized by deposition of A\u03b21\u201340, whereas diffuse plaques in both s-AD and CU-AP are characterized by deposition of A\u03b21\u201342. Further, our data show that diffuse plaques in s-AD show increased levels of pyroglutamate-modified N-terminally truncated A\u03b21\u201342 species  as compared with diffuse plaques in CU-AP. Imaging MS identified a specific A\u03b21\u201340 localization to the center of cored plaques, suggesting that A\u03b21\u201340 is associated with mature amyloid structures and dense fibrils, respectively, within cored plaques in s-AD. In contrast, diffuse areas of cored deposits as well as diffuse plaques in both s-AD and CU-AP were largely composed of A\u03b21\u201342. The corresponding pyro-E peptides A\u03b2pE3\u201342 and A\u03b2pE11\u201342 localized to diffuse structures as well.Because plaques in CU-AP show primarily a diffuse morphology, these results suggest that full-length A\u03b21\u201342, while being indicative of general amyloidosis, is not the primary neurochemical trait associated with A\u03b2 pathogenicity and toxicity in AD.These findings appear to stand in contrast to the current perception that A\u03b21\u201342 is the most relevant A\u03b2 species associated with AD pathogenesis as suggested by CSF biomarker findings, where decreased A\u03b21\u201342 levels, but not A\u03b21\u201340, point toward brain wide accumulation of A\u03b21\u201342 \u201335.\u2013SWE  is too minor to be reflected in the periphery.An increase of A\u03b21\u201342 in the brain, as indicated by decreased CSF levels, points to a general increased plaque load irrespective of plaque morphology and can be explained with A\u03b21\u201342 being spherically accumulated in all plaques, including cored plaques, and thereby accounts for a significantly larger part of the plaque volume. Indeed, by comparing relative values, an increase in A\u03b21\u201340/A\u03b21\u201342 ratio seems to originate from increased A\u03b21\u201340. Because A\u03b21\u201340 is confined to the core structures that are smaller in volume relative to the total plaque volume, the amount may be underestimated by histological, antibody-based staining techniques. This is also consistent with Western blotting\u2013based results reported on laser-microdissected plaques in s-AD, CU-AP, and tgAPP/PS2 mice, which showed that cored and diffuse plaques were found to contain predominantly A\u03b21\u201342, whereas the A\u03b21\u201340/A\u03b21\u201342 ratio was higher in cored plaques as compared with diffuse plaques owing to a higher content of A\u03b21\u201340  in diffuse plaques in AD but not in CU-AP further suggest a prominent role of A\u03b21\u201342 functionalization in seeding A\u03b2 pathology in AD. Indeed, N-pyro-E-A\u03b242 truncation has previously been identified to be prominent in brain extracts  and senig A\u03b21\u201340 \u201354. TherOverall, these data indicate that A\u03b21\u201342 and N-pyro-E-A\u03b242 are relevant species in seeding pathology and that diffuse plaques represent an early stage of A\u03b2 deposits that mature into cored plaques and that this process involves the recruitment of more hydrophilic A\u03b21\u201340 species over time. Here aggregation and functionalization of A\u03b21\u201342 via N-terminal pyroglutamation are critical for seeding A\u03b2 pathology in AD, whereas A\u03b21\u201340 was shown to be associated with mature amyloid fibril formation . FurtherSWE. Further, in mice, similar to plaques, predominant A\u03b21\u201340 deposition in CAA was found to increase with age. This suggests that CAA maturation is characterized by increased A\u03b21\u201340 deposition.This notion is further supported by our observations for cerebrovascular amyloid pathology. Here, a strong localization of A\u03b21\u201340 peptide along with dominating q-FTAA binding was demonstrated for CAA in s-AD as well as in tgAPPSWE mice . All cases were obtained through the brain donation program of the Queen Square Brain Bank for Neurological Disorders, Department of Movement Disorders, UCL Institute of Neurology. The standard diagnostic criteria were used for the neuropathological diagnosis of AD . All studies abide by the Declaration of Helsinki principles.Fresh brain tissue samples were obtained from temporal cortex of eight clinically and pathologically diagnosed sporadic AD cases s-AD, AD1\u2013AD8) and four nondemented CU-AP cases (CU-AP1\u2013CU-AP4) (is of AD \u201369. The AD8 and fn = 3) and 18-month-old (n = 5) male transgenic AD mice (tgAPPSwe). Animals were reared ad libitum at an animal facility at Uppsala University under a 12-h/12-h light cycle (Fresh brain tissue samples were obtained from 12-month-old (ht cycle . The anim q-FTAA and 0.77 \u03bcm h-FTAA in PBS) similar to a protocol described previously  that were fixed in 99% ethanol and rehydrated through 10-min dips in 70% ethanol, distilled Hications . In shorA\u2013CFig. S2, ).Hyperspectral imaging of LCO-stained tissue sections was performed using a Leica DM6000 B fluorescence microscope  equipped with a SpectraCube module . Imaging of Congo red\u2013stained tissue sections was performed using a Nikon Eclipse 50i microscope with open, semi-crossed, and crossed polarizers, respectively (m sodium cacodylate buffer (Agar Scientific). Tissue was washed with 0.1 m sodium cacodylate buffer and postfixed with 2% osmium tetroxide (Agar Scientific) in 0.1 m sodium cacodylate buffer at room temperature in the dark for 2 h. Dehydration was done with rising concentrations of ethanol  and later with 100% acetone and embedded in Agar 100 resin (Agar Scientific). Semi-thin tissue sections were obtained with an ultra-microtome (Leica EM UC6), placed onto copper grids , and post-stained with uranyl acetate and Reynolds lead citrate.For EM, tissue samples were prepared by fixation, embedding, and ultra-microtome sectioning. Paraformaldehyde-fixed tissue was incubated at 4 \u00b0C overnight with Karnovsky fixative, containing 2% formaldehyde , and 2% glutaraldehyde  in 0.1 DFig. S2).EM observations were carried out on a GAIA3 FIB-SEM work station using a STEM detector  at 30.0 kV  . A plan-apochromat \u00d720/0.8 (WD = 0.55 mm), \u221e/0.17 objective was used for spectral imaging of amyloid deposits prior to their isolation. Continuous emission was acquired in the range of 405\u2013750 nm . Linear By investigating plaques at different sections for each patient or animal brain sample, we ensured that only truly diffuse or truly cored plaques were excised. This was to prevent classification of a diffuse corona of a cored plaque as a diffuse plaque, as truly diffuse plaques span over several sections. At the same time, this also provided a representative coverage of biological variation within each brain sample, by including plaques from different sections.Annotated plaques were then excised by laser microdissection pressure catapulting. Microdissection was done using a PALM Microbeam LMPC microscope (Zeiss) equipped with a 355-nm pulsed UV laser. The spectrally differentiated A\u03b2 plaque subpopulations and CAAs were collected in Adhesive Cap 500 opaque tubes (Zeiss) and stored at \u221220 \u00b0C prior to extraction.m EDTA was added, and the samples were sonicated for 5 min and incubated for 1 h at 24 \u00b0C. The samples were then neutralized to pH 7 using 0.5 m Tris. A\u03b2 peptides were than purified through immunoprecipitation using A\u03b2-specific antibodies , coupled to magnetic Dynabeads M-280 sheep anti-mouse  as described previously . The high resolution orbitrap spectra were deconvoluted using Mascot Distiller before submission to a database search using the Mascot search engine (both from Matrix Science) as described previously , Glu \u2192 pyro-Glu (N-term E), oxidation (M); instrument: default. For illustration, spectra were processed and searched using PEAKS Studio version 8.5  .For statistical analysis, individual mass spectra were exported as csv files from FlexAnalysis  and imported into Origin . Bin borders were used for area under curve (AUC) peak integration within each bin using an in-house developed R script, as described before . Individeviously . The MS/2O with 0.2% TFA (60 s), and 100% EtOH (15 s) was carried out. Tissue was subjected to formic acid vapor for 20 min. 2,5-Dihydroxyacetophenone was used as matrix compound and applied using a TM Sprayer . A matrix solution of 15 mg/ml 2,5-dihydroxyacetophenone in 70% acetonitrile, 2% acetic acid, 2% TFA was sprayed onto the tissue sections using the following instrumental parameters: nitrogen flow (10 p.s.i.), spray temperature (75 \u00b0C), nozzle height (40 mm), eight passes with offsets and rotations, spray velocity (1000 mm/min), and isocratic flow of 100 \u03bcl/min using 70% acetonitrile as pushing solvent. Following the matrix deposition, the preparations were recrystallized with 5% methanol at 85 \u00b0C for 3 min as described previously . A series of sequential washes of 100% EtOH (60 s), 70% EtOH (30 s), Carnoy's fluid (6:3:1 EtOH/chloroform/acetic acid) (110 s), 100% EtOH (15 s), Heviously .MALDI IMS was performed with 25 \u03bcm spatial resolution on a Bruker UltrafleXtreme instrument equipped with a SmartBeam II Nd:YAG/355-nm laser as described previously . For verJ. H. and W. M. conceived and designed the study. S. S. and D. S. provided the mouse brain samples. T. L. selected and provided the human brain samples. W. M., S. N., P. H., and G. B. performed experiments. W. M., P. W., T. L., L. G., G. B., and J. H. analyzed and interpreted the data. W. M., S. N., P. W., T. L., G. B., S. S., D. S., I. K., D. B., L. G., K. P. R. N., P. H., K. B., H. Z., and J. H. discussed the data. W. M., K. B., H. Z., and J. H. wrote the manuscript. All authors approved the final version of the manuscript."}
+{"text": "Is severe hyperoxemia  associated with mortality among critically ill children?In this cohort study of 23\u2009719 intensive care encounters from 2009 to 2018 at a children\u2019s hospital, 6250 patients had at least 1 measured arterial oxygen tension value. After adjusting for covariates, severe hyperoxemia appeared to be independently associated with in-hospital mortality, and a stepwise increase in the adjusted odds of mortality was observed with more episodes of severe hyperoxemia.Severe hyperoxemia appeared to be associated with mortality in a large, single-center cohort of critically ill children; prospective data are needed to assess causality. o2, termed hyperoxemia, is postulated to have deleterious health outcomes. To date, the association between hyperoxemia during the ongoing management of critical illness and mortality has been incompletely evaluated in children.A high PaTo examine whether severe hyperoxemia events are associated with mortality among patients admitted to a pediatric intensive care unit (PICU).A retrospective cohort study was conducted over a 10-year period ; all 23\u2009719 PICU encounters at a quaternary children\u2019s hospital with a documented arterial blood gas measurement were evaluated.o2 level greater than or equal to 300 mm Hg (40 kPa).Severe hyperoxemia, defined as Pao2 values during hospitalization were dichotomized according to the definition of severe hyperoxemia and assessed for association with in-hospital mortality using logistic regression models incorporating a calibrated measure of multiple organ dysfunction, extracorporeal life support, and the total number of arterial blood gas measurements obtained during an encounter.The highest Pao2 value. Severe hyperoxemia was independently associated with in-hospital mortality . Increasing odds of in-hospital mortality were observed with 1 , 2 , and 3 or more  severely hyperoxemic Pao2 values obtained greater than or equal to 3 hours apart from one another compared with encounters without hyperoxemia. A sensitivity analysis examining the hypothetical outcomes of residual confounding indicated that an unmeasured binary confounder with an aOR of 2 would have to be present in 37% of the encounters with severe hyperoxemia and 0% of the remaining cohort to fail to reject the null hypothesis .Of 23\u2009719 PICU encounters during the inclusion period, 6250 patients  had at least 1 measured PaGreater numbers of severe hyperoxemia events appeared to be associated with increased mortality in this large, diverse cohort of critically ill children, supporting a possible exposure-response association between severe hyperoxemia and outcome in this population. Although further prospective evaluation appears to be warranted, this study\u2019s findings suggest that guidelines for ongoing management of critically ill children should take into consideration the possible detrimental effects of severe hyperoxemia. This cohort study examines whether severe hyperoxemia events are associated with mortality among children admitted to a pediatric intensive care unit. First described at the end of the 20th century, increasing evidence suggests that overuse of oxygen may be associated with harm among both critically ill children and adults.22 In contrast, 2 large observational studies identified an association between presenting hyperoxemia and mortality among diagnostically diverse cohorts of critically ill children.24Critically ill children are frequently exposed to supplemental oxygen for prolonged periods and are at theoretic risk of hyperoxemia-related injury and resulting poor outcomes; however, studies of hyperoxemia in critically ill pediatric patients have produced conflicting results. Several smaller studies examining arterial oxygen tension early following cardiac arrest, each including fewer than 250 children, did not find an association between hyperoxemia and mortality.It remains unclear whether a causal relationship exists between hyperoxemia and outcome or whether an unidentified confounder mediates these findings, such as an association between hyperoxemia and aggressive resuscitation with high concentrations of supplemental oxygen among severely ill patients. In the present study, our objective was to examine whether severe hyperoxemia during hospitalization among patients admitted to a pediatric intensive care unit (PICU) was associated with mortality. To build on previous studies, we sought to determine the possibility of whether an exposure-response association existed between severe hyperoxemia and mortality in a large, acuity-adjusted series of PICU patients. We hypothesized that severe hyperoxemia would be independently associated with mortality and that an increasing number of severe hyperoxemia events would be associated with increasing risk of death.2 during hospitalization were identified and included in the analysis of hyperoxemia. This study followed the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) reporting guideline.25 Prior to data collection, all aspects of this study were approved by the University of Pittsburgh Institutional Review Board with a waiver of informed consent, owing to deidentified data following collection.We performed a retrospective cohort study from a quaternary care PICU in western Pennsylvania. The study institution is a level I trauma center and serves a catchment area of approximately 5 million people. A dedicated neonatal intensive care unit provides care for infants less than 44 weeks\u2019 corrected gestational age at the time of admission, and patients with congenital heart disease are cared for in a separate, dedicated cardiac intensive care unit; these groups were not included in the present study. We evaluated all encounters in children admitted to the PICU between January 1, 2009, to December 31, 2018. Each hospitalization was treated as a separate encounter. An illness severity measurement was constructed using data from all PICU encounters. Encounters with a measured PaOo2 values. In addition, we collected clinical data  and laboratory data elements  required for risk adjustment scoring. Because patients receiving extracorporeal life support (ECLS) may have a high Pao2 level resulting from a venoarterial circuit, use of ECLS was abstracted for all patients. All data points were time stamped.For each encounter, the following data were abstracted from an electronic, clinical data warehouse using the business intelligence platform SAP BusinessObjects: demographic data (age and sex), hospitalization data (time of admission and discharge), outcome data , and Pao2 at any time during PICU hospitalization for each encounter were used in the analyses. On the basis of previously published literature,26 we selected 300 mm Hg (40 kPa) as the arterial oxygen tension defining severe hyperoxemia. Duration of exposure to severe hyperoxemia was modeled by identifying encounters with at least 3 Pao2 values, each recorded at least 3 hours apart, and grouping these encounters into 4 categories based on the number of severely hyperoxemic Pao2 values .The outcome of interest was in-hospital mortality. Maximum values of Pao2 to fraction of inspired oxygen (Pao2/Fio2) values from the m-PELOD-2 calculation for the present analyses.28 The m-PELOD-2 scores range from 0 to 31, with 0 indicating no organ dysfunction and 31 indicating the greatest amount of organ dysfunction as quantified by the score. For risk assessment, m-PELOD-2 scores were derived using data obtained throughout the entire hospitalization. Calibration of the m-PELOD-2 instrument was performed by randomly selecting 75% of all PICU encounters as a development cohort and assessing performance of the resulting model output among the remaining 25% of all PICU encounters.To account for patient illness severity, we constructed a modified version of the Pediatric Logistic Organ Dysfunction-2 (m-PELOD-2) score using structured data harbored by the electronic health record, per previously published methods, excluding the ratio of PaP\u2009<\u2009.05. The 95% CIs of the C statistics were calculated per the method of Delong using the pROC package, version 1.13.0, in R . Calibration was assessed using the GiViTi package, version 1.3, in R to construct calibration belts and the ResourceSelection package, version 0.3-4, in R to perform the Hosmer-Lemeshow goodness-of-fit test based on deciles of observed to predicted mortality. Acceptable calibration was defined a priori as a P\u2009>\u2009.05 using either approach.Data were summarized with descriptive statistics, using mean (SD) for parametric data and median (interquartile range [IQR]) for nonparametric data. We assessed predictive validity of the m-PELOD-2 by examining the C statistic as a measure of discrimination and calibration by inspection of observed vs predicted mortality calibration belts and use of the Hosmer-Lemeshow goodness-of-fit test, defining inadequate fit a priori as o2 increments. Univariable logistic regression models assessed patient age, m-PELOD-2 score, use of ECLS, the number of Pao2 values obtained during the encounter, and severe hyperoxemia with in-hospital mortality as the outcome. A multivariable model was constructed incorporating variables with a univariable P\u2009<\u2009.10. Differences in time intervals between admission time and multiple Pao2 values were compared using the Wilcoxon rank sum test and the Kruskal-Wallis test. We conducted a sensitivity analysis to assess for residual confounding in the multivariable model by examining the hypothetical influence of an unmeasured, binary confounder of hyperoxemia on mortality using the obsSens package, version 1.0, in R. The unmeasured confounder was modeled with effect sizes of adjusted odds ratios (aORs) of 2, 3, 4, and 5. The threshold for statistical significance in all analyses was an \u03b1 level of .05, with 2-tailed P values determined. Results are reported as odds ratios (ORs) and aORs with 95% CIs. Analyses were conducted using R, version 3.5.1 .Proportions of observed and predicted mortality were examined in strata of 50\u2013mm Hg (6.7 kPa) Pao2, including only the last available encounter for each child. For the second analysis, we included all encounters and constructed a generalized estimating equations logistic regression model, clustering by patient identifier, to account for correlation between recurrent encounters by the same patient.We performed several post hoc analyses to further evaluate the association between hyperoxemia and mortality identified in our initial analyses. To evaluate whether multiple encounters of the same patient may have confounded the results, we performed 2 sensitivity analyses. First, we again conducted the main analysis constructing logistic regression models with each encounter\u2019s maximum Pao2 level for each encounter and identified cut points using the Youden method, misclassification cost term, maximized specificity, and maximized sensitivity and specificity. Sensitivity, specificity, positive and negative predictive value, and positive and negative likelihood ratios were identified at each cut point. Univariable and multivariable logistic regression models examined maximum Pao2 levels in bins of no hyperoxemia (<300 mm Hg [40 kPa]), severe hyperoxemia (300-499 mm Hg [40- 66.5 kPa]), and extreme hyperoxemia (\u2265500 mm Hg [66.5 kPa]). To better account for nonparametric predictors, a multivariate adaptive regression splines (MARS) model was constructed using all covariates from the primary analysis.29 The MARS model provides added flexibility compared with linear models, such as logistic regression, by incorporating nonlinear relationships of the included variables. We performed 10-fold cross-validation to identify the optimal combination of interaction effects and terms and ranked the terms in order of importance on the basis of reduction of generalized cross-validation estimates. This analysis was performed using the earth, version 5.1.1; caret, version 6.0-8.1; and vip, version 0.1.2; packages of R software. The area under the receiver operating curve (AUROC) of the MARS model was compared with the logistic regression model of the primary analysis using the method of DeLong and the pROC package, version 1.15.0.To further evaluate thresholds of hyperoxemia associated with mortality, we constructed a receiver operator curve (ROC) using maximum Pao2 over the initial 3 days following arterial line placement and calculated an AUC using trapezoidal integration. We additionally explored whether paired oxygen saturation as measured by pulse oximetry (Spo2) and Fio2 values between Pao2 measurements could serve as a reliable surrogate of arterial oxygen tension. This testing was accomplished by examining distributions of Pao2 measurements obtained within 20 minutes of a documented Spo2 value of 100% and a Fio2 value. A MARS model was constructed that incorporated the AUC as a continuous variable, adjusting for patient age, m-PELOD-2 score, use of ECLS, and the number of Pao2 values obtained during the encounter.To further evaluate a gradient-response association between severe hyperoxemia and mortality, we additionally modeled arterial oxygen tension as an area under the curve (AUC). We selected the subset of patients for whom there were at least 3 daily measurements of Pao2 values measured in 6250 encounters. Among patients with a Pao2 value available, 13 422 were male (56.6%), the mean (SD) age was 7.5 (6.6) years, and 405 children (6.5%) died during hospitalization. In-hospital mortality among patients without a measured Pao2 value was 0.49%. Demographic data for included encounters are provided in There were 23\u2009719 PICU encounters in the 10-year study period; 491 children (2.1%) died during hospitalization. There were 174\u2009160 PaP\u2009<\u2009.001). After recalibration, the AUROC was 0.94  and the goodness-of-fit test indicated acceptable calibration by the calibration belt (P\u2009=\u2009.71) and the Hosmer-Lemeshow goodness-of-fit test (P\u2009=\u2009.63) in the test cohort (n\u2009=\u20095939)  bin, as well as in all bins 300 mm Hg (40 kPa) or more (The m-PELOD-2 AUROC in the development cohort (n\u2009=\u200917\u2009816) was 0.93  and did not demonstrate acceptable calibration through assessment of the calibration belt and the Hosmer-Lemeshow goodness-of-fit test (both P\u2009<\u2009.001), as was the m-PELOD-2 score . The results of a sensitivity analysis assessing possible residual confounding indicated that an unmeasured, binary variable would have to be present in 37% of the encounters with severe hyperoxemia and 0% of the remaining cohort to fail to reject the null hypothesis   did not have documented severe hyperoxemia. There were 816 encounters (23.6%) with 1 severely hyperoxemic Pao2 value, 236 encounters (6.8%) with 2, and 201 encounters (5.8%) with 3 or more. In-hospital mortality was 127 of 2211 deaths (5.7%) among encounters without any severely hyperoxemic Pao2 values, 102 of 816 deaths (12.5%) among encounters with 1 severely hyperoxemic Pao2 value, 53 of 236 deaths (22.5%) among encounters with 2 severely hyperoxemic Pao2 values, and 75 of 201 deaths (37.3%) among encounters with 3 or more severely hyperoxemic Pao2 values (eTable 5 in the P\u2009=\u2009.03), 2 , or 3 or more  severely hyperoxemic Pao2 values in patients were independently associated with in-hospital mortality compared with patients without documented severe hyperoxemia, after adjusting for illness severity, ECLS, and the number of Pao2 values obtained during hospitalization  or 3 or more  severely hyperoxemic Pao2 measurements were significantly different (P\u2009=\u2009.04). In patients with 3 severely hyperoxemic Pao2 values, the median duration between the first and second severely hyperoxemic Pao2 values  and second and third severely hyperoxemic gas values  were similar (P\u2009=\u2009.30).Comparing groups of patients with 1, 2, or 3 severely hyperoxemic Pao2 value as a predictor of mortality demonstrated an AUROC value of 0.71 and a Youden cut point of 302 mm Hg (40.2 kPa)  . Plots demonstrating the splines for each independent variable in the MARS model are presented in eFigure 2 in the P\u2009=\u2009.05).Analyses accounting for multiple encounters in the same patient during the inclusion period using only the last available patient encounter (n\u2009=\u20094432) demonstrated results consistent with those of the primary analysis  died during hospitalization. The median AUC of PaO2 values over 3 days was 8300 mm Hg . The AUC was higher in patients with in-hospital mortality compared with those without in-hospital mortality . Plots derived from the nonparametric MARS model incorporating AUC as a continuous variable with the covariates m-PELOD-2 score, use of ECLS, number of Pao2 values, and age demonstrated an association between in-hospital mortality and rising AUC above a threshold of approximately 8355 mm Hg (1113 kPa) over the initial 3 days of arterial line placement  or higher, was independently associated with in-hospital mortality after controlling for a calibrated measure of illness severity, the use of ECLS, and the total number of obtained Pao2 measurements. In addition, an exposure-response association was observed, with increasing odds of mortality evident with 1, 2, and 3 or more severely hyperoxemic Pao2 values. A sensitivity analysis indicates that these results are robust, as an unmeasured, binary confounder with an effect size of an aOR of 2 would need to be present in more than one-third of encounters with severe hyperoxemia, and not present in any of the nonhyperoxemic encounters, for severe hyperoxemia not to be associated with mortality. Findings from our post hoc analyses are consistent with our initial results.In this large cohort study examining encounters in a quaternary PICU over 10 years, severe hyperoxemia, defined as a Pao2 levels.17 In a prospective study of 280 adults, early hyperoxemia was associated with poor neurologic outcomes.14 Another study of 6326 adults following cardiac arrest identified an independent association between hyperoxemia and mortality.12 Similar studies of pediatric patients have not consistently demonstrated comparable findings, although these have been limited by smaller sample sizes. In one of the largest studies of children after cardiac arrest that included 1875 patients, a first-measured Pao2 value of 300 mm Hg (40 kPa) or higher following ICU admission was independently associated with mortality.26 In addition, 2 observational studies report associations between admission hyperoxemia and mortality among diagnostically diverse, critically ill children.24 Raman et al24 identified a U-shaped association between admission Pao2 values and mortality among 7410 children admitted to a PICU, after adjusting for age, sex, and an m-PELOD 2 score that excluded Pao2/Fio2 ratio measurements to control for illness severity. Risk of mortality was observed to rise below a Pao2 level of 188 mm Hg (25.1 kPa) and above 300 mm Hg (40 kPa). Numa et al23 observed among 1447 PICU patients that an admission Pao2 value greater than 250 mm Hg (33.3 kPa) was associated with 2.66 increased odds of death after adjusting for illness severity using the Pediatric Index of Mortality-3.Our finding of an association between severe hyperoxemia and poor outcome fits into a large body of adult data suggesting a detrimental outcome of high Pao2 level and in-hospital mortality identified in our own and other observational studies may reflect confounding by indication. Higher concentrations of supplemental oxygen are commonly administered during resuscitation, with the sickest patients often receiving an Fio2 of 1.0, via either a nonrebreather facemask or positive pressure ventilation. Severity of illness measurements, such as versions of the Pediatric Index of Mortality or the Pediatric Risk of Mortality score, are conventionally used to control for acuity of the patient\u2019s condition when examining whether a factor such as hyperoxemia is independently associated with an outcome such as mortality. However, these common severity-of-illness measurements have been developed using multicenter data and typically require recalibration to uniformly control for illness severity when applied to single institution data.31 In addition, the Pediatric Index of Mortality and Pediatric Risk of Mortality score include only data surrounding PICU admission and therefore do not adequately control for increasing illness severity later during a hospitalization. We calibrated a modified version of the PELOD-2 to our institutional data to generate a predicted mortality risk representative of population-level outcomes at our institution across the full spectrum of illness severity. The m-PELOD-2 incorporated data from the patient\u2019s entire hospitalization, in contrast to admission illness severity measurements, which only incorporate data from a narrower time window surrounding admission.33The association between Pao2 values, these measures were most commonly separated by several hours. Periods of prolonged hyperoxemia may have an aggravated proinflammatory response34 and lead to depletion of endogenous free-radical scavenger systems.35 The study by van Zellem et al21 of children receiving mild therapeutic hypothermia following cardiac arrest suggested a possible benefit of cumulative oxygen exposure during the first 24 hours of admission, in which oxygen exposure was measured by an estimated AUC based on Pao2 values using the trapezoid method. In that study, the median AUC for the first 24 hours was 3264.8 mm Hg (136 mm Hg per hour) in survivors vs 3119.9 mm Hg (130 mm Hg per hour) in nonsurvivors, which was not a statistically significant difference. A high AUC could be observed in patients without any Pao2 values above 200 mm Hg (26.7 kPa), and results were only nominally significant in multivariable analysis without accounting for multiple testing.The observation of a possible biological gradient or dose-response with increasing severe hyperoxemic events in the present study is consistent with the biological mechanisms postulated to underlie the harm conferred by hyperoxemia. For patients with multiple hyperoxemic Paio2 level of 1.0, then weaning when able to target an oxyhemoglobin saturation of 94% to 99%.36 Similarly, the European Resuscitation Council recommends maintaining oxyhemoglobin saturations in the range of 94% to 98%.37 Recognition of possible harm caused by hyperoxemia in newborns40 prompted changes to resuscitation guidelines,42 although a prospective, randomized clinical trial of lower vs higher target oxygen saturations in neonates demonstrated an increased risk of mortality in the target oxygenation range of 85% to 89% compared with 91% to 95%.43Although true causal inference will require rigorous, prospective evaluation of hyperoxemia as it relates to mortality, the existing evidence, coupled with the biological plausibility of the deleterious effects of hyperoxemia, continues to warrant consideration in the design of guidelines for both resuscitation and ongoing support of critically ill children. The 2015 update of the American Heart Association guidelines for pediatric advanced life support recommend starting resuscitation with an Fo2 and Fio2 as study targets.44 In contrast, Spo2 was not a reliable surrogate of Pao2 in our study.Our sensitivity analyses indicate that a beneficial association with hyperoxemia could have been masked by an unmeasured confounder with an aOR of 5 that was present in approximately 40% of encounters with hyperoxemia and 0% of the encounters with normoxemia. Prospective data are needed to determine whether targeting normoxemia and avoiding both hypoxemia and hyperoxemia is the safest approach to provide ongoing life support for critically ill children without cyanotic heart disease, or exceptional disease states, such as cyanide poisoning or high concentrations of carboxyhemoglobinemia, One pilot, multicenter, randomized trial examined conservative vs liberal oxygenation management among critically ill children and demonstrated the feasibility of a prospective study using Spo2 values, we did not assess for an association between hypoxemia and mortality, and a lower acceptable threshold of Pao2 cannot be identified in the present analysis. The timing and frequency of Pao2 values were determined by the treating clinical team, with sicker patients and patients with longer hospitalizations likely contributing to sampling bias. We attempted to control for this possible bias by including the total number of Pao2 values obtained per encounter in our regression models. Furthermore, it is unclear in the present study whether the median times of more than 4 hours between the first, second, and third hyperoxemic Pao2 value measurements signify periods of protracted exposure to hyperoxia or shorter discrete events. Sensitivity analyses of unmeasured confounding modeled the theoretic effect of a single dichotomous variable; however, in the dynamic context of disease and patient care, confounding may occur as an aggregate of transient exposures. We did not distinguish different categories of disease in the present cohort and therefore may have missed a beneficial effect of hyperoxemia in certain disease states, such as traumatic brain injury.45 Although our sensitivity analysis appears to indicate that the present results are robust, residual confounding remains possible and would be optimally addressed with a prospective, randomized trial design.This study is limited by its retrospective observational design. Because we only included maximum Pao2 values during hospitalization appear to be associated with increased odds of in-hospital mortality. These findings, while in need of prospective validation, seem to support an association between severe hyperoxemia and poor outcomes among critically ill children and adolescents. Future guidelines for the ongoing support of critically ill children may account for the possible deleterious effects of supratherapeutic oxygen levels in this population.Data derived from a large cohort of patients admitted to a PICU suggest that severe hyperoxemia was independently associated with in-hospital mortality. In addition, a greater number of measured severe hyperoxemic Pa"}
+{"text": "Pain, especially chronic pain, can lead to cognitive deficits. Mismatch negativity (MMN) is a change-specific component of the auditory event-related brain potential (ERP) that is thought to provide a unique window into sensory memory processes. The present study was designed to determine how chronic and acute pain affects auditory sensory memory. In experiment 1, MMNs elicited by standard and deviant auditory stimuli at short and long inter-stimulus intervals (ISIs) were compared between trigeminal neuralgia (TN) patients and demographically matched healthy controls (HCs). The TN patients were found to have stronger attenuation of the MMN at longer ISIs than HCs. Correlation analysis revealed a significant positive correlation between the sensory subscale of McGill Pain Questionnaire and MMN amplitude reduction across ISI conditions. In experiment 2, MMNs recorded before, during, and after the cold pressor test were compared in healthy subjects. MMN amplitude was significantly reduced during pain exposure and recovered immediately thereafter. These results suggest that both chronic pain and acute pain can interfere with automatic change detection processes in the brain. This study provides the first evidence that chronic pain patients have a faster auditory memory trace decay than HCs. When pain is chronic, it can produce sequela beyond the sensation of pain itself5. Indeed, substantial evidence indicates that chronic pain is associated with a general decline in cognitive functions, including attention, memory, and executive function7.Pain is a subjective experience that involves interactions among sensory, affective, and cognitive factors5. According to this theory, competition between pain and cognition for processing resources may impair cognitive abilities in chronic pain patients. In a functional magnetic resonance imaging (fMRI) study of attention-related cerebral responses, Martinsen et al. found that, relative to healthy controls (HCs), chronic pain patients had reduced activation in brain regions implicated in cognitive processing8. In another fMRI study, Aizawa et al. found that patients with irritable bowel syndrome had cognitive flexibility impairments that were associated with altered activity in the dorsolateral prefrontal cortex and hippocampus9.The division of resources theory holds that pain-related cognitive impairment may be a consequence of limited resources being consumed by pain processing and management13. Experimentally, the MMN is elicited reliably by a detectable auditory change or regularity violation in a sequence of frequent standardized stimuli14. It is thought to arise from an automatic comparison between ongoing sensory input and the memory trace of the previous stimulus, and thus to reflect some aspect of sensory memory processing15. Two major generator sources of MMN in the brain have been proposed, one bilaterally generated by the auditory cortices  and the other by the frontal cortex 16. The temporal and frontal component has been suggested to reflect pre-perceptual change detection and involuntary attention switch to auditory change respectively18.Electroencephalography (EEG) studies of pain effects on event-related potentials (ERPs) have also provided evidence of pain-associated cognitive impairment. The mismatch negativity (MMN) has been demonstrated to be affected by ongoing painet al. provided the first evidence that the MMN was affected by pain when they demonstrated that MMN amplitude was increased in pain patients following analgesic treatment12. Conversely, the same group did not find evidence of the MMN being affected by experimentally induced ischemic pain11. In a recent study, Yao et al. reported unchanged MMN amplitudes but delayed MMN latency in low back pain and neck pain patients13. Most recently, Choi et al. showed that the amplitude of MMN\u2019s magnetoencephalographic equivalent was smaller in patients with fibromyalgia than in healthy subjects10.Dick et al.\u2019s 2006 study. The aim of the present study was to examine how both chronic and acute pain affect auditory sensory memory. MMNs elicited by auditory stimuli at short and long ISIs were compared between chronic pain patients and HCs. We hypothesized that MMN attenuation in long ISI trials would be stronger in chronic pain patients than in HCs. In addition, MMNs recorded before, during, and after acute pain in the cold pressor test (CPT) were compared in healthy subjects. We predicted that the MMN amplitude would be reduced by acute cold pain and would recover after the pain subsided.To date, the effect of chronic pain on sensory memory, as reflected by the MNN response to ISI lengthening, has not been examined and the effect of experimentally induced pain on MMN has not been reexamined since Dick A total of 71 individuals participated in this study, which consisted of experiments 1 and 2. Experiment 1 was designed to investigate the effects of chronic pain on the maintenance of the sensory memory trace, indexed by the MMN. It had a between-subject design with a group of 26 chronic pain patients suffering from trigeminal neuralgia (TN) and a group of 25 age and gender matched HCs. Experiment 2 was designed to examine the modulation of MMN by experimentally induced acute pain. It employed a within-subject design with a group of 20 healthy, undergraduate and graduate students who underwent the cold pressor test (CPT).19; (b) persistent chronic pain for at least 6 months; and (c) normal hearing and normal or corrected to normal vision. Patients were excluded if they had: (a) other types of acute or chronic pain; (b) a history of any other medical, neurological, or psychiatric disorder; or (c) current alcohol or substance abuse problems. All TN patients suffered from unilateral (13 left and 13 right) facial pain. The mean duration of pain history was 5.48\u2009\u00b1\u20095.59 years. The experiments were performed on the day before neurosurgical interventions . During the experiment, pain was controlled with carbamazepine. Based on the present pain intensity scale of the McGill Pain Questionnaire (MPQ), all patients rated their current pain less than 3 .The TN patients were recruited from the Department of Neurosurgery, Chinese PLA General Hospital of Jinan Military Command, which receives TN patients from all over the country for microvascular decompression surgery. TN diagnosis was confirmed by a neurosurgeon (author F. Y.) based on inquiry, physical examination, and magnetic resonance imaging. Inclusion criteria for the TN patients were: (a) idiopathic TN, as defined by the International Headache SocietyThe HCs in Experiment 1 were recruited through local advertisement posted in the local community. The HC group were demographically matched to the TN group. The exclusion criteria applied to the TN group were also applied to the HC group. Two patients who refused to undergo EEG were excluded from the study. Another 4 TN patients and 3 HC subjects were excluded because they could not understand the instructions. Additionally, 3 TN patients and 4 HCs were excluded from the analyses due to excessive EEG artifacts. The demographic information of the Experiment 1 participants is summarized in Table\u00a020. Two participants could not endure the cold pressor pain and quit the study, and another 2 were excluded due to excessive EEG artifacts. Thus, the final sample size in Experiment 2 was 16 .The participants in Experiment 2  were recruited through advertisements posted on local college campuses. The exclusion criteria were: (a) a history of cardiovascular disease, (b) a history of fainting or seizures, (c) a history of Reynaud\u2019s syndrome, or (d) a recent injury or open cut affecting the handAll study participants gave their written informed consent after they had received a detailed explanation of the experimental protocol. They were informed that they could terminate the experiment at any time. The study was performed in accordance with relevant guidelines and regulations. Ethical approval was granted by the Institutional Review Board of the Institute of Psychology, Chinese Academy of Sciences.Questionnaires were used to collect information on demographics, medical history, and emotional status. All participants were asked to fill out Chinese versions of the Fear of Pain Questionnaire (FPQ), the 20-item Pain Anxiety Symptoms Scale (PASS-20), and the 21-item Depression Anxiety and Stress Scale (DASS-21). TN patients also completed the short form (SF)-MPQ, to provide a quantitative evaluation of the sensory and affective aspects of their pain. If the participant could not read, the experimenter read the scales to them, and the participant reported their answers verbally.21. This scale has a good reported internal consistency, with Cronbach\u2019s \u03b1 of 0.93. The Chinese FPQ (edition III) used in the experiment was translated and validated by a research group at Southwest University, Chongqing, China22.The FPQ is a 30-item survey that has been widely used as a self-reported measure of pain-related fear in (chronic) pain syndromes as well as in non-clinical samples. For each painful situation described on the FPQ, respondents rate how fearful they are on a scale from 1  to 5 (extreme)23. All items are rated on a frequency scale from 0 (never) to 5 . The PASS-20, a short form version of the original 40-item PASS, has been demonstrated to have good internal consistency (mean \u03b1\u2009=\u20090.81) and to correlate strongly (mean r\u2009=\u20090.95) with the original scales23. The four subscales and full scale of the Chinese PASS-20, used in this study, have been shown to have good internal consistency with a Cronbach\u2019s \u03b1 of 0.72\u20130.9224.The PASS-20 consists of four 5-item subscales  and is intended to measure pain-related anxiety and fear responses25. Each of its 21 items are rated on a 4-point (0\u20133) scale of frequency or severity of respondent experiences over the last week. Respondents rated how much each item applied to them . This scale has high reliability, with Henry reporting a Cronbach\u2019s \u03b1 of 0.9326. The Chinese version of DASS-21 has internal consistency indices  of 0.83, 0.80, and 0.82 for its Depression, Anxiety, and Stress subscales, respectively, and 0.92 for the total scale24.The DASS-21 is a self-reported questionnaire that is widely used to assess depression, anxiety, and stress dimensions in clinical and nonclinical groups27. The SF-MPQ provides information on the sensory, affective, and overall intensity of pain with a sensory index, affective index, and pain rating index, respectively. It includes the present pain intensity index of the standard MPQ and a visual analogue scale. The sensory and affective dimensions of the SF-MPQ were shown to have good internal consistency , and were translated into a Chinese version and standardized28.Pain intensity was assessed with the SF-MPQ, which consists of 15 pain descriptors (11 sensory and 4 affective) rated on a 4-point scale 29.Auditory stimuli consisted of standard tone (1000\u2009Hz) and occasional deviant tone (2000 Hz). Both were pure sine wave tones with an intensity of 80\u2009dB SPL (sound pressure level) and a duration of 50\u2009ms with 5-ms rise and fall times. Stimuli were presented in two blocks, each having a constant ISI of 500\u2009ms (short) or 2500\u2009ms (long). Each block contained 500 auditory stimuli and the order of blocks (short-ISI and long-ISI) was counterbalanced among participants. The standard and deviant tone occurrence probabilities were fixed at 90% and 10% for both ISI conditions, resulting in 450 standard and 50 deviant tones in each block. Within each block, stimuli were presented pseudo-randomly with the constraints of at least three standard tones being displayed at the beginning of the block and that deviant tones were separated by at least two standard tonesWinged Migration) while listening passively to auditory stimuli via earphones. Subjects were instructed to pay attention to the video clips and to ignore the tones. They were told that they would be quizzed on content of the movie. During EEG recordings, participants were asked to refrain from frequent blinking and head movements. Between blocks, they were allowed to take a short break. On average, the task lasted for a total of about 30\u2009min.Participants were seated in a comfortable armchair in a dim, electrically shielded room. The stimuli were generated by a PC running E-prime software  and were delivered binaurally through earphones. During EEG recordings, participants watched a silent documentary movie  with electrodes positioned according to the extended 10\u201320 system. Signals were referenced online to the common mode sense-driven right leg ground and digitized at 512\u2009Hz with 0.01-Hz high-pass and 100-Hz low-pass filtering. The impedance of each electrode was <5\u2009k\u03a9. Vertical eye movements were monitored with bipolar recordings above and below the left eye. Horizontal eye movements were monitored with electrodes placed at the outer canthus of each eye. Two additional EEG signals were recorded from the bilateral mastoids, M1 and M2, for computing temporal MMN, and another electrode was placed at the tip of the nose for off-line referencing.30 were used for the offline analysis of EEG data. All data were first re-referenced to nose tip and then re-referenced to M1 and M2. They were all band-pass filtered in the range of 1\u201325\u2009Hz. Trial epochs starting 100\u2009ms before and ending 400\u2009ms after the onset of auditory stimulus were extracted and then baseline corrected. Artifacts related to eye movements and cardiac responses were removed by independent component analysis31. Trials with EEG amplitudes larger than 100 \u03bcV were excluded from further analysis. At least 70% artifact-free standard and deviant trials were preserved for each ISI condition (short and long). The remaining trial epochs were averaged separately to compute standard and deviant ERPs under each experimental condition.MATLAB  and EEGLAB toolbox32. Based on visual inspection of the difference waveforms, as well as previous studies34, the MMN component was measured as the mean amplitude of the difference wave within the 150\u2013200\u2009ms post-stimulus time window. The MMN was recognized as a characteristic negative deflection over the frontal and central scalp sites and as positive wave over the posterior temporal regions36, and was thus analyzed within frontocentral  and temporal  regions of interest (ROIs). For mastoid re-referenced data, the MMN was analyzed only within the frontocentral region. To assess the responses elicited by standard and deviant tones per se, peak amplitude and peak latency of the N1 (50\u2013175\u2009ms) and P2 (120\u2013280\u2009ms) components were measured33.To obtain the MMN, a difference wave was computed by subtracting the individual grand average responses to standard stimuli from those to deviant stimuli for each ISI conditiont-tests and chi-squared analyses where appropriate. The N1 and P2 components elicited by auditory stimuli at Cz were analyzed with three-way group (TN vs. HC)\u2009\u00d7\u2009stimulus type (standard vs. deviant)\u2009\u00d7\u2009ISI (short vs. long) repeated measures (rm) analyses of variance (ANOVA) of peak amplitude and peak latency. For the nose-referenced MMN, three-way group\u2009\u00d7\u2009ISI\u2009\u00d7\u2009hemisphere rmANOVAs were conducted separately at frontocentral sites and temporal sites. To better elucidate the ISI effects, separate two-way group\u2009\u00d7\u2009ISI ANOVAs, split by hemisphere, were performed. Post-hoc pairwise comparisons with Bonferroni corrections were carried out as follow-up analyses of ANOVA revealed significant interactions. The Greenhouse-Geisser correction was applied to control for non-sphericity where appropriate. Corrected probability values are reported. The same analyses were conducted on mastoid-referenced MMN components recorded at frontocentral sites. To examine whether the electrophysiological activities were associated with pain perception, Pearson correlation analyses were performed between MMN amplitude (at each ROI for each ISI condition) and MPQ scores . All statistical analyses were conducted in SPSS version 19.0 . The significance level was set at P\u2009<\u20090.05.Demographics and pain-related neuropsychological assessment results were compared between patient and control groups with Student\u2019s 3) holding ice and water. A thermostat-controlled electric pump was used to propel water flow, while maintaining temperature 4\u2009\u00b1\u20091\u2009\u00b0C. Ice was packed into a mesh pocket submersed in the water to prevent direct contact between the ice and the participant\u2019s skin. A similar tank of warm water (32\u201334\u2009\u00b0C) was used for hand immersion before the CPT task, to reduce inter-subject differences in hand temperature.The CPT was conducted in a custom-made plastic tank  with a 400\u2009ms ISI. Each block contained 500 auditory stimuli (400 standard and 100 deviant), and lasted approximately 4\u2009min.The CPT commenced with each participant placing his or her nondominant hand in the warm water for 4\u2009min (baseline phase), during which auditory stimuli were delivered binaurally through earphones and EEG signals were recorded. Then, the participant transferred the immersed hand from the warm water immediately to the cold water, where it remained immersed for 4\u2009min (maximum tolerance time) or until the participant felt too uncomfortable to continue (immersion phase). Subsequently, the participant\u2019s hand was exposed to the room air (26\u2009\u00b0C) for 4\u2009min (recovery phase).During the immersion and recovery phases, participants reported their perceived pain intensity and unpleasantness on 0\u20139 scales at 15\u2009s, 30\u2009s, 60\u2009s, 120\u2009s, 180\u2009s, 240\u2009s, 300\u2009s, 360\u2009s, 420\u2009s, and 480\u2009s after the beginning of the immersion. Auditory stimuli were delivered and EEG signals were recorded throughout the experiment.EEG recording and data processing were performed as in Experiment 1 except that the ERPs were analyzed with nose-referenced data only. The self-reported pain intensity and unpleasantness ratings were analyzed with one-way rmANOVAs followed by Dunnett\u2019s tests.P\u2009<\u20090.05.Peak amplitudes and peak latencies of auditory stimulus elicited N1 and P2 components recorded at Cz were analyzed with two-way condition \u2009\u00d7\u2009stimulus type (standard vs. deviant) rmANOVAs. The MMN datasets at frontocentral  and at temporal  sites were each subjected to two-way condition\u2009\u00d7\u2009hemisphere rmANOVAs. Condition effects were detected with one-way ANOVAs followed by Dunnett\u2019s tests. Analyses of the correlations between MMN amplitude and self-reported ratings were also conducted. All statistical analyses were conducted in SPSS version 19.0 . The significance level was set at t\u2009=\u20090.83, P\u2009=\u20090.411), gender , and education level . The TN patients exhibited a higher level of pain-related anxiety than HCs, manifested as more anxiety thoughts  and increased avoidance behaviors  when experiencing suffering. No other differences were observed between the two groups.The groups\u2019 demographic characteristics and neuropsychological findings are presented in Table\u00a0F1,33\u2009=\u200933.16, P\u2009<\u20090.001, \u03b7p2\u2009=\u20090.50) and P2 , with larger amplitudes being recorded in the long-ISI condition than in the short-ISI condition. There was also a main effect of stimulus type on N1 amplitude , with N1 being larger with deviant stimuli than with standard stimuli.Grand average ERPs elicited by auditory stimuli with respect to stimulus type (standard vs. deviant), experimental group (TN vs. HC), ISI condition (short vs. long), and electrode site  are shown in Fig.\u00a0F1,33\u2009=\u20096.98, P\u2009=\u20090.013, \u03b7p2\u2009=\u20090.18) and P2  latencies, where the peak latencies in the long-ISI condition were delayed compared to those in the short-ISI condition. There was also a main effect of stimulus type on P2 latency  and a stimulus type\u2009\u00d7\u2009ISI interaction , with the peak P2 latency in response to standard stimuli being faster than that in response to deviant ones in the short-ISI condition, and no stimulus difference in the long-ISI condition  that constitute the MMN in short- and long-ISI conditions are presented in Fig.\u00a0F1,33\u2009=\u20095.43, P\u2009=\u20090.026, \u03b7p2\u2009=\u20090.14), as well as a main effect of hemisphere, with higher MMN amplitudes being recorded from the right hemisphere  than from the left hemisphere  . No ISI effects on frontocentral MMNs were found. Group\u2009\u00d7\u2009ISI two-way ANOVAs for each hemisphere revealed main effects of group on the MMN at medial sites   and at right hemisphere sites , but not at left hemisphere sites.There was a main effect of group (nose reference) on mean MMN amplitude Fig.\u00a0 at frontF1,33\u2009=\u20098.59, P\u2009=\u20090.006, \u03b7p2\u2009=\u20090.21) and hemisphere  on MMN amplitude. Unlike the nose-referenced data, there was a significant effect of ISI on MMN amplitude  and a significant group\u2009\u00d7\u2009ISI interaction . Subsequent post-hoc analysis indicated that the TN patients had a smaller MMN than the HC group in the long-ISI (P\u2009<\u20090.001), but not the short-ISI (P\u2009=\u20090.643), condition. Within-group contrasts showed a marked reduction in MMN amplitude for TN patients from the short to the long ISI (P\u2009<\u20090.001), whereas the MMN amplitude remained relatively stable across ISIs in the HC group (P\u2009=\u20090.258).Similarly, three-way ANOVAs of the mastoid-referenced data Fig.\u00a0 revealedF1,33\u2009=\u20098.80, P\u2009=\u20090.006, \u03b7p2\u2009=\u20090.21), indicating that temporal MMN amplitude decreased with ISI prolongation. This decrease was more pronounced in the TN patient group than in the HC group, yielding an ISI\u2009\u00d7\u2009group interaction  , whereas MMN amplitude did not differ significantly between the two ISI conditions in the HC group (P\u2009=\u20090.634). In addition, the post-hoc comparisons showed a marginally significant difference between TN vs. HC for the short ISI (P\u2009=\u20090.053). No other significant differences were found.A three-way group\u2009\u00d7\u2009ISI\u2009\u00d7\u2009hemisphere ANOVA at temporal sites (left and right mastoids) revealed a main effect of ISI (14) Fig.\u00a0. A Bonfer\u2009=\u20090.6523, P\u2009=\u20090.0062)   and pain unpleasantness . Post-hoc analysis indicated that the perceived pain intensity and unpleasantness ratings at time points in the range of 15\u2013300\u2009s were significantly higher than those at 480\u2009s  .Changes in perceived pain intensity and unpleasantness ratings over time during  and after ice-water immersion  are illustrated in Fig.\u00a01,15\u2009=\u200915.27, P\u2009=\u20090.001, \u03b7p2\u2009=\u20090.51) and P2 amplitude , with both being larger in deviant trials than in standard trials. There was a main effect of phase   on N1 peak latency and a main effect of stimulus type on P2 peak latency . No other effects were found.ERPs generated in response to standard and deviant auditory stimuli were compared during the baseline, immersion, and recovery phases. Grand average waveforms recorded at Cz, Fz, and M2 are shown in Fig.\u00a0MMN waveforms corresponding to recordings made before (baseline), during (immersion), and after (recovery) the CPT at Fz and M2 are shown in Fig.\u00a02,30\u2009=\u20094.05, P\u2009=\u20090.031, \u03b7p2\u2009=\u20090.21). Post-hoc tests revealed that the MMN amplitude was reduced during ice-water immersion compared to that during the baseline (P\u2009=\u20090.038) and recovery phases (P\u2009=\u20090.032). No effect was found for the temporal MMN.Because a phase \u2009\u00d7\u2009hemisphere two-way ANOVA did not detect a significant interaction, data were collapsed across the hemispheres. One-way ANOVAs across the three phases at frontocentral areas and at temporal areas Fig.\u00a0 revealedChanges in MMN amplitudes in frontocentral areas before, during, and after cold-water immersion for individual subjects are shown in Fig.\u00a0The present study represents a first attempt to determine how pain affects auditory sensory memory in chronic and acute pain paradigms. Experiment 1 showed that TN patients had a smaller frontocentral MMN than the HCs with a right hemisphere dominance. This effect was observed in both nose- and mastoid re-referenced data analysis. When the ISI was increased, temporal MMN amplitudes decreased more rapidly in TN patients than in HCs, consistent with our hypothesis predicting that chronic pain patients would exhibit greater MMN attenuation in response to extending the ISI than HCs. Similar results were obtained in the mastoid-re-referenced data, corroborating the notion that chronic pain patients have impaired auditory sensory memory. Experiment 2 showed that MMN amplitude was reduced by acute cold pain and recovered after the pain was relieved, as we had hypothesized.39. Likewise, a recent auditory evoked magnetic field study conducted in fibromyalgia patients showed that the MMN magnetoencephalographic equivalent has a right-hemisphere dominance lateralization pattern in response to tone stimuli10. This consistent laterality suggests that some MMN generation process is stronger in the right hemisphere than in the left hemisphere. Moreover, there appears to be a predominant right hemisphere frontal process associated with involuntary attention switching in response to an auditory change11.We observed a right hemisphere dominance of the MMN in both TN patients and HCs, consistent with previous studies showing a predominant right hemisphere scalp distribution of the MMNet al.\u2019s findings of an increased MMN amplitude following analgesic treatment in chronic pain patients12. This pattern of findings may indicate a pain-related deficit in the initial encoding of sound stimulus properties. According to Eccleston et al.\u2019s model, chronic pain, which is behaviorally distracting and disruptive, may in fact disrupt cognitive neurophysiological processes at very early processing stages associated with the MMN40. Empirically demonstrated attentional deficits in chronic pain patients, particularly in attention switching and attention interference tasks42, may be due to pain competing with other attention-demanding stimuli for limited cognitive resources43. Thus, chronic pain-induced reduction of the MMN may reflect disruption of pre-attentive processing.It is noteworthy that our TN patients had a smaller frontocentral MMN than the HCs. This effect was observed in both nose- and mastoid re-referenced data analyzed across ISI conditions. These results are in agreement with Dick 44. According to Bartha-Doering et al., the duration and decay of auditory sensory memory can be examined by increasing ISIs, such that a prolongation of the ISI decreases MMN amplitude47. Consistent with this view, the significant main effect of ISI in the present study can be interpreted as a fading of the memory trace and the mastoid data are indicative of a hastened trace decay in chronic pain patients. This decreased MMN with a longer ISI may reflect a specific deficit in auditory sensory information maintenance and an impairment of echoic memory early in the progression of TN. Indeed, pain can slow stimulus information processing and impede working memory function48. Reports of poor memory and concentration among chronic pain patients are well known49.The present data also provided evidence that the lifetime of a memory trace was reduced faster in chronic pain patients than in HCs. Both mastoid re-referenced frontocentral data and nose-re-referenced temporal data indicated that MMN amplitude decreased as a function of ISI in TN patients but not HCs. Generally, the MMN is thought to reflect an automatic change detection mechanism that is supported primarily by the perception of an incoming stimulus and the maintenance of its trace in memoryIn the present study, neither chronic pain nor acute induced pain affected temporal MMN, although there was a near-significant increase in the chronic pain condition for the short ISI. This finding may seem inconsistent with the main finding. We speculated that the increased temporal MMN in TN patients might be partially explained by a heightened vigilance  to external stimulation in those suffering from chronic pain. The hypervigilance may result in a general enhancement in processing of sensory perception, including auditory discrimination, reflected as a somewhat larger temporal MMN.51. Following Melzack et al.\u2019s model of sensory, motivational, and cognitive determinants of pain52, the affective-motivational dimension of pain has been brought clearly into focus by clinical pain studies. Psychological factors have been shown to have a selective influence on the affective, versus the sensory, dimension of pain54. Nonetheless, the affective component of pain often covaries with pain intensity, a key feature of the sensory component of pain56. Pain intensity and unpleasantness ratings have often been reported to correlate strongly with each other58; the anterior cingulate cortex and medial thalamic nuclei, implicated in the encoding of the affective dimension of pain61, have also been found to exhibit pain intensity-related activation62.Our finding of a significant correlation between MPQ sensory subscale score and MMN amplitude reduction across ISI conditions (long minus short) further confirmed that the greater the perceived intensity of pain, the faster auditory sensory memories decay. It was the sensory, but not the affective, component of pain that was associated with the sensory memory decay in chronic pain patients. It has been suggested that this MMN reduction results mainly from pain-related emotional disturbances, such as anxiety, distress, or depressionet al., who found that experimentally induced pain did not disrupt generation of the MMN11, we found that MMN amplitude was reduced by cold pressor pain and recovered after the pain was relieved. This inconsistency may be due to the different models used in the two studies, ischemic pain versus cold pressor pain. The former is thought to be caused by accumulation of algesic metabolites, occlusion of blood vessels below the inflated cuff, and mechanical pressure of the cuff, which activates mechano-sensitive nociceptors directly63. This physiological mechanism differs from that of cold-induced pain wherein direct activation of high-threshold thermo-sensitive nociceptors produces pain64. Another possible explanation for the discrepancy between findings is that the present study used an easy-to-detect tone differential (1000\u2009Hz vs. 2000 Hz) while Dick et al.11 used both a difficult-to-detect (1000\u2009Hz vs. 1020\u2009Hz) and an easy-to-detect (1000\u2009Hz vs. 1500\u2009Hz) distinction. According to Sams et al., a greater standard-deviant distinction causes a larger MMN65. Thus, when the MMN is used as an index of cognitive impairment, the stimulus parameters used should be considered to ensure better sensitivity.The present study was the first to demonstrate that experimentally induced acute pain can disrupt the MMN. In contrast to Dick In conclusion, the current study represents a first attempt to determine how pain affects auditory sensory memory in chronic and acute pain conditions. We found that the auditory memory trace decayed faster in chronic pain patients than in HCs, and that experimentally-induced cold pain impaired pre-attentive auditory processing. Thus, we provided evidence that both trait pain and state pain can interfere with automatic change detection processes. Our study indicates that the MMN has the potential to be used as an objective index of clinical pain and therapeutic response. In future studies, it will be important to set up specific MMN recording parameters for different pain disorder etiologies."}
+{"text": "Dementia is a health and care priority globally. Caring for persons with dementia is a challenge and can lead to negative psychological, physiological and financial consequences for informal carers. Advances in technology have the potential to assist persons with dementia and their carers, through assistive technology devices such as electronic medication dispensers, robotic devices trackers and motion detectors. However, little is known about carers\u2019 experience and the impact of these technologies on them. This review aims to investigate the outcomes and experience of carers of persons with dementia, who live at home and use assistive technology.A systematic search in seven databases and manual searches were carried out using pre-defined inclusion and exclusion criteria to identify studies on carers of persons with dementia involving the use of assistive technology. The search identified 56 publications with quantitative, qualitative and mixed-method designs.The studies reported positive and negative findings and focused on a wide variety of assistive technology devices. There were large differences in the uses of assistive technology, outcome measures used and the quality of studies. Knowledge and acceptance, competence to use and ethical issues when using assistive technology were themes that emerged from the studies. Carers generally appreciated using assistive technology and their experience of use varied.The intention of this systematic review is to list and classify the various types of assistive technology used by carers of persons with dementia and explores the positive and negative aspects, knowledge, acceptance and ethical issues in the use of assistive technology by carers of persons with dementia. We recommend the use of a standard and person-centred system of classifying and naming assistive technology devices and systems and for future research efforts in assistive technology to incorporate a family/carer centred model.CRD42017082268.PROSPERO - The online version of this article (10.1186/s12877-019-1169-0) contains supplementary material, which is available to authorized users. Dementia is a complex acquired brain condition characterised by a decline from a previous level of cognitive functioning with impairment in cognitive domains . WorldwiCurrently, AT and Artificial Intelligence driven healthcare solutions are being viewed as a panacea for reducing carer burden , 21 and Identify the types and uses of AT in dementia;Describe the effectiveness of AT for outcomes  of carers of people with dementia living at home;Describe carers\u2019 experiences of AT use in dementia;Determine the aspects of AT that are valued and work well for carers by integrating (2) and (3) as above.This review aims to:The review protocol was registered with the international prospective register of systematic reviews PROSPERO (CRD42017082268). The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) checklist is included as Additional\u00a0file\u00a0Quantitative, qualitative and mixed method study designs were included. Letters to the editor, abstract and conference proceedings, book reviews, study protocols and theses/dissertations were excluded. We did not include other reviews but checked references within identified existing reviews on dementia, informal carers and AT to ensure that all relevant studies had been located. Due to funding constraints, only studies in English language or those translated to English language were included.We included all randomised and controlled trials that compared AT for carers of someone who has dementia to those not provided with the AT, and who received usual care. We also included observational and cohort studies.We included studies that used qualitative methods of data collection and analysis, either as a stand-alone qualitative study or as part of a mixed-method study.Studies that included carers who provide unpaid care for a person living with dementia at home were included. Providing care is defined for the purposes of this study as \u2018supporting a person with dementia physically, emotionally, financially or socially\u2019 and care could be provided by a relative, a friend or a neighbour. There were no restrictions regarding gender, living arrangements or ethnic background. Studies reporting on carers who provide support to a person living with dementia receiving care in hospital and/or long-term institutions and carers younger than 18\u2009years and formal/paid carers were excluded.For this review, studies that evaluate AT use in dementia involving carers were included. AT was defined as \u2018any advanced electronic equipment, which can be used to enhance support and care, act as a prompt for intervention by carers, monitor welfare and assist in communication and leisure activities for a person with dementia\u2019. This AT can be standalone (e.g. Tablet computers) or be part of an integrated system (e.g. GPS and sensor trackers) and can be stationary or mobile. As the focus of most research studies invariably is on the person living with dementia, any study that reported on effects or experiences of AT use on carers were included. Studies that reported only on AT use for people with dementia without including carers were excluded, as were studies that focus only on electronic therapeutic interventions that are not AT (e.g. computer-based education or support for carers).The search was not limited to specific types of outcome measures and included carer self-reported outcome measures of burden; quality of life; and well-being; and self-reported or researcher observed experiences of usefulness; benefits and disadvantages of AT and impact on carer /person living with dementia relationship.The search strategy was developed in collaboration with a Bodleian medical library librarian at the University of Oxford.Searches were carried out on:Including MEDLINE (Ovid) from 1946 to June 2018; EMBASE from 1974 to June 2018; PsycINFO from 1806 to June 2018; AMED 1985 to June 2018; CINAHL from 1981 to June 2018; Database of Abstracts of Reviews of Effects (DARE), OT seeker and The Cochrane Library of Systematic Reviews. The search included studies within ALOIS (from inception to June 2018).The International Standard Randomised Controlled Trials Number (ISRCTN) registry  and the We also conducted manual searches of reference lists to identify relevant research studies.Details of the full search, with search strategies and the number of records identified in each database are included in Additional\u00a0file\u00a0.ris files. Duplicates were removed using the software. Authors VS and MP independently screened all titles and abstracts for eligibility against the inclusion/exclusion criteria. For studies that had insufficient information from the title and abstract, full text articles were retrieved to determine inclusion. Studies marked for possible inclusion underwent a full-text review. At full-text review, when both VS and MP agreed that a study did not meet the full eligibility criteria, the study was excluded. CJ was consulted when VS and MP did not agree on a study. Discrepancies were resolved by mutual discussion.Electronic search results were downloaded into Covidence software   and 1 Controlled Clinical Trial. The publications were from 2000 to 2018, reporting on findings from 2016 carers  and 84 types of AT. Carers\u2019 age ranged from 19 to 91\u2009years, with 13 publications not reporting an age range for participants. Several methods were used for data collection including interviews (32), surveys (14), observations (8), focus groups (7), questionnaires (6), diary/log entries (4) and video recording and email and blog reviews (1 each), with 19 studies using more than one method for data collection. Seven studies \u201342 reporAs this review involved quantitative, qualitative and mixed-method studies, the Mixed Methods Appraisal Tool , 44, 45 As the included studies were a mixture of quantitative, qualitative and mixed-methods studies, we completed a narrative synthesis of the evidence , 93\u201395. We followed the method of Timulak  for qualTo date, there appears to be no agreed way of classifying AT available for use by people with dementia, and we have classified them by their use as part of this review. A list of AT described in the included studies Table\u00a0 was crean\u00a0=\u200938) including tracking devices and home safety devices. Followed by devices used for supporting memory and orientation for the person living with dementia (n\u00a0=\u200923) and for social interaction and leisure activities (n\u00a0=\u200916). In this review, very few studies (n\u00a0=\u20093) considered AT which supported basic Activities of Daily Living activities such as feeding, washing, grooming or dressing. The AT used (including some research prototypes) are adapted from aids/devices that many people, with and without cognitive impairment, already use. None of the AT were for advanced instrumental Activities of Daily Living, such as managing finances, shopping or preparing meals and none of the AT addressed behavioural issues such as aggression or disinhibition, which is quite common in someone who has dementia.The most commonly used AT was for safety and security , many of which were created for a specific study. A list of outcome measures used is presented in Additional file Thematic synthesis from the qualitative data generated 4 themes and 15 sub-themes. Quotations from studies to support themes and sub-themes are listed in Table\u00a0All the studies reported that the experience of cares using AT was generally positive.The use of AT for leisure and social interaction, memory support; orientation; safety and security seemed to help strengthen relationships between the person living with dementia and their carers. The AT was perceived as helping the carer function better in their caregiving role and became a \u2018member\u2019 of the wider social network of the person with dementia. For example, the use of a picture button telephone assisted a person with dementia in longer instances of interaction and maintaining social contacts with neighbours, friends and family.Some of the studies reported carers having to use controlling methods such as locking and restricting access and the AT seemed to offer an alternative solution of enabling the person living with dementia to become independent and participate in meaningful activities. This in turn had a positive effect on the carers. The AT also provided carers with additional personal time which was highly valued and, in many instances, helped create the balance between their own personal space and independence with that of staying connected with the person with dementia.Carers viewed someone who has dementia\u2019s ability to stay in the community and their physical safety as more important than privacy and autonomy. Tracking devices that supported safety were enthusiastically received and AT provided carer reassurance and enhanced independence for both the carer and the person with dementia.Whether the person living with dementia used the AT independently or the carer assisted them, AT was perceived as removing worries and burden and generally improved mental well-being, especially when the carer was living away from the person with dementia.AT was perceived as improving independence for someone who has dementia, this had a positive effect on the carer, with some carers also reporting benefitting from using the AT themselves, such as the simple remote control for TV and memory aids.While the overall experience of AT use was perceived as positive by carers, some important negative aspects were also raised.When AT failed or the person living with dementia was no longer able to use the AT, this invariably caused constraints in the relationship, as an outcome of the presence of the AT. Some carers also perceived that the AT would replace the \u2018person\u2019 component of caring.There were perceptions that the person living with dementia\u2019s declining abilities could be further worsened using AT as they would no longer be actively challenged cognitively. Carers also believed that with the people with dementia who did not have adequate social care could be left alone with the technology without additional support for autonomy or social contact.Carers seemed to be more willing to use AT in the future rather than currently. Elderly carers also worried about their competence and familiarity with AT, especially when there were technical failings with the AT or when the devices required to be replaced with new AT, as the illness progressed.Occasionally, the use of AT seemed to create more dependence of the person with dementia on the carer, which led to increased stress for the carer, and the attitude of the person living with dementia towards the AT (from hostility to indifference) also led to additional carer burden, while choosing and using the AT.Carers weighed the needs of personal reassurance and sense of security with that of autonomy of someone who has dementia while deciding on use of AT. Often there was no perceived ethical dilemma where the safety of the person with dementia was concerned. There was a consensus among carers that people with dementia must be involved as much as possible to select and use AT. Ethical issues around who held the power of choice of usage and discontinuance of AT and whether the needs of the person living with dementia were altered to match the potential of the currently available AT also seem to arise from the studies with no definitive conclusions.Carers continuous engagement and willingness to provide support with the use of AT for the person with dementia was key in the use of AT in most of the studies. The carers\u2019 attitude, commitment and willingness to learn about the AT were vital if the equipment was to be useful and functional.Carers used different methods to convince people with dementia to accept and use AT, especially when the person living with dementia was hostile towards or did not understand the need to use the AT. Carers especially had difficulty convincing someone who has dementia where monitoring and safety devices were to be used compared to using AT for leisure and social interaction.Carers noted that AT was generally expensive, however most of the studies included in this review either provided the technology to the participants or participants did not mind spending the extra costs for AT that could support the person with dementia to stay for longer, in their own home.Many of the carers accepted AT as useful and their adoption depended on the perceived usefulness of the AT. They would also recommend its use to other carers and people with dementia. Carers also saw technological innovations as inevitable and expected the use of AT to increase and future generations of carers would have better skills and motivation to adopt them.There was a general feeling among carers that information regarding AT should be provided early in the process of diagnosis and support available to the person living with dementia, especially as the progress of dementia was unpredictable. The main need of information was on simple and practical AT solutions with most carers unaware of new AT devices and solutions available.The aim of this systematic review is to identify the types and uses of assistive technology in dementia and describe the effectiveness and experience of its use for carers. The studies included cover the last 18\u2009years and give a broad picture of AT use in dementia care. Caregiving for people with dementia in the community is usually unplanned, unpaid work carried out by the relative of the person living with dementia. The role of carer can be rewarding, but it can also be detrimental to a person\u2019s well-being and can put them under a lot of stress , 101, esThe symptoms which have the highest impact on carers of persons with dementia are repetitive questions, apathy, getting lost, aggression and incontinence , 40, 66 This review highlights the continued lack of consistency in describing or classifying AT . Other sThough some research, involving robotic technology in institutional and simulation/lab based settings is looking into this , 109, thIt is also clear from this review that installation of AT at home for use by someone who has dementia was often wrongly seen as a one-off event, rather than an ongoing process for getting the best out of AT. Similar to other findings \u2013114, thiThe review also highlights the perceived fear among some carers that use of AT could lead to social isolation. However available AT solutions such as tablet computers and monitoring devices to alert carers gives them a sense of participating in the life of a person living with dementia even when the carer is not physically present, this led to AT being viewed as a positive addition. There was no evidence within the included studies that multiple AT solutions were being harnessed to bring them together for an integrated solution that could assist both people with dementia and carers. AT devices were used in isolation for specific functions rather than a combined use of the devices. With the rise of internet of things , 116 andInterestingly all the studies considered the introduction of AT after a diagnosis of dementia, the timing of introducing devices may be important. Safety/tracking devices were introduced pre-emptively to prevent secondary problems , 27 suchMany of the installed AT did not meet the needs of the user. Despite a surprising lack of reporting on adverse events, some of the negative reactions to AT were because they were \u2018Off the shelf\u2019 devices and were rarely useful, especially with a progressive condition like dementia. The AT needed to be adapted or customised for the carers and people with dementia\u2019s individual needs and when this was not the case, led to abandonment of the AT , 120. CoThe function assisted domain  as a way of naming the AT is usually defined by the manufacturer/developer of the AT. We recommend a shift towards considering naming the use of the AT from the perspective of the person with dementia and their carer to ensure that device is appropriately used and can provide the intended benefits of that AT  for bothFurther research should be carried out on how multiple AT devices could work together or be combined to better support someone who has dementia and their carers rather than how individual AT devices can support them.Future research should focus on AT solutions which are co-designed by those with lived experience of the challenges of dementia at home and should include carers, who live with and away from a person with dementia.Ability of a carer to \u2018problem solve\u2019 should be a consideration in AT prescription and use. Technology should match the needs of the person requiring the use of the AT, rather than the person being \u2018moulded\u2019 to match what technology is available for them.Due to the variety of AT devices and outcome measures used, we could not pool results from the quantitative studies and have provided a narrative review instead. Due to financial constraints we did not include studies in languages other than English within this review and this could have potentially led to some suitable studies being missed. However, we did scan for reference lists of all studies that were included for full text review and are confident that this review captures all suitable studies that met our inclusion criteria.Technology is advancing at an extremely rapid pace, especially within the fields of artificial intelligence and machine learning with their resultant healthcare applications. It is likely that AT powered by AI may become ubiquitous soon. The quality of research focussing on AT use in dementia continues to be low. AT solutions helps improve carers\u2019 experience of providing care to a person living with dementia. AT would support people with dementia and carers in the community but researchers, healthcare professionals and technology developers should adopt a family centred model for use of AT than pursuing only an individual/person centred model of care.Additional file 1:Search strategy. (DOCX 18 kb)Additional file 2:Data extraction forms. (DOCX 15 kb)Additional file 3:Data from included studies. (DOCX 114 kb)Additional file 4:PRISMA checklist. (DOCX 27 kb)"}
+{"text": "The heterogeneity of symptoms across dementia subtypes has important implications for clinical practice and dementia research. Variation in subtypes and associated symptoms may influence the capability to live well for people with dementia and carers. The aim of this study is to investigate the potential impact of dementia subtypes on the capability to live well for both people with dementia and their carers.The analysis was based on the 1283 dyads of community-dwelling people with dementia and carers in the Improving the experience of Dementia and Enhancing Active Life (IDEAL) project, a large cohort study in Great Britain. Capability to live well was defined using three measures: quality of life, life satisfaction and wellbeing. Structural equation modelling was used to investigate capability to live well in seven dementia subtypes: Alzheimer\u2019s disease (AD), Vascular dementia (VaD), mixed AD/VaD, frontotemporal dementia (FTD), Parkinson\u2019s disease dementia (PDD), Lewy body dementia (LBD) and unspecified/other, accounting for dyadic data structure and adjusting for age and sex, type of relationship between person with dementia and their carer and the number of chronic conditions.The major subtypes in this study population were AD (56%), VaD (11%) and mixed AD/VaD (21%). Compared to participants with AD, people with non-AD subtypes generally reported a lower capability to live well. Carers for people with PDD  \u2013\u20093.24, \u2212\u20090.18) and LBD  also reported a lower capability to live well than carers for people with AD. After adjusting for demographic factors and comorbidity, PDD  and LBD  continued to have the strongest impact on both people with dementia and their carers.This study suggests a variation in capability to live well across dementia subtypes. It is important for care providers to consider different needs across subtypes. Health professionals who provide post-diagnostic support may need to pay more attention to the complex needs of people living with PDD and LBD and their carers.The online version of this article (10.1186/s12916-018-1135-2) contains supplementary material, which is available to authorized users. Dementia is a key priority area in health and social care planning across the world, with an increasing emphasis on timely diagnosis and appropriate support throughout the trajectory of the condition , 2. To sLiving well with chronic illness has been defined as the best achievable state of physical, mental and social health and wellbeing, indexed by a self-perceived level of comfort, function and contentment with life . The conThe heterogeneity of symptoms across dementia subtypes has been a key topic in clinical practice and relevant research , 8. VariThe Improving the experience of Dementia and Enhancing Active Life (IDEAL) project is a longitudinal cohort study of community-dwelling people with dementia and their carers across England, Scotland and Wales. The study was set up to investigate social, psychological and economic factors that support people living well with dementia. The participants were recruited through a network of 29 NHS sites between July 2014 and August 2016. Eligible participants needed to have a clinical diagnosis of dementia and a Mini-Mental State Examination (MMSE) score of 15 or above on entry into the study. Primary carers, who provided practical or emotional unpaid support for people with dementia, were also invited to take part where possible. For those who agreed to take part, researchers visited participants and completed structured interviews to collect data. The study protocol has been published elsewhere [The IDEAL cohort at baseline included 1547 people with dementia and 1283 carers. This analysis focused on the 1283 dyads of person with dementia and their carer.Capability to live well was defined using three individual measures for quality of life, life satisfaction and wellbeing for the person with dementia and the carer. For people with dementia, self-rated life satisfaction was measured by the Satisfaction with Life Scale , which is designed to measure global judgements of satisfaction with life ; wellbeiN\u2009=\u200912), this group was combined with family carers. As poor health status has been related to poor quality of life and wellbeing, the number of chronic conditions was used to indicate the general physical health of people with dementia and was measured using the Charlson Comorbidity Index [The interviews collected information on age, sex, dementia subtypes and the type of relationship between the person with dementia and the carer. Age was divided into five groups: <\u200965, 65\u201369, 70\u201374, 75\u201379 and\u2009\u2265\u200980 for both people with dementia and carers. Dementia diagnoses were obtained from medical records of the participants and classified in seven groups: Alzheimer\u2019s disease (AD), vascular dementia (VaD), mixed AD and VaD, frontotemporal dementia (FTD), Parkinson\u2019s disease dementia (PDD), Lewy body dementia (LBD) and other/unspecified. For those who selected other or an unspecified diagnosis in the interviews, open-ended text descriptions provided by the interviewer were reviewed by two clinicians and re-categorised into the six empirical groups where possible. The type of relationship between the person with dementia and carer was categorised into two groups: spouse/partner and family/friend such as daughters, sons and grandchildren. Due to the small numbers of friends serving as carers . This study was based on the IDEAL baseline data version 2.0. All analyses were conducted using Stata 14.2.Before conducting the dyadic analysis, the associations between subtypes and the three living well measures in people with dementia and carers were investigated using multivariate modelling. Structural equation modelling (SEM) was used to build two latent factors including three living well measures in people with dementia  and carers , and SwLS was fixed at 1 in the latent factors. Covariance of their error terms was estimated to account for the dyadic structure  were estimated to be 3.82  3.52, 4.13) for WHO-5 and 1.21  for QOL-AD. In carers, loading estimates were 3.37  for WHO-5 and 0.41  for the WHOQOL-BREF factor score. The two living well latent factors were correlated, and the estimated covariance was 5.62 .Table\u00a0Based on the adjusted results, Fig.\u00a0Using dyadic analysis methods, this study suggest a potential impact of subtype diagnosis on capability to live well in both people with dementia and carers. People with non-AD subtypes, including VaD, mixed VaD/AD, PDD and LBD, had a lower capability to live well than those with AD. For carers, those caring for people with PDD and LBD reported lower scores on living well measures than carers of people with AD. Further adjustment for comorbidity attenuated differences between AD, VaD and mixed AD/VaD, but PDD and LBD continued to have a particularly strong impact on capability to live well in both people with dementia and carers.The IDEAL study included a large number of community-dwelling people with dementia and their carers across Great Britain. In addition to major subtypes (AD and VaD), people with rare subtypes were also recruited and were represented by at least 40 dyads in this study population. The interviews included multiple measures of living well, including aspects of quality of life, life satisfaction and wellbeing for both people with dementia and their carers. The method of dyadic analysis was used to investigate the association between subtypes and capability to live well in both people with dementia and carers and to take into account correlations within dyads.N\u2009=\u20091547); therefore, this should have a minimal impact on the main findings.To be eligible to take part, participants needed to have a clinical diagnosis of dementia and a MMSE score of 15 or above. People with severe dementia were not included in the study, and the dyadic association between subtypes and capability to live well might be different in this group compared to the current study population focusing on mild to moderate dementia. Given our interest in the dyadic relationship, this analysis mainly focused on participants with carers. Since those without carers might have better health status and functional ability and in some cases might not need a carer, the association between subtypes and capability to live well might be different in this group. Nevertheless, similar results were found in sensitivity analyses including all participants irrespective of carer involvement . Table S1.2. Loadings of six WHOQOL-BREF domains. Figure S1. Histogram of WHOQOL-BREF factor score. Table S2.1. Multivariate modelling of living well measures and subtypes in all people with dementia . Table S2.2. The association between living well and subtypes in people with dementia. (PDF 42 kb)"}
+{"text": "Purpose: Yes-associated protein 1 (YAP1) is overexpressed in head and neck squamous cell carcinoma (HNSCC). However, it is unknown whether verteporfin, a YAP1 inhibitor, can inhibit HNSCC cells as well as the molecular mechanisms involved.Methods: YAP1 expression was investigated by immunohistochemistry in human head and neck carcinoma tissues (n=70). CCK-8 assay, colony formation assay, flow cytometric analysis, wound-healing assay and Transwell migration and invasion assays were used to evaluated the effects of verteporfin on the six HNSCC cell lines (three HPV-positive and three HPV-negative). The transcription and protein expression levels of YAP1 and its associated genes were investigated by real-time PCR and Western blotting, respectively. The effects of verteporfin on HNSCC cells in vivo were assessed by a xenograft model.Results: YAP1 expression was significantly higher in carcinoma tissues than in tumor-adjacent normal tissues (n=10). A CCK-8 assay showed that the inhibitory effects of verteporfin on HNSCC cells were markedly enhanced by light activation. Verteporfin significantly inhibited HNSCC cell proliferation, migration and invasion, induced apoptosis, and arrested the cell cycle at the S/G2 phase. Verteporfin significantly attenuated the expression of genes related to epithelial-mesenchymal transition  and stemness (Oct4 and YAP1) and increased E-cadherin expression in HNSCC cells. Furthermore, verteporfin significantly inhibited PD-L1 expression in HNSCC cells. However, the expression levels of HPV-16 E6 and E7 did not change with VP treatment. The anticancer effect of verteporfin on HNSCC was confirmed by the inhibition of xenograft growth in vivo.Conclusions: Our results indicate that YAP1 overexpression is involved in HNSCC tumorigenesis and verteporfin is a potential therapeutic drug for HNSCC. Head and neck squamous cell carcinoma (HNSCC) is the 6th most common cancer worldwide YAP gene encodes two major isoforms YAP1 and YAP2, which contain one WW domain and two WW domains, respectively.The Hippo pathway is an evolutionarily conserved signaling pathway regulating numerous biological processes, including cell growth, organ size, and tissue homeostasis. This pathway consists primarily of upstream signals, core kinases (MST1/2 and LATS1/2) and downstream effectors, including the transcriptional coactivators Yes-associated protein (YAP) and TAZ, which mainly interact with TEA domain (TEAD) family transcription factors (TFs) to regulate cell proliferation, survival, migration, stemness, epithelial-mesenchymal transition (EMT) and differentiation Dysregulation of the Hippo pathway has been implicated in many human diseases, including cancer The human head and neck carcinoma and normal tissue array, with stage and grade information, were purchased from Outdo Biotech Inc. . This array contained 70 carcinoma tissues and 10 tumor-adjacent normal tissues. The study was approved by the ethics committee of the Southeast University.YAP1 protein expression in human head and neck tissues was detected by using peroxidase-based immunohistochemistry (IHC). In brief, formalin-fixed and paraffin-embedded tissue sections were deparaffinized in xylene and hydrated through descending concentrations of ethanol before being placed in blocking solution to inhibit endogenous peroxidase activity. The slides were incubated with primary antibody  at 4\u00b0C overnight. A horseradish peroxidase-conjugated rabbit secondary antibody  was added for 60 min at room temperature, followed by 3,3\u2032-diaminobenzidine kit  for staining. Sections were scanned with an iSCAN Coreo slide scanner . Positive YAP1 staining was defined as brown granules in the cytoplasm or nuclei. The intensity score was graded as follows: - (negative), + (low), ++ (moderate), and +++ (high). The results were evaluated by two independent pathologists.The sources and characteristics of the HPV-negative HNSCC cell lines SCC-4, CAL-27 and SCC-25 and the HPV 16-positive HNSCC cell lines UM-SCC-47, UPCI-SCC-090, and 93-VU-147T have been described in a previous publication VP  was dissolved in dimethyl sulfoxide  at a concentration of 10 mg/mL and stored at -80\u00b0C. During treatment, the stock solution was diluted to the required concentration using cell culture medium to yield the working solution in the dark.3 cells/well were seeded in 96-well plates, and allowed to attach overnight. Then the medium was replaced with fresh cell culture medium supplemented with various concentrations of VP and incubated in the dark. After 12 h, photoactivation was performed in the light-activated groups with a light  for 20 min, afterwords cells were cultured in a 37\u00b0C incubator. The groups without light activation were constantly maintained in the dark. Each group included six replicates.The effects of VP on the proliferation of cancer cells were assessed using a CCK-8 kit (Beyotime) according to the manufacturer's manual, with or without light activation. Briefly, 2 \u00d7 10treated group mean/ODcontrol group mean \u00d7 100.The optical density (OD) at 450 nm was measured using a microplate reader (BioTek) at 24, 48 and 72 h. Cell viability was calculated as follows: Cell viability (%) = ODIn the subsequent experiments, VP treatment was performed with light activation.An apoptosis kit  and a cell cycle kit (Beyotime) were used according to the manufacturers' manuals. In the apoptosis assay, the cells were seeded in 6-well plates and VP treatment was as CCK-8 assay. After VP light activation for 24 h, the cells were harvested and washed twice with cold phosphate buffer saline (PBS) and stained with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) in the dark at room temperature for for 15 min. In the cell cycle assay, the cells were seeded in 6-well plates using non-serum cell culture medium for 12 h. Then the cells were treated with VP as CCK-8 assay. After VP light activation for 24 h, the cells were harvested, fixed in 70% ethanol at 4\u00b0C overnight, and then stained with PI at 4\u00b0C for 30 min in the dark. Stained cells were analyzed using a FACSCalibur flow cytometer (BD Biosciences).3 cells/well) were plated in 6-well plates and allowed to attach overnight. Then the medium was replaced with fresh medium with VP for 12 h. Then, the cells were irradiated with the light for 20 min to activate the VP. The fresh medium was changed every three days. At 10 days, the cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 30 min. The cell colonies were imaged, and the number of colonies was counted for statistical analysis.The cells  \u00d7 100%.4) were suspended in 0.1 mL of medium without FBS and seeded into the upper chambers of Matrigel-coated  (for assessing the cell invasion ability) or uncoated (for assessing the cell migration ability) polycarbonate membrane filters. Then, medium containing 10% FBS was added to the lower chambers as a chemoattractant. Cells that had migrated to the lower chambers at 24 h were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 30 min. Three low-magnification areas were randomly selected, and the number of migrated cells was counted.Transwell assay was used to assess the cell migration and invasive abilities. Briefly, after VP light activation, HNSCC cells  according to the manufacturer's instructions. RT-qPCR was performed using a SYBR-Green-based PCR kit (TAKARA) with an Applied Biosystems StepOnePlus Real-Time PCR system . The comparative Ct method was applied to determine the fold-differences in expression levels relative to those in \u03b2-actin. The primers used are listed in Table The cells were prepared and treated with VP as RT-qPCR above. After VP light activation for 6 h or 12 h, total protein was extracted from cells for Western blot analysis as described previously 6 cells/100 \u03bcl as indicated in Fig. 3, the mice were randomized to the different experimental groups . VP was injected intraperitoneally at a concentration of 100 mg/kg or the vehicle (control) every 2 days. Tumors were excised and weighed at 21 days. Tumor volume was calculated as the product of all three dimensions.Six-week-old SCID mice (BALB/c) were handled according to the Guidelines for Animal Experiments of the Southeast University. Each of the nude mice was subcutaneously injected with 10t-test. The significance of data obtained from patient specimens was determined using a Chi-square test. P<0.05 was considered to indicate a significant difference .All experiments were repeated at least twice. The data were analyzed using GraphPad Prism version 5.0  and SPSS 17.0  and expressed as the mean values \u00b1 SEM (standard error of the mean). Statistical analysis was performed using the standard Student's YAP1 protein expression was evaluated using IHC in head and neck carcinoma tissues and tumor-adjacent normal tissues. Representative results are shown in Fig. CDH1 (E-cadherin gene) expression was higher in UPCI-SCC-090 and 93-VU-147T cells than in the other HNSCC cell lines. Snail expression was high in all HNSCC cell lines except UPCI-SCC-090 cell line, suggesting that the Snail may inhibit E-cadherin expression in HNSCC cells and that the expression levels of E-cadherin and Snail are inversely related. These results suggest that SCC-4, SCC-25, CAL-27, UM-SCC-47 and 93-VU-147T cells are epithelial-like cells with partial EMT, while UPCI-SCC-090 cells still maintain epithelial properties. Oct4 expression was high in all HNSCC cell lines except UPCI-SCC-090 and 93-VU-147T cell lines, suggesting that these cell lines lack stemness. HPV-negative HNSCC cells had relatively higher levels of EGFR expression than HPV-positive HNSCC cells, consistent with our previous results Fig. Fig. The apoptosis assays showed that the percentages of apoptosis in control SCC-4, SCC-25, CAL-27, UM-SCC-47, UPCI-SCC-090 and 93-VU-147T cells were nearly 2.5%, 2.9%, 6.4%, 22.9%, 8.8% and 8.7%; these percentages increased to 12.9%, 15.1%, 52.4%, 26.9%, 61.4% and 18.9% after treatment with 1 \u03bcM VP for 24 h and increased further to 49.5%, 35.0%, 99.3%, 45.0%, 76.9% and 49.4%, respectively, after treatment with 2 \u03bcM VP for 24 h. Histogram analysis indicates that the apoptotic cells are significantly increased in the VP treated groups relative to the control , Oct4, EGFR and PD-L1, whereas the expression of E-cadherin was upregulated in HNSCC cells. Our results showed that the response of HPV-positive HNSCC cells to VP was generally similar to that of HPV-negative HNSCC cells except E-cadherin. E-cadherin expression in SCC-4, SCC-25 and CAL-27 cells was increased by approximately 12-, 10- and 7-folds, respectively, whereas E-cadherin expression in UM-SCC-47, UPCI-SCC-090 and 93-VU-147T cells was only increased by approximately 2-, 2- and 3-folds, respectively, after treatment with 1 \u03bcM VP for 12 h compared with the control. However, the expression levels of HPV-16 E6 and E7 did not change with VP treatment.Fig. 3) in the SCC-4, SCC-25, UM-SCC-47 and 93-VU-147T cell models was declined from 959, 563, 644, 783 in the control groups to 447, 186, 249, 286 in the VP groups, respectively. This inhibitory effect was no obviously difference between HPV-positive xenografts and HPV-negative xenografts, consistent with that YAP1 expression was not closely associated with HPV status in HNSCC cells  database and head and neck carcinoma exhibits the second highest frequency of YAP1 gene alteration The cBioPortal online analysis tool  YAP1 gene amplification and 93-VU-147T cell line has YAP1 gene deep deletion The baseline expression levels of key genes differ among HNSCC cells Fig. B, reflecThe anticancer effects of the photodynamic agent VP are reported to be different with light activation Although differences in the cell cycle distribution between HPV-negative and -positive HNSCC cells were observed Fig. B, the reThe results of cell colony formation, migration and invasion assays showed that low concentrations of VP significantly inhibited the colony formation, migration and invasion of HNSCC cells, which indicates that VP inhibits EMT and stemness of HNSCC cells. Capacity of cell colony formation is generally considered to be associated with cancer stem-like cells, and the abilities of cell migration and invasion are considered to be linked to EMT. Previous studies have shown that VP can significantly inhibit cell adhesion and invasion of breast cancer cells YAP1, Snail, CTNNB1 and EGFR) and stemness (Oct4 and YAP1) and increased E-cadherin expression in HNSCC cells. The expression level of E-cadherin, a major interepithelial adhesion molecule, is closely related to EMT. Reduced or absent E-cadherin expression has been considered to be an initial step for the invasion and metastasis of many carcinoma cells CDH1 gene. The loss of E-cadherin expression was mostly caused by Snail expression in our study, since the Twist and Snail are the most commonly expressed TFs in HNSCC EMT and stemness are basic features of cancer stem cells, and YAP1 is involved in these processes The expression of a stemness marker Oct4 in 93-VU-147T cell line was lowest among all HNSCC cell lines, suggesting that this cell line lacks cancer stemness. Consistent with this finding, previous reports have shown that 93-VU-147T cells are the most sensitive one of tested HNSCC cell lines to therapies \u03b2-Catenin plays two major roles in cells. In canonical Wnt/\u03b2-catenin signaling, it is the key effector responsible for transducing signals to the nucleus to trigger the expression of target genes, including genes orchestrating the EMT program. The second role of \u03b2-catenin is linked to E-cadherin in the formation of epithelial cell-cell adherens junctions. The triggering of EMT by \u03b2-catenin is well known EGFR transcription EGFR transcription via a TEAD binding site in the EGFR promoter EGFR, a receptor tyrosine kinase, is of particular interest in HNSCC, as it is detectable in approximately 85% of HNSCCs PD-L1 gene amplification and PD-L1 protein expression have been reported to be common events in squamous cell carcinoma of the oral cavity PD-L1 enhancer in lung cancer cells Our data showed that the expression of PD-L1, a ligand for the immune checkpoint protein programmed death 1 (PD1), was increased in UPCI-SCC-090 and 93-VU-147T cells, suggesting that HPV oncoproteins may influence PD-L1 expression in HPV-infected cells. The relationship between PD-L1 and HPV status in HNSCC is controversial. For example, Schoenfeld et al. reported that PD-L1 expression was associated with HPV status in oropharyngeal squamous cell carcinoma (OSCC) E6 and E7 oncogenes in three HPV-positive HNSCC cell lines. However, VP did not change the expression of E6 and E7, suggesting that the anticancer effects of VP are mediated through an E6 and E7-independent mechanism in HPV-positive HNSCC cells.Additionally, we examined the effect of VP on the expression of the in vitro and in vivo, and the inhibitory effects of VP on HNSCC cells were significantly enhanced by light activation in vitro. The anticancer effects of VP on HNSCC cells are mediated via the attenuation of the expression of genes related to EMT and stemness and the increase of E-cadherin expression. Furthermore, VP significantly inhibited the expression of immunosuppressive protein PD-L1 in HNSCC cells. These data indicate that VP is a potential therapeutic drug for HNSCC.In conclusion, our results demonstrated that VP inhibited the proliferation of HNSCC cells both Supplementary figures.Click here for additional data file."}
+{"text": "In this study, two groups of human plasma proteome at different age groups (old and young) were used to perform a comparison of global chemical modifications, as determined by tandem mass spectrometry (MS/MS) combined with non-limiting modification identification algorithms. The sulfhydryl in the cysteine A total of 4 molecular modifications were found to have significant differences passing random grouping tests: the succinylation and phosphorylation modification of cysteine  and the modification of lysine  with threonine  were significantly higher in the old group than in the young group, while the carbamylation of lysine was lower in the young group. We speculate that there is an increase in certain modified proteins in the blood of the old people which, in turn, changes the function of those proteins. This change may be one of the reasons why old people are more likely than young people to be at risk for age-related diseases, such as metabolic diseases, cerebral and cardiovascular diseases, and cancer. Chemical modification of proteins refers to the covalent group reaction of amino acid residues or chain ends. In general, a few changes in chemical structure do not affect the biological activity of proteins, which are called modification of nonessential parts of the protein. However, in most cases, changes in molecular structure will significantly change the physical and chemical properties of the protein, change the conformation of the protein, and make the activity of the protein vary, and then the function that it performs is changed2. Therefore, even if there is no change in the protein content level, but some small changes in the level of chemical modification, the function of the proteins will change significantly, which means that the chemical modification of the proteins enriches the different functions of the protein in another dimension. The effects of chemical modification of proteins on the functions of proteins are mainly shown in the following three aspects: (1) Even if a modification occurs, the functions of proteins will be affected. (2) The same type or different type of modifications of the different amino acids have different effects on the same protein\u2019s function. (3) The same protein may undergo many types of chemical modification, which makes the biological process in which it participates a more variable and complex process3. The main types of chemical modifications related to proteins are as follows: (1) Post-translational modifications (PTMs) refer to the chemical modification of a protein after translation4. The precursor of post-translationally modified protein often has no biological activity. Post-translational modification of a specific modified enzyme is usually required for it to become a functional mature protein and perform its specific biological functions6. (2) Chemical-derived modification of proteins refers to a kind of modification that introduces new groups or removes original/intrinsic groups in the protein side-chain, usually including spontaneous non-enzymatic modifications, as well as the modifications introduced by cross-linking agents and artificial agents. (3) Amino acid substitution refers to the change in protein properties and functions caused by the substitution of amino acids in the protein side-chain by other kinds of amino acids. These changes are the types of modifications that significantly affect protein function.The biological processes of living things/organisms can perform and operate in mutual coordination and high-efficiency cooperation simultaneously, relying on the synthesis, catalysis, and regulatory reactions in which proteins are involved. Proteins are biological macromolecule with complex structures, and the difference in the high-level structures of proteins determines their different biochemical activities, which can perform specific functions through a higher-level network formed by the combination of proteins7. Therefore, comprehensive and non-limiting modification identification plays an important role in understanding all the chemical modification information contained in the sample proteome. Open-pFind is an open sequence library search algorithm that integrates the UniMod database, analyses, and processes the collected mass spectrum data through an open search to obtain the global chemical modification information of samples10.Mass spectrometry can not only realize the acquisition of large-scale data and in-depth mining but also achieve the accurate determination of specific protein targeted modifications. With the continuous development of scientific instruments, ultrahigh-resolution and tandem mass spectrometry (MS/MS) provide more abundant information or data for proteomics and chemical modification research, which also facilitates the accurate identification of chemical modification sites in the protein chain. In the process of proteomic data analysis, it is usually necessary to search and compare the proteomic database of species, and high-resolution tandem mass spectrometry is the primary method for obtaining a large amount of protein modification information. When using the search engine to search the database, known types of protein chemical modification were usually set. This type of search method is called a restricted search, but it is difficult to identify a new type of modification with a type in the product that is unknown11. At present, there are more than 1,500 kinds of chemical modifications in the UniMod12, PSI-MOD13, and RESID databases. There are many kinds of chemical modifications in the human plasma proteome, such as N-terminal acetylation, phosphorylation in the side chain, methylation, glycosylation, ubiquitination, and disulfide bonds between two chains. The plasma proteome can reflect the nuances defining the differences between age and ageing14. A study of the proteome changes in another body fluid, urine, demonstrated that this fluid can be analyzed to elucidate body ageing15. Even the common physiological process of hunger can be analyzed to characterize the urine proteome16. However, the comparison of the global proteome chemical modifications in two kinds of body fluids (plasma and urine) showed the differences in modifications between different types of samples17. Based on the importance of chemical modifications in the human plasma proteome, this study attempted to compare the differences in the global chemical modification levels of the plasma proteome at two different age groups, as determined by high-resolution tandem mass spectrometry combined with non-limiting modification identification (Open-pFind).Plasma is an important part of the internal environment and homeostasis, and it plays a role in transporting the substances needed for maintaining the life activities and the wastes generated off the body. Proteins are rich in variety and content in the plasma, and the components are easily affected by metabolism, physiology, and pathology. All metabolites or wastes in cells and tissues are transported and exchanged through the blood; the study of plasma proteomics may reflect the physiological state of the body at a specific stage. Chemical modification levels are another important research area of plasma proteomics. A comprehensive comparison of the changes in plasma proteome chemical modification levels will provide multiple dimensions of information for the study of physiological changes in the bodyhttps://www.iprox.org/page/HMV006.html) under the Project ID: IPX0002313000. And the results of pFind were showed in Supplementary Table In the label-free proteomic analysis, 20 10/10) samples were analyzed by LC\u2013MS/MS. After retrieving data (.raw) based on pFind studio, the analysis results can be browsed and exported in pBuild studio. The 120-min liquid chromatogram gradient was analyzed, and 628\u2013781 kinds of proteins (average 724) and 7,526\u201311,464 kinds of peptides  were identified in the plasma samples without high-abundance protein removal. About the raw data of pFind, we had submitted to iProX Datasets  were identified in the plasma samples of the old group, and 1,154 modifications (including low abundance modifications) were identified in the plasma samples of the young group. Eighty-eight percent of the modifications are of the same type, and the remaining 12% are related  are counted, and the identification coverage in each group is required to be greater than 50%. There are 120 kinds of chemical modifications in 1,080 kinds that meet this condition. Unsupervised cluster analysis can roughly distinguish young group and old group samples, but 40% of young group and old group samples are clustered into one group, which is not classified as being the same as other samples in the group. Figure\u00a0Four different modifications satisfying different screening conditions  were performed by random grouping tests to verify the false-positive rate of each modification. Ten young group datasets and 10 old group datasets were randomly divided into two groups with 10 samples in each group and 92,378 different combinations  and formed by irreversible reactions. This modification has been reported in diabetes, obesity, fumaric acid hydratase-related diseases, and the model of RIE's syndrome. At the same time, it was also found that the content of succinic acid protein increased in mouse 3T3-L1 adipocytes cultured in high glucose medium , as well as in rats treated with streptozotocin24. It has been reported that an excess of nutrients (sugars) will lead to an increase in ATP: ADP, NADH: NAD+ and mitochondrial membrane potential, while an increase in NADH: NAD\u2009+\u2009will inhibit oxidative phosphorylation, resulting in the continuous accumulation of mitochondrial intermediates (including fumaric acid), leading to an increase in protein succinylation21. The accumulation of succinate protein is also caused by a decrease in fumarate hydratase activity26. Fumaric acid hydratase catalyzes the reversal of fumaric acid to malic acid in the tricarboxylic acid cycle. It is important to note that loss of function and mutations in fumaric hydratase is known to predispose affected individuals to multiple skin diseases and uterine leiomyomas, as well as hereditary leiomyomas and renal cell carcinoma (HLRCC)19.The succinylation and phosphorylation of cysteine in this study involve the participation of the sulfhydryl group, which may affect the formation of the disulfide bond. Fumaric acid was added to the dissociative sulfhydryl sites of some Cys residues in proteins by a Michael addition reaction to form S-(2-succinic acid) cysteine29. The increase in protein succinic acid was also described in the brain stem of ndufs4 knockout mice (a model of Leigh syndrome)30, indicating that this type of protein chemical modification has a potential role in the pathogenesis of this mitochondrial disease. Park et al. found that in the detected protein succinylation sites, 16 succinylation sites appeared in the cofactor binding area or enzyme catalytic area, and 74 succinylation sites existed around the enzyme active site31. Baynes et al. found that cysteine succinyl modification in human skin collagen increased with age33. Cysteine phosphorylation was recently found in prokaryotic and eukaryotic systems and is believed to play a key role in signal transduction and regulation of cellular responses. Due to the low chemical stability of thiophosphates in peptides, the in vivo phosphorylation of cysteine side chains is rarely studied34. Phosphorylation of cysteine is an important function of cysteine-dependent protein phosphatase (CDP), which belongs to a subfamily of protein tyrosine phosphatases (PTPs) and catalyzes the hydrolysis of phosphate ester bonds through the formation of phosphate cysteine intermediates. Studies have shown that this reversible post-translational regulation (PTM) is crucial in regulating the expression of virulence determinants and bacterial resistance to antibiotics. Besides, it has also been shown that phosphorylation of cysteine, previously considered a rare modification, may be more common in nature and may play an important role in the biological regulation of various organisms37.Although the exact role of succinic acid-modified cysteine and other related proteins has not been fully elucidated, it is related to the cancer response related to fumarate hydratase38. Sun WY et al. found that the mutation of nucleotide 20,040 in exon 14, with Thr replacing Lys at amino acid 556, would reduce the pro-coagulative activity of prothrombin by 50%39. The decrease in oxygen affinity, including some other recessions belonging to coagulation activity and other physiological conditions, also reflects the slow metabolism of the body, which may be the earlier manifestation of ageing. Also, it was found that human and mouse embryonic stem cells need specific amino acids to proliferate. MES cells need threonine (Thr) metabolism to complete epigenetic histone modification. Thr is converted to glycine and acetyl coenzyme A, and glycine metabolism specifically regulates the trimethylation of lysine (Lys) residues in histone H3 (H3K4me3)40. Besides, we also found that the modification of L-lysine carbamylation in the old group was lower than that in the young group. Carbamylation is an irreversible non-enzyme modification process. The process is the side chain reaction between the decomposition product of urea and the N-terminus of protein or lysine residue, which was previously reported to be related to the ageing of proteins41. L-lysine carbamylation can promote the coordination interaction of metal ions to specific enzyme activities. Some studies have pointed out that the amount of carbamylation in the plasma of patients with increased urea levels (such as nephrotic patients) is significantly increased42.The replacement of lysine with threonine changed the acid\u2013base properties of the protein, which affected the activity and function of the protein. It has long been observed that the substitution of lysine residues with threonine residues on hemoglobin will reduce its oxygen affinityAgeing is an inevitable and spontaneous process undergone by the organism over time. Ageing is a complex natural phenomenon that is manifested by the degeneration of structure, the decline of function, and the recession of adaptability and resistance. Ageing is one of the largest known risk factors for most human diseases: approximately two-thirds of the world's 150,000 people die every day from ageing-related causes. At present, the cause of ageing has not been determined. The current mainstream theory explaining ageing is damage theory, and DNA damage is considered as the common foundation of cancer and ageing. Some people think that the internal cause of DNA damage is the most important driving force of ageing. According to the waste accumulation theory, the accumulation of waste in cells may interfere with metabolism. For example, a waste called lipofuscin is formed by a complex reaction of fat and protein combining in cells. These wastes accumulate in cells in the form of small particles, and their size will increase with age. Plasma protein can reflect changes in the body during the process of ageing. At the same time, the accumulation of biological macromolecules whose structure is destroyed or even inactivated may lead to the gradual failure of the biological body and system, which is also considered to be the concept of ageing.Through the research described above, we found several types of chemical modifications and replacement of proteins in different age groups. These chemical modifications change the structure and properties of proteins and then affect the function of proteins. It is speculated that the gradual accumulation of some kinds of harmful and irreversible protein modifications in the plasma of the elderly may reflect the ageing process of the body. The accumulation of harmful protein modifications may be one of the reasons why the old are more likely than the young to suffer from ageing-related diseases, such as metabolic diseases, cardiovascular and cerebrovascular diseases, and tumor risks.https://www.iprox.org/page/HMV006.html) under the Project ID: IPX0002313000.The plasma samples of 20 candidates who had medical examinations with passing medical tests were collected from the clinical laboratory of Beijing Hospital, and all of the samples had been discarded from the clinical laboratory. All candidates fully understood and signed the informed consent. The samples were divided into two groups according to age: a young group and an old group. The samples were randomly selected from the clinical laboratory samples, and there were no restrictions or requirements on the diet, drugs, and other factors of the blood sampling donors. The study was approved by the Beijing Hospital and the ethics committee of Beijing Normal University and all experiments were performed under relevant guidelines and regulations.\u00a0This experiment provided volunteers with detailed information about the study, including its purpose, method, and process, and kept the personal information of volunteers strictly confidential. Only age and gender information are mentioned for discarded samples from the laboratory. Table The plasma was centrifuged after whole blood anticoagulant treatment. The plasma sample (n\u2009=\u200920) was diluted 40 times with Milli-Q water, and then 100\u00a0\u03bcL was taken for subsequent experiments. A 20\u00a0mmol/L dithiothreitol (DTT) was used to react with the sample at 37\u00a0\u00b0C for 1\u00a0h to denature the disulfide bond in the protein structure, and then 55\u00a0mmol/L iodoacetamide (IAM) was added and reacted in the dark for 30\u00a0min to alkylate the disulfide bond sites. The supernatant was precipitated with three volumes of precooled acetone at \u2212\u00a020\u00a0\u00b0C for 2\u00a0h and then centrifuged at 4\u00a0\u00b0C and 12,000\u00d7g for 30\u00a0min to obtain protein precipitation. The precipitate was then resuspended in an appropriate amount of protein lysis buffer solution . The concentration of protein extract was measured by Bradford analysis. Using filter-assisted sample preparation (FASP), trypsin gold  was used to hydrolyze 100\u00a0\u03bcg protein at a ratio of 50:1 for each sample. The dried peptides were sealed at -80\u00a0\u00b0C after drying by a vacuum centrifugal concentrator.Before analysis, the dried polypeptide samples were dissolved in 0.1% formic acid solution, and the final concentration was controlled at 0.1\u00a0\u03bcg/\u03bcL. Each sample was analyzed according to 1\u00a0\u03bcg polypeptide quality: a Thermo Easy-nlc1200 chromatographic system was loaded on the precolumn and the analytical column. Proteomic data were collected by the Orbitrap Fusion Lumos mass spectrometry system . Liquid chromatography: pre-column: 75\u00a0\u03bcm\u2009\u00d7\u20092\u00a0cm, nanoviper C18, 2\u00a0\u03bcm, 100\u00a0\u00c5; analytical column: 50\u00a0\u03bcm\u2009\u00d7\u200915\u00a0cm, nanoviper C18, 2\u00a0\u03bcm, 100\u00a0\u00c5; injection volume: 10\u00a0\u03bcL, flow rate: 250\u00a0nL/min, mobile phase: phase A: 100% mass spectrometry grade water /1\u2030 formic acid (Fisher Scientific), phase B: 80% acetonitrile (USA)/20% water/1\u2030 formic acid, 120\u00a0min gradient washing off: 0\u00a0min, 3% B phase; 0\u20133\u00a0min, 8% B phase; 3\u201393\u00a0min, 22% B phase; 93\u2013113\u00a0min, 35% B phase; 113\u2013120\u00a0min, B phase; mass spectrometry, ion source: spray voltage: 2.0kv, capillary temperature:320\u00a0\u00b0C, resolution setting: first-order(Orbitrap) 120,000 @m/z 200, second-order (Orbitrap) 30,000 (Orbitrap) @m/z 200,parent ion scanning range: m/z 350\u20131,350; sub ion scanning range: start from m/z 110, MS1 AGC: 4E5, charge range: 2\u20137, ion implantation time: 50\u00a0ms, MS 2 AGC: 1E5, ion implantation time: 50\u00a0ms, ion screening window: m/z 2.0, fragmentation mode: HCD, energy NCE 32, data dependent MS/MS: Top 20, dynamic exclusion time: 15\u00a0s, internal calibration mass number: 44 5.12003.The pFind Studio software  was used to analyze the LC\u2013MS/MS data with label-free quantification. The target retrieval database is from the Homo Sapiens database downloaded from UniProt (updated to October 2018). Raw files generated by the Orbitrap Fusion were searched directly using a\u2009\u00b1\u200920-ppm precursor mass tolerance and a\u2009\u00b1\u200920-ppm fragment mass tolerance.\u00a0At the time of retrieval, the instrument type is HCD-FTMS, the full specificity of an enzyme is trypsin, and there are at most two missing sites, peptides with at least six amino acids were retained. Open-search is selected. Screening conditions: the FDRs were estimated by the program from the number and quality of spectral matches to the decoy database; for all data sets, the FDRs at spectrum, peptide, and protein level were\u2009<\u20091%, and the Q-value at the protein level is less than 1%. Data are analyzed using both forward and reverse database retrieval strategies.Supplementary Table 1.Supplementary Table 2."}
+{"text": "N-acetyl cysteine moiety produced by an actinomycete strain. These results demonstrate the potential of MoS-screening in the search for new sulfur compounds from microbial sources.The molybdenum (Mo)-catalyzed oxidation of sulfide under neutral conditions yields sulfone. This reaction proceeds more smoothly than olefin epoxidation and primary or secondary alcohol oxidation. In this study, Mo-catalyzed oxidation was used to screen for sulfur compounds (named \u201cMoS-screening\u201d) in microbial broths by liquid chromatography-mass spectrometry (LC/MS). To demonstrate proof-of-concept, known sulfur microbial compounds were successfully identified from a mixture of non-sulfur microbial compounds as sulfinyl or sulfonyl products of Mo-catalyzed oxidation. Then our MoS-screening method was used to screen 300 samples of microbial broth for sulfur compounds. One of the identified compounds was a kitasetaline-containing  Lentzea albida AM-2282, strongly inhibits protein kinase C (PKC) and sets a precedent for the development of PKC inhibitors +), indicating a higher polarity than the original compound  (m/z = 580 [M + H]+) at a lower retention time than that of nanaomycin K  (N-acetylcysteine moiety. This suggests that lactacystin was oxidatively decomposed (data not shown). Thus, sulfur compounds that are stable enough to withstand Mo-catalyzed oxidation will yield sulfinyl and/or sulfonyl products.To determine the suitability of Mo-catalyzed oxidation for the identification of sulfur compounds, methanol solutions of several known microbial compounds containing sulfur, such as outovirin A , nanaomyM + H]+) . This reM + H]+) . Figure 2O2 and (NH4)6Mo7O24\u00b74H2O as a catalyst. As a non-oxidized sample, this process was repeated using H2O in place of the Mo catalyst. A comparison of data and the experimental conditions are provided in m/z [M + H]+) are shown in m/z = 564 and 580 [M + H]+, respectively, and the same absorption spectrum as that of peak 6 (nanaomycin K). Peak 5a (5.72 min) gave a pseudomolecular ion peak at m/z = 497 [M + H]+ and exhibited the same UV absorption spectrum as peak 5 (outovirin A). Thus, peaks 5a, 6a, and 6b were identified as corresponding to sulfinyl outovirin A, sulfinyl nanaomycin K and, sulfonyl nanaomycin K, respectively. Because the oxidative product (m/z 295) of peak 1a (SF-227) was not detected in the oxidized sample, SF-227 likely decomposed during oxidation. Identification of corresponding oxidative products was relatively straightforward because the UV absorption spectra were unchanged by oxidation. All of the sulfur compounds were identified from a complex mixture by comparing the chromatograms and MS spectra of the non-oxidized and oxidized samples. These results suggest that oxidized sulfur compounds, such as sulfinyl, sulfonyl, or both derivatives, can be identified by the presence of additional chromatographic peaks adjacent to those of the original compounds.Next, we investigated the possibility of selectively identifying sulfur compounds from a mixture containing 1.0 mg each of six microbial compounds: outovirin A and nanaomycin K as sulfur compounds, and acremolin B , SF-227 4)6Mo7O24\u00b74H2O and 30% H2O2 was added to the wells in one plate, while, as a control, only H2O was added to the wells of the other plate. After 6 h of shaking, all of the wells were analyzed by LC/MS and the data were compared between the two plates to identify any sulfur compounds. MoS-screening of broths cultured from 300 different microbial strains (150 of actinomycetes and 150 of fungi) yielded a single potentially sulfur compound. The candidate compound was produced by actinomycete strain Kitasatospora setae KM-6054T and showed a retention time of 7.11 min and UV absorbance peaks at 214, 242, 276, 310, and 384 nm . The data in m/z = 434.1018 [M + H]+). Comparisons of the LC/MS data and UV spectrum of the candidate compound with those of known natural products contained in the Dictionary of Natural Products database identified the candidate as kitasetaline, which contains an N-acetyl cysteine moiety [Then our MoS-screening method was applied to screen microbial broths for novel or known sulfur compounds. Microbial broths were prepared in 50% aqueous ethanol and dispensed across two 96-well plates. 6Mo7O24\u00b74H2O and 30% H2O2 were purchased from FUJIFILM Wako Pure Chemical . Liquid chromatography-high resolution electrospray ionization mass spectrometry (LC/MS) spectra were measured using an AB Sciex TripleTOF 5600+ System . All analyses were conducted in positive ion mode. Detailed conditions of MS analysis are shown as follows; Ion Source Gas1 50 psi; Ion Source Gas2 50 psi; Curtain Gas 25 psi; Temperature 500 \u00b0C; IonSpray Voltage Floating 5500 V; Declustering Potential 80 V; Collision Energy 45 V; Collision Energy Spread 15 V; Ion Release Delay 30 \u03bcs; and Ion Release Delay Width 15 \u03bcs. LC/MS data were analyzed by Analyst software . Known microbial compounds were obtained from the natural compound library in the Kitasato Institute for Life Sciences. All solvents were purchased from Kanto Chemical . (NH4)6Mo7O24\u00b74H2O (10 mg/mL in H2O) and 10 \u00b5L 30% H2O2. After shaking for 6 h at room temperature, the samples were analyzed by LC/MS. The analysis conditions for HPLC of the pure sulfur compounds are shown in A 100 \u00b5L aliquot of the test compound solution (1 mg/mL in methanol), mixture solution (1 mg/mL in methanol), or microbial broth (50% aqueous ethanol) was added to 10 \u00b5L  in a 70 mL test tube. The test tube was incubated on a shaker (210 rpm) at 27 \u00b0C for 6 days. In all, 150 strains of actinomycetes were cultured on agar slants consisting of 1.0% starch, 0.3% NZ amine, 0.1% yeast extract, 0.1% meat extract, 1.2% agar, and 0.3% CaCO2PO4, 0.02% K2HPO4, 0.02% MgSO4\u00b77H2O, 0.02% KCl, 0.2% NaNO3, 0.02% yeast extract, and 1.5% agar (adjusted to pH 6.0 before sterilization)). A loop of spores of each strain was inoculated into a 70 mL test tube containing 10 mL seed medium . The tubes were shaken at 210 rpm on a shaker at 27 \u00b0C for 3 days. A 0.5 mL portion of the seed culture was transferred to 10 g rice medium containing seaweed tea  and placed in a static state at room temperature for 13 days.In all, 150 different fungal strains were grown on slants of modified Miura\u2019s medium (LcA: consisting of 0.1% glycerol, 0.08% KHIn this study, a method of screening microbial broths for naturally occurring sulfur compounds was demonstrated using a combination of Mo-catalyzed oxidation and LC/MS analyses. The results indicate that MoS-screening is effective for identifying sulfur compounds that are sufficiently stable to withstand the oxidation conditions. Although this method requires further validation with compounds containing more than two sulfur atoms, it shows great potential for use in the screening of microbial broths and other natural extracts for novel sulfur compounds."}
+{"text": "Gated computed tomography (CT) might not adequately predict occurrence of post-implantation transcatheter aortic valve replacement (TAVR) complications in hostile aortic root as it would require a more complex integration of morphological, functional and hemodynamical parameters. We used a computational framework based on finite element analysis (FEA) to simulate patient-specific implantation. Application of biomechanical modelling using FEA to gated-CT was able to demonstrate the relation of the device with voluminous calcification, its consequent misalignment and a significant stent deformation. Use of FEA and other advanced computed predictive modelling techniques as an adjunct to CT scan could improve our understanding of TAVR, potentially predict complications and fate of the devices after implantation and inform patient-specific treatment.  The use of transcatheter aortic valve replacement (TAVR) is still hampered by daunting complications mainly related to hostile anatomical characteristics of the aortic root. The presence of voluminous calcifications can severely impair device deployment leading to paravalvular regurgitation ,2,3 valvWe investigated the case of an 80 years-old woman undergone TAVR with a n\u00b0 26 CoreValve prosthesis and readmitted with acute coronary syndrome nine months after the index procedure. Biomechanical modelling and FEA was performed on pre-procedural CT scans to simulate implantation and infer potential complications deriving from the patient-specific aortic root anatomy and calcification distribution.\u22123 m, while, for simplicity, native leaflets were reconstructed under the assumption of a uniform thickness of 0.5 \u00d7 10\u22123 m  and comparison with follow-up data. FEA was performed using the commercial FE solver Abaqus 6.14 by Dassault Syst\u00e8mes . The aortic root model was generated by considering a constant thickness of its wall at 2.5 \u00d7 10\u00d7 10\u22123 m .6 Kg/m\u00b7s2 and a Poisson\u2019s ratio \u028b of 0.45. The hyperelastic material model , descri03 Kg/m3 . Frictio03 Kg/m3 . The entThe subjects gave her informed consent for inclusion before they participated in the study. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of 7/2020 (TAVR_CCN_2020_3).2, post-TAVR 272 mm2, change from baseline \u221295 mm2) and in the height of the coronaries relative to annulus   . Coronarctively) .The patient underwent emergently to surgical aortic valve replacement and coronary artery bypass grafts on the left and right coronary system and made an unremarkable recovery being discharged on day 9.6 Kg/m\u00b7s2). In 6 Kg/m\u00b7s2).A precise geometrical model of the patient\u2019s aorta, including the aortic root wall, native leaflets, and calcific plaques was developed from pre-operative CT images. On the basis of the recreated geometric model , we perfThe device was not properly aligned with the aortic root, thereby lacking complete basal attachment and showed stent deformation B. FigureRoot calcification determined an asymmetric and incomplete expansion of the device with stent deformation. Distortion of the entire root geometry was noted as result of stent deformation and might have contributed to the approximation of coronary ostia to the pre-existing calcification.Despite remaining purely speculative, the observations made after biomechanical modelling and FEA in this case strengthened the idea that three-dimensional CT scan alone cannot predict the fate of TAVR device postimplantation. The proposed predictive biomechanical model can be a useful integration to the CT scan as was able to anticipate the potential incorrect deployment of the device, the presence of paravalvular leakage and the distortion of the stent due to voluminous calcifications. The geometric alterations and the location of calcifications, often close to the coronary ostia, can be at the root of daunting complications ,9,10,11.In this case we noticed dynamic changes of aortic anatomy many months after the procedure. These changes involved the diameter of the aortic anulus and the height of the coronary ostia, all significantly reduced in comparison to pre-TAVR. These findings are only in partial agreement with the ones by Madukauwa-David et al. , who perAuthors acknowledge that these findings derive from the analysis of only one case, but, if confirmed by further investigations, the combined approach CT-FEA in the preoperative evaluation of TAVR candidates could really hold a promise to dramatically improve the management of these patients. Indeed, FEA could capture a significant amount of information potentially useful in predicting the fate of device implantation and inform patient-specific treatment. The use of FEA in the preoperative planning of TAVR permits not only the reconstruction of the patient-specific anatomy but also an in-silico simulation of the entire procedure in such specific anatomy. A combined FEA-CT approach could inform the physician on the potential risks or problems occurring after the implantation. In this case who developed long-term complications after TAVR, patient-specific preoperative FEA simulation of valve deployment anticipated that pre-existing root calcifications could have determined device misalignment and incomplete and asymmetric stent expansion. The subsequent device deformation predisposed to paravalvular regurgitation. The information provided by the combination of FEA with CT could assist and guide several aspects of the preprocedural planning such as the selection of the type of device , the best technique of implantation  or the use of strategies to protect or treat the coronary preventatively.The routine use of finite element analysis as adjunct to CT scan could therefore provide complex integration of morphological and functional parameters predicting complications and informing patient-specific treatment."}
+{"text": "Zootermopsis angusticollis, to a rival colony while preventing physical combat with a permeable barrier. We measured social contacts, allogrooming and trophallaxis before, during and after exposure. Termites showed elevated rates of social contacts during exposure to a rival compared to the pre-exposure phase, but rates returned to pre-exposure levels after colonies were separated for 9 days. There was evidence of a delayed effect of conflict on worker trophallaxis. We suggest that social contacts during intergroup conflict function as a form of social surveillance, to check individual identity and assess colony resource holding potential. Intergroup conflict may increase social cohesion in both the short and the long term, improving the effectiveness of groups in competition.Intergroup conflict has been suggested as a major force shaping the evolution of social behaviour in animal groups. A long-standing hypothesis is that groups at risk of attack by rivals should become more socially cohesive, to increase resilience or protect against future attack. However, it is usually unclear how cohesive behaviours  function in intergroup conflict. We performed an experiment in which we exposed young colonies of the dampwood termite,  More reA hypothesis linked to, but distinct from, these models is that groups exposed to conflict should evolve to respond on a behavioural timescale by becoming more coordinated or cohesive, to increase effectiveness or resilience in group competition \u201310. ThisTwo limitations of existing research are, first, in behavioural ecology , the coZootermopsis angusticollis. We test (i) the impact of intergroup conflict on behaviours that might promote social cohesion and (ii) whether there are any lasting impacts of intergroup conflict, long after exposure to rival groups has ceased. In Z. angusticollis, intergroup conflict is a key aspect of life history because multiple colonies compete for a single limited resource (a log) in which to develop, feed and reproduce [In this study, we test how exposure to rival groups influences measures of social cohesion in the primitive dampwood termite eproduce \u201322, and eproduce .We experimentally exposed colonies to a rival group while preventing physical combat by means of a permeable barrier and measured behaviour before, during and after exposure. We predicted that exposure to a rival colony would result in increased rates of social contact and affiliative behaviour. We also tested whether these behavioural responses persist long after colonies had been separated.2.(a)Betula pendula) wood into which termites could burrow, and damp, cellulose filter paper (cut to 10 cm \u00d7 7 cm). Colonies were kept in a controlled environment room set at 23\u00b0C and 85% humidity, in total darkness, and were sprayed with distilled water approximately twice per week to maintain a damp environment.Experiments were conducted at the University of Exeter's Centre for Ecology and Conservation (UK) between November and December 2018. Incipient colonies used in these experiments were bred from stock colonies collected under permit from Redwood Regional Park, California . Incipient colonies were formed by pairing de-winged virgin male and female alates harvested from stock colonies during dispersal events ,25. At t(b)Thirty-three incipient colonies  were used in the experiment, which consisted of three phases . Colonies consisted of a reproductive royal pair (king and queen), workers  and solIn the pre-conflict phase, colonies remained separate and undisturbed for 10 days, except for biweekly water spraying. On day 11, we extracted five individuals from each colony for behavioural observations. The king and queen were always extracted (if present). For colonies numbering fewer than five individuals, all colony members were used . Extracted individuals were placed in a fresh 10 cm \u00d7 10 cm Petri dish (the observation arena) lined with clean filter paper. Termites were left to acclimatize for 15 min and then videoed for 10 min using a Sony HDR-PJ330 camera. Extracted individuals were filmed under red light using two 11 W light bulbs, before being returned to their original colonies.At the start of the conflict phase (day 11), group size-matched pairs of colonies were placed adjacent to one another in contact along their mesh barrier and taped together. Pairs were matched for size to ensure that all colonies were exposed to a stimulus group of similar size to themselves. Pairs were left undisturbed for 10 days, except for bi-weekly water spraying. On day 22, we extracted 5 individuals from each colony, placed them in an observation arena, videoed them as before, then returned them to their original colonies.At the start of the post-conflict phase (day 22), joined colonies were separated and, again, left undisturbed for 9 days , except for bi-weekly water spraying. On day 32, we conducted the final video recordings using methods described previously.(c)Videos were analysed using BORIS version 7.4.5 . We measN = 102 pre-conflict; 102 conflict; 103 post-conflict) in 33 colonies [Statistical analyses were performed in R version 3.6.0 . For theN = 102 pre-conflict; 102 conflict; 103 post-conflict) in 33 colonies [For the analyses of allogrooming and trophallaxis, we fitted either the proportion of time spent allogrooming or engaging in trophallaxis as the response variable in a linear mixed model with a Gaussian error structure and identity link function. The response variable was logit transformed to ensure model residuals were normally distributed with homogeneous variance. We included phase, caste and their interaction as fixed effects, and an additional fixed effect of  to account for differences in the focal individual's opportunity to initiate social interactions. As in the model of social contacts, we included whether there was the queen, the king or a soldier present in the colony, and whether there was a soldier present in the observation arena as fixed effects. We included colony ID as a random effect, and fitted each model to 307 individuals per capita at the end of the conflict phase than at the end of the pre-conflict or the post-conflict phase . Overall, reproductives initiated significantly more social contacts than workers , but this effect was independent of phase (p = 0.83). We observed fewer social contacts among individuals when the queen , the king , or a soldier was present in the colony .Individual termites initiated significantly more social contacts (b)p = 0.72; electronic supplementary material, table S4), but overall workers spent significantly longer allogrooming than reproductives . Individuals spent longer allogrooming when the queen , the king , or a soldier was present in the colony .There was no difference in the time that termites spent allogrooming across phases p = 0.021; electronic supplementary material, table S5), which revealed that workers spent significantly longer in trophallaxis in the post-conflict phase compared to both the conflict and the pre-conflict phases . Workers spent significantly longer in trophallaxis than reproductives in the post-conflict phase  but there was no change in trophallaxis by reproductives across phases.There was a significant interaction between phase and caste . We fouIn other systems, there is great variety in the types of response that are assumed to represent social cohesion. Studies of social birds and mammals often use allogrooming or allopreening as measures of affiliation, and by implication, social cohesion . In cichOur study adds to evidence that intergroup conflict shapes within-group behaviour, with effects that vary depending on the function of social interactions. Future research could usefully test how measures of cohesion affect group competitive ability, and the causes of variation in the durability of behavioural responses."}
+{"text": "Caesalpinia volkensii, Vernonia lasiopus, and Acacia hockii have folkloric remedies against associated oxidative stress-mediated complications. However, the upsurge in its use has not been accompanied by scientific validations to support these claims. In this study, in vitro antioxidant activity of Caesalpinia volkensii, Vernonia lasiopus, and Acacia hockii collected from Embu County (Kenya) were determined by radical scavenging activities of 1,1-diphenyl-2-picrylhydrazyl (DPPH) and hydroxyl radical in addition to ferric reducing antioxidant power analyzed against that of L-ascorbic acid as the standard. The obtained results revealed remarkable antioxidant activities of the studied plant extracts as evidenced by the low IC50 and EC50 values. These antioxidant activities could be due to the presence of antioxidants phytochemicals such as flavonoids, phenols, terpenoids, and saponins among others. Therefore, the therapeutic potential of this plant could be due to their antioxidant properties. This study recommends bioassay of the extracts against oxidative stress-related disorders for development of phytomedicine with antioxidant properties.Oxidative stress is the result of the disparity between pro-oxidants and antioxidants in an organism, and it is important in the pathogenesis of several degenerative disorders, such as arthritis, Alzheimer's, cancer, and cardiovascular diseases. Free radicals can damage biomolecules, such as nucleic acids, lipids, proteins, polyunsaturated fatty acids, and carbohydrates, and the DNA leading to mutations. The use of antioxidants is effective in delaying the oxidation of biomolecules. Antioxidants are complexes found in the food that can retard or deter oxidation by preventing the initiation and propagation of oxidizing chain reactions. Medicinal plants have been used for centuries by man to manage diseases and have a host of antioxidant complexes. Traditionally,  Oxidative stress is the major driving factor responsible for the initiation and progression of cancer, diabetes mellitus, cardiovascular diseases, neurodegenerative diseases, and inflammatory diseases among other syndromes . The conThe body possesses a complex antioxidant defense system, comprising of enzymatic and nonenzymatic pathways, which in the normal physiologic state, maintain a steady equilibrium between prooxidants and antioxidants, thereby ensuring well-being . The enzConventionally, oxidative stress is managed using various synthetic antioxidant compounds such as butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), and propyl gallate (PG). Despite their usage, these synthetic antioxidant compounds have been associated with undesirable effects . For insConsidering the available alternative and complementary strategies, medicinal plants stand a better chance of providing potent, safer, affordable, and easily accessible therapies for oxidative stress-related maladies . MedicinThe major groups of phytochemicals that contribute to antioxidant capacity of plants include polyphenols and vitamins . Phenolic compounds of plants are hydroxylated derivatives of benzoic acid and cinnamic acids, which possess antioxidant and anticarcinogenic effects . They inVernonia lasiopus (O. Hoffm.), Acacia hockii (De Wild.), and Caesalpinia volkensii (Harms.). Vernonia lasiopus (O. Hoffm.) is a shrub of Asteraceae family. Leaf infusion and decoctions of V. lasiopus are used by traditional herbalists in Kenya for the treatment and management of malaria, epilepsy, inflammation, pain, and other diseases [Vernonia amygdalina leaves against acetaminophen-induced hepatotoxicity and oxidative stress in mice.The search for better alternatives to synthetic antioxidants has triggered a significant research interest on dietary and medicinal plants that can inhibit, reverse, or ameliorate diseases caused by oxidative stress , 10. In diseases , 12. Prediseases  reportedAcacia hockii (De Wild.) is a shrub in the Fabaceae family. The root and back decoctions of A. hockii are used in traditional medicine to treat inflammation and associated diseases including gout [Acacia, in the Fabaceae family, have been shown to have harbor antioxidant properties. An investigation of one of the Acacia species, Acacia mearnsii, has led to the isolation of a strong antioxidant molecule, with neuroprotective properties [ing gout . Other poperties .Caesalpinia volkensii (Harms.) is a shrub belonging to the Caesalpiniaceae family. Fruit and leaf preparations of this plant are used by herbalists to manage diarrhea, dysentery, ophthalmic diseases, and diabetes mellitus complications [Bauhinia rufescens, have antioxidant properties as described by Aliyu et al. [Caesalpinia volkensii, Acacia hockii, and Vernonia lasiopus were selected based on their ethnomedical usage in the management of oxidative stress-related diseases. Thus, the current study provides a framework towards the discovery of alternative, safer, affordable, and efficacious antioxidants to counter oxidative stress-related disorders.ications . Variousu et al. . In thisCaesalpinia volkensii and Vernonia lasiopus and stem bark of Acacia hockii were collected from their natural habitats, in Mbeere North subcounty, Embu County, where they grew naturally. The plants were chosen based on an extensive ethnomedical survey and folklore reports from the local practicing herbalists [Caesalpinia volkensii (\u201cMubuthi\u201d), Vernonia lasiopus (\u201cMucatha\u201d), and Acacia hockii (\u201cMugaa\u201d), and diseases they treat by the help of a reputable local herbalist.Fresh leaves of rbalists . PrimariThe plant samples were furnished to an acknowledged taxonomist for botanical authentication. The voucher specimens were deposited in plant science department of Kenyatta University for future reference. Samples were sorted out properly and transported to the Department of Biochemistry, Microbiology and Biotechnology laboratories at Kenyatta University where they were shade dried for a period of two weeks. After drying, the plant materials were ground well using an electric plant mill into a fine powder, packaged in well-labeled airtight containers, and stored at room temperature awaiting extraction.Approximately 400\u2009g of each of the powdered plant materials was soaked in a liter of analytical grade methanol in a 2-liter capacity conical flask. The flasks containing each plant material were shaken regularly, corked, and left to stand for 48 hours at room temperature. In each case, the menstruum was separated by filtration through Whatman filter paper No. 1. The filtrates were then concentrated using a rotary evaporator at 50\u00b0C and later in a hot-air oven at 35\u00b0C to dry completely. The concentrates were put in airtight containers and stored at 4\u00b0C awaiting use in in vitro bioassay .Caesalpinia volkensii and Vernonia lasiopus and the methanolic stem bark extract of Acacia hockii were carried out using standard phytochemical screening procedures [Qualitative tests for various phytochemicals present in the methanolic leaf extracts of ocedures . Visual About 2\u2009g of each of the studied plant extracts was weighed and dissolved in 5\u2009ml of distilled water. Thereafter, aliquots of 2\u2009ml were taken from each plant extract solution, stirred for 30 seconds, and briskly agitated. The setups were then allowed to settle for 15 minutes. The presence of frothing, which persists for over 15\u2009minutes, is an indication of the presence of saponins in the tested sample .About 2\u2009g of each of the studied plant extracts was added to 10\u2009ml of 0.1\u2009M hydrochloric acid, warmed in a waterbath (50\u00b0C) for 5 minutes, and filtered through Whatman filter paper No. 1. After cooling, 3 drops of Dragendorff's reagent were added and mixed. The appearance of a reddish-brown colour is a positive indication for the presence of alkaloids in the sample .Into clean test tubes, 2\u2009ml of alcoholic extracts were mixed with 5 drops of acetic anhydride. Thereafter, 5 drops of concentrated sulphuric were carefully added through the side of the test tube.The formation of a blue ring at the interface shows the presence of terpenoids in the tested sample .To 2\u2009ml of alcoholic extracts of the studied plants and 5 drops of concentrated hydrochloric acid were added. The formation of a red colour indicates the presence of flavonoids. To another portion of the alcoholic extracts (2\u2009ml), 1\u2009ml of dilute ammonia was added and gently mixed. A greenish-yellow colour indicates the presence of flavonoids .2SO4 was then slowly introduced into the underlying mixture. Appearance of either a violet band at the boundary is a positive test for the deoxy sugars (cardenolides) [To test for cardiac glycosides presence, 0.5\u2009g of the extract was dissolved in 2\u2009ml glacial acetic acid containing 2 drops of 10% ferric chloride solution. One milliliter of concentrated Hnolides) .The presence of steroids in the studied plant extracts was determined in this study. About 0.5\u2009g of each extract was dissolved in 2\u2009ml of chloroform. This was followed by addition of 3 drops of the Liebermann\u2013Burchard reagent and gently agitated. The presence of reddish-purple colour indicates the presence of steroids .About 0.5\u2009g of each of the studied plant extracts was boiled in 5\u2009ml of 70% ethanol in a waterbath for 5 minutes and then filtered through Whatman filter paper No. 1. After cooling, 5 drops of 5% ferric chloride were added and mixed. The appearance of a green precipitate indicates the presence of phenols in the sample .3Fe (CN)6). The mixture was incubated at 50\u00b0C for 20 minutes. Then, 2\u2009ml of 10% trichloroacetic acid (TCA) was added, and the mixture was centrifuged at 1000 revolutions per minute (rpm) for 10\u2009min. The supernatant (2\u2009ml) was aspirated and mixed with 2\u2009ml of distilled water and 1\u2009ml of 0.1% ferric chloride (FeCl3). In each case, the experiment was performed in triplicate. Afterward, the absorbances were measured spectrophotometrically at 700\u2009nm using a UV-vis spectrophotometer and recorded. The concentrations of each extract able to yield an absorbance value of 0.5 were determined from the graph of absorbance at 700\u2009nm against extract concentrations and considered as the median effective concentration (EC50).The reducing power of the extracts was determined according to the method described by Oyaizu , with soThe DPPH radical scavenging assay was performed using 1,1 diphenyl-2-picrylhydrazyl (DPPH) according to the method described by Brand-Williams et al.  with somAs is the absorbance of the sample, and Ac is the absorbance of the control.The negative control comprised 2.5\u2009ml of DPPH solution and 1\u2009ml of methanol, while L-ascorbic acid at the same concentrations as the studied extracts was used as the positive control. After incubation in the dark, the absorbance values were measured at 517\u2009nm using a spectrophotometer. The experiments were performed in triplicate. The DPPH radical scavenging activity was estimated using the equation described by Brand-Williams et al. .(1)%\u2009RadThe half maximal inhibitory concentration (IC50) of the extracts was computed from a plot of percentage DPPH free radical inhibition versus the extract concentration.\u03bcl of 1\u2009mM 1, 10 phenanthroline, 150\u2009\u03bcl of 0.1\u2009mM hydrogen peroxide, 60\u2009\u03bcl of 1\u2009mM iron (III) chloride, and 1.5\u2009ml of the Phytexponent and the standard (L-ascorbic acid) at different concentrations  were added except in the controls, followed by incubation at room temperature for 5 minutes. The increase in absorbance at 560\u2009nm was measured, and radical scavenging activity was calculated using the following formula:The hydroxyl radical scavenging activity was performed as per the method described by Klein et al.  with min2CO3) was added. The mixture was shaken for 20 seconds and incubated at 40\u00b0C for 30 minutes. Absorbance was measured at 765\u2009nm. Gallic acid was used for the generation of the standard curve. The total phenolic content was expressed as mg of gallic acid equivalents (GAE) per gram (g) of the studied extracts. The experiment was repeated in triplicates.The total phenolic content of the extracts was measured according to the Folin-Ciocalteu method adapted from Do et al. , with so2 (0.5\u2009M), and 0.15\u2009ml of AlCl3\u00b76H2O (0.3\u2009M) were mixed. After 5 minutes, 1\u2009ml of NaOH (1\u2009M) was added and mixed well, and the absorbance was measured against the reagent blank at 510\u2009nm. The standard curve for total flavonoids prepared using quercetin standard solution (0\u2013100\u2009mg/l). The total flavonoids were expressed as milligrams of quercetin equivalents per g of sample. The experiment was repeated thrice.The total flavonoid content of the extracts was evaluated through a technique described by Park et al. . In a 10P < 0.05 was considered statistically significant. On the other hand, qualitative data on phytochemical analysis was only tabulated.Quantitative data were presented in tables, and the data were then exported into Minitab statistical software version 17.0 for analysis. The data were subjected to descriptive statistics and stated as mean\u2009\u00b1\u2009standard error of the mean (SEM). One-way analysis of variance (ANOVA) was used to analyze whether there was any significant difference among the means of different groups. This was followed by Tukey's tests for pairwise comparisons and separation of means. C. volkensii and V. lasiopus lacked cardiac glycosides and steroids ; however, the observed percentage radical scavenging activities were significantly higher than that of C. volkensii  were also determined in this study. The IC50 values for the C. volkensii, V. lasiopus, and A. hockii extracts were 0.25\u2009mg/ml, 0.24\u2009mg/ml, and 0.12\u2009mg/ml, respectively. On the other hand, the IC50 value of the standard (L-ascorbic acid) was 0.06\u2009mg/ml.The concentrations of the studied plant extracts required to scavenge 50% of the DPPH radicals  was also determined. The results showed that the IC50 values for the methanolic extracts of C. volkensii, V. lasiopus, and A. hockii extracts were 0.11\u2009mg/ml, 0.23\u2009mg/ml, and 0.49\u2009mg/ml, respectively. Besides, the IC50 value of the standard (L-ascorbic acid) was 1.05\u2009mg/ml  than the phenolic content in the methanolic extracts of V. lasiopus (6.04\u2009\u00b1\u20090.032\u2009mg of GAE/g) and C. volkensii (28.51\u2009\u00b1\u20090.061\u2009mg of GAE/g)  compared with the total flavonoid content in the methanolic extracts of V. lasiopus (32.89\u2009\u00b1\u20090.01\u2009mg of QE/g) and C. volkensii (22.52\u2009\u00b1\u20090.09\u2009mg of QE/g) , \u03b1-tocopherol, and tocotrienols (vitamin E), which are derived from dietary foods we consume [To maintain homeostasis in the redox system and protect the body against ROS and RNS, humans have evolved complex antioxidant systems, which work to avert deleterious effects of oxidative stress . The bod consume . Endogen consume \u201330.A. hockii and leaf extracts of V. lasiopus and C. volkensii.Synthetic antioxidants such as propyl gallate (PG), butylated hydroxyanisole (BHA), and butylated hydroxytoluene (BHT), currently used against oxidative stress, have been associated with adverse health effects including hepatic damages and malignancies. Additionally, they have limited potency in animal models and humans . CurrentResearch has indicated that antioxidant activities ought not to be established based on a single antioxidant experimental model . In prac3+) to ferrous ion (Fe2+) [2+ formation can be examined by absorbance capacity at 700\u2009nm [In the present study, the ferric reducing antioxidant power (FRAP) assay was adopted . This men (Fe2+) , 36. HenC. volkensii, V. lasiopus, and A. hockii depicting appreciable ferric reducing antioxidant power. The findings were comparable with the in vitro study by Aliyu et al. [Bauhinia rufescens Lam. Additionally, a study conducted by Adesanoye and Farombi [Vernonia amygdalina, in concurrence with our study. Furthermore, our results corroborate with those of Sowndhararajan et al. [Acacia species methanolic bark extracts.The findings of this study demonstrated a concentration-dependent increase in absorbance values of the methanolic extracts of u et al.  who demo Farombi  establisn et al.  who demo\u03bcg/ml. The results that were observed in the study corroborated those of Fidrianny et al. [Momordica charantia.Moreover, antioxidant activities of the studied plant extracts were appraised according to the criterion of Do et al. . Based oy et al.  who demoOn the other hand, the DPPH radical scavenging technique described by Brand-Williams et al.  has beenC. volkensii, V. lasiopus, and A. hockii exhibited a concentration-dependent relationship as previously demonstrated by Patil et al. [Ageratum conyzoides and Caesalpinia pulcherrima, respectively. Moreover, metabolomic profiling of different parts  of Acacia species  by Abdel-Farid et al. [In the current study, we found that DPPH scavenging capacity of the methanolic extracts of l et al.  and Vivel et al.  in extrad et al.  displaye50 values were lower than 50\u2009mg/ml.Upon grading of the DPPH free radical scavenging effects as per the criterion of Fidrianny et al. , all the2+\u2009+\u2009H2O2\u2009\u27f6\u2009Fe3+\u2009+\u2009OH\u2212\u2009+\u2009OH\u2022 [Moreover, the ability of the studied plant extracts to scavenge for the hydroxyl radical was investigated in this study. Research has shown that the hydroxyl radicals directly denature body enzymes via oxidation of thiol (-SH) groups . The hydH\u2212\u2009+\u2009OH\u2022 . A samplBulbine abyssinica [A. hockii, C. volkensii, and V. lasiopus were lower than 50\u2009mg/ml, which, according to Fidrianny et al. [In this study, the studied plant extracts revealed a concentration-dependent decrease in hydrogen peroxide scavenging activity in agreement with the findings reported on both acetone and aqueous whole plant extracts of yssinica . Conversyssinica . The cony et al. , rendereExtensive research has shown that medicinal plants contain active principles, which are responsible for antioxidant activity . VariousThe antioxidant potential of these phytochemicals is thought to be through the reductive and oxidative capacities that allow absorption and counteracting effects of free radicals . Many ofFlavonoids are one of the phenolics compounds found in plants, and they are associated with various pharmacological activities including anti-inflammatory and antitumor properties, and they are capable of acting as antioxidants that shield the cells from destructive effects of free radicals , 48. TheC. volkensii and V. lasiopus and stem bark extracts of A. hockii we report herein provides a valuable source of biologically active elements and will consequently lead to discovery and development of potent, efficacious, safe, and affordable antioxidants to curb oxidative stress. Furthermore, our study confirms the use C. volkensii, V. lasiopus, and A. hockii in the management of oxidative stress-related disorders in the traditional medicine [The studied medicinal plants are traditionally used to manage various diseases, which are associated with oxidative stress , 12, 14.medicine , 12, 14.Caesalpinia volkensii and Vernonia lasiopus and the methanolic stem bark extract of Acacia hockii have appreciable antioxidant capacity and antioxidant-associated phytochemicals. Further studies that aimed at isolating and characterizing the pure phytoactive principles for enhancement are recommended. Toxicity studies on the methanolic stem bark extracts of Caesalpinia volkensii, Vernonia lasiopus, and Acacia hockii should be performed to determine their safety.From the obtained results, it was concluded that the methanolic leaf extracts of"}
+{"text": "This study aims to assess rehabilitation needs and provision of rehabilitation services for individuals with moderate-to-severe disability and investigate factors influencing the probability of receiving rehabilitation within six months after traumatic brain injury (TBI). Overall, the analyses included 1206 individuals enrolled in the CENTER-TBI study with severe-to-moderate disability. Impairments in five outcome domains  and the use of respective rehabilitation services  were recorded. Sociodemographic and injury-related factors were used to investigate the probability of receiving rehabilitation. Physiotherapy was the most frequently provided rehabilitation service, followed by speech and occupational therapy. Psychological counselling was the least frequently accessed service. The probability of receiving a rehabilitative intervention increased for individuals with greater brain injury severity (odds ratio (OR) 1.75, CI 95%: 1.27\u20132.42), physical  and cognitive problems  but decreased for individuals reporting psychological problems . The study results emphasize the need for more extensive prescription of rehabilitation services for individuals with disability. Moreover, targeted rehabilitation programs, which aim to improve outcomes, should specifically involve psychological services to meet the needs of individuals recovering from TBI.  Physical, cognitive and emotional problems after traumatic brain injury (TBI) may cause physical, behavioral and psychosocial impairments, work disability , and an TBI rehabilitation is beneficial in that it improves patients\u2019 functional outcomes beyond those expected from spontaneous recovery ,5. The kService utilization may vary based on demand and specific needs across different demographics and injury severity characteristics, and service provision and access may further vary across regions and countries. Studies determining the predictive value of socio-demographics on the use of rehabilitation services after TBI show contradictory results. Some report sex differences in service utilization, such as higher healthcare use among females ,10. In oJohnstone et al., report that geographical regions might influence access to TBI rehabilitation services , which mTo this end, the Collaborative European NeuroTrauma Effectiveness Research in TBI (CENTER-TBI)  observatTo assess the rehabilitation needs and provision of rehabilitation services for individuals exhibiting TBI-related impairments and disability across Europe during the first six months post-injury.To investigate whether sociodemographic, premorbid, and injury-related factors predict the probability of receiving rehabilitation services at three and six months after injury.The aims of this study were as follows:There will be a high percentage of rehabilitation needs among individuals with TBI-related impairments and disabilities in the first six months following TBI.There will be an association between the probability of receiving rehabilitation and age, sex, injury severity, comorbidities, and geographical regions.Based on previous studies, we hypothesized that: Participants were recruited from the CENTER-TBI project, a multicenter, prospective observational longitudinal cohort study that aims to better characterize TBI and to identify the most effective interventions for managing TBI . The corThis study is a part of Work Package 14 (WP-14), aimed at describing optimal ways to provide different levels of care to individuals after TBI. The complex issue of rehabilitation is a major focus of this WP. Thus, the assessments included in the current study were from the original CENTER-TBI study.n = 11) were excluded as this study assesses the rehabilitation needs across the Europe. All selected individuals showed TBI-related moderate-to-severe disability outcome\u2014as measured by the GOSE score\u2014at their six-month follow-up appointment. The GOSE score consists of an eight-point scale  and is based on structured clinical interviews or self- or proxy- ratings. Besides the GOSE, the patient- or proxy-reported version of the GOSE questionnaire (GOSE-Q) [To assess rehabilitation needs, 1206 individuals over 16 years of age were selected from the 17 European countries involved in the CENTER-TBI project. Participants from Israel ((GOSE-Q)  administSociodemographic and injury-related data were collected at the study\u2019s inception. Data included sex , age in years, years of education, living situation  and work participation . The geographical region was determined by the country of the participating sites. Based on the EU Vocabularies (EuroVoc) classification , countriPremorbid somatic health status was assessed according to the classification of the American Society of Anesthesiologists Physical Status Classification System . This clInjury-related information covered: (i) the injury mechanism ; (ii) clinical care pathways ; (iii) TBI severity as measured by the Glasgow Coma Scale  [QOLIBRI) ,32 with Physical problems covering mobility  and movement ability  were self-reported and assessed by two questions from the Participant Questionnaire of the CENTER-TBI project. Individuals who responded affirmatively to at least one yes/no question were considered impaired. Problems with cognition were measured using three questions from the Rivermead Post-Concussion Symptoms Questionnaire (RPQ) [re (RPQ) . \u2018Forgetre (RPQ) . IndividProblems with speech and language were measured using the yes/no question \u2018problems with speaking or understanding others\u2019 in the Participant Questionnaire mentioned above. Psychological problems were considered to be present if at least one of the following outcomes was rated as impaired: (i)Post-traumatic stress disorder (PTSD) was captured by the Posttraumatic Stress Disorder Checklist-5 (PCL-5) [ (PCL-5) . The PCL (PCL-5)  using a  (PCL-5) .(ii)Depression was assessed with the Patient Health Questionnaire (PHQ-9) [ (PHQ-9) . The PHQ (PHQ-9) ,39.(iii)Anxiety was assessed with the self-reported Generalized Anxiety Disorder seven-item scale (GAD-7) [ (GAD-7) . The GAD (GAD-7) .Information concerning professional help and rehabilitation services provided after TBI was based on self-report. Participants were asked to report any specialized professional help they received because of the TBI, including help for problems with speaking , memory or attention , problems with movements , help for problems with looking after themselves , emotional difficulties, behavioral regulation and fatigue . Multiple answers were allowed. Participants were then asked to utilize the following response categories to describe the rehabilitation they received because of the TBI with the following response categories: inpatient/residential rehabilitation, out-patient/community rehabilitation, or no rehabilitation. This information contained no reference to the impaired outcome domains. First, we identified rehabilitation needs at three and six months after TBI using the methods and instruments described above. The amount of professional help and rehabilitation services provided was measured using the ratio of total impaired individuals versus individuals who had received professional or rehabilitation services. Individuals with impairments who did not receive inpatient/residential or outpatient/community rehabilitation services were considered to have unmet rehabilitation needs.To provide an overview of these unmet rehabilitation needs, we classified the ratio into three groups based on the following the cut-off values: covered needs , semi-covered needs , and uncovered needs (less than 25% receiving respective services). Coverage of rehabilitation needs is provided per outcome category. For example, if a person reported problems with activities of daily living and psychological problems but received only occupational rehabilitation and no psychological treatment, his or her needs were covered to 100% in the \u201cactivities of daily life\u201d outcome category and not covered in the \u201cpsychological problems\u201d category. If each person who reported an impairment in a category received appropriate rehabilitation, the total coverage was 100%. Based on the results of this classification, the coverage of rehabilitation needs was subsequently ranked according to the five outcome domains at three and six months after TBI, respectively.p-values for multiple outcome comparisons . Nineteen independent variables include sociodemographic information at baseline ; premorbid health status ; injury-related factors such as injury cause, clinical care pathways, TBI severity  and overall injury severity. In addition, impairments in the five outcome domains were included. p-value of 0.157 corresponding to a predictor with 1 degree of freedom. While the regression model was defined based on previous research, a liberal p-value was used to justify variable selection for the final model reported [2 [2 ranges from 0 to 1 with higher values indicating the relative improvement of the estimated model compared to a null model. The area under the receiver operating (ROC) curve (AUC), which corresponds to the c-statistic [The following steps were performed to run the regression analyses. First, the missing values in the predictor variables  were imputed using multivariate imputation by the chained equations (MICE) procedure . The MICreported . A bootsorted [2  was usedtatistic ,46, was tatistic . All analyses were performed with the R version 4.0.2  using thN = 1206) consisted of majority males (67.7%) and had a mean age of 49.3 . Half of the participants had at least 13 years of education and were employed (52.5%) at the time of the injury, and half were residents of Western European countries (49.2%). Most individuals (52.4%) reported no somatic health problems and no psychological problems (80.3%) prior to TBI. Road traffic accidents (45.6%) were the most common cause of TBI, and most of patients with TBI were admitted to the ICU (71.2%). Of the sample group, 49.1% sustained a mild TBI, 11.7% sustained a moderate and 35.2% a severe TBI. Finally, 62.2% showed abnormalities on the first CT-scan . Over 40% reported suffering from at least two or three impairments, and nearly 9% were impaired in all five areas  at three and six months after TBI. Irrespective of the outcome area impaired, individuals admitted to the ICU participated more frequently in in-patient rehabilitation programs at both time points. In contrast, out-patient treatments were used by those admitted to the ER and then discharged, followed by individuals treated in the hospital ward see . Overall, at both time points rehabilitation needs were semi-covered across all outcome domains \u2014the only ranking difference between the time points involved occupational and speech therapies. While occupational therapy was a more frequent part of the rehabilitation program component at three months post-TBI, speech therapy was more highly ranked at six months. At each time point, psychological services were the least frequent service provided relative to documented impairment. For details, see Of the 1206 participants, approximately 30% received inpatient rehabilitation at three and six months after TBI, irrespective of the impaired outcome domains. Individuals admitted to the ICU displayed the highest rate of involvement in rehabilitation programs . At three months post-TBI, 13% of individuals admitted to a hospital ward participated in inpatient rehabilitation programs, whereas at six months after TBI, only 8% received inpatient treatment. Among all groups, individuals admitted to the ER and subsequently discharged showed the lowest percentage of participation in rehabilitation programs with 2% and 5% at three and six months, respectively. Overall, about 15% of participants received outpatient rehabilitation regardless of the impaired outcome domains. Individuals admitted to the ER and then discharged  were closely followed by those admitted to a hospital ward (14% and 18%) in terms of the frequency with which they received outpatient rehabilitation services. Approximately 12% and 14% of those admitted to the ICU took part in outpatient rehabilitation programs at three and six months, respectively. Around one-fourth did not take part in any rehabilitation programs. Nearly one-third provided no information on rehabilitation treatments at each time point with individuals admitted to the ICU showing the highest number of missing values . For details, see The group of individuals with low recovery status (GOSE scores of 2/3) had the highest number of missing values . Still, the lower the GOSE score, the lower was the likelihood of outpatient rehabilitation. For further details, see Since there was almost no difference in the three- and six-months prediction results, only the six months results are reported here. At six months post-TBI, a more severe TBI , the presence of physical and cognitive problems, and the absence of psychological problems contributed significantly to a higher probability of receiving rehabilitation services. The total ISS and clinical pathways  were included in the model according to the stepwise AIC procedure, but they generated no significant results. The corrected AUC/c-statistic produced the value of 0.84 (optimism correction of \u22120.01), indicating a strong model with excellent discriminating ability . AccordiThe present study is, to our knowledge, the first study to assess rehabilitation needs and the use of rehabilitation services in individuals with moderate-to-severe disability after TBI from the European perspective. We chose to focus on the more severe spectrum of the TBI population as their rehabilitation needs are unequivocal . The malConsistent with our first hypothesis, rehabilitation needs were reported by 90% of individuals, and these often presented within several outcome domains. However, the needs were only semi-covered across all outcome areas. Cognitive impairments were most common in the present study, followed by physical problems, problems with daily life activities, and psychological problems and speech problems. The burden of cognitive problems in the TBI population is well known , yet proIn contrast, psychological services were provided to less than one-third of the individuals reporting psychological problems, representing the service with the lowest coverage of existing needs. Psychological problems may develop for various reasons, including as a result of the brain injury, secondary to other problems in functioning or because of unmet health care and rehabilitation needs related to the TBI, such as a lack of meaningful activities at an appropriate level or problems coping with injury consequences . AccordiInpatient rehabilitation services were provided to 30% of the present population, and unsurprisingly, the highest coverage was extended to individuals admitted to the ICU, who are assumed to have the most severe injuries. Rehabilitation is considered highly beneficial for individuals after TBI; however, only 15% of patients received outpatient rehabilitation, which is considerably low given the long-term rehabilitation needs in the TBI population evidenced in earlier studies ,54.The applied model showed a good predictive ability and indicated that the probability of receiving rehabilitation depends primarily on injury-related factors, such as brain injury severity and impaired outcome domains. Consistent with our second hypothesis, injury severity, as well as physical and cognitive problems did increase the probability of receiving rehabilitation services, yet psychological problems decreased this probability. It is particularly worrisome that patients with psychological problems\u2014assumed to be a vulnerable population\u2014receive insufficient health care services . Contrary to our second hypothesis, age, sex, and geographical regions  did not predict the probability of receiving rehabilitation. One possible explanation for this finding is an increased focus on the equality of health care during the last decade. In particular, the provision of rehabilitation services for those with severe injuries is supported by the current literature, which demonstrates improved outcomes for patients with severe TBI who complete specialized in-patient rehabilitation ,55. HoweOverall, the present study highlights an inadequate provision of services, which leads to a high prevalence of unmet rehabilitation needs and emphasizes the necessity of more extensive and standardized assessment of functional impairments and corresponding rehabilitation needs. This finding may provide a starting point for further development of personalized and targeted interventions following TBI. The present study\u2019s strengths are its large sample size and the number of participating European countries, which together render a robust overview. Nevertheless, the study also exhibits some limitations. Firstly, patients with the two lowest functional recovery statuses were combined into one category, as the questionnaire version of the GOSE applied in the study cannot distinguish between vegetative status and severe disability. Further, functional impairments and the use of rehabilitation services were based on self-reports from the participants. By including the subjective experience of patients in a patient-centered rehabilitation, greater satisfaction, better adherence to treatment, and improved outcomes can be achieved; nevertheless, self-reported information can be biased , especiaSecondly, overall, more than half of the initial group of patients did not provide information on different aspects of functioning and rehabilitation services. Among those were mostly male; they also had fewer years of education on average and resided predominantly in Western and Northern European countries. They were mostly admitted to the ICU, had significantly more severe injuries and suffered from more severe disabilities post-TBI. These findings suggest that non-participation could be related to an inability to complete self-report questionnaires due to cognitive impairments. Utilizing the perspective of the families or caregivers could allow for the inclusion of more severely injured patients. At the same time, however, it would likely introduce other biases such as the overestimation of problems\u2014this may be related to a proxy\u2019s inability to accurately assess a patient\u2019s problems or the proxy\u2019s own perceptions of what is important. Thirdly, to avoid losing statistical power, the study imputed missing predictor values using the MICE procedure. Nevertheless, the influence of the imputed values was negligible, since in the final model only injury severity (GCS) and brain injury severity (brain AIS) were retained. Both variables initially showed 3% and 1% missing values, respectively. Furthermore, even if a stepwise selection procedure for model building is sometimes criticized, backward selection appears to be the best of all stepwise approaches ,58, and Finally, distinguishing between in- and out-patient rehabilitation was not possible in the regression model due to the relatively low number of observations. Therefore, future studies should provide a broader overview of various rehabilitation types by differentiating between in- and outpatient rehabilitation programs.This study indicates numerous unmet rehabilitation needs across different outcome domains for individuals with moderate-to-severe disabilities after TBI. The study results emphasize the necessity of more extensive multidimensional and standardized assessments of functional and psychological impairments and the provision of corresponding rehabilitation services. Moreover, targeted rehabilitation programs aimed at improving outcomes should involve psychological services to meet the needs of individuals after TBI. Future research studies, which take into account objective administrative data, clinical evaluations, reports of caregivers and, as well as patients reports, will further improve knowledge about rehabilitation needs and services for TBI patients."}
+{"text": "In contrast to all other areas of medicine, psychiatry is still nearly entirely reliant on subjective assessments such as patient self-report and clinical observation. The lack of objective information on which to base clinical decisions can contribute to reduced quality of care. Behavioral health clinicians need objective and reliable patient data to support effective targeted interventions.We aimed to investigate whether reliable inferences\u2014psychiatric signs, symptoms, and diagnoses\u2014can be extracted from audiovisual patterns in recorded evaluation interviews of participants with schizophrenia spectrum disorders and bipolar disorder.We obtained audiovisual data from 89 participants : individuals with schizophrenia spectrum disorders (n=41), individuals with bipolar disorder (n=21), and healthy volunteers (n=27). We developed machine learning models based on acoustic and facial movement features extracted from participant interviews to predict diagnoses and detect clinician-coded neuropsychiatric symptoms, and we assessed model performance using area under the receiver operating characteristic curve (AUROC) in 5-fold cross-validation.The model successfully differentiated between schizophrenia spectrum disorders and bipolar disorder (AUROC 0.73) when aggregating face and voice features. Facial action units including cheek-raising muscle (AUROC 0.64) and chin-raising muscle (AUROC 0.74) provided the strongest signal for men. Vocal features, such as energy in the frequency band 1 to 4 kHz (AUROC 0.80) and spectral harmonicity (AUROC 0.78), provided the strongest signal for women. Lip corner\u2013pulling muscle signal discriminated between diagnoses for both men (AUROC 0.61) and women (AUROC 0.62). Several psychiatric signs and symptoms were successfully inferred: blunted affect (AUROC 0.81), avolition (AUROC 0.72), lack of vocal inflection (AUROC 0.71), asociality (AUROC 0.63), and worthlessness (AUROC 0.61).This study represents advancement in efforts to capitalize on digital data to improve diagnostic assessment and supports the development of a new generation of innovative clinical tools by employing acoustic and facial data analysis. Approximately 20% of individuals aged 15 years and older experience psychiatric illness annually . PsychiaIn recent years, progress has been made in audiovisual data processing -21. AdvaConcurrently, alterations in facial expressivity accompany several psychiatric illnesses: flat or inappropriate affect in individuals with schizophrenia, euphoric or labile affect in mania, and slowed or diminished facial movements in depression . Video aAudiovisual patterns represent an easily extractable, naturalistic, universal, and objective data that could serve as viable digital biomarkers in psychiatry, contributing adjunctive information about a patient, beyond what can be assessed solely through traditional means. No study, to the best of our knowledge, has explored the potential for using audiovisual data to discriminate between a diagnosis of schizophrenia or bipolar disorder, a task which can be challenging for behavioral health clinicians given significant symptom overlap ,53, espeWe aimed to differentiate between schizophrenia spectrum disorders and bipolar disorder using audiovisual data alone. We hypothesized that physiological data from voice acoustics and facial action units could be used to distinguish between individuals with schizophrenia spectrum disorders and individuals with bipolar disorder and that these signals would be associated with specific psychiatric signs and symptoms.Participants between the ages of 15 and 35 years old diagnosed with schizophrenia spectrum disorders or bipolar disorder were recruited from Northwell Health Zucker Hillside Hospital\u2019s inpatient and outpatient psychiatric departments. Diagnoses were based on clinical assessment of the most recent episode and were extracted from participant\u2019s medical record at the time of consent. Most participants with schizophrenia spectrum disorders were recruited from the Early Treatment Program, which is a specialized outpatient early psychosis intervention clinic. Individuals with psychiatric comorbidities (such as substance use disorders) were included. Participants with known physical impairments  capable of impacting facial movements or acoustic capabilities were excluded. Eligible participants were recruited by a research staff member. Healthy volunteers who had already been screened for prior studies were also recruited. Recruitment occurred between September 2018 and July 2019. The study was approved by the institutional review board (18-0137) of Northwell Health. Written informed consent was obtained from adult participants and legal guardians of participants under 18 years. Assent was obtained from minors. All participants received treatment as usual.Participants were assessed at baseline and invited to return for optional quarterly assessments thereafter for a maximum of 12 months. Healthy volunteers were assessed at baseline and invited to return for optional assessments at month 6 and month 12. At each visit, all participants, including healthy volunteers, were interviewed by a trained and reliable research rater utilizing the Brief Psychiatric Rating Scale (BPRS) , Scale fRaw data were stored in a firewalled server and were never shared outside of Northwell Health. The processing of high-level features was implemented locally, and only those features were used for further analysis outside the raw data server. High-level feature data remained within Health Insurance Portability and Accountability Act\u2013compliant servers.Before extracting acoustic features, saturation, if present, was removed by identifying time points with amplitudes higher than 99.99% of the maximum value, and given that recordings involved the use of two audio channels , we extracted only the participant\u2019s voice.Acoustic features were extracted using the OpenSMILE open-source toolbox . We usedFor facial features, we used openFace software . This toBoth facial action units and acoustic time series were downsampled to 10 Hz  and aligned. We then fragmented each interview into consecutive 1.5-minute blocks. In each block, we derived 2 sets of aggregate features  to help ensure that the silence between answers did not have an effect on acoustic feature values and that the dynamics of facial action units in both conditions were captured by the models. Mean value and standard deviation were computed for each feature and for each 1.5-minute block. For better classification generalization and to reduce overfitting, we augmented each interview 25 times by selecting only 1 out of 2 consecutive blocks randomly for each block in the sequence.We explored 2 main classification tasks: differential diagnosis, assigning an interview as belonging to a specific group (either schizophrenia spectrum disorders or bipolar disorder) based purely on physiological patterns, and symptom detection, predicting the presence of a psychiatric sign or symptom. In total, 75 classification tasks were run, each corresponding to the 75 unique psychiatric signs and symptoms assessed with the BPRS (18 items), SANS (22 items), YMRS (11 items), and HAMD (24 items). For each classification task, participants were assigned to the positive class if their symptom score exceeded the clinical threshold of at least mild severity: score \u22653 on BPRS items (range 1-7), score \u22652 on SANS items (range 0-5), score \u22652 or \u22654 on YMRS items , and score \u22652 or \u22651 on HAMD items . Total scores could range from 18 to 126 for the BPRS, 0 to 110 for the SANS, 0 to 60 for the YMRS, and 0 to 76 for the HAMD.For each classification task, we computed 2 independent models for both men and women. This was done to prevent possible sex-specific physiological confounds in voice and face to impact the results, as the bipolar disorder group was composed of a majority of women. Additionally, we aimed to build models that were not individual-dependent.All inferences were undertaken using a gradient boosting classifier   had similar average interview durations, We removed the final few minutes from the end of the lengthier interviews (corresponding to the difference between the average length in each class) to ensure that interview duration was not a confounding factor in classification performance, because longer interviews would provide greater statistical sampling of the features.We investigated 3 different models including a Face model , a Voice model , and a Face\u2013Voice model, which was constructed by averaging the probability outputs of the Face model and the Voice model. For each inference, 5-fold AUROC, accuracy, accuracy chance (the accuracy one would get by randomly attributing the classes), and F scores (for both classes of the classification) were calculated. A threshold of 0.5 was used to compute accuracy and F scores. To rank features (to assess which ones were most predictive), we used a 5-fold AUROC for each feature sequence alone. We report the most successful models per modality .In total, 89 participants  with schizophrenia spectrum disorders (n=41), bipolar disorder (n=21), and healthy volunteers (n=27) were included , resultiDifferential diagnosis classification performed well (5-fold AUROC 0.73) when aggregating features from both face and voice . Facial We identified some features that discriminated well between schizophrenia spectrum disorders and bipolar disorder across both sexes: lip-corner pulling (AU12), which represented the movement of lip corners pulled diagonally by the zygomaticus major muscle  for which the mean value was higher on average for participants with schizophrenia spectrum disorders than for participants with bipolar disorder . The timBest performing models were derived from the SANS scale, predominantly from the affective flattening and blunting subgroup , avolition/apathy subgroup , and asociality/anhedonia subgroup . Two items passed the performance threshold from the BPRS (blunted affect and motor retardation), and 2 others were derived from the HAMD scale (work interest and worthlessness). No signs or symptoms from the YMRS passed the performance threshold criteria.Voice outperformed facial action units for blunted affect (5-fold AUROC 0.81), whereas facial action units outperformed voice for unchanging facial expression (5-fold AUROC 0.64) . Synergyr=0.35; P<.001) between work and interests and blunted affect, and a correlation  between avolition and affective flattening.Voice alone outperformed facial action units for several items including asociality (5-fold AUROC 0.63) and work and interests (5-fold AUROC 0.64) . Facial r= \u20130.27, P=.004). Specifically, a reduction in the average amount of energy in high frequencies was associated with the presence of this symptom. In addition to affecting voice quality or timber , high frequencies (1-4 kHz) are typical in shaping consonants through rapid air motion from the mouth and through the teeth. In contrast, vowels are generally in the lower frequencies (500 Hz) and contain the majority of the voice energy. Clinically, mismatch between the acoustic frequencies of vowels and consonants jeopardizes the natural sound of the voice and leads to a reduction in speech intelligibility. This observation is stable across sex.Among the top acoustic features  for objer= \u20130.26, P=.002 during speaking). When the symptom is present, the standard deviation of this feature is decreased.Among the top facial action unit features  for the r=0.30, P=.001, calculated over all participants)  .We aimed to explore the feasibility of utilizing audiovisual data extracted from participant interviews for psychiatric diagnoses and to predict the presence of psychiatric signs and symptoms. Our results indicate that computational algorithms developed from vocal acoustics and facial action units can successfully differentiate between participants with either schizophrenia spectrum disorders or bipolar disorder, as well as identify the presence of several psychiatric signs and symptoms with high degrees of accuracy. Both acoustic and facial action unit features could be independently used to differentiate between participants with schizophrenia spectrum disorders and bipolar disorder in our data set, and integrating the two modalities produced the strongest signal, as previously seen in studies of depression -66, suggWe also identified audiovisual features common to both sexes that successfully differentiated between diagnostic categories. In line with prior work demonstrating altered facial expressivity in individuals with psychiatric disorders ,54,71,72Some top features contributing to the diagnostic classification remained stable throughout the course of the interview, while others changed depending on the temporal pattern. For example, AU12 (lip-corner pulling), demonstrated a consistent downward trend for all participants, whereas the energy of the voice signal in the frequency band 1-4 kHz remained mostly flat. These same trends were noted in healthy volunteers as well, suggesting that the identified differences in facial activity and voice represent subtle pathological variations in the frequency or intensity of otherwise healthy activity. The amount of high frequency energy in the voice, for example, may represent a subtle state marker of psychiatric illness or perhaps a physiological response to certain medications, impacting speech intelligibility. Additionally, activating lip corner\u2013pulling muscles more at the start of an assessment (perhaps to produce a smile) may represent a healthy behavior , though the frequency and degree of activation is what separates those with schizophrenia spectrum disorders from those with bipolar disorder.Our findings suggest that a tool capable of extracting and analyzing audiovisual data from newly identified psychiatric patients might offer valuable collateral clinical information, supporting a more reliable approach to differential diagnoses. Accurately diagnosing someone as having either schizophrenia spectrum disorders or bipolar disorder is a critical first step in selecting appropriate medications and therapeutic interventions, and a task that is often challenging to behavioral health clinicians given significant symptom overlap ,53, espeSeveral psychiatric signs and symptom inferences were accurately made using features extracted from voice and face either individually or combined. Similar to the findings of prior studies ,45,71, tThere are several noteworthy limitations to our study. First, while prior analyses using machine learning on audio and visual features have enrolled comparable sample sizes ,25,48, aAudiovisual data hold promise for gathering objective, scalable, noninvasive, and easily accessed, indicators of psychiatric illness. Much like an x-ray or blood test is routinely used as adjunctive data to inform clinical care, integrating audiovisual data could change the way mental health clinicians diagnose and monitor patients, enabling faster, more accurate identification of illness and enhancing a personalized approach to medicine. This would be a significant step forward for psychiatry, which is limited by its reliance on largely retrospective, self-reported data."}
+{"text": "I\u03baB\u03b1 is considered to play an almost exclusive role as inhibitor of the NF-\u03baB signaling pathway. However, previous results have demonstrated that SUMOylation imposes a distinct subcellular distribution, regulation, NF-\u03baB-binding affinity and function to the I\u03baB\u03b1 protein. In this review we discuss the main alterations of I\u03baB\u03b1 found in cancer and whether they are (most likely) associated with NF-\u03baB-dependent or NF-\u03baB-independent (moonlighting) activities of the protein. I\u03baB\u03b1 is considered to play an almost exclusive role as inhibitor of the NF-\u03baB signaling pathway. However, previous results have demonstrated that SUMOylation imposes a distinct subcellular distribution, regulation, NF-\u03baB-binding affinity and function to the I\u03baB\u03b1 protein. In this review we discuss the main alterations of I\u03baB\u03b1 found in cancer and whether they are (most likely) associated with NF-\u03baB-dependent  or NF-\u03baB-independent (moonlighting) activities of the protein.2O2, EGF  or pervanadate, induce tyrosine phosphorylation of I\u03baB\u03b1 (at Y42) that leads to NF-\u03baB activation both independent or dependent on I\u03baB\u03b1 degradation [NF-\u03baB signaling plays an essential role as regulator of the immune system and inflammation. In addition, it contributes to several aspects of tumorigenesis by direct modulation of cellular functions such as proliferation, apoptosis inhibition or cellular migration. The mammalian NF-\u03baB family of proteins is composed of five transcription factors (TF), RelA p65), RelB, c-Rel, p105/p50 (NF-\u03baB1) and p100/p52 (NF-\u03baB2), that can induce gene transcription as combinations of homo- and heterodimers, the p50/p65 heterodimer being the most prevalent. Under basal conditions, NF-\u03baB TFs are maintained in an inactive state in association with the inhibitors of kappaB (I\u03baB), which impose NF-\u03baB cytoplasmic retention. Canonical NF-\u03baB activation induced by PAMPs (Pathogen-associated molecular patterns) and pro-inflammatory cytokines is initiated by the IKK kinase complex that phosphorylates I\u03baB thus inducing K48-linked ubiquitination at K21 of I\u03baB and proteasomal degradation, leading to release of NF-\u03baB TFs that then translocate to the nucleus to activate specific gene transcription . Other s, RelB, cradation ,8.Constitutive activation of the NF-\u03baB pathway has been identified in multiple solid and hematopoietic tumors by either detection of nuclear NF-\u03baB factors or by presence of NF-\u03baB-related transcriptional patterns. Several mechanisms including gene amplification or overexpression, chromosomal rearrangement, mutations, truncations and splicing variants have been found to impose constitutive NF-\u03baB activation in cancer. In some cases, elevated NF-\u03baB activity is associated with defective I\u03baB function ,10.The I\u03baB proteins, including I\u03baB\u03b1, I\u03baB\u03b2, I\u03baB\u03b5, I\u03baB\u03b6, Bcl-3 (B-cell lymphoma 3-encoded protein), and the precursor Rel proteins p100 (I\u03baB\u03b4) and p105 (I\u03baB\u03b3), are structurally characterized by the presence of multiple ankyrin repeats, which mediate protein\u2013protein interaction and cytoplasmic NF-\u03baB retention. Although this family of proteins is primarily known from its almost exclusive role in canonical NF-\u03baB inhibition . I\u03baB\u03b1 caDrosophila melanogaster [Caenorhabditis elegans [Caenorhabditis elegans, as the rest of nematodes, lacks recognizable NF-\u03baB factors, strongly suggesting that nuclear and polycomb-related I\u03baB\u03b1 functions appeared in the evolution before or in parallel to its role as NF-\u03baB inhibitor.Transcriptional regulation mediated by chromatin-bound I\u03baB\u03b1 affects about 10% of all PRC2 target genes in the different models studied, and involves genes related with development, stemness and tissue homeostasis ,14,16. Inogaster  and CaenTherefore, there is cumulative data indicating that alterations related with I\u03baB\u03b1 function not only affect NF-\u03baB pathway but I\u03baB\u03b1 exerts moonlighting functions including regulation of PRC2 activity on specific gene sets, which are pivotal for cancer initiation and progression.NFKBIA, the gene codifying for I\u03baB\u03b1, in cancer were detected in Hodgkin lymphoma (HL), a B-cell lymphoma developed in lymph nodes, characterized by the presence of giant Reed-Sternberg (RS) cells. Several inactivating mutations  in this gene are the direct cause of constitutive activation of the NF-\u03baB pathway observed in RS cells. These mutations produce non-functional proteins, which usually lack fragments of the ankyrin domain and/or the C-terminal region. About 37% of HL patients show NFKBIA mutations, with more than 18% of them having loss-of-function mutations  [The first mutations of alleles) ,20,21.NFKBIA were also found in around 22% of patients with Gray zone lymphoma (GZL), a rare hematological disease with features intermediate between large B-cell lymphoma (LBCL) and classical HL. These mutations (non-sense or frameshift) are among the most prevalent in GZL patients [Mutations in NFKBIA mutations has also been reported in diffuse large B-cell lymphoma (DCLBL) patients [RELA have been found to impose constitutive NF-\u03baB activation in these cells [mediastinal large B-cell Lymphoma (MLBCL), a subtype of DCLBL with clinical and molecular features that resemble the ones observed in HL patients [A high presence of patients  and in tpatients , which rse cells ,25. Notapatients , which lpatients .chronic myeloid leukemia (CML), a myeloproliferative disorder driven by the BCR-ABL translocation. In this type of cancer, I\u03baB\u03b1 is expressed at high levels and associated with the BCR-ABL and p53 proteins. This complex imposes cytoplasmic retention of p53 thus precluding its nuclear activity as tumor-suppressor [Trp53-deficient mouse model [In addition to its linkage with B-cell neoplasms, aberrant I\u03baB\u03b1 function was also detected in ppressor . A crossse model  and acutse model .ectodermal dysplasia, mutations leading to N-terminal truncation of I\u03baB\u03b1 leading to a non-degradable protein with higher inhibitory activity on NF-\u03baB have been identified [In entified  but the NFKBIA gene likely associated with altered protein activity or gene expression. For example, polymorphisms localized in regions that may affect the rate of protein degradation are more frequent in multiple myeloma patients than in healthy subjects [Moreover, different hematological diseases have been linked to the presence of polymorphisms in the subjects ,33. Somesubjects ,19, furtNFKBIA mutations promote cancer initiation and/or progression through activation of NF-\u03baB signaling or by alternative NF-\u03baB-independent mechanisms in the different systems has not directly been analyzed.In general, whether grade IV glioblastoma patients demonstrated reduced expression of I\u03baB\u03b1 in these tumors. Reduced I\u03baB\u03b1 levels in glioblastoma was not linked to mutations in the coding or promoter regions of the NFKBIA gene, but to gene copy number alterations. Monoallelic deletions were detected at low frequency in classical glioblastoma (~6%) and were more common in non-classical subtypes (~25%). Notably, heterozygous NFKBIA deletion and EGFR amplifications are mutually exclusive suggesting that both alterations impact in the same pathway, which should be further investigated. NFKBIA deletions and reduced I\u03baB\u03b1 levels are significantly associated to unfavorable outcomes and tumor recurrence in patients [NFKBIA gene or I\u03baB\u03b1 protein by nanoparticles induced apoptosis and increased the sensitivity of tumor cells to chemotherapy [of NFKBIA, which leads to reduced expression of I\u03baB\u03b1, is more frequently present in glioblastoma patients than in the healthy population and is associated to poor prognosis [It has consistently been observed that NF-\u03baB activity is significantly higher in brain tumors than in normal tissues ,35. Notapatients ,37,38. Iotherapy . In addirognosis .lower-grade glioma (LGGs), which is a heterogeneous group of brain tumors that can progressively evolve into higher-grade gliomas, heterozygous NFKBIA deletions are observed in approximately 7% of patients, being more common in the more advanced stage III tumors (~11%) than in stage II tumors (~3%). Moreover, it was demonstrated that both NFKBIA deletion and reduced levels of I\u03baB\u03b1 are associated with tumor aggressiveness and poor prognosis. In fact, the dosage of NFKBIA was identified as an independent factor for 5-year survival and recurrence-free survival [In survival .Multiple evidences indicate a pro-tumorigenic activity of constitutive or aberrant NF-\u03baB signaling in several solid tumors including skin , prostatlung cancer patients, loss of heterozygosity (LOH) in 14q, where the NFKBIA gene is localized, was previously identified [NFKBIA silencing as a driving force in the development of this subset of tumors [NFKBIA may support defective I\u03baB\u03b1 expression [Despite the high frequency of increased NF-\u03baB activity in solid tumors, alterations in I\u03baB\u03b1 function have marginally been identified. In entified . A diffef tumors . Whole gpression . In addipression . Importapression . In contpression .NFKIA gene was found among the most frequently mutated genes in whole-exome sequencing analysis of nasopharyngeal carcinoma patients. The identified mutations include missense single nucleotide variations or insertions/deletions that result in stop codon gain or changes in frameshift, especially in the ankyrin repeat region. These loss-of-function mutations lead to protein truncation that induce altered NF-\u03baB response. Loss of 14q region, containing the NFKIA locus, was also observed in a high proportion of nasopharyngeal carcinoma patients [NFKIA but also NFKBIB gene was found to be silenced in most nasopharyngeal carcinoma tumors leading to increased NF-\u03baB signaling [The patients ,58,59,60ignaling .NFKIA gene also play an important role in different solid tumors, although the association between NFKIA polymorphisms and cancer susceptibility varies among the different populations and tumor types. For example, a polymorphism (A > G) in the 3\u2032UTR of NFKBIA and insertions/deletions in the promoter region were found to increase the predisposition to colorectal cancer [gastric cancer [ovarian [melanoma [NFKIA were associated with increased risk of HBV (hepatitis B virus)-induced hepatocellular carcinoma (HCC) [prostate cancer in the Chinese population [Polymorphisms in the l cancer ,63 and wl cancer . Other pc cancer , ovarian[ovarian  or melanmelanoma , and polma (HCC)  and prospulation . Moreovepulation .skin cancer. In particular, nuclear I\u03baB\u03b1, which is robustly detected in non-transformed basal-layer keratinocytes, is lost in transformed cells (mutant H-RasV12 plus \u0394Np63\u03b1) as well as in samples from patients with aggressive squamous cell carcinoma (SCC). Moreover, loss of nuclear I\u03baB\u03b1 and cytoplasmic accumulation was progressively acquired with tumor malignization [HOX homologues. HOX genes deregulation is a common trait in cancer .S32,36A super-repressor (SR) mutant in basal-layer keratinocytes. Unexpectedly, these mice, which display constitutive NF-\u03baB inhibition, developed hyperplasia and spontaneous SCC within 3 months [S32,36A that contains an additional stabilizing deletion of the COOH-terminal PEST sequence [KRAS (G12V) increased tumor invasiveness [The relevance of I\u03baB\u03b1 in skin homeostasis and tumorigenesis was repeatedly demonstrated in different mouse models. In 1999, Van Holgerliden and colleagues generated mouse lines expressing the I\u03baB\u03b13 months . A compasequence . Moreovesiveness . Togetheintestinal stem cell compartment. Indicative of its functional relevance, mice deficient on I\u03baB\u03b1 showed fetal traits in the intestinal stem cell population and increased regeneration capacity after intestinal damage [Nuclear I\u03baB\u03b1 was also robustly detected in the l damage . Based ol damage  and H4 [l damage . Loss ofl damage ,78).NF-\u03baB has been considered as a targetable pathway in cancer for many years. However, general inhibition of NF-\u03baB signaling was found to be extremely toxic due to its widespread effects (reviewed in ). One ofIL6, CyclinD1, cIAP). In contrast, altered nuclear I\u03baB\u03b1 activity may either inhibit or potentiate PRC2-mediated regulation of stem cell- or differentiation-related transcription thus precluding physiologic gene regulation modulated by signals provided by the tumor stroma or the stem cell niche   . This po"}
+{"text": "Objective: Pulmonary vascular resistance (PVR) is a measurement obtained with invasive right heart catheterization (RHC) that is commonly used for management of patients with pulmonary arterial hypertension (PAH). Computed tomography pulmonary angiography (CTPA) is also done as part of the workup for PAH in some cases. The aim of our study was to assess the correlation of contrast dynamic changes in the main pulmonary artery (MPA) on CTPA with PVR obtained with RHC.Methods: This is an IRB-approved retrospective study performed in two separate institutions  between January 2010 and December 2013. During CTPA done as test bolus, serial images are acquired at the level of MPA after intravenous injection of contrast to determine timing of the CT acquisition. Since the PVR changes with the degree of PAH, we hypothesize that will be reflected in the contrast kinetics in MPA. A correlation of standard CT metrics  and dynamic  CTPA parameters in patients with known PAH was performed with PVR obtained from RHC done within 30 days. Statistical analysis was performed by Pearson correlation coefficient.Results: Among 221 patients in our database, 37 patients fulfilled the selection criteria. There was a strong correlation between full width half maximum (FWHM) and mean pulmonary artery pressure (mPAP) , PVR  and indexed PVR (PVRI) .Conclusion: FWHM obtained from CTPA strongly correlates with RHC parameters and is potentially more helpful than static measurements for follow-up of patients with known PAH to assess response to treatment or progression. Pulmonary arterial hypertension (PAH) is defined as a mean pulmonary artery pressure (mPAP) of 25 mm Hg or more at rest, measured at right heart catheterization (RHC) . PulmonaThis is an institutional review board (IRB)-approved retrospective study performed in two separate institutions  and adhered to Health Insurance Portability and Accountability Act requirements. Patient\u2019s consent was waived as per IRB guidelines.Patients with known PAH  who hadCTPA techniqueCTPA was performed on a 64 slice multidetector CT  in both the institutions. Similar protocols were used for bolus tracking in both institutions injecting 15 mL of intravenous nonionic contrast  at 3 ml/sec via an upper extremity venous access and repeated axial images with breath hold at the level of the main pulmonary artery, using 100 - 140 kV and 250-450 mA and 2.5 mm slice thickness, scanned at two-second intervals until the contrast opacification of the ascending aorta.Image analysisCTPA images were analyzed on dedicated picture archiving and communication system (PACS) workstations  by fellowship-trained board-certified cardiothoracic radiologists with 10 and 12 years of experience in one institute and eight and 25\u00a0years of experience in the other institute. The radiologists were blinded to the RHC data. ROI (size = 1 cm2) was placed on the center of the main pulmonary artery (MPA) and a time attenuation curve was generated based on attenuation values in Hounsfield Units (HU). From this time attenuation curve, full width at half maximum (FWHM) was calculated. FWHM of the test bolus is the width of the main pulmonary artery enhancement curve at half its maximum density.Figure Similarly, aortic diameter was obtained at the same level for assessment of MPA/aorta ratio Figure . AdditioStatistical analysisPearson correlation coefficients were calculated by using Microsoft Excel software between FWHM with mPAP, PVR and PVRI. Correlations with these angiographic parameters were also assessed with all other conventional parameters measured from the CT test bolus data. A P-value of <0.05 was considered statistically significant.Patient population and demographicsWe identified 221 patients in our database who had undergone CTPA study between January 2010 to December 2013 for evaluation of pulmonary hypertension. Among those patients, 52 were identified who had a CTPA study for evaluation of pulmonary hypertension and also had an RHC within one month of CTPA. Of these 52 patients, 37 fulfilled the selection criteria. Eight patients were excluded due to breathing motion and streak artifacts during contrast bolus. Seven patients were excluded due to inadequate duration of test bolus injection. Our selected patient population comprised 26 female and 11 male patients with an age range between 30 to 85 years.Correlation of test bolus (CTPA) with right heart catheterization dataA correlation of established CT parameters including main pulmonary artery diameter (MPA), right and left main pulmonary artery diameters (RPA and LPA), MPA/aorta ratio, and RV/LV ratio was obtained with RHC data Table . Table 1There was a strong correlation between FWHM and mPAP , PVR  and PVR  Figure , 3b, 3c.RHC hemodynamic measurements, including mPAP, PVR and PVRI, are markers of severity of pulmonary hypertension. They are also used to predict prognosis and survival in patients with PAH . In thisIncreased mPAP and PVR lead to eventual right ventricle (RV) dysfunction . ChangesDilatation of the central pulmonary arteries can be seen in patients with PAH. Previous studies have shown that a diameter of MPA measuring 29 mm or more has 87% sensitivity and 89% specificity for PAH . HoweverWe recognize a few limitations of our study. This is a retrospective study with a small sample size. Patient factors other than altered pulmonary hemodynamics can also affect the density measurements, such as variation in the phase of respiration, dilution caused by unopacified blood pool from inferior vena cava, differences in end diastolic right ventricular volume, pulmonary valvular regurgitation, and heart rate variation to name a few. Anatomic factors such as site of contrast injection  and body habitus were not controlled. Our study lacked a control group without pulmonary hypertension. Another limitation is the rate of contrast injection may not be similar in different institutions, which may change the graph. We think that further research with a larger cohort, inclusion of normotensive patients and assessment of subtypes of pulmonary hypertension will provide a better perspective.FWHM calculated from the dynamic images during test bolus of CTA is an easily available, simple to perform, reliable, and noninvasive quantitative measure. Our study shows a very strong correlation between this CTA parameter and mPAP and PVR/PVRI obtained on right heart catheterization in pulmonary hypertension, whereas the traditionally used morphological CT measurements such as diameter of main and branch pulmonary arteries or RV/LV ratio did not show significant correlation.Since CTPA is performed as a part of routine workup for pulmonary hypertension, this has a potential for diagnosis as well as follow-up for assessing the treatment response or disease progression. It may also help to detect subclinical cases of pulmonary hypertension on CTPA studies done for other indications enabling early diagnosis and treatment."}
+{"text": "Mid-depth North Pacific waters are rich in nutrients and respired carbon accumulated over centuries. The rates and pathways with which these waters exchange with the surface ocean are uncertain, with divergent paradigms of the Pacific overturning: one envisions bottom waters upwelling to 1.5\u2009km depth; the other confines overturning beneath a mid-depth Pacific shadow zone (PSZ) shielded from mean advection. Here global inverse modelling reveals a PSZ where mean ages exceed 1400 years with overturning beneath. The PSZ is supplied primarily by Antarctic and North-Atlantic ventilated waters diffusing from below and from the south. Half of PSZ waters re-surface in the Southern Ocean, a quarter in the subarctic Pacific. The abyssal North Pacific, despite strong overturning, has mean re-surfacing times also exceeding 1400 years because of diffusion into the overlying PSZ. These results imply that diffusive transports \u2013 distinct from overturning transports \u2013 are a leading control on Pacific nutrient and carbon storage. The deep North Pacific is the end of the road for global ocean circulation, but the circulation patterns and ventilation are poorly understood. Here the authors show that diffusive transports both along and across density layers play a leading role in returning 1,400 year old water to the surface. The mid-depth North Pacific thus constitutes a vast reservoir of remineralized nutrients and respired carbon accumulated over a long time6. When the waters of this reservoir are returned to the surface, their high nutrient content supports biological production and their respired carbon can outgas to the atmosphere. While the ventilation of the deep Pacific is thus important for ocean biogeochemistry and climate, there is a great deal of uncertainty about the pathways and rates with which the deep Pacific and the surface ocean exchange water, with divergent schools of thought on the nature of the deep Pacific overturning circulation8.The world\u2019s oldest seawater can be found in the mid-depth North Pacific where estimates of the ideal mean age exceed 1300 years11. This concept is epitomized by a schematic of the large-scale interbasin overturning circulation that has since been elaborated and refined based on absolute geostrophic transports12 and more comprehensive inverse modelling of observed tracer properties15. Schematics of the global overturning circulation have become an entrenched conceptual framework for discussing the ocean circulation and its climate-driven changes. However, these schematics are widely acknowledged to be an oversimplification of oceanic transport16, in large part due to their inability to adequately capture the role of eddy-diffusive mixing across different branches of the overturning circulation and between vigorously flowing and more stagnant regions such as the deep Pacific. An analysis of the local fraction of water in transit between specified surface regions in ocean models19 revealed that the pathways depicted in typical overturning schematics only capture the paths that are fast on the scale of the most probable interior residence time and that these advectively dominated fast paths carry typically much less than half the formation-to-reexposure flow rate. The bulk of the flow is carried by paths that explore much larger fractions of the ocean volume, and asymptotically slow paths are organized into the deep North Pacific by what has been dubbed the diffusive conveyor17.The global pathways of newly formed deep water, and the mechanisms through which dense deep waters gain buoyancy to return to the surface, have long been of fundamental interest in oceanography. The observed radiocarbon age of water and simple mixing analyses of hemispherically distinct quasi-conservative properties have led to the concept of the great ocean conveyor20 for the deep overturning of the Pacific  Although this paradigm does not commit to a definite latitudinal distribution of the upwelling AABW, its most recent schematic7 and its precursors11, as well as results from tracer inversions15, suggest a broad overturning cell that reaches above 2.5 km depth and into the Northern Hemisphere  By contrast, it was recently argued8 that the area of seafloor intersected by a given density class is a key control on buoyancy-flux divergences and hence overturning. Because 85% of the seafloor lies at depths greater than 2.5 km, this argument implies a vertically compressed abyssal Pacific overturning with southward return flow below\u2009~2.5 km depth  that assimilates the observed global distributions of potential temperature, salinity, CFC-11, CFC-12, natural radiocarbon (\u039414C) and \u03b43He, plus sea-surface height, and surface fresh-water and heat fluxes (see Methods). Due to the inclusion of multiple tracers, as well as dynamical constraints2, the OCIM is much better constrained than geostrophic box inverse models24 constructed from hydrographic sections. The OCIM\u2019s high fidelity to the observed tracer distributions and its matrix formulation of the advective-diffusive flux-divergence operator, which allows efficient implementation of Green-function-based diagnostics (see Methods), makes it one of the best available tools for investigating oceanic transport.Here we investigate the overturning circulation and ventilation of the deep Pacific using a steady global Ocean Circulation Inverse Model  The uncertainty of any quantity X reported here is the half-range spread X across the three states. Note that because the OCIM is optimized for each state to fit the observational constraints as closely as possible, the sensitivities quantified here are smaller than the sensitivities to the same changes in \u03ba\u22a5 expected for a forward ocean model. Based on the OCIM circulation, we define shadow and abyssal zones of the North Pacific and systematically quantify the advective-diffusive transport that ventilates these zones and re-exposes their water back to the atmosphere.To assess the sensitivity of our results to the values of We find that both paradigms of the overturning capture aspects of the meridional mean transport of the Pacific, but neither gives a completely accurate picture. In accord with the shadowed conveyor paradigm, the deep overturning is vertically compressed with a well-defined overlying shadow zone, but the shadow zone gradually erodes with decreasing latitude into the Southern Hemisphere. The standard conveyor, if broadly interpreted as representing Lagrangian diffusive paths, captures the diapycnal transport through the Pacific shadow zone, but does not capture the shadow zone itself or the vertically compressed overturning beneath. Here, we provide a more complete picture that quantifies the importance of both Southern Ocean and North Atlantic ventilated waters in supplying the Pacific shadow zone. Our results highlight that the subarctic Pacific, in addition to the Southern Ocean and tropical Pacific, is an important region for re-exposing shadow-zone water back to the atmosphere. A quantification of the surface-to-interior and interior-to-surface path densities, transport rates, and associated mean transit times allows us to contrast a diffusively ventilated shadow zone with the advectively ventilated abyssal region beneath.32) has a deep cell with northward streamflow of AABW well into the Northern Hemisphere; abyssal inflows and outflows across the equator are roughly 8 Sv. The maximum deep overturning of 8.6\u2009\u00b1\u20090.3 Sv (1 Sv\u2009=\u2009106\u2009m3\u2009s\u22121) at\u2009~6\u2218S and neutral density \u03b3\u2009=\u200928.12\u2009kg\u2009m3 is consistent with the estimate of 10.6\u2009\u00b1\u20091.7 Sv for flow through the Samoan and adjacent passages based on moorings and hydrography36, but significantly smaller than the\u2009~14 Sv of AABW inflow inferred from absolute geostrophic velocities37. Contrary to the standard conveyor paradigm, the deep overturning cell is vertically compressed and does not feature southward flow centred around \u03b3\u2009=\u200927.8 kg\u2009m\u22123. In broad agreement with theoretical predictions based on density transformation driven by exposure to the seafloor8, the change in direction from abyssal northward flow to overlying southward flow lies around \u03b3\u2009=\u200928.1 kg\u2009m\u22123, and the southward mean flow north of\u2009~30\u2218S is approximately confined to depths below 2.5 km. Note that both paradigms allow a few Sv of upwelling into the thermocline circulation. Here, the vertical streamflow across 2.5 km depth is generally weak but by\u2009~30\u2218S approaches roughly\u2009~4 Sv, reaching as high as \u03b3\u2009=\u200927.4 kg\u2009m\u22123 and onward into the thermocline. The sensitivity of the PMOC to a factor-of-2 change in \u03ba\u22a5 leads to a PMOC half-range .The North Pacific between roughly 1.5 and 3\u2009km depth is largely shielded from the PMOC and can thus be considered a shadow zone it Fig.\u00a0c. This r\u2193 provides a measure of the degree of isolation from the overturning, the mean time to next ventilation anywhere at the surface  diffuses upward out of the direct influence of the overturning, thus imparting these waters with the ocean\u2019s longest mean re-exposure times. The local mean residence time of water in the ocean interior  is given by \u0393\u2193\u2009+\u2009\u0393\u2191 (not shown), which has only weak vertical gradients in the North Pacific below roughly 1.5\u2009km depth. The sensitivity of \u0393\u2191 to changes in \u03ba\u22a5  as the region of the North Pacific bounded horizontally by 1.5 and 3 km depth and vertically by the equator, and we define the Pacific Abyssal Zone (PAZ) as the region immediately beneath the PSZ Fig.\u00a0. We do n\u2193 of water destined for a given interior zone  that is bound to make next contact with a specified destination region. To avoid overcounting, we exclude fluid elements that make repeat contact with the origin region or make contact with the sea surface along the way (see Methods). Importantly, these fluxes are thus one-way (or gross) fluxes42 that are more useful ventilation metrics than the net volume fluxes because the one-way fluxes govern surface\u2013interior tracer exchange which can be non-zero even for zero net flux43.Maps of the surface ventilation flux \u03a6one Fig.\u00a0a, c and one Fig.\u00a0b, d reve\u2193 is dominated by the high-latitude deep-water formation regions: The subpolar North Atlantic and Nordic Seas, and the Weddell and other Antarctic marginal seas. The pattern of the re-exposure flux \u03a6\u2191 is largest in the Southern Ocean, in regions of tropical upwelling, and in the subarctic Pacific . While revealing, the differences between the normalized flux patterns are small, with peak differences in the zonally integrated patterns on the order of 1% of the total global flux per degree latitude. This underlines that the geographic locations of the conduits into and out of the ocean interior are to first order determined by upper-ocean dynamics; deep-ocean destination or origin is of secondary importance.To reveal the differences between the PAZ and PSZ surface fluxes, Fig.\u00a0\u2193 and mean interior-to-surface transit times \u0393\u2191, averaged over a given interior zone, are mapped out in Fig.\u00a0\u2193 from the North Atlantic surface into the PSZ are about 1700 years, roughly 300 years older than the mean transit time from the North Atlantic into the PAZ, which underscores the fact that (as quantified below) roughly half the water last ventilated in the North Atlantic that enters the PSZ does so by diffusing up into the PSZ while traversing the PAZ. By the same token, the mean transit time from the Antarctic margin, where AABW forms, to the PAZ is around 1100 years, but to the PSZ it is 1400\u20131500 years. Mode/intermediate waters from the subpolar Southern Ocean reach the mid-depth PSZ on average in 1000\u20131200 years, which is roughly 200\u2013400 years more quickly than their mean transit into the deeper PAZ , as we track water from the surface to its first contact with an interior zone or from an interior zone back to the surface (see Methods).The streamflow across the faces of the PSZ is weak cf. Fig.\u00a0 with rat\u03b3\u2009=\u200928.12 kg\u2009m\u22123 represents an inflow of 7.8\u2009\u00b1\u20090.2 Sv , while transport from the PAZ to the surface occurs mostly through the upper half (quantified below), underscore the importance of horizontal advection for the PAZ. The PAZ-to-surface transport rate of 4.5\u2009\u00b1\u20090.4 Sv through the PAZ top face is about three times as large as the corresponding surface-to-PAZ transport. The fact that PAZ-to-surface transport through the PAZ top face must pass through the largely advectively decoupled PSZ indicates that this transport is controlled by diapycnal diffusion.As seen in Fig.\u00a0 Sv Fig.\u00a0b, while  Sv Fig.\u00a0c. The ho18 (see Methods). The zonal-mean path densities are plotted in Fig.\u00a045.In Fig.\u00a047, and downward  diffusive transport in the subarctic Pacific.NADW and AABW are the dominant volumetric contributors to the ventilation of both the PAZ and PSZ (each contributing roughly 35\u201340% of the water volume of each zone), with the bulk of the remaining 20\u201330% coming from the subpolar Southern Ocean (mode/intermediate waters) . As PAZ water is transported isopycnally, it establishes a core between roughly \u03b3\u2009=\u200927.9 and 28.0 kg\u2009m\u22123 and diffuses diapycnally into both lighter and denser layers that outcrop in the subpolar Southern Ocean and in the Antarctic margin, respectively  and is thus effectively shielded from ventilation. However, the water in the PSZ is not isolated the longest from re-exposure to the atmosphere. The longest re-exposure times (>1400\u2009years) lie in the PAZ beneath the PSZ because much of the re-exposure of PAZ water occurs though diapycnal diffusion into the overlying shadow zone Fig.\u00a0 where thBy providing a more comprehensive, quantitative description of how deep North Pacific waters are ventilated and ultimately re-exposed to the surface, our analysis reconciles the two paradigms of the overturning circulation as capturing distinct aspects of the deep Pacific circulation. While the shadowed conveyor gives a better description of the vertically compressed PMOC, the standard paradigm, broadly interpreted, captures the slow diffusively dominated paths through the shadow zone. Our revamped ventilation schematic explicitly separates these two pathways while also highlighting the connectivity of the abyssal and shadow zones through diapycnal diffusion as well as the substantial diffusion-mediated transport of deep North Pacific waters to the low-latitude and subarctic Pacific surface Fig.\u00a0.14C but for any tracer with a sufficiently simple source/sink structure. For example, the observed silicic-acid distribution39 has high concentrations in the PSZ but lower concentrations in the PAZ. This distribution is consistent with the advective flushing of deep regenerated silicic acid out of the PAZ and with the accumulation of silicic acid injected into the poorly ventilated shadow zone, but difficult to reconcile with the traditional view of deep Pacific overturning. Our analysis here applies to the current state of the ocean as the OCIM assimilates observational climatologies. Similar analyses could be applied to prognostic ocean circulation models54 in order to illuminate the roles of Pacific overturning and ventilation in climate change.The detailed transport pathways and timescales revealed here have important implications for ocean biogeochemistry. About a quarter of the shadow zone eventually re-emerges in the subarctic Pacific bringing with it old nutrients to sustain biological production and pelagic ecosystems. For sequestering anthropogenic carbon, both the PSZ and the PAZ beneath it have long residence times: the PSZ has the slowest access to ventilation, while the PAZ has the slowest access to re-exposure. Poor ventilation and high carbon accumulation make the PSZ particularly sensitive to any future changes in the biological pump that drive increased oxygen demand. Importantly, the shadowed conveyor paradigm with leading-order diffusive transports allows for consistent interpretations of observed tracer distributions in the Pacific. This holds not only for age tracers such as \u039423. The OCIM solves linearized steady-state momentum equations with neglected nonlinear terms and any discretization errors assigned to an adjustable forcing field. The equations are discretized on an Arakawa B grid55 with horizontal levels, and the observed density distribution is prescribed. Here, we update the most recent 24-layer version, OCIM24, to an improved 48-layer version OCIM2-48L. OCIM2-48L assimilates six different circulation tracers: potential temperature (\u0398), salinity (S), CFC-11, CFC-12, natural radiocarbon (\u039414C), and natural \u03b43He. Annual mean objectively analyzed observations of \u0398 and S are taken from the 2013 World Ocean Atlas57. CFC-11 and CFC-12 measurements were taken from version 2 of the Global Ocean Data Analysis Project (GLODAPv258). For \u039414C, we use the same compilation of observations used for OCIM2, which includes data from GLODAPv2, a compilation of \u039414C measurements from surface corals59, historical \u039414C measurements60, and a collection of pre-bomb surface ocean \u039414C measurements from the 14CHRONO database . OCIM2-48L uses the same set of \u03b43He observations as OCIM2, which includes \u03b43He observations from GLODAPv2 and from a transect in the Eastern Tropical Pacific61. The \u039414C and \u03b43He observations were processed using exactly the same procedure as for OCIM2, which includes screening for and removal of observations that are potentially contaminated by bomb radiocarbon and tritiogenic 3He. OCIM2-48L also assimilates the climatological average air-sea heat and freshwater fluxes from the NCEP reanalysis for the period 1980\u2013200962 as well as the mean dynamical sea surface topography from the AVISO data product for the period 1993\u20131999 (release MDT-CNES_CLS09).The ocean circulation inverse model (OCIM) is a three-dimensional dynamical ocean model that assimilates ocean tracer data to estimate the climatological mean state of the ocean circulation23. For the CFCs, the time-dependent surface boundary conditions are propagated to the time and location of the GLODAPv2 measurements. An adjoint approach64 is used to determine the optimal model parameters that minimize the misfit cost function. As for OCIM2, these parameters include (i) a set of parameters to adjust the local geostrophic momentum balance to mimic unresolved physics and to account for model discretization errors, (ii) a set of parameters to adjust the restoring temperature and salinity used for simulating air-sea heat and freshwater fluxes at the sea surface, (iii) a set of parameters to adjust the local mantle 3He injection rate along mid-ocean ridges, and (iv) a single parameter to control the global relationship between gas-transfer velocity and wind speed, using a quadratic wind-speed dependence65. OCIM2-48L uses an additional set of adjustable parameters that controls the local value of the isopycnal diffusivity. Like previous OCIM versions, the parameters and circulation are time-invariant and thus neglect temporal  variability. The model thereby yields a climatological mean-state estimate of the combined advective-diffusive tracer transport.These observations are assimilated into OCIM2-48L by adjusting model parameters to minimize a quadratic cost function that measures the misfit between model and observations\u03ba\u22a5 in OCIM2-48L is parameterized using a recently developed global model of tidal energy dissipation25 due to breaking internal waves generated by tides flowing over uneven topography. This formulation of \u03ba\u22a5 replaces the less realistic constant or depth-enhanced background diffusivity used in previous OCIM versions. Like previous versions of the OCIM, OCIM2-48L has enhanced vertical diffusivities in the surface mixed layer that are parameterized using the KPP scheme66. However, OCIM2-48L prescribes a climatological annual mean mixed-layer depth67 rather than the monthly maximum mixed-layer depth used in previous versions23. Finally, to account for buoyancy gain by direct geothermal heating, we have included a recent estimate of the geothermal seafloor heat-flux distribution68.OCIM2-48L includes several updates and improvements to better represent the deep Pacific ventilation. First, the vertical resolution has been increased from 24 to 48 levels. The thickness of the layers ranges from about 10 m near the sea surface to 300 m in the abyssal ocean. This is important for better resolving the vertically compressed overturning of the deep Pacific. The horizontal resolution remains at 2 degrees, which is sufficient for resolving the large-scale circulation of the Pacific. Second, the vertical diffusivity r, for both the global and Pacific-basin fields. The improved parameterization of diffusivity and higher vertical resolution result in RMS errors that are 15\u201350% smaller than those for OCIM24. For all tracers, the fit in the Pacific is slightly better than the global fit, making OCIM2-48L well-suited for quantifying deep Pacific transport.The high fidelity of OCIM2-48L-assimilated tracer distributions to the observations is quantified in Table\u00a0T, and all gridded scalar fields are organized into corresponding column vectors, so that the generic tracer equation for concentration \u03c7 is \u2202t\u03c7\u2009\u2009+\u2009T\u03c7\u2009=\u2009S, where S are the discretized source/sink terms. Because OCIM flow is steady, T is time-independent.We track water from origin to destination by labeling the water with a passive tracer. The OCIM\u2019s steady discretized advection-diffusion flux-divergence operator is organized into a matrix s, a subregion of the surface \u03a9a, and an interior region \u03a9b (the PAZ or PSZ). (The entries of these masks are zero or unity depending if the corresponding grid point lies in the region or not.) We then calculate the local fraction Ga\u2009dt of water that had last contact with \u03a9a during time interval .For the calculations here, we define 3 regions in terms of their discretized mask vector: the global surface layer \u03a9s and \u03a9b, we remove \u03a9a-labelled water as soon as it makes contact with these regions, i.e., we impose the boundary condition that Ga\u2009=\u20090 in \u03a9s and \u03a9b for t\u2009>\u20090. The most convenient way to enforce these boundary conditions numerically is by relaxing Ga to zero with a fast timescale \u03c4 for grid points inside \u03a9s and \u03a9b.  Thus, Ga obeys\u03b4(t) is the Dirac delta function specifying the labelling-rate distribution on \u03a9a, and we have defined the diagonal matrices Ls\u2009\u2261\u2009diag(\u03a9s/\u03c4) and Lb\u2009\u2261\u2009diag(\u03a9b/\u03c4). (Note that Ls\u03a9a\u2009=\u2009\u03a9a/\u03c4 as \u03a9a is a subset of \u03a9s.) Similarly, the fraction that had last contact with \u03a9b during To enforce the condition of no contact with \u03a9a or with \u03a9b at some point in the past (without further contact with \u03a9s or \u03a9b) are given by Tsb\u2009\u2261\u2009T\u2009+\u2009Ls\u2009+\u2009Lb, givesa or \u03a9b at some time in the future are obtained in the same manner but for the time-reversed adjoint flow69. The time-reversed adjoint of Tsb is given by T superscript denotes matrix transpose and W\u2009=\u2009diag(w), with w being the column vector of grid-box volumes. Thus, Tsb with a\u2009\u2192\u2009\u03a9b path density \u03b7a\u2192b  and the \u03a9b\u2009\u2192\u2009\u03a9a path density \u03b7b\u2192a are given bya\u2009\u2192\u2009\u03a9b transit; previous definitions of the path density18 considered only surface-to-surface transport for which \u03b7a\u2192b was additionally normalized by the ocean volume.The local steady-state fractions of water that had contact with \u03a9mentclass2pt{minima\u2009\u2192\u2009\u03a9b volume flow rate \u03a6a\u2192b by calculating the rate with which the fast relaxation removes \u03a9a-labelled water over \u03a9b. To get the total flow rate, we volume integrate over \u03a9b, and to get the flow rate into a particular face of \u03a9b, we integrate over the grid layer of the face only. (For short \u03c4 a single layer gives accurate results.) Thus, the total \u03a9a\u2009\u2192\u2009\u03a9b volume flow rate can be written ass, in which case the adjoint expression can be used to find the surface map of the flux in a single step by replacing \u03a9a with diag(\u03a9s), each column of which is the \u03a9a mask for a single surface grid box. Note that the \u03a6a\u2192b flow rates are robust transport metrics that integrate the effect of advection and diffusion over all possible paths from \u03a9a to \u03a9b because \u03a6a\u2192b is the flux into \u03a9b of water labelled at \u03a9a. To calculate \u03a6b\u2192a volume flow rate, we simply interchange a and b in , and dividing by the horizontal area of \u03a9a to obtain the volume flux, i.e., the volume flow rate per unit area. \u03a6\u2191 is computed similarly, but with origin and destination interchanged.We calculate the \u03a9a\u2192b a one-way or gross flow rate43, with the usual net volume flow rate being the residual of the gross rates for opposite directions. If the origin region is part of the surface, excluding contact with the surface elsewhere ensures that summing over surface-origin regions tiling the global sea surface gives the total one-way flow rate from the surface.  In this study, \u03a9a and \u03a9b neither overlap nor abut, ensuring that the corresponding flow rates are non-singular69.Excluding repeat contact with the origin region eliminates the flux in the opposite direction, rendering \u03a6b-volume-averaged mean transit time, we consider Ga, which obeys the same equation as Ga, but without relaxation to zero on \u03a9b. The local fraction in the ocean interior that had last surface contact in \u03a9a is then given by Ts\u2009\u2261\u2009T\u2009+\u2009Ls, and the normalized \u03a9b-volume-averaged transit-time distribution is given by 69a at once, i.e., by replacing \u03a9a with diag(\u03a9s). The mean \u03a9b-volume-averaged re-exposure time \u0393\u2191 is obtained in the same way but with Ts replaced by its adjoint To calculate the surface maps of \u03a9Supplementary note: Diffusivity fields"}
+{"text": "Polymyxin B hemoperfusion (PMX) aims to treat septic shock by removing endotoxin from the patient\u2019s blood. However, the relationship between the severity of the patient's organ damage and the survival benefit of PMX treatment is not clear.We analyzed the efficacy of PMX on adult sepsis patients using the propensity score matching method and the Japanese Diagnosis Procedure Combination (DPC) national inpatient database from April 2018 to March 2020. We stratified the patients into five categories based on their baseline Sequential Organ Failure Assessment (SOFA) score and compared the mortality between PMX-treated and non-treated groups in each category. We also compared continuous hemodiafiltration (CHDF)-, ventilator- and noradrenaline-free days between the groups.Of 44,177 patients included in the study, 2191 received PMX. After 1:1 propensity score matching, we created matched cohorts of 2033 pairs. PMX significantly improved the survival of the patients in the SOFA score categories of 7\u20139 and 10\u201312. On the other hand, there was no significant difference in the survival rate in SOFA score categories of 0\u20136, 13\u201315, and 16\u201324. In analyzing organ support-free days, PMX was also beneficial in the 7\u20139 and 10\u201312 SOFA categories compared to other categories.Analysis of a large-scale Japanese inpatient database found a significant association between PMX efficacy and baseline SOFA score. This result indicates higher efficacy in patients with medium SOFA scores in the range of 7\u201312. The result provides a promising hypothesis for selecting appropriate patients for PMX and should be validated in future RCTs.The online version contains supplementary material available at 10.1186/s13613-021-00928-z. Sepsis is the most common cause of death in the ICU. Sepsis-related deaths were reported as 11 million per year, representing 19.7% of global deaths \u20134.The standard treatment for sepsis includes early administration of antimicrobial agents, removal of the infected foci, and early infusion of fluids and vasopressors in case of shock. Also, controlled clinical trials of various adjunctive medications and therapies did not show a clear survival benefit.One of the adjunctive therapies for septic shock is polymyxin B hemoperfusion (PMX). This therapy uses a polymyxin B-immobilized fiber column to remove endotoxin from the bloodstream , 6. ManyRCTs are the means of clinical research that provide the highest level of evidence regarding the efficacy of treatments. However, it is difficult to include many patients affected by acute and severe conditions such as sepsis into the studies in a limited period. Furthermore, RCTs include patients who meet specific criteria defined for each study, which do not always reflect the effectiveness in actual clinical practice. In recent years, studies using real-world big data have become a common alternative to RCTs. One big data source available in Japan is the Diagnosis Procedure Combination (DPC) database , 11. TheThe DPC data provide information on the diagnosis and treatments performed. Still, it does not provide data on various laboratory values. Thus, it has the limitation of not fully grasping the severity of the diseases. Since April 2018, patients diagnosed with sepsis are required to record their Sequential Organ Failure Assessment (SOFA) score on the day of sepsis diagnosis and the following day in their DPC data. This SOFA score will enable more precise analysis based on the severity of patients' organ damage, which has not been possible in the past.In this study, we examined the association between SOFA score at the onset of sepsis and the efficacy of PMX using 2\u00a0years of DPC data after April 2018.This retrospective observational study analyzed the inpatient data from the Japanese Diagnosis Procedure Combination (DPC) database. We extracted the patient data from April 2018 to March 2020, including patients whose primary diagnosis was sepsis based on the ICD-10 codes. We excluded patients who were under the age of 20, whose SOFA score data were missing, who died within 3 days after sepsis diagnosis, who received their first PMX treatment other than on the first or second day of sepsis diagnosis, who were on chronic hemodialysis before sepsis onset, and who transferred to other hospitals within 28\u00a0days without improvement. We defined the first SOFA score record as the first day of sepsis diagnosis (day 1). We categorized patients who received PMX on the first or second day of sepsis diagnosis into the PMX group and patients who did not receive PMX into the control group. In addition, we collected baseline information of the patients, such as age at admission, gender, emergency versus elective hospital admission, university hospital or non-university hospitals, admission to emergency rooms or intensive care unit (ICU), and the Charlson Comorbidity Index (CCI) , 13. We We performed a propensity score matching analysis between PMX-treated (PMX group) and non-treated (control group). We estimated the propensity score using a logistic regression model for the use of PMX as a function of the following confounders: the age at admission, gender, emergency versus elective hospital admission, university hospital or non-university hospitals, admission to the emergency room (E.R.) or intensive care unit (ICU) and CCI, CHDF, H.D., mechanical ventilation, surgery, administration of \u03b3-globulin, AT III, rTM, steroid, red blood cell transfusion, platelet transfusion, and the maximum daily dose of noradrenaline. A one-to-one matched analysis using the nearest-neighbor matching was performed based on the estimated propensity score of each patient. We used a caliper width of 0.2 of the standard deviation of the propensity score. We evaluated the balance among covariates using absolute standardized difference (ASD).Patients were stratified based on the SOFA scores in the matched population into five categories . We examined the difference in the survival curves and 28-day mortality between the PMX and control groups. We also analyzed CHDF-, mechanical ventilation- and noradrenalin-free days at 28\u00a0days in patients on each treatment on day one or day two of sepsis diagnosis. We divided patients into two groups (SOFA 0\u20131 and 2\u20134) using each organ's SOFA score components. We examined the odds ratio of death with and without PMX in each group.2 test  to compare two groups for mortality within 28\u00a0days, and the Wilcoxon rank-sum test to compare free days.We reported continuous variables as the median and interquartile range (IQR) and categorical variables as number and percentage. We performed statistical analysis using JMP Pro 15.2.0 (SAS Institute Inc.) and used logistic analysis for multivariate analysis. We used the Kaplan\u2013Meier method to compare survival curves, and \u03c7During the study period, 74,879 patients met the inclusion criteria of sepsis diagnosis. We excluded 30,702 patients and included 44,177 patients in the study. Missing SOFA scores were the most common reason for exclusion. Among the included patients, 2191 received PMX treatment, and 41,986 did not. After the 1:1 propensity score matching, we created a pair of 2033 patients , and 18.6% and 27.4%, respectively, in the category of SOFA 10\u201312 (p\u2009=\u20090.0008). These results confirm that PMX treatment is associated with a significant reduction in mortality in these ranges of baseline SOFA score. The detailed results of 28-day mortality analyses are provided in Additional file Figure\u00a0Table Figure\u00a0In this study, we examined the association between the severity of organ failure and the efficacy of PMX by using the Japanese nationwide inpatient database, the DPC data. After adjusting the patient background characteristics by propensity score matching, we found that PMX significantly improves the survival of sepsis patients in the SOFA score ranges of 7\u20139 and 10\u201312. On the other hand, there was no significant difference in the survival rate in SOFA score ranges of 0\u20136, 13\u201315, and 16\u201324. In analyzing organ support-free days, PMX was also effective in the SOFA ranges of 7\u20139 and 10\u201312, compared to 0\u20136, 13\u201315, and 16\u201324. In a more detailed analysis comparing the mortality difference in each SOFA score, the risk ratio of 28-day morality was lower than 1 in SOFA 6, 7, 8, 9, 12, 14, 16, 17, 20, and \u2267\u200921. In addition, the survival benefit was statistically significant in SOFA 9, 10, 12 (Additional file Several previous studies have examined the effectiveness of PMX using the DPC data. In one study focused on septic shock due to lower gastrointestinal perforation, the 28-day mortality rates for patients with and without PMX were 17.1% and 16.3%, respectively, which were not significantly different . ConversThis study, which used the DPC data after April 2018, is the first to utilize the SOFA score recorded in the DPC database to analyze the efficacy of sepsis treatment. The SOFA score, which reflects the degree of damage to multiple organs, has been widely used as a factor reflecting the severity of sepsis in patients. Many studies have reported that it is highly associated with mortality. Using the SOFA scores is a powerful method for analyzing large-scale registry data such as DPC and examining the effectiveness of various treatments for critically ill patients in actual clinical practice in detail.Several multicenter RCTs have been conducted to evaluate the efficacy of PMX on septic shock. However, they showed inconsistent findings regarding the survival benefit. We assume that one reason for the lack of apparent efficacy of PMX in those RCTs may be that the included patients were heterogeneous with varying severity of the disease. In the EUPHRATES trial, the largest RCT of PMX conducted so far, the analysis of all enrolled patients showed no difference in the mortality between the PMX and control groups . But a pOur previous study on the analysis of noradrenaline-administered septic shock patients showed that PMX efficacy is less pronounced in the subgroup of patients with the highest maximum daily dose of noradrenaline . FurtherIn the stratified analysis using individual SOFA score components of each organ, the survival benefit of PMX tended to be higher in patients with central nervous system SOFA scores of less than two than in patients with scores of two or more. On the other hand, the effect tended to be higher in patients with scores of 2 or more for respiration, coagulation, liver, cardiovascular, and renal SOFA score. This result suggests that optimal timing may vary depending on the type of organ that is impaired. However, the present analysis did not consider the correlation between each organ damage. Thus, further study is needed to determine the impacts of individual organ damage on the efficacy of PMX.One study aimed to identify the optimal population for PMX using the sepsis database, which could not show the correlation between PMX efficacy and SOFA score . HoweverThe SOFA score is widely used to indicate of organ damage in critically ill patients. There are many reports on the association of SOFA score and the prognosis of sepsis patients , 25. TheThis study has several limitations. First, the study is a retrospective analysis of data. Although we adjusted for possible background factors by propensity score matching, we cannot rule out the presence of confounding factors. These include vital signs or laboratory data, which are not available in the DPC database. Second, the disease code of sepsis is based on clinical judgment and not always based on the international definition of Sepsis-3.Analysis of a large-scale Japanese inpatient database found a significant association between PMX efficacy and baseline SOFA score. These findings suggest higher efficacy in patients with medium SOFA scores in the range of 7\u201312. The result provides a promising hypothesis for selecting appropriate patients for PMX and should be validated in future RCTs.Additional file 1: Table S1. Detailed analysis of 28-day-mortality differences between PMX group and control group in each single SOFA score."}
+{"text": "Cellulose nanocrystal (CNC)-reinforced bio-composite films containing glycerol were produced using the solution casting technique. The influences of the addition of CNC  and glycerol  on the properties of the bio-composite films were studied in the present work. The resulting films were characterized by X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy, and thermogravimetry analysis (TGA), and according to their tensile, water absorption, and light transmission behavior. The introduction of 4 wt% CNC into the chitosan film did not affect the thermal stability, but the presence of 20 wt% glycerol reduced the thermal stability. The addition of 4 wt% CNC to the chitosan film increased its tensile strength, tensile modulus, and elongation at break by 206%, 138%, and 277%, respectively. However, adding more than 8 wt% CNC resulted in a drastic reduction in the strength and ductility of the chitosan film. The highest strength and stiffness of the chitosan bio-composite film were attained with 4 wt% CNC and 20 wt% glycerol. The water absorption and light transmission of the chitosan film were reduced dramatically by the presence of both CNC and glycerol. Eucommia ulmoides gum, and natural rubbers [Currently, most food packaging films are made of synthetic polymers derived from fossil fuels. This is ascribed to their superior mechanical and barrier properties, easy processing, and low cost . However rubbers ,5,6,7.d-glucan, which is part of the deacetylated derivative of chitin [Chitosan is a natural linear polysaccharide containing 1,4-linked 2-amino-deoxy-\u03b2-f chitin . Chitosaf chitin . Howeverf chitin ,9, nano f chitin , starch f chitin , and carf chitin .Among the various nanofillers, CNC has attracted significant interest as a potential nano-reinforcement for chitosan films because of its sustainability, abundance, large surface area to volume ratio, lightness, and high mechanical strength . CNC is Although numerous studies on chitosan/CNC bio-composite films have been reported ,16,17,18Chitosan , glacial acetic acid, and glycerol were supplied by Sigma Aldrich, Singapore. The CNC used in the present study was prepared from the isolation of ramie fibers via sulfuric acid hydrolysis following the procedure described in our previous work .v/v). The CNC suspension was centrifuged at 4000 rpm for 15 min to remove the acid solution. CNC precipitates were collected and rinsed with distilled water until rinses were neutral. The ultra-sonication of CNC suspension was then ultrasonicated for 1 min with 50% amplitude to obtain a uniform CNC suspension. The obtained CNC had rod-shaped particles with high crystallinity (90.77%), an average diameter of 6.67 nm, and an average length of 145.61 nm, consistent with our previous studies [CNC was extracted from the chemically purified cellulose (CPC) of ramie fibers through sulfuric acid hydrolysis based on our previously published procedures . Briefly studies .w/v) was produced by dissolving chitosan powder in  aqueous acetic acid solution using a mechanical stirrer at 90 \u00b0C for 15 h at a constant speed of 300 rpm, and subsequently cooled to room temperature. The chitosan solution was mixed with CNC of varying amounts  using a mechanical stirrer at 70 \u00b0C for 2 h with a speed of 300 rpm. This solution was then poured into a 200 mm \u00d7 200 mm acrylic mold and cooled to room temperature. The films containing 0, 2, 4, and 8 wt% CNC are referred to as CS, CS/CNC2, CS/CNC4, and CS/CNC8, respectively. Additionally, the chitosan/CNC/glycerol bio-composite films were also prepared by adding different amounts of glycerol  on solid CS into the chitosan/CNC solution containing 4 wt% CNC, and stirred using a mechanical stirrer at 70 \u00b0C for 2 h at a speed of 300 rpm. Subsequently, the solution was poured into the acrylic mold and then cooled to room temperature for producing the films. Furthermore, the bio-composite films with 4 wt% CNC consisting of 10, 20, and 30 wt% glycerol are referred to as CS/CNC4/G10, CS/CNC4/G20, and CS/CNC4/G30, respectively.The films were produced via a solution casting method, as previously described, with a few modifications ,20. The The X-ray diffraction of the films was analyzed using an X-ray diffractometer  fixed with CuK\u03b1 radiation (\u03bb = 0.1541 nm) in the 2\u03b8 range of 5\u221230\u00b0 with a step increment of 2\u03b8 = 0.02\u00b0 at 40 kV and 30 mA using the 2\u03b8 mode for scanning.\u22121 at a resolution of 4 cm\u22121.The FT-IR analysis of the films was carried out by recording spectra with an FT-IR spectrophotometer  in the wavenumber range of 4000\u2013400 cmThe thermal stability of the films was determined by thermogravimetry analysis (TGA)  at a temperature range of 30\u2013600 \u00b0C with a heating rate of 10 \u00b0C/min under nitrogen conditions.The tensile properties of the films were measured through a tensile test. The tensile test was conducted by a universal testing machine  at a crosshead speed of 5 mm/min following the ASTM D638 Type IV standard. The tensile strength, tensile modulus, and elongation at break were determined through the tensile test at room temperature. The films were stretched with an initial grip separation of 33 mm, and four samples were tested for each measurement.Water absorption was measured using the following procedure. Films with dimensions of 12 mm \u00d7 12 mm \u00d7 0.09 mm were placed in a desiccator for 24 h, followed by weighing to measure the dry mass. The films were then immersed entirely in the distilled water in a sealed beaker. The weight of the films was measured followed periodic immersion, and the water absorption  at room temperature and related to the film thicknesses according to the Beer-Lambert law. The light transmittance analysis was performed at a wavelength range of 300\u2013800 nm with a 0.2 nm spectral bandwidth.The XRD patterns of the chitosan film (CS) and its bio-composite films consisting of either 4 (CS/CNC4) or 8 wt% CNC (CS/CNC8), and 8 wt%CNC/30 wt% glycerol (CS/CNC8/G30) are shown in \u22121  based on the derivate thermogravimetry analysis (DTG) curves, as presented in max values of the films of chitosan, with 4 wt% CNC, and containing 20 wt% glycerol were 279, 280, and 270 \u00b0C, respectively. This indicates that the presence of 4 wt% CNC did not affect the thermal resistance, but the presence of 20 wt% glycerol reduced the Tmax by 10 \u00b0C. In other words, the incorporation of 20 wt% glycerol decreased the thermal stability of the chitosan/CNC bio-composite films. This might be ascribed to the lower thermal degradation of glycerol, where glycerol degradation occurs at 160\u2013200 \u00b0C [Furthermore, the effect on thermal resistance of the addition of both 4 wt% CNC and 20 wt% glycerol into the chitosan film was investigated by determining the maximum degradation temperature  compared to other commercial food packaging films such as low-density polyethylene (8\u201331 MPa), liner low-density polyethylene (20\u201345 MPa), high-density polyethylene (17\u201345 MPa), and polypropylene (31\u201343 MPa) [lization ,36. Similization . The efflization . Furtherlization . From Filization . Similar\u201343 MPa) . However\u201343 MPa) .\u22121 (reflecting O\u2013H stretching). Furthermore, an increase in the water resistance of the film with 8 wt% CNC related to the chitosan film was probably caused by a barrier effect attributed to large CNC agglomerates that physically impeded the infiltration of water molecules [After an immersion time of 180 min, the water absorption of all chitosan/CNC bio-composite films containing 0, 2, 4, and 8 wt% CNC increased to 153.8, 179.1, 179, and 136.7%, respectively. This suggests that the water resistance decreased for chitosan films with 2 and 4 wt% CNC, but increased for the film containing 8 wt% CNC. The increased water absorption of the films containing 2 and 4 wt% might be attributable to both CNC and chitosan being hydrophilic materials, where hydrogen bonds easily form in water, thereby increasing water absorption [olecules .\u22121 (representing O\u2013H stretching) [The water absorption of the chitosan/CNC bio-composite films as a function of glycerol content is also shown in etching) . Other retching) ,42,43,44The light transmittance of the chitosan film (CS) and its bio-composites with 4 wt% CNC (CS/CNC4) and with 30 wt% glycerol (CS/CNC4/G30) is presented in Chitosan bio-composite films with different CNC and glycerol contents were produced using the solution casting technique. Both the tensile strength and the elongation at break of the chitosan film increased in the presence of 2 and 4 wt% CNC, but decreased with 8 wt% CNC. Upon incorporating 4 wt% CNC, both the tensile strength and ductility of the chitosan film were enhanced significantly by 206 and 277%, respectively. The incorporation of 20 wt% glycerol into the bio-composite films increased both their strength and stiffness slightly, but drastically reduced their ductility. The thermal resistance of the chitosan film remained unchanged with the presence of 4 wt% CNC. However, the thermal resistance of the chitosan/CNC composite films was reduced by the introduction of 20 wt% glycerol. The combined use of CNC and glycerol lowered the water absorption of the chitosan film dramatically. Furthermore, the light transmission decreased because of the presence of both CNC and glycerol. Overall, it can be concluded that bio-composite films based on chitosan/CNC/glycerol exhibit great potential for application as an alternative packaging film material."}
+{"text": "Leishmania infantum. Infection in dogs can result in a disease with non-specific clinical signs or in a subclinical condition. Infection diagnosis is crucial to guide public health measures considering the zoonotic potential of L. infantum. Serological approaches to detect infection with a reduced antigen panel potentially limit the quality of the information obtained. To evaluate the impact of using distinct antigens in a serological survey, a cohort with 390 dogs from endemic regions in Portugal was subjected to a serological evaluation using ELISA and DAT. Using ELISA, six Leishmania-specific antigens in conjunction with a non-related antigen, Escherichia coli soluble antigens, were evaluated. The global seroprevalence was 10.5% for DAT and 15.4 to 23.1% for ELISA, depending on the antigen for the latter. Still, only 8.2% of the animals were seropositive to all Leishmania-specific antigens. Importantly, a further 31.0% presented antigen-dependent seropositivity. Considering this observation, a serological score system was proposed and validated to address the complex serology results. With this system, the overall dog seropositivity was 26.9%. This work highlights the limitations of single-antigen serological surveys and presents an approach that might contribute to the establishment of CanL-specific serological profiles.Canine leishmaniosis (CanL) is a vector-borne disease caused by  Leishmania infantum, is a vector-borne parasitic disease of dogs (Canis lupus familiaris). Female sand flies are the vectors responsible for parasite transmission. In geographical areas where susceptible sand flies are present, dogs are the main reservoir of L. infantum and represent an increased risk for zoonotic transmission to humans [L. infantum infection in dogs can be associated with non-specific clinical signs , or can assume a subclinical form [Leishmania-specific antibody titres [Leishmania-specific antibody responses by serological evaluation is highly used, not only for CanL diagnosis, but also in epidemiological surveys. Enzyme-linked immunosorbent assay (ELISA) and the direct agglutination test (DAT), presenting high sensitivity and variable specificity, are methods suitable for mass-screen epidemiological studies [Leishmania-specific antigens: soluble promastigote Leishmania antigen (SPLA), recombinant antigens , a mixture of recombinant antigens (LAM) [Escherichia coli soluble antigens (SECA) [Leishmania-specific serological signatures as an alternative to address complex serological data. Moreover, the data provided will contribute to further validation of the serological performance of several Leishmania-specific antigens, using the same ELISA technical approach.Canine leishmaniosis (CanL), caused by the protozoan parasite o humans ,2,3,4. Lcal form ,2,5,6. Wy titres . Althougy titres ,9. Therey titres . The eva studies ,12. The  studies ,14,15. E studies ,17. The  studies ,19. The  studies ,20,21,22 studies . Therefos (SECA) . Crude ps (SECA) ,26. The s (SECA) ,28. LicTs (SECA) . LAM is Leishmania antibodies by the direct agglutination test (DAT) (cut-off titre = 400) and/or positive for the presence of amastigotes in bone marrow or lymph node aspirates.Group Leish+ (n = 29): sera from dogs living in geographical regions of Portugal where CanL is endemic, collected in a veterinary centre, or during anti-rabies campaigns, and which presented at least two clinical signs (CS) compatible with the disease . These animals were also seropositive for anti-Group Leish- (n = 121): sera from dogs that visited a veterinary centre in a Portuguese region that is considered to be non-endemic for CanL. All dogs were seronegative by DAT (titer < 100).Leishmania DNA by PCR  (n = 390): sera from dogs with unknown serological status, mostly collected in dog kennels and a veterinary centre in five endemic areas in the north and centre of Portugal  with the legal responsibility and owners\u2019 informed consent, respectively, during June 2011. The PT group contains six groups  defined according to three parameters: clinical data-presence of CS, seropositivity by DAT, and molecular detection of A by PCR . Animals7 freeze-dried L. donovani promastigotes (MHOM/SD/68/1S)/mL were suspended in 5 mL of physiological saline (0.9% NaCl), according to the manufacturer\u2019s instructions . After dispensing 50 \u00b5L of DAT antigen per well, plates were incubated for 18 h at room temperature. Results obtained with DAT are expressed as an antibody titre, i.e., the reciprocal of the highest dilution at which agglutination (large diffuse blue mats) is still clearly visible after 18 h incubation at room temperature. A cut-off titre of 400 has been chosen to maximize the sensitivity and specificity of the test. Positive controls for the DAT consisted of serum samples from dogs diagnosed with leishmaniosis. DAT titres in these samples ranged between 51 200 and \u2265102 400. Sera from dogs living in areas where leishmaniosis is not endemic were used as negative controls.The DAT protocol was performed as described by Schallig et al. . PreviouDNA was extracted from blood samples using the E.Z.N.A Blood Mini Kit , following the manufacturer\u2019s instructions. The concentration and quality of DNA obtained from tissues was determined with a NanoDrop , and then stored at \u221220 \u00b0C until use.2, and 1.4 U of NZYTaq DNA polymerase, . The PCR program included initial denaturation at 94 \u00b0C for 5 min, followed by 30 cycles of 30 s at 94 \u00b0C, 30 s at 60 \u00b0C, and 30 s at 72 \u00b0C, with a final extension at 72 \u00b0C for 5 min. Samples positive for SSUrRNA revealed a 603 bp product.Using small subunit ribosomal ribonucleic acid (SSUrRNA) as the target gene, the first amplification was performed using the primers R1 (5\u2032GGTTCCTTTCCTGATTTACG 3\u2032) and R2 (5\u2032GGCCGGTAAAGGCCGAATAG3\u2032), specific for Kinetoplastida. The Nested-PCR protocol was adapted from Cruz et al., 2002 . BrieflyLeishmania-specific primers in order to re-amplify the PCR product of the first reaction. These PCR products were diluted (1/40) with nuclease-free water. The volume of the reaction was 25 \u00b5L, containing 10 \u00b5L of the first PCR product (diluted 1/40), 10.1 \u00b5L of nuclease-free water , 15 pmol of R1 and R2 primers, 10 mM deoxynucleoside triphosphates 10 mM MgCl2, and 1.4 U of Taq polymerase . The PCR program included initial denaturation at 94 \u00b0C for 5 min, followed by 30 cycles of 30 s at 94 \u00b0C, 30 s at 65 \u00b0C, and 30 s at 72 \u00b0C, with a final extension at 72 \u00b0C for 5 min. Samples positive for Leishmania revealed a 353 bp product. Amplification products were visualized after electrophoresis in 2% agarose gel with a 1000 bp DNA ladder  and stained with 0.1% of ethidium bromide. The second reaction was performed using R3 (5\u2032TCCCATCGCAACCTCGGTT3\u2032) and R4 (5\u2032AAAGCGGGCGCGGTGCTG 3\u2032) L. infantum MHOM/MA/67/ITMAP-263 promastigotes were cultivated as previously described [g, 10 min, at 4 \u00b0C. The pellet was suspended in PBS containing 1 mM phenylmethylsulfonyl fluoride protease inhibitor and submitted to 10 freeze-thaw cycles for rupture of the parasites. This suspension was centrifuged at 13,000\u00d7 g, 30 min, at 4 \u00b0C and the supernatant was recovered, quantified by DC (detergent compatible) protein assay , and stored at \u221280 \u00b0C in single aliquots. The recombinant protein LicTXNPx was purified by affinity chromatography on a Ni-NTA column , as described in previous reports [2O, quantified and stored at \u221280 \u00b0C in single-use aliquots. The recombinant protein kDDR, provided by Dr. Ricardo Fujiwara , was quantified by DC (detergent compatible) protein assay (BioRad), and stored at \u221280 \u00b0C in single aliquots. Leishmania antigen mixture (LAM) was prepared as described by Santar\u00e9m et al. [For SPLA production, escribed . Parasit reports , and is m et al. , combiniNinety-six-well flat-bottom microtiter plates  were coated with the antigen in 50 \u00b5L of 0.05 M carbonate buffer, pH = 9.6. The antigen concentrations used were 10 \u00b5g/mL of SPLA, 3 \u00b5g/mL of LicTXNPx, 1 \u00b5g/mL of rK39, 4 \u00b5g/mL of rK28, 3 \u00b5g/mL of rKDDR, and 5 \u00b5g/mL of LAM (1 \u00b5g/mL of LicTXNPx + 4 \u00b5g/mL of rK39). Plates were incubated O/N at 4 \u00b0C and blocked with 200 \u00b5L of PBS-low-fat-milk (3%) at 37 \u00b0C for 1 h. Next, plates were washed with PBS-Tween 0.05% (PBS-T), and the sera, positive, and negative controls, diluted at 1:1500 in PBS-T were dispensed in triplicate (100 \u00b5L/well) and incubated at 37 \u00b0C for 30 min. After a washing step, 100 \u00b5L/well of conjugate\u2014secondary anti-dog IgG antibody conjugated with horseradish peroxidase \u2014diluted at 1:1176.5, was added and the plates were incubated at 37 \u00b0C for 30 min. Plates were washed and incubated with 0.5 mg/mL of o-phenylenediamine dihydrochloride  for 10 min in dark. The reaction was stopped with 50 \u00b5L/well of HCl (3 M). Absorbance was read at 492 nm in an Synergy 2 automatic reader . All samples and antigens were assayed in at least two independent assays.The proposed score system was used as described by Lima et al.  with minReceiver operating characteristic (ROC) curves were generated using sera from groups Leish+ and Leish-. A 95% confidence interval (95% CI) for the area under the curve (AUC) was considered. The quality associated with the AUC values was excellent for AUC between 0.9 and 1, very good for 0.8 to 0.9, good for 0.7 to 0.8, satisfactory for 0.6 to 0.7, and unsatisfactory for 0.5 to 0.6. Cut-off values were inferred through these curves for each antigen (by choosing the best compromise between sensitivity and specificity associated with the ROC curve), and values of sensitivity (Se) and specificity (Sp) were calculated for the samples for each group . OpticalLeishmania-specific antigens were associated with excellent quality (AUC between 0.9 and 1.0). The cut-off values used enabled the best compromise between sensitivity and specificity. For the non-specific antigen SECA, the calculated AUC was 0.79, a good quality model  presented, 10.5 % (41/390) of the dogs were seropositive by DAT, and 6.1 % (24/390) were PCR-positive. On the other hand, 279 dogs did not present any of the above-mentioned traits. This information was used to divide the cohorts according to what is presented in Leishmania-specific antigens was similar with higher OD values for groups A and B1, intermediate for B2, and lower for C, D, and E . The dogs from subgroup B1 were also seropositive for all Leishmania antigens tested, except for two that were seronegative only for LicTXNPx. In subgroup B2, the antigen associated with the highest seropositivity was rK28 with 82.6% (19/23) of seropositive dogs. For subgroup C, LicTXNPx with 38.5% (5/13) of seropositive dogs was the antigen associated with the highest seropositivity. In subgroup D, LicTXNPx with 15.4% (43/279) of seropositive dogs presented the highest seropositivity. The other 5 antigens presented lower: SPLA 10.8% (30/279), 5.4% for rK39 (15/279), 6.4% for rK28 (18/279), 4.3% for rKDDR (12/279), and 5.4% (15/279) for LAM. In subgroup E, SPLA with 26.3% (15/57) presented the highest seropositivity. When comparing E and D subgroups, except LicTXNPX 14.0% (8/57), all other antigens presented higher seropositivity when compared with group D, LAM 15.8% (9/57), rK39 and rKDDR 19.3% (11/57), and rK28 21.0% (12/57) , as previously described . All dog (12/57) . Subgrou (12/57) . A higheConsidering that the PT cohort\u2019s average seropositivity was 18.5%, a more detailed evaluation of individual seropositivity was performed . It is wThe most common seropositivity scenarios were: all antigens with 32 dogs, LicTXNPx only with 31, SPLA only with 17, and all antigens except LicTXNPx with 12 . The mosOnly four animals, one in subgroup D and three in E were seropositive to all antigens. LicTXNPx monopositivity was the most frequent scenario in subgroup D with 27 animals. SPLA monopositivity was the most frequent scenario in the E cohort with five dogs and was also present in dogs from the D cohort. The seropositivity to five antigens while being negative to LicTXNPx was mostly present in subgroup B with seven animals present, two in B1 and five in B2.Leishmania-specific antigens analysed presented a fair to moderate agreement (Considering the mixed positivity in the subgroups, dogs from subgroup A were positive for all antigens . Regardigreement . This digreement . The k-cAs an alternative to simple seropositivity evaluation, a scoring system, previously described by Lima et al. , using tWhen the proposed cumulative scoring system was applied to the control cohorts, no overlap in scores existed; the lowest Leish+ score was two while the highest for Leish- was one . Using tLeishmania-specific antigens was assessed using ELISA. The individual seropositivity for the six antigens only varied between 15.6% and 22.3%. Still, only 8.2% of the dogs were seropositive to all antigens, and 38.9% of the cohort was seropositive to at least one antigen. Thus, a 30% variation in seropositivity reporting was possible depending on the used criteria. To clarify the serological profile, a scoring system, using the seroreactivity data for rK39, SPLA, and SECA, was used to reevaluate the cohort. This system identified 26.9% of dogs with serological profiles similar to those found in Leish+ and absent in the Leish- cohort.In this study, a cohort of 390 dogs from Portugal CanL endemic regions was clinically evaluated for CS compatible with CanL and tested by DAT and PCR. Then, global seropositivity to six k value associated with the kinesin-based antigens was only substantial (Leishmania antibodies that are easily detectable by conventional serology. On the contrary, infected animals without clinical signs represent a problem. There is a temporal gap between infection and seroconversion, during this period with often variable serology the cut-offs might not be adequate [L. infantum both free or vesicle-associated [Rickettsia spp., Toxoplasma spp, Ehrlichia spp, and other trypanosomatids [The total seroprevalence observed by DAT was 10.5%, while using ELISA, the average seropositivity was 18.1%. The antigens with the higher seropositivity observed were LicTXNPx and SPLA, with 22.3% and 21.5%, respectively. Although the DAT seropositivity was lower when compared to ELISA, the global seropositivity obtained using SPLA 21.5% was in accordance with other reports in the CanL endemic areas of Portugal ,38,39. Tstantial . The lacstantial . In factadequate ,29. In fsociated . The facsociated  using nosomatids ,43. In fsomatids . This apsomatids . It is wAn alternative way to address seropositivity was presented in the context of non-endemic and vaccinated animals using not only the absolute seroreactivity but also the relationship between the antigen-specific seroreactivity ,37. A moOverall, the reported seropositivity levels are similar to those previously reported for Portugal. It also validated the capacity of kinesin-related antigens to detect CanL and active infections, in Portugal. The existence of complex antigen seropositivity patterns that can limit the interpretation of epidemiological information was confirmed. Last but not least, we successfully applied the proposed scoring system using three antigens, SPLA, rK39, and LicTXNPx leading to a better understanding of infection-relevant serological profiles. Approaches similar to the proposed scoring system can be an alternative to conventional serological approaches. The definition of serological profiles can be used to comprehend not only the status of infection but also to integrate complex information like vaccination status or treatment efficacy."}
+{"text": "Clostridium perfringens (C. perfringens) is a bacterium that commonly causes zoonotic disease. The pathogenicity of C. perfringens is a result of the combined action of \u03b1, \u03b2, and \u03b5 exotoxins. In this study, Lactobacillus crispatus (pPG-T7g10/L. crispatus) expressing the main toxoids of C. perfringens, \u03b1, \u03b5, \u03b21, and \u03b22, with EGFP-labeling, was constructed, and the protective effect was estimated in chickens. The \u03b1-\u03b22-\u03b5-\u03b21 toxoid was constitutively expressed for confirmation by laser confocal microscopy and western blotting, and its immunogenicity was analyzed by enzyme-linked immunosorbent assay (ELISA) and immunohistochemical assays. After booster immunization, the probiotic vaccine group showed significantly higher levels (p < 0.05) of specific secretory IgA (sIgA) and IgY antibodies in the serum and intestinal mucus. Furthermore, the levels of cytokines, including interferon (IFN)-\u03b3, interleukin (lL)-2, IL-4, IL-10, IL-12, and IL-17, and the proliferation of spleen lymphocytes in chickens orally immunized with pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus increased significantly. Histopathological observations showed that the intestinal pathological changes in chickens immunized with pPG-E-\u03b1-\u03b22\u03b5-\u03b21/L. crispatus were significantly alleviated. These data reveal that the probiotic vaccine could stimulate mucosal, cellular, and humoral immunity and provide an active defense against the toxins of C. perfringens, suggesting a promising candidate for oral vaccines against C. perfringens. Clostridium perfringens (C. perfringens) is a common zoonotic pathogen that is abundantly present in the environment. It often causes gas gangrene, necrotizing enteritis, and enterotoxemia in cattle, sheep, and chickens [C. perfringens is the main pathogenic factor that infects animals, causing rapid onset, high mortality, and serious economic losses to animal husbandry [C. perfringens results from the synergy of multiple exotoxins, of which \u03b1, \u03b2, and \u03b5 are the most common and highly toxic [C. perfringens promotes the development of necrotizing enteritis, leading to a mortality rate of up to 50% [C. perfringens infections is highly desirable. Currently, many countries use antibiotics and sulfonamides to prevent and treat diseases caused by C. perfringens infection in animals [chickens ,2. The eusbandry . The patly toxic . These tly toxic . In chicp to 50% . Therefo animals . Because animals . Therefo animals .C. perfringens mainly infects the intestinal tract of animals, developing an oral immunization vaccine is a promising approach to prevent the occurrence of this disease. Lactic acid bacteria (LAB) are Gram-positive bacteria which are widely distributed in animal intestinal tissues and play a key role in maintaining the stability of microbial ecology and inducing mucosal and systemic immunity [Lactobacillus, a member of LAB, has many advantages: it has been proven to be a food-grade safe microorganism for application in the research of food-grade gene cloning vector systems and expression vector systems; it interacts with cells and induces the production of a series of cytokines; and it has the ability to tolerate bile acids and is affected by immune adjuvants [Lactobacillus induces a mucosal immune response in the body. Some of these microorganisms pass through the microfold cells between the epithelial cells of the small intestine, whereas some pass through the dendritic cells under the epithelial cells to enter the lamina propria of the small intestine tissue, where they activate Th2 lymphocytes through the activation of plasma cells, which secrete specific IgA antibodies [Lactobacillus with better antigenic quality, whose application in production practices has far-reaching significance. Song et al. developed a stable and marker-free Lactobacillus strain, realizing expression of the alpha-toxin gene of Clostridium perfringens on the surface of bacteria [Lactobacillus casei (pPG-\u03b1/L. casei 393) for constitutively expressing the toxoid of C. perfringens \u03b1-toxin, a BLA/c mice experiment to evaluate the oral immunogenicity of pPG-\u03b1/L. casei 393, the results indicating that the strain could induce the production of mucosal, humoral, and cellular immunity, and provide a protective effect to a certain degree [As immunity . Use of djuvants . It helpdjuvants . Lactobatibodies ,14. Spectibodies ,16. Spectibodies . With cobacteria . Gao et n degree .L. crispatus, expressing the main toxoids of C. perfringens, \u03b1, \u03b21, \u03b5, and \u03b22, with non-antibiotic resistance, was constructed, and the genes were modified by our laboratory for mutating the 68th histidine residue to a glycine residue in \u03b1 toxin, the 234th cysteine residue to a glycine residue in \u03b22 toxin, and the 106th histidine residue to a proline residue in \u03b5 toxin. Its immunogenicity in chickens was evaluated for its protective effect against C. perfringens infection.In this study, the recombinant strain pPG-T7g10/L. crispatus N-11 strain was isolated from the intestine of a chicken in our laboratory [C. perfringens types A (C57-1), B (CCVC-81), and C (CACC-61) were obtained from the China Institute of Veterinary Drug Control, Beijing, China. Escherichia coli strain JM109 and the engineered strain pPG-T7g10/TG1, containing the constitutively expressed plasmid were cultivated in our laboratory at 37 \u00b0C in Luria\u2013Bertani (LB) broth with shaking. The pMD19-EGFP plasmid containing the gene encoding EGFP (Accession No. U57607) and the pMD18-T-\u03b1-\u03b22-\u03b5-\u03b21 plasmid, which had been constructed to contain a fusion of the genes encoding the quadruple toxoid of C. perfringens \u03b1 (H68G), \u03b22 (C234G), \u03b5 (H106P), and \u03b21 , were preserved in our lab [The boratory  and grow our lab . The pPG our lab ,22. The C. perfringens was acquired from the plasmid pMD19-T-\u03b1-\u03b22-\u03b5-\u03b2 via PCR amplification and then inserted into the constitutive expression vector pPG-T7g10-PPT, generating the recombinant plasmid pPG-\u03b1-\u03b22-\u03b5-\u03b21. Subsequently, the fragment encoding EGFP was inserted upstream of the fusion genes \u03b1, \u03b22, \u03b5, and \u03b21 and fused with \u03b1-\u03b22-\u03b5-\u03b21 by a linker, resulting in creation of the plasmid pPG-E-\u03b1-\u03b22-\u03b5-\u03b21. Finally, the recombinant plasmid pPG-E-\u03b1-\u03b22-\u03b5-\u03b21 was electroporated into L. crispatus N-11 competent cells and the positive strain was validated using laser confocal microscopy, flow cytometry, and western blotting.The recombinant strain was constructed using a previously described method . BrieflyL. crispatus N-11 was cultured in MRS medium at 37 \u00b0C for 16 h, centrifuged at 10,000\u00d7 g for 5 min, and washed three times with sterilized phosphate-buffered saline . The precipitate was incubated with lysozyme and ultrasonicated. Then, 2 \u00d7 sodium dodecyl sulfate (SDS) buffer solution was added and the sample was boiled for 10 min. After boiling, the sample was centrifuged, and the supernatant was collected. The supernatant was then subjected to SDS-polyacrylamide gel electrophoresis (PAGE) in a 10% gel, followed by western blot analysis using an anti-\u03b1 toxin polyclonal and mouse anti-toxoid monoclonal antibody (generated in our laboratory) at a dilution ratio of 1:500. Subsequently, the membrane was incubated with the secondary antibody horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG  diluted 1:5000. Immunolabeled bands were visualized using chemiluminescent substrate reagent .pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11, the recombinant pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 was cultured in MRS medium at 37 \u00b0C for 16 h, centrifuged at 10,000\u00d7 g for 5 min, washed three times with sterilized PBS, resuspended in sterile PBS, and then the cells were examined using laser confocal microscopy [To further analyze the protein expressed on the cell surface of pPG-T7g10-PPT/croscopy .L. crispatus N-11 grown until the optical density at 600 nm (OD600) was approximately 1.0, and then centrifuged at 5000\u00d7 g for 10 min. The pelleted cells were resuspended at a concentration of 1010 colony-forming units (CFU)/mL and then washed twice with sterile PBS. The strain was then labeled with carboxyfluorescein diacetate-succinimidyl ester (CFDA-SE) and incubated for 20 min at 37 \u00b0C. Subsequently, the cells were washed and resuspended in PBS, and the labeling ratio was determined using flow cytometry. A total of 15 chickens were inoculated with CFDA-SE-labeled recombinant strain (approximately 109 CFU/mL). Intestinal segments of the jejunum, ileum, and colon were collected on days 1, 4, 7, 11, and 15 (n = 3), and the colonization capability of the recombinant strain in the intestinal tract was assessed using flow cytometry.For the colonization test, recombinant pPG-E-\u03b1-\u03b21-\u03b5-\u03b22/L. crispatus N-11 as oral vaccine, 1-day-old specific pathogen-free (SPF) chickens provided by the Harbin Veterinary Institute were selected as an animal model and kept under SPF environments with free access to standard feed and water. The basal feed diet ingredients and environmental factors of all the groups were equally managed. Before oral immunization, the recombinant strain pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 was cultured to an OD600 = 1.0, washed with PBS, and resuspended to a concentration of 1 \u00d7 1010 CFU/mL in PBS. The immunization procedure was as follows. SPF chickens were divided into five groups. The recombinant strain group (n = 36) was orally immunized with 1 mL pPG-E-\u03b1-\u03b22-\u03b5-\u03b21L. crispatus N-11; the empty carrier vector group (n = 36) was immunized with 1 mL of pPG-T7g10-PPT/L. crispatus N-11; the control group (n = 36) was orally inoculated with 200 \u03bcL of L. crispatus N-11; the mock control group (n = 36) received 200 \u03bcL of PBS, and this group was considered as a control without inoculation (n = 15). All chickens were immunized orally, and the immunization schedule was repeated three times at 14-day intervals. Each dose was administered (offered) once every three days. The samples were collected on days 0, 7, 14, 21, 28, 35, and 42 [The maintenance and use of the experimental animals followed the appropriate international  and national guiding principles (CNAS-CL 06:2018). In this study, to evaluate the immunogenicity of the engineered strain pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/, and 42 .2SO4). On day 35 post-immunization, the levels of interferon (IFN)-\u03b3, interleukin (lL)-2, IL-4, IL-10, IL-12, and IL-17 in the samples were determined using an ELISA kit  according to the manufacturer\u2019s guidelines.Serum and intestinal mucus samples were collected from three chickens randomly in each group on days 0, 7, 14, 21, 28, 35, and 42 after primary immunization, and specific antibody IgA and IgY levels were detected using ELISA as described earlier ,19. Brie2) were obtained from chickens immunized with pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 and the PBS control group (inoculation-free group). Collected samples were fixed with 10% neutral-buffered formalin, processed with paraffin wax, and cut to a thickness of 5 \u03bcm. Immunoglobulin (IgA) cells confined to the intestine were detected using immunohistochemistry. Immunohistochemical staining and calculations were performed as described previously [On day 42 post-immunization, intestinal samples from the duodenum, jejunum, ileum, and cecum (1 cmeviously . Polyclo6 cells/mL) was incubated in each well of a 96-well plate  at 37 \u00b0C in a 5% CO2 atmosphere for 8\u201312 h. Cells were then stimulated with purified recombinant \u03b1-\u03b22-\u03b5-\u03b21 protein at final concentrations of 0.01, 0.1, 1, and 10 mg/mL for 60 h, and an equal volume of the medium was added to the control cells. Then, 10 \u00b5L of thiazolyl blue tetrazolium bromide (MTT) at 5 mg/mL was added to each well and incubated at 37 \u00b0C for 5 h. Finally, the absorbance was measured at 600 nm and the stimulated index was estimated as follows: SI = OD600 (sample)/OD600 (blank control).On day 42 post-immunization, splenocytes were collected from chickens in each group and used in the lymphocyte proliferation assay conducted using the respective kit from Sigma Life Science . Briefly, 100 \u03bcL of spleen cell suspension  of the natural \u03b1-\u03b22-\u03b5-\u03b21 toxin combined with 108 CFU of C. perfringens type A and type B oral pathogenic bacteria via oral administration using an oral gavage needle; the respective control group was not challenged.To estimate the immune protection of chickens orally vaccinated with pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/The daily subsistence ratio of the experimental chickens in each group was counted post-challenge, and histopathological changes in the intestinal sections, including duodenum, jejunum, ileum, and cecum, of all the groups were observed, with special consideration given to the structure, color, and occurrences of necrosis, hemorrhage, congestion, and cell infiltration.L. crispatus pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 on the gut microbiota, we divided a total of 24 chickens into three groups: recombinant L. crispatus-, C. perfringens-, and PBS-inoculated groups (n = 8). The intestinal contents were collected on days 7 and 14 from each group. Microbial DNA was extracted using a Tiangen Stool DNA kit , according to the manufacturer\u2019s instructions. After extraction, the concentration was measured using a NanoDrop 2000 spectrophotometer. After extracting genomic DNA from the samples, the V3-V4 region of 16S rDNA was amplified using specific PCR primers . Purified primers were mixed in equal quantities and connected to the Illumina adapter and linker sequences. A paired-end sequencing (2 \u00d7 250) was performed with equal amounts of purified amplicons on the Illumina platform, then analysed using an Illumina HiSeq2500 from GeneDenovo .To evaluate the effect of the recombinant p < 0.01 and * p < 0.05 indicated statistical significance.All data conformed to a normal distribution for analyzing with Shapiro\u2013Wilk test, shown as mean \u00b1 standard deviation (SD). All experiments were performed in triplicate. Statistical significance was evaluated via one-way analysis of variance (ANOVA) using Tukey\u2019s multiple comparison test and Prism 7 software. ** L. crispatus N-11 cells, but not on the pPG/L. crispatus N-11 cells  in IgA and IgY antibody levels among the groups before immunization. However, after booster immunization, particularly on day 14 post-immunization, anti\u2013\u03b1-\u03b22-\u03b5-\u03b21 toxoid specific IgA level (L. crispatus N-11 group were significantly higher (p \u02c2 0.05) than those of groups \u201cpPG/L. crispatus\u201d L. crispatus N-11\u201d and \u201cPBS\u201d. Conversely, there was no significant difference (p > 0.05) between the control groups before and after immunization. These results indicate that oral pPG-E-\u03b1-\u03b22-\u03b21/L. crispatus N-11 induced specific mucosal and systemic immune responses in chickens.To assay the immunity of chickens orally immunized with strain pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/gA level  in intesgA level  in sera p \u02c2 0.01) were found in chickens immunized orally with pPG-E-\u03b1-\u03b21-\u03b5-\u03b22/L. crispatus N-11 than in the pPG-T7g10-PPT/L. crispatus N-11 and PBS groups . Following taxonomic assignment, 373 operational taxonomic units (OTUs) were shared among all groups. Moreover, we found that most OTUs were present individually in different groups (L. crispatus (R. Lact-7 and R. Lact-14) was measured on days 7 and 14, and was found to be significantly different from the negative control group (PBS-7 and PBS-14) and C. perfringens groups (Cp-7 and Cp-14).We analyzed the V3\u2013V4 regions of the bacterial 16S rRNA gene sequence and evaluated the \u03b1-diversity indices . The results showed that the gut microbiota of the control, Cp, and R. lact groups differed from each other (t groups A. The miL. crispatus N-11 (R. Lact-7 and R. Lact-14), C. perfringens (Cp-7 and Cp-14), and control (PBS-7 and PBS-14) groups were different from each other  constitutively expressing the toxoid of C. perfringens, \u03b1-toxin, and evaluated its immunogenicity. They observed a significant increase in sIgA level, with the immune protection rate being 80% [upp-deficient L. casei strain with a plasmid cross-recombination system, which expressed the \u03b1 toxin in place of the upp gene. This did not necessitate antibiotic screening and provided a reference for the preparation of an oral vaccine against C. perfringens [otoxemia . The patfections . The tox poultry . It is t poultry . The toxl damage . Therefoeing 80% . Song etfringens .L. crispatus N-11, with the EGFP-marked plasmid pPG-E-\u03b1-\u03b22-\u03b5-\u03b21, was effectively constructed with the constitutive expression plasmid pPG-T7g-10-PPT. Based on the different types of promoters in the Lactobacillus expression system, the system is divided into an inducible expression system and a constitutive expression system. Inducible expression is widely used in the construction of genetically engineered LAB, with lactose, xylose, pH, temperature [Lactobacillus oral vaccines. In the current study, we constructed a constitutive Lactobacillus expression system, using the pPG-T7g10-PPT carrier vector [L. crispatus to express \u03b1-\u03b22-\u03b5-\u03b21 toxoids of C. perfringens. The results revealed that the fusion protein \u03b1-\u03b22\u03b5-\u03b21 could be expressed by recombinant PG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11, and the expression was sufficient for the toxoid to be recognized by an anti-toxoid monoclonal antibody. Moreover, the expression of the plasmid toxoid protein on the cell surface of the strain pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 was confirmed using laser confocal microscopy. Thus, the membrane-linked, antigen-generating, genetically engineered Lactobacillus strain, as an oral vaccine, holds potential to help the host detect antigens and efficiently stimulate antigen-specific immune responses. The ability of genetically engineered LAB to colonize and proliferate in the intestinal tract is a key factor for effective induction of an immune response in the body. Strong adhesion of LAB can effectively improve the immune response of the body [L. crispatus N-11 in the intestine. The results indicated that pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 could effectively colonize the intestine of chickens and were distributed in the jejunum, ileum, and colon, and likely among other regions. Colonization rates in the jejunum, ileum, and colon of chickens on day 1 after oral administration were high, but gradually decreased, although they remained appreciably high until the 15th day after oral administration. The good colonization capability of pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 improved its ability to effectively stimulate the immune response of the body.In the current study, as an antigen delivery vector, pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/perature ,30,31, aperature  being usr vector , and appthe body ,29,33. TL. casei and its complementary plasmid to express the non-toxic antigen of Porcine Epidemic Diarrhea Virus (PEDV), and the results showed that it could stimulate the production of sIgA and IgG in mice [L. crispatus N-11 in chickens, immunized orally using ELISA and immunohistochemistry. Our results revealed there was a significant increase in levels of (p < 0.01) anti-\u03b1-\u03b21-\u03b5-\u03b22 toxoid sIgA-based mucosal immune responses and IgY-based systemic immune responses, indicating that the pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 constructed in this study showed better immunogenicity. Furthermore, the IgA content in the chickens immunized with the recombinant strain was significantly higher than that in the control group. The immunohistochemistry results also supported the results of the ELISA antibody detection test.An ideal mucosal vaccine must successfully induce both intestinal mucosal and systemic immune responses. sIgA is the dominant antibody on the mucosal surface and plays a significant role in host defense against infections ,24. Avia in mice . TherefoL. crispatus N-11 can also induce cellular immune responses. The ratio of T helper 1 (Th1)/(Th2) cells determines the direction of the immune response. According to a previous study [Lactobacillus can stimulate the progression of innate immune responses and trigger Th1-mediated immune reactions. IFN-\u03b3 is mainly produced by Th1 cells and can improve the activity of Th1 cells in promoting cellular immune activity [p \u02c2 0.01) in chickens immunized orally with pPG-E-\u03b1-\u03b21-\u03b5-\u03b22/L. crispatus N-11 than in the empty vector PPG-T7g10-PPT/L. crispatus, non-recombinant L. crispatus N-11, and PBS groups. Additionally, it is worth noting that the concentrations of these cytokines in the serum of chickens in the PPG-T7g10-PPT/L. crispatus and L. crispatus N-11 groups were higher than those in the PBS group, indicating that the non-engineered probiotics themselves can directly improve the nonspecific immune response. The experimental results show that oral immunization with recombinant L. crispatus not only induces a systemic humoral immune response in the body of the animal, but also stimulates the body to produce a cellular immune response. To verify the immune-protective effect of orally administered recombinant L. crispatus, we conducted a post-immunization challenge test. The toxin used was a mixture of natural toxins of C. perfringens types A and B. The experiment showed that the immunity induced by oral administration of recombinant L. crispatus in the vaccine group was able to resist the effect of the natural toxin of C. perfringens, with all four chickens tested showing protection, whereas all of the pPG-T7g10-PPT/L. crispatus N-11 and PBS control chickens died. Our histopathological observations show that the intestines of the vulnerable groups showed obvious pathological changes compared with that of the chickens orally immunized with recombinant L. crispatus. These results indicate that recombinant pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 is immunogenic. We also examined the fecal microbiome to explore the effects of oral recombinant L. crispatus on the gut microbiota. We analyzed the V3-V4 regions of the bacterial 16S rRNA gene sequence and found a significant difference in the microbial diversity in intestinal feces of the chickens orally administered recombinant L. crispatus N-11, compared with the control groups. The relative abundance of Bacillus increased significantly, whereas that of Clostridium decreased compared to that in the control group.We found that there was a positive association between cell immunity and lymphocyte proliferation rate. Subsequently, we were able to identify increased spleen lymphocyte proliferation in immunized chickens. Our results indicated that recombinant pPG-E-\u03b1-\u03b21-\u03b5-\u03b22/us study , Lactobaactivity . The Th2activity . In the L. crispatus constitutively expressing the \u03b1, \u03b21, \u03b5, and \u03b22 toxoids of C. perfringens. Its immunogenicity as an oral probiotic vaccine was explored, and our results showed that pPG-E-\u03b1-\u03b22-\u03b5-\u03b21/L. crispatus N-11 could effectively induce mucosal, humoral, and cellular immune responses and provide protective effects against a C. perfringens challenge. These results demonstrate that the engineered strain is a promising candidate vaccine against C. perfringens infections.In conclusion, this study constructed EGFP-marked, genetically engineered"}
+{"text": "C. albicans-administered 5/6 nephrectomized (Candida-5/6 Nx) mice. At 20 weeks post 5/6 Nx, Candida-5/6 Nx mice demonstrated increased 24 h proteinuria, liver enzymes, and serum cytokines , but not weight loss, systolic blood pressure, hematocrit, serum creatinine, or gut-derived uremic toxins (TMAO and indoxyl sulfate), compared to in 5/6 Nx alone. The gut leakage in Candida-5/6 Nx was more severe, as indicated by FITC-dextran assay, endotoxemia, and serum BG. The areas of fibrosis from histopathology, along with the upregulated gene expression of Toll-like receptor 4 (TLR-4) and Dectin-1, the receptors for LPS and BG, respectively, were higher in the kidney, liver, and heart. In vitro, LPS combined with BG increased the supernatant IL-6 and TNF-\u03b1, upregulated the genes of pro-inflammation and pro-fibrotic processes, Dectin-1, and TLR-4 in renal tubular (HK-2) cells and hepatocytes (HepG2), when compared with LPS or BG alone. This supported the pro-inflammation-induced fibrosis and the possible LPS\u2013BG additive effects on kidney and liver fibrosis. In conclusion, uremia-induced leaky gut causes the translocation of gut LPS and BG into circulation, which activates the pro-inflammatory and pro-fibrotic pathways, causing internal organ fibrosis. Our results support the crosstalk among several organs in CKD through a leaky gut.Uremic toxins and gut dysbiosis in advanced chronic kidney disease (CKD) can induce gut leakage, causing the translocation of gut microbial molecules into the systemic circulation. Lipopolysaccharide (LPS) and (1\u21923)-\u03b2-D-glucan (BG) are the major gut microbial molecules of Gram-negative bacteria and fungi, respectively, and can induce inflammation in several organs. Here, the fibrosis in the kidney, liver, and heart was investigated in oral  Candida cell wall), from the intestinal translocation activate their receptors, it leads to the enhanced inflammatory responses that further facilitate the progression of CKD [Candida albicans are the microbes with the most and the second most abundance in the human intestine. Therefore, increases in both molecules through a leaky gut might lead to clinical adverse effects [Chronic kidney disease (CKD) has been acknowledged as a significant global burden , leadingn of CKD . Notably effects .Candida spp. to be detectable in stool cultures [Candida spp. in the gut does not directly cause disease, gut fungi alter the gut microbiota and provide a higher BG in gut content [Candida exotoxin, and endogenous alcohol) [Candida spp. possibly facilitate the growth of specific bacteria with the glucanase enzyme, which can digest BG from the fungal cell wall [Candida on gut bacteria, gut fungi alter microbial homeostasis, and the oral administration of Candida causes gut dysbiosis, with leaky gut and inflammatory reactions observed in several mouse models [However, fungi are less prominent in the mouse gut than in the human intestine, and the influence of intestinal fungi in mouse models is possibly underestimated . Contrarcultures . Althoug content , which p content ,18,19,20alcohol) ,22,23,24alcohol) . Meanwhiell wall . Despitee models ,28,29,30e models ,32.Candida gavage at 16 weeks after 5/6 nephrectomy (5/6 Nx), despite a synergistic pro-inflammatory effect of LPS plus BG [Gut translocation of LPS and BG causes systemic inflammation , and chr plus BG . However plus BG  and endo plus BG ,40, (ii) plus BG ,40,41,42 plus BG ,43, the Candida gavage were observed for 20 weeks with the exploration of fibrosis in other internal organs (liver and heart) along with in vitro experiments. To understand the pathophysiologic effects of fungi on fibrosis, BG and LPS  were tested on hepatocytes (HepG2 cells) and renal tubular cells (HK2 cells).Here, 5/6 Nx and Candida administration during the 20 weeks observation, more prominent systemic inflammation and organ injuries in Candida-administered 5/6 Nx mice, compared with 5/6 Nx alone, were demonstrated by the increased 24 h proteinuria  [Candida-administered 5/6 Nx mice than in 5/6 Nx alone, as indicated by FITC-dextran assay, endotoxemia, and increased serum BG  , liver eserum BG A\u2013C. Notaserum BG , supportAlthough inflammatory maladaptation from uremia and LPS alone can cause fibrosis and organ dysfunction ,48,49, aLikewise, LPS and BG also enhance inflammation in hepatocytes because LPS and BG from gut translocation are directly transported to the liver through the portal vein . Here, aCandida administration in mice is used to examine the influence of gut fungi in several models, taking advantage of the lower abundance of C. albicans in mouse feces compared with humans (Candida in mouse feces is detectable only by polymerase chain reaction (PCR) [Candida-5/6 Nx mice had more severe gut leakage (FITC-dextran assay), with a higher level of serum endotoxin and BG (glucanemia) compared to non-Candida 5/6 Nx mice, perhaps due to the direct intestinal invasion of fungi, gut dysbiosis, and pro-inflammatory enterocytes [Candida-induced gut dysbiosis in uremic mice, as previously described [Candida 5/6 Nx were higher than non-Candida 5/6 Nx, and serum BG might be the main factor responsible for the hyper-inflammation in Candida uremic mice. Additionally, the inflammatory activation of LPS and BG in the blood of 5/6 Nx mice might be responsible for the increased proteinuria, elevated liver enzyme, and organ damage , as indicated by histology. Although Candida did not alter systolic blood pressure in 5/6 Nx mice, cardiac fibrosis was more prominent in Candida-5/6 Nx than 5/6 Nx alone, implying an impact of some non-blood pressure-related profibrotic factors possibly, which was due to the direct myocardial activation by LPS and BG. An upregulation of TLR-4 and Dectin-1 in these organs  supported an inflammatory synergy of LPS and BG in Candida-5/6 Nx mice. Likewise, enhanced fibrosis in the liver might be correlated with LPS\u2013BG from a leaky gut that was directly transported to the liver through the portal vein [Candida administration is important as renal fibrosis at 20 week, but not at 16 weeks of the experiment [Candida administration (both heat-killed and viable cells) was also previously demonstrated [Candida-5/6 Nx mice, supporting the importance of gut fungi in the condition with systemically chronic inflammation. Thus, pro-fibrosis of the internal organs in other conditions with chronic inflammation from leaky gut, such as obesity, inflammatory bowel disease, and cirrhosis, would be interesting to explore further.Oral on (PCR) , but noton (PCR) , which don (PCR) . Here, Cerocytes . Althougerocytes . Despiteescribed , only setal vein ,52. Notaperiment , demonstnstrated . It is instrated . Here, tDectin-1 by LPS, possibly responsible for the higher responses against BG when simultaneously presented with LPS. The LPS\u2013BG responses of hepatocytes were severe enough for the more profound upregulation of HIF-1\u03b1 and fibronectin, the important liver profibrotic genes [Dectin-1, but the inflammatory responses against LPS\u2013BG were potent enough for a more prominent collagen type III upregulation compared with LPS activation alone [The synergy or additive effect of BG presentation upon LPS responses is intensively demonstrated through the activation of several innate immune cells  ,59,60,61ic genes ,73, whenon alone . Hence, Our data support the crosstalk among several organs in CKD through leaky gut, which might be a common situation in several medical conditions . TherefoThe approved protocol of the Institutional Animal Care and Use Committee of the Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand (CU-ACUP No. 018/2562), according to the National Institutes of Health (NIH) criteria , using 8Candida albicans (5/6 Nx + Candida) to explore the impact of gut fungi using C. albicans from the American Type Culture Collection (ATCC 90028) , which was cultured overnight on Sabouraud dextrose broth (SDB)  at 35 \u00b0C for 48 h before enumeration using a hemocytometer. The C. albicans at 1 \u00d7 106 CFU in 0.5 mL PBS or PBS alone was orally administered on alternate days starting from 4 weeks after the right nephrectomy until 20 weeks. Another group of mice underwent the sham operation to identify renal vessels before abdominal closure (Sham group). The Candida-administered sham mice have not been demonstrated here because of the lack of difference from the sham control reported in a previous publication [First, 5/6 nephrectomy (5/6 Nx) surgery was performed via flank approach under isoflurane anesthesia by removing the upper and lower poles of the left kidney before the right nephrectomy 1 week later, as previously described ,42. Only\u00ae silica; 00G-4274-E0, Phenomenex\u00ae, Torrance, CA, USA) and high-performance liquid chromatography , as previously described [\u00a9 software, Bethesda, MD, USA) in a 200\u00d7 magnification field with 10 fields per sample. Because of the interest in the pro-inflammatory effect of LPS and BG in each organ, the gene expression of TLR-4 and Dectin-1 in each organ was evaluated by quantitative reverse transcription polymerase chain reaction (qRT-PCR) relative to \u03b2-actin (a house-keeping gene) with the 2\u2212\u0394\u0394CT method, as previously described [All mice were sacrificed at 20 weeks post right nephrectomy, and the 24 h urine samples were collected at 48 h before sacrifice using a metabolic cage . The mouse systolic blood pressure and hematocrit were measured by tail-cuff plethysmography   and the escribed . Serum cescribed ,80. The escribed ,81,82,83\u00ae, St. Louis, MO, USA) was orally administered before measuring FITC-dextran in serum 3 h later by fluorospectrometer . Meanwhile, serum LPS and BG was evaluated by HEK-Blue LPS Detection Kit 2  and Fungitell\u00ae assay , respectively, and values less than 0.01 EU/mL (for LPS) and 7.8 pg/mL (for BG) were recorded as 0, due to the lower limit of the standard curve of the test.Because the detection of fluorescein isothiocyanate (FITC)-dextran  in serum after an oral administration, or the spontaneous elevation in serum of LPS or BG without systemic infection, indicate gut permeability defects (gut leakage), these parameters were used as previously described ,58,84,85Candida, respectively, on kidneys and liver, HK2 renal proximal tubular cells (ATCC 237 CRL-2190) and HepG2 hepatocytes  were used as the representatives. Briefly, HK2 cells or HepG2 at 1 \u00d7 106 cells/well maintained in Dulbecco\u2019s modified Eagle Medium (DMEM) were incubated LPS (Escherichia coli O26:B6) (Sigma-Aldrich) at 100 \u00b5g/mL with or without BG (CM-Pachyman)  at 100 \u00b5g/mL for 24 h (HK2 cells) or 4 and 72 h (HepG2 cells) under 5% CO2 at 37 \u00b0C before the determination of supernatant cytokines (TNF-\u03b1 and IL-6) by ELISA . Additionally, the expression of several genes related to inflammatory responses and fibrosis was examined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) relative to \u03b2-actin (a house-keeping gene) with the 2\u2212\u0394\u0394CT method using cDNA (SuperScript\u2122 Vilo\u2122 cDNA synthesis assay) (Invitrogen\u2122) prepared from 50 ng of TRIzol-extracted total RNA (invitrogen\u2122) by a qPCR machine (LightCycler\u00ae 2.0) (Roche Diagnostics) with the primers , determined using GraphPad Prism version 9.0 software . Statistical significance was determined by one-way analysis of variance (ANOVA) followed by Tukey\u2019s analysis. The time-point experiments were analyzed by repeated measures ANOVA. All statistical analyses were performed with Stata 16.0 software  and Graph Pad Prism version 7.0 software . A Our results suggest the crosstalk among several organs in CKD through a leaky gut. Uremia-induced leaky gut in advanced CKD causes the translocation of LPS and BG from the gut into the systemic circulation. As such, LPS and BG additively induce the pro-inflammatory and pro-fibrotic pathways through the activation of TLR-4 and Dectin-1, causing internal organ fibrosis. These enhanced inflammatory responses during leaky gut could worsen uremic complications in patients with advanced CKD. Gut abundance of Gram-negative bacteria and fungi and/or the levels of LPS and BG in the blood might be interesting factors in predicting the severity of systemic inflammation during CKD-induced leaky gut."}
+{"text": "Cardiopulmonary exercise testing (CPET) has been used to explore the blood pressure response and potential cardiovascular system structure and dysfunction in male patients with essential hypertension during exercise, to provide a scientific basis for safe and effective exercise rehabilitation and improvement of prognosis. n\u2009=\u200947) and non-EH group (n\u2009=\u200953). Based on whether the oxygen pulse (VO2/HR) plateau appeared immediately after anaerobic threshold (AT), the EH group was further divided into the VO2/HR plateau immediately after AT (EH-ATP) group (n\u2009=\u200919) and EH-non-ATP group (n\u2009=\u200928). The basic clinical data and related parameters, key CPET indicators, were compared between groups.  A total of 100 male patients with essential hypertension (aged 18\u201360) who were admitted to the outpatient department of the Center for Diagnosis and Treatment of Cardiovascular Diseases of Jilin University from September 2018 to January 2021 were enrolled in this study. The patients had normal cardiac structure in resting state without clinical manifestations of heart failure or systematic regularization of treatment at the time of admission. Symptom-restricted CPET was performed and blood pressure was measured during and after exercise. According to Framingham criteria, male systolic blood pressure (SBP) \u2265210\u2009mmHg during exercise was defined as exercise hypertension (EH), and the subjects were divided into EH group  at AT but also WR, oxygen consumption per minute (VO2), VO2/kg, and VO2/HR at peak were significantly lower in the EH-ATP group compared to the EH-non-ATP group. Peak diastolic blood pressure (DBP) increment and decreased \u25b3VO2/\u25b3WR for AT to peak were independent risk factors for VO2/HR plateau appearing immediately after AT in EH patients.  Body mass index (BMI) visceral fat, resting SBP, and SBP variability in EH group were significantly higher than those in non-EH group. Moreover, VOChiCTR2100053140. EH patients have impaired autonomic nervous function and are prone to exercise-induced cardiac dysfunction. EH patients with exercise-induced cardiac dysfunction have reduced peak cardiac output and exercise tolerance and impaired vascular diastolic function. CPET examination should be performed on EH patients and EH patients with exercise-induced cardiac dysfunction to develop precise drug therapy and effective individual exercise prescription, to avoid arteriosclerosis and exercise-induced cardiac damage. The retrospective study protocol was approved by medical ethics committee of the First Hospital of Jilin University (AF-IRB-032-06 No. 2021-015). The study was registered with the Chinese Clinical Trials Register, registration number:  Hypertension is one of the most important global health challenges and a leading risk factor of cardiovascular diseases (CVDs). Studies have shown that in 2015, the number of hypertensive patients was about 1.13 billion worldwide, among which the age-standardized prevalence rate of males and females was 24% and 20%, respectively [At present, three measurements of resting state blood pressure (systolic blood pressure \u2265140\u2009mmHg and/or diastolic blood pressure \u226590\u2009mmHg) in different days are still used to diagnose hypertension and evaluate hypertension according to resting blood pressure , referriCardiopulmonary exercise testing (CPET) is the most accurate method for detecting cardiopulmonary function during exercise and is the gold standard for evaluating exercise tolerance and cardiopulmonary fitness , 12. CPE2. The retrospective study protocol was approved by medical ethics committee of the First Hospital of Jilin University (AF-IRB-032-06 No. 2021-015). The study was registered with the Chinese Clinical Trials Register, registration number: ChiCTR2100053140.This retrospective study included a total of 386 18\u201360-year-old male patients with essential hypertension admitted to outpatient department of cardiovascular disease of the First Hospital of Jilin University from September 2018 to January 2021. Patients with abnormal cardiac structure (105) and patients who disagreed to undergo CPET (181) were excluded from this study. The normal cardiac structure was defined by echocardiographic measurement from M-mode echocardiogram in the parasternal long-axis view as follows: (1) left atrium anteroposterior diameter is 19\u201339\u2009mm, (2) left ventricular end diastolic diameter is 35\u201355\u2009mm, (3) interventricular septal depth is 7\u201311\u2009mm, (4) left ventricular posterior wall thickness is 7\u201311\u2009mm, (5) left ventricular ejection fraction is \u226550% in resting state, and (6) left ventricular mass index \u2264115\u2009g/m\u03b2-blockers.The diagnostic criteria for essential hypertension were in line with the guidelines for hypertension prevention and Treatment in China in 2018 : (1) hyp2/HR plateau appeared immediately after anaerobic threshold (AT), namely, the VO2/HR plateau immediately after AT (EH-ATP) group (n\u2009=\u200919) and non-VO2/HR plateau after AT (EH-non-ATP) group (n\u2009=\u200928).According to the Framingham standard , 10, theBaseline characteristics, including age and biochemical data such as total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), uric acid, and creatinine, were obtained from electronic medical records. Before CPET, all patients completed the blood biochemical tests by venous blood sampling under fasting state in the morning.Subjects were placed supine on an examination bed and rested for 5 minutes. Left and right ankle brachial index (ABI) and left and right brachial-ankle pulse wave velocity (baPWV) were measured by an arteriosclerosis detection device .Subjects took off their shoes, socks, and heavy clothing and stood on a body composition analyzer  for body composition measurement, body mass index (BMI), and visceral fat content.2) and carbon dioxide (CO2) emission at resting state, AT state, and peak state by increasing 20 watts/min. At the same time, heart rate and blood pressure were monitored by 12-lead electrocardiogram recorder and dynamic blood pressure monitor. The CPET parameters including oxygen consumption per kilogram body weight (VO2/kg), heart rate (HR), oxygen pulse (VO2/HR), work rate (WR) at resting, AT, and peak states, and blood pressure at resting state and 1 and 3 minutes after exercise were recorded. The exercise test was terminated if the patient developed any of the following subjective or objective conditions: abnormal hemodynamic or ECG exercise response or other causes such as dyspnea, angina, or lower extremity muscle fatigue [Cardiopulmonary function detector  was used to detect the changes of oxygen consumption . The variability of blood pressure within 15 minutes was calculated from the blood pressure values at 1, 3, 5, 7, 10, and 15 minutes after exercise.U test; chi-square test was carried out for dichotomous variables. In all analyses, a two-tailed P < 0.05 was considered statistically significant. To minimize potential bias, corrections were performed by multifactor binary logistic regression, in which the indices and variables showing P < 0.05 in the univariate analyses were introduced and were used to distinguish independent influencing factors. The results are presented as odds ratios (ORs) with 95% confidence intervals (95% CIs).SPSS 23.0 software was used for statistical analysis. The measurement data conforming to normal distribution were described by mean\u2009\u00b1\u2009standard deviation, and non-normally distributed variables were presented as medians . Categorical variables were expressed as numbers and percentages. Continuous variables between the groups were compared with means of one-way analysis of variance or Mann\u2013Whitney 2, P=0.006), visceral fat , resting SBP , peak SBP increase , and SBP variability  within 15 minutes after exercise in the EH group were significantly higher than those in the non-EH group , peak DBP increase, and DBP variability within 15 minutes after exercise between the two groups . BMI .As shown in 2 , VO2/kg , VO2/HR , and WR  in the EH-ATP group were lower than those in EH-non-ATP group  were both significantly lower in EH-ATP group than in non-EH group only at peak state but not at AT state , but lower at peak state (10.76\u2009\u00b1\u20091.70 vs. 11.24\u2009\u00b1\u20092.11\u2009ml/beat) in the EH-ATP group than in the non-EH group  and VO2/HR plateau are independent risk factors for EH. We found that EH patients with exercise-induced cardiac dysfunction have a significant decrease in both exercise tolerance and oxygen utilization efficiency. Moreover, we showed that peak DBP increment and decreased \u25b3VO2/\u25b3WR for AT to peak are independent risk factors for VO2/HR plateau appearing immediately after AT in EH patients.The current study is to explore the correlation between EH and cardiovascular dysfunction. Our study showed that EH patients have higher BMI, visceral fat content, and resting SBP in resting state, and the rate of exercise-induced cardiac dysfunction is higher than that in non-EH patients. Multivariate binary logistic regression analysis showed that resting SBP, 15-minute SBP variability, and the presence of VO2/HR plateau are independent risk factors for EH. Our results revealed no significant difference in the degree of arteriosclerosis at the resting state but higher autonomic nervous dysfunction during exercise in EH patients compared to non-EH patients. Miyai et al. [The presence of EH may indicate a subhealth state, and for hypertensive patients, the presence of EH may increase the damage of target organs and the occurrence of cardiovascular and cerebrovascular events. Therefore, early detection of EH in hypertensive patients is particularly important. Studies have shown that the occurrence of EH may be related to hyperactivity of sympathetic nervous system , excessii et al.  found th2/HR does not rise with the increase of exercise intensity after the AT state, it indicates a decrease of cardiac stroke volume [2/HR level of EH patients increased significantly at AT state, but there was no difference in heart rate and WR, indicating that in EH patients, the after-loading of left ventricle (SBP) is greater during moderate intensity exercise, and the heart needs to do more work to meet the body's need for oxygen. Recent studies have reported that the elevation of SBP during moderate exercise is a better predictor of left ventricular hypertrophy (LVH) than resting SBP in hypertensive patients [2/HR plateau in moderate exercise is higher in the EH group and it is an independent risk factor for EH, which may be a vital sign of early decrease in cardiac function due to excessive elevation of blood pressure.During exercise, with the increase of exercise intensity, the demand for oxygen of skeletal muscle increases, and the left ventricle increases cardiac output to meet the oxygen demand of muscle . The ince volume , which ipatients , 26. As 2/kg is an important indicator of exercise tolerance and is used to evaluate the level of aerobic capacity [2, VO2/kg, WR, and VO2/HR are significantly reduced in EH patients with VO2/HR plateau immediately after AT state during exercise. These indicate that both exercise tolerance and maximum stroke volume are significantly reduced in these patients, which is an important sign of early decline in exercise-induced cardiac function. At AT state, VO2/kg and HR in EH-ATP group did not change, but WR decreased significantly than that in non-EH-ATP group. Furthermore, the parameter of oxygen utilization efficiency, \u25b3VO2/\u25b3WR for AT to peak, decreased significantly in the EH-ATP group. It was an independent risk factor for VO2/HR plateau in EH patients, suggesting the decrease in aerobic work efficiency of muscle above moderate intensity exercise. This may be a more important cause of the decline in exercise tolerance except for the decrease in peak VO2. Previous studies have shown that decreased type I muscle fiber in patients with chronic heart failure induces the reduction in the number of skeletal muscle capillaries and the number of oxidase, resulting in a decline in the utilization efficiency of oxygen [2/HR plateau appearing immediately after AT in EH patients, indicating exercise-induced cardiac dysfunction, which may be related to the exercise-induced vascular diastolic dysfunction. Taken together, EH patients with decreased exercise-induced stroke volume may have a potential decline in the aerobic work efficiency of skeletal muscle and impaired vascular diastolic function, which may contribute to the development of LVH. Thus, special attention should be paid to the safety and effectiveness of exercise intensity to avoid the exercise-induced cardiovascular injury in EH-ATP patients. In addition, no significant difference was found in cardiopulmonary fitness of EH-ATP patients before AT exercise intensity, which is consistent with the previous studies showing that regular moderate intensity aerobic exercise treatment is safe and effective for hypertension patients [2/HR plateau (decreased stroke volume) to prevent the development of LVH.VOcapacity , 12. In capacity . Our stuf oxygen . In the patients , 30. A mpatients . It seempatients . Therefopatients , the timIn conclusion, compared to non-EH patients, EH patients have worse autonomic nervous function and are more prone to exercise-induced cardiac dysfunction. EH patients with exercise-induced cardiac dysfunction have decreased peak cardiac output and exercise tolerance and impaired vascular diastolic function. Therefore, exercise with an intensity above the AT state for a long time may aggravate damage of the heart. In view of this, it is recommended to conduct early screening of CPET for patients with essential hypertension to detect potential exercise-induced cardiac dysfunction in EH patients as early as possible. We can achieve safe and effective anti-hypertension through precise drug therapy and individualized exercise treatment to inhibit the process of arteriosclerosis and improve the long-term prognosis. Future studies are needed to determine the optimal individual level of exercise to achieve aerobic performance and avoid the onset of EH in hypertensive patients.Firstly, the patients included in this study were all outpatients from the department of cardiology at the First Hospital of Jilin University, only representing the single center study. Secondly, the sample size of patients included in this study was limited, and the results of the study need to be confirmed by a larger sample size. Thirdly, the subjects were all patients with essential hypertension and were not compared to the general healthy population. Fourthly, although EH patients with decreased exercise-induced stroke volume may be related to the exercise-induced vascular diastolic dysfunction, endothelial function was not evaluated in the present study. Future studies are required to assess endothelial function, such as a flow-mediated vasodilation and SBP at moderate exercise, to clarify the influence of vascular endothelial dysfunction on exercise-induced cardiac dysfunction in EH patients. Fifthly, EH patients with decreased exercise-induced stroke volume may have a potential decline in the aerobic work efficiency of skeletal muscle above moderate exercise. To achieve safe and effective anti-hypertension through individualized exercise treatment, the intensity and duration of HIIT should be determined in the future studies. Finally, female subjects should be studied to investigate whether there is any gender difference."}
+{"text": "To evaluate the effect of the VFQ-25 scale on the efficacy of Nd\u2009:\u2009YAG laser ablation in patients with different severity of vitreous opacities.  From January 2020 to March 2021, data of patients who presented to our department and were diagnosed with vitreous opacity were collected, and the severity of vitreous opacity was divided into four grades: I, II, III, and IV. Preoperative visual acuity, intraocular pressure, dilated fundus, B ultrasound, and other examinations were performed, and the patients were scored using the VFQ-25 scale. All patients underwent Nd\u2009:\u2009YAG laser ablation and were followed for 6\u2009months. The VFQ-25 scale was again used postoperatively to score the patient's efficacy. The general information and clinical characteristics of the patients we collected. The Spearman's test was used to evaluate the correlation between VFQ-25 score and Nd\u2009:\u2009YAG laser efficacy in patients. P < 0.001). The overall response rates of vitreous opacities I, II, III, and IV were 100%, 90.9%, 80.0%, and 71.4%, respectively. There was a significant correlation between the postoperative VFQ-25 total score, and the therapeutic effect of laser ablation for grade I vitreous opacities, with a correlation coefficient r of 0.417 (P=0.001). The correlation coefficient r between the total score of postoperative VFQ-25 and the treatment effect of grade II vitreous opacity was 0.622 (P=0.002). However, the correlation between the postoperative efficacy of grade III and IV patients and the VFQ-25 score was not significant.  A total of 80 patients (95 eyes) were included in this study. Vitreous opacities were grade I in 56 eyes (58.9%), grade II in 22 eyes (23.2%), grade III in 10 eyes (10.5%), and grade IV in 7 eyes (7.4%). Compared with preoperative scores, patients with vitreous opacity had significantly higher postoperative scores in terms of overall health (36.54\u2009\u00b1\u200917.06 vs 33.52\u2009\u00b1\u200916.74), overall visual acuity (60.39\u2009\u00b1\u200914.24 vs 57.56\u2009\u00b1\u200913.13), color vision (88.94\u2009\u00b1\u200912.56 vs 86.38\u2009\u00b1\u200912.37), and peripheral visual acuity (74.06\u2009\u00b1\u200918.38 vs 72.20\u2009\u00b1\u200918.79) items (all  In patients with different degrees of vitreous opacity undergoing Nd\u2009:\u2009YAG laser vitreous ablation, the overall health, overall visual acuity, color vision, and peripheral visual acuity were improved after surgery, and the VFQ-25 score was significantly correlated with the postoperative efficacy, which is worthy of clinical use. The vitreous body is an extracellular matrix consisting of 98% water and macromolecules, the most important of which are hyaluronic acid and collagen in clear gel . The vitFrom January 2020 to March 2021, the data of 95 eyes of 80 patients  who presented to our department and were diagnosed with vitreous opacity were collected.Inclusion criteria is as follows: (1) vitreous opacity was confirmed by B ultrasound and slit lamp examination; (2) there were dust and cloud flocculent floaters in front of the eyes and affected life; and (3) the general health status was stable, and the symptoms were stable within half a year.Exclusion criteria is as follows: (1) previous history of ocular surgery; (2) ocular diseases with uveitis, fundus lesions, and other ocular diseases affecting treatment or causing complications; (3) risk of retinal detachment; (4) unable to cooperate, or failed to adhere to treatment and follow-up; and (5) combined liver and kidney dysfunction, tumors or bleeding, and coagulation diseases. All patients were informed and signed a consent form. The study protocol was approved by the Ethics Committee of Hefei Bright Eye Hospital.Grade I refers to discomfort during vision, and monomeric opacities can be seen in the fundus; grade II refers to discomfort during vision, and several clear monomeric opacities can be seen in the fundus; grade III refers to obvious symptoms, an annular floating sensation during vision, and obvious annular opacities can be seen in the fundus; and grade IV refers to obvious symptoms, nebulous discomfort during vision, and a large number of opacities of different shapes can be seen in the fundus.All patients underwent visual acuity, intraocular pressure, dilated fundus, and B ultrasound. The Lumenis SmartV Selecta Duet Laser System was selected for laser treatment with parameters set to a starting energy of 2.0\u20138.0\u2009mJ, single point emission, and energy parameters were progressively adjusted to vaporize the opacities. During the treatment, the number of pulses emitted per treatment is controlled within 500, and the time is controlled within 30 minutes according to the previous order after up and down. If there are still many opacities, elective retreatment is carried out.All patients were followed up until 6 months after laser treatment. Visual acuity, intraocular pressure, dilated fundus, and B ultrasound were re-examined to analyze the improvement of clinical symptoms. Criteria for curative effect determination is as follows: (1) markedly effective: the symptoms disappeared, and no complications were observed; (2) effective: the symptoms were improved, and no complications were observed; (3) ineffective: the symptoms were not improved, with or without complications. Overall response rate = (markedly effective\u2009+\u2009effective)/total number of eyes \u00d7 100%. The complications include lens injury, postoperative high intraocular pressure, glaucoma, retinal hemorrhage, and an increased number of floating objects.t-test was used to compare differences in the VFQ-25 scores before and after laser treatment in patients with vitreous opacities. Categorical variables were presented as frequencies (percentages) and differences in overall response rates among patients with different severity of vitreous opacities were assessed by the chi-square test. The Spearman's test was used to evaluate the correlation between VFQ-25 score and Nd\u2009:\u2009YAG laser efficacy in patients. Two-sided P < 0.05 was considered statistically significant. Data were analyzed using SPSS statistics 21.0 .Continuous variables were presented as mean\u2009\u00b1\u2009standard deviation, and a paired As shown in P < 0.001). However, the preoperative and postoperative scores of near vision activity, distance vision activity, social function, mental health, social activity role disorder, eye pain, social dependence, and driving were similar, and the differences were not statistically significant (P > 0.05).As shown in \u03c72\u2009=\u200922.576, P=0.001).As shown in Correlation of VFQ-25 with Treatment Effect.r of 0.417 (P=0.001). The correlation coefficient r between the total score of postoperative VFQ-25 and the treatment effect of grade II vitreous opacity was 0.622 (P=0.002). The correlation coefficient r between the postoperative VFQ-25 score and the treatment effect of grade III vitreous opacity was 0.583 (P=0.077). The correlation coefficient r between the postoperative VFQ-25 score and the treatment effect of grade IV vitreous opacity was 0.673 (P=0.097).As shown in In patients with vitreous opacities, Nd: YAG laser ablation was found to significantly improve overall health, overall visual acuity, color vision, and peripheral visual acuity item scores. Different severity of vitreous opacity may lead to different therapeutic effects. Notably, the postoperative VFQ-25 score was significantly correlated with the treatment effect of laser ablation.Vitreous opacity is most commonly caused by posterior vitreous detachment, and a small proportion can also be caused by vitreous liquefaction deformation and high myopia, and vitreous opacity can lead to blurred vision and decreased visual acuity . Even ifStudies have shown that among patients with vitreous opacities undergoing Nd\u2009:\u2009YAG laser vitrectomy, 75% reported significant improvement and 25% reported moderate improvement . This isThe VFQ-25 score was developed with support from the National Eye Institute to create a survey measuring self-reported sight-targeted health status and further incorporate the impact of quality of life, such as emotional well-being and social functioning . The VFQ\u03b1 range 0.739\u20130.932) and high test-retest reliability (intraclass correlation coefficient 0.876\u20130.975) [Symptoms such as blurred vision and impaired vision are the main factors afflicting patients with vitreous opacity, but they also have further life and work impact. Previous studies have shown that the VFQ-25 score is a good scale for evaluating the severity of symptoms in patients with vitreous opacities and has reliable reliability and validity . The VFQ6\u20130.975) . This stHowever, this study also has the following limitations: the study had a small sample size, no treatment control group was set and only the treatment effect at 6 months after surgery was observed in this study. In addition, we observed a significant correlation between the VFQ-25 score and postoperative efficacy in patients with grade I and II vitreous opacity. However, we did not observe a significant correlation in patients with grades III and IV, which may be related to our small sample size. Future large, prospective randomized controlled clinical trials are needed to evaluate the role of the VFQ-25 score in patients undergoing laser ablation for vitreous opacities.In summary, in patients with different degrees of vitreous opacity undergoing Nd\u2009:\u2009YAG laser vitreous ablation, the VFQ-25 score was significantly correlated with the postoperative efficacy, which is worthy of clinical use."}
+{"text": "For many indications, BoNT/A is repetitively injected with the risk of developing neutralizing antibodies (NABs). Therefore, it is important to analyze whether there is a difference in antigenicity between the different licensed BoNT/A preparations.In this cross-sectional study, the prevalence of NABs was tested by means of the sensitive mouse hemidiaphragm assay (MHDA) in 645 patients. Patients were split into those having exclusively been treated with the complex protein-free incoBoNT/A preparation (CF-MON group) and those having started BoNT/A therapy with a complex protein-containing BoNT/A preparation (CC-I group). This CC-I group was split into those patients who remained either on abo- or onaBoNT/A (CC-MON group) and those who had been treated with at least two BoNT/A preparations (CC-SWI group). To balance treatment duration, only CC-MON patients who did not start their BoNT/A therapy more than 10\u00a0years before recruitment (CC-MON-10 group) were further analyzed. The log-rank test was used to compare the prevalence of NABs in the CF-MON and CC-MON-10 group.p\u2009<\u20090.035) between the CF-MON and CC-MON-10 group.In the CF-MON subgroup, no patient developed NABs. In the CC-I group, 84 patients were NAB-positive. NABs were found in 33.3% of those who switched preparations (CC-SWI) and in 5.9% of the CC-MON-10 group. Kaplan\u2013Meier curves for remaining NAB-negative under continuous BoNT/A therapy were significantly different (Frequent injections of a complex protein-containing BoNT/A preparation are associated with significantly higher risks of developing NABs than injections with the same frequency using the complex protein-free incoBoNT/A preparation. The popularity of the use of botulinum neurotoxin type A (BoNT/A) is rapidly increasing. In dermatology, BoNT/A injections have become the most popular of all cosmetic procedures worldwide , 2. In nBoNT/A is a 150\u00a0kDa large molecule that is usually embedded in a 750\u00a0kDa large protein complex. Antibodies (ABs) can be induced against various parts of this BoNT/A complex. Some ABs do not reduce the efficacy , but somHowever, for a variety of indications, repetitive injections have to be performed to maintain a certain level of benefit of BoNT/A therapy . This in\u00ae, Allergan, USA) and abobotulinumtoxinA  preparations contain proteins of the entire botulinum toxin type A complex built-up out of the botulinum neurotoxin molecule as well as out of hemagglutinins and non-hemagglutinin proteins .This monocentric, cross-sectional study took place at the Department of Neurology of Heinrich Heine University, D\u00fcsseldorf, Germany. Recruitment lasted from 1/2015 until 6/2017. Finally, 645 patients were recruited. An interim analysis was performed in 2016 and published 1/2019 .Patients were recruited during their regular outpatient clinic visit to receive their next routine 3-months BoNT/A injection. Patients underwent a detailed neurological investigation, and a blood sample was taken for the determination of antibodies before the routine injection was performed.Blood samples were centrifuged, deep-frozen, and stored until the interim analysis date was reached or recruitment had been finished. Patient personal and treatment-related data, including the indication for BoNT/A therapy, were collected from the charts. For the sake of comparison, the dose per session was transformed and unified by leaving ona- and incoBoNT/A doses unchanged and dividing aboBoNT/A doses by 3. This 1:3 conversion ratio was used in a previous study  and is iFor adequate statistical analysis, the entire cohort (ALL) was split into six different treatment groups of patients  for the detection of NABs by means of the mouse hemidiaphragm assay (MHDA). The outcome measure of MHDA is paralysis time [After collection of the clinical data, blood samples were coded by a running number and tested for the presence of ABs with an ELISA screening test by an independent, blinded contractor . ELISA-positive samples were sent to another blinded contractor  and the corresponding analysis of the number of patients at risk were performed for all treatment groups to determine the probability of remaining NAB-negative during BoNT/A therapy. A statistical comparison of the KMAs using the log-rank test was performed only between the complex protein-free (CF-MON) and the complex protein-containing (CC-MON-10) groups, testing the hypothesis that the probability of remaining NAB-negative during BoNT/A treatment depended on the BoNT/A preparation used. All statistical tests were performed using the SPSS\u00ae statistics package .A chiThe private non-profit institution \u201cInge-Diesbach Stiftung\u201d has interest to support the research work of HH and his team. This funding did not have any influence on the design, the performance, and presentation of the study.A total of 645 patients (ALL group) were enrolled; 395 patients were females and 250 were males. The mean duration of treatment was 2885\u00a0days (7.90\u00a0years). The mean dose (at the recruitment session) was 210 uDU   was split into 6 different treatment groups Fig.\u00a0, 2. The p\u2009=\u20090.108, n.s.) from that in the CC-MON-10 group (1938\u00a0days\u2009=\u20095.31\u00a0years), but the mean dose per session was significantly higher (p\u2009<\u20090.001) in the CF-MON group than in the CC-MON-10 group  than in the CF-MON group. The comparison of the CC-I group with the CC-MON and CC-SWI groups demonstrated that in the course of BoNT/A therapy, the BoNT/A preparation was switched in only a few FD patients, whereas in many CD patients, another BoNT/A preparation was used Table .2 testing did not show a significant difference in NAB induction between females and males .Cross-sectional testing for antibodies in all 645 patients detected NABs in 84 patients 13%). The mean incidence of NAB induction was 1.65% per year  tested positive in the MHDA.NABs were detected in 61 out of 183 patients (=\u20091/3) in the CC-SWI group. In those 392 patients in the CC-MON group in whom BoNT/A preparation had not been switched and who remained on abo- or onaBoNT/A, only 23 (=\u20095.9%) patients tested positive in the MHDA. In the CC-MON-10 group with a duration of treatment comparable to that of the CF-MON group 19 (=\u20096%) patients were MHDA-positive.Since none of the patients in the CF-MON group had developed relevant NAB titers, the KMA curve of the probability of remaining NAB-negative is a straight line in Figs. p\u2009<\u20090.035) different from the KMA curve of the CF-MON group when a 10-years period of time was analyzed. The KMA curve of the CC-SWI-10 group showed an even steeper decrease than the KMA curve of the CC-MON-10 group. During 10\u00a0years, the number of patients at risk to develop NABs continuously decreased in all three patient groups down to zero.When the KMA curves of the CF-MON and CC-MON-10 groups were compared Fig.\u00a0A, the KMThis is the first comparative study demonstrating a statistically significant difference in antigenicity between the different botulinum neurotoxin type A preparations.In general, studies on antibody formation following BoNT/A treatment report low antibody formation rates. However, in contrast to prevalence and incidence, the antibody rate (% of NAB-positive patients in a cohort) is not a well-defined statistical term. In many studies reporting NAB rates, only a limited number of selected patients are tested for the presence of NABs (for a review see ). FurtheFor a reliable measure of antibody prevalence, all members of a cohort should be tested for the presence of antibodies by means of the same assay, and a Kaplan\u2013Meier survival analysis should be performed to estimate the probability of patients remaining antibody negative. This approach takes into account the duration of treatment and the drop-out rates at each time point. Furthermore, in comparison studies, the temporal development of the censoring process and the numbers of patients at risk for the development of NABs should be comparable over an equally long period of time .\u00ae) with a much higher protein content and antigenicity [In the present study, ELISA screening followed by an MHDA confirmation test was used for all patients which is more sensitive for detecting relevant NAB titers than the mouse lethality assay (MLA), also referred to as the mouse protection assay (MPA) , 23, 25.genicity , 16 was None of the patients in the CF-MON group tested positive by means of the MHDA, in full agreement with another recently published study . Most ofWhenever a patient developed clinical hints of a PSTF, he/she was switched to incoBoNT/A. This was done, because PSTF is associated with an MHDA-positive test in up to 50% of the patients  and becap\u2009<\u20090.035) lower in the CF-MON group than in the CC-MON-10 group.Our selection process to detect a beginning PSTF and to switch these patients to incoBoNT/A had obviously been highly effective, since the prevalence of NABs was high (>\u200933%) in the CC-SWI group and low (5.9%) in the group of patients who remained on abo- or onaBoNT/A (CC-MON group). Because of this selection bias and the significantly higher mean dose in the CF-MON group, which is a relevant risk factor for NAB formation, the present statistical procedure to compare the CF-MON and CC-MON-10 groups is highly conservative and favors the CC-MON-10 group. Nevertheless, the difference in the prevalence of NABs was significantly  NABs may be present despite of an excellent clinical outcome . This isA recent study demonstrated that higher doses of incoBoNT/A  and shorThe lesson learned from the transition from \u201cold\u201d to the \u201cnew\u201d Botox\u00ae was that booster injections, short reinjection intervals, and unnecessary high doses per session should be avoided , and thaWe present a monocentric, cross-sectional study with a long recruitment period. Patients were not randomized, and the distribution of disease entities was slightly different in the CF-MON and CC-MON-10 groups because of the different license situations of the different BoNT/A preparations. The study is highly conservative, since those who switched preparations were thoroughly excluded from the final analysis.A controlled longitudinal multicenter study with continuous assessment of NAB induction, clinical outcome, development of PSTF, and drop-out rates is warranted to investigate differences in probability to develop a secondary non-response and in antigenicity between different BoNT/A preparations in more detail."}
+{"text": "P\u2009<\u20090.001). Iron deficiency (serum ferritin levels\u2009<\u200912\u00a0ng/mL) was significantly more prevalent in male than in female infants (P\u2009<\u20090.001). Linear regression revealed a positive association between serum ferritin levels and general quotient, gross motor, fine motor, language, and adaptive behavior in females. Iron deficiency was significantly associated with an increased risk of adaptive behavior delay in females (adjusted odds ratio (OR), 2.22; 95% confidence interval (CI): 1.17\u20134.20). Iron deficiency anemia was associated with an increased risk of developmental delay for general quotient , fine motor  and adaptive behavior  among females, but not in males. Associations between serum ferritin levels and neurodevelopment in infants aged 6\u201312\u00a0months were sex-related. Females with iron deficiency, especially those with iron-deficiency anemia, were more susceptible to neurodevelopmental delay than males.Early iron deficiency has detrimental consequences on neurodevelopment; whether male and female infants are equally susceptible to the functional outcomes of iron deficiency is unclear. This study aimed to investigate the sex differences in the association between serum ferritin levels and neurodevelopment in infants. Data for this cross-sectional study were drawn from hospital information and early childhood development program service systems at Guangdong Women and Children\u2019s Hospital, Guangzhou, China. In total, 4579 infants aged 6\u201312\u00a0months were included from July 2018 to March 2020. Their neurodevelopment was assessed using the Children Neuropsychological and Behavior Scale-Revision 2016. Serum ferritin levels were measured by chemiluminescence assay. The association between serum ferritin levels and neurodevelopmental delay in each domain was estimated using logistic regression models adjusted for potential confounders. The mean concentration of serum ferritin was 35.56\u2009\u00b1\u200921.57\u00a0ng/mL. Serum ferritin levels were significantly higher in female than in male infants ( Serum ferritin levels decrease because of iron deficiency and anemia. Iron deficiency is a prevalent nutritional deficiency in early childhood2 that could have a negative impact on neurodevelopment and has been linked to long-term neurobehavioral consequences, including poor attention, increased anxiety, and depression6. Although efforts have been made to establish links between serum ferritin levels and neurodevelopmental function in humans, few studies have explored sex-specific relationships between serum ferritin concentrations and neurodevelopment. It is generally believed that the differences in iron status between males and females arise after adolescence8. Some studies have reported substantial sex differences in serum ferritin levels in infants and pre-pubertal children11. Serum ferritin levels differ significantly according to sex, suggesting a sex-dependent relationship for ferritin and neurodevelopmental function risk. We therefore set out to investigate the sex differences in the association between serum ferritin and neurodevelopment in infants aged 6\u201312\u00a0months.Serum ferritin is a reliable indicator of body iron stores and is commonly used to diagnose and monitor iron deficiencyThe sample for this cross-sectional study was drawn from database of the hospital information system and early childhood development program service system. The early childhood development program service system was used to monitor the growth of children with regular health checkups at the Guangdong Women and Children\u2019s Hospital, Guangzhou, China. When children aged\u2009<\u20096\u00a0years underwent routine health check-ups, all data on maternal information, physical measurements, and neurodevelopmental examinations were recorded. In the present analysis, we included 6\u201312-month-old infants who underwent routine health checkups. Data on neurodevelopmental measurements were extracted from the early childhood development program service system from July 2018 to March 2020. These data were linked to individual serum ferritin levels and hemoglobin records from the hospital information system. Regarding potential confounding factors, the choice of covariates that may have confounded the relationship between serum ferritin levels and childhood neurodevelopment was guided by directed acyclic graphs  as described elsewhere13. Based on the World Health Organization criteria for using ferritin concentrations to assess iron status in infants and young children aged 0\u201323 months14, iron deficiency was defined as a serum ferritin level\u2009<\u200912\u00a0ng/mL and iron deficiency anemia (IDA) as a serum ferritin level\u2009<\u200912\u00a0ng/mL and hemoglobin\u2009<\u2009110\u00a0g/L.Ferritin and hemoglobin measurements were extracted from the hospital\u2019s laboratory information system. During our study period, to minimize the impact of potential batch effect on laboratory measurements, the ferritin and hemoglobin laboratory tests were performed according to the consistent platform and standard operating procedures. Serum ferritin was measured by a chemiluminescence assay using an Abbott i2000SR analyzer16. It includes general quotient and five subscales: gross motor, fine motor, language, personal-social, and adaptive behaviors. A general or subscale quotient\u2009<\u200980 points indicates a mild delay (<\u200970 points means a significant delay), and a quotient\u2009\u2265\u200980 points indicates no delay.Neurodevelopmental levels of the infants were assessed using the Children Neuropsychological and Behavior Scale-Revision 2016 (CNBS-R2016). The CNBS-R2016 is a diagnostic assessment tool developed by the Capital Institute of Pediatrics in China that is widely used to assess the developmental level of children aged 0\u20136 yearsp-value for the interaction. R software version 4.1.0 (www.R-project.org) and the SPSS statistical software package  were used for all statistical analyses. P\u2009<\u20090.05 was considered to be the threshold for statistical significance in analyses.Data are presented as the mean\u2009\u00b1\u2009standard deviation for continuous variables and as numbers (percentages) for categorical variables. For the comparison of differences between male and female infants, the t-test was used for continuous variables and the chi-square test was used for categorical variables. Correlations between serum ferritin levels and the different domain scores of the CNBS-R2016 were analyzed using Pearson\u2019s correlation analysis. The linear association between serum ferritin levels and the different domain scores of the CNBS-R2016 was tested using linear regression models. In the adjusted models, some covariates, including maternal education, parity, feeding at 6\u00a0months, age of the infant, height, and weight, were considered as potential confounders as they were reported to be related to neurodevelopment or serum ferritin levels based on previous studies. The odds ratios (ORs) and 95% confidence intervals (CIs) for the association between serum ferritin (<\u200912\u00a0ng/mL vs. \u2009\u2265\u200912\u00a0ng/mL) and neurodevelopmental delay (<\u200980 points) in each domain were estimated using logistic regression models, considering the serum ferritin level\u2009\u2265\u200912\u00a0ng/mL group as the reference category, and adjusting for maternal education, parity, feeding at 6\u00a0months, infant age, height, and weight. In addition, we performed analyses for the association between IDA (yes: serum ferritin\u2009<\u200912\u00a0ng/mL and hemoglobin\u2009<\u2009110\u00a0g/L vs. no) and neurodevelopmental delay. We conducted separate experiments in males and females to evaluate whether infant sex modified the relationship between serum ferritin levels and neurodevelopment. Interactions between infant sexes were tested by including an interaction term of infant sex\u2009\u00d7\u2009serum ferritin in the corresponding full model and obtaining a P\u2009<\u20090.001). Iron deficiency (defined as a serum ferritin level\u2009<\u200912\u00a0ng/mL) was also significantly more prevalent in male infants (12.6%) than in female infants (7.8%). The total proportion of infants with IDA was 5.8%, with a significant sex difference (P\u2009<\u20090.001).Characteristics of the infants according to sex are presented in Table P\u2009<\u20090.05). Neurodevelopmental delays in general quotient, gross motor, fine motor, language, and personal-social that occurred in males with iron deficiency were similar to those in females. Adaptive behavior delays occurred more frequently in females with iron deficiency than in males  were positively correlated with serum ferritin levels in females but not in males Fig.\u00a0.Figure 2P\u2009=\u20090.015 and P\u2009=\u20090.030, respectively; Table The estimated ORs (95% CIs) of developmental delay for each domain according to sex-specific iron deficiency using logistic regression analysis are presented in Table In the present study, we performed a comprehensive analysis of sex-specific associations between serum ferritin levels and neurodevelopmental function, based on data from the hospital\u2019s early childhood development program service system. We observed that serum ferritin concentration varied by sex and was positively associated with developmental scores of general quotient, gross motor, fine motor, language, and adaptive behavior in female infants but not in male infants. Iron deficiency, specifically IDA, was more strongly associated with neurodevelopmental delays in females than in males.20. However, to date, little has been reported on the mechanisms underlying sex-related differences in ferritin levels during early childhood. This mechanism may be explained by hormone-mediated differences in metabolism. It is well known that serum insulin and leptin concentrations are different in male and female infants21. Sex differences in ferritin levels during infancy may also be associated with cord blood ferritin levels. A previous study showed a significantly lower concentration of serum ferritin in umbilical cord blood in males than in females23. Furthermore, the physiological characteristics in the first year of life, greater need for and use of iron due to accelerated growth and development, and progressive changes in the dietary supply and bioavailability of iron may result in variations in serum ferritin levels.The results showed that the mean serum ferritin levels were significantly higher in female than in male infants, which is consistent with previous studies24. Similarly, sex differences were observed in the association between serum ferritin levels and neurodevelopment in our study. We found a linear relationship between serum ferritin levels and general quotient, gross motor, fine motor, language, and adaptive behavior scores in females but not in males. Recent research from Canada has found a stronger negative nonlinear relationship between serum ferritin and cognitive function in children aged 1\u20133\u00a0years, and recommends a serum ferritin level of 17\u00a0\u03bcg/L corresponding to the maximum level of cognition in children25. The pathophysiological pathways responsible for iron status and neurodevelopmental outcomes are complex and include dysfunctional myelination, neurotransmitter alterations, and endocrine pathways26. Iron deficiency is a common micronutrient deficiency primarily affecting children and women27. Iron is a key element in myelin production, neuron metabolism, and dopamine function. Iron deficiency during infancy can alter brain development, disrupt cognitive development, and exert long-term effects. Iron-mediated epigenetic mechanisms indicate that early-life iron deficiency directly causes stable changes in gene regulation across the lifespan, resulting in cognitive impairment and neuropsychiatric disorders28. Studies have shown significant differences in iron status between males and females. Girls, especially adolescents, have a high demand for iron to maintain their physical and psychological development29. To our knowledge, few studies have evaluated the relationship between serum ferritin and neurodevelopmental function in a sex-specific fashion, which may be associated with sex differences in hepcidin levels, which regulate neuronal ferroptosis in cognitive dysfunction30. It remains unclear how sex differences affect outcomes. Considering sex differences is important for developing preventive strategies for adverse neurodevelopmental effects due to iron deficiency.Studies on the association between serum ferritin and neurodevelopment performed decades ago showed that higher serum ferritin levels were associated with better neurodevelopmental functionThis study has several limitations. A key limitation is the use of the database of a hospital information system. Consistent with similar studies, some data may have been incomplete or missing. Participants were included using non-random population-based sampling. The representativeness of the data may have been influenced by a selection bias. Although we carefully adjusted for potential confounding factors in our analyses, the database did not record some necessary confounders, such as iron supplementation and dietary habits; therefore, we did not adjust for them in our analysis.This study highlights the association between serum ferritin levels and neurodevelopment in infants aged 6\u201312\u00a0months with sex differences. Females with iron deficiency, especially those with IDA, are more susceptible to neurodevelopmental delays than males. Our study suggests that serum ferritin may have a sex-specific effect on neurodevelopment: females may have worse neurodevelopmental outcomes with iron deficiency and IDA. It may be necessary to consider the sex of infants when evaluating serum ferritin concentrations and providing recommendations for the nutrition of infants. Furthermore, there may be a need to develop sex-specific cutoff levels of ferritin in early childhood.Supplementary Information 1.Supplementary Information 2."}
+{"text": "ACAC\u03b1 gene to determine whether SNPs are associated with milk composition (MC) and the fatty acid profile (FA) in Najdi sheep milk. An analysis and alignment of the PI, PIII, and Exon 53 sequences for the ACAC\u03b1 gene identified twenty SNPs. The homozygous ewes with PI, PIII, and Exon 53 SNPs were associated (p < 0.05) with essential fatty acids (EFAs) , linoleic acid , and conjugated fatty acid (CLA)) in their milk fat. These results suggest that ACAC\u03b1 genes are involved in PUFA synthesis, which modifies the compositional properties of Najdi sheep milk, resulting in healthier dairy products.The acetyl-CoA carboxylase gene (ACAC\u03b1) plays a role in facilitating the delivery of fatty acid precursors to the mammary glands during lactation. The purpose of this study was to identify single-nucleotide polymorphisms (SNPs) for promoter I (PI), promoter III (PIII), and Exon 53 in the ACAC\u03b1 gene and their association with the MC and FA profiles in Najdi sheep milk. A total of 76 multiparous Najdi ewes were used, and they were maintained using the same feeding system. Milk and blood samples were collected during the first lactation. A genetic polymorphism analysis identified 20 SNPs: 4 SNPs on PI, 6 SNPs on PIII, and 10 SNPs on Exon 53. In PI, the SNP g.4412G > A was associated (p < 0.05) with palmitic acid (C16:0), palmitoleic acid (16:1 n-7) and linoleic acid (LA), while SNP g.4485C > G was associated with CLA and vaccenic acid (VA) (p < 0.05). Furthermore, in PIII, two SNPs (g.1168A > G and g.1331G > T) were associated with milk protein (p < 0.05), while the SNP g.6860G > C in Exon 53 was associated with milk fat (p < 0.05). SNPs in the Najdi breed have been shown to be strongly related to milk fat and EFA contents. This could support a genetic selection program and the control of milk traits in the Najdi breed of high-quality dairy sheep.Recently, increasing attention has been paid to sheep milk products, which are high in saturated fatty acids (SFA), and the extent of their impact on human health. This study aimed to identify SNPs for PI, PIII, and Exon 53 in the  The acetyl-CoA carboxylase gene is one of the important genes affecting the MC and FA profile in milk fat . This paACAC, SCD, FAS, and di-glyceride acyltransferase [ACAC enzymes in mammals: ACAC\u03b1 and ACAC\u03b2. ACAC\u03b1 is an enzyme involved in lipid metabolism and storage, and ACAC\u03b2 acts as a mitochondrial enzyme for the synthesis of malonyl-CoA, altering fatty acid oxidation by suppressing fatty acid transport to the mitochondria [ACAC plays a crucial role in the catalysis of malonyl-CoA, the main substrate for promoting fatty acid synthesis and elongation as well as limiting fatty acid oxidation [ACAC is produced in high concentrations in lipogenic tissues such as the liver, adipose tissue, and mammary glands [The synthesis of fatty acids in milk underlies the role of several enzymes such as nsferase . There achondria . ACAC plxidation . ACAC isy glands .ACAC\u03b1 gene (cDNA 6.6 kb) located on chromosome 11 (OAR11), which has 54 Exons, and 12 SNPs showed higher gene frequency in dairy cultivars [ACAC\u03b1 gene in sheep has many variations. The majority of studies have focused on the promoter regions of the ACAC\u03b1 gene, with promoter I (PI) and promoter II (PII) identified in mammals [Sheep were sequenced for the ultivars . Compare mammals  and prom mammals  and goat mammals .ACAC\u03b1 gene is extremely variable in sheep [ACAC\u03b1 gene in mammary glands increases 15\u201328-fold during lactation [The PI transcript is mainly present in adipose tissue, while the PII domain transcript is found in almost every tissue , and thein sheep . In addiactation ,12.ACAC\u03b1 gene in the Najdi sheep population and to identify SNPs associated with milk quality traits.The Najdi sheep is a desert-adapted native breed of fat-tailed sheep that is recognized for its hardiness and adaptability. Najdi sheep are mainly found in the central and eastern regions of Saudi Arabia. Under improved feeding and management practices, the Najdi breed performs satisfactorily and has high potential for milk production with intensive production . The aimIn this study, 76 ewes were randomly selected from a private Al- Khaldiyah farm in Riyadh. All ewes were multiparous and were reared on the same farm to avoid variations in management conditions. They were fed a diet consisting of 30% alfalfa hay and 70% concentrate without additives, as presented in All ewes were in the first stage of lactation  and were milked at in the morning (08:00 h). Samples of milk (50 mL) were collected from the whole milk after the morning milking. The composition of the milk  was analyzed 24 h after collection using a Milko-Scan FT6000 , and the milk was then stored at \u221220 \u00b0C until the analysis of the FA profiles. The extracted lipids were obtained from 30 mL milk samples according to Luna, et al. , and FA Blood samples (10 mL) were collected from all animals using jugular vein puncture and EDTA vacuum tubes and were stored at \u22124 \u00b0C until DNA extraction. Genomic DNA was extracted from the whole blood of all ewes using a GFX genomic blood DNA 27-9603-01 100-purification kit  according to the manufacturer\u2019s instructions. The integrity and purity of the extracted DNA samples were assessed using 0.8% gel electrophoresis and a Nano-Drop 2000/C spectrophotometer (Thermo Scientific), respectively. The obtained O.D. 260/280 ratios ranged from 1.8 to 2.2, indicating high-quality DNA.ACAC\u03b1 gene (ACAC\u03b1 forward and reverse: 0.5 \u00b5M), and 4 \u00b5L of DNA, and nuclease-free water was added to a total volume 20 \u00b5L. The PCR conditions were as follows: initial denaturation at 95 \u00b0C for 5 min; 35 cycles of amplification in three stages, including denaturation at 95 \u00b0C for 30 s, hybridization at 58\u201361 \u00b0C for 45 s, and extension at 72 \u00b0C for 40 s; and a final extension incubation at 72 \u00b0C for 10 min. The ACAC\u03b1 gene PCR product was checked using 2% agarose gel electrophoresis containing ethidium bromide and was recorded using a gel documentation system .Specific primers targeting PI , PIII 1, and ExoAC\u03b1 gene . For theACAC\u03b1 gene promoter I, promoter III, and Exon 53 PCR products were purified and sequenced by the Macrogen sequencing service . The sequences were edited, aligned using the Geneious 5.5.9 version Biomatters Ltd. software, and compared to identify polymorphic sites. The obtained sequences were compared with their respective reference sequences .In total, 76 samples were sequenced in both the forward and reverse directions. The primers (forward and reverse) for sequencing were the same as those used for the PCR amplification. The https://wpcalc.com/en/equilibrium-hardy-weinberg/ (accessed on 17 June 2021). The effect analyses for the SNPs at PI, PIII, and Exon 53 of the ACAC\u03b1 genes for milk composition  and the FA profiles of milk fat were performed in Najdi sheep using the Proc Mixed procedure in SAS software  [The allele frequency and genetic equilibrium of the studied population were estimated using the Hardy\u2013Weinberg equilibrium and were tested using the chi-square test for the 76 ewes online at NC, USA) .ijklm is the dependent variable; \u00b5 is the overall mean; Agei is a fixed effect of an animal\u2019s age at calving; BIj is a fixed effect of type of birth with two levels (single and twins); SNPjl is a fixed effect of ACAC\u03b1 gene genotype; Animalm is a random effect of the mth individual ewe nested within the ACAC\u03b1 genotype; and eijklm is a residual error. Significance was declared when p < 0.05.where yHaploview 4.2 software  was used to estimate the extent of linkage disequilibrium (LD). The associations of genotypes and haplotypes with the MC and FA profile were tested using g-PLINK .ACAC\u03b1 gene under various assumptions related to milk quality traits according to Hong and Park [In this study, we demonstrated the effective sample size and the statistical power required to achieve 80% statistical power, as calculated using G*Power 3.1.7 software, for the genotypes of the and Park  and Gaudand Park .ACAC\u03b1 gene using the Hardy\u2013Weinberg frequencies equilibrium. The detection of SNPs from sequencing read-outs and a multiple sequence alignment of the Najdi sheep ACAC\u03b1 gene  revealed four SNPs in PI, including g.4412G > A, MT512519; g.4441T > A, MT512520; g.4485C > G, MT512521; and g.4507T > C, MT512522  were separated using agarose gel electrophoresis within 60 min, as shown in MT512522 , and twoACAC\u03b1 gene, from 956 bp to 1454 bp, were sequenced. The sequencing revealed six SNPs  and a nucleotide insertion of T at position 1184 in all individuals (according to GenBank accession number MT512530) (The genomic regions of PIII (499 bp) in the T512530) . Two of T512530) .ACAC\u03b1 gene revealed ten SNPs with the GenBank accession numbers shown in A sequence analysis of 526 bp at Exon 53 in the In addition, an 18 bp sequence of AC/GGTGAGTATGCGGCCC was inserted at position 6852. Using the ExPASy translate tool to translate the sequence of Exon 53 showed that two of these SNPs are predicted mutations that cause amino acid substitutions: g.6860G > C (serine/TCA to stop codon/TGA) and g.7031C > T . The allele frequencies and genotypes for all SNPs detected in Exon 53 (identified and linked to accession numbers) are summarized in p < 0.05) associations with the MC and FA profiles. An association analysis showed that the SNP g.4412G > A of PI in the ACAC\u03b1 gene was significantly (p < 0.05) associated with palmitic acid (C16:0), palmitoleic acid (16:1 n-7), and LA (C18:2 n-3) (p < 0.05) associated with behenic acid (C22:0), and SNP g.4485C > G was significantly (p < 0.05) associated with CLA (C18:3) and VA (C18:1). In addition, SNP g.4507C > T showed a significant (p < 0.05) association with arachidic acid (C20:0). It is worth noting that the homozygous ewes with AA at SNP 4412G > A and CC at SNP g.4485C > T had a significant effect on LA, VA, and CLA compared to heterozygous ewes.The results presented in 8:2 n-3) , while SACAC\u03b1 gene was significantly (p < 0.05) associated with lauric acid (C12:0) and CLA, while SNP g.1014C > T was significantly (p < 0.05) associated with CLA. In the same context, heterozygous ewes with CT and GT alleles for the SNPs 1007T > G and 1014C > T had a significant (p < 0.05) effect on CLA compared to homozygous ewes (p < 0.05) associated with the protein content of milk and palmitoleic acid (16:1n-7). Whereas SNP g.1431C > T was significantly (p < 0.05) associated with CLA and arachidonic acid (C20:4). Notably, milk from heterozygous ewes with AG and GT alleles at SNP g.1168A > G had high protein contents (4.58 \u00b1 0.21 and 4.56 \u00b1 0.20) compared to homozygous ewes.The association analysis of SNPs, revealed that SNP g.1007T > G at PIII in the ous ewes . FurtherACAC\u03b1 gene in Najdi sheep were significantly associated with at least one milk trait (p < 0.05) associated with LA (C18:2 n-6) and arachidic acid (C20:0), as shown in p < 0.05) associations with ALA (C18:3 n-3).Overall, 9 of the 10 SNPs identified at Exon 53 of the lk trait . The sixp < 0.05) associated with the milk fat content of Najdi ewes. The heterozygous ewes with the GC and CC alleles showed lower milk fat levels  compared to the homozygous ewes with the GG allele at SNP g.6860G > C (4.16 \u00b1 0.22). It is worth noting that the homozygous ewes whose SNP alleles at Exon 53 were GG, CC, or TT were superior in their EFA contents, such as LA (C18:2 n-6) and ALA (C18:3 n-3).Interestingly, the SNP g.6860G > C at Exon 53 was significantly   .The frequencies of the six haplotypes in block 1 were as follows: H1B1 (TCAGCC: 41%), H2B1 (TCGTGC: 39%), H3B1 (GTGTCT: 8%), H4B1 (GCGTCT: 5%), H5B1 (TTGTCT: 3%), and H6B1 (TCGTGT: 1%). The frequencies of the seven haplotypes in block 2 were as follows: H1B2 (GTCT: 39%), H2B2 (GTGT: 31%), H3B2 (ATGC: 12%), H4B2 (ATCT: 7%), H5B2 (AAGC: 4%), H6B2 (ATCC: 4%), and H7B2 (AACC: 3%). In addition, the frequencies of the 10 haplotypes in block 3 were as follows: H1B3 (GGTCCTGC: 42%), B3H2 (GCTCCTTC: 19%), H3B3 (CGCTGCGT: 15%), H4B3 (CGCTGCGT: 1%), H5B3 (CGTCGCGT: 2%), H6B3 (CGTCCTGC: 7%), H7B3 (GGTCCTTC: 1%), H8B3 (CGCCGCGT: 1%), H9B3 (CGCCGCGC: 1%), and H10B3 (CGCTGCTT: 3%), as shown in p < 0.05) associations with milk fat, C6:0, C8:0, ALA, LA, C16:1 cis7, and C20:0 (p < 0.05) associated with C16:1 cis7 and C22:0, while haplotype block 2 was significantly (p < 0.05) associated with C6:0, C8:0, and ALA. In addition, haplotype block 3 was significantly (p < 0.05) associated with the milk fat percentage and LA  at position 6852 of the ce sheep . Interesce sheep . The seqin sheep ,24 overlThe translated sequences of Exon 53 showed differences in translated protein in Najdi sheep compared to Valle del Belice sheep . PreviouACAC\u03b1 gene showed strong associations with the milk fat and FA contents in Najdi sheep milk. Several studies have been performed to identify SNPs in the ACAC genes of sheep [ACAC\u03b1 gene in Italian sheep had a significant impact on the milk fat content [ACAC\u03b1 gene in Munjal sheep had a positive effect on milk fat and protein content [In the current study, the SNPs identified in PI, PIII, and Exon 53 of the of sheep ,22 and gof sheep . Furtherof sheep ,23,30. S content .ACAC\u03b1 gene have significant associations with long-chain FAs  [ACAC\u03b1 gene were significantly associated with the FAs  of the longissimus dorsi muscle [ACAC\u03b1 polymorphism had marked effects on the C13:0, C14:1, C16:1, and CLA levels in Holstein\u2013Friesian cows. A study in Holstein\u2013Friesian and Japanese black cattle reported that three SNPs in the PIII of the d C18:0) . In addii muscle . Furtheri muscle  found thACAC\u03b1 on de novo FA synthesis in the mammary glands found that the ACAC\u03b1 gene was associated with PUFAs that are not synthesized by milk-producing cells [2 = 0.11 to 0.27; C18:3, h2 = 0.09) [ACAC\u03b1. In contrast, the FASN, ACAC, and SCD polymorphisms are key genes affecting PUFA composition and are promising for improving FA composition [In the current study, the majority of SNPs in Exon 53 had significant effects on ALA (C18:3-n3), LA (C18:2-n6), and CLA, while the LD for block 3 haplotypes was strongly associated with LA. This confirms the previous statement that most studies on the effect of ng cells . Polyuns = 0.09) . Kong, e = 0.09)  mentioneposition ,35. Mostposition .ACAC\u03b1 gene had significant differences in C10:0, C12:0, C14:0, and C15:0 compared to the GC and CC alleles. SNPs in the gene\u2019s promoter can alter transcription factor binding, which affects promoter activity and can be considered a functional mutation [ACAC\u03b1 gene may play a crucial role in regulating transcript expression in mammary epithelial cells, thereby affecting FA metabolism and explaining the role of the ACAC\u03b1 gene in milk FA biosynthesis [ACAC\u03b1 gene, was negatively associated with de novo synthesized short- and medium-chain FAs: C8:0, C10:0, and C12:0 [ACAC\u03b1 gene showed that the ewes with the CC genotype had a lower somatic cell count and a significant correlation with the clotting time.In a study by K\u0119sek-Wo\u017aniak et al. , it was mutation . This inynthesis ,6,7. Thind C12:0 . Dettorind C12:0  reportedACAC\u03b1 enzyme is important in the de novo synthesis of FAs in the mammary gland. The results of the current study confirm the effect of the ACAC\u03b1 enzyme on UFA biosynthesis, which is mainly controlled by the animal\u2019s diet. Therefore, the results of this study are expected to show that the ACAC gene is associated with lipid metabolism properties. Finally, the results of this study indicate that the SNP found in PI is associated with palmitic acid (C16:0), which could be attributed to the reported biological function of the ACAC\u03b1 gene [This demonstrated that the AC\u03b1 gene  since thACAC\u03b1 gene were identified via an analysis and an alignment of sequences. The SNP g.6860G > C (MT649199) in Exon 53 of the ACAC\u03b1 gene significantly influenced the milk fat content. Furthermore, SNPs in PI, PIII, and Exon 53 were significantly associated with EFAs, particularly the LA-n3, ALA-n6, and CLA in the milk fat of Najdi sheep. The identified association between the Najdi breed genotypes and phenotypes could play a crucial role in altering the milk composition and FA profile of milk fat and could form the basis of a genetic selection program to produce healthy milk. Further research is needed to examine the association of the ACAC\u03b1 gene with the fatty acid profile in dairy sheep using a large sample.A total of 20 SNPs of the Najdi breed"}
+{"text": "Neurons are the functional units of the nervous system. They are responsible for carrying stimuli throughout the human body and help coordinate all of the necessary functions of life by using electrical and chemical signals.The nervous system regulates immunity and inflammation. Neuroinflammation is a key component of neurological disorders and is an important therapeutic target. Neurological disorders are the conditions which affect the neurons in the human body and the rest of the nervous system, resulting in a range of symptoms. The specific causes of neurological diseases are different, as some neurological conditions are congenital, and the others may originate because of structural defects, degeneration, infections, tumors, or trauma. At any rate, all neurological diseases result from the disturbance, impairment, or deterioration of the nervous system. Symptoms of illnesses manifest themselves depending on the location, type, extent, and the dimensions of the damage.The intention of this Special Issue is to highlight the role of neurons in human health and disease. In the first paper in this issue, Ugrumov et al.  evaluateAccording to their observation, neuron fibers deliver L-DOPA and DA to the cerebrospinal fluid, participating in the neuroendocrine regulation of the brain. This finding is important because of the L-DOPA\u2019s effect in Parkinson\u2019s Disease.Liu et al.  studied The gut\u2013brain axis has become the main focus for many researchers lately due to its connection to both ENS and CNS, and therefore their implications in human health. In the CNS and PNS, the vascular endothelial growth factor (VEGF) mediates neuroprotective and neuroregenerative effects. Since the ENS is considered the origin of neurodegenerative diseases, it may be crucial to study the potential positive effects of the VEGF on enteric neurons. Based on the promising results of their research, Theiss et al.  have conThe medulla oblongata is an important relay center for critical sensory, proprioceptive, and motor information. It consists of a number of nuclei all involved in different forms of essential and vital activities. Mesman et al.  studied Functional somatic syndromes have become common in chronically ill patients presenting with a series of symptoms not pertaining to physical diseases and without a definite etiology. Stress and certain childhood traumas are now recognized as important risk factors for chronic pain conditions. Functional somatic syndromes are also highly related co-morbidities of a number of psychological and psychiatric conditions. In this review, Garvey et al.  aim to pIn their review paper, Klimov et al.  point toIn this paper, Huang et al.  discuss Astrocytes are the major homeostatic cells in the central nervous system. Their reactivation or cellular senility may have serious impacts on the immediate microenvironment, resulting in pathological results. In this review, Lazic et al.  outline Alzheimer\u2019s Disease (AD) is a multifaceted neurodegenerative condition defined by progressive cognitive deterioration, indifference, lethargy, and neuropsychiatric disorders. Neurofibrillary tangles and A\u03b2 plaques are the major pathological indications for this disease.In this review, Maccioni et al.  focus on"}
+{"text": "Background: Self-medication is vital to public health because it has an impact on people's health and the current healthcare system, both positively and negatively. During public health catastrophes like the COVID-19 disease, this is particularly true.Aim: This study aimed to examine the behavioral response of the community with regard to self-medication during the COVID-19 pandemic in the eastern region of the Kingdom of Saudi Arabia.Methods: During the COVID-19 outbreak from March to September 2020, a cross-sectional online survey of 398 participants using structured questionnaires was conducted to observe knowledge, prevalence, patterns, and sources of self-medication among the respondents in the eastern region of the Kingdom of Saudi Arabia.Results: The percentage of respondents who had heard about self-medication was 50.5%, and those who practiced self-medication during COVID-19 were 43.7% of the respondents. Regarding knowledge, 60.3% had a low overall knowledge level versus 39.7% who had a high knowledge level. Most of those who practiced self-medication took medication based on their own decision (34.4%). The most frequently used drugs during the outbreak were analgesics (43.5%) and vitamins (24.9%). Only 1% of participants reported using anti-malaria drugs (hydroxychloroquine). The most common reasons for self-medication practices were having a mild illness (30.4%), followed by fear of infection (26.6%). The symptoms for which the respondents took self-medication were headache (29.6%), cough (26.6%), and fever (24.6%).Conclusion: Our investigation showed a low level of knowledge about self-medication and a considerable level of self-medication practices. Therefore, self-medication may be minimized with ongoing awareness-raising and sensitization. Self-medication (SM) is defined by the World Health Organization (WHO) as \"the selection and use of medicines by individuals  to treat self-recognized or self-diagnosed conditions or symptoms . GloballCommon reasons for self-medication included delays in accessing health care, socio-cultural beliefs, relatively high hospital costs, expertise in treating similar symptoms, easy medical availability, poor regulatory practice, the urgency of feeling relieved, and advice from friends and the media . The WHOA recent Google Trends study has shown an upward trend regarding self-medication during the COVID-19 pandemic. This study has shown an increasing number of searches worldwide for self-medication and would be an indication of increasing self-medication interests around the globe since the declaration of the pandemic . SeveralIn Saudi Arabia, the number of COVID-19 cases started to rise significantly around May 16, 2020, at 2840, or 81.58 per million, while the number of currently infected cases peaked at 28728, or 825.19 per million, on May 25, 2020 . Self-meTherefore, our study aims to examine the behavioral response of the community with regard to self-medication during the COVID-19 pandemic in the eastern region of the Kingdom of Saudi Arabia.In this online cross-sectional survey, a descriptive, non-experimental research design was used to examine self-medication practices from March to September 2020, the period during the nationwide lockdown and a surge in the number of positive COVID-19 cases. The inclusion criteria were adult Saudi citizens of the eastern region of the Kingdom of Saudi Arabia who were at least 18 years of age and residents of the region. The sample size was 385 using the formula n=Z2\u00a0pq/E2, where the margin of error (E) equals 0.05. The confidence level (Za/2) was 95%, which equals 1.96. The expected proportion (p) of adults equals 0.5; the actual sample size was 398 randomly selected participants. In order to learn more about how the general public felt about taking over-the-counter medicines during the COVID-19 outbreak, respondents with medical knowledge or background  were excluded from the survey. The response frequencies were noted in a datasheet and tracked in relation to demographic data, information sources, clinical symptoms, and the status of the COVID-19 test results. Face and content validity techniques were used to create and validate the questionnaire. Face validity was achieved by administering the draft questionnaire to a few citizens who met the inclusion criteria in the Eastern region in order to determine whether the response appeared meaningful, well-designed, and/or a good measure of the construct to an innocent participant. The questionnaire was further improved and altered using the data gathered from this exercise. Three independent researchers from the fields of social statistics, community medicine, and public health evaluated the questionnaire's appropriateness, clarity, coverage, and relevance to the study as part of the content validity process. The incorporated draft questionnaire was rewritten to remove vagueness and eliminate questions that were asked more than once. The reliability of the questionnaire was calculated by using Cronbach\u2019s alpha test, and the result showed a Cronbach\u2019s alpha value of 0.837, indicating that the questionnaire was highly reliable.Statistical analysisDescriptive statistics were used to summarize the responses. Frequency distributions were generated to show the proportion of participants who self-medicated during the lockdown period, the types of medications used, and the sources of information they relied on. Means and standard deviations (SD) were calculated to describe the age; frequencies and percentages were used to describe the categorical variables. A Chi-square test was performed to explore the relationship between self-medication practices and the demographic characteristics of the participants, such as age, gender, and education level.All statistical analyses were conducted using Statistical Package for the Social Sciences (SPSS) version 26.0 , and a p-value of less than 0.05 was considered statistically significant.A total of 398 adult participants completed the study questionnaire. Participants' ages ranged from 18 to more than 65 years old, with a mean age of 39.5 \u00b1 13.7 SD years old. A total of 245 (61.6%) participants were female. Regarding marital status, 252 (63.3%) were married. Considering education level, 202 (50.8%) had bachelor's degrees, and 33 (8.3%) had post-graduate degrees. Considering monthly income, it was less than 4000 Saudi Riyals (SAR) among 213 (53.5%) participants and more than 12000 SAR among 15.6%.\u00a0Table Table Table Table Considering relations, a total of 73.7% of participants aged 50-65 years had a low knowledge level versus 53% of others aged 18-29 years, with recorded statistical significance (p=.005). Low knowledge level was insignificantly higher among female adults (61.2% vs. 58.8%), married adults (60.7% vs. 59.6%), Saudi adults (60.8% vs. 37.5%), elementary school adults (80% vs. 75% for PhD), and high-income adults (67.7% vs. 55.9% for others with lowest income), with all having an insignificant association .Age also showed a significant association with \"proximity of the pharmacy to home,\" with the highest frequency at old age above 65 years (100%) (p=.022) and with \"I used the drug even though I did not have any symptoms,\" with the highest frequency in the same age group (100%) (p=.041). Gender was significantly associated with \"skin problems,\", with the highest frequency among male adults (96.7%) (p=.002). In comparison, marital status showed a significant association with reasons for using self-medication, with the highest rate among the married group (93.7%) (p=.024). Also, marital status showed a significant association with \"mild illness\", with the highest rate among married adults (74.2%) (p=.009). Educational level was significantly associated with \"fear of infection or contact while visiting healthcare facilities,\" with the highest frequency in the intermediate school group (92.9%) (p=.002). Also, educational level showed a significant association with \"I used drugs even though I did not have any symptoms,\" with the highest frequency among intermediate schools (100%) (p=.002). Income also showed a significant association with \"lack of trust in the doctor,\" with the highest reported frequency among middle-level income participants  (p=.002). Gender showed a significant relationship with \"analgesics,\" with the highest percentage of male participants (63.4%) (p=.029), and also with \"NSAIDs,\" with the highest frequency among males (97.4%) (p=.017). Additionally, male adults showed a significantly higher rate of \"previous prescription by a doctor\" (90.8%) (p=.020) and a source of medication where 28.7% of males reported pharmacy versus 26.2% of females (p=.015). Sixty percent of elementary school participants never treated themselves versus any of the high diploma participants and 50% of others with Ph.D. degrees (p=.001).Also, 19.6% of participants with low knowledge never self-treated compared to 9.5% of others with high knowledge (p=.002). Also, knowledge level was significantly associated with \"analgesics\", with the highest frequency among low-knowledge participants (63.8%) (p=.001). Exactly 79.1% of participants with high knowledge reported \"I did not practice self-medication\" versus 69.6% of those with low knowledge levels (p=.035). Additionally, 72.9% of participants with low knowledge self-selected medication in comparison to 54.4% of others with high knowledge (p=.001). Exactly 89.2% of participants with low knowledge reported \"previous prescription by a doctor\" versus 80.4% of others (p=.014) and 95% reported \"recommendation by the pharmacist\" versus 88%, respectively (p=.011).As for the relationship between knowledge level and demographics, higher knowledge was significantly associated with old age, where 100% had a high knowledge level (p=.005).This study has revealed some interesting results regarding knowledge, prevalence, patterns, and sources of self-medication during the COVID-19 pandemic among the respondents. One hundred and seventy-four respondents (43.7%) had practiced self-medication with various medicines; 45.2% used self-medication due to fear or protection from infection. Overall, participants exhibited a good attitude toward self-medication but poor knowledge.In the current study, 245 (61.6%) participants were female, which is consistent with some studies from other regions , 20, whiA local study had shown that a poor level of knowledge was observed among participants when it came to purchasing prescription-only medications without a prescription and knowing the drug instructions . SimilarRegarding the causes of self-medication, our study has stated that mild illness was the most common reason for self-medication (30.4%), followed by fear of infection (26.6%) and protection against COVID-19 (18.6%), when almost 29.4% practiced self-medication. In the same context, two studies conducted in Peru and Central Saudi Arabia revealed similar results, as mild symptoms like a cold or flu were commonly the main reason for self-medication ,16, whilAccording to a systematic review conducted in Iran about predictors of self-medication , friendsSeveral studies have discussed the drugs that are utilized in self-medication. One study conducted in Togo during the COVID-19 outbreak described vitamin C 27.6%) as the most commonly used . Two oth7.6% as tThe present study provides important insights into self-medication practices among the adult population of the eastern region of the Kingdom of Saudi Arabia during the COVID-19 pandemic. The study found that self-medication practices were prevalent among the respondents, with more than 40% of them reporting self-medication use. The reasons for self-medication included mild illnesses, fear of infection, and protection against COVID-19. However, the study also showed that a significant proportion of respondents had low overall knowledge of self-medication practices, which indicates the need for targeted educational programs to improve public awareness of the risks and benefits of self-medication. Moreover, analgesics and vitamins were the most common medications used, with the majority of respondents obtaining them from pharmacies. The study recommends that healthcare providers emphasize the importance of consulting with healthcare professionals before starting any medication to prevent harm to themselves. Lastly, further research in this area should explore the reasons behind the widespread use of self-medication, assess its consequences, and investigate ways to improve public health and prevent the risks associated with self-medication practices."
\ No newline at end of file