diff --git "a/deduped/dedup_0397.jsonl" "b/deduped/dedup_0397.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0397.jsonl"
@@ -0,0 +1,82 @@
+{"text": "Green tea is widely consumed in Asian countries and is becoming increasingly popular in Western countries. Epidemiologically, it has been suggested that green tea consumption prevents type 2 diabetes. The present study was aimed at providing evidence of improvement in glucose metabolism in diabetic mice and healthy humans upon green tea consumption.Green tea promoted glucose metabolism in healthy human volunteers at 1.5 g/body in oral glucose tolerance tests. Green tea also lowered blood glucose levels in diabetic db+/db+ mice and streptozotocin-diabetic mice 2\u20136 h after administration at 300 mg/kg without affecting serum insulin level, whereas no effect was observed in control mice . The serum protein profiles of db+/db+ and +m/+m mice were analyzed for the first time by SELDI (surface-enhanced laser desorption/ionization)-TOF (time-of-flight)-MS (mass spectrometry), and then compared to investigate any effects of oral green tea administration on serum proteins. The protein profiles in db+/db+ mice showed that the spectral peak intensities at the mass/charge ratios (m/z) of 4119, 4203, 4206, 4211, 4579, 9311 and 18691 were >3 times lower, and those of 13075, 17406, 17407, 17418, 17622, 18431 and 26100 were >3 times higher than respective peak intensities in +m/+m mice. When green tea was administered to db+/db+ mice, the peak intensities were markedly decreased at m/z 11651 and 11863, and slightly decreased at m/z 4212. The peak intensities at 7495, 7595, 7808, 14983, 15614, 31204 were markedly increased after the administration.The present study provides evidence that green tea has an antidiabetic effect. Although we could not find simple reversed effect of green tea on the diabetes-induced modifications of the levels of several serum proteins, we found that the 4211 (4212) Da protein level that was decreased in the diabetic state was further decreased after green tea administration. This is the first report demonstrating that a certain serum protein may be involved in the antihyperglycemic effect of green tea. The contribution of this protein should be further studied. Camellia sinensis, Theaceae) is a popular beverage in East Asia, and also used as a herbal remedy in Europe and North America. Green tea is considered to be antiinflammatory, antioxidative, antimutagenic, and anticarcinogenic . PP is primarily expressed in the endocrine cells of the pancreas, and the plasma PP concentrations are elevated by food intake [ Da proteThe changes in serum protein profiles by green tea also demonstrate the increase in the peak intensities of hemoglobin-related multi-MS signals, suggesting the adverse side effects of green tea, although blood samples from db+/db+ mice tended to exhibit a hemolytic feature compared with those from wild-type mice (data not shown). Interestingly, the hemoglobin-related multi-MS signals shown in Fig. We observed that green tea improved oral glucose tolerance in humans. It is therefore likely that green tea is prophylactic against diabetes and ameliorates diabetic hyperglycemia. Green tea consumption at moderate doses may be associated with a reduced risk of type 2 diabetes in apparently healthy individuals by controlling postprandial hyperglycemia.The control of postprandial hyperglycemia by green tea can help reduce the risk of type 2 diabetes. In the present study, we provide evidence showing that green tea promotes glucose metabolism in healthy humans, and produces an antihyperglycemic effect in diabetic mice. In addition, we analyzed the serum protein profiles of db+/db+ and +m/+m mice for the first time using SELDI-TOF-MS, and further investigated its association with any effects of oral green tea administration on serum proteins. Among the several proteins that were significantly lowered in the serum of diabetic mice, the 4211(4212) Da protein was significantly decreased after green tea administration. This is the first report demonstrating that a certain serum protein is involved in the antihyperglycemic effect of green tea. The contribution of this protein, therefore, should be further investigated in a future study.Moreover, we speculate that the observed effects of green tea on BGL are primarily due to the promotion of insulin action in peripheral tissues, such as skeletal muscles and adipocytes. Indeed, a recent paper showed that green tea supplementation for 12 weeks ameliorates insulin resistance and increases glucose transporter IV content in a fructose-fed rat model resembling the human type 2 diabetes mellitus . Since tC57BLKS/J db+/db+ mice  and its age-matched control C57BLKS/J +m/+m mice  were purchased from SLC  and used as the type 2 diabetic mouse model. Male ddY mice  were singly injected with STZ , and then used 4\u20136 weeks after the injection . The age-matched normal ddY mice  were also used. The animals were housed (3\u20135 per cage) under a daily cycle of 12 h light and 12 h darkness, with free access to food and water. Animals were treated as approved by the Toyama Medical and Pharmaceutical University Animal Research Committee, and according to the guidelines for animal experiments established by the Japanese Pharmacological Society.Mice were deprived of food for 11\u201314 h. Blood samples (20 \u03bcl) were collected from mouse tail veins under ether anesthesia. In experiments for proteomic analyses and serum insulin measurements, blood samples (100 \u03bcl) were collected from the orbital venous plexus of mice under ether anesthesia. The food deprivation was continued throughout the measurement of blood glucose levels (until 6 h after the administration with green tea). In the oral glucose tolerance test as described below, blood samples (0.3 \u03bcl) were obtained from human skin microvessels using FreeStyle .Healthy human volunteers (18\u201324 years old) were fasted 12 h before the starting point of experiments. The participants were perorally administered with either a suspension of green tea powder or hot water at 9:20 a.m. Ten min after the administration (at 9:30 a.m.), the participants were perorally administered with 225 ml of Trelan-G75  containing 75 g glucose. BGLs were measured before and 30, 60, and 120 min after the administration with Trelan-G75 (glucose). All the subjects enrolled in this study were ethnic Japanese. Before participation, the purpose and risks of the study were carefully explained, and written informed consent was obtained from all the participants. The protocol was approved by the Toyama Medical and Pharmaceutical University Ethics Committee regulating human research.g for 1 min at 4\u00b0C, and its supernatant was immediately separated from the pellet.BGLs were measured using ANTSENSE II  in the mouse study and using FreeStyle  in the human study. Serum insulin levels were measured using an insulin-ELISA kit . To prepare the serum samples, blood samples from mice (100 \u03bcl) were kept on ice for 2 h, centrifuged at 16,000 \u00d7 2+  (Ciphergen Biosystems), were used to fractionate proteins in serum. For the proteomic analyses with Q10 ProteinChip array, samples were 10-times diluted with denaturation buffer (7 M urea/ 2 M Thiourea/ 4% CHAPS/ 1% dithiothreitol/ 2% ampholine) and incubated on ice for 10 min, and then 10-times more diluted with buffer of 50 mM Tris-HCl (pH8). When CM10 ProteinChip array was used, samples were 10-times diluted with the denaturation buffer and incubated on ice for 10 min, and then 10-times more diluted with buffer of 100 mM NaOAc (pH4) or 50 mM HEPES (pH7). When IMAC30 ProteinChip array was used, samples were 100-times diluted with phophate-buffered saline. Spots on the different arrays were equilibrated with the buffer used for sample dilution, e.g., Tris-HCl buffer for spots on Q10 array, and each sample solution (70 \u03bcl) was loaded onto two separate spots on the arrays. After incubation for 20 min with rotation spots were rinsed with water and air-dried completely. The spots were analyzed using the SELDI ProteinChip system . In each sample, data from the two spots were averaged (duplicate assay). If a signal/noise ratio was larger than 2, the peak was considered to reflect the amount of a protein. Quantitative nature of the instrument was confirmed as previously described [Quantitative serum proteomic profiles were measured with SELDI-TOF-MS . The mouse serum was prepared as described above. Several types of ProteinChip Array, i.e., Q10 , CM10  and IMAC30-Cuescribed . The m/zCamellia sinensis, Theaceae)  were prepared at the Taiwan Tea Experiment Station, picked in May at Nan-Tou County, and immediately used without drying. The leaves were steeped in hot water (95\u00b0C) for 30 min and the filtrate was condensed under reduced pressure. The dry weight of the extracts was determined, and the extracts were dissolved in saline for administration into mice. On the other hand, green tea powder was donated by Fukuju-en . The particle size (median diameter) of the green tea powder was 2.9 \u03bcm, according to the measurement using a Centrifugal Particle Size Analyzer . In the human study, the tea powder (1.5 g) was added to 150 ml of hot water (80\u00b0C) and then whipped with a bamboo whisk. In the mouse study, the tea powder was suspended in saline at room temperature using a sonicator. The contents of caffeine and catechins in these tea samples were determined by HPLC: the samples were injected into an HPLC column ; the eluent was 10 mM phosphate buffer (pH2.6)/MeCN (gradient: 5 to 15%) at a flow rate of 1.3 ml/min. The data are shown in Table Fresh raw leaves of tea  followed by the Scheff\u00e9's multiple range test. Values of P less than 0.05 were considered to be significant. Especially, to determine the significance of the time-dependent effects of green tea  and the peak intensity averages at m/z indicated . The analyzed peak is indicated by arrows in the data of mass spectral signals. **P < 0.01; significantly different from the peak in wild-type mice, by unpaired t-test. Types of ProteinChip used were described in the Fig. 6 legend.Click here for fileChanges in serum protein profiles of db+/db+ mice after green tea administration MS spectra shows typical changes in the serum protein profiles of db+/db+ mice administered with saline (left) or green tea (right). Graph shows the peak intensity averages at m/z indicated, before (open column) and after (closed column) administration with saline (n = 4) or green tea (n = 4). The analyzed peak is indicated by arrows in the MS spectra. **P < 0.01; significantly different from the peak obtained before the administration, by unpaired t-test. Types of ProteinChip used were described in the Fig. 7 legend.Click here for file"}
+{"text": "Borrelia burgdorferi in ticks and mammals is facilitated, at least in part, by the selective expression of lipoproteins. Outer surface protein (Osp) A participates in spirochete adherence to the tick gut. As ospB is expressed on a bicistronic operon with ospA, we have now investigated the role of OspB by generating an OspB-deficient B. burgdorferi and examining its phenotype throughout the spirochete life cycle. Similar to wild-type isolates, the OspB-deficient B. burgdorferi were able to readily infect and persist in mice. OspB-deficient B. burgdorferi were capable of migrating to the feeding ticks but had an impaired ability to adhere to the tick gut and survive within the vector. Furthermore, the OspB-deficient B. burgdorferi bound poorly to tick gut extracts. The complementation of the OspB-deficient spirochete in trans, with a wild-type copy of ospB gene, restored its ability to bind tick gut. Taken together, these data suggest that OspB has an important role within Ixodes scapularis and that B. burgdorferi relies upon multiple genes to efficiently persist in ticks.Survival of  Borrelia burgdorferi is a bacterium that is maintained in an enzoonotic cycle between Ixodes ticks and a large range of mammals. Accidental encounters of infected Ixodes ticks with humans results in the transmission of B. burgdorferi and subsequent Lyme disease. Given that global control efforts have met with limited success, the need for developing novel interventions to combat this infection has become all the more vital. A better understanding of how B. burgdorferi interacts with its vector might lead to new ideas for combating the Lyme disease. B. burgdorferi upregulates outer surface protein (Osp) A and B during entry into ticks, and OspA contributes to the colonization of bacterium within the vector gut. We now demonstrate that OspB also facilitates the colonization and survival of B. burgdorferi in ticks. This work provides the basis for future studies as to how this protein facilitates interaction of B. burgdorferi to the tick gut and thus ultimately a basis for the development of novel strategies to interrupt the spirochete life cycle.Lyme disease is the most common vector-borne disease in North America and Europe. The causative agent  The causative organism, Borrelia burgdorferi, is a microaerophilic spirochete that contains a 910-kb linear chromosome and at least 21 linear and circular plasmids [B. burgdorferi is composed of several genospecies known collectively as B. burgdorferi sensu lato (s.l.) of which B. burgdorferi sensu stricto, Borrelia garinii, and Borrelia afzelii are responsible for most cases of Lyme borrelliosis worldwide [B. burgdorferi s.l. is maintained in an enzootic cycle that primarily involves Ixodes ticks and a large range of transmission-competent vertebrate hosts [Ixodes ricinus species complex, including Ixodes scapularis and Ixodes pacificus in eastern and western North America, respectively [I. ricinus and Ixodes persulcatus in Europe and Eurasia [B. burgdorferi s.l. during engorgement on a reservoir host [B. burgdorferi s.l. in this group of ticks [B. burgdorferi s.l. replicates and persists within the gut, then during a subsequent blood meal, migrates through the vector and is transmitted to a new host [B. burgdorferi s.l. initially establishes a localized infection in the skin at the site of the tick bite known as erythema migrans, then disseminates via the blood stream and can chronically infect distant organs, resulting in arthritis, carditis, and neurological disease [B. burgdorferi s.l. and serve as a reliable model for the study of Lyme borreliosis [Lyme disease is the most common tick-borne disease in the United States . The cauorldwide ,4. B. bute hosts \u20136. Ticksectively , and I. oir host \u20136. Studiof ticks \u20138. Afterreliosis .B. burgdorferi evades the host immune system and adapts to various host microenvironments, such as those in a mammal or a tick vector [B. burgdorferi selectively expresses specific Osps in distinct phases of its life cycle and in specific tissue locations. For example, the expression of B. burgdorferi OspA and OspB is immediately turned on when the spirochetes enter and reside within the arthropod vector. However, during transmission from the arthropod vector to a vertebrate host, B. burgdorferi downregulate OspA and OspB expression and upregulate the expression of proteins such as OspC, DbpA, and BBK32 [I. scapularis TROSPA protein [Variation in the synthesis of outer surface proteins (Osps) is a primary strategy by which k vector \u201315. Numend BBK32 \u201321. This protein  supportsospA and ospB are highly conserved among B. burgdorferi isolates in the United States [B. burgdorferi as the Lyme disease agent, OspA has been a subject of intensive investigation [B. burgdorferi. Previous studies have identified an ospB escape mutant in a clonal population of infectious B. burgdorferi with a single base change in the consensus ribosomal binding sequence and a single nucleotide deletion in the open reading frame of ospB gene [ospB gene resulted in reduced expression and truncation of this protein that diminished the penetration capability and infectivity of the spirochete in the human umbilical vein endothelium cells [B. burgdorferi within unfed ticks [B. burgdorferi colonization in I. scapularis gut [ospAB operon inhibited B. burgdorferi colonization and persistence in the tick gut [The genes d States ,24. Theyd States ,26. Bothd States ,28. Sinctigation . In contspB gene . These cum cells . Severaled ticks \u201333 and taris gut . Targetetick gut . While tB. burgdorferi allows researchers to study the importance of specific B. burgdorferi genes that are required throughout the spirochete life cycle [B. burgdorferi, genetically complementing the mutant, and performing in vivo studies in ticks and mice.Progress in the methodologies for genetic manipulation of virulent fe cycle . In the B. burgdorferi OspB, an isogenic OspB-deficient mutant was generated from infectious B. burgdorferi B31 clone 5A11 by replacing a 554-base pair (bp) internal fragment of the ospB gene with a Borrelia-adapted kanamycin resistance cassette, kanAn, through homologous recombination . The plasmid content of these two mutants was analyzed and compared to that of the wild-type parental clone using an array-based assay [B. burgdorferi infectivity in mice [ospB mutant lacking cp9 for further studies.To understand the function of bination . The coned assay , which s in mice , we chosospB mutant, a series of PCRs were performed  and a total of 900 na\u00efve nymphs (50 nymphs/mice). Five nymphs were removed from the murine skin at various time points during feeding, in order to examine the kinetics of spirochete migration, and the remaining nymphs were allowed to feed to repletion. Nymphs were subjected to Q-RT-PCR analyses to determine the spirochete burden  of a subset of the nymphs that were collected at various time points. Tick gut luminal contents  as well as gut tissues washed free of luminal contents were prepared and subjected to IFA (see ospB mutant-infected mice (See 72-h panel in p < 0.0001) in comparison to the number of the OspB-deficient spirochetes in the blood meal sample , but the ospB mutant spirochetes are not able to persist within the luminal content or fully adhere to the tick gut.Furthermore, a subset of fully engorged nymphs was allowed to molt to the adult stage to determine whether the diminished capacity of t sample C and 3D.B. burgdorferi colonization and survival in the ticks, we constructed a strain of the mutant complemented in trans with a wild-type copy of the ospB gene. The promoter of the ospAB operon was fused to the ospB gene and cloned into the shuttle vector pKFSS1 [ospB mutant with pFGN1 resulted in three positive clones that grew in the BSK-H media supplemented with streptomycin and kanamycin, of which one clone had lost both lp25 and lp28\u20131 plasmids and the other two clones showed identical endogenous plasmid profiles as its parental isolate (unpublished data). Furthermore, to determine whether these two clones harbored pFGN1 and were indeed from the ospB mutant, total DNA of these complemented clones was examined by PCR amplification. The three PCRs using primer combinations N21/N27, N28/N17, and N21/N17 confirmed the inactivated ospB locus  for further analysis. OspB expression was detected at both the mRNA and the protein levels in the OspB complemented strain .To further address whether the loss of OspB expression results in a defect of r pKFSS1 , resultid strain C and 1D.of pFGN1 F. ImmunoospB mutant, and three for OspB complemented strain) and a total of 135 nymphs (15 nymphs/mice). Eight nymphs were forcibly removed during feeding (48 h) and analyzed by IFA and Q-RT-PCR. The results of the confocal microscopy revealed that, in contrast to the ospB mutant, the OspB complemented strain readily colonized the tick gut tissue (p < 0.0001), albeit to a lower level than the wild-type isolate  prepared separately from flat-nymphal ticks and fed-nymphal ticks with the wild-type, the ospB mutant, and the OspB complemented strains  and was comparable to the wild-type spirochetes  of spirochete viability.While significant research has focused on the biological role of OspA in spirochete life cycle, relatively little information is available on the role of OspB in the life cycle of lt ticks . The binlt ticks . The lumospB mutant, the OspB complemented strain readily colonized tick gut tissue and showed a drastic increase in its persistence within ticks, which was comparable to the wild-type isolate , and it was found that disruption of both the ospA and ospB genes had no observable effect on the ability of spirochetes to establish infection in mice, whereas the locus is critically essential for colonization of the tick gut [ospAB double mutant with both OspA and OspB expression restores the ability of B. burgdorferi to colonize the gut [ospA gene alone could only partially restore (50%\u201360% in comparison to the wild-type) the colonization defect of the ospAB mutant [ospAB double mutant complemented with the ospA gene alone, the ospB mutant analyzed in our study was significantly impaired in its persistence in the tick gut. These variations could have been the results of (i) the different B. burgdorferi strains used in the studies (B31 5A11 versus 297 BbAH130) and (ii) the relative OspA expression in the ospAB double mutant complemented with the ospA gene (on a circular plasmid) compared to the ospB mutant analyzed in our study. Overall, our studies in conjunction with the previous studies [B. burgdorferi in ticks. In an evolutionary perspective, the conservation of ospB in the genome of B. burgdorferi is the result of positive selection pressure [Yang and co-workers recently examined the role of the gdorferi . This watick gut . Spirochtick gut . Further the gut . On the B mutant , suggestB mutant  indicate studies  show thapressure ,24, and B. burgdorferi colonization of I. scapularis gut [B. burgdorferi surface, and steric hindrance might then interfere with OspB binding to the tick gut; or it is possible that steric hindrance by OspB antibodies also affected OspA-mediated binding of spirochetes to the tick gut [B. burgdorferi cultures, the expression of OspB is lower than OspA  in spirochete colonization and survival at arthropod-pathogen interface, but they also enhance our knowledge in the development of new therapeutic strategies, such as new transmission blocking vaccines that may be useful to combat B. burgdorferi infection.In summary, these data suggest that OspB plays a critical role for B. burgdorferi isolate B31 infectious clone 5A11 that lacks lp5 and contains all other 20 plasmids [B. burgdorferi. This B. burgdorferi isolate, its ospB deletion mutant, and the OspB complemented mutant (ospB\u2212/pFGN1) were cultivated in vitro at 33 \u00b0C in Barbour-Stoenner-Kelly complete media . Where necessary, antibiotics kanamycin and streptomycin were added to a final concentration of 350 \u03bcg/ml and 50 \u03bcg/ml, respectively. Spirochetes from in vitro cultures were needle-inoculated  at a dose of 105 spirochetes/mouse and were recovered from cultures of ear punch biopsies at 2 wk after inoculation. E. coli strain DH5\u03b1  was used as a cloning host. Unfed I. scapularis nymphs were obtained from a colony of I. scapularis ticks maintained by Dr. Durland Fish and Dr. Fred S. Kantor at Yale University.plasmids ,48 was uBorrelia-adapted kanamycin resistance cassette, kanAn, driven by the flaB promoter, was excised from pTAkanAn [EcoRI site of pBluescript . The resulting construct, designated pXLF10601, contains two multi-cloning sites flanking the kanAn cassette, which allows efficient cloning of the 5\u2032 and the 3\u2032 arms required for homologous recombination. PCR primers N33/N34 and N35/N36  and 200 \u03bcl aliquots were dispensed into two 96-well plates. After 2\u20133 wk of incubation at 33 \u00b0C in a CO2 incubator, the wells that contained kanamycin-resistant (KanR) clones were identified by the color change of the culture medium. The presence of viable spirochetes in these wells was subsequently verified by dark-field microscopy. The homologous recombination between the sequences of pXLF11303 and of the native ospAB operon results in the excision of the ospB gene with the integration of the \u0394ospB::Kan fragment  and the ospB gene were PCR-amplified from the B. burgdorferi genomic DNA using primers N29/N30 and N31/N32, respectively  and 200 \u03bcl-aliquots were distributed into two 96-well plates. After 2\u20133 wk of incubation, streptomycin- and kanamycin-resistant clones were selected and analyzed by PCR with primers N23/86 and N83/N84 to detect the PospAB-ospB and the aadA fragments, respectively. RT-PCR with N16/N11 primers and immunoblot with mAb B22J were also performed to confirm the presence of ospB transcripts and OspB protein, respectively  were allowed to feed on B. burgdorferi-infected mice. Partially fed nymphs (five nymphs/time point) were removed from the skin of mice at various time points during feeding . Remaining nymphs were allowed to feed to repletion and were collected at 24 h, 48 h, and 72 h following up to 7 d post-feeding . Three to five guts from each group of nymphs were microscopically dissected in 20 \u03bcl phosphate-buffered saline (PBS) and washed to remove luminal contents and unbound bacteria. In addition, luminal contents (including the blood) from the gut were separately isolated from the fed ticks and subjected to immunofluorescence confocal microscopy as described [After a 3-wk inoculation of escribed ,52. The B. burgdorferi-infected mice. Engorged nymphs were then collected and transferred into 10-ml glass vials with vented lid and stored at 22 \u00b0C incubator with a relative humidity of 97% and 16 h:8 h light:dark photoperiod. Engorged nymphs were allowed to molt to the adult stage for 6\u20138 wk. Five to seven guts from adults were microscopically dissected, and guts and luminal contents were subjected to immunofluorescence confocal microscopy as described [Nymphal ticks were allowed to feed to repletion on escribed ,52. SpirBorrelia antibody . Samples were subsequently stained with propidium iodide (20 \u03bcg/ml) for 3 min at 37 \u00b0C followed by mounting with SlowFade-Antifade kit (Invitrogen). The tissues were viewed using a Zeiss LSM 510 scanning laser confocal microscope equipped with an argon/krypton laser .The washed gut and luminal contents were subjected to immunofluorescence confocal microscopy as described ,52. BrieB. burgdorferi into the ticks was performed as described [B. burgdorferi isolates  were cultivated under normal conditions in BSK-H medium with or without antibiotics. Log-phase cultures were centrifuged and concentrated in a fresh BSK-H media to a density of 109 spirochetes per ml. 1 \u03bcl of the re-suspended cultures was then loaded into a 1-mm diameter glass capillary needle  and approximately 1 nl (103 spirochetes) was injected into each tick via the rectal aperture using femtojet microinjector system  as described [Microinjection of escribed . Brieflyescribed ,35. 15 mB. burgdorferi grown in vitro, total RNA was isolated from B. burgdorferi B31 and its derived mutants using Nucleospin RNAII kit  and converted to cDNA using iScript cDNA synthesis kit . RT-PCR for the ospB, ospA, and flaB genes was performed using the primer combinations N16/N11, N21/N22, and N12/N13, respectively  was extracted and converted to cDNA. The cDNA was used as a template for the amplification of flaB using primers N18 and N19 and for tick \u03b2-actin, using primers N3 and N20.For RT-PCR analysis of ectively . For theflaB amplicons were quantified using the oligonucleotides N18 and N19 and iQ-SYBR Green Supermix (Bio-Rad). The reaction conditions are initial 95 \u00b0C for 10 min followed by 94 \u00b0C for 30 s, 60 \u00b0C for 1 min, 72 \u00b0C for 1 min for 35 cycles. As an internal control and to normalize the amount of template, tick actin amplicons were quantified using N3/N20 (for tick samples), and mouse \u03b2-actin amplicons were quantified using the oligonucleotides N25 and N26 (for mice samples). Standard curves for flaB, tick actin, and mouse \u03b2-actin were prepared using 10-fold serial dilutions of known quantities .For the quantification of the spirochete burden in mice and ticks, quantitative PCR (Q-PCR) and quantitative RT-PCR (Q-RT-PCR) analysis was performed, respectively, as described ,35. The http://www.vwrsp.com). Total protein concentrations in the TGE were determined using the Bio-Rad Protein Assay Kit (Bio-Rad Laboratories). 100 \u03bcl of TGE (5 \u03bcg/ml) in PBS was used to coat the wells of 96-well plates . Control wells were coated with fetal bovine serum (FBS) (10 \u03bcg/ml). The coated wells were incubated for 4 h at 33 \u00b0C with 107 spirochetes per well in PBS-Tween 20 supplemented with 5% FBS. Unbound spirochetes were washed away with PBS-Tween, followed by incubation for 1 h at 33 \u00b0C with FITC-labeled anti-Borrelia antibody (KPL). Binding was detected using anti-FITC IgG-horseradish peroxidase  as a secondary reagent and TMB microwell peroxidase substrate (KPL) was used for color development. The reactions were stopped after 15 min incubation using TMB stop solution (KPL) and optical density (OD) was read at 450 nm.Guts from flat-nymphal ticks (40 ticks) and fed-nymphal ticks (25 ticks) were dissected in PBS and homogenized on ice using Kontes micro homogenizer  were centrifuged and re-suspended in 25 \u03bcl Laemmli Sample buffer (Bio-Rad). Samples were incubated in boiling water for 5 min and loaded onto 12% SDS-PAGE gels. Gels were stained with Simply Blue SafeStain (Invitrogen) and processed according to the manufacturer's instruction. Immunoblotting analysis was performed with the protein extracts from 107 spirochetes and processed as described [For sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis, 10 ml of actively growing spirochetes  accession numbers for B. burgdorferi B31 isolate M1 are NC_001318 for the chromosomal genome sequence and NC_001857 for the lp54 sequence.The GenBank ("}
+{"text": "Study of the distribution of the p21 ras oncogene product as demonstrated by monoclonal antibody Y13-259 shows this protein to be apparently present in all epithelial populations of both premalignant and malignant tumours and throughout the normal foetal and adult epithelial crypt population in the colorectum. Metastatic tumour in liver shows a similar staining pattern which is less intense however than in the surrounding normal hepatocytes. Our results suggest that the presence of this protein is a widespread feature of normal cellular metabolism in certain cell types and is not restricted to those actively involved in cellular proliferation. It appears, furthermore, that neither cells at different stages of carcinogenesis nor those representing variants of a malignant phenotype can be identified using this particular antibody."}
+{"text": "Tristetraprolin (TTP/ZFP36) family proteins have anti-inflammatory activity by binding to and destabilizing pro-inflammatory mRNAs such as Tnf mRNA, and represent a potential therapeutic target for inflammation-related diseases. Tea has anti-inflammatory properties but the molecular mechanisms have not been completely elucidated. We hypothesized that TTP and/or its homologues might contribute to the beneficial effects of tea as an anti-inflammatory product.Ttp family genes , pro-inflammatory genes , and Elavl1/Hua/Hur and Vegf genes in liver and muscle of rats fed a high-fructose diet known to induce insulin resistance, oxidative stress, inflammation, and TNF-alpha levels.Quantitative real-time PCR was used to investigate the effects of green tea  on the expression of Ttp and Zfp36l1 mRNAs were the major forms in both liver and skeletal muscle. Ttp, Zfp36l1, and Zfp36l2 mRNA levels were more abundant in the liver than those in the muscle. Csf2/Gm-csf and Zfp36l3 mRNAs were undetectable in both tissues. Tea (1 g solid extract/kg diet) increased Ttp mRNA levels by 50\u2013140% but Tnf mRNA levels decreased by 30% in both tissues, and Ptgs2/Cox2 mRNA levels decreased by 40% in the muscle. Tea (2 g solid extract/kg diet) increased Elavl1/Hua/Hur mRNA levels by 40% in the liver but did not affect any of the other mRNA levels in liver or muscle.These results show that tea can modulate Ttp mRNA levels in animals and suggest that a post-transcriptional mechanism through TTP could partially account for tea's anti-inflammatory properties. The results also suggest that drinking adequate amounts of green tea may play a role in the prevention of inflammation-related diseases. Zfp36 in the mouse  [Recent investigations have established a mechanism for the regulation of inflammatory responses at the post-transcriptional level by tristetraprolin (TTP) family of CCCH tandem zinc finger proteins (ZFP). TTP family consists of three known members in mammals  and the fourth member in mouse and rat but not in humans (ZFP36L3) [roteins) . TTP binroteins) , granuloroteins) ,11, and roteins) . The mRNroteins) ,10. Exceroteins) ,14. In croteins) . These lTtp gene expression may have potential therapeutic value for the prevention and/or treatment of inflammation-related diseases. A number of agents have been shown to increase Ttp mRNA and/or protein levels in mammalian cells. The inducible agents include growth factors  [Ttp gene expression is also induced by tumor promoters (phorbol 12-myristate 13-acetate and tetradecanoyl phorbol acetate) [Ttp gene expression is induced by viral infection [Agents that induce f serum) ,4, cytokf serum) ,8,15 andf serum) . Howeveracetate) ,18. Finanfection . The facnfection  may limiCamellia sinensis) is a popular beverage worldwide. Recent studies indicate that tea has a wide range of effects on animal and human health. A number of studies have indicated that green tea has anti-inflammatory properties [Tea  from Charles River Laboratories  were housed individually in thermoformed polystyrene cages in accordance with standards accredited by the French Ministries of Agriculture and Environment. The rats were kept under the conditions with a 12-h light:12-h dark schedule, a room temperature of 21 \u00b1 1\u00b0C, and a relative humidity of 55%. The fructose-rich diet used in this study contained 60% (w/w) fructose, 20.7% casein, 5% corn oil, 8% alphacel, 1% mineral mix, 1% vitamin mix, and 0.3% casein . The green tea solid extract used in this study contained 12.75% (w/w) epigallocatechin-3-gallate (EGCG), 9.21% epigallocatechin (EGC), 3.73% epicatechin gallate (ECG), 2.4% epicatechin (EC), 5.94% caffeine, and 0.195% L-theanine (Unilevel France).All rats were fed a standard Purina chow for one week before being randomly divided into three groups with 10 rats per group. The first group of rats was given a high-fructose diet that has been shown to induce insulin resistance and oxidative stress (diet control). The second group of rats was given the high-fructose diet plus 1 g of green tea solid extract/kg diet (1 g tea) and the third group of rats was given the high-fructose diet plus 2 g of green tea solid extract/kg diet (2 g tea). Animals were sacrificed after 6 weeks on the diet. Food intake for rats fed the diet control, 1 g tea, and 2 g tea was 20.7 \u00b1 0.8, 20.5 \u00b1 0.9, and 20.3 \u00b1 1.5 g/d, respectively. The body weight for rats fed the diet control, 1 g tea, and 2 g tea for 6 weeks was 360 \u00b1 7, 350 \u00b1 5, and 353 \u00b1 7 g, respectively. The trend of decreased body weight in treated rats was not significant after 6 weeks of diet. The mean body gain by week for rats fed the diet control, 1 g tea, and 2 g tea was about 35, 34, and 34.5 g, respectively. These data are in agreement with a previous report in which the same diet was used and a similar evolution in body weight was reported . The livZOL reagent  in a 15-ml Falcon tube. RNA was isolated according to the manufacturer's instructions. The RNA pellet was suspended in 20 \u03bcl DEPC-treated water. RNA integrity and concentrations were determined using RNA 6000 Nano Assay Kit and the Bioanalyzer 2100 according to the manufacturer's instructions  with RNA 6000 Ladder as the standards .Rat liver and muscle were ground into powder under liquid nitrogen. About 200\u2013400 mg of the tissue powder was homogenized in 4 ml of TRI15 primer (Invitrogen), 0.25 \u03bcg random primers (Invitrogen), 500 \u03bcM dNTPs, 5 mM MgCl2, 2.5 \u03bcl RNasin ribonuclease inhibitor, and 5 \u03bcl ImProm-II reverse transcriptase in 1\u00d7 ImProm-II reaction buffer. The cDNA synthesis reactions were carried out at 42\u00b0C for 60 min.Total cDNA synthesis was performed in 0.2-ml microfuge tubes using the ImProm-II Reverse Transcription System . The reaction mixture (20 \u03bcl) contained 5 \u03bcg total RNA, 1 \u03bcg oligo(dT)The primers and probes were designed using Primer Express software  and were synthesized by Biosearch Technologies, Inc. . The mRNA names, GenBank accession numbers, amplicon sizes, and the sequences (5' to 3') of the forward primers, TaqMan probes TET \u2013 BHQ1), and reverse primers, respectively, are described in Table , and revCT method of relative quantification was used to determine the fold change in expression [CT) values of the target mRNAs to the CT values of the internal control Rpl32 in the same samples (\u0394CT = CTTarget - CTRpl32). It was further normalized with the diet control (samples with only the high-fructose diet but without tea supplement) (\u0394\u0394CT = \u0394CTTea - \u0394CTDiet). The fold change in expression was then obtained (The TaqMan reaction mixture (25 \u03bcl) contained 25 ng of total RNA-derived cDNAs, 200 nM each of the forward primer, reverse primer, and TaqMan probe, and 12.5 \u03bcl of 2\u00d7 Absolute QPCR Mix . The reactions were performed in 96-well plates in a ABI Prism 7700 real-time PCR instrument (Applied Biosystems) . The thepression . This wap < 0.05 and p < 0.01, respectively.The data were analyzed by SigmaStat 3.1 software  using One Way Analysis of Variance (ANOVA). Multiple comparisons were performed with Duncan's Multiple Range Test. Values with different lower case and upper case letters displayed above the columns of the figures are significantly different at CT values of the Ttp family and the internal control Rpl32 mRNAs and the relative ratio of Ttp family mRNAs in the liver and muscle are shown in Table CT values of Rpl32 in the liver and muscle were essentially the same and the results validated the assumption of using the Rpl32 mRNA level as an internal control for the normalization of gene expression levels. Ttp and Tis11b mRNAs were the two dominant forms of Ttp family messages in both liver and muscle. In liver, the relative levels of Ttp, Tis11b, and Tis11d mRNAs were 100%, 148%, and 6%, respectively. In muscle, the relative levels of Ttp, Tis11b, and Tis11d mRNAs were 100%, 70%, and 15%, respectively. Zfp36l3 mRNA was undetectable by 50 cycles of PCR in the liver or muscle. As a positive control for the PCR assay, Zfp36l3 mRNA was detected in two cell lines (data not shown). Ttp, Tis11b, and Tis11d mRNA levels were more abundant in the liver than those in the muscle, and were 5, 12.5, and 2 fold of those in the muscle, respectively  . The CT Low levels of Tnf and Ptgs2/Cox2 mRNAs were detected in both liver and muscle (Table Green tea (1 g solid extract/kg diet) increased Ttp mRNA levels by 50% (P = 0.003) but did not have statistically significant effects on Tis11b or Tis11d mRNA levels in the liver  increased Ttp mRNA levels by 140% (P < 0.001) but did not have statistically significant effects on Tis11b or Tis11d mRNA levels in the skeletal muscle Fig. . Green tThe increased levels of the anti-inflammatory Ttp mRNA level with 1 g of green tea solid extract per kg of diet shown above suggest that green tea might have destabilizing effects on pro-inflammatory ARE-containing mRNAs such as Tnf mRNA. Therefore, we analyzed the expression levels of Tnf, Csf2/Gm-csf, and Ptgs2/Cox2 mRNAs, whose stability are known to be decreased by TTP ,10,12, iPCR analyses showed that green tea extract at 1 g decreased Tnf and Ptgs2 mRNA levels in the skeletal muscle by 30% (P = 0.008) and 40% (P = 0.042), respectively  significantly increased the mRNA levels of the anti-inflammatory protein TTP and decreased those of the pro-inflammatory TNF-\u03b1 in both liver and muscle of rats and also decreased Ptgs2 mRNA in the muscle. The induction of Ttp and reduction of Tnf mRNAs by green tea in rats suggests that at least part of the mechanisms of tea's anti-inflammatory effects may be involved in TTP at the post-transcriptional level.Tnf and other genes. It was shown that green tea polyphenol EGCG inhibited LPS-mediated Tnf mRNA levels by blocking NF-\u03baB activation in macrophage RAW264.7 cells [Tnf gene expression by blocking NF-\u03baB activation [Previous investigations have suggested that the mechanism of tea's anti-inflammatory effects also involves the regulation of gene transcription. Tea affects a number of important molecular targets including TNF-\u03b1 , interle.7 cells . Therefotivation . Taken ttivation ,17,18.We also found that a higher dose of green tea extract at 2 g in the high-fructose diet significantly increased the mRNA levels of Elavl1/Hua/Hur in rat liver. ELAVL1 is known to be an RNA binding protein -35. PrevThere are two known TTP-related proteins in mammalian cells, ZFP36L1  and ZFP36L2  . HoweverWe therefore described the expression profiles of the four Ttp family mRNAs in rat liver and muscle. Real-time PCR analyses showed that Ttp and Tis11b mRNAs were the two major forms in the liver and muscle and that Ttp, Tis11b, and Tis11d mRNA levels were more abundant in liver than those in muscle. The PCR results are in agreement with immunoblotting results reported previously that TTP protein levels are more abundant in mouse liver than muscle . Zfp36l3Ttp gene expression is regulated by a narrow dose of tea for certain period, since its gene expression is transiently induced by growth factors such as insulin, i.e., Ttp mRNA levels peaked at 45 min but declined to normal level in 2 h in a cell culture system [Ttp and Tnf gene expression. We believe cell culture systems could be a much more effective way to address this area of research in the future. Second, confirmation of TTP protein levels in rats with tea treatments requires future development of high-titer rat antibodies, since TTP protein is only detectable with the mouse TTP antibodies in the spleen of rats after LPS stimulation [Ttp gene expression? Our working hypothesis is that Ttp gene expression is increased by catechins, the major polyphenols in green tea. We reported that polyphenolic compounds in cinnamon increased TTP protein levels in mouse 3T3-L1 adipocytes [Ttp gene and/or bind to the AU-rich elements in the 3'-untranslated region of Tnf mRNA, which are also the preferred binding sites for TTP protein [The induction of Ttp and reduction of Tnf mRNAs in rat liver and muscle by green tea (1 g solid extract/kg high fructose diet) suggests that TTP may be involved at the post-transcriptional level in the mechanisms of tea's anti-inflammatory effects. However, some issues need to be investigated in future experiments. First, the reason(s) why tea at 2 g solid extract/kg diet did not increase Ttp mRNA levels and decreased Tnf mRNA levels in the same tissues requires further studies to determine the optimum dose that demonstrates green tea effects. It is possible that e system . Furthere system . Therefomulation ,17,18 ormulation . Third, ipocytes ,50. Receipocytes . It will protein ,52.This study describes profiles of the anti-inflammatory Ttp family mRNA levels and green tea effects on these and some of the pro-inflammatory mRNAs in the liver and muscle of rats with metabolic syndrome induced by a high-fructose diet. Our results suggest that the molecular mechanism of the anti-inflammatory effects of green tea may be partially due to its ability to increase mRNA levels encoding anti-inflammatory factors such as TTP/TIS11/ZFP36 and/or ELAVL1/HuA/HuR and to decrease mRNA levels encoding pro-inflammatory factors such as TNF-\u03b1 and/or PTGS2/COX-2. To our knowledge, this is the first report to show that a plant nutritional product such as green tea can modulate Ttp mRNA levels in a biological system and the results provide a novel post-transcriptional mechanism for green tea's anti-inflammatory properties. These results suggest that drinking adequate amounts of green tea may play a role in the prevention of inflammation-related diseases.Zfp36, Zfp36, and ZFP36 represent Zfp36 gene, mRNA, and protein, respectively.ANOVA: one way analysis of variance; ARE: AU-rich element; COX-2/PTGS2: cyclooxgenase-2/prostaglandin-endoperoxide synthase 2; EGCG: Epigallocatechin-3-gallate; GM-CSF/CSF2: granulocyte-macrophage colony-stimulating factor; HuR(HuA)/ELAVL1: Hu antigen R/embryonic lethal, abnormal vision-like 1; LPS: lipopolysaccharide; NF-\u03baB: nuclear factor-kappa B; RPL32: ribosomal protein L32; TNF: tumor necrosis factor; TTP: tristetraprolin; VEGF: vascular endothelial growth factor; ZFP36: zinc finger protein 36; ZFP36L1: ZFP36-like 1; ZFP36L2: ZFP36-like 2; ZFP36L3: ZFP36-like 3. The nomenclature of genes, mRNAs, and proteins was according to reference 1 and was accepted by the Mouse Genome Database. For example, The author(s) declare that they have no competing interests.HC designed the experiment, designed PCR primers and probes, performed PCR assays, analyzed PCR data and wrote the manuscript. MAK performed RNA isolation and cDNA synthesis. FK and HDD provided advice on RNA isolation, cDNA synthesis, and PCR assay. JFU analyzed the data and revised the manuscript. SC provided the green tea solid extract. AMR designed the animal study and provided the animal tissues. RAA designed the animal study, analyzed the data, and revised the manuscript."}
+{"text": "Chemical Research in Toxicology that analyzed the toxic potential of green tea polyphenols.Throughout China and Japan, green tea is considered a staple beverage. Many epidemiologic studies have linked frequent tea intake with a lower incidence of cancer, cardiovascular disease, and neurodegenerative disorders. Consumer interest in the tea\u2019s health benefits has led to the inclusion of green tea extracts in multivitamins and other dietary supplements. But too much of a good thing could prove harmful, according to a review in the April 2007 issue of Currently there are no published epidemiologic studies on the toxicity of green tea supplements. But laboratory research with both rodents and dogs has shown that high doses of the most heavily studied green tea polyphenol, (-)-epigallocatechin-3-gallate (EGCG), cause liver, kidney, and gastrointestinal toxicities.Case reports on the toxic effects of green tea extracts in humans are also beginning to emerge. \u201cTo date, there have been nine anecdotal case reports of liver toxicity in humans associated with consumption of high doses  of green tea from dietary supplements,\u201d says lead author Joshua Lambert, an assistant research professor in the Department of Chemical Biology at Rutgers University. \u201cIn some cases, the subject stopped taking the supplement and the symptoms resolved, and then the subject started taking the supplement again and liver toxicity returned.\u201d Such observations, albeit anecdotal, suggest that green tea supplements are not without risk.o-methyltransferase, an enzyme critical to the protection of cells against EGCG-mediated oxidative stress and hepatotoxicity. About a quarter of the population have a polymorphism that is associated with low activity of this enzyme. \u201cThis is just a hypothesis that we are testing,\u201d says coauthor Chung S. Yang, a chemical biology professor at Rutgers.Cell culture studies have shown that EGCG can cause oxidative stress, although these data now need to be confirmed in animal models. The Rutgers team speculates that some susceptible individuals may carry a particular polymorphism of the gene that codes catecholamine-Toxic effects tend to arise when people take green tea supplements, which can contain more than 50 times as much polyphenol as a single cup of tea. \u201cPeople who take less than 500 mg [of green tea concentrate or preparation] per day and spread the dose out over the course of the day are unlikely to have toxic side effects,\u201d says Yang.Yang adds that some Japanese publications report beneficial effects for the consumption of 10 cups of green tea a day with no apparent harmful effects. At most, people may experience stomach irritation after drinking strongly brewed green tea on an empty stomach. Commercial preparations such as the bottled green teas found in the United States and green tea\u2013flavored gum, bread, candy, ice cream, and desserts found in Asia have very low levels of polyphenols.At the present time there is no established upper tolerable limit for green tea consumption. The Rutgers review points to the need for epidemiologic studies to test the potential concerns of taking green tea supplements at 500-mg doses or higher. Yang and Lambert hypothesize that people with oxidative stress\u2013related liver diseases such as hepatitis or cirrhosis may be at greater risk of toxic side effects from ingesting high doses of green tea polyphenols. \u201cWhen a person\u2019s liver is already under stress, toxic effects tend to become amplified,\u201d Yang says. Conversely, he notes there are data showing that low or moderate amounts of green tea have a protective effect against both toxicity and carcinogenesis in target organs\u2014once again supporting the adage \u201ceverything in moderation, nothing to excess.\u201d"}
+{"text": "The fenchol-based P-H phosphonite BIFOP-H exeeds with 65% ee other monodentate ligands in the Pd-catalyzed substitution of 1-phenyl-2-propenyl acetate with dimethylmalonate. Palladium catalyzed allylic substitutions provide valuable tools for stereoselective C-C- and C-heteroatom connections \u20132. The cet al. improved the yield of the chiral, branched product by employing electron withdrawing substituents on the P-donor atoms in P, N-oxazoline ligands[N1-like addition at the substituted, allylic C-atom. High regio- and enantioselectivities were also achieved with biphenylphosphites by Pamies et al.  and biphenylbisfenchol based phosphorus ligands are all suitable for Pd-catalyzed allylic alkylations of 1-phenyl-2-propenyl acetate  are apparent for these trans position in comparison to the shorter C1-Pd bond distances , as was observed previously with diethylzinc,[+ vs. Zn2+) and the huge steric shielding prevents halide substitutions and BIFOP-Cl(Br) decompositions.Monodentate BIFOP ligands yield more of the linear alkylation product , despitethylzinc, was founR-enantiomeric product, the S-enantiomer is preferred by all BIFOP ligands. Enantioselectivities increase from FENOP with 19% ee to FENOP-Me with 31% ee and to FENOP-NMe2 with 37% ee, reflecting the effect of steric demanding and electron donating pyridine groups on enantioselectivity.With regard to enantioselectivities, some monodentate BIFOPs are even superior to the pyridine-phosphinites (FENOPs). While FENOPs favor the BIFOP-Cl and BIFOP-Br yield even higher enantioselectivities (39% and 37% ee) than the corresponding phosphite BIFOP-OPh or the phosphoramidite BIFOP-NEt2 (10% and 29% ee, BIFOP-H (65% ee, BIFOP-H.The surprisingly stable halogen phosphites  65% ee, . As in cFENOP system, an exo allyl arrangement and a trans to phosphorus addition of the nukleophile is slightly preferred (cf. the two most stable transition state in Si-addition of the nucleophile explains the experimentally observed formation of the R-alkylation product (BIFOP-H in allylic substitutions yields BIFOP-H-Re as the most stable transition structure. Its Re-addition of the NH3-nucleophile is slightly more favored than the Si-addition in the competing transition structure BIFOP-H-Si (S-alkylation product with BIFOP-ligands (Computational transition structure analyses of allylic substitutions with ammonia mimicking the malonate nucleophile help to understand origins of enantioselectivities,\u201334 as we product . SystemaFOP-H-Si . This ag-ligands .BIFOP-Cl and BIFOP-Br are stable towards nucleophiles under catalysis conditions, apparently due to absence of strongly Lewis-acidic cations and the large steric shielding of the phosphorus-halogen functions. With respect to enantioselectivities, the P-H phosphonite BIFOP-H is clearly superior and reaches 65% ee, a rather high selectivity for a monodentate ligand.Besides P, N-bidentate FENOP ligands, monodentate BIFOP ligands can be employed successfully in Pd-catalyzed allylic substitution of 1-phenyl-2-propenyl acetate with dimethylmalonate. Surprisingly, the halogen phosphites File 1contains all experimental data"}
+{"text": "Both urine and plasma from mice and humans with cancer cachexia have been shown to contain higher levels of lipid mobilising activity than normal controls, even after acute starvation. There was no significant increase in the urinary lipid mobilising activity of either mice or humans after acute starvation, suggesting that the material in the cachectic situation was probably not due to an elevation of hormones normally associated with the catabolic state in starvation. Further characterisation of the lipid mobilising activity in the urine of cachectic mice using Sephadex G50 exclusion chromatography showed four distinct peaks of activity of apparent molecular weights of greater than 20, 3, 1.5 and less than 0.7 kDa. No comparable peaks of activity were found in the urine of a non tumour-bearing mouse. The high molecular weight activity was probably formed by aggregation of low molecular weight material, since treatment with 0.5 M NaCl caused dissociation to material with a broad spectrum of molecular weights between 3 and 0.7 kDa. Lipolytic species of similar molecular weights were also found in the urine of cachectic cancer patients, but not in normal urine even after 24 h starvation. The lipid mobilising species may be responsible for catabolism of host adipose tissue in the cachectic state."}
+{"text": "Arabidopsis protein with overall sequence similarity to the HETEROCHROMATIN PROTEIN 1 (HP1) family of metazoans and S. pombe. TFL2/LHP1 represses transcription of numerous genes, including the flowering-time genes FLOWERING LOCUS T (FT) and FLOWERING LOCUS C (FLC), as well as the floral organ identity genes AGAMOUS (AG) and APETALA 3 (AP3). These genes are also regulated by proteins of the Polycomb repressive complex 2 (PRC2), and it has been proposed that TFL2/LHP1 represents a potential stabilizing factor of PRC2 activity. Here we show by chromatin immunoprecipitation and hybridization to an Arabidopsis Chromosome 4 tiling array (ChIP-chip) that TFL2/LHP1 associates with hundreds of small domains, almost all of which correspond to genes located within euchromatin. We investigated the chromatin marks to which TFL2/LHP1 binds and show that, in vitro, TFL2/LHP1 binds to histone H3 di- or tri-methylated at lysine 9 (H3K9me2 or H3K9me3), the marks recognized by HP1, and to histone H3 trimethylated at lysine 27 (H3K27me3), the mark deposited by PRC2. However, in vivo TFL2/LHP1 association with chromatin occurs almost exclusively and co-extensively with domains marked by H3K27me3, but not H3K9me2 or -3. Moreover, the distribution of H3K27me3 is unaffected in lhp1 mutant plants, indicating that unlike PRC2 components, TFL2/LHP1 is not involved in the deposition of this mark. Rather, our data suggest that TFL2/LHP1 recognizes specifically H3K27me3 in vivo as part of a mechanism that represses the expression of many genes targeted by PRC2.TERMINAL FLOWER 2/LIKE HETEROCHROMATIN PROTEIN 1 (TFL2/LHP1) is the only  Arabidopsis is TERMINAL FLOWER 2/LIKE HETEROCHROMATIN PROTEIN 1 (TFL2/LHP1). Here we present highly detailed \u201cepigenomic\u201d maps that establish that TFL2/LHP1 associates with a subset of Arabidopsis genes that are marked by tri-methylation of Lysine 27 of histone H3. In plants and animals, an evolutionarily conserved complex called PRC2 deposits this mark. In Drosophila and mammals this modified histone is then read by another complex, called PRC1, to maintain the stable repression of genes. In Arabidopsis however, no PRC1 complex exists, and our results provide evidence that TFL2/LHP1 may fulfill a related function.Stable repression of gene expression is an important aspect of the developmental programs of higher organisms. In plants and animals, DNA is organized within chromatin, which contains at its core a set of evolutionarily conserved proteins called histones. These proteins can be modified for example by methylation or acetylation of lysines or phosphorylation of serines. Specific combinations of these histone modifications are interpreted by other chromatin proteins and thereby play essential roles in gene regulation. One such potential effector of the histone code in the flowering plant  Drosophila Enhancer of zeste (E[z]) and Suppressor of zeste 12 (Su[z]12), respectively, two core components of Polycomb repressive complex 2 (PRC2) [Drosophila and mammals, PRC2 catalyzes the tri-methylation of lysine 27 of histone H3 (H3K27me3) of nucleosomes widely located across target developmental genes [Spatial and temporal patterns of gene transcription are central to the developmental programs of plants and animals. Transcriptional repression plays a major role in creating and stabilizing these patterns. In plants, roles for transcriptional repression in reproductive development have been extensively studied. Proteins that repress transcription of genes that promote flowering or confer floral organ identity were identified by analysis of early-flowering mutants, and several of these proteins were predicted to play roles in chromatin regulation \u20137. For e2 (PRC2) \u201310. In Dal genes ,12. Thisal genes , which mal genes .Arabidopsis protein TERMINAL FLOWER 2/LIKE HETEROCHROMATIN PROTEIN 1 (TFL2/LHP1), which was implicated in the repression of flowering and chromatin regulation but is unrelated to known animal PRC1 or PRC2 components [TFL2/LHP1 cause a range of developmental defects, including early flowering, reduced stability of the vernalized state, conversion of the shoot apical meristem to a terminal flower, curled leaves, and reduced root growth [Arabidopsis display constitutively altered glucosinolate levels and are unable to respond appropriately to heat-shock [tfl2/lhp1 mutants results from increased expression of the floral promoter FLOWERING LOCUS T (FT) [tfl2/lhp1 mutants is due to unstable repression of the floral repressor FLOWERING LOCUS C (FLC) [FLC [. Finally, the curled-leaf phenotype of tfl2/lhp1 mutants is correlated with ectopic expression of the floral organ identity genes AGAMOUS (AG) and APETALA3 (AP3) [tfl2/lhp1 seedlings [Here we focus on the mponents ,6,14. Mut growth ,6,14. Inat-shock . The ear C (FLC) ,17, and A3 (AP3) . These reedlings .Arabidopsis protein that shows homology to HETEROCHROMATIN PROTEIN 1 (HP1) of metazoans and S. pombe [Drosophila, HP1\u03b1 and \u03b2 in mammals) are enriched in heterochromatic regions. These HP1 isoforms, which are involved in the formation and maintenance of heterochromatin, but also participate in the regulation of heterochromatic and euchromatic genes, are believed to associate with target sites via the interaction of their chromodomain with di- or tri-methylated lysine 9 residues of Histone 3 (H3K9me2 or 3) [Drosophila and mammalian HP1c/\u03b3 isoforms appear to localize predominantly to euchromatic sites, where they either repress or activate genes through unknown mechanisms [AG, AP3, FT, PISTILLATA (PI), and FLC [TFL2/LHP1 is the only S. pombe ,6, and bS. pombe . As theie2 or 3) \u201324, althe2 or 3) \u201327. In cchanisms . Similarchanisms ,29. Take and FLC ,17,30.Arabidopsis Chromosome 4. We demonstrate that TFL2/LHP1 associates with hundreds of targets across this chromosome, the vast majority of which correspond to genes located within euchromatin. Furthermore, we show that although TFL2/LHP1 binds to H3K9me2, H3K9me3 and H3K27me27 peptides in vitro, in vivo TFL2/LHP1 associates almost exclusively and nearly co-extensively with H3K27me3. Moreover, the absence of noticeable changes in the distribution of H3K27me3 along Chromosome 4 in lhp1 mutant plants indicates that TFL2/LHP1 is not involved in the deposition of this mark. Rather, TFL2/LHP1 specifically associates with H3K27me3 in an in vivo context, indicating that it is involved in a general mechanism of gene regulation mediated by PRC2.In order to gain deeper insight into the nature and chromosome-wide distribution of TFL2/LHP1 target sites and their associated histone marks, we have performed chromatin immunoprecipitation with antibodies that recognize epitope-tagged TFL2/LHP1 and hybridized the precipitated DNA to a DNA tiling array of the entire FT, but not with the WRKY33 gene taken as a negative control  experiments were conducted using transgenic plants expressing a functional HA-tagged version of the protein see . PCR ana control A. This aeviously ,32  was used to categorize genes targeted by TFL2/LHP1 according to their functions. While most categories of \u201cbiological processes\u201d were represented among TFL2/LHP1 targets, several categories were significantly enriched or depleted in comparison to their representation on Chromosome 4 , which are located on other chromosomes but are represented on the tiling array .To analyze the characteristics of TFL2/LHP1 targets further, expression levels were estimated using a comprehensive list of public microarray data compiled at AtGenExpress . Over 802 mutant . Of the S. pombe homologue Clr4, it was originally proposed that TFL2/LHP1 recognizes chromatin marked by dimethylation of histone H3 lysine 9 [Arabidopsis indicating that they are preferentially localized within euchromatin, as is TFL2/LHP1 [By analogy with animal HP1a,b/\u03b1,\u03b2 and the lysine 9 . Howeverlysine 9 ,29,38. TFL2/LHP1 \u201341. The To explore further the interaction between TFL2/LHP1 and chromatin, ChIP-chip analyses were carried out using antibodies specific to these three histone H3 modifications. ChIP-chip performed with antibodies against H3K9me2 demonstrated that this chromatin mark is present almost exclusively over transposable elements and related repeats  and S4. AG (At4g18960) and FT (At1g65480) confirmed the broad and coincidental localization of H3K27me3 over TFL2/LHP1 target genes (Arabidopsis accessions Landsberg erecta and Columbia (data not shown), in which the TFL2/LHP1 and the various histone modifications were mapped, respectively. We conclude therefore that TFL2/LHP1 and H3K27me3 are generally colocalized along the genome, and overlap at more than 85%\u201390% of sites at which they are present. Finally, ChIP-chip analysis of H3K27me3 was also performed in lhp1 mutant seedlings. The H3K27me3 profiles were found to be very similar between wild type and lhp1 ,which is present in the evolutionarily conserved PRC2. Once deposited, this chromatin mark is thought to be recognized by PRC1, which maintains transcriptional repression by still-unknown mechanisms. The recognition of H3K27me3 by PRC1 is believed to occur via the chromodomain of the Polycomb protein, based on in vitro studies [In  studies . HoweverE(z) homologues in Arabidopsis, CLF, SWINGER (SWN), and MEA, reduces H3K27me3 levels at PRC2 target genes, demonstrating that PRC2 generates the same chromatin mark in plants and animals [clf mutants show a curled-leaf phenotype similar to tfl2/lhp1 as well as ectopic expression of AG and AP3 [tfl2/lhp1, although these defects are considerably enhanced in some PRC2 mutants. For example, VERNALIZATION 2 (VRN2) and EMF2, which are homologues of the PRC2 component Su(z)12 in animals, also control processes regulated by TFL2/LHP1. VRN2 is critical for the maintenance of transcriptional repression of FLC after vernalization [FLC [FLC expression also requires TFL2/LHP1 [FLC following vernalization [tfl2/lhp1 mutants compared to mutants in which PRC2 function is affected. Furthermore, tfl2/lhp1 mutants lack fertilization or seed development defects [fertilization independent endosperm (fie), fertilization independent seed 2 (fis2), and mea [Recent reports have shown that mutations in one of the three genes encoding  animals ,44\u201347. T and AP3 . Mutatiolization  and leadion [FLC ,44. StabFL2/LHP1 ,17. By alization . In othe defects ,6,14, wh and mea . These d and mea .Drosophila Polycomb recognizes H3K27me3, the chromodomains of Drosophila and mouse HP1 proteins have low affinity for H3K27me3 peptides and bind to H3K9me2 and H3K9me3 [While the chromodomain of  H3K9me3 \u201354. Howe H3K9me3 . SimilarDrosophila PRC1, although here, deposition of the mark appears to be a downstream event of H3K27 trimethylation [tfl2 and that some mutants of PRC2 have more severe phenotypes than tfl2/lhp1 mutants, since loss of TFL2/LHP1 function could be buffered by other members of the complex [If TFL2/LHP1 takes the place of Polycomb in a plant-specific complex functionally related to PRC1 of animals, other proteins present in this complex may provide additional affinity to H3K27me3. Alternatively, a second, yet unidentified chromatin mark could codistribute with H3K27me3 and be specifically recognized by other proteins that are part of the complex. Likewise, the ubiquitination mark of H2A lysine 119 is recognized by the hylation \u201358. Both complex .Arabidopsis connecting TFL2/LHP1 to any of the SUV(39)1/2 histone methyltransferases [lhp1, single mutants of the ten Arabidopsis homologs of SUV(39)1/2 do not interfere with the stable repression of FLC after vernalization [Arabidopsis SUV(39)1/2 homologs has not been excluded. Nevertheless, suvh4 and suvh2 single mutants affect gene silencing [PAI1 gene silencing is SUVH4 dependent but does not require a functional TFL2/LHP1 [As HP1, TFL2/LHP1 probably recruits accessory repressive proteins via an interaction with its chromo-shadow domain. One of the best characterized interaction partners of HP1 is the SUV39)1/2 histone methyltransferase ,28. Intesferases . In contlization . Howeverilencing ,39 and P1/2 histoFL2/LHP1 .FLC gene, which is silenced during vernalization [FLC is stably repressed only in plants exposed to vernalization, and TFL2/LHP1 might interact with H3K9me2 and H3K9me3 only under specialized conditions such as these.A connection between transcriptional repression, TFL2/LHP1 recruitment, and di- as well as trimethylation of H3K9 and H3K27, was previously suggested for the lization ,17,60. TArabidopsis genes are associated with some degree of DNA methylation [Finally, although 20%\u201330% of hylation \u201363, we fhylation ,63.Drosophila, repression by Polycomb group proteins occurs through their association with specific DNA sequences. These Polycomb response elements (PREs) include many conserved short motifs, but exhibit no overall sequence similarity [Drosophila, H3K27me3 methylation extends well beyond these PREs, whereas binding of most PRC2 and PRC1 components, with the notable exception of Polycomb, is restricted to the PREs themselves. In mammals however, no PRE has been identified and PRC1 and PRC2 binding extends over larger regions, leaving open the possibility that Polycomb group proteins are recruited by a different mechanism [Drosophila in this respect remains to be determined. Interestingly, TFL2/LHP1 binding and H3K27me3 marking were often more pronounced around the proximal promoter and 5\u2032 coding region of target genes  accession. The 35S::TFL2/LHP1:HA construct used in this study complements the tfl2/lhp1 mutation, indicating that the addition of the HA epitope does not impair functionality of the protein. Of 22 scored T1 plants, six showed a wild-type growth habit, 15 showed intermediate phenotypes between wild type and tfl2 and only one showed the terminal flower phenotype. Wild-type and lhp1\u20131 mutant plants used for the ChIP-chip analysis of histone H3 methylation marks were of the Columbia (Col) accession. The lhp1\u20131 mutation was originally isolated in the Wassilewskija accession [TFL2/LHP1:HA C-terminal fusion gene was generated by amplifying a full-length TFL2/LHP1 cDNA with primers TFL2_HA_F, 5\u2032-CCATGAAAGGGGCAAGTGGTGCT-3\u2032 and TFL2_HA_R, 5\u2032-CATTAAGTAGTGGGAGAGTCACCGG-3\u2032 that were flanked by Gateway recombination sites, and by recombining the PCR product into a Gateway entry clone . The TFL2/LHP1 cDNA was then recombined into a modified pJawohl binary destination vector to produce 35S::TFL2/LHP1:HA. Transformation was carried out as described [TFL2/LHP1:HA transgenic plants were produced in the Landsberg escribed .http://www.sigmaaldrich.com), anti-H3K9me2 , anti-H3K9me3 , and anti-H3K27me3 . Primers used for ChIP-PCR are described in er, which carries a 1.5-kb deletion compared with the publicly available Col sequence, has been deposited at EMBL. No signal was detected in mock-antibody precipitations, whereas a weak signal was found in nontarget regions. Since the background bands are at the limit of detection for quantitative PCR and the more sensitive end-point PCR analysis, we expressed our ChIP results as percentage of input fraction and not as fold-enrichment over negative controls. Quantitative PCR values were obtained by averaging results of at least two independent experiments. Note that no significant difference in H3K27me3 distribution was observed between untransformed and 35S::TFL2/LHP1:HA transgenic seedlings, indicating that overexpression of TFL2/LHP1:HA does not affect H3K27me3 distribution  and directly from input chromatin (INPUT) was differentially labeled and hybridized in classical dye-swap experiments to correct dye biases, as previously described [ChIP-chip analyses of TFL2/LHP1:HA and the three histone marks H3K9me2, H3K9me3, and H3K27me3 were performed on two biological replicates, except for that of H3K27me3 in the escribed . Arrays ijY be the signal of the sample labeled with the dye j on the array i. Given that the second array is a technical replicate of the first one, the distribution of Y21 (respectively Y22) should be close to that of Y12 (respectively Y11). In practice, the relationship between Y21 and Y12 is linear but it is not the identity function. The parameters of the two linear models are estimated by Y21 = a + bY12 + N and Y22 = c + dY11 + N, and these estimates are used to define the normalized IP and INPUT values of the second array relative to the first one: Y21 = (Y21 \u2013 a)/b and Y22 = (Y22 \u2013c)/d. For each sample and for each tile, the values of the two arrays of the dye-swap are then averaged.Since the INPUT and IP samples differ substantially, array-by-array normalization such as loess cannot be applied. Instead, normalization between arrays was performed based on the properties of dye-swaps to remove technical biases. Let For each dye-swap, IP/INPUT ratios were analyzed using a two-step procedure, as follows see also . First, In a second step, all IP values above the hybridization threshold were retrieved from the list of ~21000 IP values in order to analyze the corresponding IP/INPUT ratios. To define so-called \u201cenriched\u201d tiles, a similar procedure based on mixture models was used. Given that the Chromosome 4 tiling array contains both unique and repeated sequences, the unavoidable carry over of total genomic DNA leads to possible significant IP values for these sequences. As a matter of fact, most selected models contained two or three components, and the component with the lowest mean was found to correspond mainly to tiles with highly repeated sequences. When the selected model is a mixture with two well-separated components, tiles classified in the component of greatest mean according to the MAP rule are declared enriched. When the number of components is three, we note that the two components with the lowest means are well separated from the last. As above, tiles classified in the component of greatest mean according to the MAP rule are declared enriched. In the case of the model with four components , the component with the second-lowest mean is fully included within the component with the lowest mean. Tiles classified in the two components of greatest means according to the MAP rule are declared enriched .Lists of tiles with IP/INPUT ratios reporting significant enrichment were compared between biological replicates . Overlaphttp://www.promega.com) with the Gateway cassette cloned in the XbaI restriction site . This plasmid allows in vitro transcription of TFL2/LHP1 by the T7 polymerase. Plasmid DNA (1 \u03bcg) was transcribed and the resulting RNA translated using the TNT Quick Coupled kit  following the manufacturer's instructions. For peptide pull-down assays, 50 ng of biotinylated histone H3 peptides, that were either methylated on K27 , methylated on K9, or unmethylated  were incubated with 10 \u03bcl of Dynabeads M-280 Streptavidin  in PBS for 2 h at 4 \u00b0C and blocked with 0.25% BSA in PBS for 30 min. The beads were washed three times with binding buffer  containing 200 mM KCl and mixed with 5 \u03bcl of in vitro translated protein and 100 \u03bcl of binding buffer for 60 min at 4 \u00b0C. After washing five times with binding buffer containing 500 mM KCl, the bound proteins were eluted in SDS loading buffer, resolved by SDS-PAGE, and visualized using a phosphorimager.The TFL2/LHP1 cDNA was recombined into a pTNT vector Click here for additional data file.Figure S2The entire set of epigenomic maps that was produced in this work is presented in consecutive 1-Mb panels. Biological replicates are shown below each other. IP/INPUT ratios (log2) reporting significant association are marked in dark colors.(4.4 MB PDF)Click here for additional data file.Figure S3PCR was carried out on ChIP samples obtained with anti-H3K27me3 antibodies, using 23 different primer pairs. IP/INPUT ratios are plotted against each other. The data show that over-expression TFL2/LHP1 does not affect H3K27me3 distribution.(46 KB PDF)Click here for additional data file.Figure S4ChIP-PCR was carried out based on 33 randomly selected tiles that showed by ChIP-chip either no association with TFL2/LHP1 and H3K27me3, or association with both. Fifteen out of the 17 tiles declared \u201cnegative\u201d and 13 out of 16 tiles declared \u201cpositive\u201d by ChIP-chip were validated by PCR in independent ChIP experiments. Except in one case, discrepancies between ChIP-chip and ChIP-PCR concerned tiles with IP/INPUT values in the ChIP-chip analysis of TFL2/LHP1and H3K27me3 that were just below or above the positive/negative thresholds.(65 KB PDF)Click here for additional data file.Table S1(239 KB XLS)Click here for additional data file.Table S2(61 KB XLS)Click here for additional data file.Table S3(335 KB XLS)Click here for additional data file.Table S4(53 KB XLS)Click here for additional data file.Table S5(389 KB XLS)Click here for additional data file.Table S6(91 KB XLS)Click here for additional data file.Table S7(681 KB XLS)Click here for additional data file.Table S8(165 KB XLS)Click here for additional data file.Table S9(32 KB DOC)Click here for additional data file.Table S10(30 KB XLS)Click here for additional data file.Table S11(27 KB DOC)Click here for additional data file.http://www.ebi.ac.uk/arrayexpress) data discussed in this paper are A-MEXP-602, array design and E-MEXP-951, experimental data.Accession numbers for the ArrayExpress (http://www.ebi.ac.uk/embl) accession number for the FT promoter sequence in Ler is AM492685.The European Molecular Biology Laboratory database (EMBL) (http://dynagen.ijm.jussieu.fr/research/tools/repet/gbrowse/arabidopsis.A browser-based interface to the data is available at the following website:"}
+{"text": "When a 52-year-old Missouri woman approached physicians in 1998 complaining of stiffness and pain in her spine, the symptoms were at first attributed to \u201cdisc disease.\u201d But a series of laboratory tests showed that the woman had abnormally thick, dense bones and strikingly high levels of fluoride in her urine\u2014hallmarks of skeletal fluorosis, a disease that has been diagnosed only a handful of times in the United States.The only way to develop skeletal fluorosis is to ingest or inhale too much fluoride. The woman\u2019s drinking water had only about 2.8 parts per million (ppm) fluoride, well below the Environmental Protection Agency (EPA) limit of 4.0 ppm. Other sources of fluoride were also eliminated: She didn\u2019t swallow her toothpaste, she didn\u2019t work with pesticides, and she didn\u2019t live near a mine. So where was she getting all the fluoride?Then the woman revealed she had drunk up to two gallons of extra-strength instant tea every day of her adult life. Physician Michael Whyte of Washington University School of Medicine and his colleagues decided to measure the fluoride levels in her tea preparation.They found that, counting the fluoride in her water, the woman was ingesting 37\u201374 milligrams of fluoride per day. EPA studies suggest that severe skeletal fluorosis could occur over the course of 20 years from a continuous exposure of 20 milligrams of fluoride per day.The American Journal of Medicine.Whyte and colleagues then tested 10 instant teas available in grocery stores. They found average fluoride concentrations of 1.0\u20136.5 ppm in regular-strength tea made with fluoride-free water, with several brands exceeding the Food and Drug Administration limit of 1.4\u20132.4 ppm for bottled beverages. Their study appears in the January 2005 issue of Whyte believes that individuals who drink large volumes of instant tea for a prolonged period may be putting themselves at risk for skeletal fluorosis. But Joe Simrany, president of The Tea Association of the USA, believes that the Missouri incident was highly unusual. \u201cIt had less to do with tea than it had to do with excessive behavior,\u201d he says.So should the average tea drinker be concerned? \u201cIt may be that certain brands ought to cut down the amount of fluoride in their tea or add a warning label to their product,\u201d says Michael Kleerekoper, director of research for bone and mineral metabolism at Wayne State University, \u201cbut it would be a real mistake to throw out the baby with the bathwater.\u201d He adds, \u201cI drink tea\u2014it\u2019s wonderful on a hot summer\u2019s afternoon.\u201dWhyte, who also hasn\u2019t stopped drinking tea, says, \u201cOur research is a call for better understanding of fluoride levels in various teas.\u201d He is now investigating the fluoride levels of bottled tea preparations.Meanwhile, the woman in Missouri has stopped drinking tea, and her pains have abated. She has since switched to lemonade."}
+{"text": "Epidermal growth factor receptors (EGFr) were measured using a radioligand binding assay, in membrane preparations from 51 human non-small cell lung cancers and in normal tissue of the same patients. The binding characteristics of EGFr were similar in tumour and normal lung membranes (range of dissociation constant of high affinity sites: 0.1-0.6 nM). However, the concentrations in tumours  were significantly higher than in normal tissues . The receptor levels in normal tissue were normally distributed. It was therefore possible to define a normal/pathologic cut-off level (12.9 fmol mg-1 of protein). In 57% of cases EGFr in cancer was higher than the cut-off. No relationships were found between receptor concentrations and positivity rates of EGFr and histology, stage, lymph node positivity and pT. A trend for a direct relation between receptor positivity and grading was found."}
+{"text": "Synthesis of cationic hydrous thorium dioxide colloids (ca. 1.0 to 1.7 nm) has been originally described by M\u00fcller  and GrooPseudomonas aeruginosa adjacent cell wall biopolymers. For the first time thorificated biopolymers, i.e. bacterial outer cell wall layers, have been analysed at the ultrastructural level with electron energy loss spectroscopy (EELS) and electron spectroscopic imaging (ESI), leading to excellent contrast and signal strength for these extracellular biopolymers.Synthesis of colloidal thorium dioxide has been modified and its use as a suitable stain of acidic mucopolysaccharides and other anionic biopolymers from bacteria, either as whole mount preparations or as preembedment labels, is described. The differences in stain behavior relative to commonly used rutheniumred-lysine and Alcian Blue\u2122 electron dense acidic stains has been investigated and its use is exemplified for 2 colloids for tracing acidic groups of the bacterial surface and/or EPS has been shown to be rather effective by transmission electron microscopy. Because of its high electron density and its good diffusibility it stains and outlines electro-negative charges within these biopolymers. In combination with ESI, based on integrated energy-filtered electron microscopy (EFTEM) Th-densities and thus negative charge densities can be discriminated from other elemental densities, especially in environmental samples, such as biofilms.Application of cationic hydrous ThO Capsular and slime matrices of pathogenic bacteria play an important role in host defense and the immune response. In particular the significance of neutral and/or acidic EPS in biofilms, either 'in vitro' or 'ex vitro', is known ,3. In thThe use of colloidal thorium dioxide, i.e. Thorotrast\u2122, as a high density stain for transmission electron microscopy began in the 1950s when colloids of 7 nm  were maiThe usage of thorium dioxide as a stain of acidic mucopolysaccharides of bacteria and microorganisms, however, was only seldomly applied, either as pre-embedding or post-embedding label ,34. Sinc10 years)[The high binding strength and nearly quantitative binding of thorium(IV) to acidic biopolymers, especially those of the so-called particulate organic carbon (POC) in marine waters, has been known for a long time. Thus Th234 with its short half-life of 24 days, derived from the natural decay of uranium, has been used for global carbon flux measurements in the open oceans, based on the Th234/Th232 isotope ratio . Actual E.coli and Pseudomonas aeruginosa by thorium dioxide and compare these with those from staining with ruthenium red or AlcianBlue\u2122. Further high resolution thorium using EFTEM is presented. These experiments show thorium dioxide is a favorable alternative in contrasting acidic biomatrices relative to ruthenium red or AlcianBlue\u2122.In the present paper we describe the preparation of cationic colloidal hydrous thorium dioxide, based on modified methods from M\u00fcller  and Groo2 precipitate Dzimitrovicz et al. [2 \u00d7 H2O(am) by alkaline precipitation with carbonate-free NaOH from thorium nitrate solution. They found the dried powder was amorphous, as X-ray powder diffraction patterns did not reveal any peaks or broadened bands, which is contradictory to the measurements of Dzimitrowicz et al. [2 by gravimetric measurements after drying the sample at 800\u00b0C.Some useful modifications, detailed below, have been introduced for the preparation of thorium dioxide by M\u00fcller  and Grooz et al.  describez et al.  preparedz et al. . Rothe ez et al.  assumed 4(am) [2 \u00d7 H2O(am) [2 [In general, the alkaline precipitate is considered to be a hydroxide sol, with a formula of either Th(OH)4(am) ,19 or Th H2O(am) ,9,24. ThO(am) [2 . M\u00fcller O(am) [2  has showEscherichia coli cells showed distinct binding to negatively charged ligands, either directly associated with the cell surface or with peripheral amorphous slime  is shown in figure Pseudomonas aeruginosa biofilms, the intensely stained outer layer has been supposed to represent the B-band O-antigens of the lipopolysaccharide (LPS) layer, which is known to contain \u03b3-D-mannuronic acid in substantial amounts [The difference in staining of the outer wall-layers of  amounts ,15.In contrast this LPS-layer is only poorly stained by RRL, when method 2 of the Fassel-Edmiston protocol ,8 was apSince no additional stain has been used during the embedding treatment with thorium dioxide all inner cellular biomatrices are visible from their own intrinsic contrast, based solely on mass thickness and elemental composition. In combination with EFTEM distinct ultrastructural features can be visualized either in the elastic bright-field view at 0 eV energy loss, termed 'zero-loss imaging' or 'high-contrast imaging' at 250 eV, revealing ultrastructures at high resolution with reversed intensities, similar to a dark-field view (data not shown). As shown here, zero-loss imaging by EFTEM renders the outer and cytoplasmic membrane as faint lines fig. .The use of thorium dioxide is rather effective in tracing negatively charged surfaces or biomatrices with nearly a comparable diffusibility as non-colloidal, amorphous stain solutions. Therefore the corresponding charge densities found in images from thorium dioxide staining may correlate with grey level intensities of micrographs of zero-loss images. This is shown in different electron dense labels of LPS and EPS clusters in fig. Synthesis of cationic hydrous colloidal thorium dioxide has been modified from former recipes and is described in detail. Its usage as an effective staining agent in transmission electron microscopy of acidic and negative groups of bacterial extracellular matrices has been reevaluated, both for preembedding treatment and 'whole mount' preparations. Its contrasting potency as a 1.5 nm particulate stain has been compaired with AlcianBlue\u2122 and rutheniumred, which are commonly used to stain acidic mucopolysaccharides. The staining protocol is straight forward and as a 'one-component' stain there is minimum interference in contrast with other sample inherent elements, especially those in environmental probes. Charge densities appear directly modulated as corresponding grey values and are effectively traced as high resolution thorium-maps by energy-filtered transmission electron microscopy.4OH led to intense turbidity at pH = 4.0 and a further 0.4 ml of NH4OH quantitatively precipitated the thorium-hydroxide at a final pH = 11.0. The milky suspension was concentrated under slight vacuum over filter paper  in a flat funnel and residual electrolytes were rigorously removed by washing with 100 to 150 ml reverse-phase osmophoresed water until no further ammoniac was evident. Thorium hydroxide was transfered to a 100 ml Erlenmeyer-flask by the aid of a spatulum. Residual precipitate was washed with 5 to 8 ml water and added to the bulk.4. In general a 50 % (w/v) colloidal ThO2 solution was obtained with a pH of 2.0 to 2.5. On analysis by electron microscopy, thorium dioxide appeared monodispersed and showed a particle size, ranging from 1.0 to 1.7 nm in diameter. It could be stored in a refrigerator at 4\u00b0C for two years or even longer without loss of the colloidal state and charge properties.The slurry hydroxide was stirred and brought to boil under reflux. After 5 minutes 0.2 ml of thorium nitrate solution (20 % w/v) was added. This 'reflux-boiling' for 5 minutes was always performed, when 0.2 ml thorium nitrate aliquots had been added to the slurry. When a further 2 \u00d7 0.2 ml thorium nitrate had been added the solution clarified. Addition of a further 2 \u00d7 0.2 ml thorium nitrate led to slight re-turbification. A final addition of 0.2 ml thorium nitrate did not cause an increase in turbidity and this opalescent solution defined the final state of thorium dioxide. On the whole 1.2 to 1.6 ml of 20 % thorium nitrate were sufficient for thorium hydroxide peptization. The final volume was measured and the corresponding concentration of thorium dioxide was calculated relative to the original amount of Th at an OD590 nm = 0.600 were sedimented at 7500 rpm  for 4 minutes at ambient temperature. Cells were resuspended in 1.0 ml of 1.8 % (v/v) formaldehyde \u2013 10 mM Hepes, pH 7.1 and fixed for 15 minutes at ambient temperature, cells were again sedimented for 3 minutes and resuspended in 1.5 ml of 0.04 % (w/v) thorium dioxide, pH 3.0. Cells were subsequently incubated for 30 minutes at ambient temperature. Labelled cells were washed twice and finally resuspended in 200 \u03bcl 10 mM Hepes, pH 7.1.Mid-logarithmically growing cells (4.0 ml) of Pseudomonas aeruginosa, clinical strain PAO1 (NCCB 2425), were fixed with 2.5 %(v/v) glutardialdehyde \u2013 20 mM Hepes, pH 7.0 for 2 hours or several days at ambient temperature. Cells were washed twice in 100 mM sodiumacetate, pH 3.0 for 15 minutes and then were labelled with 0.4 % (w/v) thorium dioxide in 100 mM sodium-acetate, pH 3.0 for 2 hours at ambient temperature or at 4\u00b0C over night. Labelled cells were washed once for 2 minutes at ambient temperature in 50 mM Hepes, pH 7.2 and then were immobilized in 2% aqueous agar. Immobilized bacteria were dehydrated in an acetone-series and were embedded in epoxy resin according to Spurr [Mid-logarithmically growing cells of to Spurr .Pseudomonas aeruginosa mid-logarithmically growing cells were prefixed with 2.5 % (v/v) glutardialdehyde in 10 mM Hepes, pH 7.2 after immobilization in aqueous 1% (w/v) agar, and were treated with AlcianBlue\u2122 by aid of a microwave oven as described by Moorlag et al. [g et al. .Pseudomonas aeruginosa mid-logarithmically growing cells were treated for staining and embedding as described by Fassel and Edmiston [Edmiston .Thorium dioxide labelled cells were adsorbed for 2 minutes at carbon-Formvar (thickness: 60 nm to 90 nm) coated 300 mesh Cu-grids and were intensely blotted with filter paper  and air-dried. Transmission electron microscopy and EELS analysis were performed with a Zeiss CEM902. Recording of thorium maps by ESI was performed according to the 'Three-Window-Power-Law' method  with an energy slit-width of 24 eV and an objective aperture of 6 mrad (= 30 \u03bcm). PEELS were recorded in an energy range from 40.0 to 140.0 eV. Element maps and PEELS were recorded with a cooled 1024 \u00d7 1024 CCD camera .Ultrathin sections (90 nm) were produced and analyzed by transmission electron microscopy as is described in detail by L\u00fcnsdorf et al. . ThoriumEPS: extracellular polymeric substances; EFTEM: Energy-filtered transmission electron microscopy; EELS: electron energy loss spectroscopy; PEELS: parallel EELS; ESI: electron spectroscopic imaging;IK and EB performed the synthesis of thorium dioxide and its application for transmission electron microscopy. HL designed the experiments, performed EFTEM-analysis and wrote the manuscript."}
+{"text": "Skin toxicity is a common side effect of radiotherapy for solid tumors. Its management can cause treatment gaps and thus can impair cancer treatment. At present, in many countries no standard recommendation for treatment of skin during radiotherapy exists. In this study, we explored the effect of topically-applied tea extracts on the duration of radiation-induced skin toxicity. We investigated the underlying molecular mechanisms and compared effects of tea extracts with the effects of epigallocatechin-gallate, the proposed most-active moiety of green tea.2 release from human monocytes. Effects of tea extracts on 26S proteasome function were assessed. NF-\u03baB activity was monitored by EMSAs. Viability and radiation response of macrophages after exposure to tea extracts was measured by MTT assays.Data from 60 patients with cancer of the head and neck or pelvic region topically treated with green or black tea extracts were analyzed retrospectively. Tea extracts were compared for their ability to modulate IL-1\u03b2, IL-6, IL-8, TNF\u03b1 and PGETea extracts supported the restitution of skin integrity. Tea extracts inhibited proteasome function and suppressed cytokine release. NF-\u03baB activity was altered by tea extracts in a complex, caspase-dependent manner, which differed from the effects of epigallocatechin-gallate. Additionally, both tea extracts, as well as epigallocatechin-gallate, slightly protected macrophages from ionizing radiationTea extracts are an efficient, broadly available treatment option for patients suffering from acute radiation-induced skin toxicity. The molecular mechanisms underlying the beneficial effects are complex, and most likely not exclusively dependent on effects of tea polyphenols such as epigallocatechin-gallate. Skin toxicity is a common side effect of external beam radiotherapy in patients suffering from solid cancers. Radiation technique has improved dramatically with the introduction of linear accelerators, thereby reducing skin toxicity. However, current treatment concepts often include radiation dose escalation to improve tumor control, thereby surpassing normal tissue tolerance doses. This often leads to the occurrence of moist skin desquamation (RTOG grade \u2265 2 skin toxicity) , which cPatients with grade 2+ skin toxicity mostly suffer from skin disintegrity and symptoms caused by inflammation in the irradiated areas. Radiation-induced inflammation is mainly caused by activation of NF-\u03baB, a preformed dimeric transcription factor sequestered in the cytosol by its inhibitor molecules of the I\u03baB-family. Following ionizing irradiation, I\u03baB-kinases become activated and phosphorylate I\u03baB at specific serine sites. This tags I\u03baB for poly-ubiquitination and subsequent degradation through the 26S proteasome , a multiDegradation of I\u03baB frees NF-\u03baB for translocation into the nucleus, where it binds to specific consensus sequences in promoter regions of NF-\u03baB-dependent genes to initiate transcription of pro-inflammatory cytokines .Tea extracts are known to terminate inflammatory conditions, and its usage has been reported to prevent skin damage caused by UV irradiation . There aIn the present study, we analyzed the efficacy of our standard skin care program containing topically-applied black or green tea extracts on the duration of grade 2+ skin toxicity during radiation therapy. We found green tea extracts to be superior to black tea extracts in the treatment of radiation-induced skin toxicity. Investigating the underlying molecular mechanisms to understand how tea extracts help to restore skin integrity, we observed that whole tea extracts altered DNA-binding of the transcription factor NF-\u03baB in a complex manner, different from that seen after EGCG treatment.Data from 60 inpatients experiencing skin toxicity RTOG score grade 2 and higher (grade 2+) during radiotherapy at the Department of Radiation Oncology, University Hospital Freiburg, Germany, were assessed retrospectively. All patients received our standard skin care program, which consisted of once-daily treatment of irradiated skin areas with a moisturizing cr\u00e8me  starting at day one of radiation treatment . Frequency of application was increased to twice or three times daily if a radiation-induced erythema occurred, and stopped with the occurrence of moist desquamation. Irradiated skin areas with grade 2+ lesions were treated three times daily with either green or black tea preparations for 10 minutes from the first day moist desquamation was observed. Skin toxicity was scored by nurses on a daily basis before every application of tea extracts. Treatment with tea extracts was discontinued immediately after the disappearance of moist desquamation. Nine patients  were released from the hospital with persisting grade 2+ skin toxicity. These patients were censored and the dataset was analyzed for the duration of skin toxicity grade 2+ using the Kaplan-Meier-Method. A p-value \u2264 0.05 (log-rank test) was considered statistically significant. The study was approved by the local ethics board of the University Hospital Freiburg, Germany.2 flasks (Greiner) at 37\u00b0C in a humidified atmosphere at 5% CO2 in DMEM medium , supplemented with 10% heat-inactivated FCS and 1% penicillin/streptomycin (Sigma).Cultures of RAW 264.7 murine macrophages  and MCF-7 breast cancer cells  were grown in 75 cm6 cells/well) and incubated at 37\u00b0C/5% CO2. The medium and the non-adherent cells (lymphocytes) were removed and fresh RPMI-1640 medium containing 1% human serum was added.Monocytes from healthy human donors were prepared following a standardised protocol  using a completely endotoxin-free cultivation ,11. UsinTwo tea bags (1.5 g each) tea were covered with 50 ml Millipore water  for five minutes. The resulting extracts were passed through a 0.8 \u03bcM and a 0.22 \u03bcM filter to free the extracts from insoluble material. Small aliquots were stored until usage at -20\u00b0C in the dark. Given a estimated total catechin content of 10\u201340 mg/g for green tea , tea pre137Cs-laboratory irradiator  at a dose rate of 0.78 Gy/min. Control cells were sham-irradiated.Exponentially-growing RAW 264.7 murine macrophages were irradiated at room temperature using a Approximately 10,000 RAW 264.7 murine macrophages per well were plated into 96-well plates in 100 \u03bcl RPMI medium per well. After 24 h, tea extracts were added to the media. Three hours later, the cells were irradiated with 0, 2, 4, 6, and 8 Gy. After five days, 20 \u03bcl MTT (5 mg/ml) was added to each well and cells were subsequently incubated for four hours at 37\u00b0C. Fifty microliters of a 20% SDS solution (0.02 N HCL) was added to each well and absorbance at 560 nm was measured after overnight incubation at 37\u00b0C .2, 2 mM ATP), and pelleted by centrifugation . Glass beads and homogenization buffer  were added and cells were vortexed for 1 min. Beads and cell debris were removed by centrifugation at 1,000 \u00d7 g for 5 min and 10,000 \u00d7 g for 20 min at 4\u00b0C. Protein concentration was determined by the Micro BCA protocol (Pierce) with BSA (Sigma) as standard. To measure 26 S proteasome activity, 10 \u03bcg protein of crude cellular extracts or 1 \u03bcg protein of partially purified proteasomes of each sample was diluted with buffer I to a final volume of 200 \u03bcl. The fluorogenic proteasome substrate SucLLVY-MCA  was dissolved in DMSO and added in a final concentration of 80 \u03bcM in 1% DMSO. Proteolytic activity was continuously monitored by measuring the release of the fluorescent group 7-amido-4-methylcoumarin (AMC) in a fluorescence plate reader  at 380/460 nm.Proteasome function was measured as described previously  with somg for 5 min at 4\u00b0C. Protein concentration was determined using the BCA protocol (Pierce) and bovine serum albumin  as standard. Fifteen micrograms of protein from the resulting supernatant was incubated for 25 minutes at room temperature with 2 \u03bcl BSA (10 \u03bcg/\u03bcl), 2 \u03bcl dIdC (1 \u03bcg/\u03bcl), 4 \u03bcl Ficoll-buffer , 2 \u03bcl buffer D+  and 1 \u03bcl of the [\u03b332P]-ATP labeled oligonucleotide . For a negative control, unlabeled oligonucleotide was added in 50-fold excess. Gel analysis was carried out in native 4% acrylamide/0.5% TBE gels. Dried gels were placed on a phosphor screen for 24 hours and analyzed on a phosphor imager .For preparation of total cytosolic extracts, cells were dislodged mechanically, washed with ice-cold PBS and lysed in TOTEX-buffer  for 30 minutes on ice. Lysate was centrifuged at 12,000 \u00d7 2 release, cells were preincubated with the green and black tea solutions in the indicated concentrations for 30 min before stimulation with LPS (10 ng/ml) for additional 24 h. After culture supernatants were harvested and centrifuged for 10 min at 10,000 \u00d7 g, levels of the cytokines or PGE2 in the supernatant were measured by ELISA  or EIA  according to the manufacturer's instructions. All experiments were carried out in triplicates using two-sided student's t-test for statistical analysis .For the analysis of IL-6, TNF-\u03b1, IL-1-\u03b2, IL-8 and PGEDuring curative-intended radiation treatment of solid cancer, many patients experience grade 2+ skin toxicity, which can cause treatment gaps and thus limit the curability of the cancer. Tea extracts have been applied in our department empirically to terminate acute skin reactions during radiation therapy, but their use has not been investigated systematically to date. In the present study, 60 patients treated with radiation therapy received our standard skin care program. Demographics of all patients are shown in Table 2 secretion in to the media. While both extracts showed clear anti-inflammatory activity, this inhibitory effect was more pronounced in green tea extracts reflecting the higher efficiency of green tea in the clinical study , 9.9% \u00b1 1.3 at 1% . Green tea extracts at concentrations of 2% and higher completely inhibited chymotryptic 26S proteasome activity.Extracts from black tea were even more effective. Concentrations of 0.5 % strongly inhibited chymotryptic 26S proteasome activity to 8% \u00b1 1.1  of untreated controls. No remaining activity was detected at 1% or 0.5%. Comparable results were found for the peptidyl-glutamyl 26S proteasome activity  did not have a significant cytotoxic effect while black tea extracts (0.4%) significantly decreased viability to 73.6% \u00b1 8  of untreated control cells. Concentrations of 0.04% of either green tea or black tea had no toxic effect. Additionally, EGCG (40 \u03bcM), green tea extracts (0.4%) and black tea extracts (0.4%) caused a slight radioprotection Figure .in-vitro models we demonstrated that tea extracts attenuated the release of pro-inflammatory cytokines and terminated pro-inflammatory signaling by caspase-dependent and caspase-independent mechanisms.In this study, we showed that a skin care program containing topically-applied tea extracts for radiation-induced grade 2+ skin lesions helped to restore skin integrity. Data on the duration of grade 2+ skin toxicity is very rare in the literature. However, green tea extracts in our study appeared to be an efficient treatment as a previous study reported duration of skin toxicity to be 22 days for anal carcinomas and 26 days for head and neck cancers . Using irima ani, and these lesions are prone to bacterial superinfections. Green tea is known for its comparably higher content of polyphenols [S. aureus [In patients with cancer of the pelvic region, in the majority treated with radiochemotherapy, green tea preparations were significantly more effective than extracts from black tea in decreasing the duration of grade 2+ skin toxicity. A possible explanation for the superiority of green tea in patients with cancer of the pelvic region might be the fact that most of these patients suffered from anal carcinomas. By the size, location, and shape of the radiation fields, treatment of anal carcinoma often induces grade 2+ skin toxicity in the inguinal regions and the yphenols , which e. aureus , often fin-vitro and caused a significant decrease in the release of the pro-inflammatory cytokines IL-1\u03b2, IL-6, IL-8, TNF\u03b1 and PGE2 in our experimental system.One of the leading symptoms of radiation-induced dermatitis is inflammation, a major cause of discomfort for patients undergoing radiotherapy. This makes the involved molecular pro-inflammatory pathways a reasonable target for supportive care. Inhibition of the proteasome \u2013 a key regulator of inflammation \u2013 by tea polyphenols has been reported earlier . In accoIn addition to their proteasome inhibiting properties, tea polyphenols and theaflavins have been shown to modulate NF-\u03baB activity through the p38 MAPK pathway and direct inhibition of I\u03baB kinases ,19. Our Previously, EGCG has been shown to protect from ionizing radiation, chemotherapy and UV radiation -27. In oTaken together, our retrospective analysis of clinical data showed that topically-applied green tea extracts were clinically efficacious in the treatment of grade 2+ skin toxicity during radiation therapy. However, the underlying mechanisms are most likely complex and involve antibacterial and anti-inflammatory processes. Our in-vitro data indicate that these mechanisms involve several different pathways, some of which might be dependent on tea compounds other than polyphenols.We conclude that tea extracts are efficient means to treat radiation-induced skin toxicity. Understanding the underlying molecular mechanisms in the future may establish tea extracts as a cheap and broadly available treatment for skin toxicity caused by ionizing radiation in industrial as well as developing countries during clinical radiotherapy and in case of accidents involving ionizing radiation.The author(s) declare that they have no competing interests.FP conceived the study, analyzed the data, and drafted the manuscript. AR conducted the biological studies and participated in drafting the manuscript. MH and WH participated in the design of the study and drafting the manuscript. BF conducted the biological studies and participated in drafting the manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Shewanella oneidensis MR-1 and Geobacter sulfurreducens have developed electron transfer (ET) strategies that require multihaem c-type cytochromes (c-Cyts). In S. oneidensis MR-1, multihaem c-Cyts CymA and MtrA are believed to transfer electrons from the inner membrane quinone/quinol pool through the periplasm to the outer membrane. The type II secretion system of S. oneidensis MR-1 has been implicated in the reduction of metal (hydr)oxides, most likely by translocating decahaem c-Cyts MtrC and OmcA across outer membrane to the surface of bacterial cells where they form a protein complex. The extracellular MtrC and OmcA can directly reduce solid metal (hydr)oxides. Likewise, outer membrane multihaem c-Cyts OmcE and OmcS of G. sulfurreducens are suggested to transfer electrons from outer membrane to type IV pili that are hypothesized to relay the electrons to solid metal (hydr)oxides. Thus, multihaem c-Cyts play critical roles in S. oneidensis MR-1- and G. sulfurreducens-mediated dissimilatory reduction of solid metal (hydr)oxides by facilitating ET across the bacterial cell envelope.Dissimilatory reduction of metal  (hydr)oxides represents a challenge for microorganisms, as their cell envelopes are impermeable to metal (hydr)oxides that are poorly soluble in water. To overcome this physical barrier, the Gram-negative bacteria  Although their amino acid sequences differ greatly, all c-Cyts possess at least one haem that is covalently bound through amino acid side-chains of the proteins to position and orient the haem moiety and thereby facilitate efficient reactions. The haem moieties are commonly co-ordinated through two thioester bonds to proximal cysteines in the protein, where the signature motif of most c-Cyts is CX2CH . These motifs with covalently bound haems are the key components used to constitute the haem-containing domains whose diverse functions range from binding of O2 and catalysis to electron transfer and accumulation oxides.f c-Cyts . This reShewanella oneidensis MR-1 and Geobacter sulfurreducens, contain numerous c-Cyts   or trimethylamine N-oxide (TMAO) is used as the terminal electron acceptor  c-Cyts whose 3-D structures have been solved is the arrangement of haem groups. In these multihaem c-Cyts, all haem groups are positioned in such way that each is in close proximity to at least one of the other haems, and the porphyrin rings of two adjacent haems are positioned either parallel or perpendicular to each other. These arrangements are thought to facilitate rapid ET with considerable specificity among the haem groups that form a continuous \u2018electric wire\u2019 /nitrite reductase (NrfA) complex of Desulfovibrio vulgaris consists of two NrfHs and four NrfAs with a total of 28 haems that are used to form the entire ET network of the NrfH/NrfA complex. The longest distance that electrons could flow from the haem possibly used for quinol oxidation in one of the NrfH subunits to the haem for nitrite reduction in an NrfA subunit along the haem network (centre-to-centre) is \u223c98 \u00c5 (or 9.8 nm), in which 10 haems are involved  structures vary considerably, one of the unique features found in most bacterial multihaem ic wire\u2019 . When prc-Cyts with multiple haems are believed to function as capacitors to accumulate electrons (c-Cyts require multiple electrons (e.g. six-electron reduction of nitrite to ammonia by NrfA). Accumulation of a sufficient number of electrons might help complete the chemical reactions  ] or manganese [Mn] (hydr)oxides, as terminal electron acceptors to generate energy for biosynthesis and cell maintenance , was originally discovered in the Gram-negative bacteria ades ago . Since t\u221218 M for Fe(III)] oxides.Reduction of Fe(III)/Mn (hydr)oxides, however, requires specific mechanisms to overcome physical limitations associated with ET to the (hydr)oxides because: (i) Fe(III)/Mn (hydr)oxides are poorly soluble in water at neutral pH and in the absence of strong complexing ligands [e.g. 10Fe(III)] . To overFe(III)] . AlthougS. oneidensis MR-1, where a range of different multihaem c-Cyts provide the structural and electrochemical means to mediate ET from the quinone/quinol pool of the inner membrane, to the periplasm, to the outer membrane and finally to the Fe(III)/Mn (hydr)oxides outside the cell oxides through an elongated type IV pili (T4P), or geopili, that is electrically conductive oxides. We will then discuss the possible roles of multihaem c-Cyts of G. sulfurreducens in ET to solid metal (hydr)oxides and current evidence suggesting functional similarities and differences in the reduction of extracellular metal (hydr)oxides by these DMRB.Because of their critical roles in ET to solid metal (hydr)oxides in S. oneidensis MR-1 is a tetrahaem c-Cyt that shares some sequence similarity to the members of NapC/NirT family of quinol dehydrogenases (S. oneidensis MR-1 (i.e. 80\u2013100%) to use a range of substrates as terminal electron acceptors, including Fe(III)/Mn(IV) oxides, fumarate, nitrate, nitrite and DMSO  of ogenases . Like otogenases . Deletio3), the respiratory fumarate reductase of S. oneidensis MR-1, with a second-order rate constant of 19 \u03bcM\u22121 s\u22121 /Mn(IV) oxides and DMSO -citrate and MnO2, while its ability to reduce fumarate, nitrate, nitrite, DMSO, TMAO, thiosulphate and sulphide remains normal, demonstrating its specific role in reducing metals (The gene encoding MtrA (SO_1777) is located within a four-gene cluster that also includes genes encoding three outer membrane proteins: MtrB (SO_1776), MtrC or OmcB (SO_1778) and OmcA (SO_1779). All have been linked to dissimilatory reduction of insoluble forms of Fe(III) and/or Mn(IV) oxides  oxides as well -nitrilotriacetic acid (NTA) but, when mixed, their combined activity is greater than the sum of the individual activities, suggesting that MtrC and OmcA interact cooperatively   to O2 (650 s\u22121 for COX of bovine heart and 1230 s\u22121 for COX of Rhodobacter sphaeroides) (S. oneidensis MR-1 for dissimilatory reduction of insoluble Fe(III)/Mn (hydr)oxides, although other factors such as potential energy associated with the mineral surfaces may also be important.In addition to soluble Fe(III)-NTA, both purified MtrC and OmcA bind to and reduce crystalline Fe(III) oxide haematite (\u03b1-FeS. oneidensis MR-1 produces extracellular structures that are associated with nano-sized particles of uraninite (UO2). MtrC and OmcA, the major components of these structures, might serve as the extracellular terminal reductases to uranyl carbonate complexes, because (i) double deletion of mtrC/omcA genes considerably lowers the amount of extracellular UO2 nano-particles formed, (ii) MtrC and OmcA are colocalized with the UO2 nano-particles and (iii) MtrC reduces uranyl carbonate complexes in vitro . Nanowires have been implicated in S. oneidensis MR-1-mediated reduction of Si-HFO and generation of electrical current in microbial fuel cells (MFC). MtrC and OmcA were proposed to have a functional role in these materials, as the \u0394mtrC/omcA mutant produces extracellular materials that are not readily imaged by STM and has impaired abilities either to reduce Si-HFO or to generate the current in MFC /Mn(IV) oxides, demonstrating for the first time the direct involvement of T2S in reduction of solid metal oxides  MtrC and OmcA were the major c-Cyts in the medium, and (ii) their abundances in the medium were significantly reduced by the gspD deletion. This result was further substantiated by haem-staining and Western blot analyses . Thus, in the absence of O2 as the terminal electron acceptor, S. oneidensis MR-1 cells most likely use the T2S to facilitate the translocation of MtrC and OmcA across the outer membrane to the bacterial surface  seems to play a critical role. Insertional inactivation of t in MFC . The phe surface .S. oneidensis MR-1 cells are able to reduce solid metal (hydr)oxides via direct contact between MtrC/OmcA complex and surface of solid metal (hydr)oxides oxides, the extracellular MtrC/OmcA complex should be considered as a single functional unit for metal reduction. Many important questions regarding extracellular MtrC/OmcA complex remain unanswered, such as how it receives the electrons from the periplasm and how it functions at the molecular scale in terms of engaging with and transferring electrons to the substrates. It is clear, however, that r)oxides .S. oneidensis MR-1 cells might be able to reduce the solid metal (hydr)oxides that are located in regions of sediments and soils where pore sizes limit direct access by the whole cells. The extracellular structures could be extended into small pores where they may contact the (hydr)oxides, consistent with previous results showing that MtrC is involved in the reduction of solid Fe(III) oxide trapped inside porous glass beads  oxide is used as the terminal electron acceptor in G. sulfurreducens cultures, the two c-Cyts OmcE (GSU0618) and OmcS (GSU2504) are identified in culture supernatants after subjecting cells to shear forces generated by blending for 2 min at low speed. Both OmcE and OmcS are predicted to be outer membrane proteins with four and six CX2CH motifs respectively (G. sulfurreducens to reduce Mn(IV) as well as Fe(III) oxides. A gene located immediately downstream of omcS, omcT (GSU2503), also encodes a hexahaem c-Cyt that is 62% identical to OmcS  and Fe(III) oxides reduction by G. sulfurreducens. Deletion of omcE, omcS or omcT, however, does not have any effect on the ability of G. sulfurreducens to reduce soluble Fe(III)-citrate. These results indicate that OmcE, OmcS and OmcT are likely to be directly involved in reduction of insoluble Fe(III)/Mn(IV) oxides by G. sulfurreducens oxides, it has been suggested that G. sulfurreducens uses T4P to transfer the electrons directly from the outer membrane to extracellular metal (hydr)oxides oxides   and, finally to the outer membrane protein complex MtrC/OmcA facing the extracellular space, which are capable of transferring electrons directly to solid metal (hydr)oxides , multihaem r)oxides . Indeed,S. oneidensis MR-1, much less is known about the mechanisms underlying metal reduction in G. sulfurreducens. The multihaem c-Cyts OmcE and OmcS might play supporting roles to facilitate ET to the T4P structural complex, which then relays electrons directly to the surface of solid metal (hydr)oxides oxides, respectively, demonstrates a common biological function shared by these two systems. Furthermore, nearly all key structural components of the ET pathway used by S. oneidensis MR-1 to reduce solid metal (hydr)oxides have their putative counterparts in G. sulfurreducens (G. sulfurreducens is required for reducing solid Fe(III)/Mn(IV) oxides oxides . This suancestor . Their ireducens  and one c-Cyts in S. oneidensis MR-1-mediated dissimilatory reduction of solid metal (hydr)oxides, four important questions must be answered to provide a basic framework for understanding of the physiology of extracellular metal (hydr)oxide reduction by DMRB. Our primary question is how the T2S facilitates translocation of MtrC/OmcA across the outer membrane. To date, the pullulanase of Klebsiella oxytoca is probably the only outer membrane lipoprotein whose translocation via the T2S is well characterized oxides. This is critical, as MtrB is essential for S. oneidensis MR-1 to reduce the solid metal (hydr)oxides. Finally, it is unclear how the electrons are transferred from CymA to MtrA. Does CymA transfer electrons directly to MtrA or require NrfA and/or other periplasmic proteins as ET intermediates? Answers for these questions are critical to our understanding of how electrons are transferred across the periplasm.Despite recent advances in understanding the roles of the multihaem cterized . If confS. oneidensis MR-1 and G. sulfurreducens is that multihaem c-Cyts, which are strategically located at the inner membrane, periplasm and outer membrane and are able to interact with other proteins, facilitate ET across the physical barrier of bacterial cell envelope to the surface of solid metal (hydr)oxides.In summary, although considerable gaps in our knowledge about the bacterial ET pathways used for dissimilatory reduction of solid metal (hydr)oxides remain, the common feature of these pathways found in"}
+{"text": "An immunotoxin (IT) comprising abrin A chain attached to the mouse monoclonal antibody SWA11, recognising a cell surface antigen highly associated with human small cell lung cancer (SCLC), was synthesised using a hindered disulphide crosslinker, N-succinimidyl 3-(2-pyridyldithio) butyrate (SPDB), and purified by Blue Sepharose CL-6B affinity chromatography. The IT preparation contained monomeric conjugate, composed of one abrin A chain molecule linked to one SWA11 molecule, and was free from unconjugated A chain or antibody. The IT fully retained the cell-binding capacity of the antibody component and the ribosome-inactivating activity of the A chain. In cytotoxicity assays using the SW2 SCLC cell line in tissue culture, SWA11-SPDB-abrin A chain inhibited the incorporation of 3H-leucine by 50% at a concentration of 10 pM and by 99% at a concentration of 1 nM. The anti-tumour efficacy of the IT was tested in nude mice bearing established s.c. solid SW2 tumour xenografts. A single i.v. injection of SWA11-SPDB-abrin A chain at a non-toxic dose induced a significant 7 to 10 day growth delay that could not be matched by administration of equivalent doses of either unconjugated SWA11 or abrin A chain alone. The results of this study indicate that the antigen recognised by SWA11 is an effective target for therapy of SCLC with A chain ITs in vivo."}
+{"text": "Chloride substitution in BIFOP-Cl proceeds only under drastic conditions. New enantiopure, sterically demanding phosphorus ligands such as a phosphoramidite, a phosphite and a P-H phosphonite (BIFOP-H) are hereby accessible. In enantioselective Cu-catalyzed 1,4-additions of ZnEt With half of an equivalent of Cu(OTf)2, no free 1 is detectable, only a [(1)2Cu(OTf)2] complex is evident from a 31P-NMR signal at \u03b4 = 81.1 with a stronger 1J  coupling of 299.5 Hz. [However, under catalysis conditions, BIFOP-Cl . While 1 converts to the P-Et phosphonite BIFOP-Et (4) during Cu-catalyzed 1,4-additions of diethylzinc to cyclohexenone, the P-H phosphonite BIFOP-H (3) is stable and gives even a higher enantioselectivity than a corresponding phosphite or phosphoramidite. Hence, the large steric demand and the relatively low accessibility of the phosphorus atoms in biphenyl-2,2'-bisfenchylphosphites (BIFOPs) founds the special suitability for BIFOP-H (3) as P-H phosphonite ligand in transition metal catalysis. This points to promising applications of 3 or analogue P-H ligands in enantioselective catalysis.The large steric demand of embedding fenchane units makes phosphorus atoms in BIFOPs hardly accessible by nucleophilic reagents and leads to an unusually high stability, e.g. for the chlorophosphite BIFOP-Cl (File 1Experimental details"}
+{"text": "In separate experiments, normal foreign tissue and malignant tumour were implanted s.c. into the rat thigh. NMR T1 values of the adjacent normal muscle, resulting from local inflammatory reactions or from malignant invasion, were measured. Elevations in T1 of the underlying muscle occurred within 24 h in both experiments, and it is believed these were caused by rapid inflammatory and immunological reactions to the implants. However the T1 values of muscle samples adjacent to the non-malignant implants decreased during the 11 days after implantation, dropping to values within the normal range. In the second experiment there was progressive malignant invasion into the normal adjacent tissue and the elevated T1 values were maintained throughout the 12-day period. The effects of the implantation on tissue water content are discussed in relation to NMR T1 relaxation times, and the relevance to whole-body NMR imaging of elevated T1 values due to nonmalignant pathological states is considered."}
+{"text": "The pathogenesis of pancreatic ductal adenocarcinoma (PDAC) involves multi-stage development of molecular aberrations affecting signaling pathways that regulate cancer growth and progression. This study was performed to gain a better understanding of the abnormal signaling that occurs in PDAC compared with normal duct epithelia.We performed immunohistochemistry on a tissue microarray of 26 PDAC, 13 normal appearing adjacent pancreatic ductal epithelia, and 12 normal non-PDAC ducts. We compared the levels of 18 signaling proteins including growth factor receptors, tumor suppressors and 13 of their putative downstream phosphorylated (p-) signal transducers in PDAC to those in normal ductal epithelia.S2448p-mTOR , T389p-S6K . Additionally, T389p-S6K correlated with S727p-STAT3 . Advanced tumors with lymph node metastasis were characterized by high levels of S276p-NF\u03baB  and S9p-GSK3\u03b2 . High levels of PKB\u03b2/AKT2, EGFR, as well as nuclear T202/Y204p-ERK and T180/Y182p-p38 were observed in normal ducts adjacent to PDAC compared with non-cancerous pancreas.The overall profiles of signaling protein expression levels, activation states and sub-cellular distribution in PDAC cells were distinguishable from non-neoplastic ductal epithelia. The ERK pathway activation was correlated with high levels of Multiple signaling proteins are activated in pancreatic duct cell carcinogenesis including those associated with the ERK, PKB/AKT, mTOR and STAT3 pathways. The ERK pathway activation appears also increased in duct epithelia adjacent to carcinoma, suggesting tumor micro-environmental effects. KRAS oncogene and inactivation of tumor suppressor genes p16/CDKN2, p53 and SMAD4/DPC4 [EGFR and HER2 [PKB\u03b2/AKT2 [Pancreatic ductal adenocarcinoma (PDAC) is the most common malignant tumor of the human pancreas. PDAC patients have one of the worst prognoses among all cancer types with a 5-year survival rate of less than 5%. Despite significant advances during the last decade in our molecular knowledge on this disease, the prognosis and management of PDAC patients have remained unchanged ,2. The mKB\u03b2/AKT2 . The proKB\u03b2/AKT2 . ActivitDespite a significant gain of knowledge on genes that are differentially expressed in PDAC compared with normal pancreas or duct cells, the associated changes in signal transduction networks have not yet been extensively characterized. Studies on the activation of singular pathways by immunohistochemistry (IHC) with phosphorylation-specific antibodies have been reported for PKB/AKT ,10, p70/To better understand the activation of tyrosine and serine/threonine phosphorylated proteins, we have used IHC analysis to evaluate the levels and activation state of several signaling pathways including the ERK, SRC, STAT3, PTEN/PKB, mTOR/S6K/S6, \u03b2-catenin (\u03b2CAT) and SMAD4 in PDAC cells and epithelia of normal pancreas.This study has been approved by the Research Ethics Board of the University Health Network  in compliance with applicable national Tri-Council ethics principles. The formalin-fixed and paraffin embedded (FFPE) samples used in this study were tumor and adjacent normal pancreatic tissue obtained within 30 minutes after Whipple's resection for pancreatic ductal adenocarcinoma (PDAC) or non-PDAC conditions. The FFPE blocks were made from thin cross sections of tissues collected for snap-frozen tumor banking and were initially intended for a histological quality check of the banked tissue. These samples were particularly suitable for this study due to their limited delay between sampling and fixation.Histology was reviewed to assure the correct diagnosis of the 26 PDAC specimens and 12 specimens that were considered \"normal\" pancreas from patients with non-pancreatic conditions  [see Additional file Antibodies and staining methods are summarized in an additional file [see Additional file The immunostained slides were scanned using an Aperio CS Scanner  at 20\u00d7 magnification. Either slides or digital images were used for scoring by three independent evaluators  without prior knowledge of the core source or stained target antigen. Final scores were based on a consensus of the three evaluators. A single intensity score was obtained since the intensity of staining within each core was mostly homogeneous. Intensity was scored as 0 for absence of staining, 1 for weak, 2 for moderate, and 3 for strong staining. Scores were recorded for the different cell types as well as their nuclear and cytoplasmic compartments. EGFR and MET receptor were scored for their plasma membrane staining only.Unsupervised hierarchical clustering using the agglomeration rule average linkage placed cases and antibodies next to each other if they were most similar in their IHC profiles (free software Genesis ). The reA heat map in Figure T308p-PKB (p < 0.0001), p-p38 (p = 0.02), and their putative downstream substrates p-JNK (p < 0.0001), S727p-STAT3 (p = 0.005), Y705p-STAT3 (p = 0.0005), p-GSK3\u03b2 (p = 0.006), p-RAF (p = 0.01) and p-mTOR (p = 0.05) were significantly higher in PDAC cells than in ducts. Degradation-targeted p-\u03b2CAT levels significantly decreased (p < 0.0001) in PDAC cells compared with ducts, consistent with the observation of an accumulation of \u03b2CAT in PDAC compared with ducts , p-p38 (p = 0.004), p-JNK (p = 0.01), and S473p-PKB (p = 0.001) were significantly higher in nuclei of PDAC cells than in normal ducts , SMAD4  and PTEN . These associations were absent in ductal epithelia from non-PDAC specimens except for an association of cytoplasmic and nuclear levels for p-p38  in the ductal epithelia adjacent to PDAC [see Additional file Since many signaling proteins translocate into the nucleus to serve as transcription factors after being activated by phosphorylation, we explored their profiles in PDAC cells compared with histologically normal ductal epithelia. An unsupervised clustering of the nuclear activated protein levels showed an absence of clustering between tumor and normal ducts Figure . Levels  p = 0.00, p-p38  and shows a positive trend with high levels of T308p-PKB . The activation of p-STAT3 correlated with high levels of PKB\u03b2  and the presence of SMAD4 . An association was observed between high levels of T308p-PKB and p-JNK . High levels of inactive p-RAF was correlated with PKB\u03b2 , PTEN  and p-\u03b2CAT . Protein levels were compared with clinicopathological characteristics of tumors. There was no significant association between tumor grade and individual protein levels . However, advanced stage (III and IV) showed a trend in association with higher levels of \u03b2CAT (p = 0.04), p-NF\u03baB (p = 0.05) and p-GSK3\u03b2 (p = 0.05). In contrast, high levels of p-STAT3 (p = 0.01) and loss of PTEN (p = 0.01) appeared not to be associated with cancer progression. Table Table A subset of the signaling proteins examined in this study differentially characterized histologically normal ducts adjacent to PDAC compared with ducts in non-PDAC pancreas Figure . Mean leCentroacinar cells, which are the terminal ducts lining the centre of the acini, as expected showed a protein profile that was similar compared with larger ducts Figure . The sevIn this study, we used immunohistochemistry (IHC) analysis to profile multiple signaling pathways involved in growth and progression of PDAC. To our knowledge, this is the most comprehensive analysis of signaling protein profiles in PDAC cells compared with normal pancreatic duct cells. To confirm the validity of our study, we showed similar frequencies of loss of PTEN and SMAD4 expression in our PDAC samples ,25, and The trend for associations in (phospho-) protein levels between ERK and the mTOR/S6K/S6 pathway, as well as S6K and PKB or STAT3 suggest a co-activation of these pathways or their crosstalk in PDAC. We propose that further evaluations of ERK and mTOR pathways in PDAC as possible targets for drug combinations are warranted, since single molecule-directed strategies, such as the EGFR inhibitor erlotinib only had a limited effect on patient survival .Our results further suggest that PKB activity lacked significant association with its antagonistic regulator PTEN as well as with downstream PKB substrates including GSK3\u03b2, RAF and mTOR. Previous studies reported that high levels of PKB\u03b2 (17/61 cases)  or loss The levels of a subset of signaling pathways including p-ERK, p-p38, PKB\u03b2 or EGFR were enhanced in histologically normal duct cells in PDAC compared with non-PDAC pancreas. This is consistent with a pro-survival role of ERK and JNK in ductal epithelia of a murine hereditary pancreatitis model , and of Our observations suggest that multiple signaling proteins are activated in pancreatic duct cell carcinogenesis including those associated with the ERK, mTOR, STAT3 and PKB pathways. Activation of the ERK pathway also appears increased in duct epithelia adjacent to carcinoma, suggesting a tumor micro-environmental effect.The author(s) declare that they have no competing interests.NAP participated in the study design, evaluated and analyzed the data, and drafted the manuscript. JS participated in the pathological data evaluation and assisted in the manuscript writing. VI reviewed slides for pathological determination of tumor content and assisted in the data evaluation. GP advised and performed statistical analyses. DWH participated in the study design and assessed clinical records. MST conceived of the study, participated in the study design and coordination, and drafting of the manuscript.The pre-publication history for this paper can be accessed here:Additional Figure 1 Tissue microarray. H&E stained TMA and a representative core of negative control staining. Additional Table 1A Summary of Clinical parameters. Identifies surgical procedure, age, sex, tumor stage and grade of patients. Additional Table 1B Clinicopathological parameters of PDAC cases. Sex, age, tumor stage and tumor grade is listed for individual cases.Click here for fileAdditional Table 2 Antibody list. Antibody description, source, method of use and evidence for specificity.Click here for fileAdditional Table 3 Protein levels in PDAC compared with non-neoplastic ductal epithelia. Lists significant associations of high/low protein levels with PDAC specimens compared with duct specimens.Click here for fileAdditional Table 4 Relationships between cytoplasmic and nuclear protein. Lists significant associations in protein levels between cytoplasmic and nuclear compartments.Click here for fileAdditional Table 5 Comparisons of non-neoplastic ducts. Analysis of mean protein levels of non-neoplastic ductal epithelia in peritumoral regions compared with ducts from non-PDAC specimens.Click here for file"}
+{"text": "Treponema pallidum. We investigated whether a similar situation may occur in Lyme neuroborreliosis.The long latent stage seen in syphilis, followed by chronic central nervous system infection and inflammation, can be explained by the persistence of atypical cystic and granular forms of Borrelia burgdorferi spirochetes were induced exposing cultures of Borrelia burgdorferi (strains B31 and ADB1) to such unfavorable conditions as osmotic and heat shock, and exposure to the binding agents Thioflavin S and Congo red. We also analyzed whether these forms may be induced in vitro, following infection of primary chicken and rat neurons, as well as rat and human astrocytes. We further analyzed whether atypical forms similar to those induced in vitro may also occur in vivo, in brains of three patients with Lyme neuroborreliosis. We used immunohistochemical methods to detect evidence of neuroinflammation in the form of reactive microglia and astrocytes.Atypical forms of in vitro. We also observed nuclear fragmentation of the infected astrocytes using the TUNEL method. Abundant HLA-DR positive microglia and GFAP positive reactive astrocytes were present in the cerebral cortex.Under these conditions we observed atypical cystic, rolled and granular forms of these spirochetes. We characterized these abnormal forms by histochemical, immunohistochemical, dark field and atomic force microscopy (AFM) methods. The atypical and cystic forms found in the brains of three patients with neuropathologically confirmed Lyme neuroborreliosis were identical to those induced Borrelia burgdorferi and local neuroinflammation occur in the brain in chronic Lyme neuroborreliosis. The persistence of these more resistant spirochete forms, and their intracellular location in neurons and glial cells, may explain the long latent stage and persistence of Borrelia infection. The results also suggest that Borrelia burgdorferi may induce cellular dysfunction and apoptosis. The detection and recognition of atypical, cystic and granular forms in infected tissues is essential for the diagnosis and the treatment as they can occur in the absence of the typical spiral Borrelia form.The results indicate that atypical extra- and intracellular pleomorphic and cystic forms of  Treponema pallidum .Borrelia burgdorferi in infected tissues. Their occurrence has been reported in skin lesions . Thioflproteins ,68,69. PBorrelia burgdorferi  i,70 i38,7Borrelia burgdorferi strains B31 and ADB1. Nuclear fragmentation of a subset of infected cells as revealed by TUNEL suggests that Borrelia burgdorferi can cause functional damage and cell death. The intracellular localization of filamentous, ring-shaped, cystic and granular forms suggests that such intracellular Borrelia spirochetes can be protected from destruction by the host immune system.Similar atypical, cystic and granular forms were observed in primary neuronal and astrocytic cell cultures exposed for 1 week to the Borrelia burgdorferi spirochetes can form resistant cystic forms, which may persist in the brain. Numerous colonies were also observed in vitro and in vivo. In the brain they were restricted to the cerebral cortex. These spirochetal masses included numerous cystic forms as has been described for Treponema pallidum and other spirochetes. Like for Treponema pallidum in neurosyphilis, atypical and cystic forms of Borrelia burgdorferi were also observed intracellularly in the brains of these patients, as it has previously been documented .Borrelia burgdorferi spirochetes were cultivated from the brains of these patients, that Borrelia antigens and genes were co-localized with beta-amyloid deposits in cortical spirochetal colonies, and that the serology of these patients was positive for Borrelia burgdorferi are evidences that the present cases correspond to the atrophic parenchymatous form of late Lyme neuroborreliosis.The clinical and the pathological hallmarks of Alzheimer's disease, including beta-amyloid deposition are also present in the atrophic form of general paresis and in tertiary Lyme neuroborreliosis ,63,72-74Borrelia forms were induced by the various unfavorable conditions that were employed. Extra- and intracellular atypical and cystic forms were observed in neuronal and astrocytic cultures following 1 week of exposure to Borrelia burgdorferi (B31 and ADB1). Identical extra- and intracellular atypical and cystic Borrelia forms were also observed in the brains of all three patients with Lyme neuroborreliosis, which were also similar to the atypical forms of Treponema pallidum in the brains of patients with general paresis. Astrocytes infected with Borrelia burgdorferi exhibited nuclear fragmentation.Dark field microscopy, histochemical, immunohistochemical and atomic force microscopy (AFM) analyses revealed that pleomorphic and cystic Borrelia burgdorferi may persist in the brain and may explain the long latent stage and persisting infection in Lyme neuroborreliosis. The identification of these extra- or intracellular atypical, cystic and granular forms of Borrelia burgdorferi is essential for the histopathological diagnosis of Lyme disease as they may indicate chronic Borrelia infection, even in cases where the typical coiled spirochetes are apparently absent. In analogy to Treponema pallidum, Borrelia burgdorferi can persist in the brain in Lyme neuroborreliosis and may initiate and sustain chronic inflammation and tissue damage.Our results suggest that pleomorphic forms, including cystic forms of The authors declare that they have no competing interests.JM contributed to the direction of the investigation, data interpretation and to the writing of the manuscript. SK contributed to the AFM analysis, ADZ contributed in experiments of neuronal cell cultures, SMC contributed in the analysis of syphilitic brains and in organizing the interaction of several laboratories, as well as in data interpretation, SY contributed to the immunohistochemical analysis, PLMG contributed to the writing of the manuscript and data interpretation. All authors read and approved the final manuscript."}
+{"text": "Neurenteric cysts account for 0.7-1.3% of spinal axis tumors. These rare lesions result from the inappropriate partitioning of the embryonic notochordal plate and presumptive endoderm during the third week of human development. Heterotopic rests of epithelium reminiscent of gastrointestinal and respiratory tissue lead to eventual formation of compressive cystic lesions of the pediatric and adult spine. Histopathological analysis of neurenteric tissue reveals a highly characteristic structure of columnar or cuboidal epithelium with or without cilia and mucus globules. Patients with symptomatic neurenteric cysts typically present in the second and third decades of life with size-dependent myelopathic and/or radicular signs. Magnetic resonance imaging and computed tomography are essential diagnostic tools for the delineation of cyst form and overlying osseous architecture. A variety of approaches have been employed in the treatment of neurenteric cysts each with a goal of total surgical resection. Although long-term outcome analyses are limited, data available indicate that surgical intervention in the case of neurenteric cysts results in a high frequency of resolution of neurological deficit with minimal morbidity. However, recurrence rates as high as 37% have been reported with incomplete resection secondary to factors such as cyst adhesion to surrounding structure and unclear dissection planes. Here we present a systematic review of English language literature from January 1966 to December 2009 utilizing MEDLINE with the following search terminology: neurenteric cyst, enterogenous cyst, spinal cord tumor, spinal dysraphism, intraspinal cyst, intramedullary cyst, and intradural cyst. In addition, the references of publications returned from the MEDLINE search criteria were surveyed in order to examine other pertinent reports. During the third week of human embryogenesis, the neurenteric canal unites the yolk sac and the amniotic cavity as it traverses the primitive notochordal plate. Persistence of the normally transient neurenteric canal prevents appropriate separation of endoderm and notochord. This anomalous union manifests as congenital abnormalities of the spine defined by the presence of mucus-secreting epithelium reminiscent of the gastrointestinal tract. These lesions were first described by Kubie and Fulton in 1928 as The diagnostic histopathology of neurenteric cysts has been described classically on hematoxylin and eosin (H and E) stained samples as a collection of mucin producing simple columnar or cuboidal ciliated and nonciliated goblet cells surrounding a central cystic cavity . WilkinsThe cystic epithelial cells typically stain negatively for glial fibrillary acidic protein (GFAP) and positively for cytokeratin, epithelial membrane antigen, and carcinoembryonic antigen (CEA) on immunohistochemical assays. Positive CEA staining supports a theory of shared lineage between the cystic wall and the intestinal mucosa. In the case of intramedullary lesions, astrocytes within the cyst wall may stain positively for GFAP in comparison to the typical negative staining pattern of extramedullary cysts. Confirma5The mucus-secreting columnar epithelium of the neurenteric cyst wall has been described to be similar to that of the intestinal or respiratory epithelium.11 Despitet al reported a case in which a neurenteric cyst treated with surgical fenestration resulted in widespread spinal dissemination noted 9 years postoperatively.[et al presented a case of an 18-year-old male with sudden neurological deterioration resulting from a Staphylococcus aureus infected neurenteric cyst.[The overwhelming majority of neurenteric cysts occur as solitary lesions. However, patients have been reported to present with disseminated disease along the spinal axis. Most of these cases demonstrate local propagation of neurenteric cysts in proximity to the original lesion.\u201018 Yasudric cyst. Additionric cyst.20Individuals diagnosed with neurenteric cysts most frequently present in the second and third decades of life with a male-to-female ratio of approximately 2:1.\u201023 MoreoThe waxing and waning nature of symptoms associated with spinal cord compression secondary to cyst volume instability has frequently led to misdiagnoses of central nervous system (CNS) demyelinating disease. In addit2425Neurenteric cysts are allied with bony abnormalities of the spine in approximately 50% of cases and are associated with a variety of conditions including spinal dysraphism, scoliosis, spina bifida, split cord malformation, and Kippel-Fiel syndrome.\u201036 In adPatients with signs or symptoms associated with neurenteric cysts require a diagnostic evaluation with such imaging modalities as magnetic resonance imaging (MRI) and/or computed tomography (CT). MRI has proven superior in the delineation of the cyst form and its relationship with surrounding neural structures when compared to CT.3738 Furt37et al have described a neurenteric cyst with an abscess or granulomatous-like presentation associated with peripheral enhancement of the cystic structure on MRI.[et al and Nagi et al reported cases in which the neurenteric cyst appeared hypointense on T1-weighted imaging and hyperintense on T2-weighted imaging.[39et al described one patient with a lesion hyperintense on T1-weighted imaging and hypointense on T2-weighted imaging, while the second patient presented with a cyst hypointense on T1-weighted imaging and hyperintense on T2-weighted imaging.[et al described 16 of 18 lesions hyperintense on T1-weighted imaging with only two cases demonstrating \"standard\" isointensity on T1-weighted sequences.[The most common MRI findings associated with neurenteric cysts are noncontrast-enhancing lesions that are isointense on T1-weighted sequences and hyperintense on T2-weighted imaging .11132931113311132939e on MRI. Miyagi emaging.39 In a twoet al described a unique instance of a false mural nodule identified within a neurenteric cyst.[13314578222331The archetypal appearance of neurenteric cyst structure on diagnostic imaging is that of a lobulated homogenous mass without an associated mural nodule. Paolini ric cyst. The suppric cyst.1318 Thercyst.1331 Over 90%cyst.1331.[4578222et al demonstrated that 87% of patients with vertebral anomalies evident on radiographic evaluation presented with neurenteric cysts at the same level as the bony abnormality.[The relationship of neurenteric cyst incidence in tandem with osseous malformation warrants plain film and/or CT imaging to fully delineate the pathologic spectrum of this disease process. A case series of 23 patients with neurenteric cysts reported by Garg ormality. ConsequeSurgical resection is the first-line treatment for neurenteric cysts with the goal of gross total resection. When possible, total excision is the ideal outcome given the association between partial resection and cyst recurrence. However,13The posterior technique is the most widely reported surgical approach. Although neurenteric cysts typically present in a ventral position, the posterior approach is associated with fewer intraoperative complications. FurthermThe anterior approach has also been reported as an effective option for the resection of neurenteric cysts. While effective, this approach provides additional surgical complexity and an increased need for instrumented fusion as compared to the posterior approach. The anterior approach is associated with risks such as damage to adjacent neurovascular anatomy, fusion failure, hematoma formation, and CSF leakage. However, given the goal of total excision, the procedure's plane of access is advantageous in the resection of ventrally localized, extramedullary cysts.29 FurtheThe lateral approach is the least frequently reported technique for resecting neurenteric cysts. Associated risks are not dissimilar from the aforementioned methods such as durotomy and vascular damage. However, the technique provides an adequate view of the cyst-cord boundary while affording maximal preservation of normal anatomy.44While consensus is absent with respect to the preferred approach, the literature does offer guidance regarding total versus partial resection in the case of intramedullary versus extramedullary cysts. As previously mentioned, the intradural/extramedullary location is the typical presentation accounting for approximately 95% of reported cases, whereas intramedullary neurenteric cysts comprise less than 5% of lesions. More imp53140Surgical treatment, particularly total resection, is most often curative of the sensory and motor deficits associated with neurenteric cysts. As described above, the risk of surgical morbidity must be considered when assessing the goals of surgical resection. Worsening of symptoms is documented in 11% of cases and failure to regain premorbid neurological function is cited in 18%. The mostet al. and Cai et al. observed no recurrence in their case series of eight and seven patients, respectively.[et al. observed recurrence in only 4% patients.[et al. reported the longest follow-up at 30 years and observed a 37% recurrence rate among eight patients. Of note, all cases of recurrence in this study were seen in patients who underwent partial surgical resection.[Reports of postsurgical recurrence have ranged between 0% and 37%. Kim ectively.46 Holmespatients. Chavda eesection.et al reviewed 18 recurrent cyst cases. In 16 of the cases, only a partial cyst resection was achieved.[et al. reported a case series in which recurrence was absent in those patients who underwent gross total excision versus 11% in patients who underwent partial excision.[et al. No recurrence was observed in those patients with gross total resection, whereas recurrence was seen in five out of eight (63%) patients with partial resection.[et al reported no correlation between recurrence and other factors such as age, sex, cyst size, and level.[While the rarity of neurenteric cysts and its varying presentation does not allow for a definitive range of recurrence, the literature does establish a link between partial resection and recurrence. Kimura achieved. Paleologexcision. A similaesection. Partial nd level.48 ConseqNeurenteric cysts represent a small percentage of spinal disease clinically germane to the neurological surgeon. These lesions display characteristic histopathology including well-differentiated columnar or cuboidal epithelium with or without cilia and mucus globules. Patients presenting with these heterotopic lesions of endodermal origin often display symptomology consistent with compression of the spinal cord and associated nerve roots. MRI is the gold standard for characterizing neurenteric cysts. However, CT plays an important role in defining bony abnormalities that are often coexistent with displaced remnants of the developing gastrointestinal/respiratory tract. A complete surgical resection is the goal of the treatment. However, thoughtful consideration must be given to the potential benefits and risks associated with gross total resection in situations of neuronal adhesions or ambiguous dissection planes. Although outcome analyses of patients treated surgically for neurenteric cysts are limited, the data available demonstrate excellent neurologic recovery with nominal associated morbidity following resection. With a recurrence rate as high as 37%, patients with partial resection in particular should be followed with serial imaging to assess for re-accumulation of cyst contents."}
+{"text": "Acidic fibroblast growth factor (FGF1) and two of its receptors, FGFR1 and FGFR4, were localized in cryostat sections of normal, benign and malignant human breast tissue by immunohistochemistry. Without pretreatment, FGF1 staining was mainly seen in normal epithelial cells. However, polymerase chain reaction (PCR) analysis and immunoblotting of isolated normal epithelial and myoepithelial cells showed FGF1 mRNA and protein to be present in both cell types. Following incubation of frozen sections at 37 degrees C in phosphate-buffered saline, FGF1 staining was also revealed in myoepithelial cells and basement membrane adjacent to carcinoma cells. Treatment with protease inhibitors demonstrated that this effect was due to the activity of an endogenous protease. In contrast, FGF1 staining was found to be associated with the stroma adjacent to malignant cells only in the presence of protease inhibitors. FGFR1 and FGFR4 immunostaining was localized to both normal and malignant epithelial cells and to a lesser extent to myoepithelial cells. There was no difference in the staining intensity for the FGF receptors between normal and cancer samples. The change in location of FGF1 between normal and malignant tissues and the sensitivity of stored FGF1 to the action of endogenous proteases raises the possibility of both autocrine and paracrine roles for FGF1 in the normal and malignant human breast."}
+{"text": "A method for automated macromolecular side-chain model building and for aligning the sequence to the map is described. RESOLVE software. Combined with automated main-chain model building, the procedure produces a preliminary model suitable for refinement and extension by an experienced crystallographer.An algorithm is described for automated building of side chains in an electron-density map once a main-chain model is built and for alignment of the protein sequence to the map. The procedure is based on a comparison of electron density at the expected side-chain positions with electron-density templates. The templates are constructed from average amino-acid side-chain densities in 574 refined protein structures. For each contiguous segment of main chain, a matrix with entries corresponding to an estimate of the probability that each of the 20 amino acids is located at each position of the main-chain model is obtained. The probability that this segment corresponds to each possible alignment with the sequence of the protein is estimated using a Bayesian approach and high-confidence matches are kept. Once side-chain identities are determined, the most probable rotamer for each side chain is built into the model. The automated procedure has been implemented in the  On the other hand, the identities of the side chains at each position in the map are normally not known at this stage, and at moderate resolution (\u223c2\u20133\u2005\u00c5) in a map of moderate quality it can be very difficult to distinguish many of the side chains. Consequently, the bulk of the problem is not placing the side chains but rather identifying them.Building side chains of an atomic model into an electron-density map is a very different problem to building the main chain. Normally the main chain is built first, so the approximate location of the Cet al.  this was not possible with just 40 rotamers in the library and in these cases some configurations are not represented. Additionally, for arginine the N\u03b71 and N\u03b72 atoms were not included in the r.m.s.d. calculation for defining the libraries; even so, more than 40 rotamers would have been required to represent all configurations found and the list was truncated at 40 rotamers. A total of 503 side-chain rotamers were present in the entire library of side chains.Libraries of side-chain rotamers have been constructed numerous times . In this way, the electron-density templates reflected both the variability in side-chain conformation within a rotamer group and the pattern of thermal factors from atom to atom in a rotamer. The electron-density templates were sampled on a grid with a spacing of 1\u2005\u00c5. All points within 3\u2005\u00c5 of an atom in a side chain in one or more of the conformations present in the corresponding rotamer group were contained in the templates and all other points excluded. The templates for different amino acids and for different rotamers were therefore sampled at partially overlapping sets of lattice points. The region defining the template for glycine is not well defined by these criteria and as a special case the template for glycine was calculated in the same region as the template for alanine.2.3.The relative probability that each of the 20 amino-acid side chains was located at a side-chain position in a polypeptide chain was estimated in several steps. The overall strategy at each position in the chain was to find the rotamer of each side chain that fitted the density best, then to use the fits of these 20 side chains to the density to obtain the probability for each possible side chain at that position.jk of each side-chain rotamer density template j with the electron density at each side-chain position k in the polypeptide chain was determined. This was accomplished after transforming the density in the map to the standard reference frame defined by the main-chain N, C\u03b1 and C positions. For each side-chain type, only the best-fitting rotamer was considered further.Firstly, the correlation coefficient ccZ score was calculated for the fit of each side-chain template to each side-chain position. The Z score was based on the correlation ccjk for the fit and the correlations for the fits of this template j to all other side-chain positions. The Z score calculated in this way describes how likely it is that the value of the correlation ccjk would be obtained by chance. This was used to estimate the probability of measuring a value ccjk for a template that is incorrect. We further assumed that the correct template can have any value of the correlation. This is a useful assumption because although we expect that a correct template will have a high value of the correlation, it is difficult to specify how high this value should be.Next, a j to all side-chain positions, \u2329ccj\u232a, was used as an estimate of the correlation to be expected for this side chain to arbitrary side-chain density . Similarly, the standard deviation of this correlation, \u2329\u03c3j\u232a, was used as an estimate of the variation of this correlation to be expected for arbitrary side chains. Then the Z score, Zjk = (ccjk \u2212 \u2329ccj\u232a)/\u03c3j, was expected to be related to the probability of obtaining this value of the correlation by chance  using the relation p(ccjk) \u2243 exp(\u2212Zp(ccjk) was taken to be unity for values of Z < 0 in this calculation.Using these assumptions, the mean correlation for the template i is the correct one at position k was calculated from Bayes\u2019 rule. The a priori probability for each amino acid poj was estimated from numbers of each amino acid j in the protein, nj. The probability of observing the set of correlations {ccjk} at position k if the correct amino acid at this position is i is the product over all of the other amino-acid types j  of the probabilities of observing the correlations {ccjk} by chance,pik, that amino acid i is the correct one at position k, yielding, after some simplification,Finally, the probability that amino-acid type 2.4.n residues was matched to the protein sequence using the matrix of probability estimates pik describing the probability that amino acid i is the correct type at position k in the model. As the main-chain model might sometimes be missing amino acids (commonly at loop positions) or might cross from one segment of chain to another incorrectly, a first step in the alignment was to identify the sub-fragment of the fragment which could be matched to the sequence with the highest probability. This was considered likely to be the longest segment that is contiguous in the protein chain. The match of this sub-fragment was identified and the remainder of the fragment was then considered independently as a separate fragment.A fragment of main-chain model containing n(n \u2212 1)/2 times, once for each possible sub-fragment of the n-residue model fragment. Two different scoring algorithms were used in this process. For comparisons between sub-fragments of the same length, the probability of the alignment of each sub-fragment was used as the score. For comparisons between sub-fragments of different lengths, the probability estimates were not a good indicator of the relative qualities of the alignments and instead the score for each was \u2329Z\u232aN1/2, where N is the number of residues in the sub-fragment and \u2329Z\u232a is the mean Z score \u2329Zjk\u232a of the amino acids in this alignment.To accomplish the identification of a contiguous sub-fragment and its match to the sequence, the alignment procedure described next was carried out m residues, all possible alignments l of the model with m sequential amino acids in the protein were considered. The relative probability pl that alignment l, with amino-acid type tk matched to position k in the model, was correct was estimated assuming that the probability estimates for all the residues in the model were independent, leading toFor a given sub-fragment or fragment with 3.The reliability of the probabilistic method described here for side-chain assignment and sequence alignment was examined using the density-modified electron-density map for eight different experimental maps with varying resolution, quality (figure of merit) and number of residues in the asymmetric unit. The main chain was built into each map as described in Terwilliger 2003. The cooWe first evaluated the utility of 1. A totalWe next evaluated how well the sequence-alignment probabilities estimated with . These three may therefore be slightly better fitted than a typical protein. The remaining five are likely to be relatively good indicators of the utility of the method. For the set of eight proteins as a whole, 99% of the sequence assignments were correct. The mean difference in coordinates between the side-chain atoms of the model and those of the corresponding refined structures was 1.3\u2005\u00c5 and the r.m.s. difference was 1.8\u2005\u00c5, including lysine and arginine residues, where the positions of atoms in even the refined structures is often somewhat uncertain, but excluding atoms more than 10\u2005\u00c5 away from any atom in the refined structures.The overall side-chain modeling results are summarized in Table 1a) shows the number of main-chain residues and side chains built as a function of the high-resolution cutoff. Fig. 3b) shows the r.m.s. coordinate error in main-chain and side-chain atoms for the same models. Fig. 3To test the resolution-dependence of side-chain model building, the IF5A structure was built at a variety of resolutions, truncating the data in each case. This of course does not fully simulate the ability to build a model for a poorly diffracting crystal, as the data and phases are very good to the resolution cutoff in this test. Nevertheless, it can give an idea of what is possible with very good data. Fig. 34.The probabilistic methods described here for identifying side chains and their rotamers in the electron density at positions derived from a main-chain tracing are found to be very effective. With a map of reasonable quality and a segment of ten residues or longer, the alignment to the sequence can often be identified with a confidence greater than 98%.As a side effect of aligning the model to the sequence, the quality of the main-chain protein tracing can be considerably improved. This is largely owing to the identification of errors in the main chain and elimination of the corresponding segments of main-chain model. For example, mis-tracings caused by tracing the chain through a loop region using fewer residues than are present in the actual loop are removed in this procedure. The procedure of finding the longest sub-fragment of a main-chain fragment that had a very strong match to the protein sequence was very useful for identifying these cases. This removal of residues is the reason for the differences between the number of main-chain residues in the models in this work compared with those obtained when using only the main-chain tracing algorithm (Terwilliger, 2003e.g. Dunbrack & Cohen, 1997et al., 2000et al. (2000The algorithm for side-chain fitting and alignment developed here does have significant limitations. The side-chain rotamer libraries used are not as complete or as accurate as others available ( al. 2000, which r"}
+{"text": "Known ABA signalling components were isolated including SnRK2 protein kinases. We confirm previous studies in yeast and now show that ABI1 interacts with the ABA-signalling kinases OST1, SnRK2.2 and SnRK2.3 in plants. Interestingly, the most robust in planta ABI1-interacting proteins in all LC-MS/MS experiments were nine of the 14 PYR/PYL/RCAR proteins, which were recently reported as ABA-binding signal transduction proteins, providing evidence for in vivo PYR/PYL/RCAR interactions with ABI1 in Arabidopsis. ABI1\u2013PYR1 interaction was stimulated within 5 min of ABA treatment in Arabidopsis. Interestingly, in contrast, PYR1 and SnRK2.3 co-immunoprecipitated equally well in the presence and absence of ABA. To investigate the biological relevance of the PYR/PYLs, we analysed pyr1/pyl1/pyl2/pyl4 quadruple mutant plants and found strong insensitivities in ABA-induced stomatal closure and ABA-inhibition of stomatal opening. These findings demonstrate that ABI1 can interact with several PYR/PYL/RCAR family members in Arabidopsis, that PYR1\u2013ABI1 interaction is rapidly stimulated by ABA in Arabidopsis and indicate new SnRK2 kinase-PYR/PYL/RCAR interactions in an emerging model for PYR/PYL/RCAR-mediated ABA signalling.Abscisic acid (ABA) mediates resistance to abiotic stress and controls developmental processes in plants. The group-A PP2Cs, of which ABI1 is the prototypical member, are protein phosphatases that play critical roles as negative regulators very early in ABA signal transduction. Because redundancy is thought to limit the genetic dissection of early ABA signalling, to identify redundant and early ABA signalling proteins, we pursued a proteomics approach. We generated YFP-tagged ABI1 Arabidopsis expression lines and identified  The plant hormone abscisic acid (ABA) controls important abiotic stress-induced and developmental responses, including maintenance of seed dormancy, seed development, growth regulation and stomatal closure. Forward and reverse genetic analyses have led to the identification of many loci encoding ABA signalling components that function in ABA metabolism and in ABA signalling . However2+ dependent protein kinases (CDPKs) are positive transducers of ABA signalling  and Cagnalling . The ABAabi1-1 and abi2-1 exhibit ABA insensitivity in seed germination and root growth responses  Does ABA affect this interaction in vivo and within which time frame? (iii) Does ABI1 interact with SnRK2.2, SnRK2.3 and OST1/SnRK2.6 in plants? (iv) Does PYR form complexes with these ABA signalling SnRK2 kinases and does ABA affect this interaction? and (v) Do PYR/PYL/RCAR function in ABA-induced stomatal closure and ABA inhibition of stomatal opening?Here we further address the following emerging questions: (i) Does the ABI1 protein phosphatase interact with the PYR1 protein abi1-3 knockout mutant background  ABA stimulates this interaction in Arabidopsis within 5 min of ABA exposure. (iii) ABI1 co-immunoprecipitates with the SnRK2.2, SnRK2.3 and OST1/SnRK2.6 protein kinases in plants, extending previous yeast two hybrid findings  A new PYR1 antibody was used and showed that the ABI1 protein phosphatase interacts with the PYR1 protein PYR/PYL/RCAR genes are required for ABA activation of the SnRK2 kinases  Heynh. ecotype Columbia (Col) was used in this study. Plant growth conditions, seed germination and root elongation assays were performed as described previously  for 3 h in the dark and exposed to the indicated ABA concentrations in the light (100 \u03bcmol m\u22122 s\u22121).The http://www.invitrogen.com) and sequenced and then transferred to the destination vectors pH35YG and pEarleyGate 201 by Gateway LR recombination reaction (Invitrogen). Agrobacterium tumefaciens strain GV3101 was used to transform the abi1-3 T-DNA insertion disruption line and wild-type Col-0 with plants by the floral dip method  according to the manufacture\u2019s specifications. Co-immunoprecipitations in N. benthamiana were performed as described previously without modifications  grown on horizontal MS plates were incubated for 2 h in water before ABA treatment. Co-immunoprecipitations were performed using Dynabeads Protein G (Invitrogen) captured with anti-GFP antibody (Abcam,"}
+{"text": "In order to achieve this objective, we have investigated the molecular design of such a polymer system. As a result, we were the first to demonstrate a self-oscillating polymer system driven in a solution where only malonic acid existed, which could convert the chemical energy of the Belousov-Zhabotinsky (BZ) reaction into a change in the conformation of the polymer chain. To cause the self-oscillation in solution, we have attempted to construct a built-in system where the required BZ system substrates other than the organic acid are incorporated into the polymer itself. That is, the novel polymer chain incorporated the metal catalyst of the BZ reaction, a pH-control site and an oxidant supply site at the same time. As a result of introducing the pH control and oxidant supply sites into the conventional-type self-oscillating polymer chain, the novel polymer chain caused aggregation-disaggregation self-oscillations in the solution. We clarified that the period of the self-oscillation of the novel self-oscillating polymer chain was proportional to the concentration of the malonic acid. Therefore, the concentration of the malonic acid can be determined by measuring the period of the novel self-oscillating polymer solution. In this review, we introduce the detailed molecular design of the novel self-oscillating polymer chain and its self-oscillating behavior. Moreover, we report an autonomous self-oscillating polymer gel actuator that causes a bending-stretching motion under the constant conditions.If we could realize an autonomous polymer system driven under biological conditions by a tailor-made molecular design, human beings could create unprecedented biomimetic functions and materials such as heartbeats, autonomous peristaltic pumps,  As a result, we were the first to report the autonomous and spontaneous aggregation-disaggregation self-oscillation of the polymer chain and the swelling-deswelling self-oscillation for a polymer gel under the constant conditions in the presence of the BZ substrates other than the metal catalyst. However, the operating conditions of the self-oscillating polymer system are limited to a non-physiological environment where the strong acid and the oxidant coexist. For extending the application field to biomaterials, a more sophisticated molecular design to effect the self-oscillation under physiological conditions is needed. In this review, we introduce the detailed molecular design of a self-oscillating polymer system to drive the self-oscillation in a solution where only malonic acid exists. Moreover, we show an autonomous self-oscillating polymer gel actuator that causes the desired bending-stretching motion under constant conditions.Under thermodynamic equilibrium conditions, autonomous motions of macroscopic systems are tightly restricted, in the accordance with the Second Law of Thermodynamics. On the other hand, under thermodynamically open conditions, many living organisms can generate an autonomous motion without external driving stimuli. In a living body, the mechanisms generating autonomous and stimuli-responsive activities are inherent. Moreover, all living organisms involve a system capable of isothermal conversion of chemical energy into mechanical work. The biological system is significantly efficient because the chemical energy is directly converted the mechanical energy without intermediate steps. If autonomous polymer systems could be realized by completely synthetic polymers like living organisms acting under biological conditions, unprecedented biomimetic materials would be created. Here we report biomimetic polymers that cause self-oscillations induced by the Belousov-Zhabotinsky (BZ) reaction. The BZ reaction is well known for exhibiting temporal and spatiotemporal oscillating phenomena \u20139. Untilco-Ru(bpy)3) chain as a pH control site  = 0.084 M), and nitric acid ([HNO3] = 0.894 M). One end of the gel strip was sandwiched in the incision of the silicone rubber. The bending and stretching oscillations for the gel strip were measured under constant temperature. Shape changes of the gel strip were observed and recorded using a microscope , LED light (LEDR-74/40W), and a video recorder .The gel membrane  was immersed in 8 mL of an aqueous solution containing malonic acid ([MA] = 0.0625 M), sodium bromate ([NaBrO3.co-Ru(bpy)3-co-AMPS) 3 content increased, the sharpness of the change in transmittance with temperature became duller in the reduced state, due to the hydrophobic interaction between the polymer chains [We measured the LCST  for different concentrations of the poly(NIPAAm-co-AMPS)  in the rr chains . In geneco-Ru(bpy)3-co-MAPTAC) (see co-Ru(bpy)3).As the second step, we synthesized the novel self-oscillating polymer chain with the cationic MAPTAC moiety as an oxidant supply site. The LCST for the poly(NIPAAm-TAC) see  in the r3\u2212) by itself as a counter ion to MAPTAC site, the self-oscillation was achieved without adding oxidizing agent. That is, the aggregation-disaggregation self-oscillation was caused under oxidant-free conditions. In order to cause the oscillation, a sufficient amount of BrO3\u2212 is necessary. Therefore, the self-oscillation was not observed when the polymer concentration was below 5.0 wt%. Since the poly(NIPAAm-co-Ru(bpy)3-co-MAPTAC) has the LCST around 55 \u00b0C in the reduced state, the polymer has an advantage to cause self-oscillation around body temperature as shown in This phenomenon is generally observed in NIPAAm-based polyelectrolytes when their ionic charges increase. On the other hand, in the oxidized state, the LCST disappeared because the polymer becomes highly hydrophilic. etc. Further, it is a special tendency for the MAPTAC-containing polymer that the self-oscillation continues for a longer time compared to the other polymers. For example, the self-oscillation lasted more than three hours at 27 \u00b0C. The longer duration of the self-oscillation is also attributed to the higher LCST of the polymer chain to avoid aggregation due to intermolecular hydrophobic interaction in the reduced state. Moreover, in contrast to poly(NIPAAm-co-Ru(bpy)3-co-AMPS) the polymer has no anionic site, which also acts to prevent aggregation. As shown in 32+ part. Once the polymer aggregates, they could not be easily disaggregated, even in the oxidized state. This characteristic leads to the damping aggregation-disaggregation self-oscillation.This characteristic is of significant importance for applications to biomimetic soft robots and soft actuators such as artificial muscles, co-Ru(bpy)3-co-AMPS-co-MAPTAC), that is, the pH control and oxidant supply sites coexist in the polymer chain at the same time. co-Ru(bpy)3-co-AMPS-co-MAPTAC)  see  solution+, BrO3\u2212 and Br\u2212 ions by itself as a counter ion from the AMPS, MAPTAC and Ru(bpy)3 sites, respectively. In order to cause self-oscillation induced by the BZ reaction under the solution where only malonic acid existed, sufficient amounts of H+, BrO3\u2212 and Br\u2212 ion are needed. Therefore, no self-oscillation of the novel polymer solution was observed in the concentration below 6.5 wt%. The aggregation-disaggregation self-oscillation of the novel polymer solution was attributed to the different solubilities between in the reduced and oxidized state. As shown in The novel polymer chain supplied Hco-Ru(bpy)3-co-AMPS) gel strip at 18 \u00b0C. In order to drive the poly(NIPAAm-co-Ru(bpy)3-co-AMPS) gel strip, the gel was immersed into an aqueous solution containing all the substrates , except the catalyst. As the solution penetrates into the gel, the BZ reaction takes place within the gel phase with the aid of the Ru(bpy)3 complex as the catalyst. As the reaction proceeds, the Ru(bpy)3 catalyst repeatedly changes between the oxidized and reduced state. First, the chemical wave evolves in the gel, and it propagates in the direction of the length at a constant speed from the tip of the gel to the edge fixed to the surface. As the chemical wave passes through the gel strip, a spontaneous bending and stretching motion of the gel occurred. While the chemical wave exists in the gel (1\u21924), the gel strip stretched. After that, during the reduced state (5\u21926), the gel bended until the next wave appeared. That is, the direction of the bending and stretching motion of the gel strip is decided by the redox Ru state. In addition, as the edge of the gel strip was fixed on the surface, the trajectory of the gel was a pendulum-like motion as shown in co-Ru(bpy)3-co-AMPS) gel is about a hundred times as large as that of the conventional-type self-oscillating poly(NIPAAm-co-Ru(bpy)3) gel.During the course process of these investigations, we found the high potential of the AMPS-containing self-oscillating polymer systems for causing novel self-oscillating behaviors. By utilizing the self-oscillating polymer system with an AMPS component, we were the first to succeed in causing viscosity self-oscillation and on-off switching of the transmittance self-oscillation. Moreover, by introducing the AMPS into the conventional-type self-oscillating polymer gel, we were the first to succeed in increasing the displacement of the self-oscillating polymer gel. 4.We have succeeded for the first time in causing the aggregation-disaggregaion self-oscillation of a novel polymer chain in a solution where only malonic acid existed. The novel polymer chain incorporated at the same time the metal catalyst of the BZ reaction, the pH-control (AMPS) and the oxidant supply (MATPAC) sites. As for the novel quarternary polymer chain, the effect of the concentration of the malonic acid on the self-oscillating behavior was investigated. As a result, the relationship between the period and the concentration of the malonic acid was shown to be a good straight-line relation. Moreover, we succeeded in increasing the displacement of the self-oscillating gel by introducing the AMPS component into a conventional-type self-oscillating gel. By utilizing the large displacement of the gel with the AMPS, novel autonomous gel actuators were realized."}
+{"text": "In a case\u2013control study of 107 adults with leukaemia and 110 orthopaedic controls in China, a reduced risk was found with longer duration, higher quantity, and frequency of green tea intake. Tea is one of the most frequently consumed beverages in the world . DiffereThere is some evidence of a protective effect of green tea consumption on certain cancers  demography and lifestyle; (b) tea consumption; (c) hazard exposure and family history of malignancy. Most cases were recent patients interviewed within 3\u20136 months of diagnosis. Details of leukaemia subtype and stage were retrieved from hospital records.liang, equivalent to 50\u2009g), and date of cessation. Frequency of cups was categorised as never or seldom, once a month, 2\u20133 times a month, once a week, 2\u20133, 4\u20136 times a week, once a day, 2\u20133, and \u2a7e4 times a day.Tea consumption was measured using a questionnaire adapted from our previous studies, its reproducibility evaluated in a test\u2013retest study where the intraclass correlation coefficient was 0.83 for tea  of adult leukaemia and associated 95% confidence intervals (CIs) for green tea consumption as an explanatory variable were estimated using unconditional logistic regression. Multivariate models included potential confounders identified using univariate analysis and risk factors reported in other studies  drank both green and black tea, all tea drinkers were classified as green tea drinkers. All comparisons used a Of leukaemia subtypes, 72 (67.3%) were acute myeloid leukaemia (AML), 22 (20.6%) acute lymphocytic leukaemia (ALL), 10 (9.3%) chronic myeloid leukaemia (CML), and 3 (2.8%) chronic lymphocytic leukaemia (CLL). Selected characteristics are shown in vs 54%). There was no significant difference in residential area, education, or smoking.Selected characteristics of green tea drinkers and nontea drinkers are presented in Compared with nontea drinkers or infrequent tea drinkers, the adjusted ORs and associated 95% CIs were 0.39 (0.17\u20130.91), 0.20 (0.06\u20130.60), 0.40 (0.19\u20130.82), and 0.42 (0.20\u20130.86) in those who consumed green tea at \u2a7e1001\u2009g of dried tea leaves per annum, for >20 years, at \u2a7e1 cup a day, and at \u2a7e1 new batches a day, respectively . A signiThis case\u2013control study found that higher intake of green tea was associated with a reduced risk of adult leukaemia and with significant dose\u2013response relationships, the first such evidence, although a US hospital-based case\u2013control study recently reported a negative association between black tea and AML in women (The few identified risk factors in adult leukaemia account for only a small proportion of cases and include ionising radiation, exposure to benzene, pesticides, immunosuppression, chemotherapy, and smoking (The case\u2013control design may have introduced bias and the study size was relatively small, although recruitment was carefully conducted. The response rate was high, and the matched controls were randomly selected from the same hospitals. Most patients in China are self-referred, and the recruitment procedure ensured that cases and controls came from the same populations. Selection bias among controls from convenience or clinician contact was also minimised.Details were obtained on tea consumption as well as on lifestyle factors and exposures using a validated instrument, designed for residents in southeast China. Our research interest in any type of tea consumption was revealed at the time of the interview to explain why the questions on tea were so detailed. We consider the likelihood of any information bias to have been low, and it is relevant that there had been no mention in the popular media of any link between tea and leukaemia.We found a higher proportion of nontea drinkers than in previous studies and that tea drinking was associated with older age. Although tea consumption can be reported with reasonable accuracy, misclassification may still occur. However, when nondifferential, such errors are likely to bias results towards the null and could not account for the significant inverse associations. Exposure of cases to risk factors may change due to disease status, but most were newly diagnosed within 3\u20136 months.In conclusion, this study suggests that a higher intake of green tea is associated with a reduced risk of adult leukemia, but the finding needs to be checked in larger studies."}
+{"text": "She was the product of nonconsanguineous marriage and was the first of seven children in birth order. One younger female sibling has similar symptoms. No history of similar symptoms in either of the parents was present. General physical examination was normal. On central nervous system examination, patient was conscious with the evidence of impaired attention, calculation, recall, judgment, reasoning power and abstract thinking with mini mental state examination score of 23/30. Examination of cranial nerves including fundus was normal. Speech was dysarthric. She had normal muscle bulk with spasticity of lower limbs. The power in lower limbs was grade IV in all groups of muscles. All the deep tendon reflexes in both upper and lower limbs were symmetrically brisk and plantar response was bilaterally extensor. Sensory system examination was normal. She had rest tremor in upper limbs and the gait was spastic. Rest of the neurological examination was normal. On laboratory investigation, her hemogram, blood sugar, renal and liver functions, thyroid profile was found to be normal. Serum vitamin B12 was in the normal range. Cerebrospinal fluid analysis, electromyography and nerve conduction studies were normal. MRI brain and spinal cord was done, which revealed thin corpus callosum with frontoparietal cortical atrophy on the T1-weighted image [A 42-year-old female presented with history of progressive spastic gait disturbance for the past 12 years. She had normal developmental milestones during childhood but dropped school in 12ed image , T2-weiged image  and fluied image . SymmetrSPG11 gene, also known as KIAA1840/FLJ21439, encodes for the protein spatacsin.[SPG7, SPG15, SPG21, SPG32, and HSP-TCC epilepsy).[Hereditary spastic paraplegia (HSP) is a heterogeneous group of familial neurodegenerative disorders characterized by progressive lower limb spasticity. Clinically, they are classified as \u201cpure\u201d when spastic paraplegia exists in isolation and as complicated when other major clinical features such as mental retardation, optic atrophy, retinopathy, extra pyramidal symptoms, ataxia, deafness, cerebellar signs, muscle wasting, epilepsy, and ichthyosis are present. Genetically autosomal dominant, autosomal recessive and X-linked recessive forms of inheritance are seen with both pure and complicated forms. HereditaMRI findings described are thin corpus callosum, frontoparietal atrophy and enlargement of lateral ventricles, reduced size of thalamus and symmetrical white matter lesions.6 Thin coThe diagnostic criteria of autosomal recessive HSP with thin corpus callosum are (a) autosomal recessive inheritance, (b) slowly progressive spastic paraparesis and mental impairment, (c) thinning of corpus callosum revealed by CT/MRI and (d) exclusion of other disorders by laboratory tests and MRI of spine and brain. A Pubmed"}
+{"text": "We experienced two cases of the influx of the sclerotomy site bleeding into the anterior chamber during 23-gauge sutureless vitrectomy for pseudophakic rhegmatogenous retinal detachment. Soon after the removal of a 23-gauge microcannula at the end of the surgery, presumed sclerotomy site hemorrhage was rapidly fluxed into the anterior chamber. The anterior chamber bleeding might come from the sclerotomies rather than from episcleral vessels. The posterior pressure in the gas-filled pseudophakic eye might have pushed the sclerotomy site bleeding into the anterior chamber. We could not find any vitreous hemorrhages. The hemorrhage within the anterior chamber spontaneously absorbed within 14 days. Transconjunctival sutureless vitrectomy has gained popularity in recent years. The use of 25-gauge or 23-gauge instruments showed many advantages over the conventional 20-gauge vitrectomy system, and there were many reports on the safety and efficacy of 25-gauge or 23-gauge vitrectomy for a variety of vitreoretinal diseases.2 HoweverA 57-year-old man with diabetes was diagnosed with inferotemporal pseudophakic rhegmatogenous retinal detachment with a retinal tear at the 11 o\u2019clock position in the right eye. Best-corrected visual acuity (BCVA) was 20/200 and the axial length was 22.86 mm.3F8) exchange were performed. At the end of the surgery, the three microcannulae were withdrawn from the scleral tunnel and the immediate postoperative tactile intraocular pressure (IOP) felt normal [Vitreous surgery was carried out using a 23-gauge vitreous cutter driven by a vitrectomy unit  and the DORC two-step system . The procedure was started with a scleral tunnel incision radial to the limbus, as Eckardt described.[t normal . About 1t normal . It was t normal . Surgeryt normal  and the A 46-year-old man without diabetes was diagnosed with superior pseudophakic rhegmatogenous retinal detachment with a retinal tear at the 12 o\u2019clock position in the right eye. BCVA was 20/100 and the axial length was 24.05 mm.3F8) exchange were performed. At the end of the surgery, the three microcannulae were withdrawn from the scleral tunnel and the immediate postoperative tactile IOP felt normal [Vitreous surgery was carried out using a 23-gauge vitreous cutter and the DORC two-step system. During the surgery, there were no specific events. Endolaser photocoagulation and air-gas (12% Ct normal . About 2t normal . It was t normal . Meanwhit normal  and the et al.[The scleral incision with the 23-gauge or 20-gauge stiletto blade could frequently lead to bleeding from episcleral vessels or sclerotomies. Even though it is only mild bleeding, diathermy has usually been used in conventional 20-gauge vitrectomy. However, it is unavailable in transconjunctival sutureless vitrectomy. Experienced surgeons have noticed that the placement of the microcannula within the tunnel always resulted in the stoppage of the bleeding and the withdrawal of the cannula sometimes resulted in minor subconjunctival bleeding in the area of sclerotomy.[et al. reportedIn this study, both patients had two-step 23-gauge sutureless vitrectomy and gas tamponade for pseudophakic rhegmatogenous retinal detachment. Intraoperatively, we could not find any intraocular or periocular hemorrhage except for minor subconjunctival bleeding in the area of sclerotomy. Soon after the removal of the microcannulae at the end of the surgery, we noticed significant subconjunctival bleeding just in one eye. Furthermore, the hemorrhage inflowing into the anterior chamber is considered as intraocular hemorrhage. Therefore, we suppose that the anterior chamber bleeding might come from the sclerotomies rather than from episcleral vessels. The posterior pressure in the gas-filled pseudophakic eye might have pushed the sclerotomy site bleeding into the anterior chamber.Although anterior chamber bleeding after sutureless vitrectomy is a rare complication, clinicians should be aware of this inevitable adverse event when preparing patients for pseudophakic rhegmatogenous retinal detachment surgery."}
+{"text": "We report a case of fetal nuchal cystic hygroma associated with aortic coarctation and trisomy 21. A stillborn baby, delivered at 15 weeks and 5 days of gestation, had a huge nuchal cystic hygroma. Autopsy revealed aortic coarctation of the periductal type with patent ductus arteriosus, endocardial cushion defect and left ventricular hypoplasia. Trisomy 21 was evident by karyotyping. Macroscopically, while an apparent association of nuchal cystic hygroma and aortic coarctation resembled Turner syndrome, histopathological findings were those typically seen in trisomy 21: numerous dilated lymphatics in the subcutaneous tissue with severe mesenchymal edema, and an enlarged jugular lymphatic sac. Various lymphatic abnormalities cause jugular lymphatic distension resulting in nuchal edema and cystic hygroma ,2. IncreA stillborn Japanese baby, delivered at 15 weeks and 5 days of gestation, weighed 145 g and measured 16.6 cm long. At autopsy, no apparent malformation was noted except for a huge nuchal cystic mass measuring 20 \u00d7 15 mm, , arrows Nuchal edema or cystic hygroma observed as increased nuchal translucency by ultrasound examination is regarded as a marker for aneuploidy. Since nuchal cystic hygroma is frequently associated with Turner syndrome with aortic coarctation, nuchal translucency is used as a marker for the antenatal diagnosis of aortic coarctation also . Indeed,"}
+{"text": "Aegilops tauschii Coss. has extensive natural variation available for breeding of common wheat. Drought stress tolerance is closely related to abscisic acid (ABA) sensitivity. In this study, 17 synthetic hexaploid wheat lines, produced by crossing the tetraploid wheat cultivar Langdon with 17 accessions of Ae. tauschii, were used for comparative analysis of natural variation in drought tolerance and ABA sensitivity. Ae. tauschii showed wide natural variation, with weak association between the traits. Drought-sensitive accessions of Ae. tauschii exhibited significantly less ABA sensitivity. D-genome variations observed at the diploid genome level were not necessarily reflected in synthetic wheats. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from drought-sensitive accessions. Moreover, synthetic wheats with high drought tolerance showed significantly higher ABA sensitivity than drought-sensitive synthetic lines. In the hexaploid genetic background, therefore, weak association of ABA sensitivity with drought tolerance was observed. To study differences in gene expression patterns between stress-tolerant and -sensitive lines, levels of two Cor/Lea and three transcription factor gene transcripts were compared. The more tolerant accession of Ae. tauschii tended to accumulate more abundant transcripts of the examined genes than the sensitive accession under stress conditions. The expression patterns in the synthetic wheats seemed to be additive for parental lines exposed to drought and ABA treatments. However, the transcript levels of transcription factor genes in the synthetic wheats did not necessarily correspond to the postulated levels based on expression in parental lines. Allopolyploidization altered the expression levels of the stress-responsive genes in synthetic wheats.The wild wheat  However, naturally occurring variants still provide an important alternative source of genetic variation [Arabidopsis demonstrates the usefulness of wild populations for identification of genetic loci accounting for naturally occurring variation in abiotic stress tolerance [Abiotic stress signal pathways have been studied using artificially generated mutants in the model plant ariation . Recent olerance \u20134. Naturolerance .Triticum aestivum L.). Under abiotic stress conditions, plant cells undergo drastic physiological, biochemical and metabolic changes leading to the development of stress tolerance at the cellular level. One of the mechanisms behind development of stress tolerance is induction of the Cor (cold-responsive)/Lea (late-embryogenesis-abundant) gene family; COR/LEA proteins promote the development of stress tolerance by protecting cellular components from stress [Cor/Lea genes are not only responsive to low temperature but also to drought and abscisic acid (ABA). Many low temperature- and drought-inducible genes contain both C-repeat (CRT)/dehydration-responsive element (DRE) and ABA-responsive element (ABRE) motifs in their promoters, and these cis elements are considered to function independently. Expression of these Cor/Lea genes is regulated by major transcription factors in the CBF/DREB and AREB/ABF families under abiotic stress conditions such as low temperature and osmotic stress [Abiotic stresses such as drought, temperature and salinity reduce yield of common wheat -type AREB/ABF proteins bind as dimers to ABRE and activate ABA-dependent gene expression [ABA is one of the key plant hormones responding to environmental stress . ABA is nous ABA , and ABRbidopsis \u201313. The pression \u201316.Cor/Lea genes such as Wdhn13 and Wrab17 [CBF homologs such as TaCBF, TaDREB1 and WCBF2 encode transcription factors recognizing the CRT motif [CBF homologs, TaDREB1 expression is clearly responsive to drought stress and ABA. In addition, wheat bZIP-type transcription factors, WABI5, TaOBF1 and WLIP19, bind to the Cor/Lea promoter regions and directly activate Cor/Lea gene expression [WABI5, TaOBF1 and WLIP19 is increased after drought stress and ABA treatment in leaves of common wheat seedlings. Thus, Cor/Lea gene expression mediated by CBF/DREB and bZIP-type transcription factors might play a central role in development of abiotic stress tolerance in wheat.CRT/DRE, ABRE and other cold-responsive motifs have been identified in the 5\u2032 upstream regions of many wheat d Wrab17 . Wheat CRT motif \u201324. Of tpression ,26. ExprAegilops tauschii Coss. (syn. Ae. squarrosa Eig.), a wild relative of wheat, is one of the diploid progenitors of common wheat [Triticum turgidum L.), including emmer and durum wheats, and Ae. tauschii [Ae. tauschii is widely distributed in Eurasia and shows abundant genetic variation [Ae. tauschii populations involved in the origin of common wheat are limited to a narrow distribution range relative to the entire species range, suggesting that this species holds vast genetic diversity that is not represented in common wheat [Ae. tauschii population provides potential for improving modern varieties of common wheat. In fact, hexaploid synthetic wheat derived from crosses between tetraploid wheat and Ae. tauschii has the potential to provide new genetic variation for abiotic stress tolerance [on wheat ,28. Commtauschii ,30. Ae. ariation \u201336. The ariation . Therefoon wheat . Naturalolerance .Ae. tauschii. Next, we examined expression of the natural variation in synthetic hexaploid lines produced by crossing the tetraploid wheat cultivar Langdon with Ae. tauschii accessions. In addition, we compared expression of the Cor/Lea and Cor/Lea transcription factor genes to analyze the molecular nature of the natural variation in both synthetic wheats and their parental accessions. Based on these results, we discuss the relationship between drought tolerance and ABA sensitivity and the usefulness of Ae. tauschii variation in wheat breeding.In the present study, we surveyed naturally occurring genetic variation in drought tolerance and ABA sensitivity in 2.2.1.Ae. tauschii were examined to evaluate the level of drought tolerance and exogenous ABA sensitivity (Ae. tauschii accessions (Thirty accessions of sitivity . The drocessions . All acccessions .Ae. tauschii. The ABA sensitivity was measured by the relative growth inhibition rate (% reduction in the presence ABA relative to growth in the absence of ABA).It was previously reported that cultivar difference of responsiveness to exogenous ABA was corresponding to the difference of abiotic stress tolerance in common wheat . Here, wAe. tauschii accessions  to 65.4 \u00b1 22.4% (KU-2160) in the 30 cessions , 1D. TheAe. tauschii accessions was compared with its drought tolerance. KU-20-1 showed exceptionally low drought tolerance in spite of high ABA sensitivity. In the 29 other accessions, the correlation between drought tolerance and ABA sensitivity was positive (2R=0.0993), but not significant (t-test showed that the ABA sensitivity of the drought-sensitive group was significantly (P < 0.05) lower than that of the moderately and highly tolerant groups (The ABA sensitivity of each of the 30 nificant . These 2t groups .2.2.Triticum durum cv. Langdon and 17 Ae. tauschii accessions (3 seeds examined from single F2 plants of each synthetic. All the synthetics were highly fertile and there was no segregation of plants with excessively reduced height (indicative of haploidy or aneuploidy) in the F2 populations (data not shown), suggesting that the synthetics were hexaploid and stable.Seventeen lines of synthetic wheats were used to evaluate the level of drought tolerance and ABA sensitivity. These 17 lines were derived from interspecific crosses between a tetraploid wheat accession cessions . The somAe. tauschii accessions (Ae. tauschii accessions (2R=0.238), but the correlation was not significant (P=0.24) . A total of six synthetic wheats were classified into group B and seven into group C, for which the respective parental Ae. tauschii accessions exhibited moderate (20\u201350%) and high (>50%) drought tolerance levels. The group C lines showed significantly higher drought tolerance than group A  . The 17  group A . In grou group A .R=0.424) of the ABA sensitivity between synthetic wheats and parental Ae. tauschii accessions was not significant (P=0.09)  to 83.5 \u00b1 8.2% (Langdon x KU-2829A) under the 20 \u03bcM ABA condition. The correlation ((P=0.09) . The 17  Langdon .R) values between drought tolerance and ABA sensitivity were 0.49 (P=0.122) in the parental Ae. tauschii accessions and 0.29 (P=0.26) in the synthetic wheats  and KU-2829A (high ABA sensitivity), and synthetic lines derived from them were selected. Both KU-2811 and a synthetic wheat line derived from Langdon and KU-2811 showed the lowest ABA sensitivity, while KU-2811 was the most drought-sensitive. The ABA sensitivity of both KU-2829A and a synthetic wheat line derived from Langdon and KU-2829A was high, and the drought tolerance of the KU-2829A-derived synthetic line was also high.To compare gene expression patterns between lines with low and high ABA sensitivity, two Cor/Lea genes, Wrab17 and Wdhn13, are responsive to exogenous ABA and drought stress treatment [Actin gene used as an internal control were not changed by stress treatment in any of the accessions and lines examined. Wrab17 transcript accumulation was clearly induced by ABA and drought treatment in both Ae. tauschii accessions  and drought  treatments. Transcript levels relative to Langdon (0.5 h) were calculated for both the parental Ae. tauschii accessions and the synthetic wheat lines. The transcript levels in the synthetic wheats were also compared with the postulated transcript levels, which were calculated as a 2:1 mixture of Langdon and the parental Ae. tauschii accession. Transcript levels of TaDREB1, WABI5 and TaOBF1 in KU-2829A were much higher than those in KU-2811 after ABA treatment  in the ABA-dependent signal pathway. In Arabidopsis, the Versailles core collection contains significant natural variation in freezing tolerance, CBF gene sequences and CBF and Cor/Lea gene expression patterns [CBF and Cor gene expression in freezing-tolerant accessions, neither CBF nor Cor gene expression is closely correlated with freezing tolerance, and the CBF genes alone cannot explain all differences in the level of freezing tolerance [Ae. tauschii accessions should be identified via a mapping-based approach.Two on wheat . In common wheat . Similar KU-2811 . Althougus study . TaDREB1d Wdhn13 , and WABon wheat ,26. The patterns . Althougolerance , which iWDREB2 gene expression pattern has been reported in hexaploid synthetic wheats [Cor/Lea genes and the genes encoding their transcription factors indicated that their expression patterns in the hexaploid synthetics seemed to be additive of those in their parental lines under both exogenous ABA treatment and drought conditions . All 17 synthetics were independently generated through unreduced gamete formation in each of the triploid F1 hybrids [Ae. tauschii male parents. All grew normally and showed none of the hybrid lethality or weakness, such as necrosis and chlorosis, often observed in triploid hybrids between tetraploid wheats and Ae. tauschii [3 seeds from one F2 plant of each synthetic, using the standard acetocarmine squash method.A total of 30 he study . Passpor  of synthetic wheats (F3 generation) were dehydrated on dry paper for 4 d at 23\u00b0C. Stress-treated seedlings were transferred back to the standard conditions, and on the 7th day after transfer, the number of surviving seedlings was recorded. To bioassay ABA sensitivity based on post-germination growth, seeds were imbibed under tap water for 5 h and kept overnight at 4\u00b0C. Imbibed seeds were placed in a glass petri dish containing filter paper wetted with distilled water, and incubated for 24 h at 20\u00b0C in darkness. Ten synchronously germinated seeds were further treated with distilled water or 10 or 20 \u03bcM ABA solution under the same conditions as the germination assay. After 3 d, the length of primary roots was recorded. The whole experiment was repeated at least three times. The data were statistically analyzed using JMP software ver. 5.1.2 (SAS Institute). Correlations among the morphological traits were estimated based on Pearson correlation coefficient values.Seedlings were grown under standard conditions (23\u00b0C) according to Kobayashi et al. . For ana4.3.Cor/Lea genes such as Wdhn13 and Wrab17 and their three transcription factor genes, TaDREB1, WABI5 and TaOBF1, was detected by RT-PCR amplification as previously reported [TaDREB1 was conducted with the following gene-specific primer pair: 5\u2032-AGTCTCCTCCTTCTC TTATCTC-3\u2032 and 5\u2032-TTCTTGTACCCGTTGACTTATG-3\u2032. The actin gene (Actin) was used as an internal control with the following gene-specific primer pair: 5\u2032-GGCTGGTTTTGCTGGTGACGA AT-3\u2032 and 5\u2032-AATGAAGGAAGGCTGGAAGAGGA-3\u2032. The PCR products were separated by electrophoresis through a 1.5% agarose gel and stained with ethidium bromide for detection.Total RNA was extracted from the leaves of 7-d-old seedlings for various times under stress conditions. Seven-day-old seedlings were also treated with a solution containing ABA 20 \u03bcM) by a foliar spray or were dehydrated on dry filter paper in a desiccator. The transcript accumulation of reported ,20. RT-P \u03bcM by a \u00ae Real Time System  and gene-specific primer sets. For TaDREB1 and WABI5, the following two primer pairs were designed: 5\u2032-TCTCTCTCGTCCCTCTTCTC-3\u2032 and 5\u2032-TTTTCCTCCTTCCACTTCTT-3\u2032, and 5\u2032-GGGATTGTGAGGGGGAGGAG-3\u2032 and 5\u2032-GGCGGACTCCCTGTTCTTGA-3\u2032, respectively. For the other genes, the same primer pairs used for RT-PCR amplification were used in the quantitative RT-PCR. As an endogenous control, Actin was used. The rate of amplification was monitored by SYBR\u00ae Premix Ex Taq\u2122 II (Takara-Bio) according to the manufacturer\u2019s protocol. Results were presented as 2\u2212\u0394Ct, where Ct is the number of PCR cycles required to reach the log phase of amplification for the examined genes minus the number of cycles to reach the same stage for Act, and then were represented as values relative to the transcript levels in samples of Langdon obtained at 0.5 h.Quantitative RT-PCR was performed using a Thermal Cycler Dice5.Ae. tauschii, had large genetic variation in drought tolerance and exogenous ABA sensitivity. The level of drought tolerance was at least partly related to ABA sensitivity. Similarly, synthetic wheats derived from hybrids between Langdon and Ae. tauschii accessions showed wide variations in drought tolerance and ABA sensitivity, although no significant correlation between the synthetic wheats and their parental Ae. tauschii accessions was observed. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from the drought-sensitive accessions. Therefore, Ae. tauschii accessions with high levels of abiotic stress tolerance are expected to be useful resources to breed abiotic stress-tolerant cultivars of bread wheat. Allohexaploidization altered the expression profile of abiotic stress-responsive genes. Previous studies on the transcriptome in allopolyploids used a limited number of artificially produced lines. Therefore, further studies, including detailed systematic analyses, will be needed to explain the molecular basis of modifications of D-genome variation patterns following allopolyploidization.A wild wheat progenitor,"}
+{"text": "Rickets has emerged as a public-health problem in Bangladesh during the past two decades, with up to 8% of children clinically affected in some areas. Insufficiency of dietary calcium is thought to be the underlying cause, and treatment with calcium  is curative. Despite this apparently simple treatment, little is known about the most appropriate management of bone deformities of affected children, and further studies are needed to determine the details of dosing and duration of calcium therapy, the role of bracing, and specific indications for surgical intervention. Effective preventive measures that can feasibly reach entire communities are needed, and these may differ between various affected regions. Rickets is a condition associated with bone-deformity due to inadequate mineralization in growing bones ,2. WhileIn an effort to review current knowledge about nutritional rickets and to prioritize ongoing research, 135 people gathered in Dhaka in January 2006 for an International Congress on Rickets. Fourteen clinician-scientists\u2014as part of the Rickets Convergence Group\u2014provided plenary presentations, and other delegates contributed to lively discussions. Arising from material presented at this congress, this article provides an overview of the history, epidemiology, clinical findings, treatment, and prevention of nutritional rickets from both global and Bangladeshi perspectives. In so doing, an agendum for future research is proposed.Rickets was first reported in the mid-1600s in Europe .th century  conducted a nationwide survey in 2000 and repeated it in 2004. Rickets was identified as visible varus and/or valgus deformities in children aged 1\u201315 year(s). Nationally, rachitic deformities were found in 0.26% of 21,571 surveyed children in 2000 and in 0.12% of 10,005 surveyed children in 2004. Rickets was found in more than half of the subdistricts with the highest prevalence being found in Sylhet (North-East) and Chittagong (South-East) divisions. The highest prevalence (1.4%) among 1 to 15 year(s) old children with visible rachitic deformities was found in the Cox's Bazaar subdistrict. A survey of all inhabitants in Chittagong carried out by the Bangladesh Rural Advancement Committee found rachitic deformities in 0.9% . A more In Bangladesh, results of initial studies suggested that vitamin D deficiency was not a major causal factor in the prevalent rickets, and calcium deficiency is assumed to be the primary aetiologic factor . In BangThe clinical features of rickets are similar around the world, but the age of presentation and the risk of hypocalcaemic symptoms, such as tetany, vary depending on the age of presentation and the relative importance of vitamin D  deficiency in different populations. In areas where vitamin D deficiency is more common, rickets usually presents in the first year of life often with clinically-significant hypocalcaemia. In parts of Africa and in Bangladesh , rickets usually presents from the second year of life, and hypocalcaemic tetany is much less commonly seen.Growth plates become soft as a result of diminished mineralization. With weight-bearing, gravitational pressure causes soft bones to curve in response to forces exerted across joints. Thus, the long bones of the leg curve\u2014becoming \u2018bow legs\u2019 or, show up later onset of rickets in the form of \u2018knocked knees\u2019 . MetaphyThe use of specific physical examination criteria for a diagnosis of rickets, is, however, difficult. Determination of \u2018wide\u2019 wrists and \u2018beaded\u2019 ribs is a subjective experience in subtle cases. There are broad ranges of \u2018normal\u2019 lower limb curvature, fontanel closure, and tooth eruption. A Nigerian study has, however, given some basis for a clinical diagnosis of rickets when alkaline phosphatase levels and wrist/knee radiographs are not available . SpecifiWhen resources are available, laboratory and radiologic testing should be used for confirming the diagnosis and aetiology of rickets. The serum alkaline phosphatase level is elevated when rickets is active, and x-rays of the knees and wrists show widened epiphyses with cupping and fraying of the metaphyseal border. Serum parathyroid hormone concentrations are usually elevated. With vitamin D-deficiency rickets, the 25-hydroxyvitamin D level is low, typically below 10 ng/mL (25 mmol/L). Without vitamin D deficiency, calcium deficiency stimulates elevation of the 1,25-dihydroxyvitamin D level, while the 25-hydroxyvitamin D levels remain normal or near-normal.Rickets can be devastating to children. Affected children potentially experience delays in learning to walk, pain and fractures, and crippling deformities. In addition, rickets dramatically increases the risk of pneumonia , a condiWithout medical management, rachitic leg-deformities can persist and worsen. Effective management of rachitic children begins with an appropriate diagnosis. When rickets is biologically active , curative therapy is needed. This can consist either of supplementation of vitamin D  or of replacement of calcium  .Doses of vitamin D for treatment are much higher than the doses needed to prevent rickets. When rickets is due to vitamin D deficiency, treatment may be initiated with vitamin D .For calcium-deficiency rickets, various doses have been used. In a Nigerian study, supplement of 1,000 mg of elemental calcium daily  was effective when used for six months . In anotOnce medical treatment has prompted correction of biologically-active rickets , the focus of treatment shifts to providing for the restoration of deformed extremities to functional alignment. With ongoing mineralization and weight-bearing, even severe deformities can improve Fig. . NonetheWhen severe deformities persist despite medical therapy and ongoing longitudinal growth, surgical therapy can be considered. Evidence-based guidelines are not, however, available to guide the selection of children for surgery or to determine the timing of surgical intervention.Ideally, rickets should be addressed by a community intervention, impacting all areas of life. To this end, the Chakaria Disabled Centre seeks to provide community education about the prevention and treatment of rickets. Through international collaborations, public-health education is provided. Consultation and diagnostic evaluation are provided for children, and therapeutic regimens are initiated. Even in traditional health centres, the management of rickets should fit within the framework of the Integrated Management of Childhood Illness programme  in such choon\u2019\u2014calcium hydroxide when melted in water) could be feasible, acceptable product to provide therapeutic doses of calcium. Increasing the intake of sesame seeds, green-leafy vegetables, crushed fish (containing the bones), and dairy products (if affordable and desirable) might also provide adequate increases in calcium intake to prevent rickets. Preliminary observational studies in Chakaria suggest that 90% of rachitic children with mild deformities of the leg (deformity angle less than 20o) improve during one year of nutritional education. In another retrospective review of 193 children, 75% had resolution of their rickets and reduction of the deformity with combined treatment, including nutritional advice and supplementation of 1,000 mg of elemental calcium per day, 17% stabilized, and 8% worsened despite the prescription of treatment (unpublished data). Compliance with six or more months of treatment was difficult, and it is unclear how many of the 8% of deteriorating children actually received the requested treatment. When there was success with treatment, it is not known how much of this improvement was due to the nutritional advice and how much was due to the other, incompletely controlled factors. Treatment was noted to be most successful in correcting deformity of the lower limb when it was instituted prior to six years of age.How should additional calcium be delivered to rachitic children in Bangladesh? It is now known that increased intake of calcium provides curative treatment for many children. Would dietary calcium or non-pharmaceutic supplements be adequate? Studies are underway to look at the value of nutritional advice to improve intakes of dietary calcium to stimulate a curative response. Limestone  rickets, the appropriate target would currently be to increase supply of vitamin D to exclusively-breastfed infants with darkly-pigmented skin and to their mothers during pregnancy. In Nigeria, the appropriate target would be infants and young children who suffer from calcium insufficiency. In India, there is evidence that young children need more calcium, while pubertal girls are most at risk of vitamin D-deficiency rickets  . In BangThe appropriate \u2018dose\u2019 of preventive product must be identified. For vitamin D, children should receive the equivalent of 200\u2013400 IU per day to prevent rickets. Alternatively, in temperate climates, exposure of the face and head to approximately 60 minutes of sunshine per week is probably adequate, and less exposure would be needed in areas nearer to the equator. Recommended intakes of calcium vary by age: in North America 210 up to six months of age, 270 from 7 to 12 months of age, 500 from one to three years of age, 800 from four to eight years of age, and 1,300 during the pubertal years . It mustWith the population appropriately selected and with the required intervention identified , preventive strategies can be planned. In the middle decades of the last century, vitamin D deficiency was essentially eradicated by adding vitamin D to commercially-provided infant formulae and dairy products. Similarly, iodine deficiency was effectively eradicated by adding iodine to commercially-produced salt. In China, education about rickets was effective in reducing the prevalence of rickets, although it is not clear if the advised recommendations were actually implemented . In NigeIn rural areas, most young children grow up on diets devoid of commercial infant products. It is, thus, challenging to find a \u2018point source\u2019 at which vitamin D or calcium can be introduced in a way that would reach all children at risk in a developing country. Therefore, it makes sense to try to provide community-wide (or even nationwide or regionwide) education to try to increase the habitual intake of calcium in areas where calcium is widely deficient in the diets of young children.choon\u2019  as a \u2018seasoning\u2019 to infant porridges]. Preliminary results suggest that both drama and video-based educational programmes stimulate discussion and learning but that only 12\u201316% of participants actually changed their food preparation in the recommended fashions.Interventions targeting food systems might impact entire communities. The food system in the Chakaria region of Bangladesh was evaluated in an effort to identify household-level risk factors for rickets . InteresNutritional rickets is still frequently seen in many parts of the world. While vitamin D deficiency causes rickets in areas where either latitude is associated with relatively decreased exposure to sunlight or cultural habits block exposure to sunlight, calcium deficiency has emerged as an important cause of rickets in parts of Africa and Asia, including Bangladesh. Calcium-deficiency rickets typically presents after the first year of life with deformities of the leg, widened wrists, and beaded ribs. Rickets carries a high risk of developing pneumonia. The diagnosis is suspected clinically and can be confirmed with elevated levels of serum alkaline phosphatase and/or radiographic evidence of widened, cupped, frayed epiphyses. When available, testing of vitamin D metabolites  can help distinguish between the possible causes of nutritional rickets. Treatment is effective by providing adequate amounts of the missing nutrient(s), and preventive programmes are needed. Further research is needed to: (a) determine the best way to accurately diagnose rickets and its cause in areas without complete laboratory and radiologic facilities, (b) determine the best dose and duration of treatment of calcium, (c) determine the appropriate indications and timing of surgical interventions, (d) identify the value of bracing for children with medically-treated rickets, (e) determine effective means of preventing rickets, and (f) test strategies by which preventive interventions can be widely implemented.The Rickets Convergence Group continues to investigate rickets and to study preventive and therapeutic interventions. Another international conference on rickets is being planned for Dhaka, Bangladesh."}
+{"text": "P = .0473) with PD. We also demonstrated that the TT-genotype causes a significant decrease in MTIF3 mRNA expression compared to the CC-genotype (P = .0163). Our findings support the hypothesis that MTIF3 may be involved in the etiology of PD.Genes important for mitochondrial function have been implicated in Parkinson's disease (PD). Mitochondrial translation initiation factor 3 (MTIF3) is a nuclear encoded protein required for the initiation of complex formation on mitochondrial ribosomes. Dysfunction of MTIF3 may impair mitochondrial function and dopamine neurons appear to be particularly vulnerable to oxidative stress, which may relate to their degeneration in PD. An association was recently reported between the synonymous rs7669(C>T) in MTIF3 and PD in a German case-control material. We investigated rs7669 in a Swedish Parkinson case-control material. The study revealed no significant association of the individual genotypes or alleles with PD. When comparing the combined TT/CT-genotypes versus the CC-genotype, we observed a significant association ( Parkinson's disease (PD) is the second most common neurodegenerative disorder and affects 1-2% of the population over the age of 50 worldwide . Several+) is a mitochondrial respiratory chain complex I inhibitor and causes degeneration of dopamine (DA) neurons in substantia nigra (SN) [ For example, the metabolite of the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrehydropyridine (MPTP); 1-methyl-4-phenylpyridinium (MPPgra (SN) . Anothergra (SN) . Activitgra (SN) . Certaingra (SN) . Furthergra (SN) . The N-tgra (SN) . Conditigra (SN) . These mgra (SN) . \u03b1-synuclein, Parkin, DJ-1, PINK1, and LRRK2 [drosophila melanogaster CG4523 have a 300 amino acids long homology region. This PINK1 homologue interacts with CG11656-PA, whose closest mammalian ortholog protein is MTIF3, supporting the hypothesis that MTIF3 is an interactor protein for PINK1 and important in the etiology of PD [MTIF3 is required for the initiation complex formation on 55S mitochondrial ribosomes . Dysfuncnd LRRK2 \u201315. Mutand LRRK2 . The sergy of PD . The aimgy of PD . In addin = 135) and Gothenburg (n = 187) . 52 of the Stockholm PD patients and 38 of the Gothenburg PD patients had a self-reported familial history of PD with one or more first-, second- or third-degree relatives with PD. DNA was extracted from blood samples according to standard protocol.The polymorphism rs7669 (C > T) in MTIF3 was investigated in a Swedish PD case-control material. The ethical committees of each institution, Karolinska Institutet Forskningsetikkommitt\u00e9 Nord and Forskningsetikkommitt\u00e9n, University of Gothenburg, approved the study and each subject signed an informed consent. All subjects were unrelated and of Swedish origin. A total of 381 PD patients were recruited: 211 at Karolinska University Hospital, Stockholm and 170 at Sahlgrenska Hospital, Gothenburg . All sporadic PD patients fulfilled the \u201cBrain Bank Clinical Diagnostic Criteria\u201d for idiopathic PD . Control\u03c72) test [P < .05.To genotype the genetic variant rs7669 in MTIF3 we used pyrosequencing, a method that analyzes genetic variants by detecting the energy released when a nucleotide is incorporated into a predefined DNA strand . To test2) test . DistribTo evaluate the effect of rs7669 on the mRNA structure, the secondary structure of MTIF3 was predicted using the publicly available online mfold program (version 3.2) , 22. Par\u03bcg/ml; Invitrogen, Carlsbad, CA, USA), cyclosporine , and filtered supernatant of Epstein-Barr virus (EBV) infected B95-8 cells. The medium was changed twice a week until cell lines were established at which time the cells were gradually frozen and kept at \u2212140\u00b0C until use. For mRNA quantification, the cells were thawed, cultured for approximately two weeks, and harvested when cell number reached 4-5 million cells.B-lymphocytes were separated from peripheral blood by standard protocols using Ficoll-Paque . The cells were cultivated in RPMI 1640 medium  with 20% fetal calf serum and L-glutamine , penicillin\u2014streptomycin , and SuperScript III Platinum Two-Step qRT-PCR kit with SYBR Green . qRT-PCR was performed on an ABI Prism 7000  using SYBR Green I dye . The samples were run in triplicates for the target gene MTIF3  and two housekeeping genes; beta-actin  and cyclophilin . Amplification of a single gene product was confirmed by monitoring the dissociation curve as well as agarose gel electrophoresis. Threshold cycle (Ct) values from the exponential phase of the PCR amplification plot were analyzed with ABI Prism 7000 SDS v1.2.3. Each Ct value for the target transcripts was normalized to beta-actin and cyclophilin, using qBase v1.3.5 [\u2212\u0394\u0394Ct method [\u2212\u0394\u0394Ct method has been extended in the qBase software to include multiple stable expressed reference genes to improve normalization [t-test. Significance level was set at P < .05.Quantitative real-time PCR (qRT-PCR) was performed on RNA from EBV transfected B-lymphocytes from individuals representing the three different rs7669 genotypes . Quantification of MTIF3 mRNA expression levels for the three different genotypes was performed in samples from six different individuals per genotype. Individuals were chosen only based on their rs7669 genotype regardless their neurological status . Total RNA was isolated from the EBV-transfected B-lymphocytes using RNeasy Mini Kit  and quantified by spectrophotometry at 260\u2009nm. cDNA was generated from 1\u2009e v1.3.5 , based ot method . The 2\u2212\u0394lization . The quaP = .0473). Stratification by PD onset into 50 years or younger versus older than 50 years of age at onset compared to age-matched controls revealed no associations of genotype or allele distribution with disease (data available upon request). We found all three genotypes of rs7669  in both PD cases and controls. The observed frequencies of the controls were in agreement with the Hardy-Weinberg equilibrium (data not shown). Our analysis showed no significant association of any of the three individual genotypes or alleles with PD . When coTo test whether the synonymous cytosine798thymine (Asp266Asp) substitution of rs7669 change the secondary structure of mRNA we did an mfold analysis of MTIF3 mRNA. Our analysis indicates that rs7669 in exon 5 results in an apparent change in the mRNA secondary structure and slightly higher energy for mRNA folding (dG) compared with the dG of the wild-type mRNA folding (data available upon request).P = .0163) in cells from individuals carrying the TT genotype compared to individuals with the CC genotype (P = .266). Testing both T-containing genotypes together (TT/CT) versus CC, the MTIF3 mRNA decrease was close to significance (P = .0518). Similar results were observed using the Mann-Whitney U test. Since individuals were chosen based on their rs7669 genotype without restriction to their neurological status, we also compared expression data from patients versus controls, which showed no significant association (P = .0795).To further investigate possible consequences of the synonymous polymorphism rs7669 we studied transcriptional activity of the MTIF3 gene by measuring mRNA expression levels using qRT-PCR. We found that MTIF3 mRNA levels were significantly lower (genotype . No signP = .0540), while results from our data set showed a significant association (P = .0473). Interestingly, Abahuni et al. (2007) showed an association of increased CT genotypes and decreased TT genotypes among sporadic cases (P = .0345) and in combined samples (P = .0073) compared to controls. Our findings strengthen the hypothesis that the MTIF3 rs7669 variant may be involved in the etiology of sporadic PD, because of the significant association of the TT/CT versus the CC genotype in a Swedish sample set. Abahuni et al. (2007) have previously investigated the MTIF3 rs7669 polymorphism in a German case-control material consisting of patients with positive familial history of PD as well as sporadic cases . The preThe rs7669 variant might be in linkage disequilibrium with some other real disease causing locus in MTIF3 or in some other gene in its vicinity and this locus may differ between ethnical populations, although no other known MTIF3 polymorphisms have been reported to be in linkage disequilibrium with rs7669 on chr13: 26,907,780\u201326,922,711. The results from the two studies are contrary and could possibly be explained by that the two sample series were collected from different countries and there might be a small effect of background population on the association, although this is unlikely as both our study and the previous one report similar allele frequencies that are in Hardy-Weinburg equilibrium. P = .0163). This suggests that the TT genotype affects MTIF3 mRNA levels although it cannot be fully excluded that individuals with this genotype also carry additional genetic variants affecting the mRNA levels. By dividing the samples into patients and controls without respect to their genotype, we show that the decrease in expression of MTIF3 mRNA is not due too PD (P = .0795). Mechanisms by which synonymous polymorphisms predispose to disease are not well understood, but several possibilities have been suggested including that they might affect mRNA transcriptional activity, mRNA stability, secondary mRNA structure, or at the protein level, synthesis, folding, and thereby turnover or function [in silico to investigate if the synonymous polymorphism rs7669 in MTIF3 could induce an alteration of the secondary mRNA structure. Our findings indicate that rs7669 results in a change the in mRNA secondary structure and that the polymorphism has the potential to affect folding and mRNA stability. However, no strong conclusions can be drawn from the artificial conditions used for modeling secondary structures in silico.To date, the only two genetic studies on MTIF3 and PD are Abahuni et al. (2007) and the present study. Our results indicate that the TT/CT genotypes might be more common among sporadic PD cases than controls, strengthening the involvement of mitochondrial dysfunction in PD. We could also show that the B-lymphocytes from individuals carrying the TT genotype contain significantly less MTIF3 mRNA compared to cells from individuals carrying the CC genotype (function . We perfIn summary we show that a genetic variant of MTIF3 is associated with sporadic PD in Sweden, supporting mitochondrial involvement in the disease. We have also demonstrated that the TT genotype leads to a decreased expression of MTIF3 mRNA. Further genetic studies are needed in larger materials to confirm these genetic findings. Studies of the MTIF3 protein at the cellular level are also needed to understand possible cellular sites at which alterations of MTIF3 levels may affect function."}
+{"text": "Dear Sir,I read with interest the article on ETS for hyperhidrosis. I have ath intercostal space, mid axillary line as this goes straight on to the sympathetic chain. A second 5 mm port is used in the 3rd intercostal space in the anterior axillary line to introduce the L hook which is then used to transect the chain. 2 port method is preferred as it avoids sword fighting between telescope and instrument and also due to a 30 degree angle between the two, the chain can be seen clearly while a single port method means the chain is obscured behind the hook.We use the standard laparoscopic equipment and introduce the telescope in the 5Partial collapse of the lung is obtained by introducing carbon dioxide at a variable pressure between 5 to 10 mmHg to get the desired effect.The level of transaction is between T3 and T4 as this has been reported to be associated with lower incidence of compensatory sweating. Still compensatory sweating has been observed in 62% of our patients. This ranges from mild and non bothersome in 30%, moderate (bothersome) in 28% and severe  in 4%. Only one patient has regretted having had the procedure due to its severity.It is extremely important to explain to the patient the irreversibility of the procedure and compensatory sweating.The lungs can be well expanded at the end of the procedure and many patients are able to go home the same evening."}
+{"text": "Multispectral bioluminescence tomography (BLT) attracts increasinglymore attention in the area of optical molecular imaging. In this paper, we analyzethe properties of the solutions to the regularized and discretized multispectralBLT problems. First, we show the solution existence, uniqueness, and itscontinuous dependence on the data. Then, we introduce stable numerical schemes andderive error estimates for numerical solutions. We report some numerical resultsto illustrate the performance of the numerical methods on the quality of multispectralBLT reconstruction."}
+{"text": "Green tea has been suggested to have a chemopreventive effect against various cancers including stomach cancer. The aim of this study is to elucidate the relationship between green tea consumption and stomach cancer risk by meta-analysis.Eighteen observational studies were identified using MEDLINE, THE COCHRANE LIBRARY, RISS, and a manual search. Summary relative risks/odds ratios (RR/ORs) for the highest versus non/lowest green tea consumption levels were calculated on the basis of fixed and random effect models. Subgroup analyses were used to examine heterogeneity across the studies.The combined results indicate a reduced risk of stomach cancer with intake of green tea . Subgroup analysis with six studies that reported differences between the highest and lowest consumption levels equal to or greater than five cups/day revealed a statistically significant protective effect .Green tea appears to play a protective role against the development of stomach cancer. The results also suggest that a higher level of green tea consumption might be needed for a clear preventive effect to appear. This conclusion, however, should be interpreted with caution because various biases can affect the results of a meta-analysis. Helicobacter pylori, genetic factors, dietary intake, and cigarette smoking [Risk factors for stomach cancer include infection with  smoking , 2. Diet smoking .Camellia sinensis [Presently, tea is the most widely consumed beverage in the world aside from water . Tea is sinensis . Among tsinensis . Mechanisinensis .Ahn et al.  reportedTo search for observational studies of green tea consumption in relation to stomach cancer risk, we conducted a literature search using the following medical databases, MEDLINE, THE COCHRANE LIBRARY, and RISS (to search for Korean literature); we restricted the search to papers published in English, Japanese or Korean, which were published up to May 2007. For the search, we identified articles using such medical subject-heading terms as \"stomach neoplasms\", \"tea\" or \"catechin\" or the keywords: \"stomach cancer\", \"gastric cancer\", \"green tea\", or \"catechin\". In addition, we also conducted a manual search of reference lists from the retrieved papers for further relevant publications.For inclusion in the meta-analysis, the identified articles had to meet the following criteria: 1) they had to be human studies, not laboratory or animal studies; 2) they had to document the daily consumption of the natural green tea product, not of green tea extracts or supplements; 3) the outcome of interest had to be an incidence of stomach cancer; 4) fulltext articles from the study had to be accessible to the authors. We excluded studies which did not provide information on (i) the number of stomach cancer cases and controls studied and/or (ii) the odds ratio (OR) or relative risk (RR) and its corresponding 95% confidence interval (CI) for highest versus non/lowest level of tea intake. When more than one studies analyzed the same dataset, only the most recent study was included in the analysis. These articles were reviewed independently by two authors (H.K. and C.M.N.) to determine whether the articles met the inclusion criteria of the present study.Study-specific ORs/RRs and the corresponding 95% CIs for highest versus non/lowest green tea consumption levels were extracted from the publications. Crude OR was calculated from the numbers of cases and controls in one study  because Possible heterogeneity of effect sizes across the studies was examined using the Q statistic . StatistFor calculation of the difference between the highest and lowest consumption levels of green tea, all the measured consumption levels were converted to a cups-per-day scale. Each gram of green tea consumed shown in two of the Chinese studies was converted to 0.25 cup following the suggestion by Mu et al. . For theTo detect a possible publication bias, Begg's funnel plot was visually evaluated for any asymmetry. To formally test for a publication bias, Egger's un-weighted regression asymmetry test was done . The funEighteen articles , 19-32 wThe overall result, which is presented in When stratified by gender, the results among men were divergent (p=0.02) while the results among women were consistent (p=0.53). Neither the studies of men nor of women showed any significant reduction in the risk . When stratified by difference between the highest and lowest green tea consumption levels, results among six studies with the difference equal to or greater than five cups/day were homogeneous (p=0.30) with a statistically significant risk reduction of 32% . Twelve studies with a difference of less than five cups/day showed heterogeneous results (p=0.04) with a non-significant risk reduction of 6% .This meta-analysis investigated the association between green tea consumption and stomach cancer risk on the basis of previously published researches. The overall summary RR/OR for green tea consumption and stomach cancer risk, as derived from eighteen observational studies, indicated a statistically significant 14% risk reduction in the high green tea consumption group.The reduced risk of stomach cancer in green tea drinkers was observed in studies with differences between the highest and lowest daily green tea consumption levels equal to or greater than five cups per day. Also, the studies conducted in China showed a stronger reduction in stomach cancer among green tea drinkers than those conducted in Japan. A few authors have argued that the relative lack of subjects in Japan who do not drink green tea may have resulted in an insufficient number of non-drinkers, and this might be an explanation for the weaker associations among Japanese studies , 16, 38.Research design also seemed to play an important role in the heterogeneity of effect sizes across the studies. While the protective effect was observed among case-control studies only, prospective studies tended to show null results. A few prospective studies even showed increased risks with green tea consumption although they were not statistically significant , 13, 35.Sasazuki et al.  suggesteSite-specific stomach cancer incidence in accordance with green tea consumption was mentioned in four studies , 22, 28.Helicobacter pylori infection is an important risk factor for a stomach cancer [Helicobacter pylori. Thus, the infection could have confounded the results, and further study is needed.Total duration of green tea drinking was considered in three of the Chinese studies , 17, 23.h cancer , 23, howh cancer , 40, whiThis meta-analysis has several limitations. First of all, publication bias cannot be ruled out. As shown in the subgroup analysis, the protective effect of green tea was prominent among case-control studies, which could be easily misled by a publication bias. Because of the asymmetric funnel plot, publication bias cannot be ruled out in this study. Second, the research included in this study had different categories for green tea consumption. Although the odds ratio or relative risk of the highest consumption versus non/lowest consumption was used for combining the effect size, it was not uniform across the studies. This might have distorted the result. Third, the (non-English) Chinese literature could not be reviewed because of the language barrier. Because results from the Chinese studies tended to show protective effects, the combined effect would have been different if they had been included in the study. Last, all of the studies included in the analysis had been done among Asian populations. Green tea is a popular drink in East Asia, while black tea is mostly consumed in Western countries. The result of this study cannot be applied to non-Asian populations.In summary, the result of this meta-analysis suggests a protective role of green tea against stomach cancer. Subgroup analyses revealed that the difference between the measured highest and lowest green tea consumption level was found to be the most prominent factor affecting the heterogeneity of the meta-analysis. This implies that the daily consumption level might be an important factor in determining the preventive effect of green tea against stomach cancer. Further research focusing on higher green tea consumption level is needed to clarify the association."}
+{"text": "To describe changes induced by retinal detachment in the ultrastructure and organization of rod terminals and their connections with B-type horizontal cell (HC) axon terminals and rod bipolar cell (RB) dendrites.Sections from control, 3 day, 7 day, and 28 day detached feline retinas were prepared for confocal immunofluorescence, light microscopy, and electron microscopy (EM). In addition, 100 \u03bcm-thick vibratome sections were immunolabeled with markers for photoreceptor terminals, HCs, and RBs. More than 40 rod spherules were studied in 90 nm-thick serial sections by transmission EM to greater detail changes in their ultrastructure and innervation.Following retinal detachment, many rod terminals retracted varying distances toward their respective cell bodies in the outer nuclear layer (ONL). In retinas detached for 1 to 4 weeks, an altered synaptic vesicle population and associated ribbons were found in all retracting terminals. Many rod somata in the distal ONL seemed to lack synaptic terminal structures altogether. In a retina detached for 1 week, EM showed that less than half of the retracted terminals remain in contact with RB dendrites. In contrast, almost every surviving spherule was contacted by neurite outgrowths from the axon terminals of the B-type HC. Although retracted spherules had several presynaptic structures similar to those in normal retina, numerous changes occurred in their overall synaptic architecture. The spherule\u2019s invagination was shallower, contained fewer postsynaptic processes, and often had \u201copened,\u201d allowing swollen HC processes apposing the synaptic ribbon to directly contact other processes of the outer plexiform layer (OPL) neuropil. Whereas in normal cat retina each HC \u201clobe\u201d comes from a different axon terminal system, after detachment, the opposing lateral elements can stem from the same terminal. The innervating RB dendrites that branched off stout RB dendritic trunks that extended up into the ONL were thinner than normal, unbranched, often electron dense, and lacked organelles. When present, most merely lay adjacent to retracting spherules rather than enter any synaptic invagination that might still occur.Immunocytochemistry enabled RB and HC neurites to appear postsynaptic to retracted rod terminals. However, at the ultrastructural level, HCs seemed to more consistently retain connection with the retracted spherules than the RBs. The highly conserved architecture of the rod spherule was lost as the invagination opened and postsynaptic contacts became fewer. It would seem that the lack of RB central elements as well as the drastic alterations in the architecture of most retracted terminals would necessarily alter the physiology of this complex synapse. The mammalian rod photoreceptor is unique in its reliance on a single, complex presynaptic structure with a large active zone ,2. In fee retina , the pose retina ,5. Severe retina ,6. This e retina . The cyte retina ,2,8-11. e retina . It woule retina ,14. ThesThere is a large body of existing literature on retinal circuitry in the feline retina ,5,15-20.nob2 mutant mouse [It has been shown previously that between 1 and 3 days after detachment, rod terminals begin retracting  and bothnt mouse ,24; withnt mouse ,26, CaBPnt mouse , and retnt mouse ; with thnt mouse ; as wellnt mouse \u2014all suggnt mouse , a phenont mouse . Prior tFelis domesticus) as previously described [Experimental retinal detachments were made in adult cat eyes  and cat retinas detached for 3 days (n=2), 7 days (n=4), and 28 days (n=3) were processed for light (LM) and electron microscopy (EM) as detailed in Fisher et al. . Sampledi900 . The images were then inverted, the contrast was adjusted, the images assembled, and labels were applied using Adobe Photoshop CS2 software .All transmitted and confocal images were captured digitally and required no additional image processing once correct exposures or laser settings were determined. Transmission EM images were taken using standard EM sheet film negatives that were scanned on a Microtek ScanMaker The most relevant morphological effects of detachment in the first month were evident in the outer retina compare . The retAs rod terminals retracted after detachment, immunocytochemical labeling revealed distinctive neurite outgrowths from both HCs and RBs. Based on labeling patterns, it has been established that most HC outgrowths  arise frIn normal cat retina the photoreceptor terminals and their postsynaptic processes are tightly packed together. The spaces between them are occupied by thin M\u00fcller cell processes. Typically, rod spherules rs;  are arraThe OPL of a cat retina detached for 7 days  can be hAfter detachment, HCs appeared to undergo a type of hypertrophy, resulting in swollen perinuclear cytoplasm, enlarged dendrites and axon telodendria . The perMany detailed ultrastructural studies on normal cat retina have demonstrated that every spherule contains 1 or 2 synaptic ribbons, each associated with a \u201csynaptic unit\u201d comprised of 2 invaginating HC axon terminal (HCat) processes and 1 or more RB dendrites ,6,15. ThRetracting terminals still possessed several of the typical components of presynaptic machinery including mitochondria, synaptic ribbons, arciform densities, and synaptic vesicles. Cat spherules usually have more than one mitochondrion that can lie close to the synaptic site, but also can extend distally into the rod axons . RetractAfter detachment , the patThe dilation of the hilus after detachment and the resulting opening up of the invagination revealed another feature of rod spherule architecture: the synaptic ridge. Literally a shallow evagination that projects as a ridge between the HC lateral elements, the synaptic ridge underlay the arciform density  and was The density of cytoplasmic organelles appeared sparse in the B-type HC after detachment by comparison to that in normal feline retina where their distinctively dark axon terminal processes occupied much of the distal  OPL neuropil and contained numerous microtubules, neurofilaments, and scattered mitochondria in a granular cytoplasm . Such prThe RB dendritic trunks that grew into the ONL after detachment  were quiIn response to retinal detachment, M\u00fcller cell nuclei were seen in the distal retina . At 7 daThe first few days after detachment represent a critical period of outer segment degeneration, RPE apical surface remodeling, the beginning of M\u00fcller cell reactivity, and a wave of apoptotic cell death that can kill up to 20% of the rod population ,36. AfteTerminal retraction is accompanied by dramatic changes in second order neurons, easily identified by specific confocal immunolabeling studies in several species and several retinal degenerations. The combination of rod terminal retraction and neurite sprouting by the postsynaptic targets, the RBs and B-type HCats ,21, sugg3 and varies little from spherule to spherule, and the length of the linear active zone is remarkably similar across species at approximately 2.5\u00a0\u03bcm [The rod spherule in the feline retina has been well studied and its characteristics measured in detail ,2,6. They 2.5\u00a0\u03bcm ,6. This y 2.5\u00a0\u03bcm ,2. It isy 2.5\u00a0\u03bcm . While ty 2.5\u00a0\u03bcm , the riby 2.5\u00a0\u03bcm . A ribboIt is well documented that photoreceptor outer segments undergo severe degeneration within a week of detachment. Our data showed that rod spherules also undergo structural \u201cdegeneration\u201d that seems likely to affect the physiology of synaptic transmission. Like the outer segment, many rod synapses \u201cdeconstruct\u201d their highly structured three-dimensional organization. Significantly, the elaborate fingers of rod cytoplasm that project into the invagination and may effect local glutamate concentration ,2 appearnob2 mutant mouse [Another serious challenge to normal spherule function following detachment is the loss of synaptic contacts with other cells\u2014 particularly with RBs. Fewer than half of the spherules we examined in serial sections had any recognizable RB contacts. That RBs also experience dendritic pruning, leaving only 1 to 4 neurite outgrowths per cell recognizable by immunofluorescence microscopy ,21, woulnt mouse ,24, in tnt mouse , and in nt mouse , so thatAnother consequence of retinal detachment in feline retina is the extreme hypertrophy that the B-type HCs and M\u00fcller cells undergo. The swollen, pale B-type HC cell bodies and dendritic trunks in detached samples were immediately apparent by both LM and EM. Our data indicate that this swelling also affects the terminals that contact rod spherules. Thus B-type HCs are highly reactive to detachment with abnormal swelling, robust neurite sprouting, and an upregulation of neurofilaments ,47,48. HThe more familiar example of cell hypertrophy after retinal detachment is that seen in the early reaction of M\u00fcller cells ,49,50. ALimiting the loss of photoreceptor outer segments has always been thought to be a key element in lessening damage caused by retinal detachment. However, preventing the remodeling of photoreceptor synaptic terminals and subsequent loss of synaptic connectivity may be just as important to visual recovery. This study represents a start at understanding the structural reactions of photoreceptor synapses to detachment. There is still much to be learned. Serial section studies of this kind are time-consuming, tedious, and limited in resolution in the z axis. A promising approach may be to study photoreceptor synapses in relatively thick sections by electron tomography with intermediate voltage EM . Similar"}
+{"text": "Fire is an important agent of disturbance in tropical savannas, but relatively few studies have analyzed how soil-and-litter dwelling arthropods respond to fire disturbance despite the critical role these organisms play in nutrient cycling and other biogeochemical processes. Following the incursion of a fire into a woodland savanna ecological reserve in Central Brazil, we monitored the dynamics of litter-arthropod populations for nearly two years in one burned and one unburned area of the reserve. We also performed a reciprocal transplant experiment to determine the effects of fire and litter type on the dynamics of litter colonization by arthropods. Overall arthropod abundance, the abundance of individual taxa, the richness of taxonomic groups, and the species richness of individual taxa (Formiciade) were lower in the burned site. However, both the ordinal-level composition of the litter arthropod fauna and the species-level composition of the litter ant fauna were not dramatically different in the burned and unburned sites. There is evidence that seasonality of rainfall interacts with fire, as differences in arthropod abundance and diversity were more pronounced in the dry than in the wet season. For many taxa the differences in abundance between burned and unburned sites were maintained even when controlling for litter availability and quality. In contrast, differences in abundance for Collembola, Formicidae, and Thysanoptera were only detected in the unmanipulated samples, which had a lower amount of litter in the burned than in the unburned site throughout most of our study period. Together these results suggest that arthropod density declines in fire-disturbed areas as a result of direct mortality, diminished resources  and less favorable microclimate . Although these effects were transitory, there is evidence that the increasingly prevalent fire return interval of only 1\u20132 years may jeopardize the long-term conservation of litter arthropod communities. Fire is a common and important agent of disturbance in many temperate and tropical ecosystems It has been suggested that the altered frequency and intensity of fires is in the Cerrado is causing widespread change in this ecosystem As in other tropical savannas, litter-dwelling arthropods in the Cerrado are more prevalent in more closed physiognomies Pheidole was the most diverse, with a total of 12 species.Over the course of 22 months we collected 10,703 arthropods from 16 orders and one family in the 160 unmanipulated litter samples. With 3,779 individuals Formicidae was by far the most common taxon, followed by Acari (N\u200a=\u200a1866) and Colembola (N\u200a=\u200a1070). Among ants, there was a total of 68 species, representing 28 genera of which Samples from the burned site contained, on average, fewer arthropod taxa and fewer individuals . HoweverSimilar results were obtained when we analyzed the effects of fire on the species richness of ants, and on the individual abundances of the seven most common arthropod taxa. For each one of these seven taxa we found, on average, significantly fewer individuals in samples from the burned than from the unburned site . AlthougNMDS ordination analysis did not reveal a separation between burned and unburned sites with regard to faunal composition of leaf-litter samples taken at different times since the fire event . This pr2 in samples with \u201cnormal\u201d litter and 51.8\u00b15.6 individuals and 7.4\u00b10.4 taxa in samples with \u201cgreen\u201d litter. Similarly, we found 4.06\u00b10.44 and 4.14\u00b10.44 species of ants in samples with normal and green litter, respectively.Litter type did not significantly affect the abundance or richness of leaf-litter arthropods . On averLitter transplanted into the burned site contained significantly fewer arthropod groups, less ant species, and fewer arthropod individuals than litter transplanted into the unburned site ; Fig. 4.The amount of time that had elapsed since the litter transplant also affected the abundance and richness of arthropods in the experimental plots . HoweverTo our knowledge this is the first comprehensive study of the leaf-litter arthropod fauna of the Brazilian Cerrado and its response to disturbance by fire. Consequently, no data for other Cerrado sites with which to compare our results are available. Nevertheless, the ordinal-level composition of the litter arthropod fauna of the Cerrado site we studied appears similar to that of other tropical woodland savannas. For instance, ants, mites, springtails, spiders, and beetles also comprised most of the arthropod individuals collected in the woodland savannas of northern Australia Overall, our results indicate that fire detrimentally affected the litter arthropod fauna in multiple ways: it reduced overall arthropod abundance, the abundance of individual taxa, the richness of taxonomic groups, and the species richness of individual taxa (Formiciade). However, both the ordinal-level composition of the litter arthropod fauna and the species-level composition of the litter ant fauna were not dramatically altered by fire. In fact, most of the observed changes in the composition of these assemblages were related to rainfall seasonality and not to fire disturbance.That for many taxa  the differences in abundance between burned and unburned sites were maintained even when controlling for litter availability and quality suggests that these differences were driven by a direct effect of fire on arthropod populations rather than an indirect effect on their resources (litter). In contrast, differences in abundance for Collembola and Thysanoptera, and in abundance and species richness for Formicidae, were only detected in the unmanipulated samples, which had a lower amount of litter in the burned than in the unburned site throughout most of our study period. Here, the effect of fire may have simply been a consequence of the lower availability of litter in the fire affected areas. This is not to say that fire did not have any immediate and direct impact on Collembola, Formicidae, and Thysanoptera populations, only that if there was a direct effect of fire on these populations it was brief and we were unable to detect it. It is more likely that individuals from these groups escaped from fire by finding refuge in the lower soil horizons or other safe sites. Many Cerrado ants nest deep in the soil and therefore appear resistant to direct effects Nutrient reabsorption during leaf senescence is a common feature of Cerrado trees Rainfall seasonality is a defining characteristic of the Cerrado biome region Differences in arthropod abundance, richness of taxonomic groups, and richness of species between the burned and unburned sites were for the most part negligible during the second year of our study, and this was true for samples taken during both the dry and wet seasons. This strongly suggests that the differences observed during the first year of our study were not due to a pre-existing difference between the burned and unburned sites, but rather due to the direct and indirect impacts of fire on the litter arthropod fauna. Our results thus indicate a nearly complete recovery of the litter arthropod community in less than two years after the fire, a result comparable to those of other similar studies It is important to note, however, that in our experimental design there was only one burned and one unburned site. This lack of site replication, which is typical in studies of large scale disturbances such as fires, hurricanes, and drought events In contrast to the savannas of Africa and Australiacerrado densoThe study was conducted at the Esta\u00e7\u00e3o Ecol\u00f3gica do Panga , a 404 ha reserve located 30 km south of Uberl\u00e2ndia, Minas Gerais, Brazil . This reAlthough Panga has no prescribed burn program, there are occasional fires due to human activities surrounding the reserve. Since its creation, in 1986, the reserve has been partially burned in 1992, 2003 and 2006. Our study took place following the 2006 fire, which occurred on September 15 of that year. This fire started at approximately 11 a.m. and was controlled by an anti-fire brigade within a few hours. Nevertheless, about 20% of the area of the reserve was burned , with flWe examined the dynamics of litter-arthropod populations for a period of nearly two years after the fire. To do so we established ten line-transects in a site within the fire-affected area and ten transects in a nearby part of the reserve that was structurally similar but not burned. Transects in the unburned site were located ca. 100 m away from the edge of the burned area . Althoug2 plots were set and evenly spaced along each transect. We collected the litter from all plots in randomly selected transects within each site 3, 5, 7, 10, 14 and 22 months after the fire; we collected from two transects at all sampling dates, except 5 and 22 months after the fire, when due to time constraints it was only possible to collect from one transect. Different transects were sampled at different dates, so that the same plot was never re-sampled. Prior to these collections we measured litter cover  in the four corners of each plot. The litter removed from each plot was sieved through a 0.8 cm mesh; we then extracted arthropods from the sifted litter by placing litter in a Winkler extractor Transects were 40 m long and arranged parallel to each other, with a distance of 20 m between two adjacent transects . Eight 1For this experiment we established eight additional transects in each site ca. 2.5 months after the fire. We removed the litter existing from all plots of all transects and collected additional litter samples from areas just outside of the transects. Litter from the burned and unburned sites were kept separate. The litter from each site was thoroughly mixed and dried for 72 h at 60\u00b0C to kill the associated fauna. We then added 760 g (dry weight) of arthropod-free litter (600 g of leaves and 160 g of twigs <2 cm in diameter) to each plot. This amount of litter corresponds to the average litter biomass on the ground of the unburned site at the time of our study . Half of the plots within each transect received only litter collected in the unburned site, while the other half received only the litter from the burned site . The traWe evaluated the effects of site (burned vs. unburned), litter type (senesced litter from unburned site vs \u201cgreen\u201d litter from the burned site) and time since litter transplant  on the overall abundance of arthropods, the richness of arthropod groups, and the richness of ant species in our experimental plots using a three-way factorial ANOVA. Similarly, a two-way factorial ANOVA was used to evaluate the effects of fire and time of sampling  on the overall abundance of arthropods, on the richness of arthropod groups, and on the richness of ant species in the unmanipulated litter plots. Data were log (x+1) transformed in order to meet the assumptions of parametric statistics.We used Non-Metric Multidimensional Scaling (NMDS) to ordinate samples taken at different times in the burned and unburned sites by their faunal similarity. Faunal similarity was estimated using the Bray-Curtis index, based on the relative abundances of each arthropod group at each site in a given sampling date. Similarly, we used NMDS to ordinate samples based on the similarity of their ant assemblages. Similarity in ant species composition (Bray-Curtis index) was based on the relative frequencies of each ant species at each site in a given sampling date. All statistical analyses were done using the default options of Systat 10"}
+{"text": "Proteomic profiling using mass spectrometry (MS) is one of the most promising methods for the analysis of complex biological samples such as urine, serum and tissue for biomarker discovery. Such experiments are often conducted using MALDI-TOF (matrix-assisted laser desorption/ionisation time-of-flight) and SELDI-TOF (surface-enhanced laser desorption/ionisation time-of-flight) MS. Using such profiling methods it is possible to identify changes in protein expression that differentiate disease states and individual proteins or patterns that may be useful as potential biomarkers. However, the incorporation of quality control (QC) processes that allow the identification of low quality spectra reliably and hence allow the removal of such data before further analysis is often overlooked. In this paper we describe rigorous methods for the assessment of quality of spectral data. These procedures are presented in a user-friendly, web-based program. The data obtained post-QC is then examined using variance components analysis to quantify the amount of variance due to some of the factors in the experimental design.Using data from a SELDI profiling study of serum from patients with different levels of renal function, we show how the algorithms described in this paper may be used to detect systematic variability within and between sample replicates, pooled samples and SELDI chips and spots. Manual inspection of those spectral data that were identified as being of poor quality confirmed the efficacy of the algorithms. Variance components analysis demonstrated the relatively small amount of technical variance attributable to day of profile generation and experimental array.Using the techniques described in this paper it is possible to reliably detect poor quality data within proteomic profiling experiments undertaken by MS. The removal of these spectra at the initial stages of the analysis substantially improves the confidence of putative biomarker identification and allows inter-experimental comparisons to be carried out with greater confidence. Clinical proteomic profiling experiments using high throughput mass spectrometry (MS) technologies such as matrix assisted laser/desorption ionisation time-of-flight mass spectrometry (MALDI-TOF-MS) and the derivative surface enhanced laser desorption/ionisation time-of-flight mass spectrometry (SELDI-TOF-MS) have provided encouraging and exciting results over the past few years -4. HowevThere is now an expanding literature which describes good practice in undertaking such experiments. Reanalysis of published data has raised a number of important issues relating to experimental design and dry-lab  analysis of experimental results -12. SampThe objective here is to present a web-based tool for QC of proteomic profiling experiments undertaken using MS. Such a tool should be easily integrated into the data management tools which are included with an instrument. Factors that can affect an MS profile include, time (since first determination), temperature, humidity, the instrument used and the laboratory , residuan = 30), two groups of patients post-renal transplantation with stable (n = 30) and unstable (n = 20) renal function and normal healthy controls (n = 30) with similar age and gender distributions to the clinical groups [The main study set used was data generated from a comparison of serum samples collected from patients with renal failure prior to dialysis , bovine ubiquitin (Mr 8564.8), bovine Cytochrome C (Mr 12230.92), equine cardiac myoglobin (Mr 16951.51) and bovine \u03b2 lactaglobulin A (Mr 18363.3) calibrants. After air-drying, the calibrant mixture was analyzed on the SELDI PCS4000 Enterprise system  using standard acquisition parameters for the low and medium mass ranges. Calibration was performed using single and double charged peaks where appropriate and a quadratic calibration equation generated for use in the study using Ciphergen Express 3.0 . A stock calibration solution was prepared at the start of the study to calibrate the machine. Subsequently, a fresh calibrant spot was prepared and analysed each day to check for any calibration drift by viewing plots of calibration spectra . If any The QC sample was central to both facets of QC \u2013 the monitoring of performance throughout the study and also the analysis of technical replicates. The QC sample was formed by pooling serum from all individuals in the study. This is good practice as creating a QC sample from just a few samples can allow peaks in a few dominant samples to make the QC sample unrepresentative of the majority of samples in an experiment (data not shown). The QC sample was spotted onto three ProteinChip arrays (24 spots) at the beginning of the run on the first day of the analysis to define a \"reference set\" which was used to characterise normal within-run technical variability in the profiling technique and then allowed the assessment of future experiments using this reproducible profile. To assess between-chip and between-day technical variation, the QC sample was also included on a single spot on each ProteinChip used in the analysis, ensuring equal use of spots A to H for this purpose. This protocol is shown diagrammatically in Figure S1 [see Additional file The spectral data produced by the SELDI-TOF-MS are standardly stored in a MySQL relational database supplied by Ciphergen. Raw intensity values produced by the detector are stored as a simple binary blob consisting of integer values which are multiplied by a constant  to produce actual intensity values whereas mass values are calculated using the quadratic calibration equation. All this data is retrieved from the SQL database by query functions utilising the MySQL C application programming interface (API) with no further use being made of the Ciphergen software.Each SELDI experiment has associated with it a list that identifies the appropriate spectra along with information defining the nature of each sample (i.e. sample replicate or pooled QC sample). This list is uploaded via a web browser and is used to identify the data that should be extracted from the SQL database as described above. This data then undergoes pre-processing steps  with this reference set. The transformation chosen is principal components analysis (PCA) , a vectoQC spectra from subsequent sample chips were then projected into the space defined by the PCs calculated on the reference set using the loadings from the PCA and the intensities from the peak detected profiles of these new QC spectra. Note that the QC spectra from the reference set and the QC spectra from the sample chips are peak detected together each time a new spectra is brought to QC. This allows new peaks that appear in subsequent spectra, but were not present in the reference set to be included in the procedure. These projected versions of the QC spectra from sample chips are then viewed in plots alongside the reference set to check for systematic bias due to chip, spot or order of sample generation.In addition to the visual examination of the QC spectra from sample chips, a significance test based on the Mahalanobis distance (MD) of the transformed QC spectra from the centre of the PC space defined by the reference set is also constructed. This test calculates the MD,x is the projection of the QC spectra, \u03bc is the mean vector  and \u03a3 is the covariance matrix for the PC space. A significance test is then performed under the null hypothesis that the MD from the origin of the PC space to the new QC spectrum is zero against the alternative hypothesis that it is not. This significance test is possible as it is known that the null distribution is a \u03c72 distribution with p degrees of freedom under multivariate normality [p in this case is equal to the dimensionality of the PC space used in the test. This is determined as the number of PCs that are needed to explain at least 90% of the variance which is present in the full reference set. As these QC samples were all the same, we would expect that the first few PCs would explain the vast majority of the variation.where ormality . The valThe first few PCs are sensitive to outliers that inflate variances or covariances  . So by vThe calculations in this analysis were undertaken using matrix algebra, prcomp and plotting functions in the R software environment for statistical computing .A critical part of QC is identifying differences between technical replicates of individual samples in a study which are not similar enough to be carried forward to subsequent analysis. The analysis of technical replicates was undertaken by comparing various parameters which summarize the duplicates with the parameter values obtained from all possible pairs of duplicates in the reference set. The parameters considered were:\u2022 the total ion current \u2013 the sum of all the ion signals in a mass spectrum over time  and henc\u2022 the normalised total ion current \u2013 equivalent to above, but internally normalised to the values  within each spectrum,\u2022 the total intensity of peaks \u2013 the sum of intensity of all peaks identified in a smoothed spectrum (stage 2 of the peak detection process described above) and\u2022 the total number of detected peaks \u2013 the total number of peaks in a spectrum (not to be confused with the number of common peaks that make up peak clusters).Additionally, as a further summarizing variable the difference between the intensities of each common peak in the pair of technical replicates was also calculated. This analysis was undertaken in segments of the total mass range being considered as this was found to make the QC more sensitive. Experience from a number of studies of different diseases using various sample types has shown that four equally sized mass segments provided an adequate balance of QC sensitivity as compared with computing time (data not shown).In order to decide which technical replicates required further examination, the coefficient of variation (CV) was calculated between each of the parameters for the duplicate samples and then this was compared to the distribution of CVs for all possible pairs of spectra from the reference set containing all QC spectra (which had passed chip-to-chip QC). A parameter was flagged if the CV of the sample pair was greater than the 95% quantile of the distribution of CVs from the reference spectra, indicating that the pair of spectra should be examined, but not necessarily rejected. A greater number of flags indicated more differences between technical replicates and a greater likelihood of rejection of spectra upon examination.The difference between intensities of common peaks in the technical replicates was compared with the reference set in a similar manner. Firstly, all the data (QC samples and study samples) were peak-detected together to define common peak clusters for all spectra. All possible pairs of the QC spectra were then considered and the absolute difference in intensity calculated at each peak cluster. The 95% quantile of these differences was then calculated for each peak cluster and this was used as a critical value to indicate whether the difference between replicates at that peak cluster is larger than it ought to be with reference to the QC samples. The percentage of peaks where the difference was larger than this critical value in each pair of technical replicates was then reported.The lmer function in the lme4 package  in R andBoth formulations of the variance components model assumed normally distributed data and hence a normal likelihood. The Bayesian formulation of the variance components specified vague prior distributions for all terms using normal distributions with large variance. The classical estimation procedure used maximum likelihood estimation whereas the Bayesian method used Markov chain Monte Carlo , specifiThe results of the QC analysis are presented to the user in the form of a web page with both graphical and tabulated data as described in the following sections. Links are also provided to a web based spectra viewing tool which allows multiple spectra to be plotted together facilitating manual scrutiny of any significant differences identified.The experimental run was managed over three consecutive days and resulted in 110 samples of serum from subjects being realised as 220 proteomic profile spectra  and 56 spectra of the pooled QC serum sample (24 in the reference set from the first three chips and 32 on subsequent sample chips). The 24 results in the reference set were visually examined and decided to be grossly consistent prior to the commencement of the profiling of the rest of the samples. In the low mass range 267 common peaks were detected over the full mass range with  found in the equally spaced quarters or mass segments of the region . Similarly in the medium mass range there were 151 peaks with  in the mass segments spanning . In the following sections the results of QC undertaken at the end of the third day is demonstrated, but it should be noted that similar analysis was undertaken after each of days 1 and 2 also. These can be split into QC concerning chip-to-chip integrity as compared to the reference set and similarity analysis of technical replicates. For brevity we describe only the low mass range, but results for the medium mass range were similar.The QC web tool was run selecting no baseline subtraction and default parameters for peak detection and the results page generated. This consists of a table showing the results of the significance test for each QC spot . In Figure Figure With high quality data, it is possible to estimate the magnitude of the components of variation which can be attributed to different factors in the design of this experiment. The classical estimation method was used to estimate simple variation components attributing variation to technical and biological components and these results compared with a similar model estimated in OpenBUGS and found to produce similar results. The more complex model with terms for day, chip and spot within the technical variation was fitted and convergence assessed for each parameter for each peak using the scale reduction factor. Figure Comparing these results with those found in other studies provides insights into the comparability of our laboratory with others reported in the literature. For instance, Oberg and colleagues  have shoTo our knowledge there has not as yet been an investigation which could demonstrate the proportion of variation due to chip and spot and the fact that the combined effect is smaller than that for day is encouraging. This type of analysis where we investigate experimental bias due to explainable factors is very useful in directly defining potential confounding factors . HopefulIn this article a novel system for undertaking QC in proteomic profiling studies using MS is presented. This system is multi-facetted and integrated with the database which stores data from the MS instrument and is easily run using a web interface. The multi-facetted nature refers to the functionality of the QC system to monitor the experiment as it progresses and also to evaluate the similarity of duplicates for inclusion/exclusion in subsequent analysis. This is achieved through a convenient web interface available on any networked computer in our laboratory. Additionally, a stand alone GUI is under development which will allow the import of data from other MS instruments.Rigorous QC has been shown to be an important requirement in proteomic profiling experiments . AlthougThe chip-to-chip QC procedure was inspired by the excellent work described by Coombes and colleagues , but witAnother important modification in our experiments is that the QC samples are distributed equally on all spots across the chips, whereas in the Coombes study the QC samples were applied to the same spot on all chips. This could introduce some bias into the procedure if there are systematic problems with the spots chosen for the QC sample. Additionally, it has already been noted that the method of Coombes and colleagues is expensive in terms of experimental units with 25% of sample chips devoted to the use of QC   or changes in laboratory temperature (data not shown). In these situations a leave-In the variance components analysis described previously it has been shown that there is a relatively large amount of technical variation, but a reassuringly small amount of it is due to the day of profile generation, the ProteinChip or the spot on the ProteinChip. Other authors have shown the effect of reasonable reproducibility over sessions  and the The requirement of rigorous QC for proteomic profiling by MS are not unique and occur in a number of expression analyses techniques , depletiGood clinical practice (EU directive 2001/20/EC) and good clinical laboratory practice  are a reThe authors declare that they have no competing interests.REB identified the need for an automated method of QC and initiated the programme of research together with PJS. DNP, DAC and REB identified measures to be used to monitor the quality of proteomic profiling experiments. DAC and JHB developed the statistical methods of QC. DAC wrote the scripts to undertake QC in the R software. DNP wrote the software to allow integrated QC as a web-tool added to the commercial software for managing the mass spectrometer. AJS produced the experimental data and evaluated the developing web-tool. DT evaluated the QC tool by visually inspecting raw spectral data and evaluating evolving methods of QC. DAC and DNP drafted the manuscript and all authors provided comments and approved the manuscript for submission.. This file can be used by anybody who has a Ciphergen MySQL database of results and follows the instructions detailed on the website. Further developments of the QC software will also be posted at this site.An executable file which can be used to run the QC procedures described in this paper will be available at Supplementary Figure S1. This file contains a figure describing the randomisation and quality control scheme layout diagrammatically.Click here for filePre-processing methods details. This file contains details of the pre-processing scheme for the mass spectrometry data not included in the main text for brevity.Click here for fileTable S1. This file contains the results of QC spot analysis in a supplementary table.Click here for fileTable S2. This file contains the full results from the QC replicate analysis, i.e. the unabridged version of Table Click here for fileTable S3. This file contains a table of summary statistics concerning the mean spectra and CV spectra displayed in Figure Click here for file"}
+{"text": "Here, we show that disruption of the chromodomain of Arabidopsis thaliana LHP1 abolishes H3K27me3 recognition, releases gene silencing and causes similar phenotypic alterations as transcriptional lhp1 null mutants. Therefore, binding to H3K27me3 is essential for LHP1 protein function.Polycomb group (PcG) proteins are essential to maintain gene expression patterns during development. Transcriptional repression by PcG proteins involves trimethylation of H3K27 (H3K27me3) by Polycomb Repressive Complex 2 (PRC2) in animals and plants. PRC1 binds to H3K27me3 and is required for transcriptional repression in animals, but in plants PRC1-like activities have remained elusive. One candidate protein that could be involved in PRC1-like functions in plants is LIKE HETEROCHROMATIN PROTEIN 1 (LHP1), because LHP1 associates with genes marked by H3K27me3  Polycomb group (PcG) proteins maintain gene expression patterns during development in animals and plants by establishing a cellular memory system for transcriptional repression Arabidopsis thaliana LHP1 was first found in screens for mutants with altered leaf glucosinolate levels and named TU8TERMINAL FLOWER 2in vitro and associates with genes marked by H3K27me3 in vivoThe gene for in vitro. Furthermore, recruitment to target genes and intra-nuclear localization of mutated LHP1 was greatly impaired in vivo. Because the phenotype of this new lhp1 allele is very similar to an lhp1 null allele, we conclude that chromodomain-mediated binding of LHP1 to H3K27me3 is essential for LHP1 function. These results support the model that LHP1 has a PRC1-like function in plants.Together, the model has emerged that LHP1 binds to PcG target loci that have been trimethylated at H3K27 by PRC2 to establish persistent transcriptional repression. We tested this hypothesis using a LHP1 mutant with a defective chromodomain. In agreement with predictions from structural homology-based modeling, LHP1 with the mutated chromodomain had strongly reduced binding to H3K27me3 lhp1-7 allele was discovered in a suppressor screen of a late flowering transgenic line with reduced MSI1 function . While no LHP1 transcript was detected in the lhp1-6 T-DNA insertion mutant  and lhp1-7 (CD*). Calculation of interaction energies suggested that LHP1-CD* has reduced affinity to trimethylated and unmethylated lysine residues (The HP1 and Pc chromodomains have binding cavities formed by three aromatic residues to accommodate methylated lysines of H3 histone tails residues .lhp1-7 (CD*) mutation. Similar to previously reported results, wild-type LHP1 bound strongly to the H3K27me3 peptide in vitro, but LHP1-CD* binding to H3K27me3 was significantly reduced and similar to the binding to unmethylated H3K27 . We found several lines in which the LHP1-GFP fusion protein could complement lhp1-7(CD*), demonstrating that LHP1-GFP is fully functional  and SEPALATA3 (SEP3), which are well-established PcG and LHP1 targets in vitro and that LHP1-CD*-GFP cannot bind to at least some LHP1 targets in vivo, which may explain its altered sub-nuclear localization.Altered lhp1-7(CD*) mutant to wild-type and lhp1-6(null) mutant plants to establish which aspects of LHP1 function depend on chromodomain binding to H3K27me3. Analysis of flowering time revealed that both lhp1-7(CD*) and lhp1-6(null) plants flowered at similar times but much earlier than wild-type under long and short day conditions  and lhp1-7(CD*) have the terminal flower phenotype, but lhp1-7(CD*) formed the terminal flower later than lhp1-6(null)  than in lhp1-6(null)  is phenotypically similar to lhp1-6(null) during early plant development, but has a slightly milder phenotype late in development.Arabidopsis LHP1 was initially identified genetically for its terminal flower phenotype -6(null) . Consist-6(null) . In both reduced . Togethelhp1-6 and lhp1-7(CD*) development often have supernumerary, missing or deformed organs  and lhp1-7(CD*) rosette leaves  or of targets of the RNA-dependent DNA-methylation pathway   major developmental regulatory genes  are not repressed in lhp1-7(CD*) at times when they should be silent. Thus, we conclude that specific binding of LHP1 to H3K27me3 is essential to maintain repression of PcG target genes.Together, our results show that similar to Populus trichocarpa), of a lycophyte (Selaginella moellendorffii), an ancient vascular plant lineage, and of a moss (Physcomitrella patens). In contrast, we failed to identify LHP1 or HP1 homologs in the genomes of the chlorophyte algae Volvox carteri and Chlamydomonas reinhardtii, suggesting that the presence of LHP1 is linked to multicellular development in the plant kingdom. Because chromatin immunoprecipitation has shown that LHP1 binding overlaps with H3K27me3 and LHP1 can bind H3K27me3 in vitro, it was suggested that the chromodomain-protein LHP1 is a PRC1 equivalent of plants In animals, PRC2 complexes set H3K27me3 marks, which assist to recruit PRC1 to mediate stable silencing lhp1-7(CD*) has a defective binding pocket for the quaternary ammonium group because the preference of LHP1 for H3K27me3 over H3K27 was lost for LHP1-CD*. Energy calculations using CHARMM in vivo. In contrast, the chromodomain might not be necessary for targeting of animal HP1 in vivoThree aromatic residues form the binding cavity for methylated lysines of H3 in the chromodomain of animal HP1 and Pc lhp1-7(CD*) allele was very similar to that of an lhp1 null allele, suggesting that LHP1 function requires an intact chromodomain. Because only LHP1-GFP but not LHP1-CD*-GFP could rescue lhp1 mutants, LHP1-CD* has no or strongly reduced biological activity. Residual binding of LHP1-CD* to H3K27me3 could explain the phenotypic differences between lhp-7(CD*) and lhp1-6(null) plants.Mutations in Arabidopsis LHP1 strongly affect development Loss of LHP1 or PRC2 share many similar developmental and molecular effects. Our experimental results, supported by homology modeling and previous reports, have revealed that LHP1 contributes to PRC1-like functions in plants and that chromodomain-mediated binding to H3K27me3 is required for this activity.Arabidopsis thaliana. The ddm1-2 allele was described before lhp1 allele, lhp1-6, was identified in the SALK T-DNA insertion mutant collection (SALK_011762). LHP1 and lhp1-7 cDNAs were cloned into vector pK7FWG2 Agrobacterium tumefaciens (strain GV3101). Seeds were germinated on sterile basal salts Murashige and Skoog (MS) medium , and plants were analyzed on plates or transferred to soil 10 days after germination. Alternatively, seeds were directly sown on soil. Plants were kept in Conviron growth chambers with mixed cold fluorescent and incandescent light  under long day  or short day  photoperiods or were alternatively raised in green houses.All mutants used are in the Columbia (Col) wild-type accession of msi1-tap1 transgenic line msi1-tap1. One family (0.3 362) segregated plants with a conspicuous early flowering phenotype. These early flowering plants were smaller, had reduced fertility and segregated in a 1:3 ratio (data not shown), suggesting recessive Mendelian inheritance. Molecular mapping located the mutation between the markers CER456657 (BAC MPI7) and CER457604 (BAC MXE10) on the top arm of chromosome V. Within the same region lies the gene At5g17690, which encodes LHP1. Because of similarities between the phenotypes of 0.3 362 plants and lhp1 mutants, the At5g17690 locus in 0.3 362 was sequenced and a single G to A transition was discovered.For a suppressor screen, seeds of the late flowering lhp1-6 null allele was performed. The analyzed F1 and F2 generations displayed a homogenous appearance with small rosette size and were early flowering (data not shown), while genotyping revealed the expected ratios of plants homozygous, heterozygous or negative for the presence of the lhp1-6 T-DNA insertion (data not shown), confirming that 0.3 362 was allelic to lhp1-6. The newly identified lhp1 allele was henceforth called lhp1-7.To confirm that the mutation in the LHP1 gene is indeed responsible for the observed phenotype, an allelism test between 0.3 362 and the Flowering time was defined as the time needed by the plants (n>7) to form a 5 mm high primary shoot. In addition, the numbers of juvenile and adult rosette leaves were determined based on the presence of abaxial trichomes as indicators for phase identity LHP1 and lhp1-7 cDNAs were cloned into vector pRSET-A (Invitrogen) for in vitro transcription/translation reactions  supplemented with L-[35S]methionine. Equal amounts of wild-type and mutant protein were incubated with H3K27 or H3K27me3 peptides (LATKAARKSAPATGGC) coupled to SulfoLink Coupling Gel . Samples were resolved by SDS-PAGE, exposed to a storage phosphor screen  and visualized using a Molecular Imager FX Pro Plus System .PP2A was used as reference gene RNA isolation and RT-PCR was performed as previously described Immuno-localization of GFP fusion proteins was performed as described previously Wild-type and mutant sequences were processed by the SwissModel server AG and SEP3 fragments was determined by qPCR using the Universal Probe system (Roche).Chromatin isolation was performed as described previously http://genome.jgi-psf.org/). Final sequence alignments of the selected sequences were generated with CLUSTALX 1.81 . The evolutionary history was inferred using the flat-weighted Maximum Parsimony method. The MP tree of amino acid sequences was obtained using the Close-Neighbor-Interchange algorithm with search level 3 in which the initial trees were obtained with the random addition of sequences (10 replicates). All alignment gaps were treated as missing data. There were a total of 985 positions in the final dataset, out of which 292 were parsimony informative. Phylogenetic analyses were conducted in MEGA4 Protein sequences of HP1 and LHP1 proteins were selected based on previous publications"}
+{"text": "Lymphocytes from patients with chronic lymphocytic leukaemia make large amounts of stable, rapidly labelled high molecular weight RNA, but ribosomal RNA methylation is normal. However, fewer ribosomes are available for protein synthesis than in normal lymphocytes."}
+{"text": "Backgrounds and Study Aims. Common bile duct (CBD) injury is one of the most serious complications of laparoscopic cholecystectomy (LC). Misidentification of the CBD duringdissection of the Calot's triangle can lead to such injuries. The aim of the authorsin this study is to present a new safe triangle of dissection. Patients and Method. 501 patients under went LC in the following approach; The cystic artery isidentified and mobilized from the gall bladder (GB) medial wall down towardsthe cystic duct which would simultaneously divide the medial GB peritonealattachment. This is then followed by dividing the lateral peritoneal attachment. The GB will be unfolded and the borders of the triangle of safety (TST) areachieved: cystic artery medially, cystic duct laterally and the gallbladder wallsuperiorly. The floor of the triangle is then divided to delineate both cystic ductand artery in an area relatively far from CBD. Results. There were little significant immediate or delayed complications. The meanoperating time was 68 minutes, nearly equivalent to the conventional method. Conclusions. Dissection at TST appears to be a safe procedure which clearlydemonstrates the cystic duct and may help to reduce the CBD injuries. Laparoscopic cholecystectomy has become the standard method of treatment for the removal of a diseased gallbladder. The technique most commonly employed is the infundibular approach which entails dissecting the gallbladder from its neck upward, after dissecting the cystic artery and the cystic duct using laser or electrocautery . However501 patients underwent laparoscopic cholecystectomy for gallbladder disease by the author and team in Farwanyia hospital from January 2001 to December 2008.The procedure is carried out using the standard four-port technique: the first port is a 10 mm supraumbilical camera port inserted using the open technique method of CO2 insufflation and the other three ports are inserted under direct camera vision . The galThe borders of triangle of safety are dissected out in four essential steps using electrocautery hook as follows.First step is dissecting the peritoneum over the GB wall in a direction just lateral to and parallel to the cystic artery from mid way along its length down toward the junction of the cystic artery and duct Figures . The cysSecond step is dividing the small branches of the cystic artery flaring on the GB wall under layers of peritoneum, one by one, layer by layer, until the dissection reaches a small branch that adheres cystic artery to cystic duct \u201cCalot's artery\u201d , formingThird step is releasing the lateral peritoneal attachment Figures .Fourth step is dividing tissues lying among the borders of triangle of safety close to the gallbladder wall reaching the lateral side and avoiding the posterior cystic artery branch .Finally is clipping and dividing the cystic artery over the GB wall rather in the Calot's triangle will spare dissection and possible injury near the common hepatic duct. This will leave only the cystic duct which can be divided near its junction with the GB infundubulum .There were 349 females and 152 males. The mean age was 42 years (range from 14 to 74 years). 80 patients were done as emergencies. The mean operative time was 68 minutes. Patients how underwent conversion to open cholecystectomy before start of dissecting GB due to tense adhesions and nonvisualization of GB were excluded from this study. There was one case converted to open due to bleeding from aberrant cystic artery rising directly from superior mesenteric artery on the lateral side of the GB. GB puncture with bile and stones leak occurred due to vigorous traction rather than electrodithermy. This was considered to be minor complication when compared to injury to the CBD.Prevention of injury to the ductal system continues to be a matter of considerable concern for any surgeon performing laparoscopic cholecystectomy. An increased incidence of CBD injury has been reported ranging between 0.5% to 3% , 10 comp Few methods have been advocated to reduce the incidence of ductal injuries which include: routine performance of intraoperative cholangiography , 13 and  There are four newly introduced steps in this technique and the remaining steps are carried out in the standard conventional way. In TST, dissection starts in an area away from Calot's triangle whereby no ductal or arterial anomalies are encountered. Upon reviewing the cystic duct and artery anomalies described in literature, most occur at the level of Calot's triangle \u201320. TST TST appears to be a safe technique which clearly demonstrates the anatomy of the cystic duct and reduces misidentification issue and the need for intraoperative cholangiography. As TST dissection occurs at a distance from Calot's triangle, no ductal or arterial anomalies are likely to be encountered, thus minimizing intra- and postoperative complications."}
+{"text": "Highly cohesive silicone gel implants are advertised for aesthetic and safety advantages. Our case is the fourth report describing early implant rupture and contralateral migration of siliconoma. Despite the greater degree of gel cohesiveness, a continued vigilance for signs and symptoms of migration is highly recommended. The introduction of highly cohesive silicone gel implants (HCGI) advertised favorable aesthetic and safety advantages over standard cohesive gel implants. These included greater durability of overall shape particularly with regards to the upper-pole volume and a reduction in incidence of outer shell folding. The safety profile also improved with the greater degree of gel viscosity by limiting migration and loco-regional spread of silicone gel after compromise of the implant shell. Since the introduction of HCGI in 1993 there have only been 3 published case reports of regional spread and axillary lymph node involvement after capsular rupture of an HCGI [An European Caucasian 59-year-old patient had delayed reconstruction with a latissimus dorsi flap and McGhan 410 highly cohesive silicone implant after a modified radical mastectomy of the left breast. Prior to reconstruction, the patient was treated for multifocal invasive ductal carcinoma with adjuvant chemotherapy and radiation to the chest. During reconstruction, symmetrization of the right side was achieved by performing a superior pedicle mammoplasty and insertion of a Poly Implant Prosthesis (PIP) gel implant. After 2 years of routine follow-up, the patient experienced rapid enlargement of her reconstructed left breast (Figure Silicone gel entering the lymphatics, either through overt implant rupture or slow leakage across the intact outer shell, can result in regional migration to the draining lymph node basins ,2. AxillWith the introduction of highly cohesive silicone gel matrix implants in the 1990's the risk of local-regional spread after rupture was thought to have been ameliorated. The early experience with highly cohesive implants resulted in low complication rates without evidence for silicone migration [The 3 year results of the highly cohesive silicone breast implant core study reported a less than 1% device rupture rate . MagnetiMRI has proven to be sensitive in the detection of implant rupture. Comparison studies have demonstrated higher rates of sensitivity using MRI compared to mammography or ultrasonography when the appropriate breast coil is utilized . The rolEarly implant failure of HCGI is rare, but despite the increased gel viscosity the potential for regional migration remains. This is the fourth case report describing regional migration. Our case report adds to a growing awareness of this phenomenon and emphasizes the need for continued vigilance for signs and symptoms of migration despite the greater degree of gel cohesiveness.HCGI: Highly cohesive silicone gel implants; PIP: Poly Implant Prosthesis; MRI: Magnetic resonance imaging.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.GK and RS performed the writing of the manuscript. CI, IS and CN contributed to analysis. KC contributed to revision, supervision and approval of the work."}
+{"text": "Plant WRKY DNA-binding transcription factors are key regulators in certain developmental programs. A number of studies have suggested that WRKY genes may mediate seed germination and postgermination growth. However, it is unclear whether WRKY genes mediate ABA-dependent seed germination and postgermination growth arrest.Arabidopsis WRKY2 transcription factor during ABA-dependent seed germination and postgermination growth arrest, we isolated T-DNA insertion mutants. Two independent T-DNA insertion mutants for WRKY2 were hypersensitive to ABA responses only during seed germination and postgermination early growth. wrky2 mutants displayed delayed or decreased expression of ABI5 and ABI3, but increased or prolonged expression of Em1 and Em6. wrky2 mutants and wild type showed similar levels of expression for miR159 and its target genes MYB33 and MYB101. Analysis of WRKY2 expression level in ABA-insensitive and ABA-deficient mutants abi5-1, abi3-1, aba2-3 and aba3-1 further indicated that ABA-induced WRKY2 accumulation during germination and postgermination early growth requires ABI5, ABI3, ABA2 and ABA3.To determine directly the role of wrky2 mutants during seed germination and postgermination early seedling establishment is attributable to elevated mRNA levels of ABI5, ABI3 and ABI5-induced Em1 and Em6 in the mutants. WRKY2-mediated ABA responses are independent of miR159 and its target genes MYB33 and MYB101. ABI5, ABI3, ABA2 and ABA3 are important regulators of the transcripts of WRKY2 by ABA treatment. Our results suggest that WRKY2 transcription factor mediates seed germination and postgermination developmental arrest by ABA.ABA hypersensitivity of the  ABI3 and ABI5 are known to be important regulators of ABA-dependent growth arrest during germination dATP labeled gene-specific probes. Hybridization was performed in PerfectHyb plus hybridization buffer (Sigma) overnight at 68\u00b0C. The membrane was then washed for 10 minutes twice with 2\u00d7 SSC (1\u00d7 SSC is 0.15 M NaCl and 0.015 M sodium citrate) and 1% SDS and for 10 minutes with 0.1\u00d7 SSC and 1% SDS at 68\u00b0C. Transcripts for WRKY2 were detected with about 1 kb before stop codon of WRKY2 cDNA as probe.Total RNA was isolated using the TRIZOL reagent . 20 \u03bcg RNA was separated by electrophoresis on denaturing 17% polyacrylamide gels, and electroblotted onto a Hybond-NWRKY2 gene, participated in the design of the study, drafted and edit the manuscript. DY conceived of the study, participated in the design and helped to draft and edit the manuscript. All authors read and approved the final manuscript.WJ carried out all experiments of"}
+{"text": "There are also human studies on using green tea catechins to treat metabolic syndrome, such as obesity, type II diabetes, and cardiovascular risk factors.The health benefits of green tea for a wide variety of ailments, including different types of cancer, heart disease, and liver disease, were reported. Many of these beneficial effects of green tea are related to its catechin, particularly (-)-epigallocatechin-3-gallate, content. There is evidence from Long-term consumption of tea catechins could be beneficial against high-fat diet-induced obesity and type II diabetes and could reduce the risk of coronary disease. Further research that conforms to international standards should be performed to monitor the pharmacological and clinical effects of green tea and to elucidate its mechanisms of action. In recent years, the health benefits  of consuin vitro, in vivo, and ex vivo systems [The health-promoting effects of green tea are mainly attributed to its polyphenol content , particu systems .in vivo studies, general pharmacology and toxicology. The health benefits and adverse effects of green tea and its catechins were reviewed.The review on green tea and its catechins focused on language literature in English. The literature search was conducted in the following databases: Pubmed (1980-2009), EMBASE (1980-2009), Allied and complementary Medicine Database  and China Journals Full Text Database (1975-2009). The keywords used were selected from the following terms: green tea, catechins, anticancer, diabetes, polyphenols, The authors read full articles and reached consensus after discussion. Articles included in the study covered the following effects of green tea: (1) the health benefits in humans and animals, (2) absorption of metal ions and drug-metabolizing enzymes, (3) antioxidation and inhibition of oxidative stress, (4) carbohydrate metabolism and diabetes mellitus, and (5) adverse effects. A total of 105 peer-reviewed papers in English were selected for this review.Camellia sinensis, is consumed in different parts of the world as green, black, or Oolong tea. Among all of these, however, the most significant effects on human health have been observed with the consumption of green tea [Tea is one of the most popular beverages consumed worldwide. Tea, from the plant reen tea . The firreen tea . The assreen tea ,20. GreeN-ethylglutamine, glutamic acid, tryptophan, glycine, serine, aspartic acid, tyrosine, valine, leucine, threonine, arginine, and lysine; carbohydrates (5-7% dry weight) such as cellulose, pectins, glucose, fructose, and sucrose; minerals and trace elements (5% dry weight) such as calcium, magnesium, chromium, manganese, iron, copper, zinc, molybdenum, selenium, sodium, phosphorus, cobalt, strontium, nickel, potassium, fluorine, and aluminum; and trace amounts of lipids (linoleic and \u03b1-linolenic acids), sterols (stigmasterol), vitamins , xanthic bases , pigments , and volatile compounds . Due to the great importance of the mineral presence in tea, many studies have determined their levels in tea leaves and their infusions , whose enzymes constitute an important fraction; amino acids (1-4% dry weight) such as theanine or 5-Green tea contains polyphenols, which include flavanols, flavandiols, flavonoids, and phenolic acids; these compounds may account for up to 30% of the dry weight. Most of the green tea polyphenols (GTPs) are flavonols, commonly known as catechins. Products derived from green tea are mainly extracts of green tea in liquid or powder form that vary in the proportion of polyphenols (45-90%) and caffeine content (0.4-10%). The major flavonoids of green tea are various catechins, which are found in greater amounts in green tea than in black or Oolong tea . There aStudies using animal models show that green tea catechins provide some protection against degenerative diseases . Some stGreen tea consumption has also been linked to the prevention of many types of cancer, including lung, colon, esophagus, mouth, stomach, small intestine, kidney, pancreas, and mammary glands . Severalet al. [et al. [Tea components possess antioxidant, antimutagenic, and anticarcinogenic effects and could protect humans against the risk of cancer by environmental agents . Sano etet al.  reportedet al. . Shim et [et al.  studied Helicobacter pylori infection [Herpes simplex virus have also been demonstrated [et al. [in vitro by green tea catechins.The effectiveness of green tea in treating any type of diarrhea and typhoid has been known in Asia since ancient times -43. Greenfection ,45. Effenstrated -48. Furt [et al.  observedCandida albicans and the convenience of a combined treatment with catechins and lower doses of antimycotics, which may help to avoid the side effects of antimycotics. Green tea consumption has also been associated with increased bone mineral density, and it has been identified as an independent factor protecting against the risk of hip fractures; this effect was considered independent of smoking status, hormone replacement therapy, coffee drinking, and the addition of milk to tea [et al. [et al. [In humans, Hirasawa and Takada  studied k to tea . Park et [et al.  observed [et al. ,53. Gree [et al. ,54. Stud [et al. ,56. Some [et al. ,57. In a [et al. . Skrzydl [et al.  indicate [et al. , green t [et al. .Tea has been shown anticarcinogenic effects against breast cancer in experimental studies . Howeveret al. [Hsu et al.  demonstrTea catechins can affect iron absorption, particularly in groups at risk of iron deficiency ,66, but Long-term ingestion of green tea increases UDP-glucuronosyl transferase activity in rats ,70,71, aGreen tea is a popular neutraceutical as an antioxidant. Antioxidants are compounds that protect cells against the damaging effects of reactive oxygen species, such as singlet oxygen, superoxide, peroxyl radicals, hydroxyl radicals, and peroxynitrite. An imbalance between antioxidants and reactive oxygen species results in oxidative stress, leading to cellular damage . CatechiIn vivo studies showed that green tea catechins increase total plasma antioxidant activity [in vitro, they might prevent the oxidation of other antioxidants, such as vitamin E. However, ingestion of green tea catechins does not modify the plasma status of vitamins E and C in vivo [activity ,78. Intaactivity . This acactivity . Malondiactivity ,80. Thes in vivo ,82. Neve in vivo  and in t in vivo .et al. [Pilipenko et al.  assessedType II diabetes is a heterogeneous disorder that involves resistance of glucose and lipid metabolism in peripheral tissues to the biological activity of insulin and inadequate insulin secretion by pancreatic \u03b2 cells . Animal et al. [In a study by Sabu et al. , adminiset al. .Catechins also reduced plasma triglyceride levels in an oral glucose-tolerance test in normal rats . Green tet al. [The antihyperglycemic effect of black tea was reported by Gomes et al. . EGCG waet al. . Streptoet al. ,96. Alloet al.  and are in vivo conditions, glutathione acts as an antioxidant, and its decrease was reported in a diabetes mellitus model [in vivo. Vucic et al. [Under us model . The incc et al.  reportedThe Mediterranean Islands (MEDIS) epidemiological study is a cross-sectional health and nutrition survey that aims to evaluate the association between various sociodemographic, bioclinical, dietary, and other lifestyle habits and the prevalence of the common cardiovascular disease risk factors  among elderly people without a history of any chronic disease and living in the Mediterranean islands. Because data relating tea consumption with clinical characteristics are lacking in elderly populations, in the context of the MEDIS study, the authors sought to evaluate whether green tea consumption is independently associated with fasting blood glucose levels and the prevalence of type II diabetes mellitus . An earlet al. [in vitro evidence that EGCG decreases glucose production of H4IIE rat hepatoma cells. The investigators showed that EGCG mimics insulin, increases tyrosine phosphorylation of the insulin receptor and the insulin receptor substrate, and reduces gene expression of the gluconeogenic enzyme phosphoenolpyruvate carboxykinase. Recently, green tea and green tea extracts were demonstrated to modify glucose metabolism beneficially in experimental models of type II diabetes mellitus [in vitro [in vivo [A study by Waltner-Law et al.  providedmellitus ,100. In in vitro  and prev[in vivo .et al. [Lambert et al.  showed tet al. . These rThe effects of tea on obesity and diabetes have received increasing attention. Tea catechins, especially EGCG, appear to have antiobesity and antidiabetic effects . AfricanA double-blind, placebo-controlled, cross-over design study showed that consumption of a beverage containing green tea catechins, caffeine, and calcium increases 24-h energy expenditure by 4.6%, but the contribution of the individual ingredients could not be distinguished. It was suggested that such modifications were sufficient to prevent weight gain. It has been reported that the body weights of rats and their plasma triglyceride, cholesterol, and low-density lipoprotein cholesterol were significantly reduced by feedings of Oolong, black, and green tea leaves to the animals. In addition, the inhibition of growth and suppression of lipogenesis in MCF-7 breast cancer cells may be through down-regulation of fatty acid synthase gene expression in the nucleus and stimulation of cell energy expenditure in the mitochondria ,108. WheRecent data from human studies indicate that the consumption of green tea and green tea extracts may help reduce body weight, mainly body fat, by increasing postprandial thermogenesis and fat oxidation. In a randomized, double-blind, placebo-controlled, cross-over pilot study, six overweight men were given 300 mg EGCG per day for two days. Fasting and postprandial changes in energy expenditure and substrate oxidation were assessed. Resting energy expenditure did not differ significantly between EGCG and placebo treatments, although during the first postprandial monitoring phase, respiratory quotient values were significantly lower with EGCG treatment compared to the placebo. These findings suggest that EGCG alone has the potential to increase fat oxidation in men and may thereby contribute to the antiobesity effects of green tea. However, more studies with a greater sample size and a broader range of age and body mass index are needed to define the optimal dose .et al. [in vivo. Therefore, high intake of green tea may be detrimental for diabetic animals to control hyperglycemia. At a high dose (5% of diet for 13 wk), green tea extract induced a thyroid enlargement (goiter) in normal rats [Although green tea has several beneficial effects on health, the effects of green tea and its constituents may be beneficial up to a certain dose yet higher doses may cause some unknown adverse effects. Moreover, the effects of green tea catechins may not be similar in all individuals. EGCG of green tea extract is cytotoxic, and higher consumption of green tea can exert acute cytotoxicity in liver cells, a major metabolic organ in the body . Anotheret al.  clarifiemal rats ,116. ThiHarmful effects of tea overconsumption (black or green) are due to three main factors: (1) its caffeine content, (2) the presence of aluminum, and (3) the effects of tea polyphenols on iron bioavailability. Green tea should not be taken by patients suffering from heart conditions or major cardiovascular problems. Pregnant and breast-feeding women should drink no more than one or two cups per day, because caffeine can cause an increase in heart rhythm. It is also important to control the concomitant consumption of green tea and some drugs, due to caffeine's diuretic effects . Some stLaboratory studies showed the health effects of green tea. As the human clinical evidence is still limited, future research needs to define the actual magnitude of health benefits, establishes the safe range of tea consumption associated with these benefits, and elucidates the mechanisms of action. Development of more specific and sensitive methods with more representative models along with the development of good predictive biomarkers will give a better understanding of how green tea interacts with endogenous systems and other exogenous factors. Definitive conclusions concerning the protective effect of green tea have to come from well-designed observational epidemiological studies and intervention trials. The development of biomarkers for green tea consumption, as well as molecular markers for its biological effects, will facilitate future research in this area.EGCG: epigallocatechin-3-gallate; GTPs: green tea polyphenols; UDP: Uridine di-phospatase; IQ: 2-amino-3-methylimidazol quinoline; MEDIS: Mediterranean Islands; SDLT: Sodium dependent glucose transporter; AMED: Allied and complementary Medicine Database.The authors declare that they have no competing interests.SMC and PTT did the literature search and drafted the manuscript. RK and IN critically reviewed the literature and revised the manuscript. All authors read and approved the final version of the manuscript."}
+{"text": "Normal and tumour tissues from rats, blood from normal and tumour bearing rats, and normal human blood were examined using the electron paramagnetic resonance (epr) technique. At low temperature a triplet epr signal, which is known to be produced by a NO-haemoprotein complex, was detected in some tumour samples and in decaying normal liver. At room temperature all of the tumour samples examined gave a doublet signal. This signal was also detected in blood but not in other normal tissues. The signal has a g value of 2\u00b70054 \u00b1 0\u00b70002 and a hyperfine splitting of 1\u00b780 \u00b1 0\u00b705 G and is assigned to the ascorbyl free radical. Model experiments suggest that the appearance of detectable concentrations of this radical result from a disturbance of the normal state of the ascorbic acid, dehydroascorbic acid redox system. It was verified that cell division is not responsible for the ascorbyl radical although autolysis may be involved. A possible relationship between the formation of ascorbyl radicals and other paramagnetic species in tumours is discussed."}
+{"text": "T-cell immunodeficiency is a common feature in cancer patients, which may relate to initiation and development of tumor. Based on our previous finding, to further characterize the immune status, T cell proliferative history was analyzed in CD4+ and CD8+ T cells from chronic myeloid leukemia (CML) patients.TRBV-D1 sjTRECs was performed by semi-nested PCR. Forty eight CML cases in chronic phase (CML-CP) were selected for this study and 17 healthy individuals served as controls.Quantitative analysis of \u03b4Rec-\u03c8J\u03b1 signal joint T cell receptor excision circles (sjTRECs) was performed in PBMCs, CD3+, CD4+ and CD8+T cells by real-time PCR, and the analysis of 23 TRBV subfamily sjTRECs, as well as the frequency of particular TRBV-BD1 sjTRECs in patients with CML were significantly lower than those from healthy individuals.The levels of \u03b4Rec-\u03c8J\u03b1 sjTRECs in PBMCs, CD3+, CD4+, and CD8+ T cells were significantly decreased in CML patients, compared with control groups. Moreover, the numbers of detectable We observed decreased levels of recent thymic emigrants in CD4+ and CD8+ T cells that may underlay the persistent immunodeficiency in CML patients. Chronic myeloid leukemia (CML), with the incidence of 1.5/100,000 population, represents 15% of newly diagnosed leukemia cases in adults in China. The prognosis in CML improved markedly after introduction of abl tyrosine kinase inhibitors (Immatinib mesylate and its derivatives), still a lot of CML patients die due to abl mutation related drug resistance and the blast crisis ,3, althoTCR beta locus (TRB) contains at least 64 functional V genes (TRBV) subdivided into 24 families /[RAG2(1)+RAG2(2)] . The absThe numbers of sjTRECs in PBMCs and sorted T cells from CML were higher in females than in males. The values were: the PBMCs group: 0.19 \u00b1 0.25 copies/1000cells in male (n = 33) versus 0.43 \u00b1 0.56 copies/1000cells in female (n = 15) (p = 0.0467), in the CD3+T cells group: 1.05 \u00b1 1.21 copies/1000cells in male (n = 33) versus 1.97 \u00b1 2.25 copies/1000cells in female (n = 15) (p = 0.0712), in the CD4+T cells group: 1.4 \u00b1 2.08 copies/1000cells in male (n = 14) versus 1.74 \u00b1 1.31 copies/1000cells in female (n = 5) (p = 0.739), and in the CD8+T cells group: 1.66 \u00b1 1.63 copies/1000cells in male (n = 14) versus 4.95 \u00b1 2.82 copies/1000cells in female (n = 5) (p = 0.0053). Similar results were found in healthy individual group (data not shown). Although the differences between genders were quite obvious, they were not statistically significant, except for PBMCs and CD8+ cells in CML patients.TRBV-BD1 sjTRECs from TRBV1-19 and TRBV21-24 were analyzed by semi-nested PCR, using different amounts of DNA . Samples were amplified to estimate the frequency of TCR TRBV-BD1 sjTRECs and the sequences of the junction regions of each TRBV-BD1 sjTRECs were confirmed by PCR products direct sequencing (data not shown).The TRBV subfamily sjTRECs differed significantly between CML and healthy control in 2 \u00d7 105, 5 \u00d7 104 and 1 \u00d7 104 PBMCs or in 1 \u00d7 104 of CD4+ and CD8+ T cells   when comparing the frequency of TRBV subfamily sjTRECs in CD4+ and CD8+ T cells at 1 \u00d7 104 concentration between both group  Figure . But theTRBV repertoire in peripheral blood mononuclear cells (PBMCs) from CML patients [In patients with CML, cellular immune deficiency is a common feature which may be due to decreased output of recent thymic emigrants, the abnormal expression of T cell receptor repertoire and, may in part, due to altered expression of TCR-CD3 complex. Our previous study showed decreased \u03b4Rec-\u03c8J\u03b1 sjTRECs level and skewed patients ,21. And patients ,23.In order to further evaluate the T-cell immune function, the T cell proliferative history in CML patients was analyzed. The sjTRECs-content in PBMCs and CD3+ T cells from 48 CML cases was determined. The results confirmed our previous smaller study . We showPido-Lopez et al showed that the decline in number of recent thymic emigrants in the blood with increasing age is gender-linked . PeripheTRBV subfamily na\u00efve T cells, which is an important factor in immune competence. In this study, we analyzed the total 23 subfamilies of TRBV-DB1 sjTRECs in PBMCs, CD4+ and CD8+ T-cells from CML patients by a semi-nested PCR. The results indicate that the percentage of cases positive for TRBV-DB1 sjTRECs varies in different BV subfamilies in healthy controls; the highest for TRBV1, 3, 4, 10, 12-14, 17 and V21, which could be detected in all 10 samples (at 2 \u00d7 105 PBMCs). The most important observation in this study was the significantly lower frequency of 23 TRBV-BD1 sjTRECs in PBMCs, as well as in CD4+ and CD8+ T cells from CML patients as compared with healthy individuals, indicating poor thymic output in CML patients. The results further support and explain the significant reduction of recent thymic emigrant numbers in peripheral blood of CML patients, as measured by quantitative detection of \u03b4Rec-\u03c8J\u03b1 sjTRECs.The majority of studies published previously focused only on the total thymic output, as measured by quantitative analysis of \u03b4Rec-\u03c8J\u03b1 sjTRECs . This apTRBV-DB1 subfamily specific sjTRECs. We showed a prominent decrease of sjTRECs levels in CML, indicating the reduction of recent thymic emigrants affects the majority of TRBV subfamilies.In conclusion, this is, to our knowledge, the first characterization of thymic output function in CD4+ and CD8+ T cells from CML patients based on analyses of both \u03b4Rec-\u03c8J\u03b1 sjTRECs and The authors declare that they have no competing interests.YQL, CAS and GKP were responsible for study design and data management. SXG and SHC performed the real-time PCR, QSY and LJY performed the semi-nested PCR, XLW and BL performed the statistical analysis, XD collected samples. All authors read and approved the final manuscript."}
+{"text": "The purpose of this study was to determine the condylar volume in subjects with different mandibular divergence and skeletal class using cone-beam computed tomography (CBCT) and analysis software.For 94 patients , resultant rendering reconstructions of the left and right temporal mandibular joints (TMJs) were obtained.Subjects were then classified on the base of ANB angle the GoGn-SN angle in three classes  . The data of the different classes were compared.No significant difference was observed in the whole sample between the right and the left sides in condylar volume.The analysis of mean volume among low, normal and high mandibular plane angles revealed a significantly higher volume and surface in low angle subjects (p\u2009<\u20090.01) compared to the other groups.Class III subjects also tended to show a higher condylar volume and surface than class I and class II subjects, although the difference was not significant.Higher condylar volume was a common characteristic of low angle subjects compared to normal and high mandibular plane angle subjects. Skeletal class also appears to be associated to condylar volume and surface. The shape and volume of the condyle in young adults is considered to play an important role in the stability of long-term orthodontic and orthognathic therapies\u20107]..7].Since the mandibular condyle undergoes a remodelling process as it responds to continuous stimuli from childhood to adulthood, it is the primary centre of growth in the mandible, where its final dimension of shape and volume could be linked to the relation between the maxillary and mandibular bases.Being a part of the TMJ structure, the condyle shows a continuous adaptability to functional stimuli. During adulthood, the condyle is often subjected to an ongoing remodelling processes, such as flattening, erosion, sclerosis, osteophytes, and resorption, which could affect its volume and shape.Such changes in the condyle are more associated with a number of clinical conditions: (i) arthritis, which can affect the condylar volume; (ii) the asymmetry, as recently assessed in humans; (iii) aTo our knowledge, data on the optimum size or volume of the mandibular condyle are not present in the literature, but they could be indicative and predictive of a precise clinical situation. Therefore, a list of standards, or optimum measurements for size and volume of the mandibular condyle could be useful in predicting risk factors for some pathologies, such as disc displacement.The cone-beam computed tomography (CBCT) can provide high-resolution images (i.e. with an isotropic resolution ranging from 0.4 to 0.125\u2009mm), short scanning times (10 \u2013 70 seconds), and reduced radiation dose  information, that can be useful in the study of condylar morphology.The purpose of this study was to determine the mandibular condylar volume and surface in a group of adult subjects clinically asymptomatic for TMJ pain and dysfunction using CBThe 3D scans of 188 temporo-mandibular joints (TMJ) of 94 Caucasian adult  was retrospectively examined. The subjects did not show pain or dysfunction at TMJ and condAll the subjects had taken cone beam evaluation of the stomatognatic apparatus (including the TMJ area) for the following reasons: (i) teeth extraction, such as wisdom teeth; (ii) orthodontic evaluation of unerupted teeth; (iii) the study of cephalometric aspects ; (iv) the study of the upper airway by an otorhinolaryngologist, such as clinical sinusitis, and/or cysts of the maxillary sinus; (v) the study of odontogenic cysts.exclusionary criteria).The selected patients were asymptomatic for TMJ\u2019s pain and dysfunction at their first visit. Subjects with unilateral cross bite and with loss of teeth in the posterior zones were excluded .Subjects were considered in skeletal class I if the ANB angle ranged between 2\u00b0\u2009\u00b1\u20092\u00b0, and within normal divergence if GoGn-SN angle ranged between 28\u00b0 and 37\u00b0. These measurements were obtained on CBCT using Dolphin software \u2122.Subjects in skeletal class I showed a ANB angle of 2\u2009\u00b1\u20091.5 degree; subjects in skeletal class II showed a ANB angle of 5.5\u2009\u00b1\u20091.5; subjects in skeletal class III showed a ANB angle of \u22120.9\u2009\u00b1\u20090.8 degree.Subjects in normo-divergence showed a GoGn-SN angle of 33\u2009\u00b1\u20093 degree; subjects in hyper-divergence showed a GoGn-SN angle of 40\u2009\u00b1\u20093 degree; subjects in hypo-divergence showed a GoGn-SN of 24\u2009\u00b1\u20093.The evaluation of CBCT data included condylar volume and condylar surface.Cone Beam Volumetric Tomography datasets were acquired with the ILUMA\u2122 , with a reconstructed layer thickness of 0.5\u2009mm, with a 512x512 matrix. The device was operated at 120 kVp and 3\u20138\u2009mA by using a high frequency generator with a fixed anode and a 0.5\u2009mm focal spot. A single 40-second high-resolution scan was made of each skull. The voxel size was set at 0.25-mm.The segmentation of the mandibular condyle was based on 2D Digital Imaging and Communications in Medicine (DICOM), created with CT data set, using the Mimics\u2122 software 9.0  Figure.Each condyle was visualized in the recommended bone density range  and then graphically isolated prior to the 3D and volumetric measurements. Frankfort horizontal (FH) plane was constructed by creating a plane from the inferior orbital rim to the superior border of the external auditory meatus. An initial slice was made parallel to the FH plane just above the superior aspect of the condyle.Then, the area of TMJ was graphically enlarged, and the remaining surrounding structures were progressively removed using various graphical sculpting tools for the upper, the lower and the side condylar walls.The upper limit of the condyle was defined where the first radiopaque area was viewed in the area of synovia Figure; then, fVolumetric measurements were made for each condyle with the Mimics\u2122 automatic function.In order to assess intra-observer error in identifying and pinpointing the condylar structure, ten skulls were processed twice by the same operator (S.T.)  and differences in condylar volumes and condylar surfaces were evaluated with Wilcoxon test. No significant difference was observed between the two measurements (p\u2009=\u20090.9 for the volume and p\u2009=\u20090.7 for the surface).In order to assess inter-observer error, the ten skulls were also processed by another researcher (M.S) and the data were compared by using Mann\u2013Whitney test. No significant difference was observed between the two measurements (p\u2009=\u20090.94 for the volume and p\u2009=\u20090.77 for the surface).Data were analyzed using SPSS 14.0 . Differences in surface and volumetric measurements across the three groups were analyzed with ANOVA followed by a post-hoc analysis to test the differences among the sets of means of the groups.We performed a study to evaluate the correct number of subjects in the sample for each group. Firstly, we considered the 3 groups. Then, we assigned a P value of 0.01, and a statistical power of 0.8. Then, we determined a minimal acceptable difference equal to the standard deviation of 0.684 observed in the whole sample, and obtained a minimum of 30 subjects for each group. Considering that high angle subjects were only 17, we assigned a power of 0.7 in that case. When we divided the sample on the base of skeletal class, class III subjects came out to be 25 subjects, and we obtained a power of 0.8 in that case.T-test.Considering the data in the whole sample, we performed a comparison between the data obtained in the right side and the data obtained in the left with the paired sample No significant difference emerged.When we compared the three groups with different skeletal classes and the three groups with different mandibular divergence, we tested for differences in volumetric and surface measurements among the three groups with the ANOVA test followed by a post-hoc analysis to assess the significance level.Surface graphical rendering revealed detailed images of the left and right condyles based on the processed and registered CBCT data. Visual inspection of the volume images in a 360-degree rotation showed a regular variety of condylar morphology, without any abnormal aspect of condylar anatomy.Statistical outputs for the whole sample are reported in Tablest-test with Bonferroni correction, p\u2009<\u20090.01) . Post-hoc analysis revealed significant differences between low and high mandibular plane subjects (. Post-ho) Tables.There was also a significant difference between low and normal mandibular plane subjects , while no significant difference was observed between high and normal mandibular plane subjects  . The anatomy of the mandibular condyle has already been demonstrated to change from childhood to adulthood within an age range from 8.3\u2009years to 42.8\u2009years in 94 joints of 47 subjects..14].Bjork reported that condylar growth rates can vary from as little as 0.5\u2009mm to as much as five mm per year during this period. While BWith this method, the study is the first to demonstrate a significant degree of condylar hyperplasia in low mandibular plane angle subjects, compared to normal and high angle subjects.Our statistical analysis revealed a difference of about 20% in the surface between low- and high- mandibular plane angle subjects and of about 18% in the volume between low- and normal- mandibular plane angle subjects.The mean differences were lower than the SD value observed in the whole sample, but they are statistically significant and clinically relevant considering the mean percentage of 18-20% with respect to the other groups.The hypothesis about the mechanism related to the observed differences concerns the muscular activity of the muscles associated to the stomatognatic function.Another hypothesis about the \u201cmechanism at work\u201d concerns the differences in the genome among subjects with different facial morphological characteristics; the genetic differences could be also related to the histological structures of the condyle; for example, a previous study has demonstrated that hyperplasia of the mandibular condyle is characterized histologically by the presence of an uninterrupted layer of undifferentiated germinative mesenchyme cells, a layer of hypertrophic cartilage and of islands of chondrocytes in the subchondral trabecular bone.Certain conclusions about the mechanism associated to the observed differences are not possible due to the transversal construction of this research; for this, only hypothesis can be done.From a clinical perspective, these findings lead us to hypothesize that any predisposition to temporomandibular disorders, which seems to differ in subjects with different mandibular skeletal class or divergence could also be related to the condylar volume. This hypothesis needs to be tested by future studies.For what concerns the condylar size, most articles report on the size in two-dimensional images of the condyle. In a recent study larger sDuring mastication, different force vectors against the condyle exist and alsoThere are a few reports suggesting that TMJ morphology has a strong correlation with skeletal morphology and an eIn the literature, the condylar volume has been also related to the type of mastication. In a stThroughout this study, however, the observed differences were in the range of the standard deviation observed in the whole sample, and the extent to which such differences can be considered physiological or pathological still remains unclear even though there are significant differences between groups, with a difference of about 18-20%. Quantitative information on condylar volume can not tell anything about TMJ signs and symptoms or any particular morphological alteration, as we included only asymptomatic subjects with malocclusion, so the observed variability seems to complicate correct diagnosis and treatment planning.Owing to ethical reasons, it was not possible to include other subjects  or to schedule another CBCT procedure over time. For both reasons, the interpretation of the results remains difficult.Our pilot evaluation of the volume images in 360 degree represents an initial classification, which should be supported by new studies.In the present study, using the CBCT-based method, it was shown that the condylar volume and surface could be measured accurately. In a group of subjects with different mandibular angles and skeletal classes, condylar volume was found to be a common feature. The degree of difference among the various groups was variable, but significant in the low mandibular angle subjects compared to normal and high angle subjects.Condylar size, both volume and surface, seems to correlate with the mandibular morphology, therefore influencing facial divergence and, at a lower rate, skeletal class of a subject, mostly in the low mandibular angle subjects.The authors declare that they have no competing interests.MS and ST are the Principal Investigator of this research article. They 1) have made substantial contributions to conception and design, acquisition of data, analysis and interpretation of data; 2) have been involved in drafting the manuscript or revising it critically for important intellectual content; and 3) have given final approval of the version to be published. AP and FF have made substantial contributions in acquisition of data and participated in drafting the manuscript and helped in the revision of the manuscript. All authors read and approved the final manuscript."}
+{"text": "There have been no quantitative standards for volumetric and surface measurements of the mandibular condyle in Caucasian population. However, the recently developed cone-beam computed tomography (CBCT) system allows measurement of these parameters with high accuracy.CBCT was used to measure the condylar volume, surface and the volume to surface ratio, called the Morphometric Index (MI), of 300 temporo-mandibular joints (TMJ) in 150 Caucasian young adult subjects, with varied malocclusions, without pain or dysfunction of TMJs.3 in males and 669.65 \u00b1 58.80 mm3 in, and was significantly higher (p< 0.001) in the males. The same was observed for the condylar surface, although without statistical significance .The condylar volume was 691.26 \u00b1 54.52 mm3 ) in the right TMJ was significantly higher than in the left  as was the condylar surface . The MI is 1.72 \u00b1 0.17 for the whole sample, with no significant difference between males and females or the right and left sides.Furthermore, the condylar volume (693.61 \u00b1 62.82 mmThese data from temporomandibular joints of patients without pain or clinical dysfunction might serve as examples of normal TMJ's in the general population not seeking orthodontic care. Three-dimensional 3-D) Cone Beam Computed Tomography (CBCT) systems  produce -D Cone BCBCT provides a method to calculate the volume of the structure, which could be interesting from research and clinical points of view.First, from clinical point of view, the multiple image views and computer-generated 3-D models of patients could allow the diagnostician to better visualize the potential therapeutic effects before they are actually rendered in a \"spatial plane concept,\" which is perceived as the next progressive step in dental imaging.The 3-D evaluation of the mandibular condyle could be particularly interesting, because the condyle, the primary center of growth in the mandible, responds to the continuous stimuli through a remodeling process, and thus plays an important role in the final (adult) dimension of the mandible. Hence, its volume can be related to the mandibular final dimension as well as to the relationship between maxillary and mandibular bases.During young adulthood, the condyle (its shape and volume) demonstrates adaptability to functional stimuli and this adaption can play an important role in the stability of long-term orthodontic and orthognathic therapies .Also, during adulthood, owing to its adaptability, the condyle is often subjected to remodeling processes , which could affect its volume and shape . Such chThe purpose of this study was to determine the condylar volume and surface area in young adult Caucasian subjects, through CBCT images, without pain or dysfunctions in their TMJs. The data derived from this study might provide a baseline for better understanding of the relationship between condylar volume and surface, called the Morphometric Index (MI), to define the altered shape of the condyles.The 3-D CBCT scans of 300 temporomandibular joints (TMJ) in 150 Caucasian young adults subjects , who did not show pain or dysfunction of TMJ, and referred to the public clinic of head and facial medicine for orthodontic evaluation, were examined. The selection of subjects was made among those who did not show pain or dysfunction of TMJ  at the fFrom a clinical point of view, we evaluated whether there was spontaneously evoked pain, localized in the muscles of mastication, the preauricular area, and/or the TMJs, which may be related to trauma (such as a blow to the face), interanal derangement, inflammatory or degenerative arthritis, or by the mandible being pushed back towards the ears whenever the patient chews or swallows. The muscles around the TMJ used for chewing were palpated, and head and neck pain were evaluated. In addition, difficulty opening the mouth normally was evaluated. Then, earache, headache, and facial pain were evaluated. Finally, limited or asymmetric jaw movement and joint sounds  in the temporomandibular joint were evaluated to exclude TMJ dysfunction signs.The CBCT scans were taken as orthodontic diagnostic tools. In our orthodontic department, patients who come for evaluation are asked to take the traditional radiographs  or, alternatively, to make a CBCT acquisition, avoiding the three radiographs. The sample included in this retrospective study was selected among those patients who chose to have CBCT scans.The protocol was evaluated by the Ethical Committee of the University of Chiati, that stated no ethical approval of the protocol is necessary for this retrospective study, as patients have gone spontaneously to the Department for their medical evaluation of the orthodontic problem. Only a signed informed agreement was obtained from each subject, by the radiological study, to know and approve the medical procedure.The evaluation of CBCT data included:1. Condylar volume2. Condylar surface3) set at 0.25 mm3, and a 17.0 mm diameter and 13.2 cm field of view.Cone Beam Computerized Tomography (CBCT) data sets were acquired using ILUMA\u2122 , with a reconstructed layer thickness of 0.1 mm and a 512 \u00d7 512 matrix. The device was operated at 120 kVp and 3-8 mA using a high-frequency generator with a fixed anode and a 0.5-mm focal spot. A single 40-s (because the complete volume of the head was taken) high-resolution scan of each skull was made with a voxel size  formatted data provided different planes of view as well as three-dimensionally reconstructed volumes using Mimics\u2122 9.0 software  Figure .The 3-D reconstruction of the condyle requires the mandibular condyle to be separated in all the three planes of space from all the other structures, mostly the soft tissues.Each condyle was visualized in the recommended range of bone density  and segmented using an adaptive threshold, which was visually checked prior to making 3-D and volumetric measurements.3) and surface measurements (mm2) were made for each condyle through the Mimics\u2122 automatic function , as shown in Figure n Figure To assess the intra-operator error, the CBCT data of 10 patients were processed by the same operator (S.T.) twice (one week apart ) and theWhere X1 and X2 are the two measurements and n is the number of double measurements.The volume and surface measurements were processed and analyzed using SPSS 14.0 . For the three variables, the mean, standard deviation, range, minimum, maximum, 95% confidence interval for mean and the results for normality distribution (Kolmorgorov-Smirnov Z test) were calculated, based on gender and TMJ side Table .t-test for independent samples was employed to calculate the statistically significant differences between the males and the females  or for the surface , as assessed with the Wilcoxon Signed Rank test.No significant difference was found between the two measurements made by the same operator, for the volume  is significantly influenced by side, gender, and condylar surface, as multiple factor; each factor appears to affect the TMJ volume at a significant level.To the authors' knowledge and until the advent of CBCT as an analysis, the condylar volume and surface have not been routinely calculated, although a recent study in rats shows enlargement of the left mandibular condyle compared to the rights due to the animal closing to one side,  thus sugUsing semiquantitative reverse-transcription polymerase chain reaction, a study examined the expression of insulin-like growth factor-1, fibroblast growth factor-2, and their receptors in the mandibular condylar cartilage of 28 day-old rats at 3, 7, and 14 days after placing intraoral appliances designed to produce a lateral functional shift of the mandible . This shAccording to the view that growth of the mandibular condylar cartilage adapts to its local functional-biomechanical environment, cartilage thickness was also investigated,  and it rA certain role of the trigeminal motor nucleus in the postnatal ontogeny of the mammalian craniofacial skeleton was also demonstrated in a study where a group of 42 adult rats underwent stereotaxic surgery:  among thStudies on the condylar development  stated tThe purpose of our study has not been to test the accuracy of linear measurements calculated with CBCT scans, but to utilize the proven accuracy ,18 for mThe study on method errors indicates that CBCT allows for accurate volumetric and surface evaluation of mandibular condyle. No significant difference was found between the two measurements made by the same operator.In this study, the data of only young adult subjects were included. Older subjects were excluded because they are expected to suffer more frequently from progressive degenerative bone changes owing to the development of TMJ osteoarthritis than do the younger patients .Furthermore, Schluetera et al. (2008)  develope3, which is about the 3.3% of the mean condylar volume in the whole sample. This difference was statistically significant , but not statistically significant The mean difference between the means of condylar volume in the right and the left TMJ is 25.39 mm2, which is about 5.45% the condylar surface of the whole sample (p < 0.01).The difference between the means of condylar surface in the right and the left TMJ is 17.15 mmThe clinical relevance of this high variability in the mean differences is yet to be understood, considering that no subject included in the sample had any pain or dysfunction of TMD, but only malocclusions. Consequently, the observed anatomical differences between the two condyles cannot be related to the subject's predisposition to develop any specific pathology on one side, rather than on the other. However, these types of associations are better evaluated through longitudinal studies.In conclusion, it is hard to confirm whether the dimensions measured on the images correspond to the real dimensions of the structures, because the data obtained here cannot be compared with the anatomical truth. Nevertheless, it is attempted to interpret these data on the basis of the asymmetry that is normal to all human-body structures.A comparison between the results of this study and those of a recent study , reveals differences, though not statistically significant, in the size of the mandibular condyle between the right and left sides:  mean of Besides, other variables concerning TMJ morphology also show significant difference between the two sides. The depths of the mandibular fossae and the mean anterior and posterior joint spaces are higher for the right TMJs than those of the left TMJs; however, the contrary is true for the mean superior joint space. As regards the posterior joint space, the difference between the two sides is significant. These observations corroborate the present finding of a physiologically significant asymmetry of condylar size, in almost all subjects with malocclusion.Also, in a study conducted on eight cadaveric heads (16 dissected mandibular condyles) to investigate the position of auriculo-temporal nerve in relation to the mandibular condyle, the nerve was observed to have a closed anatomic relationship with the condyle; however, although it was in direct contact with the condylar neck in all the cases, there was no correlation between the positions of the nerves in the right and left sides, suggesting marked asymmetry in the right and left condylar anatomy .The asymmetry observed in the present study between the right and left sides can also be related to the presence of a preference side for mastication in subjects with malocclusion.According to literature, the most significant morphologic alterations and positioning asymmetries of TMJ structures are related to the absence of teeth, dental abrasion, premature occlusal contact points, functional mandibular deviations, unilateral posterior crossbites, and dentoskeletal asymmetries. Specifically, the rule of articular cartilage - a growth center - has been demonstrated to respond to the degenerative changes and nonphysiological strain in the joint areas (application of soft diet or extractions), through changes in the thicknesses of single cartilage layers and total layer thickness, causing a change in the vertical dimensions and width, which is manifested by changes in the maturation processes of centrally unloaded cartilage sections in rats . With reThus, in the light of the wide range of percentages of asymmetry between the right and left sides, these clinical variables do not seem to be accurate or clinically useful to determine the existence of an abnormal condition in a subject with malocclusion and without pain of dysfunction in TMJs.Instead, MI could be a better indicator, because no statistically significant difference is found in the MI values between the right and the left sides, or between males and females, in young adult Caucasian subjects with malocclusion and without pain or dysfunction in TMJs.In young adult Caucasian subjects with malocclusion and without pain or dysfunction in TMJs, its range of values seem to be  1.72 \u00b1 0.17 mm, with a total range from 1.15 to 2.15 mm.One can interpret the data on volume and surface of condyle from a clinical point of view. But, before doing so the clinician must know that (i) the functional loads applied to the TMJ might influence TMJ's morphology, (ii) the shape and function are intimately related, although this concept is given due importance only in studies on class II and class III skeletal patterns,  and ,  these liThis study in young adult Caucasian subjects with malocclusion without pain of dysfunction in TMJs shows significant variability in condylar volume and surface between both the genders and the two sides of the mandible. In particular, the MI of the mandibular condyle (volume/surface) is 1.72 \u00b1 0.17 in this sample, with no significant difference between both genders and right and left sides. This information can prove clinically useful in establishing the diagnostic criteria for condylar volume and surface is subjects with malocclusion and without pain and dysfunction of TMJ.Furthermore, the generation of stable and repeatable data on condylar volume and surface in truly functionally normal joints , obtained in multi-center studies, could clarify the relationship between the diagnosis of TMJ dysfunction and the measurements of condylar volume and surface.The authors declare that they have no competing interests.ST, the principal investigator, conceived the study, carried out the protocol, partecipated in the recording of data, performed the statistical analysis, the interpretation of data, and partecipated to the coordination of the authors. FF cordinated the other authors. The other authors partecipated in the collecting of data. ST wrote the manuscript, that was approved by all the other authors.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2342/10/28/prepub"}
+{"text": "Coating IPMC with crystalline ZnO was observed to improve IPMC transduction.The presented research introduces a new Ionic Polymer-Metal-ZnO Composite (IPMZC) demonstrating photoluminescence (PL)-quenching on mechanical bending or application of an electric field. The newly fabricated IPMZC integrates the optical properties of ZnO and the electroactive nature of Ionic Polymer Metal Composites (IPMC) to enable a non-contact read-out of IPMC response. The electro-mechano-optical response of the IPMZC was measured by observing the PL spectra under mechanical bending and electrical regimes. The working range was measured to be 375\u2013475 nm. It was noted that the PL-quenching increased proportionally with the increase in curvature and applied field at 384 and 468 nm. The maximum quenching of 53.4% was achieved with the membrane curvature of 78.74/m and 3.01% when electric field (12.5 \u00d7 10 The type of external stimuli  and particular responses to these stimuli  leads to smart materials ranging from ceramics to polymers. Recently, smart materials like electroactive polymers (EAPs) \u20135, piezoIonic Polymer Metal Composites (IPMCs) have received great attention due to their electroactive nature. IPMCs undergo bending on application of an electric field in its thickness direction  and generate current on mechanical deformation (mechanoelectric transduction). Typically, an IPMC consists of a thin ionomeric membrane sandwiched between metal electrodes. On hydration, cations along with water molecules move towards the cathode on application of an electric field. The migrated cations induce stress in the polymer due to cation-cation repulsion, causing it to bend. On the other hand, bending an IPMC results in discrete regions of high water density causing water molecules and cations to move from their high-density region to their lower density region. This motion of ions inside the polymer produces a current. IPMCs display several advantages like low actuation voltages (1\u20133 V), flexibility, chemical stability, large actuation displacements (>1 cm) and long life . The presence of ionomeric membrane results in large capacitance of IPMCs that can be used for energy storage applications.et al. [Since Oguro et al.  observedet al. \u201322. DespIn the reported work, a measuring method obtained by depositing ZnO onto IPMCs, creaing what we have termed as an Ionic Polymer Metal-ZnO Composite (IPMZC), potentially imparts electro-mechano-optical characteristics to IPMCs. IPMZC is based on the principle of photoluminescence (PL) quenching. The process of reduction of PL intensity is called quenching. PL quenching has been observed in semiconductor-metal nanostructure systems. Although the mechanism of PL quenching is not very well understood, the reduction in the PL intensity is believed to be dependant on a number of factors like geometry of the metal, particle size and roughness of the metal surface. The resulting quenching could be due to factors like localized excited state dissociation by electric field, exciton-exciton annihilation and interaction of excited states with charge carriers.2 \u03a9\u22121cm\u22121), and piezoelectric properties [ZnO is one of the widely used functional materials due to its unique optical and piezoelectric properties. ZnO has shown to exhibit a wide direct band gap (\u223c3.37 eV), a good electrical conductivity . Platinization on both sides of the Nafion membrane was carried out by the standard electroless deposition techniques ,42.ZnO thin films have been deposited by a number of techniques including DC or RF sputtering ,44, meta3)2 and reagent grade dimethylaminoborane (DMAB) were purchased from Sigma-Aldrich. ZnO thin films were synthesized on the Pt IPMC in an aqueous solution composed of 0.1 mol/L hydrous zinc nitrate and 0.1 mol/L DMAB maintained at 60 \u00b0C. It has been reported that electrical and optical properties of ZnO film depends on the DMAB concentration [3)2 and DMAB) as reported in [Zinc nitrate, Zn with a step size of 0.02\u00b0. The shapes and sizes of ZnO grains were observed using a scanning electron microscopy  and the compositions of the IPMZC were characterized in cross-sectional view using energy dispersive x-ray spectroscopy , respectively. Differential scanning calorimeter  was performed in nitrogen atmosphere with 10 \u00b0C min\u22121 heating rate.In order to analyze the orientation of ZnO crystals deposited on the electrodes, X-ray diffraction (XRD) patterns of the films were obtained with PANaltical\u2019s X\u2019Pert Pro X-ray diffractometer system with Cu-K\u03b1 radiation in the 2The electromechanical and mechanoelectrical properties of the IPMC were investigated by using the potentiostat/galvanostat and shaker systems. IPMZCs were cut into a size of 1 cm width and 5 cm length. The actuation responses of typical IPMCs and IPMZCs were measured using chrono-potentiometry with a square wave for 5 s as a function of the applied current (\u2212200 to 200 mA). Using a laser displacement sensor, the displacement was measured at a distance of 2 cm from the tip of the sample. The experimental set-up is shown in For luminescence investigation, the IPMZC sample was photo-excited at room temperature by an excitation wavelength of 280 nm (xenon arc lamp) in the PL apparatus (FluoroMax-3) and the emission was monitored in the wavelength range 350\u2013500 nm. The opto-electrical property of the IPMZC was characterized with the use of a power supply  during the PL measurement as shown in 3.Depositing ZnO onto an IPMC potentially imparts mechano-electro-optical characteristics to the IPMC by integrating the optical properties of ZnO with the tailored electrical properties of an IPMC. The use of an IPMC as the substrate for the ZnO deposition presents certain advantages: (i) the IPMC, as a soft actuator, displays a high deformation with the application of an electric field; (ii) the porous electrodes of the IPMCs enhance the binding of the ZnO on IPMCs; and (iii) the metallic electrodes (Pt or Au) of the IPMC impart a low resistivity and, at the same time, eliminate the need of additional electrodes in a hybrid system. PL quenching in ZnO-Pt nanoparticles has been previously observed .c-axis, perpendicular to the substrate.The XRD results in n-type behavior, which is closely related to an oxygen-deficient non-stoichiometry. The electrical resistivity of the films was strongly affected by the oxygen vacancy and/or zinc interstitials. This mechanism can be easily understood by understanding that the electrical conductivity of the ZnO can be increased proportionally with increasing the oxygen vacancy.Although other diffraction peaks were observed, the c-axis (002) plane of the ZnO showed higher intensity than other additional peaks. The XRD diffraction patterns of platinum are from the electrode material of the IPMC. The observed reflections at (111), (200), and (220) are clear and support a crystal structure of metal electrode. From the EDS results in An increase in the melting temperature and storage modulus can be observed from u, with the frequency of 1 Hz, as seen in V, from ZnO layer is calculated as [ZnOt and IPMCt are the thickness of the ZnO and IPMC respectively; pe is the dielectric constant of ZnO; 31e is the piezoelectric constant for ZnO [pc is the capacitive load. The elastic modulus of the IPMZC, tY is measured to be 40 \u00d7 106 Pa. The average longitudinal strain in ZnO layer with deflection u is given as:In addition, the induced displacement of conventional IPMCs shows relaxation behavior, but much less than shown by the IPMZC. This could be due to the combined effect of the piezoelectric property of ZnO and the ionic nature of IPMC, as well as the increase of the conductivity of the \u201czinc-rich\u201d ZnO thin films. Hence, the displacement on the application of the current becomes more linear. Improvements have been observed in the voltage produced by IPMZC on the application of 12.7 mm sinusoidal displacement, lated as :(1)VZnO for ZnO ; and cp IPMCe is the dielectric constant; IPMCY is the elastic modulus; and freeL is the free length of the IPMC. The total voltage could be the combination of the above two voltages. From the equations above, one can deduce that the voltage produced by the piezoelectric component is slightly higher than the IPMC VIPMC top in . Also, dThe difference in the simulated and experimental data in The IPMZC sample was photo-excited by an excitation wavelength of 280 nm (xenon arc lamp) in the PL apparatus. The spectra of the sample display a broad emission band with some vibronic structure. A weak emission peak at the wavelength around 384 nm corresponds to the ultra-violet wave near the band edge emission. A relatively strong emission, around 468 nm, has been observed during this process .The maximum PL intensity was observed when there was no deformation and no electric field present in the IPMZC. In order to explain the PL quenching in IPMZC a schematic diagram  is plott\u03bbI(0) and \u03bbI(1/R / F) are the PL intensities with and without the imposed curvature or electric field at a particular wavelength, \u03bb, respectively. Typical applied potential and curvature values are used for measuring the efficiency. In order to clearly observe the effects of curvature and the applied potential, a differential of the intensity was calculated as follows: the intensities measured at different voltages and curvatures were subtracted from the intensity at the initial condition. The operating range of the new IPMZC as 375 nm to 475 nm wavelengths was the result. The quenching efficiency of the mechano-optical and electro-optical properties, 3 V/m) is applied across the IPMZC. This efficiency is relatively smaller than that obtained through the bending process, shown in In order to investigate PL-quenching due to the different curvatures of the IPMZC, the sample was bent, and the corresponding intensity was measured . The dif4.In summary, a novel IPMZC has been successfully fabricated to incorporate the optical and piezoelectric properties of ZnO onto the electroactive nature of an IPMC through chemical deposition technique. The structure of ZnO thin films was observed to be hexagonal in shape, with a grain size of 200\u2013300 nm and average thickness of 300\u2013400 nm. From the EDS result, it was found that the concentration of zinc is higher than that of oxygen, indicating that the ZnO thin film was zinc-rich. The resulting IPMZC exhibits significant transduction property effects. The optical effect of the IPMZC was characterized using photoluminescence. The new IPMC is shown to have working range between 375 to 475 nm wavelengths. The changes in the PL intensity, due to mechanical deformation and an external electric field, can be caused by a variety of reasons: (i) changes in the orientation of the ZnO crystal due to a change in the IPMZC curvature, (ii) changes in the localized density of the ZnO crystal with respect to the imposed strain of the polymer composite, and (iii) variations in the current flow through the high carrier densities in the device.Further work for the development of an integrated sensor-actuator platform with a ZnO layer for feedback could be performed. In addition, there is need to probe into the effect of grain size and piezoelectric coefficient on the electroactive behavior of IPMZCs."}
+{"text": "Chronic laryngitis (CL) has been described as chronic inflammation of the larynx. CL have various causes such as long-term smoking, acid reflux, voice overuse, bronchitis, allergies, pneumonia, excessive exposure to toxic chemicals and complications from the flu or a chronic cold. However, the prevalence of CL and role of air pollution in the etiology is uncertain.10) in South Korea using data from the Korea National Health and Nutrition Examination Surveys (KNHANES) during 2008\u20132012.The aim of this study was to investigate the relationship between CL and particulate matter with aerodynamic diameter less than 10 \u03bcm . A field survey team that included an otolaryngologist moved with a mobile examination unit and performed interviews and physical examinations. The mean annual concentrations of ambient PM10, SO2, O3, NO2, and CO levels in Korea were determined from monitoring station data. Multiple logistic regression was used to examine the relationship of air pollution to CL.10 (P for trend < 0.0001) from 2008 to 2012. In a multivariate model, the factors associated with CL included PM10 , age , sex , and smoking status .Among the population \u2265 19 years of age, the weighted prevalence of CL was 3.37 \u00b1 0.30% . CL was more prevalent in men, current smokers, and those with lower household income and prevalence increased with age. A significant decrease over time was observed in the prevalence of CL (P for trend = 0.0049) and the annual average concentrations of PM10 exposure on CL.Elevated PM10 exposures could be associated with increased risk of CL in South Koreans. Further epidemiological and experimental studies are necessary to clarify the impact of chronic PM Laryngitis is a general term that describes inflammation of the larynx regardless of cause . It is c2), carbon monoxide (CO), and ozone (O3). However, many epidemiologic studies have shown that PM exposure in particular is a risk factor for cardiorespiratory diseases, stroke, type 2 diabetes mellitus, and lung cancer [Air pollution is a heterogeneous mixture of gases, liquids, and solid particles, which all may be hazardous to health. Its main constituents, along with particulate matter (PM), are nitric oxides, sulfur oxides  for CL using large representative samples from KNHANES.Nationwide epidemiological studies conducted by government organizations can provide powerful data for investigating the national prevalence of disease conditions. The Korea National Health and Nutrition Examination Survey (KNHANES) was started in 1998 to examine the general health and nutrition status of populations in South Korea. From 2008 to 2012, 10,000\u201312,000 individuals were selected annually, and the participating household members were interviewed on their health and nutrition and asked to undergo a basic health assessment that included blood pressure measurements, blood and urine collection, a pulmonary function test, a dental examination, an ophthalmologic examination, and an otolaryngologic examination. The present study was undertaken to determine the national prevalence of CL in South Korea based on survey data obtained from the 2008 to 2012 KNHANES and to investigate associated factors. Furthermore, we investigated the effect of ambient particulate matter with an aerodynamic diameter less than 10 \u03bcm , and CO. Data were available from 283 monitoring stations in South Korea from January 2008 to December 2012. The average daily and annual concentrations from these stations were obtained from the Ministry of Environment. South Korea is divided into 16 administrative divisions including nine provinces , six metropolitan cities , and one capital metropolitan city (Seoul). Using average concentrations of air pollutants across 283 sites, we calculated average annual concentrations for the 16 administrative divisions of South Korea. The methods of measurement used for each air pollutant were the beta-ray absorption method (PM10), the pulse ultraviolet fluorescence method (SO2), the chemiluminescent method (NO2), the ultraviolet photometric method (O3), and the non-dispersive infrared method (CO).The air pollutants considered in this study included SOStatistical analyses were performed using the SAS survey procedure  to reflect the complex sampling design and sampling weights of KNHANES and to provide nationally representative prevalence estimates. The procedures included unequal probabilities of selection, oversampling, and nonresponse so that inferences could be made about the Korean adolescent participants.10. First, we adjusted for age and gender (Model 1). Then, we adjusted for age, gender, and other confounders that showed borderline significant differences f (P < 0.150) (Model 2). P-values were two-tailed and a P < 0.05 was considered significant.The prevalence and 95% confidence intervals (CIs) for CL were calculated. In the univariate analysis, the Rao-Scott chi-square test (using PROC SURVEYFREQ in SAS) was used to test the association between CL and risk factors in a complex sampling design. Participants\u2019 characteristics were described using means and standard errors for continuous variables and numbers and percentages for categorical variables. Multiple logistic regression analyses were used to examine the association between CL and PMAmong the 21,116 participants \u2265 19 years of age, 740 had experienced CL; the weighted prevalence of CL was 3.37 \u00b1 0.30% . The baseline characteristics of the study subjects according to CL are shown in 10 for the 16 administrative divisions of South Korea  and the prevalence of CL  (10 with borderline significance (P = 0.0621). However, no correlation was detected between prevalence of CL and SO2 (P = 0.2938), O3 (P = 0.1182), NO2 (P = 0.2943), or CO (P = 0.5579).A significant decrease over time was observed in the annual average concentrations of PM 0.0049) . The ann10 and CL using logistic regression models.10, smoking status, income, education level, waist circumference were included in a regression model, PM10 , age , sex , smoking status , and waist circumference  were significantly associated factors (Model 2). Income and education level did not show a significant correlation with CL.When age, sex, PMThis is the first epidemiological study to investigate the prevalence and associated factors of CL based on representative data from a government-centered survey in South Korea. Accurate epidemiological information may contribute to the proper provision of healthcare, preventive screenings, and rehabilitative services.The term laryngitis generically refers to inflammation of the larynx tissues. CL usually develops gradually, and the underlying signs and symptoms can wax and wane over very long periods of time; some granulomatous forms can result from a single traumatic insult, and others may emerge when the larynx is repetitively exposed to the offending agent over a longer duration. Laryngitis is considered a common condition, and primary care practitioners and otolaryngologists see it often. However, the incidence of laryngitis has never been well defined . Coyle e10 with borderline significance. Furthermore the prevalence rate of CL showed a decreased trend with decreasing annual average concentrations of PM10. CL was positively associated with PM10  as well as smoking status . Possible explanations for this may include that cigarette smoking is the particle-related exposure that presents the greatest PM burden, and smokers have more respiratory tract infections than their non-smoking peers [Ambient PM is a ubiquitous atmospheric aerosol with both anthropogenic and natural sources that has been associated with various health effects . PM depong peers \u201328.10 concentration was the only air pollutant associated with CL in the multivariate logistic regression analyses. Fine and ultrafine dust has recently become a major public concern in Korea. Korea is affected by massive quantities of airborne dust particles caused by sandstorms and anthropogenic pollutant particles. Yellow dust , which originates from the deserts of Mongolia, northern China, has been an issue for decades in Korea. The major anthropogenic source of the dust is combustion products of fossil fuel. The maximum PM10 concentration observed in Korea frequently exceeds 1000 \u03bcg/m3 during the dust event period especially in spring [In our study, PMn spring . Though 10 may have not been sufficient to cause a chronological decrease in the rate of CL in this study. Reflux esophagitis and drug history may have some role in decreasing the incidence of laryngopharyngeal reflux in our study subjects. Although we examined chronological changes in the incidence of CL, the rate of reflux esophagitis and precise drug history were not assessed. Future studies employing prospective, randomized methods to examine the CL are warranted.There were a few limitations in this study. First, we do not know the relative severity or grade of the CL in the absence of objective testing and more detailed questions. Second, the present study was cross-sectional. We were unable to analyze the temporal association between CL and air pollutants. Adequate assessment of environmental exposures that vary within communities in population-based epidemiologic studies is limited by the expense involved in obtaining measurements at multiple locations, often for prolonged periods. Thus, our study is unable to examine within-city variability in air pollutant concentrations, which can be as large or larger than between-city variability. Although the causal relationship of risk factors with CL is inconclusive, the results may be reliable because this is a population-based study all around the country. Third, there may be some response bias on reporting of several parameters such as smoking, alcohol habits, and income, because the KNHANES was conducted by using self-administered questionnaires. Finally, the chronological decrease in the annual average concentrations of PM10 on a nationally representative scale. Public acknowledgment and further intervention to modify factors associated with CL are required for preventing and managing the condition.In conclusion, our study is significant as an analysis of predictive factors associated with CL and PM"}
+{"text": "Early auditory deprivation has serious neurodevelopmental and cognitive repercussions largely derived from impoverished and delayed language acquisition. These conditions may be associated with early changes in brain connectivity. Vibrotactile stimulation is a sensory substitution method that allows perception and discrimination of sound, and even speech. To clarify the efficacy of this approach, a vibrotactile oddball task with 700 and 900 Hz pure-tones as stimuli [counterbalanced as target  and non-target (NT: 80%)] with simultaneous EEG recording was performed by 14 profoundly deaf and 14 normal-hearing (NH) subjects, before and after a short training period . A small device worn on the right index finger delivered sound-wave stimuli. The training included discrimination of pure tone frequency and duration, and more complex natural sounds. A significant P300 amplitude increase and behavioral improvement was observed in both deaf and normal subjects, with no between group differences. However, a P3 with larger scalp distribution over parietal cortical areas and lateralized to the right was observed in the profoundly deaf. A graph theory analysis showed that brief training significantly increased fronto-central brain connectivity in deaf subjects, but not in NH subjects. Together, ERP tools and graph methods depicted the different functional brain dynamic in deaf and NH individuals, underlying the temporary engagement of the cognitive resources demanded by the task. Our findings showed that the index-fingertip somatosensory mechanoreceptors can discriminate sounds. Further studies are necessary to clarify brain connectivity dynamics associated with the performance of vibrotactile language-related discrimination tasks and the effect of lengthier training programs. The rationale that auditory deprivation could benefit sensory modalities that remain intact  underlieIn recent decades, the effects of early auditory deprivation on brain organization due to neuroplasticity in developmental stages have been explored, primarily in the sensory cortices  and langAdvances in instrumentation technology for sensory substitution have opened up new opportunities to develop practical and inexpensive systems to compensate for sensory loss . SensoryVibrotactile stimulation produces a characteristic cortical response that is distinguishable and, therefore, easily evaluated. Using magnetoencephalography (MEG), The study of electrical brain activity depicts the characteristics of neural changes across time, along with the connectivity that supports those changes. In this context, the aim of the present study was to explore underlying learning-related electrophysiological changes in subjects with profound deafness and normal-hearing controls after a short training period in vibrotactile sound discrimination by applying two EEG analysis techniques: event-related potentials (ERPs) and graph theory tools.Event-related brain potentials have been utilized to study time-locked cerebral processes while performing behavioral tasks that involve attention and working memory resources. Specifically, the P300 component has been extensively studied as an index of updating memory representations  and geneGraph theory-based analysis has been widely used to study models of neural networks, anatomical and functional connectivity based on fMRI , MEG St, and EEGGraph theory-based analysis provides a method for quantifying brain networks using a reduced number of meaningful biological measures that are easily determined. Thus, it is argued that graph metrics characterize brain networks . In the Several studies using fMRI have revealed an overlap between attention and working memory networks over visual, parietal and frontal areas , findingIn summary, a powerful, early link between human speech and cognition guides infant development and casts a wide facilitative net for the fundamental cognitive capacities that underlie other core learning processes . There iOur experiment aimed to explore, comparatively, how training in vibrotactile sound discrimination affects electrophysiological processing and functional connectivity in profoundly deaf and NH individuals. Due to their early sensory deprivation and impoverished language acquisition, deaf individuals might obtain fewer benefits from a short training period. Thus, we hypothesized that they will have higher amplitudes in the P300 component \u2013before and after training\u2013 compared to NH controls, with less frontal and parietal functional disengagement, as quantified by connectivity metrics. To our knowledge, the present study is the first to use graph theory-based analysis to explore changes in brain connectivity due to training in vibrotactile discrimination of sound within the language frequency spectrum.SD = 6.63 years), and 14 age-and-sex-matched normal-hearing controls  volunteered to participate. Most control subjects were family members with similar demographic characteristics. Clinical interviews determined that no participants had personal or family histories of psychiatric, neurological or neurodegenerative illness. All participants also had normal neurological examinations and normal baseline EEGs. All deaf participants were Mexican Sign Language (MSL) users. Thirteen had received proper sign language instruction late in childhood (after age seven), most upon entering primary school. Only one participant was born to deaf parents and had learned MSL at home as his maternal language.Fourteen right-handed subjects with prelingual profound bilateral deafness . A professional interpreter translated all forms, questionnaires and instructions into MSL, and all volunteer participants or the parents of under-aged subjects gave their informed written consent.Using a Maico MA-41 Portable Audiometer with audio over-ear headphones and bone-conduction headphones, hearing threshold measurements were taken at six octaves: 250, 500, 1000, 2000, 4000, and 8000 Hz. Pure-tone air and bone conduction audiometries were performed to confirm profound bilateral sensorineural hearing loss with a pure-tone average (PTA) greater than 90 decibels (dB) in the deaf participants, and normal-hearing levels in the controls.We studied cerebral electric activity in 14 profoundly deaf and 14 NH participants using a classic oddball paradigm. Since the design was longitudinal, the experimental task was performed twice by the same individuals. An initial baseline EEG recording was made, followed by a second one after five vibrotactile sound discrimination sessions . The sessions focused on training vibrotactile discrimination of frequency and duration properties of sound, and involved exercises with three pure-tone sequences of varying levels of difficulty, as well as the discrimination of a total of 12 complex sounds, such as natural animal and object sounds. See Data Sheet 1 for detailed training program description.\u00ae) worn on the right index finger and connected directly to the computer\u2019s audio output (volume level set at 80 dB SPL). Stimuli presentation was controlled by MINDTRACER-2.0 software . The portable stimulator system has a sound range frequency of 0\u201310 kHz and consists of a tiny flexible plastic membrane with a 78.5-mm2 surface area that vibrates on the tip of the index finger in response to sound pressure waves via analog transmission.Participants were comfortably seated in a quiet, well-lit room. The vibrotactile oddball paradigm consisted of a train of 150 randomly presented stimuli, with a duration of 200 ms (ISI: 1500 ms) and a 20:80 rare stimulus frequency. The stimuli consisted of 700 and 900 Hz pure-tones; infrequent target and frequent standard conditions were counterbalanced across subjects. Participants were instructed to look at a cross-shaped fixation point on the center of a 19-inch SVGA monitor (refresh rate: 100 Hz) to minimize ocular artifacts, and to respond by pressing the left control key with their left index finger upon target stimulus detection. Sound-wave stimuli were delivered by a portable stimulator system . Also, they placed their right hand inside a sound-attenuated box to ensure the stimuli were not auditorily perceptible and were only processed via somatosensory pathways.EEG activity was recorded from the Fp1, Fp2, F3, F4, F7, F8, C3, C4, P3, P4, O1, O2, T3, T4, T5, T6, Fz, Cz and Pz scalp electrode sites, following the 10\u201320 system and using a commercial electro cap. EOGs were recorded from the outer canthus and infraocular orbital ridge of the right eye. All recording sites were referred to linked mastoids. Inter-electrode impedances were below 5 k\u03a9 at 30 Hz. EEG and EOG signals were amplified at a band pass of 0.05\u201330 Hz (3-dB cutoff points of 6 dB/octave roll-off curves) with a sampling period of 5 ms on the MEDICID-04 system (Neuronic S.A.). Single trial data were examined off-line for averaging and analysis.Correct and incorrect responses were marked automatically on the EEGs by the software; reaction times were recorded simultaneously.Stimulus onset was taken as the initial time instant (t0). ERP time windows were obtained from 100 ms before the onset of the stimuli to 1000 ms after it. Fifteen artifact-free trials  were averaged for each condition to obtain the P300 components. A pre-stimulus period of 100 ms was used for baseline correction. Epochs of data on all channels were excluded from the averages when the voltage in a given recording epoch exceeded 100 \u03bcV on any EEG or EOG channel. Each individual ERP reached a standard deviation rate (SDR) below 1.1 and a residual noise level (RNL) below 2. Epochs with artifacts were also rejected by visual inspection performed by two group-blinded experts.ij, where i and j represent two electrodes of the EEG array) was defined for the purpose of estimating the direct flows between channels  was also computed for the window under study. The CPSD matrix was averaged, thresholded and binarized. As these two matrixes were multiplied \u2013CPSD \u00d7 PDC\u2013 the resulting matrix contains both the power information from each channel and the notion of causality.This methodology was applied to each EEG recording in the database, which contained 14 recordings from deaf participants pre-training and 14 post-training, with those of their paired control subjects . The matrixes obtained were averaged and constitute the basis of the graphs. An 8 \u00d7 8 connectivity matrix was obtained that provides information on the power of the connections between each scalp location with respect to all the others, while ignoring whether the other electrodes were placed on the same \u2013or contralateral\u2013 brain hemisphere. The rationale for considering the mean value of connectivity between each electrode and all others across hemispheres is to attempt to measure \u2013via a specific coefficient\u2013 the relative relevance of each location in specific regions of interest (ROI). Higher values for these coefficients indicate that one precise location is more important for whole brain connectivity. An additional connectivity analysis was performed to separately evaluate intra- and inter-hemispheric relationships, omitting the midline scalp locations. The resulting matrix was interpreted in graph form.a priori time-window range selected between 270 and 650 ms. Greenhouse-Geisser corrections to the df were applied as needed, with the corrected probabilities reported.Behavioral data  were analyzed using repeated-measures ANOVAs. The event-related brain potential measures were assessed using Randomized-block ANOVAs [group (2) \u00d7 condition  \u00d7 hemisphere ] with maximum voltage across each time window. The amplitude and latency of each ERP component was quantified at the highest peak within an t-tests for two samples  in two conditions: pre- and post-training. This analysis was chosen to more accurately represent the functional dynamic of the cognitive processing period, corresponding to the electrophysiological measures portrayed in the ERP waveforms.According to the topographic distribution of the fronto-parietal network, graph analysis was performed in two different ROIs: (a) fronto-central ; and, (b) posterolateral areas . The connectivity coefficients for both ROIs were obtained from the EEG epochs (1.5 s) that corresponded to correct responses while detecting the infrequent stimuli. These were analyzed with Welch In order to evaluate intra-hemispheric connectivity, specifically lateralization effects, two other ROIs were analyzed: (a) left hemisphere ; and, (b) right hemisphere  by obtaining coefficients from the same EEG time windows.The mean value of connectivity was calculated for each electrode with respect to all others in each ROI. This connectivity value was estimated by averaging the connectivity matrix across the columns while excluding the diagonal. In this way, mean connectivity values of 8 \u00d7 14 and 9 \u00d7 14 were obtained for the fronto-central and posterolateral analyses, respectively. In the intra-hemispheric analysis, mean connectivity values of 7 \u00d7 14 were obtained for each hemisphere.The electrophysiological and behavioral data from two deaf subjects and their matched controls had to be excluded from the ERP analysis because the minimum number of artifact-free windows for ERP averaging was not obtained.F = 6.604, p < 0.05, \u03b7 = 0.231; mean standard error (MSE) = 1.59] and decreased the number of incorrect responses . The latter were defined as trials in which individuals failed to discriminate the target from the standard stimuli by responding to the standard. Discrimination task behavioral accuracy rates based on mean correct responses for the profoundly deaf group were 48% before training and 62% after, while those of the control group were 42% before and 59% after. Therefore, after completing only a short training period of five 1-h sessions, all subjects had learned to identify the rare stimuli and were less likely to make detection errors in the vibrotactile sound discrimination oddball paradigm. There were no statistically significant changes in reaction times due to training or between groups.Significant changes were found in pre- and post-training performance, but no such changes were demonstrated across training conditions between groups. Both groups increased the number of correct responses . Though between-group differences did not reach statistical significance, a clear tendency for the deaf group to exhibit greater voltage amplitudes is visible in the grand-average waveforms and on the topographical maps. Latency analysis showed no significant effects for training or group differences. However, parietal right hemisphere lateralization during vibrotactile discrimination of sound was more significant in the profoundly deaf group, as demonstrated by a significant group \u00d7 hemisphere interaction effect .The results of these analyses indicate a significant increase of the P300 amplitude due to training [Figure 2 shows the main changes in brain connectivity associated with training in vibrotactile discrimination in two ROIs . The control group shows a significant decrease in connectivity in both ROIs after training that predominantly affected fronto-central connections. Changes in the deaf participants, in contrast, were more widespread and less specific.t = -2.12; p < 0.05) and after training . Analysis of the posterolateral region showed no significant between-group differences in the pre-training period, but evaluation of the post-training period did reveal differences in connectivity between groups . Figure 3 shows the analysis of connectivity values in the fronto-central and posterolateral regions studied. This analysis suggests that, in general, brain connectivity decreased in the NH group after training, while an opposite trend is observed in the profoundly deaf group, especially in the fronto-central regions. The increase in brain connectivity in the deaf participants in these anterior areas seems to account for the significant differences found between the groups.The analysis of the fronto-central region showed significant differences in the mean connectivity values between groups both prior to  or after training . As for the left hemisphere connectivity analysis, values showed no significant differences between groups either before  or after training . Finally, Figure 4 illustrates the main changes in brain connectivity associated with training in vibrotactile discrimination in these two ROIs (left and right hemispheres).Additionally, a tendency suggesting that training might induce greater connectivity in the right hemisphere was observed in the intra-hemispheric analysis, though it did not reach statistical significance in the pre-training period (As was expected, both the NH and deaf groups showed similar behavioral performance after a short training period. This is not surprising due to the unimpaired somatosensory capacity of deaf individuals, and the simplicity of the task, despite the novelty of the specific vibrotactile discrimination demands. The widespread activity observed in the auditory cortical regions of the deaf individuals while processing vibrotactile stimuli supports this notion .The oddball experimental design used made it possible to interpret the ERP results using the classic P3 framework. Our results indicate a significant increase of the P300 amplitude due to training, even though the between-group amplitude effects did not reach statistical significance, likely due to individual variability. Waveform tendencies show that the voltage magnitude of the P300-like component was slightly higher in the group with profound deafness, even before the training sessions, but increased greatly after training. In both pre- and post-training conditions, the P3 component is seen to be topographically more extended in the deaf group than in NH.In the oddball paradigm, the P300 component has been interpreted as the result of an orienting response with attention allocation triggered by novel or unusual stimuli that give rise to an \u201cupdating\u201d process of stimulus representation see , memory The effects of practice and repetition are key aspects of learning and automatization . Braun eThe graph analysis showed that training-related differences in brain connectivity between the groups were mainly restricted to the frontal neural networks. In an fMRI experiment, The present results confirm our hypothesis that electrophysiological brain dynamic organization differs between profoundly deaf and normal-hearing young adults. Moreover, results from the brief training in vibrotactile discrimination of sound strongly suggest not only the probable recruitment of the primary auditory cortex, as several studies have proposed , but alsRegarding the theoretical view which assumes that incoming stimuli elicit top-down attention switching, while bottom-up memory-drive processes settle on the final outcome , our resFurthermore, the intra-hemispheric tendency observed in this study showed higher P300 right hemisphere amplitudes in the deaf group. In this context, the lateralization to the right of P300 in those participants might be interpreted as part of a supplementary activation of spatial precision processing mechanisms in personal space, directly linked to the right posterior parietal cortex , as has The connectivity units estimated for intra-hemispheric relationships were greater than those obtained at inter-hemispheric connections. This could be interpreted as reflecting the effect of attentional modulation on both the primary and secondary somatosensory cortices  and, posUp to now, biased connectivity and shape sensitivity seem to explain plasticity in sensory deprivations see .The findings from the present experiment suggest that new emergent attention demands might trigger a task-driven connectivity arrangement in which neural networks comprising frontal, somatosensory and parietal areas could participate. The recent report on the dynamic association between intersensory attention and temporal predictability \u2013as occurred by design in our work\u2013 in relation to the shaping of oscillatory power and brain connectivity to facilitate stimulus-processing  seems toIn summary, ERP tools and graph analysis successfully illustrated the differences in the electrophysiological responses \u2013pre- vs. post-training\u2013 in vibrotactile discrimination in deaf and NH individuals, and highlighted the neural plasticity capacity in the profoundly deaf. They also revealed the need to recruit additional attention and memory resources. The diffuse resource distribution and regional connectivity observed in the profoundly deaf, before and after training, may also represent a window of opportunity for this way of processing sound via index-fingertip somatosensory stimulation. Vibrotactile sensory feedback in speech production therapy has significant clinical implications for early language development in this population. In future studies, a lengthier training period of vibrotactile sound discrimination, perhaps involving language stimuli, could benefit intermodal brain organization and generate more widespread connectivity. Finally, additional studies are required to clarify the brain connectivity dynamic variation associated with the performance of vibrotactile language-related discrimination tasks with higher cognitive demands.AG-G participated in: research design, data analysis, discussion of the results, and manuscript writing. VR-S participated in: data collection, data analysis, discussion of the results, and manuscript writing. FG-V participated in: research design, data analysis, and discussion of the results. HV-P participated in: data analysis, discussion of the results, and manuscript writing. RR-V participated in: data analysis, discussion of the results, and manuscript writing. RASR participated in: data analysis, discussion of the results, and manuscript writing. AEV participated in: data analysis, discussion of the results, and manuscript writing. LC participated in: data collection, data analysis, and discussion of the results.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "There are several reasons why a definition for mental disorder is essential. Among these are not only reasons linked to psychiatry itself as a science  but also to ethical, legal, and financial issues. The first formal definition of mental disorder resulted from a deep conceptual analysis led by Robert Spitzer. It emerged to address several challenges that psychiatry faced at the time, namely to serve as the starting point for an atheoretical and evidence-based classification of mental disorders, to justify the removal of homosexuality from classifications, and to counter the arguments of antipsychiatry. This definition has been updated, with some conceptual changes that make it depart from the main assumptions of Spitzer\u2019s original definition. In this article, we intend to review the factors that substantiated the emergence of the first formal definition of mental disorder that based all its later versions. The existence of a formal definition of mental disorder remains essential for several reasons that include the following: 1) to know which diagnosis should or not be included in the classifications ; 2) to sThe first formal definition of mental disorder was presented in DSM-III stemming from a deep conceptual review carried out by APA\u2019s Committee on Nomenclature, headed by Spitzer. This definition was designed to address various needs psychiatry had at the time, notably to serve as a starting point for an atheoretical and evidence-based classification of mental disorders, to justify the removal of homosexuality from classifications, and to counter the arguments of antipsychiatry  , 7.In recent times, this definition has been updated, with conceptual changes insufficiently discussed within psychiatry, and a consequent gradual detachment from Spitzer\u2019s original definition. It is essential to reflect on the context in which this first formal definition of mental disorder emerges, and all the considerations that resulted therein, before making any updates to this definition.This article intends to briefly review the factors that laid the foundations for the establishment of the first formal definition of mental disorder and which formed the basis for all its later versions.Prior to the DSM-III, diagnostic classification was \u201cbased upon the best clinical judgment and experience of a committee and its consultants\u201d .Consistent with a descriptive and atheoretical structure, the DSM-III enhances the importance of the harm criteria (distress and disability) comparatively with the criteria of psychiatric/psychological dysfunction  .One of the contributing factors for the need to define mental disorder was an attempt not to include situations more related to cultural, moral, and religious values than to medical ones (which define what is harmful to the patient and should be treated) and which long undermined psychiatric classifications. Several such situations have been defined as mental disorders throughout history, such as, \u201cdrapetomania\u201d (applied to American slaves who wanted to escape) and \u201csluggish schizophrenia\u201d . The case of homosexuality motivated a deep reflection within the APA on which situations to include as mental disorder or not.According to Spitzer, the category of homosexuality did not make sense because one could not \u201cinsist on a label of sickness for individuals who insist that they are well  and who demonstrate no generalized impairment in social effectiveness\u201d .The most defended model of disease in the 20th century was Boorse\u2019s. According to this model, a disease corresponds to a dysfunction\u2014alteration of natural functions resulting in reduced life expectancy and/or reproductive expectations , emphasizing the importance of a dysfunction  for the existence of a disease , 13, 14.per se but mutual interpersonal and sexual satisfaction\u201d . TAlthough antipsychiatry in the general sense of the term is as old as psychiatry , emerginMadness and Civilization, Foucault presents the historical genesis of the concept of mental disorder, as we understand it today, which he does not separate from the psychiatric institution. That is to say, no knowledge about mental disorder is separated from its place of formation, the asylum. Asylum, in turn, follows a series of historical experiences that are predominantly of social control. Thus, finally, claiming that the science of psychiatry is essentially a knowledge seeking to justify the moral power of the physician. According to this view, psychiatrists forget this origin of their power and attribute it to objective knowledge obtained scientifically  to the patient and his needs arising from the suffering he bears.The first formal definition of mental disorder appears in DSM-III as a result of a deep conceptual review. This definition emerged to meet various needs of psychiatry at that time, in particular to serve as a starting point for an evidence-based and atheoretical classification of mental disorder and to justify the removal of homosexuality from classifications and counter the arguments of antipsychiatry. A definition was elaborated in which the main condition for a mental disorder to be present was the presence of the criteria of distress and disability .The criteria of harm (distress and disability) remained as paramount in the definition of mental disorder in DSM-IV and the importance of these criteria also led them to make part of the specific diagnostic criteria for most disorders listed in DSM-IV.A mental disorder is a syndrome characterized by clinically significant disturbance in an individual\u2019s cognition, emotion regulation, or behavior that reflects a dysfunction in the psychological, biological, or developmental processes underlying mental functioning. Mental disorders are usually associated with significant distress or disability in social, occupational, or other important activities\u2026 .Nevertheless, in DSM-5 a major and barely discussed change occurred, the concept of dysfunction takes precedence, appearing at the beginning of the definition, possibly being considered its main criterion:Harm criteria are no longer a basic requirement, but a frequent occurrence that might or not be present.This could lead to the inclusion  of situations that are not associated with distress and disability as happened in the past, potentially re-exposing psychiatry to the danger that entities considered psychological or biological dysfunctions, according to certain theoretical currents , may be considered mental disorders.The problem of considering a mental disorder to be mainly a dysfunction (as in DSM-5) may arise in both perspectives: as a biological dysfunction or as a psychological dysfunction.Several problems arise regarding the possibility of considering mental disorders as synonymous of biological dysfunction. Psychiatric disorders are not natural kinds directly visualized and discriminated by neuroimaging tests. Psychiatric disorders are \u201csocial constructs\u201d that do not exist independently of human effort , 24, 25.Conversely, it is also controversial to define mental disorder through a psychological dysfunction. As mentioned by Fullford, dysfunction as the concept of failure of a mechanism to determine a natural function is a concept inextricably linked to values. For biological issues and medical values (what is considered useful or not to the organism by specific societies) change over time , 29. AddMoreover, the definition of dysfunction of psychological mechanisms, as a failure of internal mechanisms to perform their functions as designed by nature, traces an artificial boundary between what is natural (innate), as opposed to social (cultivated) . AdditioKirmayer adds that: \u201cthere is little consensus on what our psychological systems are for and many evolutionary psychologists argue that we have evolved to be able to adapt to situations rather than to have fixed or specific functions. Any change in culture will change the fitness of specific psychological, traits, give new meaning and purpose to biological functions, and change their boundaries and interdependence. Beyond relatively simple physiological functions it is impossible to identify what psychological systems or functions are for in any universal sense\u201d [Ref. , pp. 18\u2013Furthermore, psychiatric disorders could be caused by distinct situations, instead of disruption function  .The difficulties inherent to the use of the concept of dysfunction to define a psychiatric disorder are not only a problem of validity in psychiatry but may also make psychiatry permeable (again) to the typical criticisms of antipsychiatry which claimed that psychiatric disorders were more linked to values associated with culture-specific social and political ideologies rather than medical values (which identify harmful situations to the patient and in need of treatment). Spitzer attempted to circumvent these issues by making distress and disability  the main defining criteria of mental disorders. These are concepts that are closer to the patient than to the psychiatrist and that are loaded with more universal values . On the other hand, as mentioned, the determination of biological or even psychological dysfunction in most psychiatric disorders is difficult, controversial, and usually the result of influenceable theoretical currents.In essence, the first definition of mental disorder resulted from a rigorous conceptual analysis. We should continue to promote critical reviews and conceptual analysis on this topic which can debate the problems that it entails and the dangers that an apparently harmless change to the definition of mental disorders (such as that which was taken in DSM 5) can bring toward psychiatry.DT-C conceived and designed research. DT-C and SS wrote the first draft of the manuscript. JG did critical revision for important intellectual content. The manuscript has been read and approved by all the authors. There are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "To identify prognostic factors for grade 3 radiation dermatitis following passive-scattering proton therapy for breast cancer.This retrospective study included data on 23 (11 post-mastectomy and 12 post-lumpectomy) breast cancer patients who underwent proton therapy with the passive scattering technique in our institute from 2012 to 2016. Each patient received 50\u201350.4 cobalt Gy equivalent (CGE) at 1.8 or 2 CGE per daily fraction. Logistic regression analysis was performed to identify prognostic factors for grade 3 skin toxicity. Receiver operating characteristic (ROC) curve analysis and the area under the curve (AUC) were used to evaluate the performance of the models.3 to skin5mm were correlated with grade 3 radiation dermatitis in both univariate and multivariate logistic regression analyses. Univariate logistic regression analysis suggested that D10cm3 to skin5mm (AUC\u2009=\u20090.69) and V52.5CGE to skin5mm (AUC\u2009=\u20090.70) were prognostic for grade 3 skin toxicity. The models using the combination of D10cm3 to skin5mm or V52.5CGE to skin5mm with breast volume marginally increased the AUC to 0.72 and 0.73, respectively. Models using the combination of D10cm3 to skin5mm or V52.5CGE to skin5mm with history of smoking increased the AUC to 0.75 and 0.83, respectively.43% of the studied patients developed grade 3 radiation dermatitis. The dose-volume histogram (DVH) parameters of V52.5CGE and D10cmIn the current study, we identified prognostic factors for grade 3 radiation dermatitis in patients treated with passive-scattering proton therapy for breast cancer. This study provides promising tool for identifying high risk patients for whom treatment plan adjustment could be done to reduce the risk of radiation-induced grade 3 skin toxicity. Post-lumpectomy or post-mastectomy irradiation is known to reduce local recurrence and increase overall survival compared with surgery alone , 2. DespRadiation dermatitis is the predominant acute side effect of radiotherapy for breast cancer. Acute reactions can impact quality of life and compromise the delivery of cancer treatment. Radiation dermatitis can progress from erythema to dry desquamation to moist desquamation and even to ulceration , after wThe purpose of this study is to identify prognostic factors of developing grade 3 radiation dermatitis following passive-scattering proton therapy, so that for those patients who are at high risk of severe skin toxicity, the treatment plans can be adjusted to reduce the risk.o and 60o were used to minimize the effect of respiratory breathing and to improve the homogeneity of dose distribution [In this study, we retrospectively evaluated 23 (11 post-mastectomy and 12 post-lumpectomy) patients with breast cancer who were treated with passive-scattering proton technique in our institute from 2012 to 2016. The study was approved by the institutional review board. All patients were simulated in the supine position with arms above their heads using a wingboard and Vac-Lok bag on a Philips Brilliance Big Bore CT . Treatment was planned using Varian Eclipse TPS V13.5)  with passive-scattering proton therapy. Two en face angles between 0  skin reactions consisting of brisk erythema or patchy moist desquamation confined to skin folds; 43% (10/23) developed grade 3 radiation dermatitis, characterized by moist desquamation in areas other than skin folds and creases, bleeding induced by minor trauma or abrasion. The primary endpoint for this study was grade 3 skin toxicity.3) [3) [Patient-specific and tumor-specific factors: breast volume (cm3) \u201318, and 3) [3) , body ma3) [3) , age [203) [3) , 20, and3) received 25 CGE, 47.5 CGE, 50 CGE, and 52.5 CGE  and doses delivered to 150\u00a0cm3, 100\u00a0cm3, 30\u00a0cm3, and 10\u00a0cm3  of the skin5mm [Dose-volume histogram (DVH) parameters for \u201cskin5mm\u201d, a layer structure of 5\u00a0mm inward from the body contour; volumes  were used in the multivariate logistic regression analysis. To avoid over fitting, we tested the performance of our model by means of leave-one-out. The leave-one-out cross validation (LOOCV) refers to the process of removing 1 patient, used as the validation sample, and reconstructing the model using the reduced sample set. The new model is then tested for predictive accuracy against the excluded patient; the process is repeated 23 times (each time with a different excluded patient).The Mann-Whitney U-test was used on the continuous variables and the Pearson\u2019s chi-squared test was used on the categorical variables, to test for differences between patients who did and did not develop grade 3 radiation dermatitis. A value of analyses , 23 wereanalyses \u201326. TherThe receiver operating characteristic (ROC) curve was plotted using the validation results from LOOCV and the area under the curve (AUC)  was usedp values of the Mann-Whitney U-test on the continuous variables. Statistically significant differences were observed for D10cm3 and V52.5CGE to skin5mm. Figure\u00a03 and V52.5CGE to skin5mm, respectively. Patients with grade 3 radiation dermatitis received higher D10cm3 to skin5mm and had larger volumes of skin5mm that received 52.5 CGE. The results of the Pearson\u2019s chi-squared test on the categorical variables are also shown in Table\u00a0Table\u00a03 to skin5mm and V52.5CGE to skin5mm with AUC of 0.69 and 0.70, respectively, were prognostic for grade 3 skin toxicity. Figure\u00a03 model and the V52.5CGE model, respectively. Although history of smoking shows statistically significant differences (p\u2009=\u20090.02), the AUC value of 0.55 suggests a poor prognostic power by this single parameter.Univariate logistic regression analysis was performed on each parameter. The AUC values from LOOCV were used to evaluate the model performance in predicting grade 3 radiation dermatitis Table\u00a0. Using ar\u2009=\u20091) is indicated in red, and no correlation (r\u2009=\u20090) is indicated in blue. Only those non-correlated parameters (with r\u2009<\u20090.3) were used in the multivariate logistic regression analysis. The AUC values from the results of LOOCV of multi-parameter models are shown in Table\u00a03 and breast volume\u2009+\u2009V52.5CGE increased the AUC marginally from 0.69 and 0.70 for the one parameter model to 0.72 and 0.73, respectively. The models of history of smoking + D10cm3 and history of smoking + V52.5CGE increased the AUC to 0.75 and 0.83, respectively. The correlation between breast volume and the D10cm3 to skin5mm or the V52.5CGE to skin5mm were very low, with r values of 0.09 and 0.10 and p values of 0.67 and 0.65, respectively. The correlation between history of smoking and the D10cm3 to skin5mm or the V52.5CGE to skin5mm were low, both with r value of 0.29 and p value of 0.18. Figure\u00a03 model, (d) breast volume\u2009+\u2009V52.5CGE model, (e) history of smoking + D10cm3 model, (f) history of smoking + V52.5CGE model in prediction of grade 3 radiation dermatitis. For those with AUC\u2009>\u20090.65, a reconstruction of the models on all 23 patients were performed and the logistic regression coefficients and p values of these models are shown in Table\u00a0The correlations among the parameters were studied and illustrated in a color map in Fig.\u00a0Studies have shown that proton therapy in the treatment of breast cancer reduces inadvertent radiation dose to the heart and lung, increase the therapeutic ratio of radiation therapy \u20137, 28. H3 and V52.5CGE to skin are associated with grade 3 acute radiation dermatitis. Various research groups found that breast volume [3 or V52.5CGE models indicate that when D10cm3 and V52.5CGE to skin5mm remain the same, women with a small breast volume have a higher likelihood of grade 3 radiation dermatitis. Although De Langhe et al. [p values of 0.02 and 0.03 on V52.5CGE and D10cm3 to skin5mm in the V52.5CGE or D10cm3\u2009+\u2009breast volume models demonstrated the importance of hot spot influence on acute skin toxicity. The history of smoking + D10cm3 or V52.5CGE models indicate that patients with history of smoking have a higher likelihood of grade 3 radiation dermatitis. Age did not seem to play a role in any of our models, which is in agreement with Kraus-Tiefenbacher\u2019s study [The study by Parekh et al.  demonstrt volume \u201318, and t volume  are corre et al.  and Kraue et al.  found the et al. . In our \u2019s study . BMI andThis study is conducted on patients treated with passive-scattering proton technique. Proton therapy facilities have started to treat breast patients with the more advanced intensity modulated proton therapy (IMPT) , 38 thatAdmittedly, this study had limited number of study subjects, which affected the robustness of our models. In addition, the individual reaction of the skin to radiation is complex and may be impacted by numerous factors that may be difficult to characterize and quantify. In this regard, it is important to note that this study is a hypothesis generating study to identify parameters that are prognostic for severe radiation dermatitis for breast cancer patients treated with passive-scattering proton technique rather than to generate a model. It should be clearly emphasized that we don\u2019t intent to construct a robust prognostic model ready to be used as a clinical decision making criteria, but to use provide useful metrics for treatment planning to minimize severe radiation dermatitis. Nevertheless, further investigation and clinical validation are warranted. This will be done when more patient data become available for analysis/validation.In the current study, history of smoking, breast volume and skin dose-volume histogram are proposed as a means to be prognostic for grade 3 skin toxicity, which is of key clinical relevance in proton therapy for breast cancer. Both patient-specific clinical parameters and treatment plan dosimetric factors have been assessed. The treatment plan can be adjusted if necessary to reduce the risk of severe radiation dermatitis. Given that the interest in proton therapy for the treatment of breast cancer has substantially increased over recent years and a large randomized trial (RADCOMP) of proton vs photon therapy for breast cancer patients just opened recently , the cur3 and V52.5CGE to skin5mm are correlated with grade 3 skin toxicity. More validation is required and further investigation is warranted.This study provides the first report of identifying prognostic factors for passive scattering proton therapy grade 3 radiation dermatitis in the treatment of breast cancer. The ROC curve analysis and AUC values from LOOCV showed that the DVH parameters of D10cm"}
+{"text": "We present a theory of thermal conduction in a transition metal dichalcogenide nanocomposite structure with rough interfaces that accounts for the anisotropic conductivities of the host, the insert and the interface regions. The host and insert conductivities are calculated using a semi ab-initio method. The effects of specularity in phonon interface scattering and the thermal boundary resistance is incorporated through linking a phonon wavevector dependent specular scattering parameter to the average height of surface inhomogeneities, and the conductivity of the composite is calculated by employing an extension of a modified effective medium approach. Our work for spherical inserts of WS The determination of key parameters of a nanocomposite structure that control its physical properties, such as thermal, electronic and optical characteristics, is essential for future technological advances. The calculation of the bulk properties of nanocomposites where a small fraction of insertions of one material are embedded within a matrix of a different material, perhaps with a boundary layer between the insertion and the matrix, is a long-standing problem. Effective medium approaches (EMAs) are a widely used method of calculating properties  the directional dependence of the matrix thermal conductivity or dielectric constant must be accounted for ,16,17. IHowever, the originally formulated mEMA  and its Transition metal dichalcogenides (TMDCs) such as MoS studies ,22,23 deulations  are useda is the radius of the spherical insert, An emEMA calculation for a system with anisotropic interface resistance is performed in two steps. Firstly we compute the effective thermal conductivity of the insert and the interface regions :(1)\u03ba*=\u03bainsor see  accountiWe then calculate the thermal conductivity of the effective medium equation : (2)\u03baE=\u03baf is the volume fraction of inserts, Here nsor see  accountiThe required values of o method , which wIn order to include the effects of specularity, we define a momentum dependent parameter h et al. , we writThe value of The effects of finite Scattering from the sample boundary itself is taken to be purely diffusive and unaffected by the specularity parameter. Minnich and Chen  include Next, we discuss the thermal boundary resistance. This is a challenging property to calculate with any accuracy, since the assumptions of the prevailing models are strictly valid only in the continuum limit and exclude the effects of inelastic scattering and other anharmonic processes  and in-plane (x) directions. In both directions it undergoes a rapid decrease as the temperature rises before saturating above 400 K.  of Ref. .Panel (b) of Results for f, as one would expect. The effect of decreasing  inserts a,b, whicWhy is the deviation from the diffuse result greater for smaller particles? Recall from Equation  that theFor practical purposes, the above conclusion should be qualified slightly. We can estimate from the lattice constant of WSf and higher thermal conductivities for larger f, whereas we would expect a Minnich-Chen calculation  to provWe have used an extension of a modified effective medium approach (mEMA) to study thermal conduction in a transition metal dichalcogenide nanocomposite structure with rough interfaces by accounting for the anisotropic conductivities of the host, the insert and the interface regions. The role of specularity in phonon-interface scattering and in thermal boundary resistance is incorporated by implementing a simple phenomenological model relating momentum-dependent specular scattering and surface roughness. In general, it is found that the effect of specular scattering due to interface roughness is more pronounced for inserts smaller than 100 nm in the vicinity of 300 K. In particular, from comparison with calculations carried out in the diffuse limit, for spherical WS"}
+{"text": "AbstractSquamapionatomarium , as well as its development cycle and the phenology of its developmental stages, are described for the first time. The larva and pupa of S.atomarium have typical morphological features of the subfamily Apioninae. Morphological data on the immature stages were compared with the only fully described Squamapion species, S.elongatum . The larvae of the two species differ in body size and shape, head shape, setae length, the chaetotaxy of the mouthparts, and individual types of setae on the pronotum and thorax. In the case of the pupa, there are also differences in body size and in the type of setae and chaetotaxy of the head, pronotum, metanotum and abdomen.The immature stages  of  Squamapion Bokor, 1923 belongs to the tribe Kalcapiini Alonso-Zarazaga, 1990 in the subfamily Apioninae Sch\u00f6nherr 1823 and family Brentidae Billberg 1820. The adult morphology, ecology, distribution and systematics of the Apionidae family have been presented in detail by Lamiaceae family, with a preference for the genera Salvia L., Thymus L., Thymbra L., Mentha L., Origanum L., Prunella L. and Saccocalyx Coss. & Durieu. Their larvae bore tunnels inside the roots and stems, occasionally causing galls   .Squamapionatomarium .This study is a continuation of research on representatives of this genus found in Poland. The authors describe the morphology of the third larval instar and pupa as well as issues concerning the development and ecology of Thymusserpyllum L.) and broad-leaved thyme (T.pulegioides L.). As regards its biology, S.atomarium feeds on the upper part of the stem of these plants, causing oval cecidia 2\u20134 mm long and 2 mm wide , 2. Bochotnica , 3. Lublin-G\u00f3rki Czechowskie , 4. Lublin , 5. Trze\u015bni\u00f3w near Lublin , 6. Kolonia Pliszczyn , 7. the Stawska G\u00f3ra Reserve near Che\u0142m  and 8. the \u017bmud\u017a Reserve . Immature stages of S.atomarium were found at sites 3, 5 and 8. In the remaining sites, despite the presence of host plants, no specimens were found. The material was collected from May to August 2016 and 2017. To obtain immature stages of the species, plants were collected at the sites every 2\u20133 days. This frequency made it possible to study the development cycle of the species in its natural conditions. Breeding was also conducted in the laboratory. Squamapionatomarium adults were collected individually, directly from the host plant and from its immediate surroundings.The research material comprised developmental stages  of f Poland . The sitT.serpyllum L. and T.pulegioides L. Wet filter paper was placed on the bottom of the containers to maintain a suitable moisture level, together with thyme. The stems were searched for signs of oviposition and eggs about every three days. Then immature stages were grown in Petri dishes in a growth chamber, in the following conditions: daytime minimum 25 \u00b0C, daytime maximum 35 \u00b0C, minimum at night 15 \u00b0C, maximum at night 20 \u00b0C, humidity (60%), light duration \u2013 day 14 h, night 10 h. Immature stages were also grown in 125 ml plastic containers stored under room conditions (25 \u00b0C with a 14:10 photoperiod). Filter paper soaked in water was placed on the bottom of the container to maintain moisture, together with thyme stems with galls. The closed containers were monitored daily for mould. This method produced better results in terms of larvae survival than the use of the Petri dishes proposed by Adult specimens were placed in plastic containers covered with mesh \u2013 separately for The immature stages obtained by the methods described above were preserved in 70% ethyl alcohol. Two methods were used to prepare microscope slides, as described by 1, 4 L2, 15 L3 and 10 pupae. The larvae were not separated by gender for the measurements. The mean and standard deviation for each parameter were calculated using Excel.The terminology of An analysis was made of the growth of the heads of individual larval instars based on Dyar\u2019s law (1890), and the growth rate (GF) was determined based on AbI, AbVII, AbVIII, AbIX, AbX \u2013 abdominal segments 1, 7\u201310, ThI, ThII, ThIII \u2013 thoracic segments 1\u20133, prns pronotal setae, pda pedal s., ps pedal s., eus eusternal s., lsts laterosternal s., prs prodorsal s., pds postdorsal s., as alar s., ss spicular s., eps epipleural s., ds dorsal s., les lateral epicranial s., fs frontal s., des dorsal epicranial s., pes posterior epicranial s., at antenna, Se sensorium, sb sensillum basiconicum, ss sensillum styloconicum, oc ocellus, enc endocarina. lrms labral setae, cls clypeus s., ams anteromedial s., als anterolateral s., mes median s., lr labral rods., mds \u2013 dorsal malae s., dms dorsal maxillary s., pfs palpiferal s., sts stipal s., mpxs maxillary palp s., mbs malar basiventral s., prms prelabium s., pms postlabium s., lgs ligular s., lbp labial palpus, as apical setae, ls lateral s., pls posterolateral s., sos suborbital s., rs rostral s., fes femoral s., ur urogomphi.Fig. 1Measurements . Length 0.28 (0.22\u20130.31), width 0.18 (0.15\u20130.20).General. Egg elliptical, shiny, smooth. Chorion soft, delicate . First larval instar (L1) \u2013 body length 0.46 (0.39\u20130.55), width 0.21 (0.19\u20130.23). Head width 0.13 (0.12\u20130.14).2) \u2013 body length 0.68 (0.64\u20130.74). Body widest at abdominal segment III (0.34). Average pronotum width 0.27 (0.15\u20130.21). Head width 0.19 (0.17\u20130.21). Stemmata present.Second larval instar (L3) \u2013 body length 1.36 (1.09\u20131.72). Body widest at abdominal segment III . Width of pronotum 0.47 (0.40\u20130.55). Head width 0.33 (0.30\u20130.38).Mature larva  distinct, long, together with epicranial suture extends 3/4 length of head  without articulations. Sensorium (Se) long, slightly narrowing apically. Antenna with 4 sensillae: 2 sb (sensillum basiconicum) and 2 ss (sensillum styloconicum) . Les1 more than 4 times longer than les2. Dorsal part of epicranium with 5 visible dorsal setae (des1\u20135), des1,3\u20135 situated more or less along frontal suture, des2 on extension of line of pes  \u2013very short and more or less equidistant. Frons with 4 frontal setae  , fs1 situated by endocarina at about 1/3 length of frons, fs3 situated outermost of all fs, close to fs4. Setae fs4 long \u2013 longest of all fs. Setae fs5 slightly above anterior margin of stemmata.ead Fig. . Pale yeMouthparts. Labrum \u2013 anterior margin slightly arched. Dorsal side with 3 thorn-shaped labral setae (lrms), of which lrms2 long and longer than others; lrms1 closer to centre, below mid-height of labrum, lrms2 and lrms3 anterolaterally , of which medial ams1 finger-shaped, outer setae ams2 thorn-shaped  present, long, extending well beyond suture   and 1 sensillum . In the upper part palpiferal setae pfs1 fairly short, placed centrally under maxillary palpus, pfs2 very long, placed on inner side, basioventral seta (mbs) short. Maxillary palpus (mp) 2\u2013segmented, distal segment cylindrical, smaller than basal segment, with 10 nodular cuticular tubercles situated apically. Basal segment with rod-shaped sensorium, 1 minute maxillary palp seta (mpxs) and 1 pore. Malar part of maxilla with 7 dorsal maxillary setae  clearly visible, finger-shaped setae of equal length in comb-like arrangement.lly Fig. . Epipharped Fig. . Beside ure Fig. . Clypeusss) Fig. . Mandibllum Fig. . Setae ctae Fig. . In lowepms1\u20133), distributed evenly, one over the other, closer to outer part of postmentum, more or less parallel to its edges. First pair setae (pms1) situated closest to lower margin, shortest of all pms. Above it pms2, very long and longest of pms, thick, narrowing only at apex. Setae pms3 situated at 2/3 height of labium, similar in structure to pms2 but half their length. Labium with Y-shaped premental sclerite situated centrally. 1 pair sensilla at base of arms of this structure. At height of premental sclerite, dorsally, chitinized inverted comma-shaped labial rods with uneven edges. Labium with 1 pair simple palpi (lbp), with 7 palpillae apically, 1 inner seta at base and 1 outer sensillum. In front of palpi 1 pair long premental setae (prms). Behind palpi 2 pairs very short ligular setae (lgs) and 1 pair sensilla , 1 pleural seta (ps) and on pedal area 3 pedal setae (pda) , 2 postdorsal setae (pds), 3 alar setae (as), 3 spicular setae (ss), 3 pda on pedal area and 1 short eusternal seta (eus). Thoracic spiracle bicameral, located intersegmentally, between Th.I and Th.II  Fig. . Meso- aAbdomen. Tergites I\u2013VII with 2 folds and 1 seta (prs) on prodorsum. Postdorsum with 2 pds and 2 ss of varying size; 1 epipleural seta (eps) slightly below ss. Pleurum with 1 ps. Sternum with 1 laterosternal seta (lsts). Tergit VIII with gentle folds and with 1 prs, 1 dorsal seta (ds) and 1 eps. Tergit IX without folds, with 1 ds and 1 ps. Sternum and pleurum of segments VIII\u2013IX with 1 ps and 1 lsts. Segments I\u2013VII with unicameral spiracles, others without spiracles . Body length 1.51 (1.24\u20131.63), width 0.84 (0.72\u20130.93)  Figs .Colouration. Colour creamy-white.Head. Eyes large, with 1 supraorbital seta (sos) between them. Rostrum long, extending to end of tarsi of mesolegs, not very wide, with 1 rostral seta (rs) below base of antennae, shorter than sos. Antennae relatively long, club with conical papillae. Antennae sub-parallel to protibia , half length of ls1 , similar in length to as1. Mesonotum without setae. Metanotum with 2 setae, slightly shorter than ls1  on convex base  with characteristic ends in form of flattened bifurcation  hatches on average 4 days after the egg is laid and moults after 10\u201312 days. The L1 instar was observed as early as mid-May, but these were isolated specimens. Maximum emergence was observed from the second third of May. L1 larvae were found until mid-June. The second larval instar (L2) appeared at the end of May. The activity of L2 larvae causes distinct galls about 1.32 mm long and about 0.75 mm wide. Furthermore, L2 gnaws out an opening for oviposition on the opposite side of the groove, but does not gnaw through the skin. The second larval instar lasts on average 10 days, and then the larva moults again. L3 larvae appeared as early as the last third of June and were noted until mid-July. The average duration of this stage is about 11 days. This stage continues feeding and the gall grows, reaching on average about ca 2.31 in length and ca 1.70 mm in width  has previously been described, and the existing data on S.atomarium concern only its habitat and host plants, with an equal role ascribed to T.serpyllum and T.pulegioides (T.pulegioides), on which more galls were observed. This is most likely linked to the environment inhabited by S.atomarium, where this species of thyme is more common. Another new observation is the site of oviposition and galls. According to Among species of the genus egioides . The pre3 larva and pupa of S.atomarium does not differ from the typical characters of the subfamily Apioninae , Stenopterapionintermedium  and Metatrichapionreflexum , by Diplapionconfluens , or by Pseudaspidapionbotanicum Alonso-Zarazaga & Wang, 2011. Squamapionatomarium was also confirmed to possess an apomorphic trait of Apioninae emphasized by Thus the immature stages of the species are generally very similar in their morphology to those described by 3 larva of S.atomarium and S.elongatum, the two species are distinguished by differences in the size of both the egg and the L3 larvae \u2013 in S.atomarium they are about half the size as in S.elongatum  and has far fewer abdominal setae (Table The case of the pupa is similar. There are clearly visible differences between species in body size and chaetotaxy. The body of the pupa of atum 1.5\u2013.0 times Squamapion will make it possible to distinguish and describe its generic characters.The study and descriptions of additional species of the genus Analysis of the growth rate and the ratio of actual and theoretical average head sizes produced some discrepancies that may have been influenced by the fact that the individuals were not divided by sex or collection site, and thus may have represented different populations."}
+{"text": "AbstractCleopomiarus and Miarus of Mecinini  was tested on the basis of morphological characters from the immature stages. The mature larvae of five Cleopomiarus species , C.graminis , C.longirostris , C.medius , and C.meridionalis ), three Miarus species , and M.campanulae ), and the pupae of four Cleopomiarus species  and two Miarus species (M.abnormis and M.ajugae) are described in detail for the first time. To confirm the taxonomic identification of some larvae, DNA COI barcode was obtained and compared with those of adults. The immature stages of the species herein studied were compared with those known from other genera in tribe Mecinini. It is suggested that Miarus and Cleopomiarus may be monophyletic based on several shared distinctive characters. Larvae of Miarus have a characteristic maxilPageBreaklary mala with six finger-like dms of two sizes (one or two dms very long and the rest of medium length), this feature being apparently unique among weevils. Other genus-specific character states are observed in the pupae, such as the length of setae on the head, rostrum and pronotum, including the number of rs on the rostrum, ds on pronotum, and finally the shape of the urogomphi. A key to the described larvae and pupae were respectively presented. New biological and distributional data on some species are reported.The relationship between the genera  Mecinini is a tribe of the subfamily Curculioninae (Curculionidae) and comprises six genera: Cleopomiarus Pierce, 1919, Gymnetron Schoenherr, 1825, Mecinus Germar, 1821, Miarus Schoenherr, 1826, Rhinumiarus Caldara, 2001 and Rhinusa Stephens, 1829  and a phylogenetic analysis based on adult morphology , whereas the Cleopomiarus species in South Africa and in the southern part of North America live on the genera of the subfamilies Campanuloideae  and Lobelioideae (Lobelia)  . Howeverable see . This plsterales . Cleopomve shown .Cleopomiarus and Miarus species is very uniform, and there are few external characters allowing differentiation of many species. Species recognition is often possible only by the careful examination of male or female genitalia. The presence of a deep prosternal canal and free claws are two easily observed external characters that immediately allow the separation of Cleopomiarus and Miarus from other Mecinini. The shape of the penis and the sclerites of the endophallus, the slightly more pronounced convexity of the male pygidium, and the more globose femora distinguish Cleopomiarus from Miarus. Moreover, in many species of Cleopomiarus, meso- and metafemora are dentate, and the uncus of the male metatibiae is enlarged, whereas the fifth ventrite of Miarus often shows a median fovea and two teeth placed posterolaterally. Finally, both genera feed on Campanulaceae, a family of plants apparently not parasitized by any other weevil. Preliminary molecular studies appear to confirm the systematic separation of these two genera, whereas several species of Miarus, well identified on the basis of morphological characteristics, tend to have very similar DNA fragments on mitochondrial COI gene , G.villosulum Gyllenhal, 1838; Rhinusacollina ; R.linariae ; Cleopomiarusgraminis, C.hispidulus , and Miaruscampanulae  to find characters distinctive between these two genera and between the species; and 3) to investigate the relationships of these two genera with other genera of the same tribe and other tribes within Curculioninae.Therefore, the purpose of this study was the following: 1) to describe larvae and pupae of PageBreakMiarus + Cleopomiarus can be found on the same plant , the Department of Zoology University collection of Maria Curie-Sk\u0142odowska (Lublin) and from personal collections of the two authors (RC and IT) which are deposited in the collection of the Group Function of Invertebrate and Plant Biodiversity in Agro-Ecosystems of the Crop Research Institute . In the last case, the specimens were collected and placed in tubes with 95% ethyl alcohol generally with a few adults. Since it is well known that more than one species of the complex me plant , to be cPart of the larval and pupal material was preserved in Pampel fixation liquid see  and usedThe observations and measurements were conducted using a light microscope with calibrated oculars (Olympus BX 40 and Nikon Eclipse 80i). The following characters were measured for each larva: head width, body length (larvae fixed in a C-shape were measured in segments), and body width in the widest place . For the pupae, the length and width at the widest place were measured. The lengths of all setae are visible on Figures.Drawings were created with a drawing tube on a light microscope and processed by a computer . The numbers of setae of the bilateral structures are given for one side.We used the terms and abbreviations for the setae of the mature larvae and pupae found in Campanulaceae. The barcoding region of PageBreakthe mitochondrial cytochrome c oxidase subunit I gene (mtCOI) was used to confirm the identity of the sampled larvae and the corresponding adults previously determined by using morphological characteristics  and MiaR (5\u2019 GCTCGTGTATCAACATCTATTCC 3\u2019). The MiaF/MiaR primers amplified a mtCOI product of 838 bp, which consisted of 635 bp of the barcoding region  under accession number MH558545\u2013MH558548.Each PCR reaction was carried out in a volume of 20 \u03bcl . The PCR protocol consisted of an initial denaturation at 95 \u00b0C for 5 min; 35 cycles consisting of three steps, i.e., 1 min at 94 \u00b0C, 1 min at 54 \u00b0C and 1.5 min at 72 \u00b0C; and a final extension step at 72 \u00b0C for 7 min. After PCR amplification, the products were separated on a 1% agarose gel, stained with ethidium bromide, and visualized under a UV transilluminator. The amplified products were sequenced by Macrogen Inc. . The sequence data were deposited in the NCBI GenBank database . Body length: 2.20\u20138.70. Body width  0.73\u20132.44. Head width: 0.35\u20131.16.General. Body elongated, slender, rounded in cross section.Colouration. From yellow to pale brown head. All thoracic and abdominal segments from distinctly white to slightly yellow.Vestiture. Setae on body thin, in different colouration, distinctly different in length; piliform, often with some asperities.Head capsule. Head oval or suboval, slightly or more flattened laterally, endocarinal line present and very distinct, more than half the length of frons. Frontal sutures on the head in different sizes, and ever extended to antennae. One or two stemmata (st), anterior stemma in the form of a pigmented spot with convex cornea behind the antenna. Dorsum of the epicranium with five setae; 3des located anteriorly on epicranium close border with frontal suture. Frons with four setae; 2fs absent; 4fs; and 5fs subequal. Head also with two les and two ves. Epicranial area with three pes and 2\u20133 sensilla.PageBreakAntennae located at the end of the frontal suture on each side, membranous and distinctly convex basal article bearing 3\u20134 sensilla and one conical sensorium, the later elongated, narrow.Clypeus transverse-shaped, approximately 2.5\u20133 times as wide as long with two cls, and one sensillum (clss) between setae; all very close to margin with frons.Mouthparts. Labrum with three piliform lms; anterior margin bisinuate. Epipharynx with three finger-like als; with 2\u20133 ams; and 0\u20131 mes; labral rods (lr) distinct, elongated. Mandibles distinctly broad, bifid, teeth of unequal height; slightly truncate; both setae piliform. Maxilla stipes with one stps, two pfs and one mbs and one sensillum; mala with six finger-like dms; five vms; all vms distinctly shorter than dms. Maxillary palpi with two palpomeres; basal palpomere with one short mxps and two sensilla; distal palpomere with one sensillum and a group of micro cuticular apical processes. Prelabium oval-shaped, with one prms; ligula with sinuate margin and 1\u20132 ligs; premental sclerite well sclerotized but without anterior and posterior extensions, U-shaped. Labial palpi with two palpomeres ; each of the palpomeres with one sensillum, distal palpomere with cuticular apical processes. Postlabium with three pms, all located laterally.Thorax. Prothorax slightly smaller than meso- and metathorax. Spiracle bicameral, placed between the pro- and mesothorax Campanulacervicaria L., 05.07.2017, Stara Planina, Babin Zub, east Serbia, leg. I. To\u0161evski, all collected in association with adults det. R. Caldara. Accession numbers of sequenced specimens: MH558546.17 L3 larvae: 7 exx., 29.07.2010, Gr\u00f3dek ad Hrubiesz\u00f3w, CE Poland, leg. E. Szwaj, det. J. \u0141\u0119towski; 10 exx., ex seed capsules of Measurements (in mm). Body length: 4.43\u20135.57 (mean 4.90). Body width  up to 1.37. Head width: 0.70\u20130.84 (mean 0.71).General. Body elongated, slender, curved, rounded in cross section .Head capsule  distinct, elongated, slightly convex. Mandibles ; one very long and one minute ss; two very long eps; one medium ps; one medium lsts; and two very short eus.PageBreakAbdominal segment VIII ; one long and one minute ss; two very long eps; one medium ps; one medium lsts; and two very short eus. Abdominal segment IX  in central Europe   . The thrms2 Fig.  and a meae) Fig. , pronotusls Fig. , and abdsls Fig. . Finallysls Fig. .Taxon classificationAnimaliaColeopteraCurculionidaeCampanulamacrostachya Waldst. et Kit. ex Willd., Dobra, Iron Gate, east Serbia. 13.07.2015, leg. I. To\u0161evski, all collected in association with adults, det. R. Caldara. Accession numbers of sequenced specimens: MH558545.11 L3 larvae: 6 exx., 18.07.2010, W\u00f3lka ad Lublin, CE Poland, leg. E. Szwaj, det. J. \u0141\u0119towski; 5 exx., ex seed capsules of Measurements (in mm). Body length: 3.75\u20136.27 (mean 4.80). Body width  up to 1.63. Head width: 0.65\u20130.78 (mean 0.71).General. Body elongated, slender, curved, rounded in cross section . Cuticle distinctly asperate.Head capsule  distinct, elongated, oval. Mandibles ; one very long and one minute ss; two long eps; one very long ps; one long lsts; and two short to very short eus. Abdominal segment VIII ; one long and one minute ss; two very long eps; one long ps; one long lsts; and two short to very short PageBreakeus. Abdominal segment IX .VII Figs  with oneIII Fig.  with one IX Fig.  with thrt X Fig.  with oneCampanula, mainly C.glomerata, C.persicifolia, and C.rotundifolia L.  A. DC, although in another Serbian locality (see below). This genus, however, is very closely related to Campanula . Therefore, the differences between these two taxa found in the study of the immature stages, especially in the larvae \u2013 antennae with a very long conical sensorium and three sensilla  long Campanulatrachelium L., leg. and det. R. Caldara, all determined by association with reared adults.11 L3 larvae: south-eastern France, Menton, July 2007, ex capsules of Measurements (in mm). Body length: 6.60\u20138.70 (mean 8.3). Body width  up to 2.44. Head width: 1.05\u20131.16 (mean 1.10).General. Body elongated, slender, curved, rounded in cross section . Cuticle slightly asperate.Head capsule ; with three ams in different length, 1ams and 2ams piliform and short, finger-like 3ams and enlarged in middle, and also located more close to lr; without mes; labral rods (lr) distinct, elongated, oval. Mandibles ; one long and one minute ss; two very long to long eps; one relatively long ps; one short lsts; and two very short eus. Abdominal segment VIII ; one relatively long and PageBreakone minute ss; two relatively long eps; one short ps; one short lsts; and two very short eus. Abdominal segment IX .VII Figs  with oneIII Fig.  with one IX Fig.  with thrt X Fig.  with oneCampanulatrachelium L., where they pupate without producing galls. It is noteworthy that adults did not exit by making a hole in the capsules but remained inside with the rostrum folded in the ventral canal until these opened spontaneously and forcefully, blowing up the seeds. On the other hand, it would be impossible, especially for the female, to straighten up the very long rostrum inside the capsule due to the limited available space. This is a more advantageous behaviour and apparently opposite to that of Rhopalapionlongirostre , another species where the female rostrum is more than twice as long as the stout male rostrum. In this species, R.longirostre does not possess a ventral canal, which allows it to retain the folded rostrum.We can confirm that larvae of this species feed on seed capsules of C.graminis, as also supported by preliminary molecular studies , from which it differs only by the very long rostrum especially in the female and usually by the larger size  extremely long Campanulalingulata Waldst. and Kit., 26.06.2017, Stani\u010denje, Pirot, east Serbia, leg. I. To\u0161evski, all collected in association with adults, det R. Caldara. Accession numbers of sequenced specimens: MH558547.13 L3 larvae, ex seed capsules of Measurements (in mm). Body length: 5.10\u20137.30 (mean 5.67). Body width  up to 2.02. Head width: 0.83\u20130.96 (mean 0.91).General. Body elongated, slender, weakly curved, rounded in cross section . Cuticle distinctly asperate.Head capsule  distinct, PageBreakelongated. Mandibles ; one long and one minute ss; two long eps; one long ps; one long lsts; and two short eus. Abdominal segment VIII ; one long and one minute ss; two long eps; one long ps; one long lsts; and two short eus. Abdominal segment IX , but larval development on this plant species is not confirmed. Like PageBreakC.distinctus and C.graminis, larvae are seed feeders inside capsules of the host plant without producing galls.Previously, the unique biological datum on this species was reported by ampanula . TherefoCleopomiarus. For example, this character is shared with C.longirostris and C.distinctus, two other taxa presented in this paper. It is distinguishable from these species by the less globose and moderately elongate elytra, and moreover by the shape of the male and female genitalia (C.medius from these two species as well as from C.graminis (see keys to larvae and pupae). There are also substantial molecular differences between C.medius and other species .This species was previously known from Anatolia, Syria and many countries of the Balkans but not from Serbia. The adults of this species are characterized by a very long rostrum in the females. This character, however, is not uncommon in the Palaearctic enitalia . Other cTaxon classificationAnimaliaColeopteraCurculionidaeCampanularapunculus L., leg. and det. R. Caldara all collected in association with adults.10 L3 larvae: south-eastern France, Castellar (Menton), Juin 2005, ex seed capsules of Measurements (in mm). Body length: 2.20\u20133.15 (mean 2.8). Body width  up to 0.73. Head width: 0.35\u20130.51 (mean 0.45).General. Body elongated, slender, curved, rounded in cross section . Cuticle distinctly asperate.Head capsule ; with three short ams in different shape, 1ams and 2ams piliform, finger-like 3ams and enlarged in middle, and also located more close to lr; without mes; labral rods (lr) distinct, elongated, oval. Mandibles ; one very long to long and one minute ss; two very long eps; one very long to long ps; one relatively long to short lsts; and one short to very short and one relatively long eus. Abdominal segment VIII ; one long and one minute ss; two very long eps; one very long to long ps; one relatively long to short lsts; and one short to very short and one relatively long eus. Abdominal segment IX .VII Figs  with oneIII Fig.  with som IX Fig.  with twot X Fig.  with oneCampanularapunculus L., and we can confirm that larvae feed on seeds of this plant as previously reported by Adults of this species are usually collected on the flowers of PageBreakC.plantarum , C.micros  and C.reitteri , from which they differ by some external characters and the shape of their genitalia . Body length: 3.80\u20138.39. Body width  1.55\u20132.04. Head width: 0.57\u20130.83.General. Body slender, C-curved, rounded in cross section.Colouration. From black to dark brown head. All thoracic and abdominal segments yellowish, with some asperities.Vestiture. Setae on body thin, in different colouration, distinctly different in length; piliform.Head capsule. Head almost rounded, sometimes slightly flattened laterally, endocarinal line present and distinct, more than half the length of frons. Frontal sutures on the head narrow and loosened, but distinct, and ever extended to the antennae. One stemma (st), in the form of a pigmented spot with convex cornea. Dorsum of the epicranium with four or five setae; 3des located anteriorly on epicranium close border with frontal suture. Frons with three or four setae; 2fs absent. Head also with two les and two ves. Epicranial area with two or three pes and more or without sensilla.Antennae located at the end of the frontal suture on each side, membranous and distinctly convex basal article bearing one very long conical sensorium; basal membranous article with 1\u20134 sensilla.Clypeus transverse-shaped, approximately 2.5\u20133.5 times as wide as long with two cls, and one sensillum (clss) between setae; all very close to margin with frons.Mouthparts. Labrum with three piliform lms; anterior margin bisinuate. Epipharynx with three finger-like als; with two ams; and 0\u20132 mes; labral rods (lr) elongated. Mandibles distinctly broad, bifid, teeth of unequal height; slightly truncate; both setae piliform and located apically. Maxilla stipes with one stps, two pfs and one mbs and one sensillum; mala with six finger-like dms, in two sizes, first or first and second dms very long as pfs, next medium length; five vms; all vms distinctly shorter than dms. Maxillary palpi with two palpomeres; basal palpomere with one short mxps and two sensilla; distal palpomere with one sensillum and a group of micro cuticular apical processes. Prelabium oval-shaped, with one prms; ligula with sinuate margin and 2\u20133 ligs; prePageBreakmental sclerite feebly visible. Labial palpi with two palpomeres; each of the palpomeres with one sensillum, distal palpomere with cuticular apical processes. Postlabium with three pms, all located laterally.Thorax. Prothorax slightly smaller than meso- and metathorax. Spiracle bicameral, placed between the pro- and mesothorax ; three pds, 2pds the longest one; one long and one minute ss; two long eps; one ps; one lsts; and two eus. Abdominal segment IX with 3\u20134 ds; 1\u20133 ps; and two sts. Abdominal segment X with one minute seta present or absent.Taxon classificationAnimaliaColeopteraCurculionidaeSolari, 1947Campanulapyramidalis L., leg. E. Tomasi, all collected in association with adults, det. R. Caldara.5 L3 larvae: north-eastern Italy, Venezia Giulia, Duino (Trieste), Rilke path, August 2017, ex galls on capsules of Measurements (in mm). Body length: 3.50\u20134.75 (mean 3.9). Body width  up to 1.65. Head width: 0.57\u20130.65 (mean 0.60).General. Body moderately elongated, rather stout, curved, rounded in cross section , and also two sensilla.ule Fig. . Head ovize Fig. . Fs1 lonong Fig. . Les1 anAntennae located at the end of the frontal suture on each side, membranous and distinctly convex basal article bearing one conical sensorium, relatively elongated; basal membranous article with four sensilla (styloconica) equal in length, and one (ampullacae)  Fig. .PageBreakClypeus  between setae; all very close to margin with frons; anterior margin of clypeus rounded to inside.eus Fig.  trapeziuPageBreakMouthparts. Labrum  2lms and 3lms; all located more or less anteromedially, all reach labral margin; anterior margin double sinuate. Epipharynx  distinct, kidney-shaped. Mandibles ; five vms (two medium size and three very short); all vms shorter than dms. Maxillary palpi with two palpomeres; basal palpomere with one short mxps and two sensilla; length ratio of basal and distal palpomeres almost 1:1; distal palpomere with one sensillum and a group of microcuticular processes apically. Prelabium ; palpomere with one sensillum and medium, cuticular apical processes. Postlabium , well pigmented dorsal sclerite with four long prns); two medium ps; and one short eus. Meso- and metathorax .rax Fig.  with tenrax Fig.  with onerax Fig.  almost iAbdomen. Abdominal segments I\u2013VII ; one medium and one minute ss; two medium eps; one medium ps; one medium lsts; and two very short eus. Abdominal segment VIII ; two medium eps; one medium ps; one medium lsts; and two very short eus. Abdominal segment IX . Unfortunately, the females of these three species appear not to be distinguishable , confirming what was suggested by the adult morphology . It is easily distinguishable from all other species of uishable , and therphology . MoreoveTaxon classificationAnimaliaColeopteraCurculionidaeAdenophoraliliifolia, 30.06.2017, Kaludjerske Bare, Mt. Tara, Central Serbia, leg. I. To\u0161evski, det. R. Caldara; 5 exx, ex galls on capsules of Campanulabononiensis L., 14.07.2017, Zavojsko jezero, Pirot, east Serbia, leg. I. To\u0161evski, all collected in association with adults, det. R. Caldara. Accession numbers of sequenced specimens: MH558548.26 L3 larvae: 9 exx., 12.07.2009, Bychawa ad Lublin, CE Poland, leg. E. Szwaj, det. J. \u0141\u0119towski; 12 exx, ex galls on capsules of Measurements (in mm). Body length: 4.50\u20138.39 (mean 5.70). Body width  up to 2.04. Head width: 0.68\u20130.83 (mean 0.70).General. Body slender, C-curved, rounded in cross section .Head capsule  elongated, broad, slightly convergent posteriorly. Mandibles , small pigmented dorsal sclerite present with five long prns, this sclerite subdivided in two triangular plates medially; two long ps; and one short eus. Meso- and metathorax ; one very long and one minute ss; two long eps; one medium ps; one medium lsts; and two short PageBreakeus. Abdominal segment VIII ; one long and one minute ss; two medium eps; one medium ps; one medium lsts; and two short eus. Abdominal segment IX .VII Figs  with oneIII Fig.  with one IX Fig.  with twot X Fig.  with oneMiarusajugae was collected on various species of the genus Campanula  and Phyteuma   A. DC. .atum L.) . HoweverM.campanulae, from which it differs mainly by the shape of the apex of the body of the penis  is very closely related to he penis . UnfortuPageBreakTaxon classificationAnimaliaColeopteraCurculionidaeCampanula, Store Dyrehave, Denmark, leg. J.P. Kryger, collected in association with adults, det. Van Emden, coll. British Museum of Natural History (London).9 L3 larvae: 30.07.1939, ex PageBreakPageBreakMeasurements (in mm). Body length: 3.80\u20135.96 (mean 5.20). Body width  up to 1.61. Head width: 0.58\u20130.64 (mean 0.61).General. Body slender, C-curved, rounded in cross section  distinct asperate.Head capsule  indistinct, slightly elongated, oval. Mandibles , next medium size; five vms, different in length, two setae medium size, and three setae very short. Maxillary palpi: basal palpomere with one short mxps and two sensilla; distal palpomere with short, cuticular apical processes; length ratio of basal and distal palpomeres 1:0.9. Prelabium ; one very long and one minute ss; two long eps; one medium to short ps; one medium to short lsts; and one medium to short and one very short to minute eus. Abdominal segment VIII ; one long and one minute ss; two very long eps; one medium to short ps; one medium to short lsts; and one medium to short and one very short to minute eus. Abdominal segment IX .VII Figs  with oneIII Fig.  with one IX Fig.  with twot X Fig.  with oneCampanula , and Phyteumaspicata L. where they cause distinct swelling . Body length: 3.00\u20136.50. Body width: 1.50\u20133.80. Head width: 0.65\u20131.10.Body moderately slender or stout. Smooth, dark brown or black spotted cuticle. Rostrum long or very long, from four up to five times as long as wide, reached up to meso- or metacoxae. Antennae elongated. Pronotum from 2.2 up to 2.9 times as wide as long. Mesonotum distinctly shorter than metanotum. Abdominal segments I\u2013V of equal length; abdominal segments VI and VII diminish gradually; abdominal segment VIII almost semicircle; abdomen segment IX distinctly reduced. Spiracles on abdominal segments placed dorsolaterally: on abdominal segments I\u2013V functional; and on segment VI atrophic on next ones invisible. Urogomphi (ur) stout and short, conical, each of them with sclerotized apex.Chaetotaxy: setae piliform, in a different size. Head capsule with 0\u20131 vs, 0\u20131 sos, and two os. Rostrum with 0\u20131 pas and one rs . Pronotum with: two as, one ds, 1\u20132 sls, 0\u20131 ls and three pls. Setae on head, rostrum and pronotum PageBreakvery thin, light and relatively short. Dorsal parts of meso- and metathorax with 2\u20133 setae placed medially. Apex of each femora with one fes. Abdominal segments I\u2013VIII with two setae laterally and sometimes 2\u20133 short setae ventrally. Dorsal parts of abdominal segments I\u2013VII with 4\u20135 setae, and abdominal segment VIII with 3\u20134 setae dorsally. Abdominal segment IX with 2\u20134 micro-setae ventrally.Taxon classificationAnimaliaColeopteraCurculionidaeCampanulacervicaria L., 05.07.2017, Stara Planina, east Serbia, leg. I. To\u0161evski, det. R. Caldara.12 specimens: 2 \u2642; 2 \u2640, 03.08.2010, Gr\u00f3dek ad Hrubiesz\u00f3w, CE Poland, leg. E. Szwaj, det. J. \u0141\u0119towski; 2 \u2642; 6 \u2640, ex seed capsules of Measurements (in mm). Body length: 3.00\u20134.10 (mean 3.20). Body width: 1.50\u20132.60 (mean 1.80). Head width: 0.65\u20130.77 (mean 0.67).Body moderately slender . Rostrum with one pas and one rs Adenophoraliliifolia, Dobra, Iron Gate, east Serbia, leg. I. To\u0161evski, det. R. Caldara; 4 \u2640, ex seed pods of Campanulamacrostachya, 13.07.2015, Dobra, Iron Gate, east Serbia, leg. I. To\u0161evski, det. R. Caldara.15 specimens: 2 \u2642, 3 \u2640, 27.07.2010, W\u00f3lka ad Lublin, CE Poland, leg. E. Szwaj, det. J. \u0141\u0119towski; 4 \u2642, 2 \u2640, ex seed pods of Measurements (in mm). Body length: 3.60\u20134.10 (mean 3.70). Body width: 2.10\u20132.25 (mean 2.15). Head width: 0.65\u20130.70 (mean 0.67).Body moderately slender . Rostrum with one pas and one rs Campanulatrachelium L., leg. and det. R. Caldara18 specimens: 8 \u2642, 10 \u2640, south eastern France, Menton, July 2007, ex seed capsules of Measurements (in mm). Body length: 5.20\u20136.50 (mean 5.60). Body width: 3.00\u20133.80 (mean 3.30). Head width: 0.90\u20131.10 (mean 1.00).Body stout . Rostrum with one rs and one es Campanulalingulata Waldst. and Kit., 26.06.2017, Stani\u010denje, Pirot, east Serbia, leg. I. To\u0161evski, det R. Caldara.4 specimens: 2 \u2642, 2 \u2640, ex seed capsules of Measurements (in mm). Body length: 4.40\u20134.60. Body width: 2.40\u20132.50. Head width: 0.70\u20130.80.Body moderately stout . Body length: 3.20\u20134.00. Body width: 1.90\u20132.70. Head width: 0.55\u20130.70.Body moderately slender or stout. Smooth, dark brown or black spotted cuticle. Rostrum long or very long, from 2.3 up to 3.5 times as long as wide, reached up to meso- or metacoxae. Antennae elongated. Pronotum from 2.1 up to 2.5 times as wide as long. Mesonotum distinctly shorter than metanotum. Abdominal segments I\u2013V of equal length; abdominal segments VI and VII diminish gradually; abdominal segment VIII almost semicircle; abdomen segment IX distinctly reduced. Spiracles on abdominal segments placed dorsolaterally: on abdominal segments I\u2013V functional; and on segment VI atrophic on next ones invisible. Urogomphi (ur) slender and elongated, conical, each of them with sclerotized apex.Chaetotaxy: setae piliform, in a different size. Head capsule with one vs, one sos, and 3\u20134 os. Rostrum with one pas and three rs . PronoPageBreakPageBreaktum with: two as, two ds, two sls, one ls and three pls. All setae of prothorax almost equal in length. Dorsal parts of meso- and metathorax with three setae placed medially. Apex of each femora with one fes. Abdominal segments I\u2013VIII with two setae laterally and sometimes 3\u20134 short setae ventrally. Dorsal parts of abdominal segments I\u2013VII with 4\u20135 setae, and abdominal segment VIII with 3\u20134 setae dorsally. Abdominal segment IX with 4\u20136 micro-setae ventrally.Taxon classificationAnimaliaColeopteraCurculionidaeSolari, 1947Campanulapyramidalis L., leg. E. Tomasi, det. R. Caldara.3 specimens: 1 \u2642, 2 \u2640, north-eastern Italy, Venezia Giulia, Duino (Trieste), Rilke path, August 2017, ex galls on capsules of Measurements (in mm). Body length: 3.55\u20133.60. Body width: 1.90\u20132.00. Head width: 0.55\u20130.60.Body moderately slender  and one es Adenophoraliliifolia, 30.06.2017, Kaludjerske Bare, Mt. Tara, Central Serbia, leg. I. To\u0161evski, det. R. Caldara; 3 \u2642, 1 \u2640, ex galls on capsules of Campanulabononiensis, 14.07.2017, Zavojsko jezero, Pirot, east Serbia, leg. I. To\u0161evski, det. R. Caldara.12 specimens: 2 \u2642, 1 \u2640, 24.08.2009, Ciechanki, CE Poland, leg. E. Szwaj, det. J. \u0141\u0119towski; 3 \u2642, 2 \u2640, 30.06.2017, ex galls on capsules of Measurements (in mm). Body length: 3.20\u20134.00 (mean 3.40). Body width: 1.90\u20132.70 (mean 2.10). Head width: 0.65\u20130.70 (mean 0.65).PageBreakBody rather stout . Rostrum with one pas, and three rs  and one es  in Curculionidae has not been completely resolved, but this has been discussed in previous papers  or close to the ams. The final decision about the count of each seta is important, but not crucial, and the comparison between groups/genera should be done together for all three of these epipharyngeal setae in order to make fewer mistakes in the creation of a differential diagnosis of genera in the tribe.The count of some setae on the epipharynx  and one Miarus species (M.campanulae) had been described  and included only basal morphological descriptions such as the number of teeth on the mandible or colouration of the head and body. The present detailed descriptions of the immature stages of five Cleopomiarus and three Miarus species allow a comparison of both genera.Before this study, larvae of only two escribed , while aspidulus . TherefoMiarus have mala with six finger-like dms in two sizes: one or two very long dms with the rest being medium length. This appears to be a unique characteristic in weevils. More genus-specific characters are in the pupae, which are more conservative in chaetotaxy. The main differential characters in pupae among known species include the following: (1) setae on the head, rostrum and pronotum very thin, light and relatively short (Cleopomiarus) vs brown, prominent and relatively long (Miarus); (2) rostrum with one rs (Cleopomiarus) vs rostrum with three rs (Miarus); (3) pronotum with one ds (Cleopomiarus) vs pronotum with two ds (Miarus); and finally (4) urogomphi (ur) stout and short (Cleopomiarus) vs relatively slender and elongated (Miarus). Less genus-specific character states in the larvae than in pupae were also shown in another tribe of the Curculioninae (Tychiini) with regard to genera Tychius Germar, 1817 and Sibinia Germar, 1817 , as already suggested in a phylogenetic study by 1817 see , 2015.C.longirostris vs C.graminis and especially M.ajugae vs M.campanulae. The latter case is particularly emblematic. In these two taxa the adults may be separated by the shape of the apical part of the penis. On the contrary they seem indistinguishable on the basis of barcoding (Our study shows that all the species considered can be identified by the examination of larvae and pupae based on at least one character state. It is noteworthy that several taxa examined only by the study of imagoes were difficult to separate. Therefore, finding distinctive supplementary characters is welcome. This is true for arcoding .Miarus and Cleopomiarus. This is true especially when it is known that more than one related species can live on the same plant or when imagoes are not available or finally when one has to study specimens not personally collected and preserved in a museum. It is noteworthy that the data filed on GenBank or BOLD are becoming larger and larger and therefore more and more useful for such an adequate comparison. Therefore, it is also important to continue to implement these data. In this regard, it is noteworthy that we reported the barcode of C.medius for the first time.We have confirmed that a molecular study of immatures is very important in cases where it is necessary to be sure on the identity of a species as already demonstrated by PageBreakCleopomiarus and Miarus are monophagous, although never strictly monophagous, to oligophagous (Miarus are gall-inducers as previously reported (Cleopomiarus species do not form galls. However, this apparently different biological behaviour requires confirmation, since it is well known that several closely related species of Mecinini, especially in the genera Gymnetron and Rhinusa, do not have the same behaviour with regard to induction of galls (It is obvious that only a careful search of immature and a careful study of their biological cycle can distinguish true host plants from those used only as a refuge or adult food when the host plants are not yet or no longer available. Our observations confirm that the species of both genera ophagous . Moreovereported  but thatof galls .Mecinini species are important for further studies of generic taxonomic relationships within the Mecinini group. The detailed descriptions of larvae and pupae of five Cleopomiarus and three Miarus species are reported in this study. Although the number remains low in comparison with the total number of species of Cleopomiarus and Miarus, these results demonstrate the possibility of identifying the immature stages in these species, as was done in other groups of weevils (see Mecinini group. Detailed descriptions of the genera Gymnetron, Rhinusa, and Mecinus and a tribe overview will be published soon.Our data show that detailed descriptions of the immature stages of the vils see , 2015. T"}
+{"text": "The study of the fabrication, material selection, and properties of microstructured polymer optical fibers (MPOFs) has long attracted great interest. This ever-increasing interest is due to their wide range of applications, mainly in sensing, including temperature, pressure, chemical, and biological species. This manuscript reviews the manufacturing of MPOFs, including the most recent single-step process involving extrusion from a modified 3D printer. MPOFs sensing applications are then discussed, with a stress on the benefit of using polymers. Photonics crystal fibers (PCF) or microstructured optical fibers (MOFs) typically include multiple air holes that run longitudinally along the fiber. MOFs have attracted increased interest because of their wide range of unique properties such as ultra-wide single mode operation, tailorable dispersion, high or low nonlinearity, and low-loss guidance in selected spectral regions. Because of these features, MOFs have been widely considered for applications in telecoms, power delivery systems, industrial lasers, environmental monitoring, and medicine/healthcare ,2,3,4,5.MOFs are an extremely apt device for environmental sensing because the cavities inside the MOFs form natural spectroscopic cells. By using the interaction between the evanescent field and the fluid in the cavities, the fiber itself can be used as a sensor and long interaction lengths can be achieved. All these combined features enable high sensitivities for a wide range of substances. Suspended-core microstructured optical fibers (SC-MOFs), first introduced in 2001 , are MOF3D printers have been developed and optimized for printing high quality matters from a variety of materials including polymers, glasses, and metals. The improved control system present in the 3D printer, which include built-in temperature controllers and accurate polymer filament feeding systems, allow for the potential use of 3D printers for fiber drawing. Billet extrusion has been shown as a promising single-step technique to fabricate polymer and soft glass optical fiber preforms ,12,13,14Here we present the advantage of using microstructured polymer optical fibers (MPOFs) and grating-based MPOFs for sensing applications, including gases, liquids, temperature, and acoustic traces. The technique used to fabricate MPOFs will be reviewed and the recently improved technique to directly extrude MPOFs using a 3D printer will also be presented. The SC-MPOF is directly extruded using a 3D printer, much faster than any others fiber fabrication technique.The fabrication of MOFs from a single material shows significant advantages over conventional core-clad optical fibers, because issues related to thermal and chemical compatibility between different materials are intrinsically decreased.Besides silica and soft glass-based optical fibers, polymer optical fibers (POFs) are one of the most interesting materials for manufacturing optical fibers. Although the POFs exhibit relatively low transmission compared to silica-based fibers, POFs remain flexible even with a large core diameter. The use of polymers for fabricating the optical fiber has been demonstrated due to their low cost for manufacturing and their mechanical ductility for applications in environments exposed to vibrations. Polymer is also an attractive material for sensing, especially biological and chemical, as it is permeable to gases and can be easily functionalized directly.POFs can also be fabricated via multiple different techniques, and it is relatively easy to incorporate various dopants into the host material. Therefore, POFs are widely used for local area network transmission and sensing applications. The most commonly used polymer for POFs is polymethylmethacrylate (PMMA) which has a theoretical loss limit of 106 dB/km at \u03bb = 650 nm . Other pgT (around 200 \u00b0C for PMMA), to reduce the viscosity of the polymer, and exerting tension to one of the preform extremities, to decrease the diameter. The drawing process often involves intermediate stages, such as the process of drawing a fiber cane [The fabrication of microstructured polymer optical fibers (MPOFs) involves at least two stages and it starts with the manufacturing of a structured fiber preform, which is then drawn into an MPOF, a 2nd preform with a smaller diameter or a fiber cane, using a drawing tower as presented in the schematic of ber cane , which hPolymer is an attractive material for optical fiber devices and sensors because it is deemed suitable for a wider range of fiber fabrication techniques than silica, due to the lower processing temperature and ease of machining. The first microstructured polymer optical fiber preform was demonstrated in 2001 by drilling holes with the desired structure into an extruded PMMA cylinder and then drawing it into an MPOF using a polymer fiber draw tower . MPOF prThe \u201cstack and draw\u201d technique is commonly used to fabricate silica MOFs because it is a versatile and flexible method. By stacking small capillaries, not only various structures can be generated but also different material besides silica glass can be utilized. The preform can be created by assembling rods or capillaries into the desired arrangement and insert the bundle inside a tube to hold the structure securely in place. For MPOF, the polymer rods are inserted into a polymer tube to create an MPOF preform as shown in Drilling is a straightforward approach for the fabrication of MPOF preforms. The structure preform is created by drilling the pattern of holes into a solid polymer rod using a drill or a laser  which isAs far as the MPOF preform rolling technique is concerned, it usually involves two different polymers as presented in Casting is another technology used to produce both glass and polymer preforms ,22,40. TThe fabrication of an MPOF preform using billet extrusion was first proposed in 2007 . It has Rapid development of additive manufacturing technologies and the related reduction in cost, moved the fabrication of 3D models into the next generation of high precision manufacturing. 3D printing has drawn a great interest in many fields, such as medicine, art, engineering, and science. Many manufacturing techniques allow to print 3D models, including photo-polymerization, selective laser sintering (SLS), continuous liquid-interface production (CLIP), and fused-deposition modelling (FDM).In photo-polymerization, a laser or light-emitting diode (LED) is used to scan across a plane and the material polymerization occurs when light interacts with the monomer. To achieve the 3D profile, the laser or LED is controlled by using a three-axial stage and the process is repeated layer by layer. SLS is one of the most popular 3D printing techniques because it can be used to print not only polymer materials but also glass, metal, and ceramic powders. In SLS, a high-power laser is scanned on the horizontal plane layer-by-layer whilst lowering the printing bed. Under the laser irradiation the printing material is fused together forming the desired 3D models. FDM is the most commonly used (and cheapest) technique which relies on the polymer filament fed through a heated nozzle oozing molten polymer. Gluing the molten polymer layer-by-layer generates the 3D profile.3D printing is widely used for manufacturing optical devices due to its low cost and ease of fabrication. Optical waveguides operating in the telecom, mid-infrared and terahertz spectral regions were the first optical devices fabricated by using 3D printing ,51,52,53Solid core optical fiber preforms have also been 3D printed and then drawn into fibers . A two-nDrilling and casting are widely used to make MPOFs, but exhibit limitations to the number of transverse features and hole shapes, involve complex steps and require expensive facilities such as clean-room environment for the fabrication . ExtrusiIn this work, a desktop fused deposition modeling (FDM) 3D printer was used as an extruder and drawing tower to manufacture the MPOFs. A suspended-core microstructured polymer optical fiber (SC-MPOF) was extruded and directly drawn from a structured 3D printer nozzle. The 3D models of nozzle with an inverse structure profile of the fiber cross-section were designed by using the Fusion 360, Autodesk software. The structured nozzle design was separated into two pieces: the structured body and the cover. While the body shapes the inner structure of the extruded fiber, resulting in the solid core connected by three struts to the outer cladding, the cover determines the outer cladding thickness. The 3D model design was used for CNC machining the nozzle. Indeed, micromachining is a technique traditionally used to fabricate the dies for the extrusion of structured fiber preforms. To fabricate SC-MPOFs, the machined structured nozzle was mounted on the 3D printer head while a commercially available 3D printer filament (acrylonitrile butadiene styrene (ABS)) was fed through the heated nozzle. The quality of extruded polymer was tested by extruding the fiber preform through the heated structured nozzle without any additional drawing. The extrusion parameters including feeding speed and nozzle temperature were varied to explore their effect on the visual quality of the extruded fiber preform and achieve the optimal effective temperature experienced by the polymer optical fiber during drawing.n~250 \u00b0C was chosen to extruded ABS filament, close to the center of the recommended printing temperature range of 220\u2013270 \u00b0C. A filament feeding speed of s~50 mm/min was used for the first try. Air bubbles and a coarse surface were observed in the extruded preform, possibly caused by the high Tn. These bubbles were attributed to the expansion of air trapped in the filament due to high filament temperature inside the heated nozzle. These bubbles are extremely detrimental as they can result in a deformation of the thin layer and structure inside the fiber and cause the fiber to break during the drawing process. The filament feeding speed also affects the filament temperature: slow speeds result in high filament fictive temperatures, hence affecting the extruded polymer surface quality. The speed was then increased from s~50 mm/min to s~250 mm/min, and an extruded fiber preform with smooth surface was successfully achieved at feeding speed of s~250 mm/min. Surface roughness and defect formation in the extruded polymer optical fiber preform are strongly dependent on the fictive temperature. Nozzle temperature was varied from 230\u2013260 \u00b0C to observe the effect of temperature with surface quality of extruded fiber preform. When the nozzle temperature was set to Tn~240 \u00b0C, the smooth and shiny surface were observed and both surface roughness and bubble formation were significantly reduced compared with the other nozzle temperature. So, the temperature of Tn~240 \u00b0C and feeding speed of s~250 mm/min were selected as they provided the best quality of the extruded fiber preform. n~240 \u00b0C).An initial nozzle temperature Tn~240 \u00b0C and s~250 mm/min by using a built-in feeding motor and a heater head  drops to d~800 \u00b5m. To observe the cross-section of drawn fiber, SC-MPOF was cleaved by using a hot blade. A single-mode MPOF is out of interest for communication applications due to the relatively high attenuation of polymers in this wavelength range. However, single mode or few modes MPOFs can be exploited for sensing by inscribing gratings in their cores.Long period gratings (LPG) can be easily inscribed by physical imprinting with a periodic pitch of the order of 100 \u00b5m to 1 mm. The resonance wavelength associated with the coupling between forward propagating core mode and forward propagating cladding mode in the 500\u2013750 nm range can be achieved with grating periods of 1 mm . Within The polymer biocompatibility was exploited in 2011 to create LPG-based MPOFs for heart rate sensing . Due to MPOF sensors based on fiber Bragg gratings (FBGs) have also been proposed in single mode and small core multimode MPOF  made froThe advantage of MPOF FBGs and LPGs over their counterparts inscribed in silica fibers is that MPOFs have the largest response to all three stimuli considered, while polymers are biocompatible and extreme a very large ductility and resistance to catastrophic failure. The temperature response of MPOF FBGs and LPGs is 2.5 to 5 larger than that of gratings written silica-based fibers ,80. AlthIn 2011 a comparative study showed that the strain response of FBGs in MPOF is identical to that in step-index when PMMA was used . The fewOverall, the potential sensing applications of FBGs and LPGs in MPOF are still being investigated: the large measurable strains, humidity sensitivity, and biocompatibility of polymers can be significant advantages in future applications.SC-MOFs can be used in nonlinear optics for applications such as supercontinuum generation due to its small field diameter and ruggedness. The small core can also enhance the evanescent field of the propagating mode, thus SC-MOFs have also been developed for sensing applications, especially for gas and liquid detection ,7,10,87.SC-MPOF can be easily turned into liquid dipping sensor, due to the strong capillarity occurring into the fiber holes. This type of sensor operates by simply dipping one end of the SC-MPOF into a liquid sample . The capExcitation and fluorescence collection both in the forward and backward guided modes of filled SC-MOF has been studied : the bacThe use of polymer fibers in fluid sensing can be extremely beneficial because they provide a fast filling time. Since polymers are permeable to fluids, long lengths of fibers can be easily filled in short times without relying on capillarity or cladding drilling.Liquid sensors based on SC-MOF using the dipping technique can exploit core surface functionalization with labeling molecules to enhance selectivity and detection limit. There are two main structures of SC-MOF which have been used for biological and chemical sensing: the conventional SC-MOF relies on filling all air holes from one of the fiber ends a while tDetection of DNA and antibodies using a functionalized SC-MPOF was first demonstrated in 2006  using a The use of polymer fibers in this field can be extremely attractive because polymers can be easily linked with chemicals used for functionalization, thus do not require the silanization/activation process used to attach the organic molecules used for sensing to the optical fiber core surfaces.SC-MOFs based sensors can also be used for a number of physical parameters, such as strain, temperature, pressure, and vibrations.A Sagnac interferometer using a section of the SC-MOF as the sensor for temperature-independent strain measurement was presented in 2008 . The senIn 2016, multimode interference was also used in SC-MOF for high temperature sensing  up to 11While polymer materials used to manufacture SC-MPOF cannot work at high temperatures because of their intrinsic degradation issues, they exhibit large thermos-optic coefficients , large expansion coefficient (one order of magnitude larger) and small Young modulus , thus SC-MPOF sensors can potentially provide sensitivities significantly larger than those observed in sensors based on glass SC-MOF.In 2012, a micro-displacement measurement based on an SC-MOF Sagnac interferometer was presented . The SC-The use of SC-MPOF could provide a cheaper alternative to the SC-MOF and allow for a significantly larger dynamic range, as polymers typically experience fracture at an elongation one order of magnitude larger than that experienced by silica.A fiber-optic acoustic sensor based on SC-MOF was designed and experimentally demonstrated in 2018 . The SC-Because of the polymer small Young modulus, SC-MPOF can provide a better acoustic coupling and a larger response to vibrations than silica SC-MOF, thus could potentially give a significantly improved responsivity to acoustic stimuli.In the past 2 decade, the development in MPOFs are focused on fabrication techniques and their applications in sensing. Many techniques use to fabricate the MPOFs and their preforms have been reported. A direct drawing of SC-MOFs from a low-cost desktop 3D printer has been demonstrated. This provides the relatively low cost and higher in fabrication speed of current desktop 3D printers compared with a conventional drawing tower, this could become a precious device for the fabrication of microstructured polymer optical fibers. The final fiber cross-section reveals the possibility to maintain the microstructure inside the fiber after the drawing process. Although the fiber size is large compared with commercial optical fibers (\u00d8 ~125 \u03bcm), this demonstrates the potential for directly drawing the microstructured polymer optical fiber using a customized 3D printer head.Sensors based on SC-MOFs have been widely researched over the past ten years and include gas, chemical, biological refractometric, temperature, and vibration sensing. Chemical and biological sensing appear of particular interest due to presence of air holes in the structure. The use of polymers as material of choice for SC-MPOFs can provide significant advantages because of the enhanced permeability to gases, large elongation, large response to acoustic waves, and improved response to temperature. In these fields, future works include permeable fibers, plasmonic and terahertz applications.MPOFs fabricated from the direct extrusion technique using the 3D printer can provide a cost-effective solution, both in terms of polymer fiber preform and polymer optical fibers, compared to the alternative high-cost and lengthy multi-steps fiber fabrication methods. This breakthrough in manufacturing optical fibers has the potential to transform optical fiber fabrication, and allow emerging new applications, as well as the development of those already in existence, to move to the next generation of sensitivity and dynamic range. This development can be interesting not only in engineering, but also in medical applications, environmental sciences, and academia where the low-cost sensing devices with fast fabrication process are crucial."}
+{"text": "Frontotemporal dementia (FTD) is associated with complex changes in eating behavior and metabolism, which potentially affect disease pathogenesis and survival. It is currently not known if body composition changes and changes in fat deposition also exist in FTD, the relationship of these changes in eating behavior and appetite, and whether these changes are centrally mediated.Body composition was measured in 28 people with behavioral\u2010variant frontotemporal dementia (bvFTD), 16 with Alzheimer\u2019s disease (AD), and 19 healthy controls, using dual energy x\u2010ray absorptiometry. Changes in body composition were correlated to brain grey matter atrophy using voxel\u2010based morphometry on high\u2010resolution magnetic resonance imaging.P values\u00a0<\u00a00.05). Changes in body composition correlated to abnormal eating behavior and behavioral change (P\u00a0<\u00a00.01) and functional decline (P\u00a0<\u00a00.01). Changes in body composition also correlated to grey matter atrophy involving a distributed neural network that included the hippocampus, amygdala, nucleus accumbens, insula, cingulate, and cerebellum \u2013 structures known to be central to autonomic control \u2013 as well as the thalamus, putamen, accumbens, and caudate, which are involved in reward processing.Behavioral\u2010variant FTD was characterized by changes in body composition, with increased total fat mass, visceral adipose\u00a0tissue area (VAT area), and android: gynoid ratio compared to control and AD participants (all Changes in body composition and fat deposition extend the clinical phenomenology in bvFTD beyond cognition and behavior, with changes associated with changes in reward and autonomic processing suggesting that these deficits may be central in FTD The effects of neurodegenerative dementia syndromes extend beyond cognition and behavior to involve the body\u2019s key physiological systems including eating and metabolism, and the autonomic nervous system.The metabolic changes found in FTD reflect complex disturbances that go beyond those expected from an increased oral intake. Indeed, patients show a smaller increase in body mass index (BMI) than expected for oral intake and are found to be hypermetabolic, with increased resting energy expenditure.It is currently not known if changes in body composition including fat distribution also occur in FTD, and whether these changes are related to changes in eating behavior, or may represent a complex interaction between eating behaviour and the neurodegenerative process with central changes in the neural structures controlling reward and autonomic function also potentially playing a role.The current study aimed to determine changes in body composition and fat deposition in patients diagnosed with behavioral\u2010variant FTD (bvFTD) using dual\u00a0energy x\u2010ray absorptiometry (DEXA) scans.C9orf72, TDP43, FUS, GRN, and MAPT genes was examined in all FTD patients. Healthy controls were recruited from a volunteer database, scored above 88/100 on the ACE\u2010III, the control group was matched to the bvFTD group for BMI.Forty\u2010four patients with dementia  were recruited from Frontier, the FTD research clinic based at the Brain and Mind Centre, University of Sydney, Australia. These individuals were compared with 19 age\u2010 and sex\u2010matched healthy controls. All patients underwent neurological review, cognitive assessment, and met current clinical diagnostic criteria for probable bvFTD or Alzheimer\u2019s disease (AD).This study was approved by the South Eastern Sydney Local Health District and the University of New South Wales human ethics committees. Written informed consent was obtained from each participant and/or their primary caregiver.www.hologic.com). The Hologic whole\u2010body scanning dimension was 196\u00a0cm by 68\u00a0cm, which ensured adequate separation of the arms from the trunk in the whole\u2010body positioning.Participants completed a single whole\u2010body scan on a Hologic Horizon A (SN\u2010300616M)  was initially identified automatically followed by manual adjustment to ensure that the lateral edges of the VAT area were correctly defined. From the DEXA scan, key measures of total lean mass, total fat mass, percentile fat (age matched):amount of fat matched to a population of similar age, android: gynoid ratio: fat in android (trunk area) compared to gynoid area,\u00a0 and visceral adipose\u00a0tissue area (VAT area): fat deposited around visceral organs were obtained for each participant.Dual energy\u00a0x\u2010ray absorptiometry body scan data were analyzed with the QDR system software for Windows (XP) Hologic software APEX 5.6.0.5 (Hologic). Total mass (grams), lean mass (grams), fat mass (grams), and fat percent were calculated for the whole body and for individual regions of interest: the head, upper limbs, lower limbs, and trunk. Regions of interest were defined as follows: head\u00a0=\u00a0immediately below the mandible; trunk\u00a0=\u00a0enclosing the chest, midriff, and pelvis; the left and right upper limbs\u00a0=\u00a0medial to the head of the humerus; and left and right legs\u00a0=\u00a0boundary placed outside of the thigh through to the middle of both legs through the femoral neck and lateral to the pubic ramus. Visceral abdominal fat 2 in\u2010plane resolution, 1\u2010mm slice thickness, echo time/repetition time\u00a0=\u00a02.6/5.8\u00a0ms, flip angle\u00a0=\u00a08\u00b0. Brain scans were available for 14 AD patients, 26 bvFTD patients, and 19 healthy controls. MRI data were analyzed with FSL\u2010VBM, a voxel\u2010based morphometry analysishttp://www.fmrib.ox.ac.uk/fsl/fslvbm/index.html)Participants underwent whole\u2010brain magnetic resonance imaging (MRI) in a 3\u2010Tesla scanner (completed within 14\u00a0days on average to the DEXA scan). High\u2010resolution T1 images were obtained using the following protocol: 256\u00a0\u00d7\u00a0256, 200 slices, 1\u2010mmP\u00a0<\u00a00.005.Voxel\u2010wise general linear models were applied to identify differences in grey matter intensity through permutation\u2010based nonparametric testingP\u00a0<\u00a00.005, uncorrected for multiple comparisons, with a conservative cluster extent threshold of 100 voxels. This approach is designed to minimize Type I error while balancing the risk of Type II error.Next, correlations between BMI, android:\u00a0gynoid ratio, and VAT area, and regions of grey matter atrophy were investigated in each patient group separately . For additional statistical power, each patient group was analyzed with the control group and a covariate\u2010only statistical model with a [\u22121] t\u2010contrast was used, providing an index of association between grey matter atrophy and increases in the behavioral measure. Statistical significance was set at https://www.nitrc.org/projects/mricron), with maximum voxel coordinates provided in the stereotaxic space. Anatomic labels were determined with reference to the Harvard\u2010Oxford probabilistic cortical and subcortical atlases.Anatomical locations of significant results were overlaid on the MNI standard brain using the mricron software (P\u00a0\u2264\u00a00.05 regarded as significant). Measurements of body composition  were also explored using ANOVA, followed by Tukey post hoc tests (P\u00a0<\u00a00.05 regarded as significant). The relationship between changes in body composition, disease duration, BMI, eating behavior  cognitive status (ACE\u2010III), and behavioral measures  was further explored using Pearson rank correlations corrected for multiple comparisons (P\u00a0\u2264\u00a00.01 regarded as significant).Analyses were conducted using IBM SPSS statistics (version 24.0). Kolmogorov\u2013Smirnov tests were run to determine suitability of variables for parametric analyses. One\u2010way analyses of variance (ANOVA), followed by Tukey post hoc tests, were used to determine group differences in demographic and clinical variables. Categorical variables were analyzed using Chi\u2010squared analyses. Independent t\u2010tests were used to determine differences between bvFTD and AD for disease duration, abnormal behavior , and eating behavior  . Group differences were observed on measures of cognition (ACE\u2010III), behavioral measures, and eating behavior , CBI total , and CBI eating  scores.Based on caregiver surveys, bvFTD showed more severe eating disturbance than AD on the APEHQ (P\u00a0=\u00a00.001), but the difference in BMI between the control and bvFTD groups was not statistically significant. Measures of body composition showed the bvFTD group to have an increased total fat and lean mass and percentile fat age matched compared to both the control and AD groups  (Table P\u00a0=\u00a00.003) and control (P\u00a0=\u00a00.006) groups. Finally, the bvFTD group showed an increased VAT area compared to both the AD (P\u00a0=\u00a00.001) and control groups (P\u00a0=\u00a00.001), despite being matched to the control group for BMI.The bvFTD group had a higher BMI than the AD P\u00a0=\u00a00.00, but ther\u00a0=\u00a00.307, P\u00a0=\u00a00.01), CBI behavioral , total CBI eating score , and BMI . VAT area was positively correlated with CBI total , CBI behavioral , CBI eating , and negatively correlated with the FRS . Finally, BMI was positively correlated with CBI eating  and CBI behavioral , and negatively correlated with the FRS .When all groups were combined due to small sample sizes, android: gynoid ratio was positively correlated with behavioral and eating changes as reflected by the CBI total  area, shown by an increased android: gynoid ratio, and visceral adipose tissue area (VAT area). Increased fat deposition was correlated with increasing abnormal eating behavior and also overall behavioral change. Increasing visceral adipose tissue deposition and total fat mass also correlated with lower overall functional ability as measured by the FRS.Undoubtedly, the abnormal eating behavior previously shown in FTD\u00a0Another potential cause of changes in body composition in bvFTD may relate to autonomic dysfunction. The presence of autonomic dysfunction in FTD is increasingly recognized with reported changes in thermoregulation, pain sensation, and other symptoms related to autonomic dysfunction.The current study provides evidence that autonomic dysfunction may play a role in changes in body composition, potentially through distributed neural networks. Here, increasing VAT area and android: gynoid ratio in bvFTD correlated with decreasing grey matter volume in a distributed network central to autonomic function including the temporal pole, hippocampus, amygdala, insula and anterior cingulate cortex, parietal regions, and precuneus.Neural network changes were not only limited to structures involved in autonomic control, but also extended to structures involved in reward evaluation including the insula, caudate, putamen, nucleus accumbens, and thalamus.The distributed neural networks relevant to body composition identified here align with previous work indicating that metabolic and eating changes in FTD involve an interaction between autonomic and reward processing. We have previously shown that increased food intake in FTD during a test meal correlated with changes in the cingulate cortices, thalami, and cerebellum, structures controlling cognitive\u2010reward, autonomic, neuroendocrine, and visual modulation of eating behavior.The neural correlate changes in BMI were less extensive than those shown for body composition with changes limited to structures involved in autonomic control including the anterior cingulate cortex, temporal pole, insula, and parietal regions in bvFTD and in the pre\u2010 and postcentral gyrus and central opercular cortex in AD, which have been proposed to be connected to the insula.Further studies are required to ascertain when changes in body composition occur in FTD, their progression over time, and effect on overall survival. Indeed, we need to ascertain whether these changes are the result of increased caloric intake or related to the intake of certain nutrients , and the potential neuroendocrine effects related to changes in body composition . Studies are required in both human and animal models to examine the interactions between intake, metabolic rate, neuroendocrine changes, and effect on underlying pathology and disease progression. Whether neuroendocrine changes are also related to sex particularly involving the hypothalamus and its interactions between the pituitary and gynoid axis, and how these could modulate changes in body composition will also deserve attention. Studies will also need to consider the interactions between environmental factors (such as diet), genetic factors, and metabolic changes, and the effect that these factors have on underlying cell processing including oxidative stress and inflammation, and their resulting effects on the neurodegenerative process.The current study has demonstrated that the clinical phenomenology in bvFTD is not limited to cognitive and behavioral changes. Our findings demonstrate the presence of systemic changes including changes in body composition and fat deposition, that potentially provide insights into the interaction between autonomic and reward processing that are emerging as core deficits in FTD. Changes in body composition may provide potential markers of underlying network dysfunction, that could be harnessed to monitor disease progression and used in clinical trials to monitor and modify, in order to slow the course of these devastating conditions.Rebekah Ahmed: study concept, data analyses, manuscript preparation, and writing. Ramon Landin\u2010Romero: data analyses, manuscript preparation, and writing. Cheng Liang: data analyses, manuscript preparation, and writing. Julia Keogh: data analyses, manuscript preparation, and writing. Elana Henning: data analyses, manuscript preparation, and writing. Cherie Strikwerda\u2010Brown: data analyses, manuscript preparation, and writing. Emma Devenney: data analyses, manuscript preparation, and writing. Matthew C Kiernan: data analyses, manuscript preparation, and writing. John Hodges: data analyses, manuscript preparation, and writing. Sadaf Farooqi: study concept, data analyses, manuscript preparation, and writing. Olivier Piguet: data analyses, manuscript preparation, and writing.The authors declare no competing financial interests. Rebekah Ahmed, Ramon Landin\u2010Romero, Cheng Liang, Julia Keogh, Elana Henning, Cherie Strikwerda\u2010Brown, Emma Devenney, Matthew C Kiernan, John Hodges, I. Sadaf Farooqi and Olivier Piguet have no disclosures.Figure S1. Patterns of atrophy within and between patient groups. Group results from voxel\u2010based morphometry analyses illustrating areas of greater decreased grey matter density in (A) bvFTD patients compared to controls in blue, and (B) AD patients compared to controls in red. (C) Comparisons between patient groups illustrate greater reduction in grey matter intensity in bvFTD patients in blue, and in AD patients in red. All analyses are reported at P\u00a0<\u00a00.005 voxel\u2010wise, uncorrected for multiple comparisons with minimum cluster size of 100 voxels. The left side of the image is the left side of the brain. Numbers below each slice refer to MNI z\u2010coordinates.Click here for additional data file.Table S1. Behavioral\u2010variant FTD patients showed widespread atrophy in frontal and anterior\u2010temporal regions compared to controls, while AD patients showed widespread atrophy in temporal and posterior regions compared to controls. Comparisons between patient groups revealed reduced grey matter density in bvFTD in bilateral orbitofrontal cortex, frontal pole, and cerebellum, while AD showed reduced grey matter density in bilateral posterior cingulate cortex and temporo\u2010parietal junction.Click here for additional data file."}
+{"text": "A physical mixture was also prepared. Physicochemical characterization was performed with various methods. Ex vivo porcine corneal permeation of polymeric micelle, physical mixture, and commercial product were compared. FML solid dispersion (1:15) showed the highest solubility, which was c.a. 169.6- and 15.3-fold higher than that of pure FML and physical mixture. Characterization showed that the crystalline form of FML changed to amorphous state and polymeric micelles were formed in round micelle. Flucon\u00ae, a commercial product of FML, showed significantly large particle size and high poly dispersity index. In contrast, FML polymeric micelle showed submicron size with uniform size distribution. Ex vivo porcine corneal permeation study showed that permeation by polymeric micelles was significantly higher than that by the commercial product and physical mixture. In addition, confocal laser scanning microscopic analysis supported the enhanced porcine corneal tissue permeation property of polymeric micelle. In conclusion, polymeric micelle prepared with solid dispersion using Soluplus\u00ae can be a potential nanomedicine for ocular delivery of poorly water-soluble FML.Low aqueous solubility of drug causes difficulties in preparation and inconvenience of administration. Polymeric micelles of fluorometholone (FML) using solid dispersion technique were prepared to develop an eye drop formulation with enhanced water solubility. Solid dispersions of FML were prepared at various FML:Soluplus The most common technique of applying drugs to the eyes is to directly apply the ocular formulation on the surface of the eye. Eye drops are the common form of formulation for anterior segment disorders; however, they are easily washed away by tears within 0.5\u20131 min after application . In addi\u00ae, Alcon Laboratories Pty. Ltd., Fort Worth, TX, USA). FML in suspension shows low bioavailability of around 1% and causes difficulty in delivering the accurate dose, leading to inconvenience in administering the suspension to the eye [Fluorometholone (FML) is a corticosteroid drug that is commonly used for inflammatory diseases and dry eye syndrome ,6. The p the eye . Therefo the eye .Various ocular drug delivery systems have been studied to improve low bioavailability caused by the unique structure of eye and to increase the solubility of poorly water-soluble drugs  10,11,1,111,12. dl-Lactic acid) (PLA) and poly(dl-lactic-co-glycolic acid) (PLGA) polymer were studied [Cyclodextrin derivatives such as hydroxypropyl \u03b2-cyclodextrin and sulphobutylether \u03b2-cyclodextrin complex were used to solubilize FML ,17 and F studied . Neverth\u00ae is triblock-copolymer of polyvinyl caprolactam, polyvinyl acetate, and polyethylene glycol. It has average molecular weight of 118,000 g/mol [\u00ae can enhance the water solubility of various biopharmaceutical classification system (BCS) class II and IV group drugs [\u00ae was added to the oral drug delivery system of poorly water-soluble drug dutasteride to increase physicochemical stability and bioavailability [\u00ae tablet showed improved solubility, AUC, and Cmax [\u00ae improved AUC and Cmax of BCS class II drugs such as danazol and fenofibrate [Soluplus00 g/mol . It is a00 g/mol . The hyd00 g/mol . In addi00 g/mol ,22. Throup drugs . Soluplulability . Itraconand Cmax . Moreoveofibrate .\u00ae. The polymeric micelles encapsulating \u03b1-lipoic acid showed improved corneal permeability through increased solubility of drug [\u00ae incorporating FML was fabricated, and the physicochemical characteristics and permeation enhancing effect were evaluated to prove the feasibility of FML/Soluplus\u00ae as an eye drop formulation.To date, few attempts have been made to increase the water solubility of poorly water-soluble drugs using Soluplus of drug . Also cu of drug . In this\u00ae was purchased from BASF SE . Coumarin-6 was purchased from Sigma-Aldrich . All other chemicals and solvents were of reagent grade.FML was purchased from Wako pure chemical industries Ltd. . Soluplus\u00aew/w ratios . FML and Soluplus\u00ae were added to a round flask, followed by the addition of a minimum volume of ethanol. Then, the mixture was shaken in a water bath at 30 \u00b0C for 30 min to solubilize FML and Soluplus\u00ae. Ethanol was removed by evaporation using rotary evaporator to make a solid dispersion film. Finally, the film was dispersed in phosphate-buffered saline (PBS) to prepare polymeric micelles in aqueous solution. In addition, a physical mixture was prepared with mortar and pestle at a 1:10 ratio.The solid dispersions were prepared by solvent evaporation method at various FML:Soluplus\u00ae 1260 infinity LC system. The reverse phase column was Gemini\u00ae 5 \u03bcm NX-C18 110 \u00c5, LC Column 250 \u00d7 4.6 mm . The mobile phase comprised 70% methanol and 30% distilled water. The flow rate was 0.5 mL/min, and the detection wavelength was set at 280 nm. The temperature of column was maintained at 25 \u00b0C.FML was analyzed by HPLC with a UV detector. HPLC analysis was performed using Agilent\u00ae, three different ratios of solid dispersion formulations , physical mixture, and the commercial product of FML suspension  was prepared for particle size measurement. The particle size was measured using a dynamic light scattering spectrophotometer . Samples were diluted in PBS with care to avoid dilution below the critical micelle concentration (CMC) of Soluplus\u00ae.An aqueous solution of Soluplus\u00ae Ultra centrifugal filters 0.5 mL\u20133 K, Millipore, Burlington, MA, USA). Free FML was separated with centrifugal force of 8000\u00d7 g for 10 min. Then the amount of free FML was quantified by established HPLC method. The encapsulation efficiency was calculated using the following equation, where freeW is the amount of free FML and totalW is the added amount of FML.The encapsulation efficiency was evaluated according to centrifugation ultrafiltration method . Briefly\u00ae, solid dispersions, and physical mixture was performed using DSC 4000 differential scanning calorimeter . Ten milligrams of samples were used for DSC. Temperature scans were performed in the temperature range 25\u2013350 \u00b0C at a heating rate of 10 \u00b0C/min, under a nitrogen purge gas flow of 20 mL/min.Thermal analysis of FML, SoluplusPowder X-ray diffraction (PXRD) analysis was performed using Rigaku D/Max-2500 . The scanning angle ranged from 3 to 45\u00b0 at the rate of 0.05\u00b0/s. \u22121 to 400 cm\u22121, with a resolution of 4 cm\u22121.Fourier transform infrared (FT-IR) spectra were obtained using Nicolet iS10 FT-IR Spectrometer . The spectra of samples were scanned over a frequency range of 4000 cmTransmission electron microscopy (TEM) imaging was performed to characterize polymeric micelles using H-7600 transmission electron microscope , with an accelerating voltage of 100 kV. The samples were stained with 2% phosphotungstic acid, placed on a copper grid, and exposed under infrared lamp for 10 min.\u00ae were added to round flasks with 10 mL PBS. Then, sealed round flasks and commercial product were placed in a water bath and shaken at 37 \u00b0C for 48 h. Each formulations were filtered through a 0.45-\u03bcm nylon membrane filter, and FML dissolved in the filtered solutions was quantified by HPLC.The solubility of FML was measured according to Higuchi and Connors\u2019 method . The purPorcine eyes were obtained from a local slaughterhouse, and the eyeballs were immediately collected after the pigs were sacrificed. The eyeballs were transported in cold PBS solution. Only the eyeballs that were transparent and had undamaged cornea were selected. Then, the corneal tissues were removed with scalpels and scissors, washed with PBS, and stored in normal saline at 4 \u00b0C until permeation study. 2. The receptor chamber was filled with PBS (pH 7.4), and the receptor medium was stirred at 600 rpm. Porcine corneal tissues were carefully placed on a Franz-diffusion cell, and 300 \u03bcL of each formulation  was applied to the donor chamber. All formulations contained 0.1 w/v % of FML. Franz diffusion cell was maintained at 37 \u00b0C with a thermostat. A 0.5-mL sample was taken every hour from the receptor chamber for 5 h and immediately replenished with an equal volume of PBS. The permeability of the drug in each formulation was evaluated by plotting the cumulative permeated amount of FML per unit area (\u03bcg/cm2) over time (h). The steady-state flux (sJ) across the porcine corneal tissue was calculated from the slope of linear portion of the cumulative permeation graph using the following equation:Qt = quantity of fluorometholone crossing membrane (in \u03bcg), A = effective diameter (cm2) and t = time of exposure (in h). After 5 h, the part of the corneal tissue in contact with the formulation was separated. The separated corneal tissues were minced, placed in a conical tube with 1 mL of methanol, and stirred overnight to extract the deposited FML. The samples were centrifuged the next day, and the supernatant containing FML was collected. All samples were diluted appropriately with methanol and analyzed by HPLC. Each experiment was repeated in triplicate.Ex vivo permeation study using porcine corneal tissue was performed with Franz-diffusion cell having an effective diffusion area of 0.672 cm6) as a fluorescent probe to evaluate the permeation enhancing effect of polymeric micelle. C6 is a fluorescent probe and suitable as a model of poorly water-soluble drug, because it precipitates in water and forms a microcrystal resulting in significant loss of fluorescence intensity; however, it emits fluorescence when solubilized [6 was dispersed in PBS at a concentration of 50 \u03bcg/mL to prepare an aqueous solution. Polymeric micelles containing C6 were prepared by same method as described above, where the concentration of C6 was same as the concentration of FML in the 1:15 formulation.Ex vivo permeation study was performed using coumarin-6  and frozen in liquid nitrogen. The block was cut into 10-\u03bcm thick sections using a cryostat  and mounted onto slides and cover slipped.6 through the porcine corneal tissue. C6 in porcine corneal tissues was observed at excitation and emission wavelengths of 488 and 505 nm, respectively.Confocal laser scanning microscopy  was used to image the permeation of C\u00ae and solid dispersions were homogeneously dispersed and had smaller particle size than the commercial product (CP) and physical mixture (PM). The particle size increased after encapsulation of FML. As the proportion of Soluplus\u00ae increased, the particle size decreased slightly. The particle size of physical mixture ranged between that of solid dispersion and commercial product, and this may be because of the limited solubilization effect of physical mixture. Poly dispersity index (PDI) can be a criterion for even particle size distribution. PDI less than 0.1 indicates good uniformity, while values greater than 0.3 indicate irregular particle size distribution. Based on our PDI measurements, we assumed that the polymeric micelle formulations prepared by solid dispersion method had an appropriate size distribution with physical stability. Nearly all FML was encapsulated into polymeric micelles in all SD groups. On the other hand only a small amount of FML was encapsulated in the PM groups.The particle size of commercial product was much larger than that of other formulations and showed relatively large deviation . In cont\u00ae showed a weak broad endothermic peak at 69.8 \u00b0C, corresponding to the glass transition of Soluplus\u00ae [. The other peak at 314 \u00b0C may be attributed to the decomposition of the polymer. The thermal profile of solid dispersions showed no characteristic endothermic peak of FML. This might be due to the phase transformation of FML from a crystalline form to an amorphous form or the dissolution of FML into Soluplus\u00ae [DSC analysis was performed to observe the phase transformation of FML during solid dispersion preparation. As shown in oluplus\u00ae . The otholuplus\u00ae . Therefo\u00ae, and solid dispersions. As shown in \u00ae. A weak peak was found at approximately 15\u00b0 for the physical mixture and solid dispersions at 1:7 and 1:10 ratios, but a sharper peak was observed for the physical mixture than for the solid dispersions. However, no peak was observed for the 1:15 formulation. These findings indicate that free FML was changed from crystalline form to amorphous form in solid dispersion, as indicated in the thermograms.To evaluate the physical characteristics of the solid dispersion formulation further, PXRD analysis was performed on FML, Soluplus\u00ae acts as a solid matrix to form a solid dispersion with FML during its transformation from crystalline form to amorphous form. Owing to the low lattice energy of amorphous form of FML in solid dispersion, the solubility can be increased [As shown in the DSC thermograms, FML has a high melting point of around 288 \u00b0C, indicating its strong crystal lattice energy. Because of this feature, FML dissolution requires large energy and has poor water solubility . The aboncreased .\u00ae in solid dispersion. As shown in \u22121 corresponding to C\u2013H bending and C=O stretching, respectively. Soluplus\u00ae showed peaks at 1628.54 cm\u22121 and 1730.98 cm\u22121 corresponding to two different C=O stretching. The IR spectrum of the physical mixture showed characteristic sharp peaks of FML, indicating that the crystalline form was still present. However, the characteristic peaks of FML and new peaks were not shown in the spectrum of solid dispersions. These results indicate that no significant interactions occurred during the preparation of solid dispersion [FT-IR analysis was performed to investigate the possible interactions between FML and Soluplusspersion .TEM imaging was performed to observe the morphology of FML solid dispersion within PBS. As shown in The solubility of pure FML, physical mixture, and solid dispersions was evaluated. Pure FML showed poor intrinsic solubility (8.92 \u00b1 0.01 \u03bcg/mL). The solubility of FML from physical mixture and solid dispersions was much higher than that of pure FML. Solid dispersions showed approximately 169.6-fold higher solubility than pure FML. In addition, the solubility of solid dispersions of 1:7, 1:10, and 1:15 formulations was approximately 11.4-, 12.9-, and 15.3-fold higher than that of physical mixture, respectively .sJ values of FML from 1:7, 1:10 and 1:15 formulations were 3.82 \u00b1 0.47, 3.02 \u00b1 0.47 and 3.51 \u00b1 0.30, respectively. There was no statistically significant difference in sJ between SD groups. The accumulated amount of FML from 1:7, 1:10, and 1:15 formulations in porcine corneal tissue after 5 h was 34.89 \u00b1 2.08, 28.89 \u00b1 4.31, and 28.68 \u00b1 0.98 \u03bcg/g, respectively  and aqueous solution of C6 (C6AS), C6 in porcine corneal tissues was observed at various time points , which is equal to that of commercial suspension product. Suspension is defined as a state in which small insoluble solid drug particles are dispersed in an aqueous solution, and it generally has an opaque appearance. The schematic representation of the main concepts of this study is shown in To date, various methods have been used to solubilize FML; however, no method capable of sufficiently dissolving FML has been developed. Malaekeh-Nikouei et al used cyclodextrin derivatives to solubilize FML. In their study, the solubility of FML by 5% \u03b2-CD, 5% \u03b3-CD, 5% HP-\u03b2-CD, and 5% HP-\u03b3-CD was approximately 0.5 mg/mL. The maximum solubility of FML (1.16 \u00b1 0.04 mg/mL) was achieved by 5% SBE-\u03b2-CD. Considering that the measured intrinsic water solubility of FML was only 8.92 \u00b1 0.01 \u03bcg/mL, the 1:15 polymer micelle system showed a solubility of 1.51 \u00b1 0.11 mg/mL. Moreover, the solubility increased approximately 169.6-fold compared with that by raw materials, and it was 1.3-fold higher than that by pure SBE-\u03b2-CD .The polymeric micelle systems in the present study were transparent because of complete dissolution of FML. As can be seen from Particle size measurement showed that the commercial product had a much larger particle size and uneven distribution than the polymeric micelles. This indicates that FML within the commercial product is not homogeneously dispersed or dissolved in aqueous solution. Therefore, the commercial product has difficulty in controlling the dose accurately. In addition, large particles can cause adverse effects such as eye irritation, blurred vision, and redness. In contrast, polymeric micelles showed uniform size distribution with small particle size and were transparent because of sufficient dissolution of FML. Thus, FML-loaded polymeric micelle can be a potential strategy to improve the adverse effects of FML suspension.\u00ae. The solubility of the drug was enhanced because the amorphous form has lower lattice energy than the crystalline form [The physicochemical characteristics were determined by DSC, PXRD, and FT-IR spectroscopy. The results showed that FML was in crystalline form in commercial product and physical mixture. However, the crystalline form of FML was converted to amorphous form in solid dispersion, with no significant chemical interactions between FML and Soluplusine form ,37.\u00ae increased, the amount of drug encapsulated in the micelle or matrix increased. In the physical mixture, Soluplus\u00ae increased the solubility of FML slightly. In contrast, Soluplus\u00ae increased solubility not only by offering matrix for solid dispersion, but also by forming polymeric micelle spontaneously [The solubility enhancing effect of solid dispersions was evaluated by solubility test. As the amount of Soluplusaneously . The syn6 permeation study. C6 incorporated in polymeric micelle showed higher permeation in the porcine corneal tissue than aqueous solution. This is because as the drug dissolves at higher concentrations, polymeric micelle can increase the permeability of the drug by creating a higher concentration gradient for the barrier [\u00ae is possible mechanism for permeation enhancement. Soluplus\u00ae change from liquid to weak gel phase temperature dependently on the ocular surface. Thus, the residence time of drug can be increased, which has a beneficial effect on enhanced corneal permeation of FML [The corneal permeation of FML was evaluated by ex vivo permeation study. FML in commercial product and physical mixture did not pass through the porcine corneal tissue for 5 h, and a small amount was accumulated in corneal tissue. However, in the solid dispersions, FML permeated porcine corneal tissues after a lag time of 2 h. The accumulated amount of FML by 1:7, 1:10, and 1:15 formulations in the corneal tissue was 22.4-, 18.5-, and 18.4-fold higher than that by the commercial product, respectively. Less than 1% of FML was accumulated in the corneal tissue from the commercial product and physical mixture. However, in the case of solid dispersions, approximately 3% of loaded FML permeated the corneal tissue and around 10% was accumulated in the corneal tissue. The permeation enhancing effect of polymeric micelle was also observed in C barrier . Also thn of FML .\u00ae for the preparation of an eye drop formulation of FML with enhanced water solubility, transparency, and physical stability. Through various characterization studies, it was confirmed that FML was converted from crystalline form to amorphous form in solid dispersion, and its solubility was increased by this mechanism. In addition, polymeric micelle formation resulted in small and uniform particles, and showed high porcine corneal tissue permeation property. Thus, polymeric micelle formulation method employing solid dispersion technique can be a promising strategy to overcome side effects and problems, such as eye irritation and difficulty in precise dosage control in conventional suspension formulations. It is also expected to improve the compliance of patients by lowering the dose and frequency of the drug by improving bioavailability. In conclusion, solubilization with Soluplus\u00ae can be a good alternative to conventional eye drops.This is the first report on the use of Soluplus"}
+{"text": "Pseudomonas aeruginosa secretes PE38KDEL, an exotoxin derivative, as a suicide gene used in gene therapy. A SERPINB3 promoter\u2010mediated PE38KDEL expression vector was created. The SERPINB3 gene expression was tested in different cell lines by RT\u2010qPCR and Western blotting, and the SERPINB3 promoter activity was detected by luciferase assay. The SERPINB3 promoter was more active in the TCA8113 cell line than in the other cell lines. The target therapeutic potential of the toxin vector pSERPINB3\u2010PE38KDEL was tested in the SERPINB3\u2010positive TCA8113 cell line, the SERPINB3\u2010negative MG63 cell line, and normal L02 cell line. The SERPINB3 gene was expressed at a high level in TCA8113 cells but a low level in MG63 and L02 cells. Transfection of the pSERPINB3\u2010PE38KDEL plasmid effectively inhibited the proliferation and invasion of TCA8113 cells and induced cell apoptosis, but no significant damage to MG63 and L02 cells was observed. The results of in vitro experiments indicated that the pSERPINB3\u2010PE38KDEL plasmid could be a promising strategy for targeted OSCC gene therapy.Oral squamous cell carcinoma (OSCC) has a poor prognosis and a high risk of recurrence. To improve the efficacy of OSCC therapy, it is of great significance to explore gene therapy for OSCC. The use of specific genes to regulate the targeted expression of suicide genes is a hot topic in gene therapy for cancer. The SERPINB3 gene is highly active in squamous cell carcinoma, but nearly undetectable or present at a low level in normal tissues. This specificity suggests that the SERPINB3 promoter can be used for targeted OSCC therapy.  A SERPINB3 promoter\u2010mediated PE38KDEL expression new vector was created. The SERPINB3 promoter was more active in the TCA8113 cell line (tongue squamous cell carcinoma) than in the other cell lines. The results of in vitro experiments indicated that the pSERPINB3\u2010PE38KDEL plasmid could be a promising strategy for targeted OSCC gene therapy. The specificity and targeted inhibition of the plasmid in the treatment of OSCC were studied by using molecular biological techniques in vitro.22.12. These cell lines were provided by Prof. Wei Shi .This study used the TCA8113 (tongue squamous cell carcinoma), MG63 (osteosarcoma), Eca\u2010109 , HeLa , MCF\u20107 (breast cancer) human cancer cell lines, and the L02  normal cell line. The cells were cultured in Dulbecco's modified Eagle's Medium (DMEM) containing 10% fetal bovine serum (FBS) (GibcoBRL), 100\u00a0U/mL penicillin, and 100\u00a0\u00b5g/mL streptomycin at 37\u00b0C in a humidified atmosphere containing 5% CO2.22.2.1Total proteins were extracted using a Mammalian Total Protein Extraction kit (Trans) according to the manufacture's introduction, and protein concentrations were determined with the BCA method. The proteins were separated by 12.5% SDS\u2010PAGE and transferred to PVDF membranes. Then, the transblotted membranes were blocked for 2\u00a0hours at room temperature and probed with the corresponding primary antibody overnight at 4\u00b0C. After three washes, the membranes were incubated with secondary antibody for 1\u00a0hour. Following another three washes, ELC Western Blotting Detection reagents (Trans) and an automatic chemiluminescence image analysis system (Tanon) were used for chemiluminescence detection. This assay was performed in triplicate.2.2.2\u2212\u0394\u0394Ct). All samples were assessed in triplicate.Total RNA was isolated from cells according to the instructions of a TaKaRa Mini BEST Universal RNA Extraction Kit, and the primer sequences used were as follows: sense: 5'\u2010GGTTACAGAGGAGGGAGCAGAA\u20103' and antisense: 5'\u2010GGGTGATTACAATGGAACTCTTCA\u20103'. The amplification was monitored on an ABI Prism 7500 real\u2010time PCR apparatus (Applied Biosystems) using SYBR Green detection chemistry (TaKaRa). The cycling conditions were as follows: 95\u00b0C for 30\u00a0seconds followed by 40 cycles of 95\u00b0C for 5\u00a0seconds and 60\u00b0C for 34\u00a0seconds. Analysis of the relative fold change in gene expression was performed with the comparative cycle threshold method . The promoter was amplified by DNA polymerase chain reaction (sense: 5\u2032\u2010CCTAGCTAGCGATTAAATGGCCTTGGACAACAACC\u20103\u2032 and antisense: 5\u2032\u2010CATGCCATGGTGGCGGTGAACTCGATGTGATCTGGAACTCC\u20103\u2032) and subcloned into NheI and NcoI sites of the pGL3\u2010Basic vector. The Luciferase gene from the pSERPINB3\u2010Basic vector was replaced with the PE38KDEL gene to generate the pSERPINB3\u2010PE38KDEL plasmid. These plasmids were transformed into 2.45\u20102.0\u00a0\u00d7\u00a0105 cells per well were seeded on 6\u2010well plates. After 24\u00a0hours, the cells were prepared for transfection. PEI (C202H505N101) transfection reagent was added to 2\u00a0\u00b5g of the DNA construct and incubated for 30\u00a0minutes in 0.5\u00a0mL of serum\u2010free medium. Following incubation, the DNA\u2010polycation mixture was added to every well. After 4\u00a0hours, the transfected cells were fed 2\u00a0mL of growth medium containing 10% FBS.Approximately 1.5\u00a0\u00d7\u00a0102.55 cells per well and incubated at 37\u00b0C for 16\u00a0hours before transfection. Then, the cells were transfected with different plasmids (pGL3\u2010Basic or pSERPINB3\u2010Basic), and cells transfected with only PEI served as the control. After 48\u00a0hours of transfection, the luciferase activity was determined using a Luciferase Assay Kit (Promega). After normalization of the protein content, the expression and activity of luciferase in each group was determined and indirectly reflected the activity of the SERPINB3 promoter in the different cell lines.The TCA8113, MG63, Eca\u2010109, HeLa, MCF\u20107, and L02 cell lines were seed in 6\u2010well plates at a density of 2.0\u00a0\u00d7\u00a0102.6To account for differences in the experimental results due to differences in transfection efficiency and experimental errors, the TCA8113, MG63, Eca\u2010109, HeLa, MCF\u20107, and L02 cell lines were cotransfected with different amounts  of the indicated plasmids  and 2\u00a0\u00b5g of the pGL3\u2010Control plasmid (containing the SV40 promoter and luciferase cDNA). Cells transfected with the pGL3\u2010Basic plasmid served as a negative control group, those transfected with the pcDNA\u2010PE38KDEL plasmid served as a positive control group, and those transfected with the pSERPINB3\u2010PE38KDEL plasmid served as an experimental group. After 48\u00a0hours of cotransfection, the cells were harvested, and the luciferase activity was detected as described above. Because a reduction in luciferase activity can reflect protein synthesis inhibition due to the plasmid, luciferase activity was used to measure the toxicity of the plasmid. This assay was performed in triplicate.2.75 cells per well, incubated at 37\u00b0C for 16\u00a0hours, and then subjected to plasmids transfection. For the cell cycle arrest assay, the cells were cultured with serum\u2010free medium for 48\u00a0hours to deplete the retained growth factors and synchronize the cell cycle before transfection. After 48\u00a0hours of transfection, the cells were harvested, and cell apoptosis and cell cycle arrest were detected by flow cytometry. For the cell apoptosis assay, an annexin\u2010V\u2010fluorescein isothiocyanate (FITC) and propidium iodide (PI) apoptosis detection kit (Best Bio) was used, while for the cell cycle arrest assay, a PI cycle detection kit (Best Bio) was used. These assays were conducted in triplicate.The TCA8113, MG63, and L02 cell lines were transfected with different plasmids (pGL3\u2010Basic or pSERPINB3\u2010PE38KDEL). The cells were seeded in 6\u2010well plates at density of 2.0\u00a0\u00d7\u00a0102.8The cells were cultured and transfected as described above. Afterward, the cells were collected after plasmid transfection and evaluated using a TUNEL cell apoptosis assay kit  to examine early apoptotic changes by fluorescence microscope as previously established. Because normal or proliferating cells have little DNA breakage and 3'\u2010OH formation, they are rarely stained. Cells with broken DNA appear brown\u2010yellow under a fluorescence microscope.2.94 transfected cells were seeded in the upper chamber with 100\u00a0\u00b5L of serum\u2010free DMEM and 700\u00a0\u00b5L of culture medium containing 10% FBS was added to the lower chamber. After 24\u00a0hours, cells that invaded the gel matrix were fixed with absolute methanol for 10\u00a0minutes, stained with crystal violet, and photographed under a microscope.Cell invasion assays was conducted using a 24\u2010well Transwell chamber of with 8\u00a0\u00b5m pores (Corning). First, Matrigel was diluted at a ratio of 1:8 and used to coat the upper surface of the bottom membrane of the Transwell chamber. The chamber was incubated at 37\u00b0C for 30\u00a0minutes, the Matrigel was polymerized into a gel, and the basement membrane was hydrated before use. The TCA8113 and MG63 cell lines were cultured and transfected as above. After 24\u00a0hours of transfection, 4\u00a0\u00d7\u00a0102.10P values <.05 were considered significant. Unless indicated, the results shown in the figures were representative. All the experiments were performed at least three times.Statistical analyses were performed using GraphPad Prism 5.0. All data were expressed as the mean\u00a0\u00b1\u00a0SEM. Differences with 33.1According to previous reports, the SERPINB3 gene is expressed in mainly squamous cells, and its expression is closely related to cellular differentiation in both normal and malignant squamous cells.3.2E\u00a0coli DH5\u03b1 cells, and the plasmids were then digested with NheI, NcoI, and XbaI restriction endonucleases (NEB). As shown in Figure The pSERPINB3\u2010Basic and pSERPINB3\u2010PE38KDEL plasmids were constructed and transformed into 3.3The pSERPINB3\u2010Basic plasmid was transfected into the TCA8113, MG63, Eca\u2010109, HeLa, MCF\u20107, and L02 cell lines. After 48\u00a0hours of transfection, luciferase expressions were detected and then normalized according to the protein content in different cell lines. Figure 3.4The PE38KDEL toxin gene can inactive the eukaryotic elongation factor 2 and inhibit cellular protein synthesis. Therefore, a reduction in luciferase activity can be used to reflect the inhibition of protein synthesis by the pSERPINB3\u2010PE38KDEL plasmid. After 48\u00a0hours of cotransfection, curves showing relative luciferase expression were obtained by comparing the luciferase expression in cell lines cotransfected with different amounts of the indicated plasmids with luciferase expression in cell lines cotransfected with pGL3\u2010Control alone  of approximately 66\u00a0000; PE is composed of 613 amino acids arranged in the following order from the N\u2010terminus to the C\u2010terminus: Ia, Ib, II, and III.The research prospect of suicide gene therapy, in which tumor cells are continuously and effectively inhibited, has attracted much attention.We used the specific regulation effect of the SERPINB3 gene on the PE38KDEL bacterial toxin, which plays a targeted toxic role in the TCA8113 cell line, to achieve gene targeting in the treatment of tongue squamous cell carcinoma. The limitation of our study was to select only one type of oral squamous cell cancer cell line. In consideration of this problem, we take advantage of the specific expression of the SERPINB3 gene in squamous cell carcinoma, and the rest of our team will continue to study the specificity and targeted inhibition of the pSERPINB3\u2010PE38KDEL plasmid in the normal oral mucosal epithelial cell lines and other OSCC cell lines. Moreover, future in vivo experiments are needed to further verify the drug toxicity and targeting of the pSERPINB3\u2010PE38KDEL plasmid and provide a strong theoretical basis for the clinical application of the pSERPINB3\u2010PE38KDEL plasmid in the targeted treatment of OSCC.Nonspecific bacterial toxin genes can act as target toxins with the help of cancer\u2010specific genes to achieve gene therapy in cancer. Therefore, the development of this kind of gene drugs could be widely used in targeted cancer therapy. At present, our team also study the targeted inhibitory effect of PE38KDEL toxin regulated by the specific expression of the CEACAM6 gene in cancer.5This study utilized the specific expression of the SERPINB3 gene in squamous cell carcinoma and constructed the pSERPINB3\u2010PE38KDEL toxin plasmid with a SERPINB3 gene fragment used as a promoter by recombinant DNA technology. In this study, we used in vitro experiments to prove the targeted inhibitory effect of PE38KDEL toxin regulated by the SERPINB3 gene on OSCC."}
+{"text": "We place the Landau theory of critical phenomena into the larger context of multiscale thermodynamics. The thermodynamic potentials, with which the Landau theory begins, arise as Lyapunov like functions in the investigation of the relations among different levels of description. By seeing the renormalization-group approach to critical phenomena as inseparability of levels in the critical point, we can adopt the renormalization-group viewpoint into the Landau theory and by doing it bring its predictions closer to results of experimental observations. The first level is the equilibrium level with the number of moles N and the energy E (both per unit volume), serving as state variables. The second level is an upper level with the variable x serving as the state variable. For example, x could be temperature and chemical potential together with an order parameter  or it could also be one particle distribution function or other state variables used in mesoscopic theories of macroscopic systems. Equilibrium thermodynamics enters the 2-level formulation in the upper reducing thermodynamic relation  Landau has noted that in the critical region all three potentials The universality of the upper reducing thermodynamic relation in the critical region is based on two observations, one is physical, the other is mathematical. The observation of the physical nature addresses the appearance of criticality on the equilibrium and on the upper levels. While the criticality is more visible, both in experimental observations and in its mathematical representation, on the equilibrium level, it manifests itself also on upper levels. For example, observations of fluctuations in the results of lower-level experimental observations are observations reaching beyond the lower level towards upper levels. Fluctuations appear to be indeed more pronounced in the critical region. The observation of the mathematical nature addresses the universality of potential functions in the critical region investigated in the catastrophe theory .x. The MaxRent principle  together with a model that allows to organize them, to reproduce them, and to make predictions. The model, based on the insight inspired by the experimental data and by investigating relations to nearby levels involving less or more details, offers also an understanding of the physics involved. For instance, the equilibrium level with the energy E, number of moles N, and volume V serving as state variables and the microscopic level with position and momenta of \u223c10upper level and the former the lower level. In this section the lower level will always be the equilibrium level. The state variable on the upper level is denoted by the symbol x. For example, in the Landau theory x is usually the equilibrium temperature and an appropriately chosen order parameter. On the level of kinetic theory r is the position vector and v momentum of one particle; reduced structure and from investigating relations to lower levels  comes the reducing structure. Both structures equip the state space with a geometry and a vector field. The geometry is a mathematical formulation of thermodynamics. Every level has thus reduced and reducing thermodynamics and reduced and reducing vector fields. Below, we limit ourselves only to the reducing thermodynamics on the upper level and the reduced thermodynamics on the lower level (which is in this section the equilibrium level).Every level is autonomous and differs from other levels in the amount of details  and in the range of applicability. However self-contained are the levels, their mathematical formulation is closely related to their relationship to other levels. From investigating relations to upper levels  comes a structure that we shall call We emphasize that the term \u201creduction\u201d has in this paper the same meaning as \u201cemergence\u201d. Some details on the upper level are lost in the reduction from an upper level to a lower level but at the same time an emerging overall pattern is gained. The process of reduction, as well as processes conductive to an emergence of overall features (pattern-recognition processes), involve both a loss and a gain. The terms \u201cupper\u201d and \u201clower\u201d levels that we use in this paper have a different meaning than they have in, say, social sciences. The lower level is inferior from the upper level in the amount of details but superior in the ability to see overall patterns.Among many questions about the origin of both reduced and reducing structures and about their relations, we shall discuss only the one that is directly relevant to the Landau theory. We shall investigate the passage from the reducing thermodynamics on the upper level to the reduced thermodynamics on the equilibrium level. A few comments about the placement of the investigation of this passage in the larger context of multiscale thermodynamics are discussed at the end of this section.The upper reducing thermodynamic relationS\u2191(x),E\u2191(3)\u03a6\u2191. Let Step 2: We solve the equation\u03a6x\u2191=0We uStep 3: We introduceStep 4: Finally, we pass from The reducing Legendre transformation  \u2192 2) ca ca2) canx),N\u2191(x) ,6. The c passage  \u2192 (2) thSumming up, the MaxEnt passage from the upper level to the equilibrium level, via the upper reducing thermodynamic relation , is the (S\u2191(x),E\u2191In the particular case when ction in  and bothction in  are . The 2-Equilibrium-level experimental observations of phase transitions are mathematically expressed in various types of singularities of the equilibrium reduced thermodynamic relation Experimental observations made on upper levels  show that the critical behavior seen on the equilibrium level is also seen on the upper levels. For instance, it is well established that fluctuations in the results of the equilibrium-level measurements (that is an example of measurements that involve more details than the equilibrium-level measurements) become very pronounced in the critical region. The mathematical manifestation of the criticality in the upper reducing thermodynamic relation Equation  has two We now illustrate the Landau theory on the van der Waals theory of a gas composed of particles interacting via long range attractive and short range repulsive forces. The macroscopic physical system investigated in this illustration is a gas composed of particles interacting via long range attractive forces and short range repulsive forces . The latter forces are treated as constraints and their influence enters the entropy rather than energy. The mathematical model of this system on the equilibrium level is the well known classical van der Waals model, on the level of kinetic theory the van Kampen model  Following van Kampen , the uppBy making the transformations in , we arrin  is ambiguous, multiple or continuum of extrema are plausible;T) and chemical potential  from  to get arenormalization time evolution  of Still another view of this relation can serve as an introduction to the renormalization-group theory of critical phenomena discussed below in given in . Our aimt. The renormalization time evolution will become the basis for a new definition of critical points discussed in B entering the repulsive short range forces in We see now that with sfy both  and the sfy both .The fixed point of the renormalization time evolution is the critical point and the eigenvalues of the vector field linearized about the fixed point are the critical exponents.This statement, which has arisen as a simple observation in the particular context discussed above, is in fact a definition of the critical points and the critical exponents in the renormalization-group theory of critical phenomena see . In the Finally we compare the classical analysis of the van der Waals gas with the analysis based on the Landau theory. The starting point of the classical analysis is the physical insight that led us to the upper reducing thermodynamic relation . By restThe extra information about the critical phenomena that the classical van der Waals theory provides  is thus: (i) the location of the critical point in the state space Before leaving the van der Waals theory, we mention that the static version of the theory recalled above has been upgraded to the dynamical theory in . The kin(f) (see ) is the In the 2-level formulation of the equilibrium thermodynamics we replace the equilibrium level with a lower level that still takes into account fewer details than the upper level, but it is a mesoscopic level on which the time evolution, called a lower time evolution, takes place. We recall that no time evolution takes place on the equilibrium level that served us as the lower level in the preceding section. We again assume that both the upper and the lower levels are well established  autonomous levels. This then means that by investigating solutions to the upper time evolution equations we have to be able to split the upper time evolution into a reducing time evolution describing the preparation process for using the lower level and a reduced time evolution that is the lower time evolution. The investigation leading to the split is essentially a pattern recognition process in solutions to the upper governing equations.There are two types of the reducing and the reduced time evolutions. The reducing time evolution can be either the time evolution taking place in ample in ,12,13,14ample in , since oThe upper reducing rate-thermodynamic relationrelation . The pas\u03a3\u2191(x),Y\u2191(relation  to the l6\u03a3\u2191(x),Y\u2191How do we specify the upper reducing relations  or 26)??26)? The(i) Both relations  and 26)26) arise(ii) In the critical region the upper reducing thermodynamic potentials  and 28)28) are d(iii) The association between specific physical systems and the upper reducing thermodynamic relations  in equilBefore proceeding to the illustration we make a few remarks.Our investigation in the preceding section was limited to equilibrium. We have considered only systems that are allowed to reach equilibrium states. Behavior of macroscopic systems that are prevented from reaching the equilibrium states  cannot be described on the equilibrium level but can be described on a lower level. For instance the experimentally observed behavior of a Rayleigh\u2013B\u00e9nard system  is well described on the level of hydrodynamics (in Boussinesq equations) ,17. The upper level \u2192 equilibrium level) or indirectly (upper level \u2192 lower level \u2192 equilibrium level). We require that the equilibrium thermodynamic relations obtained by following both routes are identical for consistency in the multilevel framework. This requirement implies the following relation between quantities entering the equilibrium and rate-thermodynamic relationsThe equilibrium can be reached either directly  have two essentially different morphologies. One in which the fluid A is dispersed in the form of droplets in the fluid B that forms a continuous phase. The second is the inverse, fluid B is dispersed and fluid A is continuous. The transition between these two morphologies is a dynamic critical point called phase inversion. Dispersions under consideration are subjected to externally imposed flows.As it was in the case of the van der Waals gas in We turn first to the latter investigation. In the absence of a complete knowledge of the rate-thermodynamic potentials, we can attempt to identify them separately on both sides of the phase inversion. At the point of phase inversion the two potentials must be equal. Their equality is then an equation determining the point of phase inversion. With the surface energy playing the role of the potentials, this analysis has been made in ,20 and wThe Landau theory has been applied to the problem of phase inversion in . The ordIt was experimentally observed in  that theIn rate thermodynamics  the rolx represents the norm of the deviatoric stress tensor. The dissipation potential is clearly non-convex, as is apparent from Note that the potential is written in a non-dimensional form and that In order to obtain the stress tensor, one has to perform the Legendre transformationLet us now find the critical points (there are two) of potential We can further expand the potential Shifting the potential around the critical point by a constant value so that their value at the critical point is zero, the general expansion around the critical point  in which the individual nature of the macroscopic system under investigation is expressed. The Ginzburg\u2013Landau form of the energy is often used . In our In order to illustrate the renormalization-group theory of critical phenomena that is cast into the setting of the Landau theory we turn to the van der Waals theory recalled in n and m that are independent of r and introduce the UPPER reducing thermodynamic potentialWe follow now the analysis that we made on the upper level in n is a solution to Next, we transform the UPPER level into a one parameter family of UPPER levels. We introduce first a one parameter family of the potentials ing into  A(n)=e\u2212\u03c4otential  turns ingiven in . This metential 44) are dIn order to be able to compare the critical part of the upper MaxEnt-reduced potential  with theare with )(45)\u03a9\u02d9=It remains to show the relation of otential  and to iotential .Regarding the former task, we only indicate the route and refer to  for detagiven in . This megiven in  and 11)\u03a8n\u2191=0=\u03a8m\u2191Next, we note thatThis relation follows fromfound in .Regarding the latter task, solutions to the renormalization time evolution governed by  have beeThermodynamics is a theory of relations among theories of macroscopic systems formulated on different autonomous levels of description. Our main objective in this paper is to show that this multiscale viewpoint of thermodynamics unifies investigations of static and dynamic critical phenomena. We emphasize that the reduction of an upper level to a lower level (a level involving fewer details than the upper level) represents a loss of details but a gain of emerging features arising as patterns in the phase portrait of the upper level. Applicability of multi-level thermodynamics is ubiquitous, ranging from chemical engineering, rheology, electrodynamics of matter, kinetic theory to machine learning .Classical equilibrium thermodynamics arises in investigations of relations between an upper level  and the equilibrium level, on which no time evolution takes place. The upper reducing entropy, which generates the approach to the equilibrium level, becomes the equilibrium entropy when the approach is completed. When the approached lower level involves the time evolution, the result of the reduction can either be seen as a reduction in the upper state space (approach to a quasi-invariant submanifold representing the lower state space in the upper state space) or as an approach of the upper vector field to the lower vector field). The thermodynamics that arises by following the latter viewpoint is termed rate-thermodynamics. The mathematical formulations of thermodynamics and rate-thermodynamics are essentially identical. The thermodynamic potentials are however replaced with rate-thermodynamic potentials. In the particular case of externally unforced systems, when the lower level is allowed to reach the equilibrium level, the upper rate-entropy is closely related to the production of the entropy generating the approach of the lower level to the equilibrium level.The multiscale thermodynamics acquires two new features in the critical region. First it is the universality of the thermodynamic and rate-thermodynamic potentials and the inseparability of levels. The former is a consequence of the mathematical representation of criticality (catastrophe theory) and the latter the consequence of the physical nature of the criticality. The former feature has been noted by Lev Davidovich Landau and is a basis of his theory of critical phenomena. The latter feature is a basis of the renormalization-group theory of critical phenomena. We show that the multiscale thermodynamics provides a unified setting for the Landau theory of static critical phenomena, for its extension to the dynamic critical phenomena and for the renormalization-group theory of critical phenomena."}
+{"text": "Multiscale thermodynamics is a theory of the relations among the levels of investigation of complex systems. It includes the classical equilibrium thermodynamics as a special case, but it is applicable to both static and time evolving processes in externally and internally driven macroscopic systems that are far from equilibrium and are investigated at the microscopic, mesoscopic, and macroscopic levels. In this paper we formulate multiscale thermodynamics, explain its origin, and illustrate it in mesoscopic dynamics that combines levels. E, number of moles N, and volume V serving as state variables [A level of investigation is a collection of results of a certain type of experimental observations (different for different levels) made on complex systems together with a theory that allows organizing them, reproducing them, and making predictions. The theory, based on the insight inspired by experimental data and by investigating relations to nearby levels involving less or more details, offers also an understanding of the physics involved. For instance, the equilibrium level with the energy ariables  and the Multiscale thermodynamics is a theory of the relations among different levels.Hamilton\u2019s mechanics, classical thermodynamics, fluid mechanics, Boltzmann\u2019s kinetic theory, Gibbs\u2019 equilibrium statistical mechanics, and extensive studies of the relations among them provide methods, tools, and also an inspiration to formulate a multiscale thermodynamics of which all these classical investigations are particular realizations. Multiscale thermodynamics provides a framework for investigating the static and dynamic aspects of reductions from an upper to a lower level with no constrains to the closeness to equilibrium or to the absence of external or internal driving forces.The motivation for developing multiscale thermodynamics comes also from problems arising in nanotechnology and machine learning. For example, egg whites (as well as other polymeric fluids) behave under imposed external forces differently than water. This is because the deformations of the internal structure of egg whites (polymer macromolecules) cannot be decoupled from macroscopic deformations described by hydrodynamic fields. The fluid mechanics of complex fluids has to combine at least two different scales. Multiscale thermodynamics provides a framework for making such combinations. Its earlier versions have indeed been shown to be very useful in rheological modeling . Every mesoscopic level Let he chain:\u27f6L\u27f6L\u27f6l\u27f6whe chain:\u27f6L\u27f6L\u27f6l\u27f6wThe passages upper level \u27f6 lower level representing the reduction process can be mathematically formulated in two ways, one called a time-evolution passage and the other a maximum entropy passage (MaxEnt passage). The former is a mathematical formulation of the time-evolution process that prepares the macroscopic systems under investigation for experimental observations at the lower level. The latter is a map transforming initial states at the level l is put on the rates of the processes involved rather than on the processes themselves, then the resulting passages and structures form what we call multiscale rate thermodynamics. The two passages, time-evolution passage and MaxEnt passage, become in rate thermodynamics the rate time-evolution passage and maximum rate-entropy passage, which we write as MaxRent passage. The structures become reducing and reduced rate structures.If the focus of the investigation of the relations between the levels Since we shall be investigating in this paper also direct links he chain  with an Before proceeding to the actual formulation of the structure and the passages, we emphasize that the term \u201creduction\u201d has in this paper the same meaning as \u201cemergence\u201d. Some details at the upper level are lost in the reduction from an upper level to a lower level, but at the same time, an emerging overall pattern is gained. The process of reduction, as well as the processes conducive to an emergence of overall features (pattern-recognition processes) involve both a loss and a gain. The lower level is inferior to the upper level in the amount of details, but superior in the ability to display overall patterns.l. Both levels l are assumed to be well established and autonomous. This means that the macroscopic systems whose behavior are found to be well described at both levels can be prepared for the level l. The time-evolution describing the preparation process is the reducing time-evolution taking place at l is the equilibrium level, the preparation process consists of leaving the macroscopic systems free of external influences and internal constraints for asufficiently long time  used at the level l. Both the Hamiltonian and the gradient parts of the vector fields are gradients of a potential  transformed into vectors by a geometrical structure. In the Hamiltonian part, the potential is the energy and the geometrical structure the Poisson structure . In the gradient part, the potential is the entropy, and the geometrical structure is the metric structure . Both geometrical structures are degenerate in order to guarantee the conservation of energy and the increase of entropy. Comments concerning the provenance of the reducing time-evolution are given in Investigations of many pairs of levels x\u02d9=L\u2191We note that the energy erned by  since E\u2191volution  with an ian part  of the rN\u2191(x) in , and thel. Let us assume that the above three steps have been made. The result is expressed in the reducing time-evolution. By following it to its conclusion, we arrive at the level l . The equation governing the reducing time evolution is x\u02d9=x\u02d9=S\u2191(x) x being a field , then the property (iv) is for example satisfied for A straightforward generalization of  is a disx\u02d9=\u039ex*\u2191(xx\u02d9=\u039ex*\u2191(xx\u02d9=\u039ex*\u2191(x side of  when X=xuch that:(i)\u039e\u2191 in ) in the  (iv) in .The inequality  becomes:m states:M\u2191(deq)={If the thermodynamic potential equality  makes ittions to  to M\u2191, and indeed, the equilibrium manifold  the Hamotential  plays thmanifold  is approIf however the gradient part of  has a la part of  drives stions to  never toution to  settles  by Grad . A compl by Grad . We shalFinally, we sum up the input and the output of the reducing time-evolution to the equilibrium level. The input consists of the reducing thermodynamic relation:ted into , impliesgiven in  is approThe two potentials duced in  and S\u2191(xS\u2191(x) in . All thrS\u2191(x) in .The equilibrium thermodynamic relation:ned from  by folloned from  to its cned from .Investigations of the process of the preparation for the equilibrium level  in Sectotential  .We now take this result of the investigations of the process of preparation for the equilibrium level as our starting point and make the passage to the equilibrium level without an explicit reference to the preparation process itself. We thus begin with the reducing thermodynamic relation  and withThe equilibrium thermodynamic relation plied by  is:22)Sution to ). The eqrelation  by two mSution toans that:S=\u03a6*elation ((S\u2191(x),E\u2191We now comment about the physical interpretation of the quantities  \u03a6\u2191 (see ) and at E and N, respectively, since the following relations hold: T since E. If a macroscopic system is put into contact with another macroscopic system called a thermometer in such a way that the internal energy freely passes freely between the system and the thermometer and both the system and the thermometer are surrounded by the membrane that blocks the passage of the internal energy, then, due to the maximization of the entropy in the equilibrium states reached as At the equilibrium level, the quantities f Callen , the forAt the upper level, the quantities x, the upper reducing thermodynamic relation has only one form (The observations that we just made about ics (see ). Due tothe form  or in thone form ; there aIt is also interesting to note the difference in the inclusion of the constraints in the maximization of the reducing entropy Still continuing with the comparison of the MaxEnt reduction (in this section) and the reduction made in the reducing time-evolution in  is a seqHaving realized that the fundamental group of thermodynamics is the group of Legendre transformations, we ask the question of what is the mathematical environment in which the Legendre transformations appear as natural transformations. The geometrical structure that is preserved in the Legendre transformations is the contact structure ,11. We cx and The time-evolution governed by  will be In order to include the MaxEnt reduction  to the cmanifold  turns inWhat remains is to lift  to M\u2191^ ie lifted , and  one-form is well known ,11. The or field  is the gRegarding the second point, the contact Hamiltonian ified in ,15, is eSumming up: (i) the contact structure of the space given in ; (iii) tgiven in , i.e., tThe contact formulation is thus very satisfactory both from the physical and the mathematical point of view. The physical satisfaction comes from seeing the reducing thermodynamic relation  as a rel GENERIC  in the glated in  involvesFinally, we also recall that the variational formulation that is well known for both the Hamiltonian dynamics and the gradient dynamics can be, in the setting of the contact geometry, extended to their combination, i.e., to the GENERIC dynamics . The conl with which we are comparing the upper level l at which a time-evolution  takes place. What has to be changed in the investigation of the passage l?So far, the lower level vel , then there has to be a way to prepare the macroscopic systems under investigations for the level l, and such a preparation process has to be presentable as a time-evolution at the level l that involves the time-evolution does not bring any change. The question that remains to be answered is as to whether the preparation process is governed again by . This ml, where l involves the lower time-evolution, is not only the lower thermodynamic relation , but also the lower time-evolution. Historically, in the first investigation of this type [l is the level of hydrodynamics with the five hydrodynamic fields serving as state variables , we begl. If the lower level changes, all quantities appearing in the reduction change. In particular, the energy x, but that do not belong to y. In order to avoid overburdening our notation, we do not show explicitly the dependence on the lower level l.The reducing time-evolution equation is  with thearing in . All redy=y(x)E\u2191M\u2191:(33)L\u2191E mapping , becomeselation:3S\u2193=S\u2193(y)Before leaving this section, we make two remarks.Remark\u00a01.The original Chapman\u2013Enskog investigation of the reduction of kinetic theory to hydrodynamics, as well as its continuation in  concentrrelation  and the relation . The redrelation  represenrelation  represenRemark\u00a02.Externally or internally driven macroscopic systems are prevented from reaching the equilibrium level. Equilibrium thermodynamics does not exist for such systems. However, the behavior of externally or internally driven macroscopic systems can often be described at a mesoscopic level l. For example, the experimentally observed behavior of the Rayleigh\u2013B\u00e9nard system  can be described at the level of hydrodynamics (with Boussinesq equations governing the lower time-evolution). In other words, the level of hydrodynamics is well established for the Rayleigh\u2013B\u00e9nard system. This then means that any other level relation  implied relation ) for sucl. The reducing structure consists of the reducing thermodynamic relation and the reducing time-evolution equation. The reduced structure consists of the reduced thermodynamic relation and the reduced time-evolution equation. Moreover, since for a given lower level l, there are, in general, many upper levels A single reduction H denotes the entropy associated with the reduction S is the entropy associated with the reduction Not all such structures are however independent. We shall now explore some of the relations among them. First, we turn to systems with no external and internal forces that would prevent the approach to equilibrium and to the chain:n fields, which are velocity moments of the one particle distribution function  MThis multiscale viewpoint of the Landau theory is formulated and illustrated by the van der Waals theory in ,28. The The realization of the existence of the second simplification originally arose in the comparison of the predictions of Landau\u2019s theory with the results of experimental observations. The agreement is found to be only qualitative. In order to explain it, attention was turned to the inseparability of levels at the critical point. It has been realized that the critical points themselves can be defined as fixed points of a group of transformations  representing a pattern recognition process. The fixed point, i.e., the critical point, is the point where no pattern can be recognized. This type of idea was originally formulated in the context of the Gibbs equilibrium statistical mechanics in . In thisl is either a mathematical formulation of the experimental investigation of the preparation process for the level l or, in the case when the time-evolution taking place at the level X, i.e., As we already emphasized several times, the reduction see also ), we shaX . The power and the enormous importance of Boltzmann\u2019s results, as well as the results obtained by his numerous followers, is not the narrow focus on the ideal gas, but the physical insight and the mathematical structure involved in the investigation.Historically, the first investigation of the time-evolution passage oltzmann . The phyWe introduced in m is the mass of one particle. We use hereafter the summation convention over the repeated indices and the shorthand notation W: (i) W is symmetric with respect to f and In mathematical terms, the Boltzmann kinetic equation takes the form of  with:  is caste, e.g., X is called in chemical kinetics a chemical affinity. The dissipation potential a appearing in the property (iv) is in this example The form of the dissipation potential eactions ,46 in wharing in  is indeearing in  is a strWe now recall some important properties of solutions to the Boltzmann kinetic equation. We begin with the global existence of its solutions that was proven in . DiPernaThe dissipation equilibrium manifold deq) see  is compoThe equilibrium manifold The fact that the Boltzmann kinetic equation is a particular realization  of the al-manifold Beside the opportunity to investigate rigorously the approach to the equilibrium level, Boltzmann\u2019s kinetic theory provides also an opportunity to investigate the approach to a lower level involving the time-evolution .After making the first step in the Chapman\u2013Enskog method, we obtain an appropriately deformed manifold The Navier\u2013Stokes\u2013Fourier vector field is the vector fieldtails in ,20,21,22tions to  with S\u2191 lead thl the equilibrium level. The reducing time-evolution equation describing the preparation process for such a passage is not a part of the Gibbs analysis. The preparation process is represented only in a few requirements: the gradient part of the reducing time-evolution by a reducing entropy that is required to be maximized, the Hamiltonian part by constraints in the maximization. The applicability of the Gibbs reduction is universal.The MaxEnt passage n particle distribution function n particles, and In mathematical terms, the upper state variable is the relation  is made We now compare the Gibbs MaxEnt passage to the equilibrium level with the Boltzmann\u2019s time-evolution passage see  also to Gibbs also begins with an insight into the appearance of the phase portrait. However, instead of expressing it in a modification of the vector field that generates it, as Boltzmann does, Gibbs expresses it directly in the entropy that generates it in the MaxEnt reduction. Both the Gibbs entropy  and its maximization (the MaxEnt principle) are postulated. The microscopic Hamiltonian vector field is represented in the Gibbs MaxEnt reduction only in the constraint of the Gibbs entropy maximization. The energy is required to remain unchanged in the reduction. The Gibbs equilibrium pattern is also often called \u201cergodic\u201d with only very vague reference to the rigorous mathematical definition of ergodicity in the theory of dynamical systems on measurable spaces . The phaThere is, of course, an enormous difference between the Boltzmann and the Gibbs approaches to the passage An obvious question is: What is the Gibbs time-evolution passage that becomes the Gibbs MaxEnt passage if only an initial state and the final state reached as asked in . We contaring in . The timaring in  corresposked in [{A,B}=\u222bd1ring in  in which unimportant details are generated. Such events are analogical to binary collisions in ideal gases. Let such an event be identified. The vector field generating it is replaced by an in-and-out balance generated by mappings:\u03a5=aring in , but witc forces:X(f*)=f*=f*0 unless , the comThe Boltzmann-inspired \u201cretouch\u201d of the phase portrait that we presented above is similar to the Ehrenfest regularization (Ehrenfest \u201cretouch\u201d) ,56 in whf and A likely scenario of the Gibbs time-evolution passage to the equilibrium level is the following. The time-evolution begins with a weak dissipation, i.e., with a large set  of invarmappings  becomes variants  representions to .The level of fluid mechanics is the oldest  and undoLeonhard Euler  introducce laws):\u2202\u03c1\u2202t=\u2212\u2202Jie, e.g., ,59). Thece laws):\u2202\u03c1\u2202t=\u2212\u2202Jice laws):\u2202\u03c1\u2202t=\u2212\u2202JiThe Hamilton formulation of the governing equations of fluid mechanics appeared in 1859 in . We presariables . Our objariables  with x=ung Euler , continu. Arnold  realized algebra ,61 (whics. The flux In order to identify the kinematics of the full set  of the se(r) in  with anosatisfy: (\u03c1(r),e for whirheology . In spitThe gradient part of the time-evolution appears in Looking at  and 56)56) just The observations that , besidesThe level of fluid mechanics is presented in the previous section as a continuum version of Newton\u2019s (or Hamilton\u2019s) dynamics. Let us now take an upper mesoscopic level n particle distribution function, With the microscopic level , the operator The second example of the abstraction is the emergence  o Onsager , who shoThe third example is Truesdell\u2019s axiomatic formulation of continuum mechanics . While hIn the spirit of multiscale thermodynamics discussed in this paper, an important criterion for abstract formulations is the occurrence and applicability at all levels. Not all Truesdell\u2019s axioms fulfill this criterion. For instance, the local temperature cannot be seen at more microscopic levels as a fundamental state variable see .The third step on the path to multiscale thermodynamics is seeing Boltzmann\u2019s kinetic theory as nonequilibrium thermodynamics itself, not only as a microscopic basis for classical  nonequilibrium thermodynamics.The fourth step towards multiscale thermodynamics is the necessity to enlarge the set of the five hydrodynamic fields playing the role of state variables in classical fluid mechanics when dealing with complex fluids (as for example polymeric fluids and suspensions). The molecules  composing the complex fluids deform and reorient themselves at the same time scale as the hydrodynamic fields evolve. Consequently, extra fields characterizing the internal structure have to be adopted for the set of state variables. However, then, the system of local conservation laws   cannot bHistorically, the first investigation of the time-evolution passage, which we recalled in q chemical reactions among p components  and an tails in ).The state spaces in the Guldberg\u2013Waage dynamics are finite-dimensional. This is obviously an advantage in the investigation of solutions. Another advantage of the Guldberg\u2013Waage dynamics, in particular in the context of multiscale thermodynamics, is the natural appearance of intermediate levels. We begin by extending  to a fuln. After the fast time-evolution of the fluxes is complete, the subsequent slow time-evolution of n is expected to be governed by the standard chemical kinetics equations  into vector fields. Specifically, the forces generated by the energy are transformed into the Hamiltonian vector fields by the Poisson bracket. The forces generated by the entropy are transformed into vector fields by the dissipation potential. The dissipation potential in gradient dynamics is thus a counterpart of the Poisson bracket in the Hamiltonian dynamics. Locally, in a small neighborhood of duced in ). In thiIf both the Poisson bracket and the dissipation potentials participate in the dynamics, then the Poisson bracket is completely insensitive to the forces generated by the entropy and the total number of moles. The dissipation potential is on the other hand completely insensitive to the forces generated by the energy and the total number of moles. The insensitivities are mathematically expressed in the degeneracies of the Poisson brackets and the dissipation potentials.In the contact structure formulation of the GENERIC dynamics see , both thm reactions be fast and the remaining Let some of the chemical reactions  be fastehe split  induces he split ) the splamics in . With thQuestion 1:How exactly are solutions to  and soluaring in  is assumaring in )?Question 2:We modify Equation  by replations to ? Investitions to  in the cThe problems discussed in this and the previous sections belong to statistical mechanics. The way we presented and discussed microscopic, mesoscopic, and macroscopic dynamics suggests an alternative view of statistical mechanics. First, we recall the conventional viewpoint, and then, we introduce its alternative.Traditionally, statistical mechanics is divided into two parts: equilibrium and nonequilibrium. In the broader viewpoint of the microscopic-mesoscopic-macroscopic dynamics that we are taking in this paper, thermodynamics has to be also seen as a part of statistical mechanics. Thermodynamics traditionally is divided into classical equilibrium and nonequilibrium. In the following four paragraphs, we briefly recall the main tenets of the four parts of statistical mechanics.V, number of moles N, and energy E playing the role of the state variables  mechanics of \u223c10bles see ). The inonst. in , as wellonst. in ) and apponst. in .Nonequilibrium statistical mechanics is a collection of various investigations, both in deterministic and stochastic settings, of the time evolution taking place at mesoscopic levels . The colClassical equilibrium thermodynamics ,8 is a vNonequilibrium thermodynamics is a theory recalled in Following State space reductions are described in Rate reductions are described in Boundary reductions are the same type of reductions as the two previous ones except that the focus is put on the behavior in the region in which the bulk meets the boundary of the system under investigation. In this paper, we have not discussed them, but this part of statistical mechanics is obviously very important and will be pursued in the future.All three types of reductions are made by following reducing time-evolutions to their conclusions. All reducing time-evolutions are generated by a potential called an entropy. Two different reductions are generated  by two different entropies. The entropy increases during the reducing time-evolution. The states at which the entropy reaches its maximum (subject to constraints determined by the target lower level) are thus the states representing the lower state variables in the upper state space. These states can be thus reached either by following the reducing time-evolution to its conclusion or simply by maximizing the entropy subject to appropriate constraints. The former way is the time-evolution reduction see , and theTwo vertices in the multiscale-thermodynamics graphs have a special status. One is with no incoming arrows and the other with no outgoing arrows. The former is the most microscopic level at which macroscopic systems are seen as composed of \u223c10The reducing entropies at the most microscopic level are potentials, called Casimirs, that remain unchanged during the upper time-evolution. There are infinitely many Casimirs. In order to single out one among them, we need to identify a nucleus of dissipation . The nucleus increases during the time-evolution, and the resulting dissipative time-evolution gives rise to a reduction represented by an outgoing arrow. The reduction is generated by a potential, which is then the entropy singled out among the infinitely many Casimirs.The reduced entropies appearing at the level of the classical equilibrium thermodynamics due to incoming arrows manifest themselves in the separation of the total energy into a macroscopic mechanical energy and heat. The former can be directly and completely converted into macroscopic mechanical work, the latter only incompletely in Carnot\u2019s machines.Seeing the conventional viewpoint of statistical mechanics in the context of the graph of multiscale thermodynamics, we note that the conventional viewpoint concentrates on some particular links , while the graph viewpoint puts the same attention on all links in the graph. We may anticipate that a general theory of the graph  can contribute to a deeper understanding of the links leaving the microscopic level (which are obviously of particular importance for understanding emerging phenomena). For instance, it was suggested in This section illustrates the use of multiscale thermodynamics in advancing specific problems. One of the oldest and probably still the most frequently used strategies to make reductions is to begin by casting the upper level governing equations into a hierarchy of equations. The hierarchy reformulation is chosen in such a way that the lower part of the hierarchy is already the system of reduced governing equations that we look for except that the equations still remain coupled to the rest of the hierarchy. Our objective in this section is to place the hierarchy reductions into the larger context of multiscale thermodynamics and to show some of the implications.f to space n functions. We recall that reduction is a pattern recognition in the upper phase portrait. We assume that from some previous considerations, we already have a reason to anticipate that We present the mathematical formulation first for the case when the upper state variable f at the level As for the time-evolution of  form of . In otheform of  transformed into a vector by kinematics expressed mathematically in the bivector E remains in the reformulation undetermined. Since it is the energy where the individual nature of the macroscopic systems is expressed, the particular physics of the system under investigation does not enter the mathematical modeling before starting the hierarchy reformulation (as is done in the standard approach), but after the kinematics-preserving hierarchy reformulation has been made. The specification of the energy becomes thus an extra tool in reductions.In this paper, we take another path. We shall make an alternative hierarchy reformulation of . We use A and B in the Poisson bracket f both directly and through their dependence on In order to obtain such a kinematics-preserving reformulation of the Liouville Equation , we procgiven in . This me bracket  becomes:The time-evolution equations  with {A,given in  take theSumming up, we have cast  into themulation  of 47)  Z. If thmulation  and (47)f. We can physically interpret f as a state variable characterizing the overall features of the phase portrait of  can be seen as the Liouville  equation corresponding to 6N ordinary differential equations governing the time-evolution of f. It is indeed a state variable expressing the overall features of the dynamics that are expressed neither in Still another insight into the physics expressed in the hierarchy  is reveaormulate  into a sf in terms of Finally, we emphasize that all the reformulations that we have made above in this section do not involve any approximation. Both  and 75)75) shareIn order to recognize a pattern in the phase portrait corresponding to  or to itentering  or 75)  E\u2191(x) enFirst, we emphasize that the choice  of the lnding to  can be eHaving chosen , we follf appearing in it in terms of The standard view is bottom up. It is the reduced dynamics, which is an appropriately closed bottom part of the hierarchy, which is typically the reason why the reductions are made. We look at the bottom part of the hierarchy and try to close it. In the hierarchy , this meeared in  and was eared in .However, the closure can also be argued from top down. As we already noticed in f. If , we arrSuch investigation cannot be done without making a commitment to a specific physical system and without a type of analysis displayed for example in . In the T is absorbed in rescaling the time. In the next step, we introduce to the top equation in the hierarchy , we obtf still appears in the matrices L and f. For instance, if the system under investigation is close to equilibrium, we can replace f in (Equation  governinand \u039b in  and 84)Z still nace f in  and (84)f in f in (84)f in  is a cloEquation  is the OEquation  is also Equation  is a parEquation . The matFormulas  and (84)volution ).L and its sign change in the transformation Summing up, the Onsager  result  has emerEquation  represenWe can also find the lower rate thermodynamic relation an write  as:(86)\u03a8Consequently, the lower rate entropy implied by the above reduction is:We note that Equation  implies:The Liouville Equation  governinEquation  is calleThe state variable at the upper level is the N particle distribution function  bracket .f to denote g to denote g is related to f by: The infinite kinematics-preserving hierarchy in this setting was developed in  for 1,\u2026,A and B that depend on f directly and also indirectly through their dependence on g . By repe , we bracket  is the sThe time-evolution Equation  correspoThe energy f, then (f) on the right-hand side of \u2202tierarchy . The oriierarchy  with N=2\u2202g\u2202tmulation  keeps thf is expressed in the Poisson bracket 96) with:that see  \u222bdr\u222bdv\u03b7 moments . With anThe time-evolution equations  with the,v)are: \u2202\u03c1\u2202t=\u2212\u2202\u2202rThe disadvantage of the choice of the energy representation  is that the hierarchy , a, a93), an functions A and B in  as the and B in  depend o(r); see ). We thund Bu in  with Auiansforms  into: (1 bracket ), the upbrackets  and 98)W (see (AW as its fine internal structure. The possible suitability of this reformulation of the Euler equation for, for example, turbulence modeling or numerical investigations is intended to be explored in a future paper.The time-evolution equations corresponding to this bracket is the following kinematics-preserving hierarchy: W\u02d9\u03b1i=\u222bdrul if l. If both levels l are well established, then there must exist a way to prepare the systems under investigation for the level l, and the preparation process has to be possible to be seen as a time-evolution at the level l. During the time-evolution, the entropy is maximized subject to certain constraints that, as well as the entropy, represent the lower level l inside the upper level l is a sequence of infinitesimal contact structure-preserving transformations, and the whole process of passing from the level l is a reducing Legendre transformation. Multiscale thermodynamics investigates the chain l. More generally, the chain is replaced by an oriented graph with levels as its vertices and links, directed toward lower levels, as reductions.Multiscale thermodynamics is a theory of relations among the levels of investigation of complex systems. It is a theory that sprung from the classical equilibrium thermodynamics, Boltzmann\u2019s kinetic theory, and the Gibbs equilibrium statistical mechanics. A level is well established if its predictions agree with the results of experimental observations. A level In this paper, we first present the main tenets of multiscale thermodynamics in , and the"}
+{"text": "Solea senegalensis. S. senegalensis is a flat fish with a karyotype comprising 2n = 42 chromosomes: 6 metacentric + 4 submetacentric + 8 subtelocentric + 24 telocentric. The Fluorescence in situ Hybridization with Bacterial Artificial Chromosomes (FISH-BAC) technique was applied to locate BACs in these chromosomes  and to generate integrated maps. Synteny analysis, taking eight reference fish species  for comparison, showed that the BACs of these two chromosomes of S. senegalensis were mainly distributed in two principal chromosomes in the reference species. Transposable Elements (TE) analysis showed significant differences between the two chromosomes, in terms of number of loci per Mb and coverage, and the class of TE (I or II) present. Analysis of TE divergence in chromosomes 2 and 4 compared to their syntenic regions in four reference fish species  revealed differences in their age of activity compared with those species but less notable differences between the two chromosomes. Differences were also observed in peaks of divergence and coverage of TE families for all reference species even in those close to S. senegalensis, like S. maximus and C. semilaevis. Considered together, chromosomes 2 and 4 have evolved by Robertsonian fusions, pericentric inversions, and other chromosomal rearrangements mediated by TEs.Cytogenomics, the integration of cytogenetic and genomic data, has been used here to reconstruct the evolution of chromosomes 2 and 4 of  Cytogenomics is a methodology in which the cytogenetic and genomic data obtained are integrated. This approach emerged to advance studies of the relationship between chromosomes and diseases in humans, but it has been extended to other species due to its potential value for studies of evolution . The widComparative genomics of orthologous sequences located in the karyotype has opened new ways to detect karyotype differences because it allows comparisons to be made between species, genera, and even families, providing a more detailed overview of the evolutionary changes in the karyotype. It also allows us to overcome serious limitations of cytological studies such as genetic disruption of meiotic pairing and indistinguishable chromosomes ,4.A large part of the eukaryotic genome is composed of repetitive DNA including satellite DNA, and transposable elements (TE). The majority of these repetitive non-coding sequences are usually located in heterochromatic regions such as centromeres and telomeres, and in other specific regions of the genome. They are organized into blocks of DNA, scattered interspersed repetitions, that undergo periodic reorganization mostly due to mobile elements that jump from one location to another, often leaving a copy of themselves in the original location. Hence the evolutionary dynamics of TEs are important, not only for genome size but, because the regrouping of mobile elements can originate differences in the number and structure of the chromosomes in some species .According to the transposition mechanism there are two types of transposons: those with and those without an intermediate RNA. That difference divides TEs into class I and class II. Class I TEs are the retrotransposons that produce an RNA intermediate by reverse transcription that is moved through the genome by a copy-paste mechanism. This class is subdivided into Long Terminal Repeat (LTR) and non-LTR retrotransposons. Class II transposons or DNA transposons can utilize three transposition mechanisms: first, \u201ccut-and-paste\u201d transposons; second, inverted terminal repeat sequence (ITRs) transposons ; and third, self-synthesizing DNA transposons  . Among vFishes show the highest chromosome number variation among vertebrates due to an extensive evolutionary radiation. Among them, the teleost group, which emerged 225 mya, is extremely diverse in terms of morphology, behavior, and adaptation . This heThe Pleuronectiformes order, in particular, has undergone intense chromosome evolution. The phylogeny of this order has been disputed, with some studies supporting a monophyletic origin ,15 and oS. senegalensis [Cynoglossus semileavis with 470 Mbp [Danio rerio with 1371 Mpb is more than double and nearly triple the size of the latter two species, respectively [Citarichthys spilopterus, to 2n = 48, found in most of the Pleuronectidae species [The genome size of flatfishes is among the smallest of all fishes; a size of 612.3 Mbp has been reported for galensis  and an e 470 Mbp ,21,22. Dectively ,24. Theiectively : the chr species .Solea senegalensis ) is a flatfish, with an oval and asymmetric body, belonging to the Pleuronectiformes order. The species is widely distributed in the Atlantic, from the Gulf of Biscay to the Northwest coast of Africa, and in Mediterranean waters, from the Strait of Gibraltar to Tunisia; this species has good potential for marine aquaculture given the high demand and profitable price. However, there are several issues that hamper its production: (1) high larval mortality, (2) sub-optimal larval weaning strategies, and (3) disease control. In recent years, considerable efforts have been devoted towards understanding genetic and genomics aspects of this species. The karyotype of this species comprises 2n = 42 chromosomes: 6 metacentric (M) + 4 submetacentric (SM) + 8 subtelocentric (ST) + 24 telocentric (T), and its Fundamental Number (FN) is 60 [S. senegalensis  by comparing them with other available species and analyzing their repetitive elements.The Senegalese sole (N) is 60 . Its chrN) is 60 . The laries, and  disease N) is 60  and its A total of 21 BACs with 154 genes were annotated . The relS. senegalensis, and 7 out of 11 BACs were distributed in two chromosomes, except in D. rerio and L. oculatus. BACs 60P19, 46C5, 36I3, and 4D15  and BAC 21O23 (arm 2) were located in the same chromosome in C. semilaevis, S. maximus, G. aculeatus, X. maculatus, and O. latipes, and in the same genomic region for C. semilaevis and S. maximus. BACs 52G10 and 38N10, which were positioned in different arms on chromosome 2 of S. senegalensis, were located in a second different chromosome in all species, except in S. maximus where they were located in two different chromosomes. For all species, gene regions for BACs 60P19 and 46C5 showed a high degree of conservation, except for D. rerio in which six out of nine genes of 60P19 were located in the chromosome far from the BAC 60P19, and only one gene of BAC 46C5 was located near BAC 60P19  was used to distribute the nodes (BACs and syntenic fish species chromosomes) in the plane. Nodes sharing more connections (syntenic positions with other fish chromosomes) are closer to each other. Figure 5a shows two BACs (9E8 and 19L16) with single connections to chromosomes from other fishes, three BACs  with a few connections and six BACs  with multiple connections, showing the conserved syntenic regions in other fish chromosomes .The synteny analysis for the eight species used as reference is presented in 0P19 see . The othL. oculatus in which the genes of this BAC were distributed on two chromosomes. The BACs 3C15, 46B2, 30J4, 12D24, 8A23, 36J2, 36H3, and 36H2 presented in a different sequence in the chromosome in each of the species, but the region with BACs 46B2, 30J4, and 12D24 was highly conserved and the BACs followed the same sequence in all the species except for D. rerio and L. oculatus. It is noteworthy that BAC 30J4 (19 genes) showed a translocation of ten genes  in all the species  remained in the conserved region for BACs 46B2, 30J4, and 12D24. BAC 46P22, i.e., in the \u201cq\u201d arm of S. senegalensis; in all the reference species they were positioned in a different chromosome. The mapping graph plot for chromosome 4  in the TE analysis by BAC and chromosome. Among chromosome 2 BACs, 4D15, 36I3, and 52G10 showed coverage values of 9.22, 8.54, and 8.5, respectively. BAC 52G10 presented a high percentage of simple repeats, and the presence of satellites was observed for BAC 4D15 .loci per Mb (NL/Mb) was proportional to coverage, but 52G10 showed higher values than the other BAC clones (1189.5 NL/Mb), mostly caused by the presence of multiple simple repeats loci  than chromosome 2 , mainly S. senegalensis chromosome 2 and syntenic regions in C. semilaevis ranged from 16 to 21% across all repeat classes, suggesting a relatively recent transposition burst across all major TE types. DNA/CMC/Emspm, DNA/Kolobok and DNA/hAT-Ac elements showed the highest coverage  element (Rex-Babar) from chromosome 4 presented a high degree of divergence (40%) between oelement .S. senegalensis chromosome 2 and syntenic regions in O. latipes revealed the widest spread of divergence values found in this study, with ill-defined peaks of divergence. S. senegalensis chromosome 4 with its syntenic regions of O. latipes, the most frequent divergence values were around 20 and 21%, with DNA/CMC-EnSpm and RC Helitron showing the greatest coverage. A second peak with higher, but more discontinuous divergence and lower coverage values was found at 34, 37, and 39% with the most representative families DNA/TcMar-1, Line/Rex-Babar and LTR/ERV. Again, a single family, DNA/Ginger-1, exhibited high coverage and a low divergence value (7%). LINE and SINE (Short interspaced nuclear element) elements throughout this chromosome revealed the greatest degree of divergence , from the plesiomorphic condition of 2n = 48 in teleosts. Fish families have followed distinct evolutionary paths in relation to the number of chromosomes. The families Haemulidae, Lutjanidae, and Sciaenidae of the Perciformes order, for example, present remarkable karyotype conservation and the ancestral condition or karyotype stasis is maintained  [Porichthys plectrodon, the presence of a pair of large metacentric chromosomes in their karyotype suggests a Robertsonian translocation between two acrocentric chromosomes in the evolution of the karyotype toward the actual 2n = 44 [One consequence of these fusions would be the reduction of the number of chromosomes in FN = 48) . In contFN = 48) . For the 2n = 44 .C. semilaevis and Trinectes inscriptus (2n = 42). While all chromosomes in C. semilaevis are acrocentric, the karyotype of T. inscriptus is formed by three large metacentric, one submetacentric and several subtelocentric chromosome pairs. The metacentric chromosomes probably originated from chromosome fusions, while the submetacentric and other subtelocentric pairs originated from pericentric inversions probably from six ancient acrocentric chromosome pairs [S. maximus (2n = 44) comprises 3 pairs of M/SM and 19 pairs of ST/T chromosomes and differs in one chromosome pair from S. senegalensis [Dagetichthys lusitanica, has 2n = 42 (FN = 50), with two metacentric, two submetacentric and 17 telocentric chromosome pairs; and Dicologlossa cuneata, with 2n = 50 (FN = 54) and with one large metacentric chromosome and several smaller ones, and 23 telocentric pairs. Zoo-FISH studies with these two species indicated that the chromosome 1 of S. senegalensis originated from the fusion of two acrocentric chromosomes found in the karyotype of both D. cuneata and D. lusitanicus. This chromosome pair has been proposed as a proto-sex chromosome in S. sengalensis [The Pleuronectiformes order shows variation in the number of chromosomes . In addime pairs ,35. The galensis . These kS. senegalensis chromosomes 2 and 4 measured the abundance of different TE classes. Chromosome 2 showed a greater abundance of class II elements (DNA transposons), in terms of NL/Mb and coverage, than chromosome 4. In most fish genomes, Class II DNA transposons are the most abundant component [The transposable elements analysis of omponent ,37, althomponent . Among Tomponent ,39. Howeomponent ; thus thomponent ,31.S. senegalensis chromosomes has shown the differences between them in the presence of classes and families of TEs. Retroviral LTR elements, hobo-Activator and Tc1-Pogo DNA transposons and LINE elements such as RTE/Bov-B and L1/CIN4 LINE showed 2-to-9 fold differences, in terms of NL/Mb and coverage. These findings indicate that these TEs could play a main role in their differentiation and evolution. Moreover, the TE analysis per mapped BACs, on various chromosomes, has allowed us to analyze the distribution on specific chromosome arms. The results show a general pattern of high TEs abundance (measured as NL/Mb and coverage) next to telomeric and centromeric regions, as described previously for S. sengalensis chromosome 1 [S. senegalensis study [The analysis of two S. senegalensis chromosome 1, where TEs could account for the evolution of the putative sex-determining chromosome of this species, although sex chromosomes evolve differently than autosomes [S. senegalensis studies \u223c400\u20131000 NL/Mb [S. senegalensis [T. nigroviridis, where SSRs account for 3.21% of the genome [T. rubripes (1.29%) [S. senegalensis could provide insights into their genome dynamics and evolution.The comparative mapping net plot revealed an isolated node cluster for this BAC, reflecting a different evolution process in that BAC region. The syntenic regions of this BAC in other fishes are always found in telomeric locations, so this chromosome could have kept its abundance of TEs during evolution. High TE abundance in these chromosomes could also be associated with selection events such as in the evolution of sex chromosomes, as found in utosomes . The num00 NL/Mb , except galensis . These v (1.29%) . The rel (1.29%) , and itsS. senegalensis chromosomes 2 and 4 and those of four other fish species, Kimura distances were calculated for all TE copies. Divergence is correlated with the age of the activity [S. maximus, which presents the most amplifications of LTR elements (Class I), with a major and recent burst of activity   . In contt copies . In teleS. senegalensis evolved by Robertsonian fusion accompanied by some additional rearrangements that could be mediated by TEs, given the high number found in the studied sequences. A genome comparison showed more similarities between S. senegalensis and C. semilaevis than with S. maximus. However, synteny results suggested otherwise, indicating that the evolution of the S. senegalensis karyotype has been notably different from those other species.This paper provides data about karyotype evolution in Pleuronectiformes, for which cytogenomics information is scarce. We conclude that chromosomes 2 and 4 of S. senegalensis comprised of 29,184 clones distributed in 384\u2013well plates . The BAC screening was carried out using a 4D\u2013PCR method [The 21 BAC clones used in this study were obtained from a BAC library of R method  as descrR method . BACs weS. senegalensis. The DNA-BAC was purified using Plasmid Midi Kit  following manufacturer\u2019s instructions, and then labelled using Biotin or Digoxigenin Nick Translation Mix , as described by manufacturer\u2019s instructions. Pre-treatment of chromosome preparations and hybridization were carried out following the protocol described by Garc\u00eda-Cegarra et al. [Chromosome preparations were carried out as described by Rodriguez et al. , using la et al. . For thea et al.  were useBAC DNA was purified using the Large Construct kit  and then sequenced using the MiSeq Illumina sequencing platform . BAC annotation was performed as described in Garc\u00eda-Angulo et al. .S. senegalensis and to estimate the distance between them. The order of the contigs in each BAC was obtained using the Ensembl database and Cynoglossus semilaevis genome as reference.For micro-synteny analysis, the program Geneious R11  was usedC. semilaevis (2n = 42), Scophthalmus maximus (2n = 44), Sparus aurata (2n = 48), Gasterosteus aculeatus (2n = 42), Xiphophorus maculatus (2n = 48), Oryzias latipes (2n = 48), Danio rerio (2n = 50), and Lepisosteus oculatus . The EnS. senegalensis and the other fish species was represented using nodes (BACs and fish chromosomes) and edges (number of shared positions) with the igraph package v1.2.5 in R [The correspondence between syntenic regions of 2.5 in R  consider2.5 in R . The maiAfter BAC clone mapping, a statistical analysis of repetitive elements was carried out using a homology-based approach with the Repbase database (release 23.07) and Repeat Masker software v.4.0.9 (from now on RM) . The repS. senegalensis BAC clone sequences per chromosome (Chromosomes 2 and 4), repetitive elements were first identified using RM with the D. rerio RepBase repeat library. Low-complexity repeats were ignored (-nolow) and a sensitive (-s) search was performed. From RM results, S. senegalensis repeat libraries, one per chromosome, were then constructed using home-made scripts and bedtools software v2.25.0 [https://github.com/Eslam-Samir-Ragab/Sequence-database-curator). Subsequently, syntenic regions from C. semilaevis, S. maximus, O. latipes and D. rerio species were mined from the Ensemble database, and the S. senegalensis repeat element libraries were used to identify repetitive elements and their divergences with RM.After pooling  v2.25.0 . SequencS. senegalensis TE elements database made per chromosomes (2 and 4) and four fish species, from the closer C. semilaevis and S. maximus, to the more distant species O. latipes and D. rerio, was carried out.A Kimura distance-based copy divergence analysis relative to the https://github.com/rmhubley/RepeatMasker). Results were analyzed per family and they were also grouped for the four different types of TEs  [Perl scripts were used to calculate divergence analytic measures on the RM alignment files and to create a Repeat Landscape graph using the divergence summary data (sposons) ."}
+{"text": "Based on the preliminary results, a verification replicated test was conducted with 3 g-VS L\u22121 d\u22121 loading rate and different SM/CS ratios . Results showed that a SM/CS ratio of 2/1 was optimal, based on maximum observed methane-VSdes generation and carbon conversion efficiency . Amplicon sequencing analysis suggested that microbial diversity was increased with CS loading. Amino-acid-degrading bacteria were abundant in the treatment groups. Archaea Methanoculleus could enhance biogas and methane productions.Long-term anaerobic co-digestion of swine manure (SM) and corn stover (CS) was conducted using semi-continuously loaded digesters under mesophilic conditions. A preliminary test was first conducted to test the effects of loading rates, and results indicated the 3 g-VS L There is an abundant supply of swine manure (SM) on livestock farms that contains plentiful organic matter, which may be used as feedstock in anaerobic digesters. However, the carbon/nitrogen (C/N) ratio for SM is around 6 to 8, depending upon pig growth stage, which is often too low for an anaerobic digestion (AD) to efficiently utilize the nutrients and function properly . In addi\u22121 in the last decade [Corn is one of the most important cereals in the world, accounting for an average production of 840 million metric tons yeart decade . Considet decade . In addi4 yields in batch digestion tests in comparison with rapeseed and sunflower. Zhang et al. [Methanosaeta as the dominant archaeal community. Gao et al. [Methanosaeta was the dominant methanogen in a dairy manure production-scale biogas plant. Literature that documents long-term semi-continuous and microbial community of anaerobic co-digestion of SM and CS is limited outside of the research cited, suggesting that additional exploration into the function and composition of co-digestion communities is warranted. Co-digestion of SM and CS was first studied by Fujita et al., the addition of CS to SM enhanced biogas production in both mesophilic 39 \u00b0C) and thermophilic (55 \u00b0C) anaerobic digestion  \u00b0C and t. Cuetos g et al.  studied o et al.  also fou\u22121 d\u22121), and characterizing biogas and methane productions, and microbial community in the different ratios of SM/CS digesters, pH value and other variables were also recorded. This will be helpful for the practical industrial application of anaerobic co-digestion.The objectives of this paper were to systematically monitor the long-term and stable biogas production of co-digesting SM with CS, in semi-continuously loaded lab-scale digester. By adjusting manure to stover ratio in fixed VS loading . All jars were swirled three times  per day to enhance mixing.The experiments were conducted at the University of Missouri College of Agriculture, Food and Natural Resources . The digesters consisted of wide-mouth 1.89 L  glass bottles with a working volume of 1.38 L. Each digester was equipped with a rigid plastic duct for pumping nitrogen and collecting biogas, which was connected with soft plastic pipe. The digesters were maintained at 38 \u00b1 1 \u00b0C. A 21 days\u2019 hydraulic retention time (HRT) was achieved by adding/removing the same volume of substrate/digestate (131 mL) every 2 days. Biogas volume and COFresh SM in this study was collected from a grow-finish barn in central Missouri (USA). The farm raised antibiotic-free pork, and had a solid-liquid separation manure collection system that separated a significant portion of solid manure. The manure samples used in the tests were collected from the solid manure storage pile. The collected manure was stored in 5 gallon (18.9 L) buckets, with air-tight lids, and kept frozen at \u221220 \u00b0C. The frozen manure was thawed for about 24 h at room temperature prior to use. A sample from each bucket was collected and measured for total solids (TS) and volatiles solids (VS) contents, following EPA method 1684 . The TS The CS sample was obtained from a corn field of South Farm Research Center  in November, 2016. The CS sample was first cut into 6\u20138\u2032\u2032 (20\u201327 cm) sections, and were then ground to the size of 8-mesh (2.36 mm) by an electric grinder. The ground CS was stored in dry black plastic bags and at room temperature until use. Samples of the ground CS were sent to the University of Missouri Agricultural Experiment Station Chemical Laboratories for cellulose and lignin content analysis. Measurements of the cellulose and lignin contents were conducted using published standard methods .\u22121 d\u22121. The average biogas production was about 1246 \u00b1 515 mL d\u22121. The inoculum had a TS of 2.20%, and a VS that was 64.92% of TS.The inoculum was collected from semi-continuous anaerobic digestion jars that had been steadily producing biogas for over three months with an organic loading rate (OLR) of 2 g-VS L\u22121 d\u22121) and three SM/CS ratios  onto biogas and methane production. A total of 12 digesters were used in Test 1, which were three control digesters, and three groups of digesters for three VS loading rates, and within each group there was one each with the three SM/CS feedstock ratio. Naming of the digesters was based on the VS loading rate, followed by the SM/CS ratio. For example, a digester that was loaded with 3 g-VS L\u22121 d\u22121 and SM/CS ratio of 1:2 was labeled as digester 3-1-2. A preliminary test (Test 1) was first conducted to compare the effects of three loading rates  were immediately loaded with the corresponding feedstock, without a stabilizing or adopting period. Most of the digesters , appeared to have stopped producing biogas when the pH values dropped below 6, which occurred within the first 10 days. The failed digesters were restarted using the digestate of working digester, and allowed to undergo a longer start-up and stabilization period. The preliminary test digesters with 2 g-VS L\u22121 d\u22121, After that, #4 to #9 (\u22121 d\u22121 for 1 HRT (21 days). Digesters #7, #8, and #9 , jar #2 was 2-2-1, and jar #3 was 2-1-2, and so on.Test 1 was conducted for 5 HRT (105 days). Each jar was flushed with nitrogen for 30 s at a flow rate of 20 L/min before being sealed and placed into an incubator after initial feedstock addition. At the first 32 days , with three SM/CS ratios  and controls , for a total of 12 jars. Other conditions were the same as in Test 1.Based on the results of Test 1, a complementary test (Test 2) was conducted to provide higher statistical confidence power of tests among the co-digestion treatments and a promising VS loading rate of 3 g-VS LBiogas produced from each digesters was collected using 10-L Tedlar bags, which was measured for volume every 4 days. The volume of biogas was estimated directly by measuring height of bags and applying a bag height-to-volume relationship equation. Said equation was established by relating the height of three bags filled with various volumes of nitrogen gas and room air to their respective volumes using a precision volume syringe .2) concentration from 100%. The CO2 concentration was measured by using a CO2 analyzer . The pH of digestate was measured every 2 days, with a pH monitor . Calibration was conducted by using two known pH solutions (4.0 and 7.0). Before measuring pH, each digester was swirled thoroughly, and the pH probe was kept in the digestate for over 1 min to ensure equilibrium before readings were taken. Total alkalinity (TA) measurement was conducted by using an Alkalinity Test Kit . Digestate sample was diluted at 1:100 ratio by using distilled water. Ammonia concentration was measured using ammonia (un-ionized ammonia (NH3) and the ammonium ion (NH4+) Test Kit , and the digestate was typically diluted at 1:3000 level. The result was reported in mg L\u22121 as calcium carbonate.Total solids and VS of the feedstock and digestate were analyzed following EPA method 1684 . Methaneg at room temperature, added with ammonium acetate, incubated on ice, and centrifuged again. Secondly, supernatant was mixed with one volume of chilled isopropanol and incubated for 30 min on ice. Finally, the analysis will follow standard operating procedures for the mechanical disruption, incubation, centrifugation, DNA sample purification and identification, and data analysis [For microbial community analysis, fresh digestate (containing liquid and solid portions) samples were collected from each of the 12 jars in Test 2 and sent to University of Missouri Metagenomics Laboratory. Firstly, samples were mechanical disrupted using a tissue lyser, centrifuged at 5000\u00d7 analysis .Extracted digestate DNA was processed at the University of Missouri DNA Core Facility. Bacterial 16S rRNA was amplified using modified universal primers 515F (5\u2032-GTGYCAGC MGCCGCGGTAA-3\u2032)  and 806RQIIME version 1.9.1 software was used to perform de novo and reference-based chimera detection and removal, and remaining contigs were assigned to Operational Taxonomic Units (OTUs) using a 0.03 OTU definition (97% sequence similarity cut-off level). Taxonomy was assigned to selected OTUs using BLAST against the Greengenes database of 16S rRNA gene sequences.Spreadsheet software  were used for analyzing and graphing. A statistics software package, SPSS Atatistics 22  was used for analyzing correlation of different items. Analysis of variance (ANOVA) was used for analyzing significant difference among treatments. \u22121 d\u22121, the biogas productions were 1500\u20131750 mL d\u22121, which compared fairly well with the control digester at 1,654.5 mL d\u22121. In period b, the VS loading rate of the treatment digesters was increased to 3 g-VS L\u22121 d\u22121. After only 8 days, the biogas volume already showed an increasing trend following the increased VS loading rate, when compared with the control digesters. After loading as designed in period c, the biogas production rates of jars with 4 g-VS L\u22121 d\u22121  rapidly increased to higher values with respect to the control digesters, and stabilized in less than 1 HRT (21 days).Biogas production rates of every four-day period are presented, and divided into periods a, b, and c for comparisons A. During\u22121, respectively. Biogas production of C2 was 30.2% higher than C1, while C3 was only 5.2% higher than C2, which indicates that the biogas production was not proportional to the VS loading rate of SM. Furthermore, the biogas production per VS-destroyed (VS des) can reflect the efficiency of digester in utilizing the feedstock. When comparing the biogas-VS des among the controls, they were 97.8, 112.0, and 92.2 mL g\u22121-VS des, for C1, C2, and C3 respectively. Although C3 produced the most biogas volume, it had the lowest utilization of feedstock. The results suggest that the biogas production efficiency is best by considering both VS loading and system limitation. The relatively lower biogas production rate at the 4 g-VS L\u22121 d\u22121 loading rate was most likely due to the digester retention time, volume and quantity of microorganisms.Results presented in this paper are based on period c post-equilibrium (72\u2013120 days), \u22121. The minimum biogas volume was recorded for the 2-1-2#3 treatment on 84 days, which was 1083 mL d\u22121. Comparing all the treatments, the 2-1-1#1 digester had the highest biogas per VS destroyed, at 115 mL g\u22121-VS des, although due to the limited nutrients (VS) in digester #1, it did not produce the most biogas. The biogas-VS des of digester 4-2-1#8 was 101 mL g\u22121-VS des, the VS loading was 4g L\u22121 d\u22121, which produced the most overall biogas, although the digestion efficiency was not proportional to the VS loading rate. As a comparison, the C1 digester was added with 26.8 g of SM every 2 days, while the digester 4-1-1#7 was added with 26.8 g of SM and 6.4 g of CS. Both digesters had same quantity of SM added, but with different amounts of CS and dilution water. Nevertheless, the digester 4-1-1-#7 produced 2,878 mL d\u22121 of biogas, which was only 35.5% higher than the C1 digester (4 vs. 2 g-VS L\u22121 d\u22121), at 1,856 mL d\u22121 of biogas. The digester 4-1-1-#7 produced 1,952 mL d\u22121 of methane, and the C1 digester produced 1405 mL d\u22121 of biogas, or 28.0% more than C1. These findings confirmed the feasibility to co-digest SM with CS, although one should expect lower digestion efficiency for the CS feedstock.Comparing the different SM/CS ratios, the SM/CS of 2/1 produced more biogas than other ratios per VS loading rate, in general, biogas production rate was SM/CS = 2/1 > SM/CS = 1/1 > SM/CS = 1/2 . This in\u22121 d\u22121 were similar, averaging 74% and 70%, respectively. For treatment digesters with VS loading of 4 g-VS L\u22121 d\u22121, the methane concentration of jar 4-2-1#8 was 69.13% higher than 4-1-1#7 (67.88%) and 4-1-2#9 (67.25%). The highest methane volume was produced by the digester of 4-2-1#8 (104 days), which was 2,147 mL d\u22121. The lowest biogas volume was produced by the 2-1-2#3 (84 days) at 909 mL d\u22121. On average, digester 4-2-1#8 produced the most methane , but the digester 2-1-1#1 produced the highest methane volume per VS des (84.4 mL d\u22121), most likely limited by the lower feedstock nutrients.The methane generation of C1, C2 and C3 was observed to have decreased almost proportionally  such tha\u22121 d\u22121 and 4 g-VS L\u22121 d\u22121. The higher pH values were caused by the high organic matters with SM, which was also producing higher biogas generation.The pH values of digesters C2 and C3 were similar, and averaged 7.87 and 7.86, respectively, just slightly higher than C1, of 7.61 . For all3 L\u22121. Ammonia concentrations of the control digesters were also higher than treatment digesters. The ammonia content of all treatments was similar, 800 mg NH3 L\u22121, except 4-2-1#8 was 1600 mg NH3 L\u22121. Ammonia concentration of C3 was 4000 mg NH3 L\u22121.Total alkalinity of the controls was higher than all the treatments, regardless of VS loading . The hig\u22121 d\u22121) but with different ratios of SM/CS  were averaged and are presented in Variation of biogas and methane productions at a same VS loading rate (3 g-VS L\u22121) was identical to 2-1 , but significantly higher (p < 0.01) than 1-1 (2284 mL d\u22121) and 1-2 (2166 mL d\u22121), respectively. After that, the control digesters produced higher biogas than the others in second HRT and the trend was similar to those of Test 1. In general, greater CS in the feedstock result in lower the biogas and methane contents, especially towards the end of the monitoring period. The average biogas production of Controls (2415 mL dIn \u22121) was comparable to 2-1 (1812 mg L\u22121) (not significantly different), but higher (p < 0.01) than 1-1 (1700 mg L\u22121) and 1-2 (1542 mg L\u22121), respectively.Similar to the biogas production, average methane production of the control digesters  and 2-1 (57.46%) were higher than the control (54.81%), except for the 1-2 (50.11%), which can be seen by comparing the VS content of the digestate. The control group pH value was lower than 2-1 group before the first HRT, nevertheless, higher after the first HRT . The pH 3 L\u22121, compared with the treatments, which were all below 7667 mg-CaCO3 L\u22121. More SM loading leads to higher TA concentration, suggesting that the CS loading can decrease TA and stabilize the AD process, a benefit of co-digestion. Ammonia concentration of 2-1 (2667 mg L\u22121), 1-1 (1467 mg L\u22121) and 1-2 (867 mg L\u22121) were all lower than the control of single feedstock of SM. More CS addition also could increase stability of the AD process, by decreasing ammonia concentration.Similar to Test 1, TA of the control digester had the highest value, 9500mg-CaCOp < 0.01) than 1-2 (2.83%), and 1-1 (2.55%). The C/N ratio is an important indicator for controlling the biological treatment system of AD. In The effective carbon conversion efficiency (ECCE) was calculated using Equation (1):Carbon supplied was the carbon content including digestate and raw materials. Methane density is 0.717 g/L (1 atm). The carbon conversion efficiency was of 2-1 was the highest, 40.59%, 1-1 was 39.57%, 1-2 was 37.73% and controls group was seen to have 36.78% . ControlThe predominant microorganism community at phylum level (abundance >1%) is depicted with stacked bars in p < 0.05), which was also likely the reason that the biogas production rate of 2-1 (2414.8 mL d\u22121) was higher than others and very close to the control group (2415 mL d\u22121). Firmicutes was the most abundant in all treatments, averaging 77.16%, 44.13 \u00b1 6.08%, 63.33 \u00b1 4.42%, and 43.95 \u00b1 2.14% for the control, 1-1, 2-1, and 1-2 groups, respectively. The relative abundance of Firmicutes was significantly higher in group 2-1 than in groups 1-1 and 1-2. Proteobacteria was less abundant in the control (0.77%) and 2-1 (0.74 \u00b1 0.23%) groups, but relative abundant in the 1-1 (4.46 \u00b1 1.87%) and 1-2 (4.68 \u00b1 1.39%) groups. The abundances of Synergistetes were 0.40%, 1.50 \u00b1 0.14%, 1.06 \u00b1 0.03% and 1.52 \u00b1 0.20% for the control, 1-1, 2-1, and 1-2 groups, respectively. The phylum Spirochaetes and Cloacimonetes had interesting distribution, they were 0.009% and 0.003% in the control sample, respectively, but Spirochaetes was much abundant in the treatment groups of 1-1 (4.71 \u00b1 0.52%), 2-1 (2.30 \u00b1 0.45%) and 1-2 (1.89 \u00b1 0.72%). The relative abundance of Spirochaetes was significantly higher in group 1-1 than in groups 2-1 (p < 0.01) and 1-2 (p < 0.05). The abundances of Cloacimonetes were 5.65 \u00b1 0.96%, 3.13 \u00b1 0.04% and 10.5 \u00b1 1.80% for the 1-1, 2-1, and 1-2 groups, respectively. The relative abundance of Cloacimonetes was significantly higher in group 1-2 than in groups 1-1 (p < 0.05) and 2-1 (p < 0.05). Meanwhile, group 1-1 was significantly higher than 2-1 (p < 0.05).Euryarchaeota was found to be the only primary archaea in each sample, which was highly diverse and included methanogens, and the relative abundances of Control, 1-1, 2-1 and 1-2 were 3.00%, 3.89 \u00b1 0.68%, 4.05 \u00b1 0.15%, and 2.36 \u00b1 0.24%, respectively. The relative abundance of Euryarchaeota was significantly higher in group 2-1 than in group 1-2 (The predominant microorganism at genus level (abundance > 1%) is depicted with stacked bar charts in Gelria were 12.40%, 1.27 \u00b1 0.27%, 2.20 \u00b1 0.58% and 1.93 \u00b1 0.19% for the Control, 1-1, 2-1, and 1-2 groups, respectively. The abundances of Ruminiclostridium 1 were 9.49%, 6.18 \u00b1 0.71%, 3.65 \u00b1 0.30% and 6.98 \u00b1 0.61% for the Control, 1-1, 2-1, and 1-2 groups, respectively. The relative abundance of Ruminiclostridium 1 was significantly higher in group 2-1 than in groups 1-2 (p < 0.01) and 1-1 (p < 0.01). The abundance of Caldicoprobacter were 7.09%, 3.29 \u00b1 0.24%, 5.60 \u00b1 0.26% and 0.94 \u00b1 0.14% for the Control, 1-1, 2-1, and 1-2 groups, respectively. The 2-1 group was significantly higher than 1-1 group (p < 0.01), and 1-1 group was significantly higher than 1-2 group (p < 0.01). Some other genera abundances in Control were less than 1%, nevertheless higher values were observed in the treatment groups. The abundances of 1-2 were 6.90 \u00b1 4.03%, 2.31 \u00b1 0.77%, 8.37 \u00b1 2.65% and 10.50 \u00b1 1.80% for the Ruminofilibacter, Mobilitalea, uncultured  and uncultured (family Cloacimonetes-W5), respectively, all were significantly higher than 1-1 (p < 0.05) and 2-1 (p < 0.05) groups. The abundances of archaea Methanoculleus were 2.84%, 3.44 \u00b1 0.67%, 3.65 \u00b1 0.16% and 1.49 \u00b1 0.48% for the Control, 1-1, 2-1, and 1-2 groups, respectively. Groups 2-1 (p < 0.01) and 1-1 (p < 0.05) were significantly higher than 1-2.Relative high abundance of uncultured genera was found, some were part of family Peptococcaceae. The abundances of Peptococcaceae were 20.38%, 0.80 \u00b1 0.04%, 0.66 \u00b1 0.04% and 0.53 \u00b1 0.10% for the Control, 1-1, 2-1, and 1-2 groups, respectively. The abundances of \u22121 d\u22121) like in this study [3 kg\u22121 VSfeed\u22121) that was reported by Cuetos, which is probably because of the different HRT and SM loading rates [Fujita et al. reported CS enhanced gas productivity by more than 65% in mesophilic 39 \u00b0C) digestion in comparison with dried SM only, under CSTR, but only adding 2% w/v CS, rather than the feedstock based on VS loading rate  than 1-2 (2.83%), and 1-1 (2.55%). This was likely the main reason that the 2-1 group produced the most biogas and methane. Cheng et al. found the carbon conversion efficiency (including CO2) of food waste and sewage sludge was 63.3%. The efficiency may be due to substrate that is more readably degradable  than SM and CS [An early study conducted by Sievers and Brune revealed that the optimal C/N range (adjusted by adding either urea or glucose to the flask digesters) for SM digestion in terms of maximum methane production, was from 15.5/1 to 19/1 . Wu et aM and CS .2, which is then utilized by hydrogenotrophic methanogens [p < 0.05), while there was no significantly difference among other treatments. Tenericutes comprises a single class, Mollicutes, which were previously classified within the Firmicutes [p < 0.05) with pH values for the treatment groups of 1-1, 2-1 and 1-2. Proteobacteria was relative abundant in the 1-1 (4.46 \u00b1 1.87%) and 1-2 (4.68 \u00b1 1.39%) groups. Proteobacteria was also the predominant phyla detected by Lee et al. in full-scale anaerobic digesters [Amplicon sequencing results indicated Firmicutes was the most dominant phylum. The dominance of Firmicutes in biogas reactors is in accordance with previous studies ,31. Firmhanogens . Firmicuhanogens . All abormicutes . Recent rmicutes . Bacterormicutes . Acetateigesters . Spirochigesters . There iPeptococcus, Peptostreptococcus, and Ruminococcus) of presently known gram-positive, anaerobic, coccal organisms, and they were capable of fermenting protein decomposition products [Gelria were 12.40%, 1.27 \u00b1 0.27%, 2.20 \u00b1 0.58% and 1.93 \u00b1 0.19% for the Control, 1-1, 2-1, and 1-2 groups, respectively. Gelria can degrade glutamate to ammonia [Ruminiclostridium genus contains anaerobic bacteria, which is believed to develop different strategies to depolymerize the cellulose and the related plant cell wall polysaccharides [Ruminiclostridium1 were 9.49% for the Control group. The results indicated that addition of CS could also increase Ruminiclostridium 1 abundance in the treatment groups, which is consistent with the function that Ravachol et al. reported. More CS loading leads to greater Acholeplasma abundance [Acholeplasma is also implicated in the first step of degrading polycyclic aromatic hydrocarbons [Caldicoprobacter was isolated from an Algerian hot spring that is an obligatory heterotroph fermenting sugars. End-products from glucose fermentation were acetate, lactate, ethanol, CO2, and H2 [Caldicoprobacter was also detected from continuous stirred tank reactors digesting chicken manure at mesophilic temperature [Ruminofilibacter, Mobilitalea, uncultured  and uncultured (family Cloacimonetes-W5) for treatment groups were extreme significant (p < 0.01) higher than control groups. Group 1-2 was seen to have the highest abundance in all treatments. Ruminofilibacter is hydrolytic bacteria while some species process hemicellulolytic activities [Mobilitalea belongs to family Lachnospiraceae. Lachnospiraceae is VFA-producing bacteria, one of many unclassified species that belonged to a group comprising soluble polysaccharide-degrading bacteria [At genus level, an assumption can be made that adding CS can decrease the abundance of Peptococcaceae. Peptococcaceae is proposed as a new family in the order Eubacteriales to include three genera  and cow manure and cattle manure with agricultural residues were systematically ,47,48. I\u22121 d\u22121, 2/1 and 14/1, respectively. The highest effective carbon efficiency was also detected at SM/CS = 2/1. High biogas production wasn\u2019t representative of effective energy and carbon conversion efficiency. Microbial diversity increased with CS loading. Amino-acid-degrading bacteria was abundant in the treatment group. Archaea Methanoculleus was the most abundant microorganism beneficial for producing biogas. On the contrary, hydrolytic and acid-producing bacteria  were observed to be associated with lower biogas production. An extended stabilization of anaerobic co-digestion with SM and CS substrates was conducted. The optimal VS loading, SM/CS and C/N were 3 g-VS L"}
+{"text": "In vitro drug release study was calculated to be 80% in 24 h. The formulation in blood was found to be safe; a study of hemolysis confirmed this. Breast cancer cell line MCF-7 was used to test cytotoxicity and cellular interaction of cisplatin-loaded SLNs with an IC50 value of 6.51 \u00b1 0.39 \u03bcg/mL. Overall, the results of our findings show that the approach of SLNs-based, cisplatin-based, drug delivery has led to increased sustainability in breast cancer therapy with superior biocompatibility.Cisplatin is one of the most leading potent chemotherapy drugs prescribed for the treatment of most solid tumors. However, the induction of toxicities and the development of resistance restricts its applications. Efforts are made in the proposed study to control the delivery of cisplatin to tumor sites by incorporating it into solid lipid nanoparticle (SLNs) drug carriers. By considering this fact, in the current research work, a single-step, one-pot, microwave-assisted technology was used to produce cisplatin-loaded SLNs. The shape of the SLNs was observed to be spherical, with a uniform size distribution of 74.85 nm, polydispersity index (PDI) of 0.311, and zeta potential of \u221220.8 mV. The percentage of encapsulation efficiency was found to be 71.85%.  Breast cancer (BC) in women throughout the globe is one of the deadliest and secondary-most prevailing causes of mortality. It is expected and anticipated to surpass the mortality rate of heart diseases in upcoming years . The AmeTreating breast cancer is a massive clinical hurdle due to its heterogeneity, complexity, and aggressiveness . Conventin vitro drug release in cisplatin-loaded SLNs could facilitate site-specific drug delivery with improved local availability in a controlled drug-release pattern. We find a scalable approach that uses biocompatible excipients to deliver rapid synthesis of nanoparticles. This method offers a one-pot synthesis straight from the microwave reactor that yields purified nanoparticles.Several site-specific drug delivery-based formulations using different nanocarrier systems like liposomes, dextran conjugates, as well as polymeric micelles, have been reported to improve the effective release of cisplatin and to govern its premature release . In the Cisplatin, stearic acid, Tween 80 and glyceryl trimyristate were purchased from Sigma-Aldrich, Durban, South Africa. MTT -2,5-diphenyltetrazolium bromide) was purchased from Sigma-Aldrich . All other chemicals and solvents used in the studies were either bought from Merck or Sigma-Aldrich, Durban, South Africa, and were of analytical grade. The pH study was performed with 0.1 M phosphate buffer which included sodium dihydrogen orthophosphate dehydrates  and sodium dibasic dehydrates . Throughout the experiment, double distilled water (DDW) was used.w/w with respect to lipid mass) [The solubility of cisplatin in different lipids was assessed with slight alterations according to previously reported techniques (id mass) . The morid mass) . The meaA microwave-based technique was used to prepare cisplatin-loaded SLNs with slight modifications to the method reported earlier . A fixedThe shape and size of the optimized finally prepared SLNs were investigated by transmission electron microscopy (TEM) on a Jeol, JEM-1010 . Morphology study of cisplatin-loaded SLNs was performed by TEM following the previously described procedure with some modifications ,34. In sThe photon correlation spectroscopy (PCS) technique was used to determine the size, size distribution, and zeta potential of the SLNs. Cisplatin SLNs was diluted in PBS for this purpose, and its absorption was calculated at 630 nm using a spectrophotometry technique. Then, a Zetasizer tool  was introduced to the suspension. r2) were y = 0.0103x + 0.0056 and 0.9991, respectively. The percentage encapsulation efficiency (% EE) was calculated as per Equation (1):With a pre-established calibration curve, UV spectrophotometry  at 307 nm was used to determine the efficacy of encapsulation. In the phosphate-buffered solution , lyophilized nanoparticles were dissolved. It was sonicated for 20 min, and then centrifuged at 1000 rpm for 10 min. Two hundred microliters of the filtrate was taken off and diluted to 10 mL using the phosphate-buffered solution, and the amount of encapsulated drug was estimated using UV spectrophotometry. The equations of correlation and linearity . The dialysis bag was soaked in distilled water for 12 h before use . In a dialysis bag, a 2 mL aliquot of prepared cisplatin-loaded SLNs was taken in amber-colored glass bottles, and 50 mL preheated release medium was immersed in the bottles. The bottles were placed in a 37 \u00b0C and 150 rpm thermostatic shaker. At predetermined time points, an aliquot of 5 mL of release medium was removed and immediately substituted with the same amount of new PBS to preserve sink conditions. Spectrophotometric analysis of the quantity of drug in the aliquot was performed at 307 nm.Study of At is the absorbance of treated supernatant, Ac is the absorbance of negative control, and Ax is the absorbance of positive control.The hemo-biocompatibility of the newly synthesized cisplatin-loaded SLNs was carried out by blood hemolytic tests. It was carried out with a slide modification of the technique stated in the earlier protocol . A blood2 incubator. After 24 h of cell incubation, cells were further treated with different concentrations of cisplatin-loaded SLNs, and were kept for 48 h at 37 \u00b0C. After 48 h, supernatant was removed and washed with 200 \u03bcL of phosphate-buffered saline (PBS). It was then substituted by addition of 200 \u03bcL of medium (DMEM for cancer cells) and 30 \u03bcL of 5 mg/mL of MTT. The plates were incubated at 37 \u00b0C for 4 h. The supernatant was removed from cell incubation and 50 \u03bcL of dimethyl sulfoxide (DMSO) was added. A microplate reader was used to evaluate MTT study at 570 nm wavelength and 630 nm reference wavelength. Experiments were performed in triplicate. IC50 values were determined from in vitro dose-response curves using linear regression analysis [MCF-7 breast cancer cell lines were used to carry out the cytotoxicity study. Briefly, 96-well plates with 5000 cells/well of MCF-7 were taken, then, kept the cell lines to grow for 24 h. After completion of 24 h, in 96-well microtiter plates, 100 \u03bcL of cells were inoculated at plating densities depending on the developmental characteristics of each cell, and then were incubated at 37 \u00b0C for 24 h in a 5% COanalysis . The datUsing TEM, the cisplatin-loaded SLNs\u2019 ultrastructural morphologies were examined. It was found that the shape of the prepared formulation was small, circular and homogenously uniform, displaying little aggregation, as shown in The intrinsic size, shape, and surface features need to be evaluated in the design and formulation of nanoscale delivery agents, as they all impact biocompatibility. This was done to accurately determine, in real time, the size, dispersion, and colloidal stability. Zeta (\u03b6) potential is the magnitude of the electrostatic potential produced between the particle and the dispersing medium at the edge of the slipping plane. Sedimentation through centrifugation is an easy, reliable, and accurate way to remove the unbound drug. Drug-bound nanoparticles will sediment at different velocities based on viscosity, size, and mass. Drugs bound to the nanoparticles are generally of higher size and mass and will consequently pellet, while unbound drug will remain in the supernatant. The percent encapsulation efficiency was calculated to be 71.85%, which correlated to TEM. The calculated encapsulation efficiencies were used to determine the actual drug content in nanoparticles based on the theoretical drug content from which dilutions were made for cytotoxicity studies.in vitro drug release study was conducted for 48 h. The dialysis bag method was applied to calculate the amount of cisplatin produced from the SLNs. This is the most commonly used technique for estimating drug releases from SLNs reported in the literature. For the prepared formulations, a biphasic release profile was noted as shown by the first burst within 3 h followed by a prolonged release. Through two distinct processes, dissolution and diffusion, cisplatin loaded into the SLNs\u2019 core leached gradually. Cisplatin\u2019s initial burst release can be attributed to the drug\u2019s rapid release incorporated into the shell. The drug release from the SLNs was anticipated to be very slow due to the strong core at body temperature. An in vitro hemolysis percentage of cisplatin-loaded SLNs is shown in The hemolytic characteristics of cisplatin during chemotherapy are also accountable for the greater risk of blood disorders such as anemia. The assessment of SLNs hemo-compatibility should be regarded as one of the variables for evaluating systemic toxicity. The current findings show that cisplatin-loaded SLNs did not induce hemolysis. The current findings suggest that the percentage of hemolysis following cisplatin-loaded SLNs therapy was smaller relative to plain cisplatin therapy. The present research shows that there was no important difference in the proportion of hemolysis, suggesting that the formulations had no effect on circulating blood cells or on their production. These preliminary findings state that cisplatin loaded in SLNs can be used instead of free cisplatin for cancer treatment to minimize potential side effects. The 50 value of 6.51 \u00b1 0.39 \u03bcg/mL on the breast cancer cell line, whereas the IC50 value of free cisplatin for MCF-7 cells was 10 \u03bcg/mL. It also promoted the fragmentation of DNA which was linked to the induction of cell death by apoptosis. The findings showed that in the study of MCF-7 cell lines, the prepared formulation was effective. From The cytotoxicity of the prepared formulation was evaluated to establish and confirm the biocompatibility of drug and excipients using an MTT assay, as shown in w/w), particularly because of the single-pot nature of the microwave method, which allows simultaneous encapsulation of the drug with the formation of SLNs, a high entanglement efficiency, and load capacity. In summary, these results highlighted that cisplatin SLNs enhanced anticancer efficacy in MCF-7 cancer cells.The clinical success of cisplatin, a well-known anticancer drug, is greatly affected by its nonspecificity and serious dose-limiting toxicities. The microwave-assisted microemulsion method was used in the preparation of SLNs loaded with cisplatin. To improve its ability, we have developed a new stearic acid-functionalized SLNs as cisplatin carrier. The drug-loaded SLNs were within the nanosize range (70.04 nm) and showed a zeta potential of \u221220 mV, entrapment efficiency of ~70\u201390%, and loading capacity of 3.6\u20134.6% ("}
+{"text": "Haplopappus baylahuen Remy (bailahuen) and Aloysia citriodora Palau (cedron) inhibit the growth and ability of Salmonella Enteritidis to form biofilms and to adhere to human intestinal epithelial cells. Herein, we first determined the total phenolic content and antioxidant and antibacterial activities of the extracts. Then, Salmonella Enteritidis was treated with the extracts to analyse biofilm formation by scanning electronic microscopy and the violet crystal test. We also measured the efflux pump activity of Salmonella Enteritidis since biofilm formation is associated with this phenomenon. Furthermore, the human intestinal cell line Caco-2 was infected with Salmonella Enteritidis pretreated with the extracts, and 30\u2009min later, the number of bacteria that adhered to the cell surface was quantified. Finally, we determined by qPCR the expression of genes associated with biofilm formation, namely, the diguanilate cyclase AdrA protein gene (adrA) and the BapA protein gene (bapA), and genes associated with adhesion, namely, the transcriptional regulator HilA (hilA). The phenolic content and antioxidant and bactericide activities were higher in bailahuen than in the cedron extract. Biofilm formation was inhibited by the extracts in a dose-dependent manner, while the activity of efflux pumps was decreased only with the cedron extract. Adhesion to Caco-2 cells was also inhibited without differences between doses and extracts. The extracts decreased the expression of adrA; with the cedron extract being the most efficient. The expression of hilA is affected only with the cedron extract. We concluded that hydroethanolic extracts of bailahuen and cedron differentially inhibit the growth of Salmonella Enteritidis and affect its the ability to form biofilms and to adhere to human intestinal epithelial cells. These results highlight the presence of molecules in bailahuen and cedron with a high potential for the control of the Salmonella Enteritidis pathogenesis.We analysed whether the hydroethanolic extracts from leaves of  Salmonella enterica subspecies enterica is a worldwide common pathogen that causes foodborne diseases [enterica subspecies is subdivided into two groups: typhoid and nontyphoid strains [Salmonella infections [Salmonella Enteritidis is the predominant strain in most countries, and the most common in clinical isolates [diseases . The ent strains . Some re strains . From 20 strains , 4. In A strains . The cos strains . In Chilfections . From thisolates , 7.Salmonella Enteritidis; this pathogen is able to form biofilms on the production equipment and the poultry's gut. The presence of biofilms of pathogenic microorganisms in the food industry has a serious risk for human health [diguanilato cyclase AdrA), which is involved in cellulose synthesis necessary for biofilm formation [Salmonella Typhimurium [Salmonella. After the ingestion of contaminated food, Salmonella adheres into the intestinal epithelium via adhesions of its fimbriae, which apparently bind to membrane proteins, glycosylated residues, or lipid structures [Salmonella converts to adhesion protein SiiE , which is essential to establish cell contact that allows the translocation of effector proteins facilitating the entry of Salmonella [Salmonella Enteritidis mutants \u2206hilA showed a reduced ability to adhere to and invade the human intestinal epithelial cell line Caco-2 [The poultry industry represents the most important reservoir for n health \u201310. Biofn health . CsgD alormation , 13. Recormation . Studieshimurium , elucidaructures , 17. In lmonella . The Siie Caco-2 .Salmonella infective capacity. In this context, Almeida et al., in 2018, tested in silico 107 common compounds in plants and their effect on biofilms, and it was observed that 83.2% of the compounds were able to inhibit the formation of Salmonella Enteritidis biofilms. Most of these compounds correspond to flavonoids, methoxyphenols, and monoterpenes. There is evidence on the inhibitory effects of some secondary plant metabolites in sublethal doses on biofilm formation of Salmonella. The berberine alkaloid inhibits biofilm formation at a concentration of 0.625\u2009mg/ml [Salmonella Typhi [Haplopappus baylahuen (bailahuen) and Aloysia citriodora Palau (cedron) are common plants in South America with medicinal properties including treatment for stomach and liver ills [Haplopappus baylahuen have a high antioxidant capacity [Salmonella Enteritidis was treated with sublethal doses of the extracts to determine whether they are able to inhibit the ability of the bacteria to form biofilms and its association with the efflux pump activity and expression of adrA and bapA. Finally, the effects of the extracts on adhesion of Salmonella Enteritidis to the human intestinal cell line Caco-2 and its association with hilA were determined.New compounds with properties that inhibit the formation of biofilms and with the ability to adhere to intestinal epithelial cells could be a good alternative to decrease la Typhi . Haplopaver ills . Extractcapacity , while ccapacity . These cHaplopappus baylahuen (bailahuen) and Aloysia citriodora Palau (cedron) and provisionally deposited in the Department of Biology of Universidad de Santiago de Chile with the registration number of 001/S1 and 002/S1, respectively. The plants were dried at 35\u00b0C for 24 hours. Subsequently, the extraction of dry leaves (3\u2009g) was made with 100\u2009ml ethanol (85% v/v). The samples were sonicated for 60 minutes and macerated for 72 hours, filtered, and dried at 37\u00b0C and then stored at 4\u00b0C until use. The hydroethanolic extracts were diluted with dimethyl sulfoxide (DMSO) 0.1% as vehicle.First, we proceeded to collect the plant material . The pla\u03bcl (0.5\u2009mg/ml) of the hydroethanolic extracts was added to 99\u2009\u03bcl of distilled water and then mixed with 100\u2009\u03bcl of the Folin-Ciocalteu reagent. After 2 minutes of incubation under darkness, 800\u2009\u03bcl of Na2CO3 was added and incubated for an additional of 20 minutes at 40\u00b0C. Absorbance was measured using a spectrophotometer (SmartSpec\u2122 3000) at 740\u2009nm. The total phenolic content was calculated as gallic acid equivalent (\u03bcg\u2009Ac.\u2009eq/ml). We used 0.5\u2009mg/ml of extract because the reagent reacts completely at this concentration. This assay was repeated six times.The total phenols were determined using the Folin-Ciocalteu method . One \u03bcl \u03bcl of the hydroethanolic extract at 0.5\u2009mg/ml was mixed with 100\u2009\u03bcl of 2,2-diphenyl-picrylhydrazyl (DPPH) 150\u2009\u03bcM. Then, the samples were incubated for 2 hours at room temperature and darkness, and the absorbance was read using a spectrophotometer at 515\u2009nm. This assay was repeated six times.To determine the antioxidant activity, we used the method based on Brand-Williams et al. in 1995  with somSalmonella enterica subs. enterica serovar Enteritidis ATCC13076 was used to determine the bactericide activity as well as the Minimal Inhibitory Concentration (MIC) of the hydroethanolic extracts. The MIC was determined in the Mueller-Hinton broth medium with the microdilution method in 96-well plates [8\u2009UFC/ml to 200\u2009\u03bcl final volume. We considered as MIC the lowest concentration where the inhibition of bacterial growth is total [l plates , 28. In is total , 30. Str\u03bcl of Salmonella Enteritidis ATCC13076 adjusted to 1 \u00d7 108\u2009bacteria/ml with sublethal concentrations of the extracts at 1 and 2\u2009mg/ml in LB broth under 24-well plates with cover glasses. The vehicle treatment is LB broth and DMSO. After 24 hours of incubation, the covers were fixed with heat, stained with safranin (0.1%), and dried at 35\u00b0C overnight; then, the covers were mounted on brackets, sputtering with a golden bath and observed using an scanning electron microscope (Zeiss EVO MA10). To quantify the inhibition of a biofilm, a violet crystal test in a 96-well plate was performed. The function of this assay is to determine the ability of the extract to inhibit the biofilm formation of Salmonella in a polypropylene plate. Briefly, 100\u2009\u03bcl of LB broth with 1 and 2\u2009mg/ml of extract and 10\u2009\u03bcl of bacteria cultures adjusted at a concentration of 1 \u00d7 106\u2009bacteria/ml was added into sterile 96-well polystyrene plates and incubated at 37\u00b0C for 24 hours. Then, the biofilm was fixed with methanol 99%, washed with PBS and dyed with crystal violet 0.01% for 15 minutes, washed thrice, and finally 100\u2009\u03bcl of acetic acid 30% was added. The plate with the crystal violet suspension was measured using a Tecan Infinite PRO at 550\u2009nm [We incubated 10\u2009t 550\u2009nm , 32.Salmonella Enteritidis ATCC13076 were suspended in LB broth overnight and then centrifuged, washed, and resuspended in 0.9% saline solution with a final concentration of 2\u2009mg/ml of extract and incubated in a plate of 96 wells at 30\u00b0C for 30 minutes; the inoculum was adjusted to 1 \u00d7 108\u2009UFC/ml. Then, 0.4% glucose and 0.5\u2009g/ml ethidium bromide were added. The plate was measured every 5 minutes for 50 minutes at 520 and 590\u2009nm of excitation and emission, respectively. The equipment used was a TECAN Infinite PRO [A method used primarily to determine the effect of substances on pumps of the RND type (resistance-nodulation-division family transporters) was used. nite PRO , 24. The5\u2009cells/well of the cell line derived from human intestinal carcinoma, Caco-2. Salmonella Enteritidis ATCC13076 were cultivated in LB broth for 18 hours at 37\u00b0C and treated with 1 and 2\u2009mg/ml of extract. The next day, bacteria were centrifuged, washed, and adjusted to 3 \u00d7 107\u2009bacteria/ml in the DMEM medium giving a multiplicity of infection (MOI) of 100 to infect Caco-2 cells for 30 minutes at 37\u00b0C and 5% CO2. Then, the cells were washed three times with PBS and fixed with formaldehyde 4% for 10 minutes and stained for 5 minutes with safranin 0.05%; the covers were again washed until colour is not detached and mounted on a slide with Canada balsam and observed in a light microscope (Zenith Lab Inc. XSZ-107BN). To perform a quantitative analysis, the same assay was replicated with some variations. The bacteria were pretreated with 1 and 2\u2009mg/ml of extracts and infected the Caco-2 cell line with MOI of 100. After incubation, the covers were rinsed 5 times with PBS and treated with Triton X-100 0.1% to determine the colony-forming unit (CFU). The initial and final CFU numbers were normalized to the adhesion capacity of the bacteria without treatment.For this assay, we used 24-well plates with coverslips (12\u2009mm) seeded with 3 \u00d7 10Salmonella Enteritidis ATCC13076 were cultured in LB medium with 1\u2009mg/ml of the extracts. After 24 hours, the bacteria were centrifuged at 12000\u2009g for 10 minutes, and then the RNA was extracted using 600\u2009\u03bcl TRIzol\u2122 Reagent (Invitrogen\u2122) as recommended by the manufacturer. The cDNA was synthesized using the enzyme RevertAid H Minus Reverse Transcriptase (Thermo Scientific\u2122). With the cDNA, rt-qPCR analysis was made on the AriaMx Real-time PCR System (Agilent Technologies) thermocycler with the Takyon\u2122 ROX SYBR\u00ae MasterMix dTTP Blue (Eurogentec) kit using the primers described in \u2212\u0394\u0394Ct method.drA, bapA, and hilA genes were carried out by employing one-way analysis of variance (ANOVA) followed by Bonferroni's post hoc multiple comparison test at a significance level of p < 0.05. The MIC and antiadhesion activity are analysed using the Kruskal Wallis test and the Dunn test.The results are expressed as percentage of the corresponding control (means \u00b1 standard\u2009deviation). Statistical analyses were performed with the program GraphPad Prism 5.01 . The statistical difference of total phenolic content and antioxidant and antibiofilm activities, and the effect on efflux pump activity and on the expression of a\u03bcg of gallic acid equivalent/ml was significantly different when compared to that of the cedron extract which had 1898.3 \u00b1 347.0\u2009\u03bcg of gallic acid equivalent/ml (p < 0.05). On the other hand, the antioxidant activity of the extract expressed as inhibition of DPPH percent showed that the bailahuen extract inhibits by 74.5 \u00b1 4.8% and the cedron extract inhibits by 40 \u00b1 7.8%, indicating that bailahuen is a better antioxidant than cedron (p < 0.05). The antioxidant activity of plant extracts is an essential feature to predict their phytomedicinal attributes. Our results corroborate previous reports showing a direct correlation between the phenol content and the antioxidant capacity of fruits (berry) and culinary (oregano) and medicinal herbal extracts  [Salmonella Enteritidis infection.The results of the Folin-Ciocalteu assay showed that the extract of bailahuen which had a total phenol content of 3899.4 \u00b1 594.6\u2009alerian) \u201338. Phenp < 0.05). The MIC of bailahuen and cedron are high compared to other extracts such as those of Mitracarpus frigidus [Salmonella Enteritidis [We found that MIC was from 9 \u00b1 1.5\u2009mg/ml for cedron to 11 \u00b1 1.5\u2009mg/ml for bailahuen ; this vafrigidus , which heritidis . This inSalmonella Enteritidis regardless of growth inhibition.Establishing the minimum inhibitory concentrations allowed us to determine the sublethal doses (1 and 2\u2009mg/ml) to analyse the effects of the extracts on the formation of biofilms and adhesion of p < 0.05). All treatments with the extracts were statistically different with the control condition (p < 0.05). The quantification results are directly related to those observed in the scanning electron microscope images. It is interesting to note that the extract with less antioxidant capacity is the most effective extract in inhibiting biofilm formation. This situation could be related to the type of compounds present, rather than the amount. There are multiple reports on extracts with antioxidant activity that demonstrate their antibiofilm effect in different microorganisms [In the vehicle group, a dense biofilm formed by multilayers of bacteria tightly linked together was observed , while trganisms \u201345, but p < 0.05); these results indicate that only cedron utilizes this mechanism to decrease biofilm formation in Salmonella Enteritidis. Paradoxically, the bailahuen extract increased efflux pump activity although it also inhibited biofilm formation of Salmonella Enteritidis. This could indicate that the effect of bailahuen on biofilm formation is not mediated by the inhibition of RND efflux pump activity; probably, other efflux pump families or other mechanisms that bind to adhering proteins or cellulose synthesis of the bacteria could be involved in the effect of bailahuen on biofilm formation, but this remains to be proven. The results obtained with cedron could be used to study a possible synergy of this extract with antibiotics in the treatment of multiresistant bacteria. If cedron can inhibit efflux pumps for a certain time, this could mean that antibiotics can be effective before being expelled from the bacteria.The cedron extract inhibits the functioning of the RND pumps between 5 and 20 minutes, while the bailahuen extract stimulated efflux pump activity at 25 and 50 minutes , with siadrA gene by 46.4 \u00b1 6.1% and 32.4 \u00b1 9.6%, respectively, being distinctly different from the control condition (p < 0.05). Interestingly, the extracts of bailahuen and cedron did not change the expression of the bapA gene , but there are no statistical differences between cedron and bailahuen.There was a greater number of bacteria that adhered to the cell surface in the vehicle  than in -2 cells , we founSalmonella. Carvacrol, present in oregano oil, decreased the adhesion and invasion of Salmonella Typhimurium in Caco-2 and IPEC-J2 cells [Chondrus crispus and Sarcodiotheca gaudichaudii decreased Salmonella Enteritidis' ability to colonize various tissues such as the ceca, spleen, liver, and ovary in birds [Salmonella to its host cells. The results obtained in the two assays are associated, and we observed a reduction in the number of bacteria that remain attached to the surface after incubation and subsequent washing to remove the planktonic cells.Our results are concordant with previous reports showing that phenolic compounds reduce the adhesion and invasion capacity of J2 cells . Furtherin birds . Thus, thilA gene in Salmonella Enteritidis treated with the extracts of cedron decreased 63.4 \u00b1 11.9% with respect to vehicle (p < 0.05)  . On the Sarcodiotheca gaudichaudii and Chondrus crispus decrease bacterial adhesion by repressing genes like invA (invasion protein), invF (invasion regulatory protein), sirA , or sirB  [hilA suggesting that this extract utilizes the hilA pathway to inhibit adhesion of Salmonella Enteritidis to Caco-2 cells. The observed differential effects of the different types of plants on the genes involved in the bacteria adhesion could be explained by differences in the content of metabolites or molecular structures specifically present in each plant. On the other hand, since the bailahuen extract also reduced the adhesion capacity of Salmonella Enteritidis but did not affect expression of hilA, we can speculate that other mechanisms that control the adhesion of Salmonella Enteritidis could be involved with the effect of bailahuen. Further studies are necessary to quantify other genetic markers and thus determine the mechanism by which the bailahuen extract decreases the adhesion of Salmonella Enteritidis to Caco-2 cells. Identification of molecular structures present in bailahuen and cedron could provide more details concerning the differential effects on the biofilm formation or adhesion to host cells of Salmonella Enteritidis, but this was not done.There is evidence that berry extracts and red seaweeds of  factor) , 39. In Salmonella Enteritidis at higher concentrations than other plant extracts. However, lower concentrations of bactericide activity differentially affected the ability of Salmonella Enteritidis to form a biofilm and adhere to human intestinal epithelial cells. The antioxidant activity is directly proportional to the total phenol content, indicating that the phenolic compounds present in the extracts are effective antioxidants and free radical inhibitors. We show that bactericide activity is not proportional to phenol content or antioxidant activity since cedron is most effective for inhibiting growth although it is the extract with a lower antioxidant activity. This indicates that there are phenolic compounds in the cedron extract with bactericide activity but not with antioxidant activity. The extracts of bailahuen and cedron can inhibit the ability of Salmonella Enteritidis to form a biofilm and adhere to human intestinal cells. In the case of the inhibition in biofilm formation, the cedron extract proved to be the most effective. This effect could be explained by the inhibition of efflux pump activity and the adrA signalling pathway. The inhibition of the ability of Salmonella Enteritidis to adhere to the surface of epithelial cells was efficient with all extracts. However, this effect probably is associated to the decreased hilA expression only in the cedron extract. Considering that biofilm formation and adhesion to host cells allow the survival of Salmonella in the environment and in the intestine of poultry, we propose that these extracts alone or combined could be used in the poultry industry as part of the feeding of the birds. This also can reduce the intestinal load of the animals and thus decrease the contamination, avoiding the selection of resistant microorganisms and the permanence of these in the human population.In this work, we showed that the extracts of cedron and bailahuen differ in their content of total phenols and antioxidant activity. Furthermore, both extracts inhibit growth of"}
+{"text": "Hypertrophic cardiomyopathy (HCM) in newborns is a rare condition with heterogeneous etiologies. While the relationship between hyperinsulinism and cardiac hypertrophy (CH) is known, hyperinsulinism has not been reported as cause of HCM.We report the case of cardiac hypertrophy (CH) in an Extremely Low Birth Weight (ELBW) infant; this patient underwent insulin therapy after the onset of persistent hyperglycemia due to parenteral nutrition (PN), supporting the hypothesis of a role of iatrogenic hyperinsulinemia in the development of HCM.The present case underlines the importance of a close cardiological follow-up in infants undergoing insulin infusion for an alteration in the glucose metabolism. Hypertrophic cardiomyopathy (HCM) in newborns is a rare pathological condition in which disruption of the myocardial structures creates a thickening of the heart muscle . CH is dIn newborns and infants hyperinsulinism can have many different causes: congenital hyperinsulinism (transient and persistent), maternal diabetes, insulin resistance syndromes, hyperinsulinism syndrome-related  and iatrogenic hyperinsulinism (excessive infusion of insulin) .In neonates with congenital hyperinsulinism, fetal hyperinsulinemia increases the storage of glucose and lipids with a consequent hyperplasia and hypertrophy of myocardial cells. Indeed, septal thickness gradually decreases until it becomes normal within the first few months of life, usually without complications and requiring beta-blockers only in rare cases . SimilarConversely, the persistent congenital hyperinsulinism is due to a focal or diffuse overproduction of insulin originated by the pancreas in relation to various genetic disorders .Even though epidemiologic and prospective studies have shown that glycosylated hemoglobin A1c level in the 6\u2009months before conception and during the first trimester of pregnancy correlates with the increased incidence of major malformations , the specific effects of hyperglycemia are still unclear , 14.Nevertheless gestational diabetes acts with a teratogen effect on the embryo already from the first weeks of gestation. Consequences are primary defects of cardiogenesis and asymmetric hypertrophic cardiomyopathy with a thickening of the interventricular septum and lower posterior ventricular wall . InfantsThere are also cases of hyperinsulinemia secondary to an excessive infusion of insulin, as in the case report presented. A multicenter case-control study, conducted by Bearsall et al., showed that insulin infusion administered to hyperglycemic VLBW infants in the first weeks of life resulted in a significant gain of glucose and a total energy intake. However, an increased risk of hypoglycemia was reported, without a significant reduction of mortality and morbidity .Insulin has the role of anabolic hormone and acts as cardiac growth factor, promoting cardiac hypertrophy due to the interaction with its receptors on heart muscle cells. Therefore, CH related to a hyperinsulinemic condition is characterized by an exuberant growth of single myocardiocytes, affecting the heart as a whole . In the For the differential diagnosis of hyperinsulinism in newborns, see Table We describe the case of a ELBW infant , born from a caesarean section due to a cervical insufficiency. The mother was a multiparous 27-year-old woman who had shown a shortening of the uterine cervix in the last month of pregnancy. For this condition, she was undergoing isoxsuprine hydrochloride therapy to reduce uterine contractions and the possible risk of a premature birth.Few hours before delivery, an intravenous glucocorticoid bolus was administered. The APGAR score was six at 1 min of life; then the newborn underwent orotracheal intubation due to the presence of respiratory failure.Surfactant was administered, followed by 96\u2009h of mechanically ventilation. Following extubation the newborn was supported with nasal continuous positive air pressure (n-CPAP) and oxygen for 7\u2009days to maintain oxygen saturation between 90 and 95%. Due to jaundice, phototherapy was administered until the fourth day of life.Because of the presence of a hemodynamically significant patent ductus arteriosus, ibuprofen was started  and eritroprotein (250\u2009units 3 times /week) for the anemia of the prematurity. No alterations of procalcitonin (PCT) and C-reactive protein (CRP) were detected excluding the diagnosis of sepsis. Feeding intolerance  required the starting of full parenteral nutrition. After 3\u2009days of therapies, persistent hyperglycemia arose (217\u2009mg/dL).Newborn\u2019s glucose intake was 11.5\u2009mg/kg/min, subsequently reduced to 10\u2009mg/kg/min, before starting a continuous insulin infusion. Insulin infusion was administered for 10 days and its rate was adjusted between 0.1 UI/Kg/h to 0.01 UI/Kg/h to obtain the stabilization of blood glucose levels, reached after only 6 days from the beginning of insulin treatment.On the 15th day of life, a systolic ejection murmur in the mesocardium 2/6) was detected, triggering an echocardiographic exam which showed hypertrophic cardiomyopathy with thickness of the septum and reduction of ventricular cavity, see Table /6 was deThe infant developed also some episodes of desaturation during n-CPAP and a doxapram hydrochloride infusion was started (0.5\u2009mg/kg/h).Cardiac ultrasonography showed: on the 17th day of life, electrocardiogram (ECG) presented an elevated ST segment, particularly in the left precordial leads. Subsequently insulin infusion was suspended.After 10\u2009days from insulin suspension, the echocardiographic ultrasound exam showed a progressive reduction of free left wall septum and of trabecular hypertrophy.After 40\u2009days of life, the ECG showed a normal tracing and the echocardiographic ultrasound revealed a further improvement in cardiac hypertrophy.At the time of discharge, the baby did not present retinopathy of prematurity, hypertension, renal failure, but outcomes of bronchodysplasia. During the follow-up and up to age of 36\u2009months, was in good clinical condition.The goal of nutrition for preterm infants should be to achieve a postnatal growth rate approximately equal to the rate of a normal fetus with the same gestational age. Unfortunately, most preterm infants, especially ELBW, are not fed sufficient amounts of nutrients to reach normal fetal growth rates. The resulting extrauterine growth retardation is a significant problem that could result in short stature, organ growth failure, neuronal deficits with behavioral problems, and poor cognitive outcomes , 24. ThePotential causes of hyperglycemia include sepsis, necrotizing enterocolitis, surgical treatments, infusion of vasoactive drugs and steroids, insulin resistance and/or relative insulin deficiency and high glucose intake, as in the case described above. The standard approach to the management of hyperglycemia in infants involves the use of glucose restriction and/or continuous insulin infusion to achieve a normal level of glycaemia, while maintaining an adequate caloric intake , 29.This treatment can prevent osmotic diuresis, dehydration and electrolyte imbalance. However, insulin infusion is not free from serious complications, including hypoglycemia, that remains an important and risky possible consequence .To the best of our knowledge, the case we describe here is the setting of the first report of an ELBW newborn who showed a transient cardiac hypertrophy in association to iatrogenic hyperinsulinemia. A possible correlation is supported by the close temporal relationship between cardiac hypertrophy and insulin infusion, and its resolution after suspension of insulin therapy. Other cases of relationship between CH and hyperinsulinism are described in the literature, mainly in the setting of congenital hyperninsulinism or maternal diabetes , 31\u201333.As for the mechanism of this association, Kruger M. et al. explained the association between cardiac hypertrophy and hyperninsulinism in diabetic rats, showing that high fetal insulin decreases the expression of the N2B titin protein isoform in cardiac cells . Titin pA recent review by Paauw N.D. et al., emphasizes the role of insulin as a cardiac growth factor in hyperinsulinemic infants with CH . Indeed,In this perspective, we speculate that the pathophysiology underlying CH in the described infant might be similar to the one assessed in hypertrophic cardiomyopathy of diabetic mothers\u2019 infants or in congenital hyperinsulinism , 41, 42.This is the first case described in the literature of an ELBW, in whom a transient cardiac isolated condition, not associated with other pathologies, was associated with iatrogenic hyperinsulinemia. This underlines the importance of a close follow-up in infants under insulin treatment, consequent to an altered glucose metabolism during PN.In conclusion, hyperinsulinism is linked to CH in many different hyperinsulinemic diseases and should be listed in the differential diagnosis of myocardial hypertrophy. Further studies are warranted to better define the potential consequences of the prolonged use of insulin therapy on the heart, and to clarify the cost-benefit relationship of this therapy in ELBW infants undergoing PN, for a period of their life."}
+{"text": "This paper carried out the friction plug repair welding of 6082 aluminum alloy keyhole defects by using the method of friction heating between shaft shoulder and base material. In addition, a well-formed friction plug welding joint was obtained at different plug rotation speeds. In order to study the influence mechanism of plug rotation speeds on the microstructure of the weld nugget zone, EBSD technology was used to analyze the grain morphology, grain size and grain boundary characteristics of the weld nugget zone under different rotation speeds of the plug rod. The results show that in the nugget zone, the grain was fine and equated crystals refinement, and there was a preferred orientation. The deformation texture components in the welded nugget zone increased with the plug rotation speed from 1600 to 2000 rpm. However, the grain size first decreased and then increased, while the components in the High-Angle Boundary first increased and then decreased. Friction stir welding (FSW) does not require filler material during the welding process. If the welding temperature is lower than the melting point of the base metal, metallurgical and crystallization defects can be effectively avoided . Therefo2Si as the strengthening phase. Furthermore, 6082 aluminum alloy is a heat treatment strengthened aluminum alloy, with moderate strength, low density, good corrosion resistance, excellent machinability and weldability, and it can be used for the main body of the high-speed train car body structure  expressed the texture.In order to further study the evolution of grain orientation in the weld nugget zone during friction plug and repair welding, this paper used Channel 5 to calculate the preferred grain orientation in the weld nugget zone at different plug rotating speeds.In the process of friction plug welding, the tapper plug and the joint material undergo plastic deformation at high temperature, while the plastic deformation of face-centered cubic metal was realized through the motion and interaction of dislocations. In the process of plug welding, the unconsumed cold tapper plug had frictional and shearing effects on the plastic metal formed in the early stage, so the feed of the tapper plug and the rotation of the shaft shoulder would produce stress on the grain in the weld nugget zone. For face-centered cubic aluminum alloys, the final orientation was determined by the stress state of the grains, which led to different textures in the weld nugget zone. When the grains were acted on by the stopper bar and shaft shoulder, the slip plane and the slip direction rotated in a certain direction and finally reached a stable orientation in the face-centered cubic metal, resulting in texture in the weld nugget zone of the joint. The higher the speed of the tapper plug, the higher the grain deformation rate in the weld nugget zone, and the higher the auxiliary heating temperature of the shoulder. On the one hand, high deformation temperature was beneficial to promote the occurrence of dynamic re-crystallization. On the other hand, the high deformation rate also caused the fragmentation of the new nucleated grains in dynamic re-crystallization, resulting in the deformation texture in the weld nugget zone. Therefore, the thermal coupling resulted in the presence of both re-crystallization texture, shear texture and deformation texture. Moreover, the components of re-crystallization and deformation texture increased with the increase in the tapper plug rotating speed.The grain refinement was significant in the weld nugget zone of the friction plug and repair welding joint, and there was an obvious preferred orientation. The grain size in the weld nugget zone decreased first and then increased when the plug rotating speed increased from 1600 to 2000 rpm, while the high-angle boundary component increased first and then decreased.At 1600 rpm, recrystallized Cube, recrystallized R and (021)[2\u201312] deformation texture mainly were found in the nugget zone; at 1800 rpm, Goss, (111)[\u2013101] texture, recrystallized Cube and R texture were found; at 2000 rpm, Copper, Goss, (313)[\u2013312] texture and recrystallized Cube texture were found.When the speed of the tapper plug increased, the deformation rate and the temperature of the welding nugget zone increased. The high deformation temperature was beneficial to promote the occurrence of dynamic re-crystallization, while the high deformation rate caused the fragmentation of new nucleated grains. The re-crystallization and the textural components of the weld nugget zone increased with the increase in the plug rotating speed."}
+{"text": "The novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has arisen as a global pandemic affecting the respiratory system showing acute respiratory distress syndrome (ARDS). However, there is no targeted therapeutic agent yet and due to the growing cases of infections and the rising death tolls, discovery of the possible drug is the need of the hour. In general, the study for discovering therapeutic agent for SARS-CoV-2 is largely focused on large-scale screening with fragment-based drug discovery (FBDD). With the recent advancement in cryo-electron microscopy (Cryo-EM), it has become one of the widely used tools in structural biology. It is effective in investigating the structure of numerous proteins in high-resolution and also had an intense influence on drug discovery, determining the binding reaction and regulation of known drugs as well as leading the design and development of new drug candidates. Here, we review the application of cryo-EM in a structure-based drug design (SBDD) and in silico screening of the recently acquired FBDD in SARS-CoV-2. Such insights will help deliver better understanding in the procurement of the effective remedial solution for this pandemic. In biological environments, proteins do not statically function, interacting with various binding partners in the context of complex networks and have dynamic regulatory mechanisms. Simultaneously, individual proteins perform with several partners and change the assembly state of the complex  have allowed an increase in resolution for efficient drug discovery , which cleave the translated polyprotin from invaded viral RNA and makes it into an individual protein (Erlanson pro inhibition, the early stage of infection, can provide a quick solution to combat viruses. For more rapid and effective findings, current led method is depending on the structural information of each target, rather than starting from a large, substrate molecule or numerous drug-sized molecules, starts with more limited smaller molecules, or fragments (Chazal and Gerlier \u2018In silico\u2019 is used to mean experimentation conducted by computer and is related to the other biological environmental terms in vivo and in vitro. This method is generally used to test in vitro data to create an experimental model. Also, such virtual models have employed in the discovery and optimization of small molecules and compound with specific affinity to a biological target, the conformation of absorption, distribution, metabolism, excretion and toxicity properties as well as physicochemical characterization (Ghosh et al. Erlanson . The lifErlanson . Thus, aCryo-EM rapidly defined the high-resolution structure underlying SARS-CoV-2 drug development after the global pandemic outbreak, and many researchers are suggesting some notable candidates as a much-needed drug for SARS-CoV-2 by using this structural information (Panda et al."}
+{"text": "Idiopathic multicentric Castleman disease (iMCD) is a rare polyclonal lymphoproliferative disease caused by the overrepresentation of interleukin-6 (IL-6). Tocilizumab (TCZ) is a humanized monoclonal antibody that binds to the IL-6 receptor and is approved for the treatment of iMCD. The efficacy and tolerability of TCZ in patients with iMCD undergoing lung transplantation (LTx) remain unknown.We present the case of a 48-year-old iMCD patient with end-stage lung disease (ESLD) who was successfully treated with cadaveric single-LTx. Intravenous TCZ was used to stabilize the iMCD patient every 2 weeks, except for withdrawal immediately after LTx. At 32\u00a0month post-transplant, the patient remained asymptomatic without evidence of rejection, development of de novo donor-specific antibody (DSA), and recurrent iMCD in the native lung.Single-LTx can be a feasible treatment option for ESLD caused by iMCD. TCZ can be used safely and may be beneficial in recipients with iMCD, and TCZ in combination with usual immunosuppression can be helpful in stabilizing iMCD patients pre- and post-LTx. Idiopathic multicentric Castleman disease (iMCD) is an uncommon polyclonal lymphoproliferative disorder characterized by the elevated levels of interleukin-6 (IL-6) \u20133. AlthoA 30-year-old man with fever, anemia and slight enlargement of the mediastinal lymph nodes was diagnosed with iMCD via lymph node biopsy. Laboratory tests revealed elevated levels of serum total protein 11.1\u00a0g/dL), serum IL-6 (44.5\u00a0pg/mL), and immunoglobulin G (IgG) (3870\u00a0mg/dL). Since treatment with oral prednisolone (PSL) failed to suppress the symptoms of iMCD, intravenous TCZ  was administered. Although oral PSL with intravenous TCZ had controlled his iMCD symptoms without the further exacerbation of his lung disease, his respiratory function continued to decline gradually, and he was registered for cadaveric LTx at 46\u00a0years of age , has been useful for iMCD during and after LTx. In this case, the IL-6 level was maintained at a low level <\u2009100\u00a0pg/mL), even with a temporal cessation of TCZ for 28\u00a0days after LTx. Glucocorticoid use following LTx suppresses hypercytokinemia and alleviates symptoms . Further0\u00a0pg/mL, Notably, in this case, the serum CRP level was not significantly elevated in the perioperative period. Although CRP levels are usually elevated even in patients without signs of sepsis and who are on immunosuppressive drugs , suppresSingle-LTx can be a feasible treatment option for ESLD due to iMCD, and TCZ in combination with usual immunosuppression can be helpful in stabilizing iMCD patients pre-and post-LTx."}
+{"text": "Ba-01, an RGD disintegrin with high affinity to this integrin. Boyden chamber, HUVEC transmigration, and wound healing assays in the presence of DisBa-01 were performed in hypoxic conditions. DisBa-01 produced similar effects in the two oxygen conditions in the Boyden chamber and transmigration assays. In the wound healing assay, hypoxia abolished DisBa-01\u2032s inhibitory effect on cell motility and decreased the MMP-9 activity of conditioned media. These results indicate that \u03b1v\u03b23 integrin function in cell motility depends on the assay and oxygen levels, and higher inhibitor concentrations may be necessary to achieve the same inhibitory effect as in normoxia. These versatile responses add more complexity to the role of the \u03b1v\u03b23 integrin during tumor progression.Breast cancer is characterized by a hypoxic microenvironment inside the tumor mass, contributing to cell metastatic behavior. Hypoxia induces the expression of hypoxia-inducible factor (HIF-1\u03b1), a transcription factor for genes involved in angiogenesis and metastatic behavior, including the vascular endothelial growth factor (VEGF), matrix metalloproteinases (MMPs), and integrins. Integrin receptors play a key role in cell adhesion and migration, being considered targets for metastasis prevention. We investigated the migratory behavior of hypoxia-cultured triple-negative breast cancer cells (TNBC) and endothelial cells (HUVEC) upon \u03b1v\u03b23 integrin blocking with Dis Despite the advances in diagnostics and treatment, breast cancer remains with high incidence and mortality, with 18.1 million new cases and 9.9 million deaths worldwide, being the main leading oncological cause of female deaths in 2020 ,4. DurinIn hypoxic conditions, the hypoxia-induced factor (HIF-1) is the central molecule that triggers cellular responses. HIF-1 is composed of two subunits, HIF-1\u03b1 and HIF-1\u03b2, whose interaction activates hypoxic response elements (HRE), promoting the expression of pro-angiogenic genes, primarily the vascular endothelial growth factor (VEGF) . This reIntegrins are transmembrane dimeric receptors formed by a noncovalent interaction between alpha and beta (\u03b1\u03b2) subunits, being responsible for cell adhesion to the ECM . IntegriIntegrin expression changes according to the type of tumor and the disease stage . IntegriBothrops asper and veridistatin from Crotalus viridis inhibit the adhesion of melanoma cells and migration of murine breast cancer cells, respectively [Agkistrodon acutus, is a \u03b1V/\u03b15 antagonist that prevents the migration and invasion of endothelial cells and decreases B16F10 proliferation [Disintegrins are natural integrin inhibitors used as tools in the design of new anti-cancer therapies . Disinteectively . Most diferation .Ba-01 is an RGD recombinant disintegrin from Bothrops alternatus with high affinity to the \u03b1v\u03b23 integrin (KD = 1.6 \u00d7 10\u22127 M), with in vivo anti-angiogenic, anti-metastatic, and anti-thrombotic properties [Ba-01 is around 100-times more specific for the \u03b1v\u03b23 integrin than \u03b15\u03b21 (KD = 7.62 \u00d7 10\u22125 M) [Ba-01 inhibits cell proliferation and migration in a number of cell lines in vitro [Ba-01 impaired the directionality of oral squamous cell carcinoma migration [Ba-01 were performed in normoxia, a very different condition from the one found inside solid tumors.Disoperties . DisBa-0 10\u22125 M) . DisBa-0in vitro ,42,43,44in vitro ,46. DisBBa-01. Due to the essential role of the \u03b1v\u03b23 integrin in metastatic spreading, our results indicate the distinct behavior of the tumor and endothelial cells upon \u03b1v\u03b23 integrin blockade, depending on the migration assay and oxygen condition. These results might be of relevance when considering testing integrin inhibitors in clinical trials for solid tumors.Here, we investigate the migration of breast cancer MDA-MB-231 cells and endothelial cells in hypoxia using some in vitro models, focusing on the effect of \u03b1v\u03b23 integrin blocking upon treatment with DisBa-01. The same assays were performed in parallel under normoxic conditions for comparison. MDA-MB-231 cell migration in the Boyden chamber was inhibited by DisBa-01 in a concentration-dependent way and in a similar way in the two oxygen conditions (p = 0.97) in normoxia and in hypoxia, respectively, indicating a small difference between the two conditions. Representative images of the analyzed membranes are depicted in To study the role of the \u03b1v\u03b23 integrin in cell motility under hypoxia, we used three different migration models  in hypoxia and in the presence or not of a specific antagonist, Disnditions A\u2013C. The Ba-01 and placed inside the insert to transmigrate through a HUVEC monolayer  in hypoxia  from the independent assays by gelatin zymography . Our hypigration ,43. The  hypoxia B. DisBa-trations C.Ba-01 did not affect MMP activity in either condition (Ba-01 concentrations (500 and 1000 nM) increased the pro-MMP-9 levels in both normoxia and hypoxia conditions , both in normoxia and hypoxia  were measured in normoxia and hypoxia in the presence or absence of Dis hypoxia A\u2013E. ReprBa-01 to inhibit HUVEC migration in the Boyden chamber and wound healing assays. DisBa-01 had no effect in normoxia, and it inhibited HUVEC migration in the Boyden chamber assay only at high concentrations in hypoxia  in hypoxia A\u2013C. DisBnditions D,E. Contnditions F.Ba-01 treatment did not alter \u03b23 integrin content in HUVECs in normoxia or in hypoxia  was more effective in normoxia than hypoxia  was transformed with plasmid pet28(a)DisBa-01. Protein expression was induced for 3 h, followed by lysis and purification in three steps: affinity chromatography , size-exclusion chromatography , and anion exchange chromatography . Total protein was determined by colorimetric detection of bicinchoninic acid assay .The expression and purification of Disribed by . Brieflyv/v) fetal bovine serum , penicillin (100 IU/mL), streptomycin (100 mg/mL), and L-glutamine (2 mM), in a humidified environment with 5% CO2 at 37 \u00b0C. Subcultures were performed using trypsin and trypan blue stain solution  on a TC20 automated cell counter . Cells in experiments were maintained in 20% O2 and 5% CO2 (normoxia) and an incubator chamber  with a gas mixture containing 1% O2 and 5% CO2 (hypoxia), both at 37 \u00b0C.Triple-negative breast tumor cells (MDA-MB-231) and human umbilical vein endothelial cells  were from ATCC. Both cell lines were maintained in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 10%  were used. MDA-MB-231 cells (1 \u00d7 10 5) in medium without serum were treated with DisBa-01 for 30 min at room temperature and inserted into the upper part of the Boyden chamber. The lower chamber contained medium plus 10% SFB. The system was incubated for 16 h (MDA-MB-231 cells) or 24 h (HUVEC) at 37 \u00b0C in normoxic and hypoxic conditions. Filters were fixed with 3.7% paraformaldehyde and the remaining cells on the upper surface were removed using a cotton swab. The nuclei of migrating cells were stained with 0.7 ng/\u00b5L DAPI solution . Membranes were assembled on a microscope slide for automated cell counting in an ImageXpress Micro microscope  under 10\u00d7 magnification with the Meta-X-press software, and quantified using the Multi Wavelength Cell Scoring.Chemotaxis assays were performed to assess MDA-MB-231 cell migration upon \u03b1v\u03b23 integrin blocking by Dis4 HUVECs were subcultured onto 8.0 \u03bcm pore 12-well inserts  with serum in the upper and lower chambers for 24 h in 5% CO2 at 37 \u00b0C. Then, MDA-MB-231 cells (0.6 \u00d7 105) were labeled with Cell Trace TM CFSE . MDA-MB-231 cells were treated with DisBa-01 in serum-free medium for 30 min at room temperature, and then allowed to transmigrate through the endothelial layer for 16 h at 37 \u00b0C in a normoxic and hypoxic environment. The lower chamber contained medium plus 10% SFB. Filters were fixed with 3.7% paraformaldehyde and the remaining cells on the upper surface were removed using a cotton swab. The nuclei of migrated cells were stained with 0.7 ng/\u00b5L DAPI solution . Membranes were assembled on a microscope slide for automated cell counting in an ImageXpress Micro microscope  under 10\u00d7 magnification with the Meta-X-press software, quantified using the Multi Wavelength Cell Scoring.To evaluate MDA-MB-231 cell migration through a layer of endothelial cells, 8 \u00d7 105) and HUVEC (1 \u00d7 105) were seeded in a 24-well culture plate for 48 and 24 h, respectively. The confluent monolayer was wounded using a sterile 200 \u00b5L pipette tip to generate a cell-free area. Then, cells were treated with 10 \u00b5g/mL mitomycin-c  for 4 h, followed by washing 2\u00d7 with PBS. Cells were treated with DisBa-01 in medium containing 10% FBS and incubated in normoxia and hypoxia for 24 h. The images were captured using an inverted microscope  using the AxionVision Rel.4.8 software of a Vert.A1 microscope (Zeiss) in a 10\u00d7 magnifying glass in three areas each well. Cell migration was analyzed through ImageJ v.1.52a [MDA-MB-231 cells , the clear bands were quantified by densitometry using ImageJ software. MMP-2 and MMP-9 were represented in arbitrary units (AU).The conditioned media from the transwell Boyden chamber, transendothelial, and wound healing assays with MDA-MB-231 cells were analyzed for their MMP content by gelatin zymography. Culture medium was collected, protein quantified, and incubated in sample buffer under non-reducing conditions. Samples were resolved on a 10% polyacrylamide gel containing 0.1% gelatin at 4 \u00b0C. Gels were washed two times with 2.5% Triton \u03a7-100 and incubated at 37 \u00b0C for 18 h in 50 mM Tris buffer, pH 8.0, 5 mM CaClBa-01 in inhibiting angiogenesis after 10 h incubation under hypoxic conditions. Firstly, HUVECs (3 \u00d7 104 cells) were treated for 30 min with DisBa-01 and plated on 1:1 Matrigel dilution (35 \u00b5L/well) in 0.5% SFB medium in a 96-well plate. Images were photographed using the AxionVision Rel.4.8 software of a Vert.A1 microscope  in a 10x magnifying glass and analyzed using the Angiogenesis Analyzer plugin for ImageJ software v.1.52a.The tube formation assay on Matrigel  was performed to evaluate the ability of Dis4 cells/well) and HUVECs (3 \u00d7 104 cells/well) were plated in a 96-well black microplate (Corning 3603) overnight at 37 \u00b0C, 5% CO2. Cells were exposed to DisBa-01 for 4 h in DMEM supplemented with 10% FBS in normoxia and hypoxia. Afterwards, cells were fixed in 3.7% paraformaldehyde for 10 min, permeabilized using 0.3% Triton X-100 for 5 min, and stained with Alexa Fluor\u00ae 488 Phalloidin  in DAPI-PBS (1:40) for 30 min. Fluorescent samples were observed using ImageXpress (Molecular Devices) equipment with 40x magnification. Morphology was analyzed in ImageJ software v.1.52a [MDA-MB-231 cells , and washed and incubated with Alexa Fluor 488-labeled secondary antibody , followed by analysis in a flow cytometer .Cells were incubated without and with DisBa-01 on MDA-MB-231 cells and HUVECs under hypoxia was analyzed by flow cytometry with the PE-Annexin V Apoptosis Detection Kit . Cells (1 \u00d7 105) were seeded in 24-well plates with DMEM and incubated overnight. A cell-free area was created using a sterile 200 \u00b5L pipette tip following treatment with or without mitomycin-c for 4 h for MDA-MB-231 and 2 h for HUVECs at 37 \u00b0C and 5% CO2. Then, cells were treated with DisBa-01 in medium containing 10% FBS and incubated in a normoxic and hypoxic environment for 24 h. After this period, control cells were harvested, heated at 100 \u00b0C for 5 min, and chilled at 4 \u00b0C immediately. Cells were incubated with PE-Annexin V and 7-aminoactinomycin D (7ADD) for 15 min in the dark at 4 \u00b0C, followed by the addition of binding buffer. Cells treated with DisBa-01  were incubated with PE-Annexin V and 7ADD, harvested, centrifuged at 400 g, and suspended in binding buffer. Analyses were performed in a flow cytometer .The possible apoptotic activity of Disp < 0.05 were considered statically significant. Graphics were generated in the GraphPad program showing mean \u00b1 SD for normal distribution of population and median \u00b1 SD for non-normal distribution of population.Data were obtained in at least triplicate in three independent series of experiments and analyses were performed using the statistical SigmaPlot7 program. For parametric data, we performed two-way ANOVA or one-way ANOVA and post hoc Tukey test, and non-parametric data were subjected to the Kruskall\u2013Wallis one-way analysis of variance on ranks post hoc Dunn test. Values of"}
+{"text": "Toxoplasma gondii to identify and characterise essential proteins involved in apicoplast genome replication and to understand how apicoplast genome segregation unfolds over time. We demonstrated that the DNA replication enzymes Prex, DNA gyrase and DNA single stranded binding protein localise to the apicoplast. We show in knockdown experiments that apicoplast DNA Gyrase A and B, and Prex are required for apicoplast genome replication and growth of the parasite. Analysis of apicoplast genome replication by structured illumination microscopy in T. gondii tachyzoites showed that apicoplast nucleoid division and segregation initiate at the beginning of S phase and conclude during mitosis. Thus, the replication and division of the apicoplast nucleoid is highly coordinated with nuclear genome replication and mitosis. Our observations highlight essential components of apicoplast genome maintenance and shed light on the timing of this process in the context of the overall parasite cell cycle.Apicomplexans are the causative agents of numerous important infectious diseases including malaria and toxoplasmosis. Most of them harbour a chloroplast-like organelle called the apicoplast that is essential for the parasites\u2019 metabolism and survival. While most apicoplast proteins are nuclear encoded, the organelle also maintains its own genome, a 35\u00a0kb circle. In this study we used  Analysis of these mutants allowed us to provide the first known direct evidence for the essentiality of DNA gyrase and Prex for the replication of the apicoplast genome and for 22.1Toxoplasma gondii \u0394Ku80/TATi parasites were maintained by serial passage in 25\u00a0cm2 culture flasks  of confluent human foreskin fibroblast  cells in DMEM  supplemented with 1% FBS (Gibco Life Technologies) and 2\u00a0mM of glutamine at 37\u00a0\u00b0C and 5% CO2. Homologs of Prex (TGME49_261850), SSB (TGME_297940), Gyrase A  and Gyrase B  were identified in the Toxoplasma genome database (http://www.toxodb.org). To tag the genomic locus of TgPrex, TgSSB and TgGyrA with a triple hemagglutinin (HA) tag (3xHA), amplicons of the 3\u2032 end of the genes were obtained by PCR using the primers shown in Parasites endogenously expressing HA-tagged Prex (Prex-HA) and a stable extra copy of myc-tagged SSB were constructed by amplification of SSB coding sequence (cDNA) by PCR, cloned into the pDT7S4-myc plasmid and transfected into parasites expressing the HA-tagged polymerase. Modified parasites were selected with pyrimethamine, cloned into 96-well plates and then screened with primers shown in 2.2T. gondii genomic DNA. The resulting amplicon was then cloned into the pDT7S4-HA plasmid between BglII and AvrII  restriction sites. Modified parasites were selected with pyrimethamine, cloned into 96-well plates (TPP) and then screened for promoter replacement and 5\u2032 and 3\u2032 integration with primers shown in Fosmids containing the locus of the genes for TgPrex (RHfos25C03), TgGyrA (RHfos04P14) and SSB (RHfos20H03) were modified to insert or replace the endogenous promoter with a tetracycline-regulatable promoter, tetO7sag4 (T7S4), using the recombineering procedure as previously described . The gen2.32 flasks of HFFs were infected with 1000 parasites of the mutant or the \u0394Ku80/TATi parental strain and treated with 0.8\u00a0\u00b5M of anhydrotetracycline  for 7\u20138\u00a0days. Flasks were then fixed with 100% ethanol and stained with crystal violet.Confluent 25\u00a0cm2.4Toxoplasma gondii tachyzoites were collected after egress and host cell lysis from infected HFF cultures, and DNA was purified with a DNeasy blood and tissue kit . Quantitative PCR (qPCR) was performed using the primers and PCR protocol described previously  using primers and PCR programs described previously (1\u2013107) of apicoplast and nuclear genome standards. Each reaction mixture was supplied with 10\u00a0\u03bcL of iQ SYBR green supermix , 1\u00a0\u03bcL of 10\u00a0\u03bcM primers, 50\u00a0ng of template DNA extracted from T. gondii and water totaling a final volume of 20\u00a0\u03bcL. All experiments were performed in triplicate on a Bio-Rad iQ5 real-time PCR detection system. Results were analysed using Bio-Rad iQ5 software. To determine the apicoplast genome copy number per cell, the average number of apicoplast genomes was divided by the average number of nuclear genomes.eviously . Amplicoeviously . PCR pro2.5T. gondii tachyzoites and, at the times indicated in the experiments (see section 3), fixed with 4% freshly prepared formaldehyde for 30\u00a0min, washed with 100\u00a0mM NH4Cl for 20\u00a0min to decrease background, permeabilized with 0.5% Triton X-100 for 20\u00a0min and incubated for 1\u00a0h with a blocking solution of 3% BSA in PBS. Coverslips were then incubated for 1\u00a0h with primary antibodies against a luminal apicoplast protein  were obtained using a cryo-ultramicrotome (Leica EM FC6), collected with 2.3\u00a0M sucrose and mounted on copper grids covered with a formvar film. The ultrathin sections were rehydrated in 2% gelatin, blocked with 3% BSA (Sigma-Aldrich) in PBS and labelled with rat anti-HA antibody for 1\u00a0h followed by 10\u00a0nm gold conjugated goat anti-rat IgG (Sigma-Aldrich). Sections were stained with 0.5% uranyl acetate in 2% methylcellulose and observed on a Zeiss 900 transmission electron microscope.2.7Harvested tachyzoites were resuspended in reducing sample buffer NuPage LDS 1\u00d7  with 2% \u03b2-mercaptoethanol. Samples were boiled for 5\u00a0min at 95\u00a0\u00b0C. Lysates were then run by SDS-PAGE on Tris-Glycine 6\u201312% gradient gels (Bio-Rad) before transfer to 0.2\u00a0\u03bcm nitrocellulose membranes and subsequent antibody labelling. Rat anti-HA (Roche Applied Science) was used at 1:100 and mouse anti-\u03b1-Tubulin (Sigma-Aldrich) was used at 1:10,000. Horseradish peroxidase (HRP)-conjugated goat anti-rat and goat anti-mouse (Bio-Rad) secondary antibodies were used at 1:5000.2.8GyrB mutants were grown for 3\u00a0days in HFF cells in the presence or absence of ATc. After that, parasites were harvested, RNA isolated (RNeasy kit Qiagen) and cDNA synthesised . The presence of GyrB transcript was assessed by PCR of 1\u00a0\u03bcg of cDNA using primers annealing to GyrB cDNA listed in 33.1T. gondii, we constructed strains that express endogenously HA-tagged Prex, SSB and DNA Gyrase A (see section 2 for details). We note that we were unable to isolate parasites with an endogenously tagged Gyrase B gene, suggesting that such a modification may be detrimental to parasite growth. We conducted immunofluorescence labelling of the tagged parasites using an antibody to the apicoplast chaperone Cpn60 and anti-HA . The western blot also showed higher mobility bands likely corresponding to the mature proteins after transit peptide processing upon apicoplast import. Prex showed a third band (approximately 130\u00a0kDa). This may indicate further processing and correspond to the c-terminal Exonuclease/DNA Polymerase I domain of Prex as previously shown for P. falciparum  was analysed by SIM  than the apicoplasts containing a single round nucleoid  a P\u00a0<\u00a00.05 , which tP\u00a0<\u00a00.05 . SimilarP\u00a0<\u00a00.05 B and at P\u00a0<\u00a00.05 . This suP\u00a0<\u00a00.05 , and pro3.3T. gondii Prex, DNA gyrase A and B subunits, and SSB are essential for the replication and inheritance of the apicoplast genome. We constructed Tet-regulatable mutants using fosmid recombination  within 2\u00a0days of ATc-mediated repression in all three strains.The ability of the Prex, GyrA and GyrB mutants to form plaques in a host cell monolayer (plaque assay) was used to assess the growth and viability of parasites in the presence or absence of ATc. For all three mutants we observed a strong growth defect in the presence of ATc that was not seen for the parental lines A, but nor 6\u00a0days B. Treatmr 6\u00a0days B. In conr 6\u00a0days B. This rWe also measured the impact of loss of Prex, GyrA and GyrB on overall apicoplast maintenance and inheritance by counting the number of organelles per parasite . While i4Toxoplasma homologs of Gyrase A and B, SSB and Prex confirmed their expected residence in the apicoplast  and division (M and cytokinesis phases). Nucleoid partitioning initiates early in the S phase B, suggesnhardtii . In line S phase . Further S phase B. Finall S phase B and 5B, S phase B and 4B. S phase C. Taken ll cycle . Thus, nll cycle B and 5B odyogeny . Similar mitosis . The con mitosis . Howeveractivity . Recentlunctions . Conditiy number . These rT. gondii proliferation, confirming that they are important for parasite fitness. Moreover, 1\u00a0week of pre-treatment with ATc abolished parasite proliferation (T. gondii in culture suggests that SSB is not essential for tachyzoite survival in culture (The knockdown of DNA gyrase subunits A and B and Prex A impaireferation A in lineferation . In the feration C, preven culture .T. gondii and P. falciparum with the antibiotics ciprofloxacin and novobiocin, known inhibitors of prokaryote gyrase A and B domains, respectively, decreased apicoplast genome replication and affected parasite viability and morphology (The effect on parasite viability seen in the conditional mutants following the decrease in the apicoplast genome copy number and apicoplast loss  is in lirphology . This isZea mays, mutants of the chloroplast DNA polymerase showed reduced chloroplast genome copy numbers which result in a decrease in the chloroplast-encoded transcripts and proteins (P. falciparum, the nuclear encoded apicoplast ClpC and ClpP protease complex members are essential for apicoplast biogenesis, and conditional mutants of these proteins resulted in growth arrest and apicoplast loss (T. gondii tachyzoites treated with DNA gyrase inhibitor ciprofloxacin and apicoplast protein translation inhibitor clindamycin (In the plant proteins . In the proteins , howeverproteins . The preproteins . Apicoplproteins  and mighproteins . In P. fast loss . Indeed,ndamycin . In thisIn conclusion, in this work we demonstrated an essential role for Prex and DNA gyrase in apicoplast maintenance. We also showed that apicoplast genome partitioning occurs in coordination with the parasite cell cycle, but initiates prior to nuclear mitosis and parasite cytokinesis, which ensures that upon apicoplast fission, all daughter cells receive a functional organelle with a genome."}
+{"text": "Infectious virus outbreaks pose a significant challenge to public healthcare systems. Early and accurate virus diagnosis is critical to prevent the spread of the virus, especially when no specific vaccine or effective medicine is available. In clinics, the most commonly used viral detection methods are molecular techniques that involve the measurement of nucleic acids or proteins biomarkers. However, most clinic\u2010based methods require complex infrastructure and expensive equipment, which are not suitable for low\u2010resource settings. Over the past years, smartphone\u2010based point\u2010of\u2010care testing (POCT) has rapidly emerged as a potential alternative to laboratory\u2010based clinical diagnosis. This review summarizes the latest development of virus detection. First, laboratory\u2010based and POCT\u2010based viral diagnostic techniques are compared, both of which rely on immunosensing and nucleic acid detection. Then, various smartphone\u2010based POCT diagnostic techniques, including optical biosensors, electrochemical biosensors, and other types of biosensors are discussed. Moreover, this review covers the development of smartphone\u2010based POCT diagnostics for various viruses including COVID\u201019, Ebola, influenza, Zika, HIV, et\u00a0al. Finally, the prospects and challenges of smartphone\u2010based POCT diagnostics are discussed. It is believed that this review will aid researchers better understand the current challenges and prospects for achieving the ultimate goal of containing disease\u2010causing viruses worldwide. This review summarizes the latest development of virus detection techniques, with the special focus on smartphone\u2010based viral diagnostics whose advances have enabled laboratory\u2010based molecular detections to be performed with plug\u2010and\u2010play stand\u2010alone devices. Discussion on challenges and future perspectives of smartphone\u2010based viral diagnostics is highlighted, which might push the development of mobile diagnostics forward with scientific and available guidance. The outbreak of Coronavirus Disease 2019 (COVID\u201019) has evolved into a global crisis, which has been defined as a public health emergency of international concern by the World Health Organization (WHO). As of February 25, 2022, authorities in 206 countries and territories had reported over 431 million cases, resulting in at least 5.9 million deaths worldwide. Controlling the spread of these viruses continues to be a global challenge. China has been the most successful country in containing the epidemic and its successful experience lies in early detection for early control. Early detection of virus infection is critical for virus containment because it can effectively identify suspected individuals and cut off the transmission chains. In addition, early detection of virus infection is critical in tracing transmission chains, such as \"who\u2010infected\u2010whom,\" contact tracing, and human\u2010to\u2010human transmission timelines, thereby assisting in interrupting the spread of virus. enzyme\u2010linked immunosorbent assay (ELISA), polymerase chain reaction (PCR) and hemagglutination/inhibition assay have been developed for virus identification and/or quantitation. These traditional techniques are generally performed in the central laboratory and hospital as the preferred diagnostic methods. However, these laboratory\u2010based tests necessitate not only sophisticated equipment but also highly trained operators, which are not easily deployed in the field. The recent COVID\u201019 epidemic demonstrates that laboratory\u2010based testing alone is insufficient to prevent epidemic outbreaks, even in developed countries. Furthermore, laboratory\u2010based testing is nearly impossible for the majority of people in regions with scarce resources. As a result, limited testing capacity slowed the response to the COVID\u201019 epidemic, eventually resulting in a global public health crisis.Viruses are composed of nucleic acids (DNA or RNA) and an envelope protein coat. They typically require a host cell to replicate their genomes and multiply virus particles. Based on this unique characteristic, molecular diagnostic methods such as virus isolation,1, 2 WHO coined the term \u201cASSURED\u201d to refer to an ideal POCT device that is affordable, sensitive, specific, user\u2010friendly, rapid, equipment\u2010free, and delivered. Additionally, as an alternative for laboratory\u2010based testing, the unique advantages of POCT for virus disease outbreak control include: 1) simpler fabrication and operation; 2) less analysis time; and 3) reduced reagent consumption. It should be emphasized that early detection of viral diseases can reduce disease infectiousness and mortality. A survey indicated that point\u2010of\u2010care (POC) malaria diagnostic could save more than 22% of lives compared to diagnosis based on laboratory infrastructure. As a result, WHO encourages the development and investment in research of POCT for infectious disease diagnostics, which will benefit not only district hospitals and centralized labs, but also rural clinics with inadequate infrastructure.Point\u2010of\u2010care testing (POCT), an emerging diagnostic platform, provides a clinically relevant testing method that has significantly improved on\u2010site infectious disease management and monitoring in recent years.6 WHO  Based on these technologies, POCT devices have been widely reported and commercialized. These devices include lab\u2010on\u2010a\u2010chip/disc (LOC/LOAD) devices, lateral flow devices, microfluidic paper\u2010based analytical devices (\u03bcPADs) and isothermal nucleic acid amplification devices (INAA). And more notably, technological advances in mobile communications, low\u2010cost optical devices and accessible electronics have increased the speed and efficiency of data collection, processing and transmission globally.Currently, various commercial POCT devices have been developed for the purpose of detecting early pandemic outbreaks. Innovative advances in microfluidics, microelectron\u2010mechanical systems (MEMS) technology, nanotechnology, and 3D printing, as well as data analytics, have facilitated the development of POCT diagnosis significantly.10 Bas Additionally, the global smartphone penetration rate as a percentage of the total population was 49.35% in 2016 and was projected to reach 78.05% by 2020. Thus, the smartphone is a ubiquitous device that is well\u2010suited for POC diagnostics and personalized healthcare, which may aid in the control of epidemic diseases. Also, the excellent functional extendibility of smartphones through the use of peripheral attaching accessories or accessory\u2010free systems enables smartphones to accurately measure a variety of signals, including colorimetric, fluorescent, chemiluminescent, surface\u2010enhanced Raman scattering (SERS), and surface plasmon resonance (SPR) signals. Moreover, smartphones can be combined with microscopic and electrochemical methods to achieve a clinically acceptable level of diagnosis. Without a doubt, the development of mobile POC tests expands the potential applications for diagnosing and monitoring infectious pathogens, as well as improves personalized healthcare in clinical management.As a technological marvel, smartphones feature advanced high\u2010resolution digital cameras, computing, and storage capabilities, as well as advanced processors and an open\u2010source operating system, all of which enable them to incorporate promising technologies for detection, processing, and transmitting/receiving test results for POC testing.14 AddIn this review, we focus on recent efforts to adopt smartphone technology for viral disease diagnostics, monitoring, and management. First, advances in POCT are compared to those in conventional laboratory\u2010based molecular diagnostics. Then, we highlight the current various smartphone\u2010based diagnostic technologies based on different sensing mechanisms, including immune sensing and nucleic acid testing. Moreover, this review covers the advances in POC diagnostics technology for COVID\u201019, Ebola, Dengue, Zika, Human Immunodeficiency Virus (HIV), Hepatitis, and Influenza using smartphones. Additionally, future developments of smartphone\u2010based POC diagnostics is discussed, including associated perspectives and challenges. This review will aid researchers in comprehending the rapid development of smartphone\u2010based POC diagnostics toward the ultimate goal of curbing disease\u2010causing viruses worldwide.22.1 Throughout human history, viruses have placed a significant burden on public healthcare and resulted in significant economic and humanitarian losses  epidemic in Asia in 2003, the H1N1 influenza outbreak in 2009 in North America, and the Ebola virus epidemic in West Africa in 2014, as well as the ongoing global Zika virus, dengue virus, HIV, hepatitis B virus (HBV), swine\u2010 and avian\u2010origin influenza (AIV) crisis.Zoonotic viruses become prevalent in human communities periodically, resulting in disease syndromes of varying severity.25 Thr AIV\u2010related hemagglutinin (HA), and COVID\u201019\u2010related angiotensin\u2010converting enzyme 2 (ACE2) receptor. Early in infection, viruses replicate themselves using host cell biological substances, and infect new cells, but which is first monitored by CD8+ T cell\u2010mediated immunity mechanisms. CD8+ T cells (cytotoxic T cells) are capable of killing infected cells at this stage, resulting in viral release from host cells but a lower viral load in the blood or tissue  can detect DNA/RNA of viruses directly, which is critical for early infection detection prior to seroconversion. Hence, NAATs have an advantage in detecting poorly cytopathic viruses early.Despite enormous efforts and significant progress, reducing infectious disease spread and mortality remains a global challenge, particularly in resource\u2010limited settings.34 Iden Figure\u00a0.[42]n Figure\u00a0. The ind It is based on the detection of antigens by enzyme labeled antibodies, which enables the quantification of particular proteins  and proteins (antibodies and antigens). Immunoassays are one of the most widely used serological methods for detecting viral antigens or serological antibodies following virus infection. They are cost\u2010effective and efficient due to the availability of high\u2010specific monoclonal antibodies and a variety of reporter modalities.47 It  This technique is used in the majority of commercial kits (Table loop\u2010mediated amplification (LAMP), rolling circle amplification (RCA), and strand displacement\u00a0amplification (SDA). Related examples that have been commercialized are listed in Table\u00a0Because of its superior sensitivity and specificity, real\u2010time PCR has remained the gold standard for virus diagnosis up to now Figure\u00a0.48]48 Besides, these devices need lower consumption of patient samples, make an easier operation, and have higher reproducibility in the detection of pathogens. Featured in the automated bio\u2010analytical process, microfluidic chips are adequate for smartphone\u2010based miniaturized devices due to their much smaller size and more flexible design. At present, polymethyl methacrylate (PMMA), polydimethylsiloxane (PDMS), and filter paper are extensively used for the fabrication of microfluidic and microarray chips for biochemical analysis. Recent advances in NAATs, microfluidic chips, and smartphones enable portable detection systems for POC diagnosis. For example, a portable smartphone\u2010controlled system was developed and integrated with a passive, self\u2010driven LAMP microfluidic device for influenza A (H1N1) virus detection \u00a0for HIV p24 antigen detection  data transmission to the phone via the audio jack. A microcontroller was programmed to perform FSK transmission by converting the photodiode readings. A microfluidic cassette containing reagent and test cassettes was used to automatically perform a multiplexed immunoassay, and the optical density (OD) (absorbance) of silver enhancement on each assay was transmitted and recorded using a touch\u2010activated pictorial smartphone dongle app. In a blinded experiment, the smartphone dongle exhibited a sensitivity of 92% and 100% for HIV and syphilis, respectively. This microfluidic\u2010based smartphone dongle was also demonstrated for simultaneous detection of hemoglobin and HIV antibodies by Guo et\u00a0al., suggesting the platform was accessible to smartphones users. In another work, Thiha et\u00a0al. designed a Lab\u2010on\u2010Compact Disc (LOCD) platform to measure the absorbance using a monochromatic light source and to interpret the ELISA test results using photo sensor circuitry. The absorbance values from the test results were transmitted via Bluetooth to a smartphone. This LOCD platform was demonstrated a high degree of accuracy in the detection of antibody IgG in 64 dengue patients.Laboratory\u2010based ELISA usually requires complex instruments such as microplate readers with a time\u2010consuming process. To address these shortcomings, Laksanasopin et\u00a0al. developed a complete laboratory\u2010quality immunoassay platform, the \u201csmartphone dongle,\u201d105 wh3.2.2 good anti\u2010interference, and robustness, fast signal speed, and simple operation. Fluorescent LFIAS sensors, which have a higher sensitivity and accuracy compared with traditional LFIAS sensors based on gold nanoparticles (AuNPs) or colored latex nanoparticles, have attracted great attention in quantitative detection of viral diseases. Recently, the smartphone\u2010based LFIAS reader enabled image capture and processing, as well as quantitative calculation of fluorescent areas in test results via a customized app algorithm. For instance, Rong et\u00a0al. developed a smartphone\u2010based fluorescent quantum dots (QDs)\u2010LFIAS platform for the detection of Zika virus nonstructural protein 1 (NS1) , a bandpass filter (624/40\u202fnm), a short\u2010pass filter (425\u202fnm), and electrical components with a smartphone. The excitation light was designed to illuminate the LFIA strips at a 60\u00b0 incidence angle, which significantly reduced background noise. In addition, the plano\u2010convex lens and bandpass filter fixed in front of the smartphone camera ensured the acquisition of high\u2010quality fluorescence images. Using ImageJ software, this system quantified the ZIKV NS1 with a sensitivity of 0.15 ng mL\u22121 within 20 min. Yeo et\u00a0al. designed a smartphone\u2010based fluorescent strip reader for the detection of three different AIV subtypes  by exploiting an efficient reflective concentrator. The utilization of refractive optics technique overcame the limited numerical aperture of the smartphone\u2010based LFIAS reader  were inserted into the reader to obtain two separate fluorescent signals from QDs in the test linesFluorescence\u2010based assays are one of the most widely used optical detection methods due to their high sensitivity,108 gor Figure\u00a0. The LED LFA analyzer consisted of a compact infrared laser, a dichroic mirror, and an infrared filter. The laser horizontal plane excitation light transmitted through the dichroic mirror at 45\u00b0, excited UCNPs on the LFIAS, reflected visible luminescence, and effectively eliminated stray light. The fluorescent intensity of UCNPs on test and control lines was captured using a smartphone camera and then converted to the sample concentration via built\u2010in RGB value algorithms in the UCNP\u2010LFA app. This LFA detection system showed great potential in quantitative analysis of nucleic acid (hepatitis B virus and HBV) in a real\u2010time manner.Upconversion nanoparticles (UCNPs) have become attractive nanomaterials in the development of UCNP\u2010LFIAS due to their long\u2010term photostability and low signal\u2010to\u2010noise ratio. Gong et\u00a0al. developed a miniaturized and portable lateral flow assay (LFA) detection system, including a smartphone\u2010based UCNP\u2010LFA analyzer and a custom\u2010designed app.116 LF This system consisted of miniaturized fluorescence housing, reverse transcription PCR (RT\u2010PCR), and melting curve analysis (MCA), which was conducted in less than 37 min. LEDs were used for stimulation and photodiodes were used to detect the fluorescence emitted in the RT\u2010PCR reaction chamber. To process the photocurrent signals, a lock\u2010in amplifier was embedded, significantly reducing background noise. ZIKV has been a major global public health concern due to its association with fetal microcephaly and Guillain\u2013Barr\u00e9 Syndrome (GBS). Chan et\u00a0al. described a portable molecular diagnostics system for ZIKV infection which could automatically perform reverse transcription recombinase polymerase amplification (RT\u2010RPA) on up to 12 samples within 15 min. Subsequently, the fluorescent image from probe\u2010based RT\u2010RPA assays was taken by a smartphone camera for further analysis with simple operation and minimal device requirements.Typically, nucleic acid\u2010based tests utilize an enzymatic amplification process to millionfold amplify target sequences. Nowadays, NAATs have demonstrated significant advantages in detecting and controlling newly discovered or emerging viral pathogens. Ahrberg\u00a0et\u00a0al. developed a smartphone\u2010sized real\u2010time PCR device for Ebola virus RNA detection.117 Th For example, LAMP eliminates the need for thermocycling and simplifies the complexity of equipment while maintaining satisfactory sensitivity or specificity in clinical samples. Priye et\u00a0al. combined a smartphone\u2010enabled LAMP box with RT\u2010LAMP assay for simultaneous analysis of Zika, dengue, and chikungunya viruses. As illustrated in Figure\u00a0 This chromaticity\u2010luminance assay achieved simultaneous detection of Zika and chikungunya viral RNA via RT\u2010LAMP assay.Isothermal nucleic acid amplification meets the criterion of a sample\u2010in, answer\u2010out device.121 Fo a unique RT\u2010LAMP, and smartphone\u2010based imaging POC system for detection of SARS\u2010CoV\u20102  with smartphone\u2010based detection. The device consists of a thermos cup body, a 3D\u2010printed holder, a smartphone, and a chip with four reactors for on\u2010chip NA extraction and BART\u2010LAMP assay. The customized smartphone app was designed to real\u2010time image/record the bioluminescence signal, process images, quantify nucleic acid concentration, and report/transmit test results. This inexpensive, hand\u2010held smartphone\u2010connected cup (SCC) eliminates the need for excitation sources and optical filters, simplified sample preparation progress, and provided a rapid, connected and quantitative detection platform for ZIKV in urine and HIV in blood.Notably, most of the reported platforms required complicated sample preparation progress, such as nucleic acid extraction and separation, that add complexity and cost. Recently, Ganguli et\u00a0al. employed a complete hands\u2010free sample processing microchip,125 a 2 Figure\u00a0. The ima In dPCR, nucleic acids samples are distributed to tens of thousands of unique reaction vessels or microdroplets at a single nucleic acid level, which enriches the virus nucleic acids and reduces the influences of PCR inhibitors To date, commercial dPCR products are mainly divided into microchamber\u2010based dPCR  and droplet\u2010based dPCR . However, these commercial dPCR platforms typically rely on multiple independent units to complete the sample dispersion, on\u2010chip amplification, and digital detection, resulting in complex and bulky overall system that is unaffordable in resource\u2010limited areas. To address this issue, Hu et\u00a0al. reported a smartphone\u2010based droplet digital LAMP device for quantification of low abundance cfDNA and gene mutation. The microchip integrated immiscible phase filtration, reagent mixing, droplet generation, and digital LAMP amplification. Fluorescent images from the droplet digital LAMP chip were captured by a smartphone camera and further analyzed. However, this system suffered from complicated manual operations and manual intervention. Gou et\u00a0al. developed a fully integrated smartphone\u2010based dPCR sensing system for highly accurate DNA quantitative analysis. The dPCR sensing system integrated a miniaturized thermocycler, an on\u2010chip dPCR into a smartphone\u2010based optical device, and the whole integrated function units were automatically controlled by a custom Android software. Recently, Cao et\u00a0al. reported a droplet digital LAMP platform based on a microgel array chip and hand\u2010held smartphone\u2010based reader. The microgel array chip held the capability of \u201csample self\u2010absorption and partition\u201d with thousands of isolated microgels, avoiding professional operations and auxiliary equipment. Although there are few reports of smartphone\u2010based dPCR systems for virus screening, it is expected to become an enormous potential platform for POC nucleic acids quantitation analysis in resource\u2010limited settings.Rapid POC quantification of low virus RNA or DNA load would significantly reduce the turnaround time for virus detection and timely curb the spread of epidemic. Digital PCR (dPCR) holds the promise of high sensitivity and accuracy in the absolute quantification of nucleic acids.128 In Ning et\u00a0al. developed a smartphone\u2010read CRISPR assay with a 15\u2010min sample\u2010to\u2010answer time for saliva\u2010based POC SARS\u2010CoV\u20102 diagnosis. The smartphone\u2010based fluorescence microscope device integrated a laser diode, a lens filter, a chip slot, a smartphone socket, a power switch, and an emission filter for the smartphone camera  script. The platform directly quantified viral load of preisolated SARS\u2010CoV\u20102 RNA and exhibited a sensitivity of 100 copies mL\u22121 in 30 min, indicating a consumer electronic\u2010based diagnostic device rather than a specialized instrument in central laboratory.The requirement for NAATs that are fast, widespread, and capable of obtaining ultrasensitive diagnostic results has prompted efforts to explore new strategies. To reduce the required expertise and infrastructure, isothermal preamplification of target RNA, such as RPA, is a commonly used strategy. Recently, by combining RPA with Cas12a and Cas13 proteins, the DETECTR and SHERLOCK systems were developed, which enable the POC detection of nucleic acids with high sensitivity, specificity, and reliability.134 Nia Figure\u00a0. On an a A flow cell microarray and a smartphone fluorescence reader were used to recognize recombinant antigens from six filoviruses. The smartphone was connected to the opto\u2010electro\u2010mechanical hardware and preinstalled with customized smartphone software, acting as a fluorescence reader, controlling operation, acquiring, and distributing test results via cloud service. Minagawa et\u00a0al. developed a smartphone\u2010based imaging platform to obtain the neuraminidase activity of influenza viruses by measuring the fluorescence of droplets, thus enabling influenza virus digital counting. The platform assembled the smartphone with other optical components, including a power LED, a micrometer head, an aspherical lens, a long pass filter, and a femtoliter reactor array device (FRAD). The FRAD was illuminated by a power LED which was activated via a smartphone app. The fluorescence images captured by the smartphone camera were saved and further analyzed using ImageJ software. Sensitivity of the digital smartphone counting device was 100 times greater than that of a commercial influenza diagnostic kit. Similarly, Jiang et\u00a0al. utilized catalytic hairpin assembly (CHA) amplification reactions and a smartphone camera achieved simultaneously detecting avian influenza virus  within 20 min. The smartphone was used to capture fluorescence images of the sample spot on the microarray, which were then analyzed at the grey level for quantifying the viral load.Droplet\u2010based digital bioassays are thought to be a highly sensitive and high\u2010throughput analytical approach for POC diagnosis. Natesan et\u00a0al. reported a digital and multiplexed microarray platform for telemonitoring Ebola and Marburg filovirus infections.136 A 3.3 On this basis, smartphones are gradually integrated with such portable instruments to become an important part of controlling, recording, and displaying electrochemical detection, thus realizing smartphone\u2010based electrochemical sensing platforms for POCT.Owing to its simplicity, reliability, and cost\u2010effectiveness, electrochemistry has demonstrated broad applications for quantitative detection of important analytes in clinical diagnostics. More importantly, electrochemical methods can be easily implemented in miniaturized and portable instruments and have a large range of applications for in situ POCT\u2010based assays.140 On3.3.1Figure The system was composed of a radiochemical device and a smartphone, with a headphone jack on the smartphone for signal transmission. However, the AC\u2010coupled audio channels present the main challenge with using a headphone jack, because no DC signal or power can be directly transmitted between the phone and the potentiostat. Fortunately, such challenge can be overcame by voltage\u2010controlled oscillator (VCO), since VCO is able to convert the DC signal output by the potentiostat to a frequency signal within the audio band which then can be sent to a smartphone for recording, demodulation, and reconstruction. To make it easier for smartphones to reconstruct voltammograms, that is, the relationship between the current and the input voltage measured by CV, the microcontroller generated marker tones representing the voltage transition point of the applied potential, and inserted them into the output of the VCO as the data was processed. This smartphone\u2010based system is highly consistent with commercial electrochemical workstations, resulting in a more affordable approach for POC diagnostics. Subsequently, Jo\u00e3o et\u00a0al. also reported a similar method for HCV detection, with excellent sensitivity and a lower cost of about $0.2.Voltammetry is an electrochemical technique based on redox reactions and widely used to study the kinetics and thermodynamics of electron transfer in chemical reactions. The information of the analyte is obtained from the register of the resulting electric current that appears on the working electrode as a function of the applied potential. Aronoff\u2010Spencer et\u00a0al. reported a smartphone\u2010based potentiostat which can implement cyclic voltammetry (CV) for Hepatitis C virus (HCV) determination Figure8a. In t WBCs analysis provides rich information in both rapid diagnosis of acute infection and chronic disease management. POC applications were highlighted by implementing a handheld smartphone DPV measurement system via wireless Bluetooth communication. Because the absorption of WBCs on the electrode surface would prevent the electron transfer, the DPV device could easily detect the content of WBCs. Beduk et\u00a0al. reported a portable POC electrochemical analyzer (KAUSTat) connected to a smartphone to detect SARS\u2010CoV\u20102 S1 spike protein. A miniaturized electrochemical immunosensor based on laser\u2010scribed graphene (LSG) was integrated into a homemade KAUSTat analyzer and operated using KAUSTat software. KAUSTat consisted of built\u2010in memory, a connectable add\u2010on device, a slot for an SD card, a battery, Bluetooth and a mini\u2010USB connector, enabling multichannel measurements. Using electrochemical immunoassay and KAUSTat analyzer, the accurate detection of S\u2010protein was achieved by detecting signal changes and recording by DPV method within only 1 h of incubation. It is worth noting that the DPV method is very similar to the CV method, and both belong to the category of potential sweep methods. However, DPV is more accurate because it reconstructs, encodes, and records the signal after subtracting the Faraday background current from the generated signal. Thus it can greatly reduce background interference and improve detection sensitivity.In addition, portable electrochemical devices based on differential pulse voltammetry (DPV) are also designed and manufactured for the detection of various viruses. For instance, Wang et\u00a0al. reported a smartphone\u2010based DPV portable device, which enables indirect detection of viruses by counting white blood cells (WBCs) Figure\u00a0. developed a chip\u2010based wireless diagnostic device by integrating QD barcode technology and isothermal amplification with smartphone\u2010based microscopy , enabling high\u2010throughput visual discrimination in morphology of a diverse population of Ebola virus\u2010like particles and Ebola vaccine candidates \u2010based smartphone system for rapid and sensitive detection of HBV, HCV, and ZIKV  was developed to generate gas bubbles that create patterns for virus detection on\u2010chip. The nanoparticle\u2010enabled smartphone (NES) system is consisted of an Android smartphone equipped with a trained CNN algorithm capable of imaging and analyzing bubbles in a straight microchannel. The system simplifies sample processing and is adaptable to various smartphone models without the need for external optical hardware for signal detection, resulting in a powerful universal modality for low\u2010cost POC diagnosis.Biological samples that illustrate changes often generate large amounts of data, so computational and statistical methods such as deep learning, the Internet of Things (IoT), and other artificial intelligence (AI) methods can be used for diagnosis.151 AIV Figure\u00a0.[152 The giant magnetoresistive (GMR) nanosensor platform included a disposable cartridge, a processor station (PCB), and a smartphone. The magneto\u2010nanosensor chip, employing the GMR effect, consisted of an array of magnetic sensors which could monitor the change in electrical resistance induced by the binding of MNPs. The platform completed circuitry, signal processing and user\u2010interface application, simplifying operation, and reducing electrical noise, thus facilitating self\u2010testing in the POC setting. Bioluminescence is a powerful analytical method because of its low background and simple instrumentation, which has been widely used in biomedical imaging, small molecule analysis, disease prevention, and food safety control. Arts et\u00a0al. developed a sensor platform (LUMABS) for antibodies detection using bioluminescence resonance energy transfer (BRET) via a smartphone. Using only the smartphone camera as the equipment, this LUMABS allowed to detect antibody concentrations against hemagglutinin (HA), HIV1\u2010p17, and dengue virus type I in blood plasma at the picomolar level.In a recent example, Ng et\u00a0al. demonstrated a smartphone\u2010based magneto\u2010nanosensor platform that utilized magneto\u2010immune\u2010nanosensor arrays and magnetic nanoparticles (MNPs) for detection of HIV in saliva Figure\u00a0.[153 The RPA reactions in the flexible chip were processed via human body heat and recorded by a smartphone\u2010based fluorescence detection system. The fluorescence signal from RPA reactions was excited by the excitation light and filtered by an emission filter, eventually captured by the smartphone camera and analyzed using ImageJ software. This wearable microfluidic sensor combined with a smartphone\u2010based fluorescence detection system was able to detect HIV\u20101 DNA at 100 copies mL\u22121 in 24\u202fmin.Wearable devices as powerful tools for personal healthcare monitoring have greatly attracted the interest of researchers in monitoring physiological parameters and biomarkers. Kong et\u00a0al. developed a wearable microfluidic device that integrated RPA assay into a smartphone fluorescent detection system for simple and rapid HIV\u20101 DNA detection Figure\u00a0.[155 influenza virus, dengue virus, because of their high sensitivity, rapidness, small sizes, and remote accessibility. However, few SAW devices have already been successfully integrated into smartphone\u2010based devices for POCT applications. One important reason is that some limitations have not been effectively solved, including damping effect in solution, high packaging costs, and difficulty in integrating with chips. Recently, Turbe et\u00a0al. developed a smartphone\u2010connected SAW device for HIV detection. A SAW biochip was connected to a pocket\u2010sized control box reader and a smartphone. The SAW biochip sensitively detected the phase changes of shear horizontal surface acoustic wave (SH\u2010SAW) caused by the immune binding of HIV and the specific antibodies, and then sent the signals to the smartphone via Bluetooth. A user\u2010friendly smartphone app enables the analysis, display, and transfer of results.Technological advances in POCT have made it possible to use a smartphones as wireless or connected instrumental interface with POCT devices equipped with signal processing units. While POC virus diagnostics are booming, however, signal transducers in smartphone\u2010based POCT have yet to be fully exploited. For instance, surface acoustic wave (SAW) biosensor has been widely reported for various virus detection such as Ebola virus,156 in Excitingly, great efforts have been spent on developing QCM\u2010based devices for early virus diagnosis, making it possible to integrate with smartphones for the detection of various viruses in the future.As another form of acoustic wave biosensors, quartz crystal microbalance (QCM) based biosensors have received great interest due to their high sensitivity and label\u2010free strategy. The QCM is based on the piezoelectric effect, whose resonant frequency is influenced by the mass per unit area at the crystal surface, and thus able to detect virtually any type of biomolecule.162 Ex For example, it has been demonstrated to connect a commercial thermal imager to a smartphone camera for exosome detection based on Au@Pd nanoparticles and aptamer\u2010nanoflower\u2010assisted thermal LFS (ANAN\u2010LFS). Recently, Guo et\u00a0al. utilized a thermal imaging sensor connecting with a smartphone via a USB port to read the signals in a microfluidic chip, and successfully detected Salmonella with a LOD as low as 93 CFU mL\u22121 within 1 h. As a connected device, the smartphone\u2010based thermal sensor with high resolution, sensitivity, and low cost holds great potential for in\u2010field applications. So far, however, few smartphone\u2010based thermal sensors have been used for virus detection. As the POCT market is growing and the range of applications is expanding, we believe that those acoustic, thermal or other new types of sensors will occupy an active place in the future development of smartphone\u2010based POC virus diagnosis.Thermal sensor is another type of signal transducers which has not fully exploited to be integrated with smartphone\u2010based sensing systems. In comparison to acoustic wave biosensors, thermal sensors are easy to be integrated and implemented in POCT devices, since no complicated electronic devices and signal processing units will be needed. Recently, emerging thermal imagers have become commercially available at a low cost, allowing thermal sensors to be applied on smartphones.168 Fo4TableLaboratory\u2010based diagnostics methods are well developed, which remain as gold standard for virus detection. Commercial POCT technology is flourishing and is expected to be a promising alternative for virus detection. For smartphone\u2010based POC virus diagnostics, although many developed devices have been reported, to our knowledge, these devices or systems have not been commercialized or used in clinical setting. To investigate this issue, we summarize the current laboratory\u2010based diagnostics, commercial POCT, and smartphone\u2010based POCT for viral diagnostics in In response, smartphone\u2010based POC virus diagnostics offer a quick, simple, and cost\u2010effective solution for achieving broad public access to testing. As an increasingly accessible electronic device in human daily life, smartphones have opened up possibilities of POC virus diagnostics in resource\u2010limited areas or personalized medical management at home. The essential reason for this is the versatility, high integration, and scalability of the smartphone, which allows it to interface with a wide variety of POCT devices and replace the complex, bulky, and expensive components. For example, microfluidic POCT systems can process small volumes of parallel samples simultaneously, enabling the simultaneous, highly sensitive, and selective detection of multiple viruses. However, conventional microfluidic POCT systems require complex and expensive equipment to add samples, acquire, and analyze data. Smartphones have made it possible for microfluidic POCT systems to run sample preprocessing, molecular detection steps, analysis, and data interpretation autonomously in a sample\u2010to\u2010answer manner. Another example is the smartphone\u2010based LOAD system which opens up a new possibility due to its unprecedented performance in terms of time, accuracy, and cost. In the LOAD system, the liquid sample can be easily obtained by centrifugal force through a rotating motor, reducing the dependence on instruments. Smartphones can further reduce the dependence on laboratory resources and be applied to large\u2010scale multiplexing and parallelization at low cost, ultimately leading to a true field platform. Smartphone\u2010based LFA reader is also a good representative. Its low cost, ease of manufacture and operation enable rapid field testing with high reliability and low error. However, these LFS systems are still limited by the inherent shortcomings of LFS, such as low sensitivity, interference from sample matrices, high false positive/negative rates, poor multiplexing capabilities and low throughput. To address this aspect, recent smartphone\u2010based mobile dPCR devices offer another possibility to supply accurate absolute quantification, small sample size, and high sensitivity. When an individual's viral load is low, these devices retain their high sensitivity and accuracy while eliminating the need for large and expensive equipment components. Despite the advantages, smartphone\u2010based POC devices are still suboptimal in terms of sensitivity and reproducibility and remain only proof\u2010of\u2010concept in the laboratory, leaving significant challenges for achieving clinical applications.Therefore, comprehensive improvement of assay precision and accuracy at all stages of sample preparation, signal transduction and analysis is the main focus of smartphone\u2010based POC virus diagnostics in the future. Improving the sensitivity and specificity of smartphone\u2010based POC virus diagnosis is the first challenge to provide testing results comparable to laboratory assays. Specificity improvement reduces some of the possible causes of false positives, such as the most typical nonspecific binding. Unlike high specificity, high sensitivity allows for high precision detection in very low viral load analysis, reducing false negatives as well. Continued development of better primer/probe sequences and antibodies is also an important strategy for rapid and specific identification of viral markers. Also, improving the signal\u2010to\u2010noise ratio (SNR) of the system is an important strategy to improve the sensitivity of smartphone\u2010based POCT systems. Optimizing the system by reducing noise or amplifying the signal allows quantification of lower concentration targets, thus improving sensitivity. In addition, signal amplification can be achieved by novel molecular diagnostic techniques , and novel optical or electrochemical materials, such as metal nanoparticles, aggregation\u2010induced emission (AIE), chemiluminescent materials, molecular beacons, carbon\u2010based materials, and magnetic nanoparticles. Signal readout hardware for smartphone\u2010based POCT devices, such as CMOS cameras, often have poor performance compared to laboratory\u2010based hardware. Therefore, it is important to reduce noise or background signals by designing new sensing strategies or improving the performance of optical components and electrical signal processing circuits.The second obstacle to the development of smartphone\u2010based POC virus diagnostics is the reliability of qualitative or quantitative detection. Smartphone\u2010based POCT systems often require control of the internal environment to ensure stability and reproducibility for field use. The development of calibration\u2010free sensors will help eliminate variations in biosensing. Improving the throughput of POCT systems can reduce clinical workload and enable testing of multiple viruses or viral samples in a single run. Therefore, full integration and development of high\u2010throughput smartphone\u2010based POCT systems with good reliability is the third challenge. Fourth, the need for standardization of smartphone\u2010based POC virus diagnostics is urgent in clinical practice. Smartphone\u2010based POC virus diagnostics should be standardized globally to collect comparable clinical results and to enable uniform analysis of test results for various diagnostic targets in different regions. We believe that any efforts to improve LOD, throughput, and diagnostic accuracy will help overcome these barriers and advance smartphone\u2010based POC virus diagnostics into clinical practice and commercialization.The development of smartphone\u2010based POC\u00a0diagnostics should begin with needs and value assessment. Researchers and clinicians could collaborate to solve an urgent diagnostic problem in a particular infectious virus disease. It must be assessed whether their devices are more valuable than currently available diagnostics techniques in terms of facilitating clinical decision\u2010making. To this end, the attribute value judgments for their devices should be based on three aspects: 1) the relevant molecular assay; 2) the impact of smartphone technology; and 3) cost\u2010effectiveness in terms of consumer demand. The effectiveness of molecular assays should be determined by the specific biomarker diagnostic requirements and validated against the current gold standard diagnostic approaches. The integration of molecular assays and mobile technology should not only increase the clinical impact of molecular assays over their laboratory counterparts, but should also keep low cost. For example, when combined with RT\u2010PCR, LAMP, and CRISPR technology, POC devices\u00a0can improve access and reduce the time and resource burden on individuals with acute and chronic viral infections. Notably, the development of smartphone\u2010based POC\u00a0diagnostics requires an understanding of the surrounding technical ecosystem to ensure that they integrate seamlessly into their associated socioeconomic environment. Therefore, the clinical differential diagnosis of RV has been a biological and technical challenge. To this end, smartphone\u2010based diagnostics for RVs will contribute to the improvement of human health, including 1) timely tracing and isolating the infected individuals to personalized treatment. 2) accurate diagnosis of cross\u2010infection and reduced complication rate. 3) reducing the overuse of antibiotics . According to the forecast by Meticulous Research, the influenza diagnostics market will reach $2 billion by 2031 . Moreover, the rapidly growing market for RV POCTs, a shift from acute virus to chronic virus POCT strategies  would emerge in smartphone\u2010based POCT technology.The current widespread global COVID\u201019 has once again brought attention to POC diagnostics for timely response to emerging human acute respiratory virus (RV) infections. The major RV types include influenza virus (IV), coronavirus (CoV), respiratory syncytial virus (RSV), parainfluenza virus (PIV), adenovirus, rhinovirus, and other secondary viruses that share similar symptoms, that is, cough, fever, chest pain, sneezing, and breathing difficulties171 ThOnce the value of diagnostics has been fully assessed, researchers can initiate formal technology development for their devices. During this phase, technology development must ensure that it is compatible with the intended target and adheres to the WHO's REASSURED framework . An\u00a0ideal smartphone\u2010based POC\u00a0diagnostics platform should be self\u2010contained and automate testing and result reading. Indeed, the majority of current POC\u00a0diagnostics techniques continue to rely on constant electricity, costly laboratory resources, and trained users to interpret readouts. Additionally, the hardware and software of the device should be optimized for a single version of the smartphone. The development of standalone devices with defined diagnostic components must account for a wide range of smartphone models while maintaining a tight control over the software environment. The variation in hardware and physical form factors between different brands of smartphones presents challenges for commercialization and risk assessment during the regulatory review process. Additional challenges arise from the automation and intelligence of devices. Automated result analysis provides the potential to reduce systematic and human errors associated with the interpretation, recording, and uploading of virus diagnostic test results. To accomplish this, computational and statistical methods, such as machine learning, deep learning, the Internet of Things (IoT), and other AI algorithms, are gradually integrated into custom\u2010built apps. Through the use of AI\u2010assisted systems, smartphone\u2010based POC\u00a0diagnostics will accelerate the development of commercial POC\u00a0devices, allowing for improved diagnosis and prediction of virus disease onset and progression.Clinical validation is essential for the development of smartphone\u2010based POC diagnostics, which pushes this technology toward successful field trials. In this stage, the accuracy and stability of the device are two important clinical parameters to assess the clinical utility of the test. Clinical samples can vary greatly due to the patient's disease state and the patient's stage of viral infection. As a result, test results may exhibit very different performance in the device compared to the sample used for proof of concept. These POC devices need to be validated in clinical diagnostics to meet their intended end use. Finally, technological innovations in mobile POC diagnostics must comply with regulatory policies, such as the Food and Drug Administration (FDA), the European Commission and the WHO. These guidelines ensure the quality of the commercialization process of smartphone\u2010based POC diagnostics, including technology development, device manufacturing, end\u2010use, and consumer services.5The convergence of mobile technology and the field POCT diagnostics offers potential opportunities for the development of groundbreaking technologies for infectious virus diagnosis. Advanced strategies of smartphone\u2010based POC\u00a0diagnostics have enabled laboratory\u2010based molecular techniques such as immunoassay and nucleic acid amplification to be performed in plug\u2010and\u2010play stand\u2010alone devices. Meanwhile, smartphone technology is disrupting the traditional field of infectious virus diagnostics by democratizing and decentralizing testing, as well as increasing their accessibility in resource\u2010limited settings. Automated and intelligent mobile\u2010assisted testing with equipment\u2010free diagnostic devices is rapidly penetrating into private homes and personalized testing due to the potential of public participation. Additionally, the real\u2010time connectivity of smartphones will facilitate the development of next\u2010generation POC\u00a0technology, allowing individuals to access digital health pathways for integrated virus outbreak detection, surveillance, and disease epidemic containment. However, only a few proof\u2010of\u2010concept POCT devices have been fully integrated and deployed, and their efficacy has not been evaluated on a large scale. To accomplish this, researchers must assess the needs and value, the cost, the development of technology, the clinical effectiveness, and the applicable regulation. Otherwise, smartphone\u2010based POC technologies will face unpredictable barriers to commercialization, institutional adoption, and public confidence. The future of smartphone\u2010based POC diagnostics is bright, and it is changing the way patients are diagnosed in centralized laboratories. At the same time, advances in smartphone\u2010based POC technology could set the stage for a larger market in global public health. We believe this review can help push the development of mobile diagnostics forward with scientific and available guidance, leading to more valuable devices and ultimately helping to reduce the global burden of infectious disease.The authors declare no conflict of interest.M.X., F.T., and X.L. contributed equally to this work. M.X. is responsible for the manuscript writing of Sections"}
+{"text": "Biofilms, aggregated bacteria colonizing the extracellular polymeric substances matrix, are associated with the mucosa of inflammatory bowel diseases (IBD) patients with some studies showing a mean density of the mucosal biofilms 2-fold higher in IBD patients than in controls. The appendix, which is a highly immune organ, seems to be involved in IBD pathogenesis.In this study we aimed to evaluate biofilms in the appendix and other non-inflamed regions of the colon in pediatric IBD patients. We hypothesized that biofilms composed of pathobionts in these sections could drive inflammation in IBD patients.Tissues from the appendix, peri-appendicular region, cecum, and ascending colon (ASC), collected from the resected colons of 9 pediatric IBD patients and one pediatric non-IBD patient, preserved in methanol Carnoy\u2019s solution were processed and paraffin embedded. Combined fluorescence in situ hybridization (FISH) for biofilms (probe: EUB338) and immunofluorescence (IF) mucin staining (MUC2) identified biofilms and their location. Biofilm formation capacity of culturable bacteria (identified through 16S DNA Sanger sequencing) from these sections was measured. Interleukin (IL)-8 (pro-inflammatory chemokine) and IL-10 (anti-inflammatory cytokine) expressions were assessed by tissue qPCR.Enterococcus avium has a significantly higher ability to form biofilms than the negative control. IL-8 and IL-10 both had the highest expression level in the appendix and peri-appendicular region and the lowest in the ASC among all the patients, suggesting an active immune response. Mechanistic experiments are in progress to investigate the type of bacteria involved in the biofilms and their effects on the gut barrier integrity.FISH demonstrated biofilms in these sections, in close proximity to epithelial cells. We used a biofilm formation assay to assess the ability of the identified bacteria from these sections to form biofilms, illustrating their potential to colonize and evade host defense and potential antibiotics. We found that Biofilms adjacent to the epithelium, especially in the appendix and peri-appendix, could interact with or invade epithelial cells. The elevated chemokine transcript level in the appendix could reflect the recruitment of immune cells to this section following bacterial invasion, resulting in the activation of the immune system. Identifying the bacteria involved in the biofilms and clarifying their characteristics will aid us in developing novel microbe-altering treatment strategies or personalized medicine.None Declared"}
+{"text": "ERBB2, GRB2, GRB7, and FGF receptor genes strongly correlated with the presence of type 2 T helper cells. Finally, only 8 genes were highly upregulated and present in the cellular membrane: MILR1, ACE, DCSTAMP, SLAMF8, CD160, IL2RA, ICAM2, and SLAMF6. In summary, we described immune populations associated with genomic alterations with different BC subtypes. We observed a clear presence of inhibitory cells, like Tregs or Th2 when specific chromosomic regions were amplified in basal-like or HER2 and luminal groups. Our data support further evaluation of specific therapeutic strategies in specific BC subtypes, like those targeting Tregs in the basal-like subtype.Identification of genomic alterations that influence the immune response within the tumor microenvironment is mandatory in order to identify druggable vulnerabilities. In this article, by interrogating public genomic datasets we describe copy number variations (CNV) present in breast cancer (BC) tumors and corresponding subtypes, associated with different immune populations. We identified regulatory T-cells associated with the Basal-like subtype, and type 2 T-helper cells with HER2 positive and the luminal subtype. Using gene set enrichment analysis (GSEA) for the Type 2 T-helper cells, the most relevant processes included the ERBB2 signaling pathway and the Fibroblast Growth Factor Receptor (FGFR) signaling pathway, and for CD8+ T-cells, cellular response to growth hormone stimulus or the JAK-STAT signaling pathway. Amplification of  Cancer is characterized by the presence of modifications in the genomic material that can subsequently lead to a proliferative advantage . AlteratThe identification of these alterations leads to the development of potential therapeutic strategies. For instance, in the case of mutations at the kinase domain, the modified protein can have a hyper-functional activity that could be inhibited by chemical entities acting on the enzymatic area , 6. ThisBC is a heterogeneous disease, and a particular subtype is that one in which the amplification of HER2 produces a protein overexpression \u201331. OtheTransformed cells interact with their microenvironment modifying the immunologic response against the tumor \u201337. The In our work, we interrogated the BC genome to identify CNV, particularly gene amplification, that could influence the immune response. In addition, we analyzed proteins that were expressed on the cellular surface and that could be therapeutically inhibited with antibodies.http://kmplot.com/analysis/), respectively.The global design of the study is displayed in www.cbioportal.org; accessed on December 2019). This dataset data was used to explore genes with CNVs for each molecular subtype of BC. Only genes that were amplificated or deleted in the samples with a frequency higher than 10% were selected.Processed TCGA (The Cancer Genome Atlas) PanCancer dataset was obtained from cBioportal , 49 . P-values below 0.05 were accepted as statistically significant however, we set up a threshold of p-value < 0.01 and FC > 1.74 to be more restricted (https://www.R-project.org/).Within each molecular subtype, the list of genes was compared to the immune scores  between those with depletion or amplification compared to the rest of samples using a Mann-Whitney test. This analysis was performed for each individual gene and we obtained its https://maayanlab.cloud/Enrichr/, accessed on: February 2022). The selected genes for this analysis were selected according to each molecular subtype, and the chromosomic regions with more than 10 amplified genes.The biological process related to each gene set was obtained using the Gene Ontology Biological Process 2021 through the publicly available EnrichR online platform \u201355  and different BC subtypes  was performed with GTEx and TCGA data using GEPIA2 web server    .https://wlab.ethz.ch/surfaceome/)   .https://www.genecards.org/, accessed on February 2022)The genes that were missing in surfaceome Atlas were consulted on the Genecards website ,  for the significant genes on the cell surface, where all the information related can be found in the A protein-protein interaction analysis was performed using the String networks database   was used to evaluate the relationship between the expression of surfeaceome significantly overexpressed genes and survival in different types of BC (n=2976). This open access database allowed us to investigate Relapse Free Survival (RFS) and Overall Survival (OS). False Discovery Rate (FDR) indicates replicable associations across multiple studies.The KM Plotter Online tool  , and 17q . Finally, we identified altered genes only in the basal subgroup . The chromosome region with more genes altered included the 8q with 425, followed by the 1q with 320  and FC higher than 1.74 are shown in a volcano plot representation in We next correlated the presence of amplified genes with specific immune cell populations using the immune score in each specific BC subtype. The statistical association , Type 1 T-helper cells (468 genes), and Regulatory T-cells (433 genes), followed by CD8+T cells (286 genes) (2(FC) greater than 0.8 and a -log10 higher than 2 (selected in yellow in ).Due to the high presence of amplified genes related to different immune populations, we added a more restrictive classification that included only those with a logp-value for transcripts in chromosomic locations that included more than 10 amplified genes  evaluating the top 5 molecular functions ranked by the significance of the ERBB2, GRB2, GRB7, and FGF receptor genes are strongly correlated with the presence of type 2 T helper cells.We next explored GSEA for the type 2 T-helper cells evaluating the difference between the molecular subtypes. For the HER 2 + tumor subtype, all genes implicated were located at chromosome 17q, where we distinguished relevant pathways such as the ERBB2, ERBB, and epidermal growth factor receptor (EGFR) or the negative regulation of ERBB 1 1 . In our i-PD(L)1 .Regarding the specific populations identified in our analysis, the Type 2 T-helper cells, Treg cells, and NK cells were highly associated with the 17q- and 6q-amplified HER2+ molecular subtype, and Type 1 and Type 2 T-helper cells within the luminal A and B subgroup. This was a relevant finding as highlighted the presence of T cell helpers in some specific BC subtypes. It has been extensively reported that tumors where hormones are the main driver of the oncogenic process like luminal A and B BC or prostate cancer display a more immune suppressive microenvironment \u201364. In oERBB2, GRB2, GRB7, and FGF receptors. ERBB2, GRB2, and GRB7 were highly present in the HER2 positive subgroup and FGF in the luminal A and B. In this regard, activation by membrane receptors tyrosine kinases like ErbB receptors or FGFR has been associated with the presence of an immunosuppressive microenvironment and lack of response to anti-PD (L)1 inhibitors , were highly associated with Type 2 T-helper cells. Specific genes included hibitors , 73. In hibitors . HER2 amhibitors . Less evhibitors . HoweverMILR1, ACE, DCSTAMP, SLAMF8, CD160, IL2RA, ICAM2, and SLAMF6, and that could be inhibited with therapeutic antibodies. Two of them SLAMF6 and 8 were highly amplified and overexpressed in the majority of tumors. SLAMF6 is expressed in NK, T cells, B cells, and dendritic cells and some articles have suggested that SLAMF6 plays an inhibitory effect on CD8+ T cells (SLAMF8 has been associated with response to anti PD(L)1 therapies . ACEPAIN. CRIS Cancer Foundation and Diputaci\u00f3n de Albacete. This research is also supported by PI18/01020from the Instituto de Salud Carlos III and co-financed by the European Development Regional Fund (FEDER) \u201cA way to achieve Europe\u201d (ERDF). EM is supported by a \u201cJuan de la Cierva Incorporaci\u00f3n\u201d contract of the Spanish Ministry of Science and Innovation with Ref. IJC2019-041728-I.AO is a consultant of Servier and a former employee of Symphogen.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Creating enough decompression, favorable outcome, less complication, and maintain adequate lordosis and stability in the patients with cervical myelopathy due to multilevel massive ossification of the posterior longitudinal ligament (OPLL) still poses a challenge for surgeons. The aim of our study is to retrospectively evaluate our patients and try to seek a better surgical strategy.Between 2015 and 2019, 55 consecutive patients with multilevel massive OPLL underwent surgical treatment. Among these, 40 patients were treated with cervical laminectomy and then anterior decompression, fusion, and fixation (ADF), which was defined as group 1, and 15 patients were treated with cervical laminectomy and fixation simultaneously, which was defined as group 2. The patient's radiographic characteristics and postoperative outcomes were evaluated.p\u2009<\u20090.001), though the functional outcome had no significant difference. In the multivariable analysis, anterior fixation accounts for independent factors for better cervical sagittal alignment (p\u2009<\u20090.001). No complications directly associated with cervical laminectomy were observed.Better postoperative cervical sagittal lordosis and less long-term axial pain was achieved in group 1  and long-segment massive OPLL majorly involving the C2 and posterior laminectomy above and below the OPLL-affected levels with posterior fixation simultaneously. Ossification of the posterior longitudinal ligament (OPLL) is also an important pathology and is not a rare degenerative spine disease that causes neurologic dysfunction in middle-aged and elderly patients . As OPLLIn this study, we analyzed our cases with cervical multilevel OPLL with kyphotic deformity and higher COR, compared the functional outcomes and complication between laminectomy with ADF and PDF, and try to seek a better surgical strategy.The study was approved by the Institutional Review Board (IRB: 202000602B0). Informed consent was waived due to the retrospective nature of this study. The OPLL diagnosis was confirmed by experienced radiologist. Inclusion criteria were (1) cervical compressive myelopathy with/without radiculopathy emanating from OPLL and involving more than three vertebrae, and (2) a maximal COR of more than 60% , which wIn our department, we managed patients with multilevel massive OPLL according to K-line (+) or (\u2212) and whether involving the C2. On this view, the K-line was drawn from the midpoint of the spinal canal at C2 to the midpoint of the spinal canal at C7 . If K-liAmong these cases, 40 patients were treated with laminectomy followed by ADF, which was defined as group 1 , and 15 t test for categorical variables. Univariate and multivariate analyses of clinical characteristics and outcomes were performed. Contingency statistics on categorical variables were performed with Fisher's exact test. All statistical tests were two-sided, and p\u2009<\u20090.05 was prospectively determined to establish statistical significance. All analyses were performed using IBM SPSS Statistics, version 25.The differences between the different groups were tested for significance using the Student\u2019s p\u2009=\u20090.549) and in the preoperative VAS score (p\u2009=\u20090.052). However, there was a significant difference in the postoperative cervical lordosis degree and postoperative 3-month VAS between the two groups  and worse in group 2, but there was no significant difference  and slightly worse than in group 2 . In the multivariable analysis, anterior fixation accounts for independent factors for better cervical sagittal alignment  540\u00b0] procedure could provide safe decompression, cervical realignment, and favorable outcomes for extensive cervical OPLL with kyphotic deformity  and multilevel massive OPLL majorly involves the C2, posterior laminectomy above and below the OPLL-affected levels with posterior fixation simultaneously is considered first.2.For other multilevel massive OPLL, regardless of K-line (\u2212) or (+), laminectomy at compression level followed by ADF depended on the severity and range of compression, but corpectomy of not more than two vertebral bodies on the day between postoperative first and second weeks is considered first.Compared with PDF, our results showed that laminectomy and then ADF (corpectomy of two or less levels) for cervical multilevel massive OPLL resulted in a better postoperative cervical lordosis curve, less postoperative pain, and better JOACMEQ score, with equal postoperative complications.For those patients with multilevel massive OPLL or OPLL majorly involving the C2, our study proves that our protocol is safe, effective, and has few complications. So, we suggested the following:p\u2009<\u20090.001), although postoperative cervical lordosis is worse compared to preoperative in group 2. However, the postoperative VAS in group 1 is significantly better than that of group 2 (p\u2009<\u20090.001), and it might be associated with the improvement in postoperative lordosis. Decompression of the neural elements could improve pain caused by myeloradiculopathy, and re-establishment of regional cervical alignment could improve axial neck pain. It had been reported that patients feel less neck tenderness after operation treated with ADF in CM with multilevel massive OPLL (Compared with PDF (group 2), laminectomy followed by ADF (group 1) has the better postoperative 1-year lordosis curve, less axial pain, and better JOACMEQ score, with equal postoperative complications. All patients have better postoperative VAS than preoperative VAS in the two groups  had a significant impact in our univariate logistic regression analysis and multivariable analysis. Factors such as \u201cPreop C2\u2013C7 Cobb's angle\u201d have no influence on postoperative cervical lordosis. It could be explained by the fact that some kyphotic patients might gain more lordosis curve after the operation in our study. The similar concept on cervical myelopathy without OPLL patients was reported that preoperatively kyphotic patients benefitted more from surgery than lordotic patients .Selection bias and lack of randomization could be anticipated in this retrospective study. Furthermore, the role of CM due to multiple massive OPLL is relatively strict and it limits our case number. A well-designed prospective validation in independent cohorts is needed to establish the ideal surgical strategy for multilevel massive and extensive OPLL.There is still no standard surgical guideline to manage cervical myelopathy due to long-segment massive OPLL, but we offer a safe and effective protocol. For patients with long-segment massive OPLL, regardless of the canal occupying ratio and K-line (\u2212) or (+), we suggest laminectomy at compression level followed by ADF depending on the severity and range of compression or corpectomy of not more than three vertebral levels on the same day or within 2 weeks. For the patients with K-line (+) and massive OPLL involving the C2, we suggest posterior laminectomy above and below the OPLL-affected levels with posterior fixation simultaneously. In addition, we also demonstrated that cervical laminectomy followed by ADF could get enough decompression, minimalize the neurologic complication, get better cervical lordosis, and have less long-term axial pain in patients with CM due to long-segment massive OPLL."}
+{"text": "High resilience increases nurses' ability to cope with job-related stressors and enhances job satisfaction and, consequently, their retention. The study aims to identify resilience predictors and perceptions of transformational leadership in a convenience sample of registered nurses in Lebanon.An anonymous cross-sectional survey of a convenience sample of 240 registered nurses working for more than a year at three private hospitals in an underserved area in South Lebanon was used. The survey instrument included demographic questions, the True Resilience Scale \u00a9, and the Global Transformational Leadership Scale. Multiple linear regression was used to assess the predictors of resilience after a descriptive analysis of the study variables.p\u2009<\u20090.05). Resilience scores and perception of global transformational leadership were moderately correlated . In the final multiple linear regression model, 30% of the variation in resilience scores was explained by designation (p\u2009<\u20090.05) and perception of Global Transformational Leadership (p\u2009<\u20090.01). Perception of global transformational leadership scores explained 29% of the variance in resilience scores. Designation and perception of global transformational leadership predicted resilience in this sample.The survey response rate was 85%. The nurses' mean resilience score was 119.4 (SD 15.3), and their perception of transformational leadership score was M\u2009=\u200925.0, SD\u2009=\u20096.8. Compared to bedside nurses, nurse managers, nurses with more than five years of experience, and nurses in critical nursing units had statistically significant higher resilience scores (A national survey of the Lebanese nursing workforce is needed to achieve an improved predictive model and support policy developments to increase resilience among bedside nurses and retain them in the nursing workforce. Nurse administrators can help by strengthening their transformational leadership behaviors. Consistent use of transformational leadership styles will strengthen bedside nurses' resilience, increase nurse retention, and help sustain the Lebanese nursing workforce. An increase in demand and a decrease in supply causes the global nursing shortage . The StaLebanon has a shortage of qualified nurses, with 16.74 nurses and midwives per 10,000 population compared to an average of 24 nurses and midwives per 10,000 population in the Eastern Mediterranean region, thus ranking 10 of 21 countries in the region . Gulf coHealthcare professionals live amid many stressors including resource shortages, time constraints, emotional concerns , and traSidon is the third largest city in Lebanon with a high concentration of the urban underprivileged. The city is suffering from poor essential services such as comprehensive healthcare services, education, electricity, and other needs associated with social tensions. Moreover, as the district of the south was separated into two parts in 1995, Sidon witnessed a decline in its administrative importance, particularly after the decentralization laws of municipalities . ConsequIn an environment where tragedy, human suffering, and distress are considered major components of nurses' daily lives, resilience emerges as an essential requirement of nurses\u2019 survival . ResilieEmployee resilience is promoted by better psychological health, which is impacted by leadership style . TransfoTransformational leadership is a management practice; it is a leadership style that constitutes a set of leadership behaviors that inspire and empower followers to go beyond what is required and expected . This tyTransformational leadership has a positive impact on employees' psychological health and resilience . Arnold Since high resilience increases nurses\u2019 ability to cope with work stressors and increases their job satisfaction, it is vital to study nurses' resilience and perceptions of global transformational leadership. Similarly, it is crucial to explore how nurses in Sidon and other disadvantaged areas perceive transformational leadership and how their perceptions affect their resilience.The scarcity of data regarding resilience and nurses' perceptions of transformational leadership in underserved areas of Lebanon needs investigation as the research findings might assist healthcare organizations in retaining nurses by increasing their resilience and improving their job satisfaction. Therefore, policymakers and nurse administrators might find the findings of this study helpful when developing strategies and implementing initiatives intended to create and sustain the nursing workforce in Lebanon's underserviced areas. Moreover, the findings of this study may inform other nurses\u2019 and healthcare authorities in other countries having similar circumstances and serving similar communities affected by economic adversities.To our knowledge, no studies in Lebanon or in the region have investigated the relationship between self-reported resilience among nurses and their perceptions of transformational leadership.This study explores resilience among a convenience sample of hospital nurses working in Sidon, South Lebanon. A related aim is to identify the relationship of perceived global transformational leadership and nurse designation (bedside care vs. management role) on resilience in this sample of nurses working in a disadvantaged area.1. What are the perceived levels of resilience and perceptions of global transformational leadership of the registered nurses in the sample?2. Do registered nurses with more positive perception of global transformational leadership have higher resilience scores?3. Which study variables predict resilience among registered nurses in the sample?The specific research questions are:nd to March 22nd, 2016, after the American University of Beirut Institutional Review Board (IRB ID: NUR.ND.11) and hospital directors at the three hospitals approved the study. The hospital directors were assured that only the aggregated study results would be reported.A quantitative cross-sectional descriptive study design using survey questionnaire was conducted to determine the average resilience score and predictors of resilience among registered nurses and their relationship to nurses' perception of global transformational leadership in Sidon in South Lebanon at three private hospitals in March 2016. The study data were collected from March 2A convenience sample of 240 registered nurses who have been working at the three private hospitals for more than one year was included in the study. Practical nurses and auxiliaries were excluded from the study since the study aims to identify predictors and perceptions of transformational leadership in a convenience sample of registered nurses in Lebanon. The participants were 173 registered nurses and 30 nurse managers. Registered nurses are healthcare professionals licensed by the Ministry of Public Health to practice nursing. The nurse managers are registered nurses with managerial responsibilities 24\u00a0h a day, 7\u00a0days a week for a patient care unit. The sample distribution included 120 nurses from hospital A, 70 nurses from hospital B, and 50 nurses from hospital C depending on the number of registered nurses at each hospital. Nurses who met the inclusion criteria (registered nurses providing direct patient care and nurse managers) confirmed their voluntary consent on the first page of the survey. Informed consent was obtained from all subjects. Practical nurses and auxiliaries were excluded from the study.The study questionnaire included demographic and work-related questions in addition to The Original Resilience Scale \u00a9  and the Demographic and work-related data fields included age, gender, marital status, number of dependents, nursing experience, educational level, designation (bedside nurse or nurse manager), and clinical specialty.The original Resilience Scale \u00a9  is a 25-The Global Transformational Leadership (GTL) Scale  was usedThe scale authors permitted translation of the scales into Arabic for the study. A professional fluent in English and Arabic translated the scales and another back translated them independently. A panel of five bilingual registered nurses reviewed the Arabic versions of the scales to ensure readability, clarity, meaningfulness, and face validity. Accordingly, the items were rephrased, synonyms were substituted, and missing words were replaced before conducting the survey . Data coFollowing IRB and hospital director approvals, the questionnaires were delivered with cover letters and consent documents to the hospitals. A graduate assistant, who was not employed at the hospitals, approached the registered nurses and nurse managers to explain the study and distribute the research materials in sealed envelopes. The graduate assistant emphasized the voluntary nature of the survey and the importance of informed consent. The participants were assured of anonymity and confidentiality. The respondents sealed their completed questionnaires in envelopes provided by the graduate assistant and deposited them in a drop box in the office of an assistant administrator at each hospital. The envelopes were collected after 20\u00a0days and returned unopened to the first author.Statistical Product and Services Solutions (SPSS) version 23 was used to analyze the data. All the demographic variables, except the number of dependents, were recoded to create new variables with two groups. Hence, age was recoded into two categories with a cut point at 30\u00a0years, marital status was grouped into married and non-married, educational level was grouped as technical versus university, and job designation was re-categorized as bedside nurses versus nurse managers. Similarly, the years of experience variable was recoded with a cut of point at five years, whereas the nursing unit variable was recoded into two subcategories: critical and non-critical. Thirty-six of the nurses (15%) did not fill the survey and were excluded from the analysis; 204 nurses\u2019 responses were considered for analysis.p-value less than 0.1 at the univariable level were selected for analysis to allow for the addition of possible confounding variables. Variables were assessed for collinearity and interaction. Finally, selected variables were entered into a stepwise multiple linear regression model to determine the best predictors of resilience.Descriptive statistics, frequencies and percentages were used to describe the demographic characteristics of the respondents. Internal consistency of the two scales (resilience and GTL) were assessed using the Cronbach\u2019s Alpha. Mean resilience and GTL scores were computed, and 95% confidence intervals were constructed. Statistical significance was set at 0.05. The relationship between resilience and perception of GTL was analyzed using the Pearson correlation. Independent samples t-tests were used to study the relationship between resilience and the demographic variables. ANOVA analysis was performed to compare group means. Variables with a The study was conducted in accordance with the IRB-approved protocol. The distribution and collection of survey materials ensured the anonymity of the research participants. Confidentiality was maintained by using sealed envelopes to deposit and transport the completed surveys. The data were analyzed on a password-protected computer in a private office at the Hariri School of Nursing. The research records are stored in a locked office and will be destroyed in accordance with the American University of Beirut Archive Policy.Table Both scales (Resilience and GTL) had excellent internal consistencies with Cronbach's alphas of 0.94 and 0.95, respectively. Resilience scores were in the range of 77\u2013150. The mean resilience score was 119.4 (SD15.3), with 95% confidence interval 117.3\u2013121.5). Perception of Global Transformational Leadership scores were in the range of 0\u201335, Mean\u2009=\u200925.0 (SD 6.8), at 95% confidence interval (24.0\u201325.9) . In addition, there were significant positive moderate to medium correlations between the global transformational leadership and resilience scores. Inspirational motivation scores had a significant positive moderate correlation with the resilience scores . Similarly, the Idealized influence scores had a significant medium correlation with the resilience scores . The Intellectual stimulation score also correlated significantly with the resilience scores . Finally, Individual consideration had a significant medium correlation with the resilience scores .The results showed a significant positive moderate correlation between the perception of global transformational leadership scores and resilience scores among nurses (p\u2009=\u20090.018). Moreover, nurses with less than five years of experience had significantly lower resilience scores (Mean\u2009=\u2009117.5) compared to those with more than five years of experience (Mean\u2009=\u2009122.3) (p\u2009=\u20090.031). In addition, nurses working in critical care areas reported significantly higher resilience scores (Mean\u2009=\u2009121.3) compared to non-critical areas (Mean\u2009=\u2009117.0) (p\u2009=\u20090.049)  compared to nurse managers (Mean\u2009=\u2009125.4)  of the registered nurses above 30\u00a0years of age, which aligns with the Lebanese Order of Nurses\u2019 records . This imThe respondents' mean resilience score was 119.4 (SD 15.3), range 77\u2013150. This score indicates high resilience levels among nurses at the three hospitals. Higher resilience scores have been reported for nurses in South Africa, M\u2009=\u2009137.2 (SD 25.7)  and nursr\u2009=\u20090.533, explains less than 30% of the variance in the measures. Factors other than perceptions of global transformational leadership influence nurses\u2019 resilience. Our finding that nurses\u2019 designation is a significant factor in explaining nurses\u2019 resilience is consistent with other findings such as Sull et al.\u2019s (2015) that showed clinical staff had less resilience than staff with line management responsibilities [The mean score for perceived global transformational leadership was 25.0 (SD 6.8), range 0\u201335, indicating that the nurses perceived their leaders as transformational. A moderately significant correlation was noted between the perception of global transformational leadership scores and the nurses' resilience scores. Our results imply that the nurses\u2019 perceptions of global transformational leadership may partly explain why they had higher resilience scores than those reported in the studies cited in the previous paragraph. However, the moderate linear relationship between the nurses\u2019 resilience acores and their global transformational leadership, et al.\u2019s 15 that sbilities . Ang et bilities . Lower rbilities .Studies suggest that working in a management role fosters resilience because the nurses in these positions have better life-work balance compared to bedside nurses . FurtherThe significant positive linear relationship between higher resilience scores and years of experience we reported is consistent with other studies , 57. Howp\u2009=\u20090.049) whereby nurses working in critical areas declared more resilience than those working in non-critical areas. Monomenidis et al. (2019) reported similar findings from their study of Greek nurses [Mealer et al. (2012) reported that younger intensive care nurses with less nursing experience have higher resilience scores than their older and more experienced colleagues. The small but significant difference is probably because the more experienced nurses have had more time to accumulate the stressors of working in an intensive care unit . In thisk nurses .p\u2009=\u20090.029). In addition, the regression model indicates that every one unit increase in the perception of global transformational leadership scores is associated with a 1.2 points increase in resilience score . The association between global transformational leadership perception scores and resilience scores might be because by modelling, enthusiasm, and status, nurse managers encourage higher levels of work engagement [Our multivariate linear regression model results indicate that being a bedside nurse resulted in a 5.5 point decrease in resilience score compared to nurses in management positions (B\u2009=\u2009-5.5, gagement . Moreovegagement . Empowergagement . Similargagement .Studying components of resilience such as hope and optimism, job designation, and perception of global transformational leadership will help achieve a better predictive model. Replicating this study using a stratified sampling design at a national level across all hospitals is needed to explore predictors of resilience across government and private, rural and urban, and teaching and non-teaching hospitals to generalize results. The results of a Lebanon-wide study could contribute to a national agenda for increasing resilience among bedside nurses and, possibly, decreasing Lebanon\u2019s nursing shortage, especially in Sidon and other underserved areas.National nursing workforce policies are required that adopt a comprehensive strategy for strengthening the nursing workforce in underserved areas. A pyramid approach that considers individual, organizational, health system level, and institutional factors offer a better prospect of success than interventions that target individuals in isolation , 63. AutHospital administrations in Lebanon should implement organizational strategies to foster transformational leadership and strengthen resilience among bedside nurses. Such strategies include training, self-development programs, mentoring to improve workplace relationships and teamwork, and promoting work-life balance and spirituality to strengthen nurses\u2019 coping strategies and improve nurse retention. Team-based approaches to workforce development are preferred because they can foster a shared sense of meaning and purposefulness . Nurses The study has several limitations. The major limitation is that it relies on a self-reported measure of resilience, resulting in possible information bias. Another limitation is that the reported results might have been influenced by factors affecting the hospitals at the time of the survey. Such factors might include political and economic tensions affecting the region and its hospitals. A third limitation is possible convenience sample bias. Furthermore, the results reported cannot be generalized beyond the hospitals where the study was conducted.The study's primary findings were that job designation and perceptions of global transformational leadership predict resilience among nurses in Sidon and adjacent underserved areas. Moreover, job designation, years of experience, clinical specialty, and perception of global transformational leadership were significantly associated with resilience. These findings can encourage hospital administrations and nurse leaders to implement strategies to strengthen nurses\u2019 resilience in Sidon and other underserved and resource-poor areas in Lebanon. The sustainability of the nursing workforce in underserved areas of Lebanon depends on interventions to build resilience and improve leadership. National, regional, and international studies are required to determine whether the reported findings can be generalized. Meanwhile, nurse managers and supervisors can strengthen nurses\u2019 resilience, contribute to retention, and improve patient outcomes by adopting a transformational leadership style. The Order of Nurses might play a major role in training nurse managers in transformational leadership not only in that region but also across the country. Nonetheless, policy reforms are needed to develop and sustain the nursing workforce in underserviced areas of Lebanon."}
+{"text": "The aging population has led to a growing health expenditure burden. According to the National Bureau of Statistics of China, the old-age dependency ratio rose from 10.7% in 2003 to 17.8% in 2019, and health expenditure increased from 658.410 billion yuan in 2003 to 5812.191 billion yuan in 2019 in China.This paper utilizes the quantile regression method to discuss the influencing factors of health expenditure in urban China based on the China Household Finance Survey (CHFS), especially dependency burden. Moreover, its regional heterogeneity is also compared.The old-age dependency ratio, age, family size, self-rated health status, and income significantly impact the health expenditure of urban families in the quantile regression of the national sample. Dependency burden and other variables on urban household health expenditure have great regional heterogeneity. The relationship between urban health expenditure and residential areas in western China is more stable than that in eastern and central China.Government should improve the healthcare system suitable for the older adult population as soon as possible. The government of western China should pay more attention to the introduction of professional medical talents and the configuration of precision medical equipment to improve the health system in western China. The aging population has led to a growing medical and health expenditure burden worldwide. For example, people over the age of 65 increased from 96.92 million in 2003 to 176.03 million in 2019, an increase of 81.62%. The old-age dependency ratio rose from 10.7% in 2003 to 17.8% in 2019, with a growth rate of 66.36% in China . As a result, the health expenditure increases too rapidly. Global scholars have given great importance to health expenditure since the 1950s and found that the influencing factors of health expenditure mainly include income level, education level, medical insurance, and so on.The influence of income on health expenditure is mostly positive. For example, Newhouse  found thIn addition to income level, education level also affects the health needs of residents, which in turn affects health expenditure. Mwabu et al.  found thCountries around the world hope to improve health insurance to reduce the medical burden on residents. Hurd and McGarry  found thHealthcare consumption increases with age due to the dependency burden. Fuchs  pointed To sum up, global scholars have discussed the possible influencing factors of health expenditure from different dimensions. Most studies believe that income level, education level, and health insurance impact health expenditure. However, few studies discussed the effect of population aging (represented by dependency burden) on health expenditure or have not reached uniform conclusions. Therefore, this paper tries to use the quantile regression method to discuss the influencing factors of health expenditure in urban China based on the China Household Finance Survey (CHFS), especially dependency burden. Moreover, its regional heterogeneity is also compared. The quantile regression method is used because it can capture the characteristics of urban household health expenditure in different quantiles nationwide and among regions and more accurately describe the influencing factors of health expenditure.It should be noted that the latest data on CHFS was released in 2017 when we wrote the paper, and its data samples covered 400,011 households and 127,012 individuals in 29 provinces . It involves household demographic characteristics, assets and liabilities, insurance and security, income and expenditure, and other micro-household financial data. Furthermore, the rejection rate of CHFS is low, and the demographic characteristics are very similar to the data published by the National Bureau of Statistics of China.Household health expenditure is divided by the total population of each household based on the personal ID calculation generated by the tracking of the respondents by sorting out the answers to the CHFS questionnaire \u201chow much did your family spend on healthcare last year.\u201d In the process of data collation, considering the sufficient sample size, the missing value and uncertain invalid data in the original data of family health expenditure are first removed and then divided by the total population of each family to obtain the per capita health expenditure of the family. At the same time, by observing the QQ chart and boxplot of the per capita health expenditure of the family, we can see that the median of the dependent variable is small and has a large outlier. The QQ chart is a curve with asymmetry, which differs greatly from the normal QQ line. In general, the per capita health expenditure of the family in the sample data does not meet the normal distribution. Second, to reduce the volatility of the variable itself, the family per capita health expenditure is logarithmically transformed. The reason for doing this is that the logarithm will not change the nature and correlation of the data, but the scale of variables is compressed, the data are more stable, and the collinearity and heteroscedasticity of the model are weakened.The key indicator of dependency burden is the old-age dependency ratio. Most studies use the old-age dependency ratio to measure the degree of population aging. Different from the previous literature, this paper calculates the proportion of the older adult population (aged 65 and above) to the working-age population (aged 15\u201364) according to the characteristics of the micro-household database, so as to measure the dependency burden for the older adults. Therefore, the higher the old-age dependency ratio is, the more significant part of the value created by the working population will be used for the consumption of the older adults, which will put a heavier dependency burden on the society and reduce the income of the working population.Other explanatory variables include age, education level, marital status, and others. The specific processing process is shown in The empirical data of this paper are from the household database published by China Household Finance Survey (CHFS), which is a nationwide sample survey designed to collect relevant information about household finance at the micro-level. CHFS is being conducted every 2 years since its inception in 2009. It has successfully carried out random household sampling surveys nationwide for four times in 2011, 2013, 2015, and 2017. This paper selects the data samples that cover 40,011 households and 127,012 individuals in 29 provinces in China Household Finance Survey (2017), involving micro-household financial data such as household demographic characteristics, assets and liabilities, insurance and security, income and expenditure, and so on. Finally, 19,787 households were selected as empirical samples by eliminating the missing value and outliers of the sample data. The rejection rate of CHFS was low and the sample size was abundant, while the missing values and outliers were few. Therefore, deleting them in the case of a large sample size had less effect on the results.Classical regression such as ordinary least squares (OLS) is focused on \u201cmean regression\u201d and is susceptible to extreme values because the objective function for minimization is residual squared and  Bassett  put forwDue to the imbalance between economic development and the allocation of medical resources in China, the health expenditure of most families remains at a low level compared with that of developed countries in Europe and the United States. However, it is not excluded that some families have high health expenditures due to special reasons, which may lead to the uneven distribution of health expenditure allocation. This case will cause errors if mean regression is still used to estimate the overall model. Therefore, the quantile regression method is used, because it can capture the characteristics of urban household health expenditure in different quantiles nationwide and among regions and more accurately describe the influencing factors of health expenditure. The model is set as Equation 1:lnPEi is the logarithm of the per capita health expenditure of the urban household i, ORiis the old-age dependency ratio of the urban household i; agei is the age of the head of household i; genderi indicates the gender of the head of household i. Mi is the marital status of the head of household i; jyi represents the educational level of the head of household i; numberi is the size of the household i. Pi represents the overall self-rated health status of the household i (including head of household); PIi represents the per capita income of household i, YBi represents the type of social medical insurance, and \u03b5i is the random interference term.where To better display the distribution characteristics of variables in the model, a descriptive summary of relevant variables in nationwide, eastern China, western China, and central China is shown in In Among the three regions, the average logarithm of the per capita health expenditure of urban families in eastern China is RMB 6.915 yuan, exceeding the national average (RMB 6.904 yuan), whereas the mean of the central and western China is RMB 6.878 and 6.903 yuan, respectively, lower than the average of the national sample family per capita health expenditure. Therefore, the average value of explained variables is the highest in eastern China, indicating that eastern families' overall level of per capita health expenditure is higher.The mean value of the old-age dependency ratio showed the trend of central China greater National greater western China greater eastern China, and the mean value from high to low was 0.262, 0.251, 0.249, and 0.247. At the same time, by comparing the standard deviation of the old-age dependency ratio between the national sample and each region, it can be seen that the aging degree of the samples in each region is similar to a small gap, indicating that the old-age dependency ratio gap between families is reasonable and the sample selection is representative. In addition, the mean of family size, education level, and age in the three regions are very close to the national average. According to the per capita income of urban families after logarithm, the eastern region has the best economic development among the three regions. Therefore, the maximum sample value of per capita health expenditure in the eastern region is 14.732, which is higher than that in the central region (14.262) and western region (14.527). However, the mean of per capita household income showed a trend of western region > eastern region > central region, with the maximum mean of 9.531 in the western region and the minimum mean of 9.484 in the central region, and only the mean of the western region exceeded the national average (9.504).In this paper, the explained variables were divided into families with different levels of health expenditure, with quantile boundaries of 10, 25, 50, 75, and 90%, respectively.As can be seen from The old-age dependency ratio has a significant effect on the per capita health expenditure of the family. With the increase of quantile (0.1 \u2192 0.25 \u2192 0.5 \u2192 0.75 \u2192 0.9), the quantile regression coefficient of the old-age dependency ratio showed a U-shaped trend of rising first and then decreasing (0.096 \u2192 0.078 \u2192 0.067 \u2192 0.076 \u2192 0.097). The results show that the old-age dependency rate has the greatest impact on the health expenditure of families with lower health expenditure. At the same time, the standard error of the estimated coefficient decreased first and then increased (0.079 \u2192 0.065 \u2192 0.045 \u2192 0.05 \u2192 0.067), indicating that the estimation of the quantile regression coefficient at both ends of the conditional distribution is not accurate, but the difference in accuracy is small. Therefore, population aging has a greater impact on families with lower levels of health expenditure in China and a smaller impact on families with higher levels of health expenditure.The influence of age on family health expenditure was significantly positive at each subsite of the national sample. The standard error of the estimated coefficients is consistent, indicating that the impact of age on family health expenditure is relatively stable. With the increase of age, health expenditure increases steadily. Female-headed households have a higher level of health expenditure per capita than the male-headed sample. Married people have a significant positive impact on health expenditure at 0.1, 0.25, and 0.5 subpoints, and the family with lower health expenditure has the greatest impact. The education level of residents is only a significant variable at 0.1 and 0.25 subpoints and has a similar effect on families with low health expenditure, with no significant difference. The regression results of family size show that health expenditure is inversely correlated with the total population, and the health expenditure of a family decreases by 11\u201312% with each additional family member.The influence of self-rated health status on the per capita health expenditure of the family is more prominent among all the influencing factors, especially in the sample group with poor self-rated health status. Compared with the residents with good self-rated health status, the impact of the sample with average self-rated health status on the per capita health expenditure of the family shows an inverted \u201cU\u201d trend, which increases first and then decreases. Therefore, when residents self-rated their health status as average, households with moderate health expenditure changed the most, accounting for 42.8%. Meanwhile, poor self-rated health status was the most prominent influencing factor. The standard error of the estimated coefficient showed a U-shaped trend of decreasing first and then increasing (0.068 \u2192 0.059 \u2192 0.050 \u2192 0.056 \u2192 0.088), indicating that the accuracy of the distribution estimation of the household per capita health expenditure is slightly lower.The effect of social medical insurance and residence on per capita health expenditure is not uniform. First of all, taking the sample group without any social medical insurance as a reference, urban employment insurance can significantly increase health expenditure and have a greater promotion effect on health expenditure with medium and low levels of health expenditure. Place of residence has no significant effect on the per capita health expenditure of families with a low level of health expenditure. The impact of residence on the per capita health expenditure of families at other subloci generally showed an inverted U-shaped trend of rising first and then decreasing. From 0.25 subloci to 0.9 subloci, the regression coefficients were \u22120.148,\u22120.271,\u22120.306, and\u22120.251, respectively, that is, compared with families living in urban areas. The per capita health expenditure of households in rural areas has decreased significantly.Based on the quantile regression results of the national sample, The quantile regression results of the study on influencing factors of urban family health expenditure in eastern China are shown in As can be seen from First, the effect of the old-age dependency ratio on per capita health expenditure is 89.5%, larger than the national sample of 80.4%, indicating that families with low health expenditure in eastern China are more affected by population aging than the national average. The influence of control variables, such as gender, marriage, family size, and demand variables, such as self-rated health status, on dependent variables was similar to that of the national sample, and there was no abnormal situation. Meanwhile, the regression coefficient between per capita household health expenditure and per capita household income was 0.068, lower than 0.113 of the national sample. The possible reason is that the economic level of the eastern region is leading in the whole country, so the health expenditure of urban families is less affected and constrained by the income parity. Compared with the sample without any social medical insurance, the per capita health expenditure of the families of NRCMS participants is lower, indicating that these families have received the benefits of NRCMS and reduced their family health expenditure.Second, health expenditure with middle-level health expenditure is significantly correlated with old-age dependency ratio, age, marriage, family size, self-rated health status, per capita household income, and residence. Among them, the effect of the old-age dependency ratio on per capita health expenditure reaches the minimum at this level. Every increase in the old-age dependency ratio by one unit can only increase per capita health expenditure by 51.5%, which is far less than the regression coefficients of 89.5 and 92.7% at 0.1 and 0.25 subpoints. It shows that population aging has the least influence on the average health expenditure per family in eastern China. The greater impact of residence on per capita health expenditure may be related to the gradual improvement of family health expenditure. With the increasing demand of family for medical and health services, the influence of medical resources and professional services on family health expenditure is also increasing. The promotion effect of social medical insurance on the per capita health expenditure of the family is gradually decreasing. The same reason is that the improvement in the family health expenditure makes the medical and health service become the necessary consumption expenditure of the family. Therefore, the influence of other factors becomes smaller.To sum up, the eastern region urban family medical expenditure on health-related factors influences the effect of the size and significance as the family per capita health spending sample conditional distribution varies. The regression results of the central region are shown in As can be seen from At the same time, similar to the influence of residence in the eastern region, the residence in the central region has the greatest influence on the per capita health expenditure of families with high health expenditure, with a regression coefficient of 0.233, lower than 0.334 in the eastern region. This may be because the medical and health resources and professionals in the eastern region are richer than those in the central region, so the medical cost of urban families in the eastern region is higher, and the use of medical and health services is more convenient and comprehensive. Thus, the health expenditure of urban families in the eastern region is higher. Refer to The regression results of the western region are shown in According to the quantile regression results shown in First of all, the influence of the old-age dependency ratio on the health expenditure of urban families in western China is generally weaker than that in eastern and central China. Similarly, the influence of families with a lower old-age dependency ratio on health expenditure is the largest at each subsite. In addition, the regression coefficients of the old-age dependency ratio at 0.25 subpoint in eastern, central, and western regions were 0.927, 0.840, and 0.743, respectively, which may be related to the different degrees of aging in different regions. At the same time, the robust standard error of the estimation coefficient of the old-age dependency ratio was larger than that of the eastern and central regions, and the size of the standard error was 0.198, 0.147, 0.140, 0.176, and 0.118 from the low loci to the high loci, indicating that the estimation of quantile regression coefficient at the right end of the conditional distribution was more accurate. The quantile regression coefficient of the left end of the conditional distribution is different. That is, the increase in per capita health expenditure of urban families in western China is <19.8% and close to 11.8% when the old-age dependency ratio increases by one unit.Second, gender and marital status only have a significant positive impact on the per capita health expenditure of families with low health expenditure, while there is a positive correlation between the level of health expenditure of families with medium or lower level and residents' education level. In addition, the effects and characteristics of family size and self-rated health status on per capita health expenditure are similar to those in eastern and central China, which are both important influencing factors. At the same time, the central region of the family healthcare spending has no obvious relation with residents affected by education level. It shows that the education level of urban areas in western China is relatively backward as a whole. There is still a large space for development.Third, the impact of per capita household income on per capita household health expenditure shows a U-shaped trend of decline first and then rise, and families with high levels of health expenditure are not affected by per capita household income, indicating that there is a large gap in economic level between urban families in western China. Based on the analysis of the regression results and coefficients of the above influencing factors, To test the robustness of the quantile regression model, this paper used elderly population coefficient  instead of the old-age dependency ratio. The regression results of the nationwide sample are shown in Compared with This paper explores the impact of the dependency burden on urban household health expenditure and its regional heterogeneity in China based on the micro-data of CHFS. A total of 19,787 valid samples were obtained and the quantile regression method was used due to the skewness of the distribution of explained variables and the possible extreme values. Some useful results were found.First, the old-age dependency ratio, age, family size, self-rated health status, and income significantly impact the health expenditure of urban families at the national sample quantile regression . This mThe above conclusions can help us put forward some policy recommendations.First, government agencies should unite with all social strata to establish a multi-level social security system for aged care and formulate relevant policies to establish a medical care system for the older adult population suitable for economic development as soon as possible.Second, the aging population greatly affects health expenditure in eastern China. This reflects the higher level of economic development in the eastern region, which leads to the early emergence of a low birth rate, low natural growth rate, and low death rate in the population structure of the eastern region, and the aging degree is deep. The aging problem in the eastern region cannot be improved significantly in the short term, so the medical institution service system related to the older adult population in the eastern region should be improved as soon as possible to ensure that the medical needs and old-age services of the elderly can be satisfied.Third, the correlation between the urban health expenditure and their residence is the most stable and strong in western China. The differences in residential areas represent the lack of medical and health resources such as medical institutions and medical professionals between urban and rural families. Therefore, we should pay attention to the introduction of professional medical personnel and the configuration of precision medical equipment in the western region to improve the medical and health system in the western region.There are some improvements in this study. For example, this paper selects the old-age dependency ratio as the core explanatory variable such as the fiscal policy factor , 33, whiThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.The data of this study came from China Household Finance Survey (CHFS) datasets (publicly available datasets). All methods were carried out in accordance with relevant guidelines and regulations (Declaration of Helsinki).XX: conceptualization, writing, and editing. QW: methodology and software. CL: data curation and project administration. All authors contributed to the article and approved the submitted version.This paper is a phased achievement of The National Social Science Fund of China: Research on the blocking mechanism of the critical poor households returning to poverty due to illness, no: 20BJY057.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Although nr-axSpA is a distinct clinical entity with characteristic clinical and radiologic features, it is mimicked by a variety of other stress-induced, degenerative, infectious diseases or other conditions both clinically and radiologically, especially when it comes to the interpretation of imaging methods such as magnetic resonance imaging (MRI). Overall, the sensitivity and specificity of MRI in the diagnosis of nr-axSpA has limitations and must be interpreted in the context of the clinical picture. Furthermore, the interpretation of sacroiliac joint MRI is critical to avoid overdiagnosis as nr-axSpA because bone marrow oedema adjacent to the sacroiliac joint may also be frequently observed in people without axSpA such as post-partum women and athletes, even in the general population.In this review article we present recent updates about the various disease entities and conditions that may mimic nr-axSpA and how to differentiate among them especially by imaging with MRI. These patients would be diagnosed today as having nr-ax-SpA based on magnetic resonance imaging (MRI), with signs of active sacroiliitis and concomitant clinical manifestations. In the last three years, there are increasing reports that the ASAS definition of a positive MRI, mainly based on the quantification of bone marrow oedema lesions suggestive of SpA, is not as specific as initially thought.9 The aim of this review is to describe and discuss the role of imaging for diagnosis of nr-axSpA and the various differential diagnoses that show similar imaging characteristics.The Assessment of SpondyloArthritis international Society (ASAS) published in 2009 the ASAS classification criteria for axial (ax) spondyloarthritis (SpA),11 In contrast, the epidemiology of nr-axSpA is still being investigated. A retrospective cohort study, based on the analysis of medical records from representative rheumatology practices in the United States, found after extrapolating the data to the national level that the U.S. prevalence of nr-axSpA according to ASAS criteria is 0.35% and similar to that for AS.12 Overall, except for the male:female ratio, no major differences in patient demographics have been reported between both SpA subgroups. AS shows a clear male dominance with a male-to-female ratio of up to 3:1.14 In contrast, nr-axSpA patients show little difference in the prevalence between males and females.16 Almost no differences were found regarding the mean age of the patients at presentation between subgroups.The prevalence of AS has been well studied and was found to be between 0.1 and 1.4%.17 Patients with AS or with nr-axSpA may present with characteristic clinical features such as inflammatory back pain (IBP), with peripheral symptoms such as enthesitis or arthritis, and with extra-musculoskeletal manifestations such as anterior uveitis, psoriasis and chronic inflammatory bowel disease.19 Furthermore, many patients, especially those who are positive for human leucocyte antigen (HLA) B27, have a positive family history of SpA or related diseases.20 The observed dissimilarities between the nr-axSpA and AS cohorts included longer disease duration, higher degree of radiographic damage, and reduced spinal mobility in AS patients.Several cohort studies examined the demographic and clinical features of patients with nr-axSpA in comparison to AS patients, seeking conclusive evidence that both disorders represent a spectrum of the same disease.21 while the spine is less frequently involved.22The diagnosis of nr-axSpA in the clinical setting can be challenging and advanced imaging has become essential for its recognition, as well as for the differential diagnosis. Because the disease affects sacroiliac joints (SIJ) in most patients, imaging of SIJ has a pivotal role for diagnosis of nr-axSpA,23Conventional radiography of the SIJ is recommended as the first imaging method to diagnose sacroiliac joint involvement as part of axSpA and to a further extent in its classification.2 . These patients are therefore regarded as \u2018non-radiographic\u2019. However, due to the complex anatomy of the SIJ, interpretation of these radiographs is often challenging. Indeed, a considerable inter-reader variation when evaluating conventional radiographs has repeatedly been reported even among experienced readers.24The term nr-axSpA, as mentioned before, is used for patients suffering from axSpA, but where the standard diagnosis, based on the presence of sacroiliitis on X-ray images, does not apply by the absence of radiographic changes.25Normal or ambiguous radiographic results of SIJ examination in the context of a possible diagnosis of SpA require MRI investigation of the SIJ as the next step.26While it may take up to 10 years for the first structural lesions to appear on pelvic radiography, MRI has the potential to detect inflammation at the very first manifestation of sacroiliitis. Moreover, MRI has shown the ability to also demonstrate inflammation-related structural SIJ lesions in 60\u201390 % of SpA patients already in the first 2\u20133 years after symptom onset.The following MRI sequences are useful for diagnosis and differential diagnosis of axSpA: a T2-weighted sequence with fat suppression (such as a short tau inversion recovery [STIR] sequence) for detection of active inflammatory changes (bone marrow oedema [BMO]) and a T1-weighted sequence for detection of post-inflammatory changes, such as erosions, sclerosis, ankyloses, and fatty lesions.27 .According to the ASAS criteria a positive scan is defined as one area of BMO on at least two consecutive slices or at least two areas of BMO on a single slice, while lesions such as capsulitis, enthesitis and synovitis should also be taken into account also.13 It is therefore important to mention that periarticular BMO signal can appear in patients with non-specific back pain,4 postpartum women,5 soldiers,6 runners,5 athletes,7 and even in the general population,28 emphasizing the importance of a proficient and expert reading of the MRI images for an accurate identification of BMO in the context of SpA diagnosis.The presence of structural damage without BMO is currently not sufficient according to ASAS, for classification to the disease. As mentioned before, more recent research reinforces the notion that inflammatory changes on an MRI, without suspicious changes in the conventional radiograph, should not be used in isolation to identify nr-axSpA.Common differential diagnoses for nr-axSpA are degenerative or mechanical problems , while other differential diagnoses such as fractures and infectious sacroiliitis are less frequent but still possible.2B). The hypothesis that previous pregnancies might be a precipitating factor was supported by the results of a case-control study of 35 patients identified with OCI over a 10-year period. All patients were female and reported previous pregnancies.29 SIJ stress tests showed higher SIJ pressure sensitivity in OCI patients compared with healthy controls. Number of pregnancies, birth weight, and back pain symptomatology did not differ between OCI patients and controls.Osteitis condensans ilii (OCI) is a condition that can present with chronic back pain and sometimes hip pain. In this case, probably mostly in the context of mechanical stress, bilateral sclerosis occurs in the area of the distal SIJ with a preference for the iliac bone. Such radiographic changes are frequently mimicking sacroiliitis such as the one found in nr-axSpA . The OCI patients had an overall significantly lower prevalence of inflammatory back pain, and typical SpA features were less frequent than in axSpA, but also more frequent than in chronic back pain patients. A statistically significant difference compared to axSpA was only found for anterior uveitis. The age at onset of back pain was not different axSpA and OCI, and there were no differences in spinal mobility. Also, disease activity  and subjective degree of functional impairment  were comparable between the groups. Although 84% of axSpA patients were HLAB27+, 35% of the patients classified as OCI patients also carried this genetic trait . An elevated CRP was found in about 40% of the axSpA and in only 7% of OCI patients. Overall, the results of these studies shown that a distinction between axSpA and OCI is difficult in daily practice.One recent prospective study compared patients with OCI and with axSpA, all of whom had been referred for possible axSpA.31 Degenerative changes of SIJ are characteristic and bone sclerosis is the main feature, with SIJ space narrowing in only about 1/4 of the cases. Sclerosis is fairly limited to the anterior and middle portion of the joints, that often manifests as sharp and well demarcated and dense area, compared to the moderately dense and fuzzy edged sclerosis in inflammatory sacroiliitis.32It has long been known that degeneration of SIJ is common and causes low back pain.33 sacroiliitis according to ASAS criteria was found in 71 examinations (25%), whereas degenerative changes were found in 11 patients (4%). These changes were defined as joint space narrowing, subchondral sclerosis, subchondral cysts, osteophytes and minute subchondral fat deposition with or without minor subchondral BMO. Patients with alternative diagnoses were older than patients with sacroiliitis ; however, this difference was not statistically different. A similar study performed by Jans et al. reported slightly lower percentage of SIJ degenerative changes (3.6%).34In a retrospective analysis of 281 MRI examinations performed for low back pain in 116 men and 165 women, mean age 44\u00b115 years,35 The prevalence of accessory SIJs has been described in 13\u201318% of the general population, found bilaterally in 50% of affected persons.36Accessory SIJs are an articulation between the medial aspect of the posterior superior iliac spine and the sacrum just lateral to the second dorsal sacral foramen. They may be congenital  or more commonly acquired (fibrocartilaginous joint) in origin.Young patients complain of chronic or recurrent low back pain, which makes this SIJ- anatomical variation a differential diagnosis of nr-axSpA.37Rafei et al. identified in their retrospective analysis of 157 MRI examinations of SIJ, the variation of accessory SIJ in 17 patients. This variation was best depicted on the axial images and was located at the level of the first or second sacral foramen. Signal intensity changes of the adjacent bone could be depicted in 11 patients, mostly of structural type (sclerosis of fatty deposition), but 4 patients also demonstrated oedematous changes.39 Patients with undiagnosed sacral stress fractures are usually referred to radiographs of the pelvis and lumbar spine, which usually do not reveal the pathology. On account of a combination of low back pain and normal radiographs is the suspicion of nr-axSpA justified . On MRI of the SIJ, BMO in the periphery of the sacrum, suggestive of a stress fracture, may be mistaken for the periarticular BMO of sacroiliitis. In this case, the fracture line should be looked for on both T1w as well as T2w sequences within the BMO.40 Sacral stress fractures may represent an underestimated cause of prolonged low back and pelvic pain both in athletically active young to middle-aged persons.42 by far its most common symptom is the deep-seated back pain43 infection of the SIJ may mimic especially nr-axSpA.Infectious diseases also present an important differential diagnosis of axSpA, since a delayed diagnosis can lead to irreversible damages of the joint. Since mostly young people are affected by pyogenic sacroiliitis,44Staphylococcus aureus is the most frequent organism recovered from synovial or blood specimens in patients with infectious sacroiliitis, but streptococcus species, Escherichia coli, and salmonella species have also been reported.46 SIJ involvement may occur together with spondylitis, and it might be hard to distinguish from other causes of sacroiliitis, like nr-axSpA as no distinct radiological findings are present in the first 2\u20133 weeks other than blurring, indistinctness of the subchondral osseous line and narrowing or widening of the interosseous space. MRI is the imaging modality of choice demonstrating intra-articular fluid, BMO with predominant periarticular involvement, especially during the early phase of the brucellosis.47 .Especially important to mention is brucellosis, which is endemic to the Mediterranean area and the Middle East. Sacroiliitis from brucellosis has been reported in 0\u201372% of the patients in different series.We describe here the most common and challenging radiographic and clinical mimickers of nr-axSpA, based on imaging findings. Various studies have highlighted a relatively high prevalence of BMO on MRI of SIJs in healthy volunteers, which could even be categorized as having a false positive classification as defined by ASAS. In the future it will be important to define clearly which MRI finding is stress-induced, degenerative, infectious, and/or non-specific versus specific for axSpA."}
+{"text": "Petra Terhoeven und Dirk Schumann 2021: Strategien der Selbstbehauptung. Vergangenheitspolitische Kommunikation an der Universit\u00e4t G\u00f6ttingen (1945\u20131965) . G\u00f6ttingen: Wallstein, geb., 357\u00a0S., 7\u00a0Abb., 34,00\u202f\u20ac, ISBN: 978-3-8353-3836\u20114.Christa Klein 2020:Elite und Krise. Expansion und \u201eSelbstbehauptung\u201c der Philosophischen Fakult\u00e4t Freiburg 1945\u20131967 . Stuttgart: Steiner, geb., 394\u00a0S., 22\u00a0Abb., 66,00\u202f\u20ac, ISBN: 978-3-515-12599\u20114.Seit den 1990er Jahren hat die wissenschaftshistorische Forschung gezeigt, in welchem Ma\u00df deutsche Wissenschaftler unter dem NS-Regime zur Selbstmobilisierung bereit waren. Bekannt ist auch, dass nach dem Krieg die \u00fcberwiegende Zahl derer, die sich in den Dienst der nationalsozialistischen Politik gestellt hatten, ihre Posten behielt oder zumindest nach wenigen Jahren wieder auf eine Professur gelangte, w\u00e4hrend nur eine kleine Minderheit ideologisch besonders exponierter Wissenschaftler dauerhaft ausgeschlossen blieb. Die Monografie von Christa Klein sowie der von Petra Terhoeven und Dirk Schumann herausgegebene Sammelband befassen sich mit dieser \u201eSelbstbehauptung\u201c wissenschaftlicher Eliten nach 1945. Beide Publikationen nehmen die kommunikativen Strategien in den Blick, mittels derer es deutschen Professoren gelang, nicht nur ihre institutionelle Position, sondern auch ihre Autorit\u00e4t und Deutungsmacht zu sichern.Strategien der Selbstbehauptung r\u00fcckt dabei, wie Petra Terhoeven formuliert, die Suche der Wissenschaftler nach \u201egesellschaftlich beglaubigten Sagbarkeitsregeln\u201c in den Fokus, \u201emit Hilfe derer die einzelnen beteiligten Akteure ihre Vergangenheit \u00fcberschreiben und sich innerhalb ver\u00e4nderter Bedeutungshierarchien erfolgreich neupositionieren konnten\u201c\u00a0(11). Die einzelnen Beitr\u00e4ge verfolgen \u00fcberwiegend einen akteurszentrierten Ansatz. Der Zusammenhang zwischen \u00f6ffentlicher Kommunikation \u00fcber die nationalsozialistische Vergangenheit und dem Streben nach individueller Rehabilitation wird besonders an den Beispielen der Historiker Percy Ernst Schramm, Walther Hubatsch und Hermann Heimpel deutlich. So zeigt Kerstin Thieler, wie sich der Mittelalterhistoriker Schramm, der von 1943 bis 1945 das Kriegstagebuch des Obersten Heereskommandos f\u00fchrte, in der westdeutschen \u00d6ffentlichkeit als Aufkl\u00e4rer und Experte f\u00fcr den Nationalsozialismus und den Zweiten Weltkrieg profilierte und damit seine N\u00e4he zum NS-Regime mit dem Gestus wissenschaftlicher Objektivit\u00e4t \u00fcberdeckte.Der Sammelband Die Beitr\u00e4ge des Bandes stellen aber nicht allein die NS-belasteten Wissenschaftler in den Fokus, sondern thematisieren am Beispiel der Physiker James Franck und Max Born sowie dessen Ehefrau Hedwig Born auch das Verhalten von Emigrierten. Dabei wird deutlich, wie schwierig deren Positionierung angesichts von Vereinnahmungsversuchen, verweigerter Wiedergutmachung und mangelnder Selbstkritik seitens ihrer in Deutschland verbliebenen \u201eKollegen\u201c war. Emigrierte Wissenschaftler wurden schon dadurch ausgegrenzt, dass sie ihre w\u00e4hrend der NS-Zeit neu besetzten Stellen nicht zur\u00fcckerhielten. Das Beispiel der Nobelpreistr\u00e4ger James Franck und Max Born ist dabei nicht unbedingt repr\u00e4sentativ, da sich die beiden prominenten Wissenschaftler, wie Kerstin Thieler und Jan Renken schildern, mit Vers\u00f6hnungsinszenierungen konfrontiert sahen\u00a0\u2013 zum Beispiel der Verleihung der Ehrenb\u00fcrgerschaft der Stadt G\u00f6ttingen \u2013, deren Zweck darin bestand, jene zu rehabilitieren, die sich mit dem Regime arrangiert hatten. Renken zeichnet zudem nach, wie die pers\u00f6nliche Erfahrung mangelnder Bereitschaft zur Wiedergutmachung sowie die allgemeine Sorge um das politische Klima in der Bundesrepublik das Ehepaar Max und Hedwig Born zu \u00f6ffentlichen erinnerungspolitischen Interventionen veranlasste. Hier wie auch im Fall von Ehrengard Schramm, die dem NS-Regime deutlich kritischer gegen\u00fcbergestanden hatte als ihr Ehemann, sich aber gerade deshalb f\u00fcr seine Rehabilitation einsetzen konnte, tritt auch die Rolle der oft ausgeblendeten Professorengattinnen hervor.Der Band zeichnet ein detailreiches Bild insbesondere der privaten vergangenheitspolitischen Kommunikation, das sich der Auswertung der Nachl\u00e4sse der zentralen Akteure verdankt. So sehr der von Terhoeven in der Einleitung formulierte Ansatz \u00fcberzeugt, lassen die einzelnen Beitr\u00e4ge aber eine konsequentere Anwendung des diskursanalytischen Instrumentariums, wie sie der Begriff der \u201eSagbarkeitsregeln\u201c nahelegt, vermissen. Solche Regeln werden bisweilen eher konstatiert als in ihrer Genese und Reproduktion erkl\u00e4rt. \u00d6fter w\u00fcrde man sich \u00dcberlegungen zu den \u201eMachtasymmetrien innerhalb der Erinnerungskultur\u201c w\u00fcnschen, wie sie Renken in seinem Beitrag zu Max und Hedwig Born anstellt (266). Es besteht zudem ein gewisser Konflikt zwischen dem systematischen, auf gesellschaftlich verbindliche Sagbarkeitsregeln gerichteten Erkenntnisinteresse und der personenzentrierten Herangehensweise in den Einzelstudien.Christa Klein geht es in ihrer Monografie weniger um die pers\u00f6nliche Vergangenheitsbew\u00e4ltigung ihrer Akteure als um die Strategien, mittels derer geisteswissenschaftliche Professoren ihre elit\u00e4re Position in der Universit\u00e4t sowie ihre Deutungsmacht in der \u00d6ffentlichkeit zu behaupten suchten. Eine entscheidende Rolle schreibt sie dabei der \u201eidealistischen Krisenrhetorik\u201c zu, als deren Tr\u00e4gergruppe in Freiburg sie eine \u201eKrisengeneration\u201c von Professoren identifiziert, die \u00fcberwiegend zwischen 1937 und 1951 berufen wurden. Diese Professoren verbindet, dass sie \u201emit einem allgegenw\u00e4rtigen Krisendiskurs wissenschaftlich sozialisiert worden waren, den sie in der Zweiten Nachkriegszeit wieder aufnahmen und f\u00fcr sich zu nutzen verstanden\u201c (195). Drei Dimensionen dieses Krisendiskurses hebt Klein hervor\u00a0\u2013 n\u00e4mlich die Beschw\u00f6rung einer deutschen Universit\u00e4tsidee, die Ablehnung von Akademisierungsprozessen und \u201e\u00dcberf\u00fcllung\u201c sowie ein gegen \u201ePositivismus\u201c und disziplin\u00e4re Ausdifferenzierung gerichtetes idealistisch-holistisches Wissenschaftsverst\u00e4ndnis. Professoren wie die Historiker Gerhard Ritter und Gerd Tellenbach griffen damit auf kulturkritische Diskurse aus der ersten H\u00e4lfte des 20.\u00a0Jahrhunderts zur\u00fcck, die zum Teil auch im Nationalsozialismus fortgeschrieben worden waren, nutzten diese aber nun, um die NS-Belastung der akademischen Elite zu \u00fcbert\u00fcnchen. Eine modernit\u00e4tskritische Deutung des Nationalsozialismus als Produkt von S\u00e4kularisierung und Orientierungsverlust in der \u201eMassengesellschaft\u201c diente dazu, die auf Basis eines idealistisch-holistischen Wissenschaftsverst\u00e4ndnisses postulierte gesellschaftliche Orientierungsfunktion der Geisteswissenschaften zu begr\u00fcnden.Konfrontiert mit einem zunehmenden Modernisierungsdruck entwickelte sich die Krisenrhetorik in den 1950er Jahren \u201ezu einer filternden Integrationsstrategie, die vorwiegend die Elite st\u00e4rkende Modernisierungsaspekte durchlie\u00df\u201c (299). Sowohl universit\u00e4tsgeschichtlich als auch mit Blick auf aktuelle Debatten \u00fcber universit\u00e4re Personalstrukturen besonders interessant ist die von Klein detailliert nachgezeichnete Reaktion auf die rapide steigenden Studierendenzahlen. Letztlich wurde die \u201e\u00dcberf\u00fcllungskrise\u201c in erster Linie durch einen \u00fcberproportionalen Zuwachs des Mittelbaus und dort wiederum Stellen f\u00fcr Nicht-Habilitierte bew\u00e4ltigt. Daf\u00fcr, dass sich diese auf hierarchischer Aufgabenteilung basierende L\u00f6sung durchsetzte und nicht etwa das zeitgen\u00f6ssisch diskutierte Modell der Studienprofessur oder ein st\u00e4rkerer Ausbau der Professuren, macht Klein (neben Kostenerw\u00e4gungen) das im Modus der Krisenrhetorik artikulierte elit\u00e4re Selbstverst\u00e4ndnis der Professoren verantwortlich.Das sich auf Humboldt berufende Selbstverst\u00e4ndnis der Krisengeneration entsprach allerdings \u2013\u00a0wie Klein mit Fokus auf Tellenbach und den Politikwissenschaftler Arnold Bergstraesser argumentiert\u00a0\u2013 immer weniger der realen Praxis. Beide verk\u00f6rperten den \u201eProfessorentypus des Wissenschaftsmanagers [\u2026], dessen Hauptaufgabe nicht in der praktizierten Forschung und Lehre bestand, sondern in deren Organisation und Koordination, Finanzakquise, Nachwuchsf\u00f6rderung, Lobby- und Netzwerkarbeit\u201c und der nun zum \u201ehegemonialen Typus\u201c aufstieg (207).Die St\u00e4rke dieser Arbeit liegt in der Verkn\u00fcpfung von Institutionen- und Ideengeschichte, wobei es Klein gelingt, die konkreten Interessen hinter der Krisenrhetorik aufzudecken, deren Leerstellen zu benennen und Inkonsistenzen zwischen der Rhetorik und der wissenschaftlichen beziehungsweise wissenschaftsorganisatorischen Praxis der Professoren aufzuzeigen. Es dr\u00e4ngt sich allerdings die Frage auf, welchen Einfluss die Entwicklungen in anderen Disziplinen auf den Wandel der universit\u00e4ren Personalstrukturen und den Aufbau der Studieng\u00e4nge hatten und wie wirkm\u00e4chtig die beschriebene Krisenrhetorik jenseits des geisteswissenschaftlichen Feldes war. Aber dies weist bereits \u00fcber die mit guten Gr\u00fcnden gezogenen Grenzen dieser Studie hinaus."}
+{"text": "Ralstonia solanacearum is one of the most devastating agents affecting different plants in 45 families. Several management practices have been used effectively for the management of this bacterium in different plants, including the use of biological control agents . However, because of difficulties in handling, culturing, and maintaining biocontrol agents or the issues related to their practical efficacy in soil, the use of their antimicrobial compounds is considered a good alternative. Ye et\u00a0al. investigated an antibacterial furoic acid compound, 5-(hydroxymethyl)-2-furoic acid, produced by the fungus Aspergillus niger. The soil application of this compound effectively controlled the R. solanacearum population in soil by direct killing effect as well as enhancing host resistance in tomato plants. Wang et\u00a0al. reviewed other studies for the management of this bacterium, including biological, organic, breeding, genetic engineering, physical, cultural, chemical and nano-technological approaches.Soil-borne plant pathogens pose a significant threat to plants, and their management is comparatively more difficult than other plant pathogens because of their nature of the hidden enemy, long persistency in soil, vast genetic diversity and host range . HoweverDutta et\u00a0al., in their review, focused on several aspects of the use of nanotechnology in the management of soil-borne plant pathogens highlighting the role of nanoparticles as protectants and inducers of plant defense against soil-borne plant pathogens. Uncovering the mechanism of host resistance and discoveries of host genes/proteins that regulate host resistance against soil-borne plant pathogens will help plant genetic engineers develop plants that can better fight against soil-borne plant pathogens. Tian et\u00a0al. reported that small G-protein StRab5b positively regulates potato resistance against the soil-borne fungus Phytophthora infestans. Pazarlar et\u00a0al. found that Bacillus cereus EC9 protects tomatoes against Fusarium wilt through JA/ET-activated immunity. In another study by Ling et\u00a0al., it was shown that WRKY genes confer resistance to Cucumis metuliferus against root-knot nematodes (RKN). The RKN-resistant variety of C. metuliferus (cm3) was found to specifically recruit beneficial bacterial communities in soil upon infestation with RKN, as reported by Song et\u00a0al. Similarly, Sikandar et\u00a0al. reviewed overall management strategies, including several recent efforts to improve host resistance against Meloidogyne enterolobii.Nanotechnology emerged as one of the most rapidly advancing sciences of the twenty-first century, and plant scientists revealed the effective application of nanotechnology for the management of plant pathogens. Dutta et\u00a0al. unveil the molecular mechanism by which Trichoderma fungus, one of the most used and studied biocontrol fungus, induce host resistance against pathogens including the role of exogenous elicitors in the induction of host resistance. Zhou et\u00a0al. proved that exogenous application of elicitor isotianil could significantly alleviate the symptoms of Fusarium wilt on the banana. They further confirmed that isotianil application might contribute to disease control by inducing host plant defense against Fusarium infection. Investigation into how the pathogens achieve virulence at the molecular level is also essential for understanding the action mechanism of the pathogen. Xu et\u00a0al. revealed the role of cAMP phosphodiesterase in the formation of sclerotia and achieving virulence in Sclerotinia sclerotiorum, an important phytopathogenic fungus that causes stem rot and white mold disease.Enhancing host resistance is also a prominent action mechanism of many biocontrol agents. In their review, Most investigations conducted for the management of soil-borne pathogens are based on greenhouse or controlled laboratory conditions. Although the outcomes of these studies provide useful insights into the action mechanism and control efficacy, field investigations are vital for assessing the practical applications of these strategies. Field assessments consider the complex interplay between plants, pathogens and soil, and environmental factors that can affect disease management and development. This more accurately illustrates how these strategies perform in real agricultural scenarios. Moreover, field assessment can give an actual clue of management strategy on economic feasibility.RK: Writing \u2013 original draft, Writing \u2013 review & editing, Conceptualization."}
+{"text": "Melissa officinalis reduces visceral fat and hepatic steatosis. We aimed to assess the safety and efficacy of ALS-L1023 as the treatment of non-alcoholic fatty liver disease (NAFLD). We conducted a 24-week randomized, double-blind, placebo-controlled 2a study in patients with NAFLD (MRI-proton density fat fraction [MRI-PDFF] \u2265 8% and liver fibrosis \u2265 2.5 kPa on MR elastography [MRE]) in Korea. Patients were randomly assigned to 1800 mg ALS-L1023 (n = 19), 1200 mg ALS-L1023 (n = 21), or placebo (n = 17) groups. Efficacy endpoints included changes in liver fat on MRI-PDFF, liver stiffness on MRE, and liver enzymes. For the full analysis set, a relative hepatic fat reduction from baseline was significant in the 1800 mg ALS-L1023 group . There was a significant reduction in liver stiffness from baseline in the 1200 mg ALS-L1023 group . Serum alanine aminotransferase decreased by \u221212.4% in the 1800 mg ALS-L1023 group, \u221229.8% in the 1200 mg ALS-L1023 group, and \u22124.9% in the placebo group. ALS-L1023 was well tolerated and there were no differences in the incidence of adverse events among the study groups. ALS-L1023 could reduce hepatic fat content in patients with NAFLD.Preclinical data have shown that the herbal extract, ALS-L1023, from  Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide as its prevalence in the general population is 25% ,2. The gMelissa officinalis is suggested to have an anti-angiogenic effect and to be capable of reducing adipose tissue mass in high-fat diet-induced obese mice ) showed no improvement after the administration of ALS-L1023. The miRNA analysis of the study patients showed that 23 miRNAs were downregulated by ALS-L1023 and GO analysis using the putative miRNA targets suggested that ALS-L1023 may have effects on the pathogenesis of NAFLD through the enriched signaling. ALS-L1023 treatment could have regulated the abundance of miRNAs in the serum, thereby resulting in changes in cellular signaling.ALS-L1023 was well tolerated in patients with NAFLD and had mild-to-moderate adverse effects. No treatment discontinuation due to adverse events occurred in patients treated with ALS-L1023; however, one patient in the placebo group had to discontinue treatment because of grade 3\u20134 laboratory abnormalities. The most frequent adverse events reported were gastrointestinal conditions such as dyspepsia, abdominal distension, and abdominal pain. These conditions were mild and self-limiting and did not result in study withdrawal because the patients spontaneously recovered. ALS-L1023 can serve as a safe pharmacological treatment option for patients with NAFLD, without causing significant adverse events.This study has several limitations. First, the small number of patients included in each study group can challenge the generalization of the findings. Therefore, the efficacy and safety observed in this study should be interpreted with caution. However, the number of patients included in this study satisfies the exploratory nature of the study. Subgroup analysis by gender could not be performed since the number of patients was rather small. Second, the diagnosis of NAFLD was made based on non-invasive assessments of MRI-PDFF and MRE rather than histological assessment. Given the reported association between non-invasive parameters and histologic response, using MRI-PDFF or MRE can be a good alternative for assessing liver fat and fibrosis ,17,18,19http://cris.nih.go.kr, accessed on 1 April 2023).This multicentre, randomized, double-blind, placebo-controlled, phase 2a study was conducted at four academic centers in the Republic of Korea. The trial protocol was approved by the institutional review board at each center, and this trial has been registered on cris.nih.go.kr , history of viral hepatitis, decompensated liver disease, hepatocellular carcinoma, other causes of liver disease, uncontrolled hypertension, unstable cardiovascular disease, malignancy, ALT \u2265 5x the upper limit of normal, and HbA1c > 9.0%. Patients with a history of glucagon-like peptide (GLP)-1 receptor agonist treatment within 8 weeks prior to screening were also excluded. Patients who received a high dose of vitamin E (>400 IU/day) or thiazolidinediones were not excluded when they were on a stable dose without any change in dose for at least 180 days prior to the screening. All inclusion and exclusion criteria are provided in the The patients were randomly assigned to either the 1800 mg ALS-L1023, 1200 mg ALS-L1023, or placebo groups in a 1:1:1 ratio. SAS V9.4 or higher was used for randomization and treatment assignment. The trial consisted of a 4-week screening and 24-week treatment periods . PatientEfficacy endpoints included changes in liver fat on MRI-PDFF, changes in liver stiffness on MRE at week 24 compared to the screening, changes in visceral fat at week 24 compared to the screening, changes in ALT at week 24 compared to baseline, and changes in AST at week 24 compared to baseline. Exploratory endpoints included the following: changes in ALT at weeks 8 and 16; changes in AST at weeks 8 and 16; changes in triglycerides at weeks 8 and 16; changes in total cholesterol at weeks 8, 16, and 24; and changes in Pro-C3, CK-18, HOMA-IR, Leptin, Ghrelin, and adiponectin at week 24. The safety assessments included clinical laboratory tests, vital signs, electrocardiograms, physical examinations, and adverse events. Clinical and laboratory adverse events were coded using the Medical Dictionary for Regulatory Activities version 23.0.Image assessment was performed by two experienced central readers who were unaware of clinical, histological data and treatment assignments. All sites underwent a quality assessment process prior to study initiation based on a review of hardware, software, phantom, and volunteer scans. All research images obtained from the trial were approved by the central readers. Liver stiffness was estimated using a gradient-echo motion detection sequence. A 60 Hz oscillation was transmitted to the liver by a driver centered on the right midclavicular line at the xiphoid level and held in place by an elastic band. This image was converted to an elastogram using an inversion algorithm that represents the estimated abdominal tissue stiffness in pixels. Three or four separate images were obtained. The central readers manually drew a region of interest (ROI) on the elastogram results of each slice to include as much liver tissue as possible, where a consistent shear wave is visible. The mean stiffness value of the liver was calculated and used . For fat\u00ae . A fluorescent sample was attached to the RNA and hybridization was performed on human miRNA microarrays (Agilent Technologies) containing 13,737 probes corresponding to 799 mature microRNAs and 22 control probes. For the cDNA microarray analysis, 50 ng of RNA was hybridized to Agilent 44 K oligonucleotide microarrays (Agilent Technologies). After correcting with control probes for each chip, those with a p-value \u2264 0.05 were selected.The integrity of the extracted total RNA was checked using an Agilent BioanalyzerThe safety set included all patients who received at least one dose of the study drug after randomization. The demographic data and baseline characteristics of the patients were analyzed using the safety set. All efficacy analyses were performed on the FAS and PPS. The FAS was defined as patients with full analysis data after administration, and the PPS comprised all patients who completed this study without major protocol deviations and had an average drug compliance of 80% or higher. When assessing the efficacy points, missing data were imputed using the last-observation-carried-forward approach (LOCF) in the FAS analysis. However, LOCF was not applied if there were no MRI-PDFF and MRE data at week 24.t-test or Wilcoxon rank-sum test. All analyses were based on observed data and were performed using SAS version 9.4 .Since this was an exploratory study, a formal power calculation was not conducted when determining the sample size. The sample size assessment was based on other proof-of-concept studies that assessed directionality across multiple outcomes, rather than statistical significance. Comparative analyses between the groups were conducted. Continuous variables were analyzed using an analysis of variance (ANOVA) or the Kruskal\u2013Wallis test. Categorical variables were analyzed using a Fisher\u2019s exact test or the chi-squared test. Efficacy endpoints between the groups were compared by a Two-sample In conclusion, this phase 2a, placebo-controlled, randomized, clinical trial found that treatment with ALS-L1023 in patients with NAFLD reduced hepatic steatosis, stiffness, ALT, and total cholesterol levels without serious adverse events. This study suggests that ALS-L1023 can be a pharmacological treatment option for patients with NAFLD, without causing significant safety issues. Future studies investigating the efficacy and clinically appropriate dose of ALS-L1023 in a larger number of patients are called for."}
+{"text": "In nearly every lab, real-time quantitative polymerase chain reaction (qPCR) is used to quantify gene expression. However, a comparison of different samples requires the careful selection of suitable reference genes (RGs), sometimes referred to as housekeeping genes. In the case of vascular smooth muscle cells (vSMCs), it is important to know under which conditions gene expression in isolated and cultured vSMCs can be compared with vSMCs in a healthy blood vessel. We isolated the vSMC-containing layer of the rat aorta (tunica media) and used one  half for direct RNA extraction, while the other half served to isolate and culture vSMCs prior to RNA extraction. First, the expression of the routinely used RGs beta-actin (Actb) and Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) is investigated in intact media and corresponding cultured vSMCs. Significant differences in their Ct values show that these RGs could not be used for such direct comparisons; therefore, we select 15 different RGs. Only the gene expression of the small ribonuclear protein (snRNP) U2 shows no significant differences between the absolute Ct values of cultured vSMCs and the intact media; moreover, no differences were found between male and female rats in our experimental setup. In conclusion, U2 was shown to be an appropriate (sex-independent) RG to compare relative expression levels of vSMCs in culture to those vSMCs within their physiological tissue environment. In view of the extensive use of cell culture models, the issue of to what extent cultured cells actually reflect cells within their physiological environment in the tissues remains largely unsolved . VSMCs aA transcription analysis may provide the most comprehensive view of changes due to cell isolation and culturing, both in a spatial and temporal resolution . Thus, wThere are two ways to quantify the mRNA level for a gene of interest (GOI) measured by qPCR . BesidesOur aim was to determine an RG that is equally expressed in vSMCs within the intact aortic media and in the corresponding cells in culture, thus enabling their direct comparison at the level of gene expression. In addition, we provide an exemplary strategy to identify an RG for qPCR.Since its introduction by Mullis and colleagues in 1983 , polymerIn general, PCR relies on the logarithmic amplification of a genetic sequence that is defined by the applied template sequence and the respective primers binding to it. PCR comprises three consecutive steps , each carried out at a specific temperature. The product can be detected in a qualitative manner according to its molecular size after electrophoresis . In contThe key value necessary for quantification is the cycle threshold (Ct). The Ct, also known as the quantification cycle (Cq) or crossing point (CP), is defined as the number of PCR cycles necessary to reach a defined fluorescence level or to exceed a fluorescence threshold level above the background level . AssuminThe major advantage of relative gene expression quantification is the correction of variations in the levels of the detected gene expression of different samples. The variations are usually due to tissue or matrix effects, inconsistent RNA harvest , or cDNAA reliable quantification requires specific properties of the RG, which is an internal control gene with a sequence different to the GOI. First of all, a constant expression regardless of any experimental conditions. Furthermore, the RG should ideally be expressed within a similar expression range as the GOI . In addiHousekeeping genes are thought to be essential for the maintenance of basic cell functions and are expressed at a constant level; therefore, they are often considered promising RG candidates . RoutineThe aorta, being the largest blood vessel in the body, is usually the main source for the extraction and investigation of cultured vSMCs ,17. The Within the intact media, vSMCs are spindle-shaped and contain a cigar-like central nucleus. The vSMCs are oriented circumferentially around the lumen, able to contract, and thus fulfil their major role in the regulation of blood pressure and blood flow by the adaption of the vessel\u2019s diameter . Within The singularisation of vSMCs for cell culture requires the destruction of the original vessel by enzymatic digestion and subsequent straining of the cells .Once cells become detached from their physiological environment, their survival depends on a quick adaptation to the circumstances in vitro. In the case of vSMCs, this includes the loss of physiological contact and exchange with neighbouring cells ,3,23,24,Finding an RG expressed stably enough throughout the entire experimental procedure from the intact media to cultured singularised vSMCs thus literally constitutes the search for a needle in the haystack.Rattus norvegicus) aged from 2.5 to 3 months and housed in the animal facility of the Veterinary Faculty at Justus-Liebig-University (JLU) Giessen, Germany. Housing, animal care, and related procedures were conducted according to the guidelines of the German Animal Welfare Act and approved by the Committee for Laboratory Animals of the JLU Giessen, case number JLU Nr. 577_M. Rats were anaesthetized with CO2 and sacrificed by cervical dislocation.Aortae were obtained from male and female Wistar rats (v/v) penicillin-streptomycin  and stored on ice. Preparation of the vSMC layer (tunica media) was performed in cold MEM 1\u00d7 + Pen/Strep under a binocular microscope. The surrounding fat was removed using sterile tweezers, branching vessels were cut, and the aorta was bisected longitudinally. One-half of the same aorta was used for cell extraction (see chapter cell extraction), and the second half was prepared as follows.Aortae were dissected from the heart to the bifurcation and immediately transferred into MEM 1\u00d7 buffer  with 1% (The outer connective tissue layer (tunica adventitia) was removed manually with curved tweezers starting from the proximal end. The inner endothelial layer (tunica intima) was carefully stripped away. For RNA isolation, the moisture of the tissue was dabbed off, tissue was scaled and immediately frozen in liquid nitrogen until RNA isolation.v/v)) and finally kept in xylol. Tissue was equilibrated in liquid paraffin at 65 \u00b0C overnight before the paraffin was left at room temperature to cool down. Tissues were cut into 5 \u00b5m thick sections with a microtome. Sections were dried at 40 \u00b0C overnight before staining.Rat tissue samples were prepared and fixed in Bouin\u2019s solution for 24 h. Before embedding in paraffin, the tissue was dehydrated in an ascending ethanol series  normal goat serum  in phosphate-buffered saline solution  to prevent non-specific binding of the antibodies. Indirect immunostaining was performed by a two-step approach.Deparaffinised and rehydrated tissue sections were incubated for one hour at room temperature in 2% (v/v) BSA and 0.1% (w/v) NaN3), and tissue sections were incubated at 4 \u00b0C overnight. For negative controls, the primary antibodies were omitted.Primary antibodies  were adjFollowing two washing steps with PBS (10 min each), the sections were incubated with the secondary antibodies  diluted w/v) paraformaldehyde (PFA) at a pH of 7.2\u20137.4. After two final washing steps with PBS (10 min each), the stained tissue sections were covered with glycerol and a cover slip and stored at 4 \u00b0C in darkness till the images were captured.Nuclear staining was performed using DAPI  at a dilution of 1:1250 in PBS together with the secondary antibodies. Stained tissue sections were rinsed twice with PBS and fixated using 4% (v/v) BSA and 0.1% (w/v) NaN3) with the primary antibodies , tissue sections were incubated in dilution buffer (PBS with 0.2% (tibodies  overnighw/v) in MEM 1\u00d7 + Pen/Strep) at 37 \u00b0C for 15 min. Digestion was stopped by transferring the tissue into fresh MEM 1\u00d7 + Pen/Strep. The tissue was separated manually from the tunica adventitia and bisected longitudinally to remove the inner tunica intima. The aortic media was cut into small pieces using sterile scissors. For the extraction of the SMCs, these pieces were transferred into fresh MEM1\u00d7 + Pen/Strep with collagenase (10% (w/v) in MEM 1\u00d7 + Pen/Strep) and incubated for 30 min at 37 \u00b0C. Afterwards, digestion was stopped by dilution with approximately 5 mL prewarmed cell culture medium DMEM/F-12  containing 10% (v/v) foetal bovine serum  + Pen/Strep. The cell suspension was strained through a cell strainer  under sterile conditions, and the flow-through, containing the singularised vSMCs, was centrifuged for 10 min at 1500\u00d7 g at room temperature. The pellet was resuspended in 5 mL fresh pre-warmed DMEM/F-12 + FBS + Pen-Strep and transferred into 25 cm2 sterile plastic cell culture flasks (Thermo Fisher Scientific).For vSMC extraction from the tunica media, a two-step enzymatic digestion was performed using collagenase . Again, aortae were dissected from the heart to the bifurcation and immediately transferred into MEM 1\u00d7 + Pen/Strep stored on ice. Preparation of the tunica media was performed in cold MEM 1\u00d7 buffer + Pen/Strep under a binocular microscope. Surrounding fat was removed using sterile tweezers, branching vessels were cut, and aortic tissue was first digested with collagenase (10% (2 with medium changed every 2\u20133 days. Extraction passage (P) was cultured for 6\u20137 days, and cells were trypsinised  for 5 min at 37 \u00b0C after gently washing (Dulbecco\u2019s PBS (DPBS) by Gibco, Thermo Fisher Scientific). VSMCs  were seeded as follows: 4\u20135 \u00d7 105 cells per 25 cm2 flask for RNA extraction and follow-up qPCR, 2 \u00d7 104 cells per well  for IF staining.vSMCs were cultured at 37 \u00b0C and 5% COw/v) PFA and washed 3 \u00d7 10 min with PBS while gently shaking. PBS was also used for the storage of fixated cells at 4 \u00b0C in the dark until staining. Cells were permeabilised with 0.1% (v/v) Triton  in PBS for 10 min. Indirect immunostaining was performed by a two-step approach. To avoid non-specific binding of the antibodies, permeabilised vSMCs were blocked for one hour at room temperature with 2% (v/v) normal goat serum in PBS. Primary antibodies  were fixated for 10 min with 4%  according to manufacturer\u2019s protocols for RNA isolation from animal cells (spin technology) with on-column DNase  digestion. Total RNA from cultured rat vSMCs  was prepared using the RNeasyv/v) 2-Mercaptoethanol  was added and, together with a sterile metal bead, the sample was processed for 3 min at 300 Hz in a tissue lyser mixer mill MM400 . The lysate was centrifuged for 5 min at 12,000 rpm, and the supernatant was further processed according to the manufacturer\u2019s protocol. RNAs were eluted in 30 \u00b5L RNase-free water, and RNA concentration was determined using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). RNA samples were stored at \u221280 \u00b0C. The same kit was used for RNA isolation from frozen rat aorta following the manufacturer\u2019s instructions for RNA isolation from animal tissue with on-column DNase digestion. Approximately 15\u201320 mg of rat aortae were frozen in liquid nitrogen and pulverised using a hammer. RLT buffer with 1% (TM II RT and Oligo(dT)20 primer  were applied according to the manufacturer\u2019s instructions using the Mastercycler gradient 5331 . Consistency of the RNA extraction and efficiency of the RT-reaction was verified via determination of cDNA concentration using the NanoDrop 2000 spectrophotometer. When the concentration of the samples differed drastically, the cDNAs were adjusted to the same concentration for the subsequent qPCR measurement.In total, 2 \u00b5g of total RNA served as template for cDNA synthesis. SuperScriptThe selection of potential RG candidates was based on the literature research. We considered studies that were performed using the model animal rat and the method qPCR. If indicated, we used the primer sequences for the RGs as described in these publications. If only the name of the RG was given, we used Primer BLAST for the respective primer design.For every gene , we detehttps://www.ncbi.nlm.nih.gov/tools/primer-blast/; accessed on 21 August 2021) or the respective references as indicated. Custom DNA-Oligos  were purchased from Eurofins, Hamburg, Germany. Details of final primer selection are given as follows:Primer pairs for GOI spanning an exon/exon junction were selected using Primer Blast (Actb:Forward 5\u2032-ATCTGATACGTCCTCTATCC-3\u2032Reverse 5\u2032-GTGGACGGAGCAAGCTCCTA-3\u2032Amplicon size: 232 bp(BLAST: NM_031144.3)Gapdh:Forward 5\u2032-CTTGTGCAGTGCCAGCCTC-3\u2032Reverse 5\u2032-ACCAGCTTCCCATTCTCAGC-3\u2032Amplicon size: 230 bp(BLAST: NM_017008.4)snRNP U5A:Forward 5\u2032-ACTCTGGTTTCTCTTCAGATCG-3\u2032Reverse 5\u2032-CAGAGTTGTTCCTCTCCA-3\u2032Amplicon size: 73 bp snRNP U2:Forward 5\u2032-ATCTGATACGTCCTCTATCC-3\u2032Reverse 5\u2032-GTGGACGGAGCAAGCTCCTA-3\u2032Amplicon size: 83 bp E) of each primer pair was calculated based on a cDNA dilution series with three steps . Every dilution sample was measured as triplet according to the qPCR steps (m) by linear regression.The efficiency  using the cycler steps listed in w/v) agarose gel was performed to check for length of the qPCR products. Double stranded qPCR products were visualised with Ethidium bromide. Agarose gels as well as corresponding melt curves for Actb, Gapdh, U5A, and U2 are given in Figure A1Electrophoresis using a 2%  was used. All the data were first checked for normal distribution. Detailed descriptions of statistical evaluation for each experiment are given in the corresponding figure legends.For all underlying statistical analysis, GraphPad Prism 9 (Version 9.5.1 (733) for Windows, GraphPad Software, La Jolla, CA, USA, p < 0.05, (**) p < 0.01, (***) p < 0.001, and non-significant (ns) when p \u2265 0.05.Standard deviations from the common mean are indicated as real standard deviations (\u00b1SDs), not SEM. Differences were considered significant when (*) We aimed to realise the direct comparison between aortic vSMCs within intact tunica media and in culture at the level of transcription. Therefore, we tried to identify an RG candidate, which, due to its stable expression between these two groups, could serve as an internal control gene for normalisation when performing relative gene expression quantification and subsequent comparison between different samples. We extracted RNA from intact tunica media and cultured primary vSMCs of the same aortae from both male and female rats and compared the expression of various RG candidates .The aorta consists of an intima with its endothelial layer, a predominant media with vSMCs and extracellular elastic fibres, and an outer connective tissue layer, the adventitia A.In efforts to isolate and culture exclusively vSMCs, we first removed the adventitia mechanically after incubation with collagenase for 15 min  was confTo perform a reliable comparison of gene expression between vSMCs in culture and tissue (intact media) an RG expressed stably between both groups is a prerequisite. We therefore initially tested whether the routinely used RGs Actb and Gapdh are expressed at a similar level and performed a pairwise comparison analysis .The Ct values, inversely correlating to the level of gene expression, of both Actb A and Gap10 times higher in the cultured vSMCs for both Actb and Gapdh.Since the template cDNA ideally is duplicated with each PCR cycle, the final amount of gene copies appears to be 2The rats analysed in The observation of an increased RG expression in cultured cells was found to be independent of the sex. A potential difference would have required a conserved sex memory in cultured cells  since a For the comparison of gene expression between the samples of intact media, it should be carefully considered whether the large variance in expression in tissue allows the comparison of the respective GOIs. After all, the range of Ct values (~10) in intact tissue is almost as large as the difference between tissue and cells. Nevertheless, Actb, as well as Gapdh, may be suitable to compare gene expression either in the intact aortic media or vSMC culture.The biological sex has not been considered as a relevant variable in research studies for too long. The concern that unpredictable hormonal changes in females (due to different cycle stages) may induce a broader variance of study results is a common argument of scientists not to involve females in their studies. However, researchers increasingly face the necessity to include male as well as female subjects in their studies to meet application criteria for funding. This seems justified since sex is an accepted risk factor for cardiovascular ,37,38,39At the level of transcription, a sex bias might affect the expression of RGs  as well Despite an increasing number of publications on RGs (housekeeping genes) in rat tissue, hardly any studies comprise a direct comparison of cultured primary cells and their intact tissue of origin. Therefore, we searched for qPCR studies that compared rat tissue or cells before and after, for instance, drug administration and/or surgical intervention.In total, 15 RGs  of such We determined the Ct values of the selected genes  in intacThe average Ct difference between tissue and cells of all the genes tested was 4.5. Two-thirds of the RGs tested showed a difference of at least 4 Ct values. Since most of the genes are categorised as housekeeping genes, meaning essential to cell survival, it may indicate that the vSMCs undergo drastic physiological changes during extraction and cultivation, although the first phenotypical impression seems inconspicuous . This isNevertheless, according to our initial evaluation, the group of snRNPs was characterised by the most stable gene expression. It can therefore be assumed that snRNPs are of similar importance in vSMCs in culture and intact aortic media, which, as mentioned earlier, is a crucial prerequisite for our RG. The snRNPs are found in the splicing speckles and Cajal bodies of the eukaryotic nucleus, where they mainly contribute to the processing of pre-messenger RNAs ,44. The To confirm these observations, we determined the absolute Ct values of U2 and U5A in a larger group of rats (t-test revealed significant differences between the Ct values of U5A in aortic tissue versus cells (In contrast to the initial results , the dirus cells A. The avFor the second candidate U2, however, statistical analyses of a larger set of samples did not reveal a significant Ct difference between tissue and the corresponding cells B, therebWhen comparing the expression of U5A A and U2 When comparing male and female rats regarding the expression of U5A C and U2 The changes in all RGs we tested  indicateA relevant task besides the detailed evaluation of RGs is the improvement of tools that support the selection of appropriate RGs for different experimental settings. It would be of utmost importance to continue updating tools like RefFinder  with rec"}
+{"text": "Trace amines, such as tyramine, are endogenous amino acid metabolites that have been hypothesized to promote headache. However, the underlying cellular and molecular mechanisms remain unknown.Using patch-clamp recording, immunostaining, molecular biological approaches and behaviour tests, we elucidated a critically functional role of tyramine in regulating membrane excitability and pain sensitivity by manipulating Kv1.4 channels in trigeminal ganglion (TG) neurons.+ current (IA) in a manner dependent on trace amine-associated receptor 1 (TAAR1). Either siRNA knockdown of G\u03b1o or chemical inhibition of \u03b2\u03b3 subunit (G\u03b2\u03b3) signaling abrogated the response to tyramine. Antagonism of protein kinase C (PKC) prevented the tyramine-induced IA response, while inhibition of conventional PKC isoforms or protein kinase A elicited no such effect. Tyramine increased the membrane abundance of PKC\u03b8 in TG neurons, and either pharmacological or genetic inhibition of PKC\u03b8 blocked the TAAR1-mediated IA decrease. Furthermore, PKC\u03b8-dependent IA suppression was mediated by Kv1.4 channels. Knockdown of Kv1.4 abrogated the TAAR1-induced IA decrease, neuronal hyperexcitability, and pain hypersensitivity. In a mouse model of migraine induced by electrical stimulation of the dura mater surrounding the superior sagittal sinus, blockade of TAAR1 signaling attenuated mechanical allodynia; this effect was occluded by lentiviral overexpression of Kv1.4 in TG neurons.Application of tyramine to TG neurons decreased the A-type KIA suppression through stimulation of TAAR1 coupled to the G\u03b2\u03b3-dependent PKC\u03b8 signaling cascade, thereby enhancing TG neuronal excitability and mechanical pain sensitivity. Insight into TAAR1 signaling in sensory neurons provides attractive targets for the treatment of headache disorders such as migraine.These results suggest that tyramine induces Kv1.4-mediated The online version contains supplementary material available at 10.1186/s10194-023-01582-5. Tyramine, a trace amine derived from the metabolism of amino acids, is naturally found in foods and plants and has been endogenously identified in the mammalian brain and peripheral nervous tissues . AlthougIA) or the delayed rectifier current (IDR) [IA is sensitive to 4-aminopyridine (4-AP), with the characteristics of rapid activation and inactivation, and repolarizes neurons after action potentials [IA [IA channels might regulate sensory neuronal excitability, which is considered useful in producing pain relief.Changes in the neuronal excitability of peripheral sensory neurons may influence nociceptive behaviors . Voltagent (IDR) \u201315. The tentials \u201318. Fiveials [IA . These cials [IA . For insials [IA . Moreoveials [IA \u201316, 21. IA and elucidated the underlying mechanisms that elicit nociceptive responses to tyramine. We reported that stimulation of TAAR1 by tyramine triggers the release of the Go protein \u03b2\u03b3 subunits and subsequently activates downstream PKC\u03b8 signaling. TAAR1-Kv1.4-mediated IA suppression results in TG neuronal hyperexcitability, which contributes to pain hypersensitivity in mice.The current study examined the role of TAAR1 in modulating Kv1.4-mediated ad libitum. Every effort was made to minimize both the number of animals used and animal suffering. The investigators were not blinded to group allocations in experiments other than behavioral experiments. Nociceptive behaviors of migraine were induced by the electrical stimulation of the dura mater surrounding the superior sagittal sinus [von Frey filaments  applied to the periorbital region as described previously [Experimental procedures were carried out in accordance with National Institutes of Health (NIH) guidelines and were approved by the Institutional Animal Care and Use Committee of Soochow University. Animals were housed on a standard 12/12-h light\u2013dark cycle in a temperature- and humidity-controlled room with food and water provided al sinus . The sural sinus , 23 witheviously \u201328. Eacheviously .\u03b8-siRNA (5\u2019-GCGACTTAATGTACCACATCC-3\u2019), G\u03b1o-siRNA (5\u2019-CGAATAATAT CCAGGTGGTAT-3\u2019) G\u03b1i-siRNA (5\u2019-GAATCTGGAAAGAGTACCATT-3\u2019), Kv1.4-siRNA (5\u2019-CCTACCTTCT AATTTGCTCAA-3\u2019) or the corresponding scrambled control siRNAs , labeled with Cy3, were dissolved in RNase-free water. Neuron promoter-specific  combinatorial lentiviral vectors, including lenti-hSyn-Kv1.4-up and the corresponding negative control (lenti-Kv1.4-NC), containing enhanced green fluorescent protein (EGFP) were obtained from GeneChem (Shanghai). The viral titer was greater than 1\u2009\u00d7\u2009108 TU.As described in our previous studies \u201332, drugAcute dissociation of TG neurons was performed as previously described \u201334. Brie2, 0.5 CaCl2, and 0.5 Na2GTP . The external solution for IA recording contained (in mM) 150 choline-Cl, 10 HEPES, 10 glucose, 5 KCl, 1 MgCl2, and 0.03 CaCl2 . To separate the two kinetically different Kv currents in our whole-cell recordings, a large outward K+ current was evoked in small neurons by a command potential of +\u200940 mV from a holding potential of -80 mV. This typical current profile exhibited a rapid inactivation component and a subsequent sustained component. A short prepulse (150 ms) at -10 mV inactivated the IA, leaving only the IDR. Then, the subtraction of the IDR from the total outward current yielded the IA. To obtain the current-voltage relationship of IA, neurons were held at -80 mV and stimulated with a series of depolarizing pulses ranging between \u2212\u200970 and +\u200970 mV at 10-mV increments. To determine the voltage-dependent activation of IA, voltage steps of 400 ms were applied at 5\u00a0s intervals in +\u200910 mV increments from \u2212\u200970 mV to +\u200970 mV. To determine the steady-state inactivation, conditioning prepulses ranging from \u2212\u2009120 mV to +\u200920 mV were applied at 5\u00a0s intervals in +\u200910 mV increments for 150 ms, followed by a 500 ms voltage step to +\u200940 mV. The pipette solution used for Ca2+ channel current recording contained (in mM) 110 CsCl, 25 HEPES, 10 EGTA, 4 Mg-ATP and 0.3 Na-GTP . The external solution used for Ca2+ channel current recording contained (in mM) 140 tetraethylammonium chloride, 10 HEPES, 5.5 glucose, 5 BaCl2, 5 CsCl and 0.5 MgCl2 . T-type channel currents were separated following the procedure described in our previous studies [2GTP . The external solution contained (in mM) 128 NaCl, 30 glucose, 25 HEPES, 2 CaCl2, 2 MgCl2 and 2 KCl . To test neuronal excitability, TG neurons were held at Vrest and injected with 1-s depolarizing currents in 50-pA incremental steps until at least one action potential (AP) was elicited. We measured AP firing frequency (the number of spikes per second) in response to 150 pA depolarizing current injection in TG neurons before and after tyramine application. The first AP elicited using this paradigm was used to measure AP threshold, amplitude and first spike latency. In the present study, TG neurons were sorted into small (soma diameter\u2009<\u200925\u00a0\u03bcm) and medium-sized (soma diameter 25\u201335\u00a0\u03bcm) groups. We limited the whole-cell recording to the groups of small neurons, as they are primarily involved in the conduction and processing of nociception and pain [Patch clamp experiments were performed at room temperature using a standard whole-cell recording configuration as described previously , 35\u201337.  studies . The pipand pain , 37\u201340. \u03b8 , anti-Kv1.4 , anti-Kv4.3  and anti-Kv3.4 . An anti-\u03b2-actin antibody  was used as the loading control. After washing three times with TBST, the membranes were incubated with a horseradish peroxidase-conjugated goat anti-rabbit  secondary antibody. Antibodies were validated by the manufacturers, and can be referred to datasheets of respective antibodies, which are listed in the supplementary materials  according to the manufacturer\u2019s instructions. Protein concentrations were determined using a Bio-Rad Protein Assay. Fractionated proteins were analyzed by immunoblotting as described above.According to the standard procedure for TRIzol reagent (Invitrogen), total RNA was extracted from TG cells as described previously , 43 and staining was performed as described previously [Immunoeviously , 37, 44.\u03b8 primary antibody  for 16\u00a0h at 4\u00a0\u00b0C. After three washes in PBS, TG neurons were visualized with FITC-conjugated goat anti-rabbit IgG . Immunopositive signals were characterized using laser scanning confocal microscopy  and analyzed with Image-Pro Plus analysis software .Immunofluorescence analysis was performed as described previously . Briefly\u03b7 pseudosubstrate inhibitor , the theta-PKC inhibitory peptide , and AmmTx3 (Tocris Bioscience) were prepared with double deionized water . Stock solutions of tyramine, EPPTB, RO5263397, G\u00f66976 (Tocris Bioscience), KT-5720 , chelerythrine chloride (Selleck), sotrastaurin (Selleck), CP339818 (Tocris Bioscience), and UK78282 were prepared in dimethyl sulfoxide (DMSO). The concentration of DMSO in each medium was less than 0.05% and had no significant effects on IA.All chemicals were purchased from Sigma\u2013Aldrich unless otherwise indicated. The QEHA (QEHAQEPERQYMHIGTMVEFAYALVGK) and SKEE peptides (SKEEKSDKERWQHLA DLADFALAMKDT) were synthesized by GenScript Corporation. Stock solutions of PTX, CTX, the epsilon-PKC specific inhibitor , the delta-PKC specific inhibitor , the PKCn values are clearly indicated within the figure legends. All statistical analyses were performed in GraphPad Prism 6.0 (Synergy Software) or SPSS 16.0 (SPSS) software. A paired t test was used to compare IA from pre- and post- drug application, while an unpaired t test was used to compare two independent groups. Data were analyzed using one-way analysis of variance (ANOVA) followed by the Bonferroni post hoc test for multiple comparisons between groups. Two-way repeated-measures ANOVA with the Bonferroni post hoc test was used to analyze differences in behavioral test data. Differences with p\u2009<\u20090.05 were considered statistically significant.Values are expressed as the means\u2009\u00b1\u2009SEMs. No statistical method was used to predetermine sample sizes. Required experimental sample sizes were estimated based on previously established protocols in the field. The sample sizes were adequate as the differences between experimental groups were reproducible. All IA and the delayed rectifier IDR in sensory neurons [IDR isolation. Offline subtraction of IDR from the total current yielded IA. This IA was eliminated by bath application of 5 mM 4-AP , while IDR remained unaffected (decrease of 2.6\u2009\u00b1\u20091.1%)  was 59.1 nM. We next characterized the biophysical mechanism of the IA decrease induced by tyramine. The peak IA amplitude was markedly reduced in response to 0.1\u00a0\u03bcm tyramine at all potentials above \u2212\u200910 mV -containing neurons and a subset of nonpeptidergic, isolectin B4-binding (IB4+) nociceptive neurons but rarely in neurofilament 200 (NF200)-positive myelinated neurons , a selective antagonist of TAAR1, had no effect on IA (decrease of -1.3\u2009\u00b1\u20092.2%), while pretreatment of TG neurons with EPPTB completely abolished the reduction in IA induced by 0.1 \u00b5M tyramine  , which inactivates Gs by ADP ribosylation, did not affect the ability of tyramine to reduce IA  completely prevented the tyramine-mediated IA response   of Go in the TAAR1-induced reduction in IA. Intracellular infusion of the G\u03b2\u03b3 inhibitory peptide QEHA (10 \u00b5M) prevented the tyramine-induced decrease in IA  via the recording pipette solution did not affect the tyramine-mediated IA decrease  completely abolished the TAAR1-mediated IA response , a PKC\u03b7 pseudosubstrate inhibitor; \u03b4V1-1 (1 \u00b5M), a peptide inhibitor of the delta isoform; or \u03b5V1-2 (2 \u00b5M), a specific inhibitor of the epsilon isoform   still robustly decreased IA  and Kv4.3 remained unchanged   or 5 nmol tyramine at 1\u00a0h (p\u2009=\u20090.017) markedly enhanced acute pain sensitivity to mechanical stimuli, while 0.1 nmol tyramine did not elicit such effects (p\u2009=\u20090.433). The effect of tyramine at 5 nmol was maintained at 3\u00a0h (p\u2009=\u20090.02) and recovered at 6\u00a0h  of the dura mater surrounding the superior sagittal sinus exhibited significant mechanical allodynia (p\u2009=\u20090.008 at 1\u00a0h and p\u2009=\u20090.03 at 3\u00a0h)  attenuated mechanical allodynia on Day 5 post-ES (\u00a0h) Fig.\u00a0G. This eIA in trigeminal ganglion neurons, with IDR remaining unaffected. The hyperpolarizing shift of V50,inact suggested that the increased proportion of A-type channels in the steady-state inactivation might be one of the factors responsible for the tyramine-induced decrease in IA. Our studies showed that this effect is mediated by TAAR1 coupling to the Go protein, leading to the release of G\u03b2\u03b3 and triggering the activation of downstream PKC\u03b8 signaling  siRNA-mediated knockdown of Go completely abolished the tyramine-induced IA response and (2) intracellular application of G\u03b2\u03b3 inhibitors abrogated the response to tyramine. However, it is still unclear how G\u03b2\u03b3 regulates Kv1.4 channel activity. G\u03b2\u03b3 has been suggested to interact directly with G protein-gated K+ channels [IA response was further blocked by inhibition of downstream protein kinases. G\u03b2\u03b3 might stimulate PKA to regulate various molecular targets, including potassium channels [IA [IA in rat hippocampal CA1 neurons [IA in dorsal root ganglion neurons, has been reported [IA response was not affected by PKA regulation, indicating that mechanisms other than PKA signaling are involved. We propose that the tyramine/TAAR1 interaction decreases IA in small TG neurons via PKC\u03b8-dependent signaling. Activation of PKC is associated with its intracellular translocation from the cytoplasm to the plasma membrane. This can occur rapidly at room temperature. For instance, C-type natriuretic peptide can induce PKC translocation to the plasma membrane [\u03b8 in the TAAR1\u2013mediated IA suppression observed in TG neurons. Consistent with the present study, another study showed that activation of metabotropic glutamate receptors results in IA inhibition in striatal cholinergic interneurons through PKC signaling [IA channels have produced conflicting results [\u03b1 upregulated IA after ischemia [IA by urotensin-II receptor through PKC\u03b1 in sensory neurons has also been reported [IA may vary in tissues/cell types expressing distinct PKC isozymes [IA [IA response.TAAR1 can couple to the G and PKA ; couple lar Ca2+ ; or intelar Ca2+ . Surpris\u03b3 dimers , 57, 58.channels . Howeverchannels , 60. In nels [IA . Similar neurons  as well  neurons . In contreported . Howevermembrane . Additiomembrane . These fignaling . Similarignaling  and in Cignaling . However results , 65. Forreported . Althougisozymes , 67. Secisozymes . Third, ymes [IA , 70. ParIA is a key component that regulates neuronal excitability and has been implicated in the control of both spike frequency and first-spike latency [IA modulation affects nociceptive somatic inputs and mediates neuropathy in various neuropathic pain models [IA decrease, stimulation of TAAR1 in TG neurons markedly increased the firing frequency along with the reduction in first-spike latency. In addition, the nociceptive effects of TAAR1 are mediated partially, if not completely, through its inhibitory effects on Kv1.4 channels in TG neurons. Indeed, it has been demonstrated that Kv1.4-encoded IA channels in mature cortical pyramidal neurons contribute to the repetitive firing rate [IA [2+ channels [Alterations in the membrane excitability of peripheral sensory neurons can directly affect nociceptive behaviors , 12. IA  latency , 71, whi latency . Both phn models . Consisting rate , althougrate [IA . Moreoverate [IA . In linerate [IA . Importarate [IA . Howeverrate [IA , 77. Intrate [IA . Worth tchannels . Moreovechannels . In addiIA by stimulating Go protein-coupled TAAR1 and downstream G\u03b2\u03b3-dependent PKC\u03b8 signaling. The identified signaling initiated by tyramine mediates TG neuronal hyperexcitability and mechanical pain hypersensitivity in mice. Considering the above mentioned findings in humans, it would be interesting to tease out the differences in PKC\u03b8 and Kv1.4 signaling between model animals and humans, and examine whether headache disorders such as migraine can be further divided into subgroups based on distinct signature signaling pathways. Such investigations would provide opportunities for novel therapeutic strategies for the treatment of headache disorders.Collectively, this study presents new insights into the effect of tyramine on Kv1.4 channels in nociceptive sensory neurons. Our results suggest that tyramine reduces Kv1.4-mediated Additional file 1."
\ No newline at end of file