diff --git "a/cluster/923.jsonl" "b/cluster/923.jsonl"
new file mode 100644--- /dev/null
+++ "b/cluster/923.jsonl"
@@ -0,0 +1,85 @@
+{"text": "When Francis Collins and Craig Venter reported the draft sequence of the human genome in 2001, Collins described the so-called book of life as more of a life sciences encyclopedia. In it, we can find our evolutionary history written in the fossil record of our DNA, a parts manual listing the genes and proteins needed to build and operate a human being, and a medical text, gleaned from the genetic variants linked to human disease. Unfortunately, he added, the texts are written in a language \u201cwe don't entirely know how to read yet.\u201d Since then, biologists have made great progress in extracting meaning from the human genome. Humans are 99.9% alike genetically, and that 0.1% makes all the difference in terms of appearance, personality, and susceptibility to disease. That 0.1% promises to shed light on the evolutionary forces that control genetic variation as well as the genetic origins of human disease.Very small genetic variations\u2014including differences of a single DNA base, called single nucleotide polymorphisms, or SNPs\u2014occur through random mutations. Individuals have two of each chromosome (one from the mother and one from the father), and the combination of SNPs found together on one chromosome can change through the random shuffling of genetic material between the two chromosomes when sperm and egg cells are produced during meiosis. By studying the location and frequency of this reassortment in the genome, biologists hope to understand how recombination affects the overall pattern of SNP variation and how these patterns relate to human disease. An international collaborative effort called the HapMap Project aims to identify the most common SNP associations within chromosomes, known as haplotypes, and then determine which haplotypes are associated with disease. This approach relies on what's known as \u201clinkage disequilibrium\u201d\u2014the nonrandom association of alleles (gene variants) at different locations on a chromosome\u2014to facilitate their search for candidate disease genes. Adjacent SNPs show strong linkage disequilibrium, which means that researchers can select a limited number of SNPs as markers for a haplotype and test their association with disease rather than testing each SNP.Patterns of linkage disequilibrium depend on the rate of recombination\u2014higher recombination rates typically cause less linkage. Demographic factors and chance also affect levels of linkage disequilibrium; while both vary across populations, it has been thought that recombination rates do not. Recombination appears to favor specific genomic regions, termed hotspots, but the observation that the recombinant chromosomes are not passed down in equal proportions suggests that recombination hotspots may be short-lived, appearing as transient blips on the evolutionary radar. Exploring this possibility, Susan Ptak et al. compared a well-studied recombination hotspot in humans, called TAP2, with a similar region in our closest evolutionary cousins, chimpanzees, to see whether they are similarly endowed.Since recombination occurs relatively rarely, researchers have relied largely on indirect methods to determine regional recombination rates. Though recent advances have made sperm analysis in humans more practical , such techniques are less feasible with chimps because collecting large amounts of sperm from individual males might compromise their success in mating competition or reduce the genetic diversity of endangered chimp populations. Here, the researchers used an indirect approach to estimate recombination rates from the patterns of linkage distribution, which \u201creflect the rate and distribution of recombination events in the ancestors of the sample.\u201d They focused on chimps from a single subspecies because the reported high level of genetic differentiation between subspecies could skew estimates of recombination rate variation. Analysis of the TAP2 region revealed 47 SNPs in the human and 57 in the chimp, with an overall lower level of linkage disequilibrium in humans: strong linkage was seen only in adjacent pairs of SNPs in humans, but was found in both adjacent and more distant pairs in the chimps. Using a statistical approach to characterize recombination rate variation between the two species, Ptak et al. found \u201cextremely strong support\u201d for rate variation in humans but found strong evidence against such variation in chimps.Humans and chimps diverged from a common ancestor five to six million years ago and differ at only 1.2% of base pairs on average. That the recombination hotspot does not exist in both species suggests that hotspots are not stable and can evolve fairly quickly. If recombination rates within a small genomic area\u2014at the level of a few thousand bases\u2014can change in such a short time frame between such closely related species, Ptak et al. reason, they may do so within species, too. Such a prospect has important implications for the HapMap Project and disease association studies that rely on linkage disequilibrium. While haplotypes offer a shortcut for identifying candidate disease genes based on typing a certain number of markers, the number of markers required depends on the strength of linkage disequilibrium. If recombination rates differ across human populations, as these results suggest, then the strength of linkage disequilibrium will too\u2014which means that association studies might need to adjust the number of markers needed to flag candidate disease genes in different populations."}
+{"text": "Recombination is a nearly ubituitous feature of genomes; where and when it occurs can provide insights about its evolution and can affect our ability to identify genes that cause disease Consider a piece of text, either this one that you are now reading or any other. Surely they are all pretty much alike, in so far as they are all run-on strings of characters. In this same sense, we can envision that all DNA strands are alike because all are monotonous polymers with the same general chemical makeup. Indeed, this is how we think of DNA when considering its basic function of inheritance, in which all parts of all chromosomes must be duplicated and then passed from one cell generation to the next. The capacity for inheritance is fundamentally a consequence of DNA's general molecular structure, and not of its sequence per se, as But sequence does matter when DNA fulfills its other, more directly functional role. When the DNA that makes up a gene is exposed and expressed, when a gene is serving its individual function, then the detailed sequence means all.So where does recombination  fit in? Recombination hotspots are of strong interest to at least two quite different groups of biologists. For geneticists and cell biologists who study meiosis, the existence of recombination hotspots offers a way to learn what other processes are associated with recombination. This is partly how we know that homologous crossovers in yeast and other eukaryotes are initiated by the cleavage of single chromosomes, called \u201cdouble-strand breaks\u201d . It turnFor population geneticists, much of the interest in recombination hotspots comes from their possible effect on the patterns of DNA sequence variation along human chromosomes and from the possibility that these patterns could be used to map the position of alleles that cause disease. When multiple copies of the DNA sequence of a gene, or of a larger region of a chromosome, are aligned, they reveal the location and distribution of variation at individual nucleotide positions\u2014single nucleotide polymorphisms (SNPs). Each particular sequence, or haplotype, will carry a configuration for the SNPs for that region . Investihttp://www.hapmap.org/), which has the goal of identifying a subset of SNPs that capture most of the relevant linkage information in the human genome  to fluctuate in location and intensity, in ways that would be hard to precisely predict without knowing what genes have been under selection and what patterns of linkage disequilibria there may have been.PLoS Biology is especially interesting. They report that chimpanzees do not have a recombination hotspot in the TAP2 region where humans have a fairly well characterized recombination hotspot  have not shown evidence of recombination hotspots. If we compare these organisms with yeast and mammals, which do show hotspots, we gain some more insight into the factors affecting the evolution of hotspots.As appealing as the recombination modifier theory of recombination hotspots may be, there is circumstantial evidence that argues against it and that suggests that recombination hotspots are not directly the byproduct of selection on alleles in linkage disequilibrium. Particularly important in this regard is that some wellstudied organisms   and thus elegans . Double-Recombination during meiosis seems to be required for proper chromosome segregation; however, in those organisms where recombination and double-strand-break hotspots occur, these phenomena are also required for proper formation of the SC. It is as if the recombination machinery has been partly co-opted for chromosome alignment in some eukaryotes more so than in others. The implication of these findings is that recombination hotspots are byproducts of other functional constraints associated with the recombination process. This does not rule out the evolutionary theory of recombination modifiers, or that the location and intensity of recombination hotspots may evolve rapidly, but it does suggest that we may not need to invoke the evolutionary modifier theory to explain the existence of recombination hotspots.Recombination hotspots co-occur with double-strand-break hotspots in some eukaryotes, and together these phenomena appear to play an important role in the formation of the SC in those organisms. Given the limited phylogenetic occurrence of recombination hotspots , general theories for the evolution of recombination may not be very helpful for understanding the existence of recombination hotspots. However, in those species where they do occur, it is quite possible that recombination hotspots do evolve in location and intensity. Furthermore, the presence of recombination hotspots in humans may have large effects on the length of local patterns of linkage disequilibrium (haplotype blocks) and thus on our ability to map disease alleles by their association with other markers.Double-strand break: A break in both strands of a DNA molecule, as distinguished from a break in just one strand.Linkage disequilibrium: A pattern of association between two SNPs or two loci that each have multiple alleles, such that pairs of particular SNPs or alleles, one from each locus, tend to co-occur within individuals or genomes more often than would be expected if the loci are sorting independently of each other.Recombination: The process of one double-stranded DNA molecule joining with another; specifically in the context of meiosis, the process of two homologous chromosomes exchanging large portions of their DNA ."}
+{"text": "In humans, the rate of recombination, as measured on the megabase scale, is positively associated with the level of genetic variation, as measured at the genic scale. Despite considerable debate, it is not clear whether these factors are causally linked or, if they are, whether this is driven by the repeated action of adaptive evolution or molecular processes such as double-strand break formation and mismatch repair. We introduce three innovations to the analysis of recombination and diversity: fine-scale genetic maps estimated from genotype experiments that identify recombination hotspots at the kilobase scale, analysis of an entire human chromosome, and the use of wavelet techniques to identify correlations acting at different scales. We show that recombination influences genetic diversity only at the level of recombination hotspots. Hotspots are also associated with local increases in GC content and the relative frequency of GC-increasing mutations but have no effect on substitution rates. Broad-scale association between recombination and diversity is explained through covariance of both factors with base composition. To our knowledge, these results are the first evidence of a direct and local influence of recombination hotspots on genetic variation and the fate of individual mutations. However, that hotspots have no influence on substitution rates suggests that they are too ephemeral on an evolutionary time scale to have a strong influence on broader scale patterns of base composition and long-term molecular evolution. Patterns of genetic variation in the human genome provide a history of the evolutionary forces that have shaped our species. The role of one factor, recombination, in shaping variation is much debated. The observation is that regions of the genome with high recombination also have high levels of genetic variation, but this pattern can be interpreted as evidence for either repeated, widespread adaptive evolution or correlation through neutral factors such as base composition. To resolve this issue, the authors constructed a genetic map of human Chromosome 20 that has a resolution more than three orders in magnitude greater than previous maps. By comparing the location of recombination hotspots with patterns of genetic variation, evolution, and base composition, the authors show that recombination has only a very local influence on diversity, which suggests that molecular mechanisms, such as mismatch-associated repair or double-strand break formation, not adaptive evolution, drives the association. The extent to which adaptive evolution has shaped the recent evolutionary history of humans is much debated. While polymorphism at certain genes, such as beta-globin or Duffy, is known to be associated with functional variation of selective importance, the functional importance of most DNA variation or substitution since the human-chimpanzee split is unknown. However, adaptive evolution is also expected to leave its footprint in patterns of genetic variation. In particular, selective sweeps that accompany the fixation of adaptive mutations will eliminate nearby genetic variation . In regiHowever, genetic diversity is influenced by many factors, not just adaptive evolution. The rate at which new mutations appear in a population through mutation varies across the genome  and is iThere are two critical limitations in determining the nature of the association between recombination and diversity. First, previous analyses have relied on genetic maps estimated from pedigree studies , which tHere we introduce three innovations to analyse the relationship between recombination and diversity in humans. The first is the use of fine-scale genetic maps estimated from patterns of genetic variation, which provide a kilobase-scale resolution to the location of recombination hotspots ,21. The n observations there are n iterations. If multiple signals have been measured, for example, base composition, gene content, recombination rate, etc., each signal can be transformed. Correlations between signals can subsequently be assessed through linear model analysis of the detail coefficients at each level . Solid and dashed lines indicate maximum likelihood estimates and maximum likelihood estimates conditional on a mean read depth of 13, respectively .Maximum Likelihood Estimates of the Strength of Gene Conversion ((175 KB PDF)Click here for additional data file.Text S1(32 KB DOC)Click here for additional data file.Text S2(48 KB DOC)Click here for additional data file."}
+{"text": "The advent of live-attenuated vaccines against measles virus during the 1960'ies changed the circulation dynamics of the virus. Earlier the virus was indigenous to countries worldwide, but now it is mediated by a limited number of evolutionary lineages causing sporadic outbreaks/epidemics of measles or circulating in geographically restricted endemic areas of Africa, Asia and Europe. We expect that the evolutionary dynamics of measles virus has changed from a situation where a variety of genomic variants co-circulates in an epidemic with relatively high probabilities of co-infection of the individual to a situation where a co-infection with strains from evolutionary different lineages is unlikely.We performed an analysis of the partial sequences of the hemagglutinin gene of 18 measles virus strains collected in Denmark between 1965 and 1983 where vaccination was first initiated in 1987. The results were compared with those obtained with strains collected from other parts of the world after the initiation of vaccination in the given place. Intergenomic recombination among pre-/early-vaccination strains is suggested by 1) estimations of linkage disequilibrium between informative sites, 2) the decay of linkage disequilibrium with distance between informative sites and 3) a comparison of the expected number of homoplasies to the number of apparent homoplasies in the most parsimonious tree. No significant evidence of recombination could be demonstrated among strains circulating at present.We provide evidence that recombination can occur in measles virus and that it has had a detectable impact on sequence evolution of pre-vaccination samples. We were not able to detect recombination from present-day sequence surveys. We believe that the decreased rate of visible recombination may be explained by changed dynamics, since divergent strains do not meet very often in current epidemics that are often spawned by a single sequence type. Signs of pre-vaccination recombination events in the present-day sequences are not strong enough to be detectable. Paramyxoviridae family in the order of Mononegavirales and only a single serotype is known. It is among the most infectious viruses known for humans, and no other host species has been identified. Only human populations of a considerable size are able to sustain circulation . The. TheMonoCo-infection of host cells with phylogenetically distinct virus strains is required for recombination events to be detectable in sequence surveys. As a result of the global vaccination against measles a situation of endemic co-circulation of multiple strains ,6,15 shipre-/early-vaccination era isolates used for isolates collected in Denmark during the period of 1965\u201383 is meant to reflect that these isolates are from a period when vaccination against measles was not practiced in Denmark but was gradually becoming common practice in many other countries in the World. Thus, it cannot be excluded that vaccination in other countries influenced measles virus strains circulating in Denmark at the time, but it is anticipated that these isolates still bear valuable information on the nature of strains circulating before an influence of vaccination was imposed.The term Table Figure Figure Figure One way to distinguish whether incompatibilities are caused by parallel mutations (i.e. true homoplasies) or by recombination is to correlate linkage disequilibrium (LD) between sets of informative sites to distance. Recombination causes a decrease in linkage disequilibrium and more recombination is expected between sites that are further apart from each other. The block structure of close sites is visualised in a different way in Figure effective sites number . The. The35]]2 test. An estimated rate of \u03c1 = 15.8 corresponds to that an expected 45 recombination events have happened in the ancestral history of the 18 pre-/early-vaccination sequences. The estimated recombination rate appears smaller than rates reported for HIV and other viruses [Given these different lines of evidence for recombination, it is of interest to try to estimate the rate of recombination needed to explain the data. The most appropriate method is the finite site, composite likelihood approach implemented in LDhat . The res viruses . The est viruses .In conclusion, the analysis of pre-/early-vaccination era MV sequences shows evidence of recombination at rates important to the evolution of MV. The five different tests of recombination should not be considered independent tests and some of the results might be explained by alternative mechanisms such as convergent evolution of functionally important sites and rate heterogeneity of synonymous variation. However, all tests agree and provide evidence of recombination both through an excess of apparent homoplasies compared to the expected frequency of parallel mutations, and through a decrease in LD with distance, which is difficult to explain by any other hypothesis than recombination. Furthermore, it is difficult to imagine a mechanism other than recombination by which apparent homoplasies could occur pairwise or in triplets in distant parts of the sequence considering also that such patterns are not seen in the post-vaccination data set.The evidence of recombination among pre-/early-vaccination era MV strains and the lack of detection of recombination among post-vaccination era MV strains are consistent with the shift in epidemiology from a situation of co-circulation of strains in populations to a bottleneck situation with incidental introduction of a single strain to a susceptible sub-population of a geographical region. Given that intergenomic recombination and co-infection of individuals are common phenomena of MV it might be assumed that the lineages surviving till today did emerge from a pool of recombining pre-vaccination era strains. A lower level or absence of recombination due to changed epidemiology since then has erased our ability to detect recombination in a global sample of present day MV despite its high level of variability. It is possible that the Danish pre-/early-vaccination era strains are representatives of the very pool in which recombination took place while present-day MV strains are representatives of temporally and/or geographically separated lineages. Analysing informative sites in other parts of the MV genome of present-day lineages render it unlikely that these lineages could have derived from a clonal population structure of a global pool of MV strains .Paramyxovirinae is a nucleocapsid complex in which each nucleocapsid monomer (N) is predicted to be associated by hydrophobic bonds with 6 nucleotides in such a way as to resist non-ionic detergent and high salt and to protect the RNA from RNase digestion [The template for replication in members of the igestion . This tiMeasles virus appear to possess the ability to recombine but the present-day epidemiology of the virus where different sequence types rarely or never meet make the impact of recombination on the distribution of sequence diversity negligible. However, in the prevaccination area, endemic MV allowed more divergent strains to meet and recombine. The present-day strains are thus descendants of recombined sequences but the signal of the early recombination is lost in present-day sequences.AJ417850-AJ417867) [AF410986) , MVi/Montreal.CAN/19.98  , MVi/Vic.AU/12.99  [AF243851) [AY184218) , and China94-1  [The Danish pre-/early-vaccination sequences consist of an 800 base-pair region (nt. 659 to 1458) of the hemagglutinin coding region of 18 strains collected in Denmark, Greenland and the Faeroe Islands between 1965 and 1983 (GenBank accession numbers J417867) . Post-vaJ417867) . The remJ417867) , MVi/AlbY127853) , (Type GF243851) , MVi/GreF045203) .The alignment of the 18 pre-/early-vaccination and 40 post-vaccination sequences does not contain any gaps. The computer program DnaSP 3.99  was usedR2 or the standardized measure D') was investigated following [Recombination was examined using five different, but complementary, approaches. (i) A graphical method by which sets of sites in strong linkage disequilibrium (LD) were visually identified and marked with different colourings Fig. . It was ollowing  and estiollowing . Analysiollowing , using tollowing . This prollowing , using Pollowing .CHM, CPM and LSC collected the data. LSC formulated the hypothesis, and MHS performed all analyses. MHS and LSC wrote the paper."}
+{"text": "Human papillomavirus (HPV) has a causal role in cervical cancer with almost half a million new cases occurring each year. Presence of the carcinogenic HPV is necessary for the development of the invasive carcinoma of the genital tract. Therefore, persistent infection with carcinogenic HPV causes virtually all cervical cancers. Some aspects of the molecular evolution of this virus, as the putative importance of recombination in its evolutionary history, are an opened current question. In addition, recombination could also be a significant issue nowadays since the frequency of co-infection with more than one HPV type is not a rare event and, thus, new recombinant types could be currently being generated.We have used human alpha-PV sequences from the public database at Los Alamos National Laboratory to report evidence that recombination may exist in this virus. A model-based population genetic approach was used to infer the recombination signal from the HPV DNA sequences grouped attending to phylogenetic and epidemiological information, as well as to clinical manifestations. Our results agree with recently published ones that use a different methodology to detect recombination associated to the gene L2. In addition, we have detected significant recombination signal in the genes E6, E7, L2 and L1 at different groups, and importantly within the high-risk type HPV16. The method used has recently been shown to be one of the most powerful and reliable procedures to detect the recombination signal.We provide new support to the recent evidence of recombination in HPV. Additionally, we performed the recombination estimation assuming the best-fit model of nucleotide substitution and rate variation among sites, of the HPV DNA sequence sets. We found that the gene with recombination in most of the groups is L2 but the highest values were detected in L1 and E6. Gene E7 was recombinant only within the HPV16 type. The topic deserves further study because recombination is an important evolutionary mechanism that could have high impact both in pharmacogenomics (i.e. on the influence of genetic variation on the response to drugs) and for vaccine development. Presence of the carcinogenic human papillomavirus (HPV) is necessary for the development of the invasive carcinoma of the genital tract . PersistThe HPV genome has three different regions: two coding (E \u2013 early and L \u2013 late expression) and a regulatory non-coding region. The early region codifies regulatory, transforming and replication proteins, among which E6 and E7 are known to act like oncoproteins in high risk virus types ,5. The lAmong more than 100 types of HPV known today, approximately 30 infect the genital tract. Within these, HPV16 and HPV18 are the two types with the highest oncogenic power. A prospective way of fighting cervical cancer is with an anti-HPV vaccine. Phase III vaccine trials are being developed by Merck, GlaxoSmithKline and the National Cancer Institute ,6. BesidBecause of HPV extreme diversity, the occurrence of recombination was initially discarded, in part because of the technical difficulties for aligning extremely diverse sequences, and in part because of the less accurate methods available for the researchers until the past decade. Nevertheless, recently reported phylogenetic incongruence at the putative high-risk ancestor node, showing that one or more presumed old recombination events should explain a non monophyletic evolution of oncogenic HPVs ,19, has However, the methods used to assess the presence of recombination signals were either phylogenetic based or substitution based. No model-based method was used. Hence, the difficulty of aligning all currently sequenced PVs imposes an additional challenge. Here we addressed the existence of recombination in HPV using a very efficient composite likelihood method ,22. The We have centered on human alpha PV sequences, which alignment is much more reliable. Our goal was to get recombination estimates of different genes  in different groups. We defined three groups  attending to their phylogenetic relationships but also to their epidemiology and clinical outcome. The identification of the specific recombinant sequences or the recombination break points is a more complex problem and requires different algorithms and software, being out of the scope of the present paper.Table In addition, rate variation among sites has been detected in several of the data sets, though only in few ones the shape value of the gamma distribution was below one indicating an important rate heterogeneity . The sigUsing a gene conversion model with a Jukes-Cantor nucleotide evolution model  and assuWhen using the best-fit models of nucleotide substitution and considering the estimated rate variation the obtained results were qualitatively similar but with a bit higher estimates and a new signal for L1 in the GII group  to infer recombination from HPV DNA sequences. Model-based methods are known to be preferred over substitution and phylogenetic ones ,30-32. TPairwise program assumes a simple Jukes-Cantor model with two alleles [Kpairwise [Regarding the existence of model complexity and rate variation among sites in the HPV samples, it is known that the amount of divergence and rate variation in the data could affect recombination estimation in some cases . However alleles . Therefopairwise  and confMoreover, we have designed an experiment to check the possibility of false positive detection due to recombination artifacts because of the model complexity and the high diversity underlying the data. As shown above, there was not significant recombination estimation under the parameters considered.In addition, we were able to estimate the expected number of recombination events in those cases with significant recombination detection. As expected, the higher numbers were found for group GI, which incorporates a major number of branches from PV phylogeny . ImportaAlthough we have detected significant recombination signal at all genes and groups in one combination or another, perhaps the most important result is that recombination was detected at intra-type level in HPV16. This may indicate that recombination is occurring at a relative high frequency in current carcinogenic HPV types and variants. HPV recombination should not be exceptional nowadays since the frequency of co-infection with more than one HPV type is not a rare event, and new recombinant types could be currently being generated. Provided that the oncogenicity of specific HPV intra-type variants appear to vary geographically and also with the ethnic origin of the population studied , more reWe provide new support to the recent evidence of recombination in HPV. In addition, we perform an evolutionary characterization, estimating best-fit models of nucleotide substitution and rate variation among sites, of some important HPV DNA sequence sets. Using simulations, we have shown that the detected recombination signals should not be artifacts. Thus, we found that the gene with recombination in most of the groups is L2 but the highest values were detected in L1 and E6. Gene E7 was recombinant only within the HPV16 type. The topic deserves further study because recombination is an important evolutionary mechanism that could have high impact in both pharmacogenomics (i.e. the effect of genetic variation on response to drugs) and vaccine development.n = 14 sequences including just one variant of type 16). Group II (GII) included 6 low risk types  associated to each data set can be computed by using formulae 5 in Hudson and Kaplan [Given the recombination values estimated and the number of sequences at each group the expected number of recombination events d Kaplan ,n is the number of sequences in the sample.recoal1.7 from David Posada and available upon request from him [To check that HPV sequences do not generate recombination false positives under the composite likelihood estimator due to their particular combination of model complexity and rate variation, we simulated 100 DNA samples of 15 sequences each and longitude 500 bp using a coalescent model . We usedfrom him . SpecifiThe author(s) declare that they have no competing interests.MA carried out the acquisition of data, sequence alignment, participated in recombination analyses and helped to draft the manuscript. AC-R conceived and designed the study, participated in the recombination analyses, performed data analysis and simulations and drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "Genetic maps of the mouse genome\u2014which identify the relative locations of specific stretches of DNA based on the likelihood of their being separated when chromosomes exchange parts during meiosis\u2014work well for broadly defining where various points lie along a mouse\u2019s chromosomes. But these maps have lacked the resolution that investigators need to be able to do things like line them up against physical maps\u2014the string of As, Gs, Cs, and Ts that gene sequencing supplies\u2014to identify the precise location of genes, or explore the nuances of genetic recombination. Because the mouse is a widely used model for genetic research, such capabilities would be invaluable. Now, Sagiv Shifman, Jonathan Flint, and colleagues have provided a powerful new tool for genetic studies with the development in mice of the most detailed genetic map available for any species but humans.To create the high-resolution map, the researchers used two groups of mice, one consisting of outbred, heterogeneous stock (HS) and the other of recombinant inbred lines (RI). Physical mapping of the mouse genome has revealed the location of thousands of single nucleotide polymorphisms (SNPs)\u2014stretches of DNA whose genetic code differs from one animal to another (or one homologous chromosome to another) by only one nucleotide base and that can be used as landmarks in the mapping process. The researchers looked at the patterns of inheritance of 10,202 SNPs in HS animals and 11,609 SNPs in RI animals, then used special software to calculate their relative location based on how likely they are to occur together. Using this process, they were able to create genetic maps of the mouse genome that can distinguish between two points 0.37 cM  apart in HS and 0.45 cM apart in RI\u2014far more finely tuned than the best previous map.After developing the super maps, the researchers used them to study recombination rates of various genes by comparing genetic and physical distances. For HS, the average recombination rate was 0.63 cM per megabase (cM/Mb), and for RI, it was 0.62 cM/Mb. But the recombination rate varied substantially from one part of the genome to another. Smaller chromosomes, for instance, had a higher average recombination rate than larger ones. There was also a difference between the study groups: the HS genome showed a higher recombination rate in big chromosomes and a lower rate in small chromosomes than did the RI genome. And when they looked at variation in recombination rate along the chromosome, the researchers found the highest recombination rate near the ends of the chromosomes .There was also a sex difference in recombination rates. Calculating rates separately for male and female HS mice, the researchers found, as previous studies had found in humans, that the average autosomal (non\u2013sex chromosomes) recombination rate for females was higher than that for males. Distribution of recombination frequencies differed with sex, too, with recombination higher near the junctures of the sister chromosomes (centromeres) in females and higher near telomeres in males. The researchers also found many individual areas along the chromosomes that showed high recombination rates in one sex but not the other.Intrigued by the incongruity in recombination, the researchers decided to look further into how rates vary with specific DNA features. In HS and RI together, they found a total of 494 regions in which recombination rates were uncharacteristically high (which they termed \u201cjungles\u201d) or low (\u201cdeserts\u201d). The researchers looked at 55 inbred strains for places with little historical recombination. They found that 59% of deserts overlapped with such areas, while only 12% of jungles overlapped.Can sequence characteristics predict jungles and deserts? In general, the researchers found more simple repeats but not more genes or SNPs in jungles. Self-copying stretches known as long interspersed nuclear elements (LINEs) were more common in deserts than in jungles. Sequences previously found to be prevalent in human recombination hot spots (CCTCCCT and CCCCACCCC) turned out to appear disproportionately often in the mouse genome jungles as well. In fact, the researchers found that the CCTCCCT motif appeared in locations corresponding to mouse jungles and deserts in rats, dogs, and chimpanzees, as well as in humans.In the brief period of its existence, this new, improved mouse genetic map has already yielded valuable information on how factors such as chromosome, chromosomal location, sex, and sequence composition are related to recombination rates\u2014information that can improve our understanding of inheritance and inform future efforts to pinpoint the precise location of genes on individual chromosomes."}
+{"text": "We report the highest density genetic map yet created for any organism, except humans. Using more than 10,000 single nucleotide polymorphisms evenly spaced across the mouse genome, we have constructed genetic maps for both outbred and inbred mice, and separately for males and females. Recombination rates are highly correlated in outbred and inbred mice, but show relatively low correlation between males and females. Differences between male and female recombination maps and the sequence features associated with recombination are strikingly similar to those observed in humans. Genetic maps are available from  A high-density SNP map based on outbred and inbred mice with male and female separation suggests a high degree of homology between mouse and human recombination. The map consists of 2,302 genetically separated bins, with an average distance between bins of 0.61 centimorgans (cM)  = 141.5); 99.0% of the intervals are below 500 kb and 81.2% are below 250 kb. Genotype accuracy, based on the inheritance of alleles in 1,097 trios and 25 duplicate samples, is 99.99%. From 5,089 SNPs typed on 42 inbred strains by us and by Merck , there wMaps were created separately for HS mice and RI strains. Genotypes were obtained for 11,247 informative SNP markers in 2,293 HS animals. There are 84 HS pedigrees, eight of which are large, complex multi-generational families with inbreeding loops, encompassing the majority (61.1%) of individuals. The remaining 72 families are nuclear, with an average sibship size of 9.6 (range 2\u201334). The pedigrees consisted of 4,048 potentially informative meioses, of which the average number of informative meioses per marker was 1,296.7 , and the average number of phase-known meioses was 198.1 (range: 7\u2013964 per marker).We estimated genetic distances using the software program CRIMAP . InitialIn three instances we obtained linkage support for physical order, but the estimated recombination rates indicated that unlinked markers were present in that SNP window. In the first instance, a SNP (mCV24244050) on Chromosome 5 appeared completely unlinked across the majority of families. The likely explanation is that the SNP is placed at the end of the genetic map (near the centromere), where recombination events are difficult to establish. In the other two cases, SNPs in the middle of chromosomes 8 (rs13479764) and 12 (rs13481579) appeared unlinked in the map. The number of informative meioses for these two SNPs was low, and an examination of the distribution of crossovers indicated that they occurred in just two families. On Chromosome 8, the inflated recombination rates were observed only in the maternal meioses, whereas on Chromosome 12, the inflation was observed in the male meioses. On Chromosome 12, the recombination rate was also inflated (but to a lesser extent) at a location eight markers upstream of the unlinked SNP. These inconsistencies may indicate the presence of chromosomal rearrangements. We excluded all these markers from the genetic maps.Altogether we discarded 1,034 markers that mapped to multiple locations or did not map to any location on their assigned chromosome see . An addiThe total length of the sex-averaged genetic map is 1,630 cM. The average genetic inter-marker distance is 0.16 cM, the largest inter-marker interval is 6.15 cM (between 53.6 and 59.8 cM) on Chromosome 5, and the average genetic distance between unique map positions (map resolution) is 0.37 cM for the sex-averaged map . There ap-value  across all strains, corrected for the number of SNPs, did not reach significance for any of the SNPs.A consensus genetic map for recombinant inbreds was constructed using 11,609 informative SNPs and 267 strains from the eight sets of RIs. R/QTL was used to estimate the genetic distances between SNPs that were polymorphic in at least one of the RI sets . On averIn the BXD set, 52 SNPs showed variation in genotypes that corresponded to the three different phases of development of the BXD RIs \u201326 Tabl. Forty-sr = 0.84, p = 0.02). The average distance between recombination events (map length divided by the number of recombinations) in the RI map is 0.11 cM (29.3 cM per strain) or 177.1 kb (47.3 Mb per strain). The average genetic distance between SNPs in the RI map is 0.14 cM or 216.4 kb, and the average resolution is 0.45 cM . There is a negative correlation between chromosome size and chromosome average recombination rate, with the recombination rate of the smallest chromosome (Chromosome 19) being approximately 1.5-fold higher than that of the longest chromosome (Chromosome 1) in the HS and 2-fold higher in the RIs. The correlation between chromosome size and recombination rate is higher in female HS  than in male HS maps . The X chromosome does not account for this difference between females and males because it exhibits a lower rate of recombination relative to the rate expected for its size. The correlation between chromosome size and recombination rate in females excluding chromosome X is nearly the same .Variation in recombination rates between chromosomes is partly accounted for by chromosome size   and the need to sample sufficient recombination events within a window. The correlation between recombination rates calculated for each window for the HS and RI maps is 0.50, 0.60, and 0.66, respectively (windows) . The ranp = 2.3 \u00d7 10\u22127), similar to the pattern observed in humans. We also examined the correlation between male and female recombination rates and identified many regions showing high recombination rate in one sex, but not the other (p < 1 \u00d7 10\u22126).We calculated recombination rates in males and females separately using the sex-specific HS map for all autosomes. On average, the autosomal rate of recombination is higher in females (0.72 cM/Mb) than in males (0.57 cM/Mb). The recombination rate in females is notably higher near the centromere, whereas in males it is higher near the telomere . Out of the 494 extreme regions, 154 are recombination jungles and deserts in both HS and RIs (84 recombination jungles and 70 recombination deserts). Thirteen regions are discordant, being in the high 10% based on one map (in ten of 13 cases in the HS map) and in the low 10% based on the other map.p = 2.4 \u00d7 10\u221213). Only one jungle predominantly lies within a haplotype block in contrast to 33 (47.1%) of the deserts. Nevertheless, there are 19 (25.7%) deserts that do not correspond to haplotype blocks.To test whether jungles and deserts are conserved, we defined the haplotype block structure of the mouse genome using 55 inbred strains that were genotyped for the same SNP panel. As in human populations, haplotype blocks were defined to be regions where there has been little historical recombination . We inven repeats (relative risk [RR] = frequency in jungles/frequency in deserts = 1.8), (TG)n repeats (RR = 1.9), and low-complexity repeats (RR = 1.4). In contrast, (TA)n repeats (RR = 0.79) and some long interspersed nuclear elements (LINEs) (RR = 0.6) are underrepresented in recombination jungles, as seen also in the study of human recombination hotspots [p = 2.8 \u00d7 10\u221235).To search for factors that predict recombination jungles and deserts, we first examined the association between recombination rate and global sequence features. We found differences in the abundance of many sequence variables, including simple repeats, interspersed repetitive sequences, and transposable elements , but genhotspots . An indip = 6.8 \u00d7 10\u221229), and the number of motifs is a very strong predictor of recombination jungles versus deserts (p = 2.2 \u00d7 10\u221220), but it does not significantly add to the deviance explained in a logistic regression model. Looking at recombination rate across the whole genome, the correlation between the CCTCCCT motif and the average recombination rate in non-overlapping windows of 1 Mb is 0.35 (p = 8.8 \u00d7 10\u221271).We examined the seven nucleotide sequence motif (CCTCCCT) previously shown to be enriched in human recombination hotspots . We comp deserts A: it expp = 1.5 \u00d7 10\u221235; females, p = 1.1 \u00d7 10\u221218). We did not find associations between other sequence elements and recombination rates that differed between the sexes.We tested for the effect of sex on the association of the CCTCCCT motif with recombination. We used the HS sex-specific recombination rates calculated in larger windows (2 Mb) to make the estimates comparable to those obtained from sex-averaged estimates. The CCTCCCT motif was found to be associated with recombination rates in both males and females, with correlation of 0.35 and 0.26, respectively . To see how these cross-species correlations in the frequency of the CCTCCCT motif correspond to recombination rates, we calculated the recombination rate (cM/Mb) for the mouse orthologous regions in humans using the Rutgers high-resolution genetic map. Recombination rates in humans are on average higher in regions orthologous to mouse jungles compared to regions orthologous to deserts (p = 1.6 \u00d7 10\u22125), and correlate significantly with the mouse rates: the correlations are 0.35 (p = 2.0 \u00d7 10\u22125) and 0.42 (p = 2.2 \u00d7 10\u22127) with the values in RIs and HS, respectively. Since our findings suggest that the role of the CCTCCCT motif in recombination is conserved across different mammalian species, we asked whether the position of the motif is conserved between species. We identified the orthologous regions corresponding to the 154 regions of mouse jungles and deserts in the genomes of the rat, dog, chimpanzee, and human. The density of the CCTCCCT motif (counts per Mb) is highly correlated between all species across the different regions , the use of large pedigrees, and the construction of separate maps based on two types of populations has result in a highly reliable linkage map and highly accurate estimates of recombination rates.Our map was constructed using HS mice that were also employed to find QTLs . We collWe found that chromosome-specific recombination rates do not greatly differ between outbred (HS) and inbred populations (RIs): there are very few regions with discrepant recombination rates. Petkov et al.  suggest We do see, however, some differences related to chromosome size. Recombination in the RIs appears to be more constrained by chromosome size, which explains 73% of the variance in the chromosome average recombination rate, whereas in the HS, it explains only 35% of the variance. Higher recombination rates are observed in the HS relative to the RIs in the large chromosomes, and lower rates in the small chromosome (with the exception of the X chromosome). We cannot at this point explain this observation.We found remarkable similarity in the features that contribute to variation in recombination rates in mouse and human chromosomes. We confirmed that chromosome, position on the chromosome, sex, and sequence composition are common important factors. In both species, differences in recombination rates are correlated with chromosome size (or arm size) and proportional distance from the centromere. It is possible that, as has been suggested in humans, variation in recombination rates between chromosomes occurs because each chromosome arm is constrained to have a single chiasma, and the effect of fixing the lower limit of recombination will affect smaller chromosome arms more than larger ,30. UnliIn both humans and mice, the average recombination rate in females is higher than males. Recombination rates are higher near the centromeres for females and towards the telomeres for males ,33. The The main difference between the LD landscapes of the human and mouse genome is the presence of large haplotype blocks of up to several megabases in size in mouse inbred strains. We have shown that the position of these haplotype blocks tends to coincide with recombination deserts. In contrast, recombination jungles coincide with borders of these blocks or regions without evident block structure. An important implication of this observation is that genetic variants (such as those underlying quantitative trait loci) that lie within a recombination desert will be difficult to identify with the SNP maps we have generated.We exploited the LD landscape of the mouse genome to concentrate on regions of very high-recombination rates (jungles) and very low rates (deserts). We used the selected jungles and deserts, as well as the recombination rates in the whole genome, to study sequence features that were shown to influence global and local recombination rates in humans. A major limitation of this analysis is that the location of recombination hotspots within jungles is unknown. Although deserts are essentially homogenous regions without recombination, jungles are presumably heterogeneous regions with an uneven distribution of recombination events. Therefore, in this study we focused on factors that are known to influence recombination in humans.In humans, sequence motifs are an important determinant of variation in recombination rate. Analyses of the sequence correlates of recombination based on low resolution genetic maps have been unable to identify motifs that independently predict recombination rate. Most of the correlations have low coefficients and the sequence variables are correlated with each other. High resolution mapping of recombination hotspots in humans found CCTCCCT oligomers to be the strongest signal of recombination hotspots . The mothttp://gscan.well.ox.ac.uk/#genetic_map and as Our data support a two-stage model of recombination in which recombination rates are constrained over large scales, but are rapidly evolving on a small scale. The conservation of recombination deserts in inbred lines, shown by haplotype blocks and the presence of some of those deserts also in humans, are also consistent with this model. Comparisons between species using low-resolution sex-averaged maps have previously detected only a slight positive correlation between recombination rates . The fachttp://www.well.ox.ac.uk/mouse/INBREDS.We selected SNPs across the genome that distinguish between the eight HS founders . We used datasets to select SNPs that are validated and polymorphic in at least some of the HS founders ,35. SNPsThe mapping algorithm used the physical sequence positions to determine the initial order of the markers on the map, followed by estimation of linkage support for the physical order, and maximum-likelihood estimates of the recombination fractions. The majority of markers were present in NCBI build 34 of the mouse genome, and where these were unavailable (125 SNPs), build 33 locations were used to interpolate marker order on build 34. We used CRIMAP  to consttwopoint option in CRIMAP. Altogether, 11,199 markers were linked to at least one marker on the chromosome with a LOD > 3, and 48 markers were discarded at this stage. The second test of map order consisted of the removal and remapping of each marker onto the map. A marker was kept in its physical NCBI build 34 location only if the likelihood of the physical location was within 1 LOD unit of the highest likelihood obtained.Linkage support for physical order was obtained in two stages. The first step was to confirm localization of each marker to the chromosome assigned by its reported physical location on NCBI build 34 of the mouse genome. In the set of 11,247 informative markers, we required each marker to exhibit linkage to at least one other marker on that chromosome, with odds greater than 1000:1, using the all function in CRIMAP. If a marker did not map to within 1 LOD unit of its physical location, we searched for the highest likelihood of placement along the remaining windows for that chromosome. At this stage, 10,213 markers mapped to their physical location using this method. The remaining 986 markers mapped to multiple locations along the designated chromosome.Because of the complexity of some of the pedigrees and the number of markers, it was not possible to include entire chromosomes in the analyses. Therefore, each chromosome was analyzed using overlapping windows of five to 15 SNPs at a time, by considering all possible orders within a given window of markers using the fixed function of CRIMAP in a series of overlapping windows of five to 15 SNPs using the maximum number of estimated data points  to calculate the recombination fraction between each pair of markers. Following recombination rate estimation, two markers in the map had inflated recombination rates and appeared completely unlinked in all windows analyzed. Because the density of markers indicated that these were highly unlikely events, we excluded these markers from the maps, and excluded one window on Chromosome 12 for which two such events occurred within a window of nine consecutive markers. As a result, 10,202 markers were placed on the map.Once linkage support for marker order was established, recombination rate estimates were obtained for the 10,213 markers in CRIMAP. Recombination rate estimates were calculated using the chrompic function in CRIMAP. The resulting estimate over the genome was 2.3 \u00d7 10\u22124, taking into account the average number of informative meioses per chromosome. However, we did not exclude any genotypes at this stage on the premise that the double recombinant events may represent chromosomal rearrangements, in particular, deletions.In the final set of 10,202 markers, we estimated double recombinant events, which may indicate erroneous genotypes or potential chromosomal rearrangements. We estimate the rate at which two or more recombinant events occurred within non-overlapping windows of five markers using the The RI sets include: AXB , BXA , CXB , BXD , BXH , AKXD , LXS , and SWXJ .calc.errorlod. R/QTL was used to estimate the genetic distances between 11,609 SNPs that were polymorphic in at least one of the RI sets.Within each set of RI animals, we deleted any non-polymorphic SNPs from each set, as well as SNPs whose flanking sequences were not mapped to a single location in the NCBI build 34 mouse genome assembly. The genotypes were recorded as 1 or 2, based on the alleles of the founders, and heterozygotes were treated as missing values. The SNPs were ordered based on build 34. The number of double recombinations of adjacent SNPs was calculated for each SNP and each strain. If more than two double recombinants were found for a SNP interval, it was taken to indicate potential genotype errors or errors in the order of markers. Markers with more than two double recombinations were excluded. For the genetic distance estimation, the genotypes of the eight RIs sets from 267 strains were combined into one dataset. Alleles of SNPs that are not polymorphic in an RI set were treated as missing data. The error LOD score  was calcInbred strains were genotyped for the same panel of SNPs with the Illumina platform as mentioned above. Haplotype blocks were defined using a 95% confidence bound on D\u2032  using Haploview 3.0. The following 55 inbred strains were selected from 72 inbred strains after removing 17 strains that are in high correlation (>0.8) with other strains: 129S6/SvEv, 129X1/SvImJ, A/J, AKR/J, ALR/LtJ, ALS/LtJ, BALB/cByJ, BPH/2J, BPL/1J, BPN/3J, BTBR T+ tf/J, BUB/BnJ, C3HeB/FeJ, C57BL/10J, C57L/J, C58/J, CALB/RkJ, CBA/J, CE/J, DBA/1J, DDY/JclSeyFrk, EL/SuzSeyFrk, FVB/NJ, I/LnJ, ILS, IS/CamRkJ, ISS, KK/HlJ, LEWES/EiJ, LG/J, LP/J, MA/MyJ, NON/LtJ, NOR/LtJ, NZB/BlNJ, NZO, NZW/LacJ, PERA/EiJ, PERC/EiJ, PL/J, RBA/DnJ, RBF/DnJ, RF/J, RIIIS/J, SB/LeJ, SEA/GnJ, SENCARA/PtJ, SF/CamEiJ, SJL/J, SM/J, ST/bJ, SWR/J, WMP/PasDnJ, WSB/Ei, and YBR/Ei.http://www.broad.mit.edu/snp/mouse/) together with SNPs from Perlegen (http://mouse.perlegen.com/mouse/download.html). We used the Student t-test to compare the abundance of features in recombination jungles and deserts. Logistic regression modeling was performed using the glm function in the R statistical analysis package version 2.1.1, with the type of region (jungle vs. desert) as the response, and the frequency of the sequence motif in the region as explanatory variable. Goodness of fit was tested using the model's deviance (twice the log likelihood ratio). Orthologous regions were defined between mouse  and other assembled genomes  using the Genome Browser \u201cNet\u201d and \u201cChain\u201d alignments as described by Taylor et al. [We obtained gene and repeat features from the Ensembl database (data derived from mouse assembly NCBI build 34) using standard Perl modules . GC contr et al. .Table S1The map gives the sex-averaged genetic position of 9,904 SNP markers from 2,293 heterogeneous stock mice. The columns are the marker name (marker), the genome build of the markers' physical position (genome_build), the chromosome, base pair (bp) position, and genetic position (cM).(830 KB XLS)Click here for additional data file.Table S2The columns are the marker name (marker), the genome build of the markers' physical position (genome_build), the chromosome, base pair (bp) position, and genetic position (cM).(830 KB XLS)Click here for additional data file.Table S3The columns are the marker name (marker), the genome build of the markers' physical position (genome_build), the chromosome, base pair (bp) position, and genetic position (cM).(976 KB XLS)Click here for additional data file.Table S4The columns are the marker name (marker), the chromosome, base pair (bp) position, the genotype of the BXD parental strains C57BL/6J (B) and DBA/2J (D), the genotypes of two highly related strains C57BL/10J and DBA/1J, the genotypes of the BXD lines sorted on the basis of the three different phases of development. B indicates an allele from C57BL/6J, D indicates alleles from DBA/2J, and H is heterozygote.(88 KB XLS)Click here for additional data file.Table S5The columns are the marker name (marker), the genome build of the markers' physical position (genome_build), the chromosome, base pair (bp) position, and genetic position (cM)(1.1 MB XLS)Click here for additional data file."}
+{"text": "We estimated the crossover frequency in 1,232 gametes from 356 subjects in pedigrees from the Collaborative Study on the Genetics on Alcoholism. We examined the effect of covariates including age, ethnicity, and years with ALDX1 on recombination rate, and found a positive correlation between recombination rate and years with ALDX1. By variance-component analysis, we estimated the heritability of recombination rate to be around 0.5, and provided suggestive evidence for a locus linked to recombination rate. Crossover between homologous chromosomes in meiosis is the most important mechanism for shuffling the genetic material in humans. It has been estimated that the average number of crossover events per gamete is 26.5 in males and 39 in females, respectively . While vDetails of the GOGA data has been described elsewhere. In brief, it consists of 143 pedigrees of variable size and different ethnic origin. Besides gender, age, and ethnicity, phenotypic data includes a selected set of phenotypes related to alcohol dependence. We selected the DSM-III-R+Feighner classification status for alcohol dependence (ALDX1) and onset age of ALDX1 for this study.The COGA pedigrees have been genotyped using three screening sets: the conventional microsatellite markers, the Illumina SNP screening set, and the Affymetrix 10K single-nucleotide polymorphism (SNP) set. Genotypes of 11,120 SNPs from the cleaned Affymetrix 10K SNP set, available in 1,316 COGA subjects, were used in our analysis due to their high density of SNPs.We first phased the genotypes of each pedigree members using GENEHUNTER . We thenWe estimated the effects of covariates including gender, age, ethnicity, and alcohol dependence on individual recombination rate with a multiple linear regression model using R 1.8.1. Generalized estimating equation (implemented in R package \"gee\") were used to adjust for correlations due to observations of multiple gametes from the same individual. The individual recombination rate was calculated as the total number of observed crossovers in 22 autosomes. The variable \"age\" was defined as the difference of the ages at interview between the individual and his/her offspring, which should approximate the age at gamete production. We let variable \"dage\" be the difference between age (at gamete production) and onset age of ALDX1 (if observed) in an individual. The years with alcohol dependence at gamete production age (\"adyr\") was defined as equal to 0 if ALDX1 = 1 (\"pure\" unaffected) or dage \u2264 0 or identical to dage if ALDX1 = 5 (affected) and dage > 0. If neither criteria held, adyr was recorded as missing.We carried out variance-component analysis on the recombination rate using GENEHUNTER v2.1, estimated the heritability of recombination rate, and performed linkage analysis under the presumption of no dominant polygenic variance . Before r2 = 0.24). The effects of covariates age, gender, ethnicity, and adyr on recombination rate, estimated by multiple linear regression, is summarized in Table p < 0.05). Both age at gamete production and ethnicity did not have a significant effect on recombination rate. Gender-stratified analysis produced very similar estimates of the gender-specific coefficients for age and adyr.With the Affymetrix 10K SNP genotypes in COGA pedigree, we were able to estimate crossover frequency in a total of 1,232 gametes from 356 individuals, including 34 non-Hispanic Blacks, 286 non-Hispanic Whites, and 21 Hispanic Whites. The average of male, female, and sex-averaged crossover rate was 22.6, 38.1, and 31.1, respectively. The sex-specific distribution is shown in Figure The heritability of recombination rate estimated from variance component analysis was 51.3%. Of 143 COGA pedigrees, only 38 pedigrees had one or more sibling pairs or half-sibling pairs with observed recombination rate. Our linkage analysis identified 9 loci with LOD > 1 Table . The higOur analysis on recombination rate in 1,232 gametes from 356 subjects in the COGA study suggests that recombination rate increases over the years with ALDX1 (adyr). We further provided evidence, for the first time, for a substantial genetic component in recombination rate, and identified a few candidate loci for recombination rate.Though statistically significant, the effect size of adyr on recombination rate is quite small. It is not clear if this effect is the direct consequence of alcohol dependence or an indirect result from alcohol drinking for which adyr serves as a surrogate marker. It would be very interesting to examine the effect of alcohol drinking, but such data at the age of gamete production was not available.Our estimates of number of crossovers per gamete in both sexes, and particularly in males, are a little lower than those from other studies. Several possible explanations for the slight under-estimation of recombination rate are: 1) the genetic markers in this study may not cover the entire autosome; 2) despite the high density of Affymetrix 10K SNPs, many SNPs with small or no heterozygosity provide little information on genotype phasing, resulting in omission of a small portion of double recombination between informative markers; and 3) the rule to discard double recombination within a 1-cM interval may lead to discarding a few true double reanalyze them.The major weakness of our variance component linkage analysis is lack of power due to insufficient sample size. Recombination rate can only be determined for individuals who have genotyped offspring. As a result, only 38 out of 143 COGA pedigrees are informative for this linkage analysis. It would be very desirable to pool all available large genome scan studies with 3-generation pedigrees and reanalyze them.Through our study, we estimated that the heritability of recombination rate was 51.3% using variance component analysis. We also provided suggestive evidence for a locus linked to recombination rate on chromosome 16.COGA: Collaborative Study on the Genetics on AlcoholismDR: Double recombinationGAW14: Genetic Analysis Workshop 14SNP: Single-nucleotide polymorphismLW carried out the variance component analysis and regression analysis, and drafted the manuscript. XX conceived of the study, took charge in study design, and draft the manuscript. Both authors read and approved the final manuscript."}
+{"text": "Psmb9 gene in the mouse major histocompatibility complex by sperm typing, demonstrating that it is a site of recombination initiation. With the goal of uncovering some of the genetic factors controlling the activity of this initiation site, we analyzed this hotspot in both male and female germ lines and compared the level of recombination in different hybrid mice. We show that a haplotype-specific element acts at distance and in trans to activate about 2,000-fold the recombination activity at Psmb9. Another haplotype-specific element acts in cis to repress initiation of recombination, and we propose this control to be due to polymorphisms located within the initiation zone. In addition, we describe subtle variations in the frequency and distribution of recombination events related to strain and sex differences. These findings show that most regulations observed act at the level of initiation and provide the first analysis of the control of the activity of a meiotic recombination hotspot in the mouse genome that reveals the interactions of elements located both in and outside the hotspot.In most eukaryotes, the prophase of the first meiotic division is characterized by a high level of homologous recombination between homologous chromosomes. Recombination events are not distributed evenly within the genome, but vary both locally and at large scale. Locally, most recombination events are clustered in short intervals (a few kilobases) called hotspots, separated by large intervening regions with no or very little recombination. Despite the importance of regulating both the frequency and the distribution of recombination events, the genetic factors controlling the activity of the recombination hotspots in mammals are still poorly understood. We previously characterized a recombination hotspot located close to the  trans . This suggests a unique type of regulation requiring the presence of a diffusible factor and/or of communications between homologous chromosomes before recombination. A second element represses the recombination initiation in cis, which might indicate the influence of local polymorphisms affecting initiation events. Our results provide the first functional analysis of the control of recombination initiation sites for meiotic recombination in mammals.In most sexually reproducing species, during meiosis a high level of recombination between homologous chromosomes is induced. These events are not evenly distributed in the genome but clustered in small regions called hotspots. The genetic factors controlling their activity in mammals are still poorly understood. We have performed experiments to identify factors that influence the recombination activity of a hotspot in the mouse genome. By detecting the recombination products by a PCR-based method, we show that the variation of hotspot activity  is mainly due to differences of initiation frequencies, rather than differences at later steps of recombination. In addition, we identify several levels of controls. First, the initiation of recombination is activated by a haplotype-specific element, localized outside the hotspot and acting in  Saccharomyces cerevisiae. Recombination is initiated by the formation of DNA double-strand breaks (DSBs), catalyzed by Spo11 [In most eukaryotes, the formation of at least one reciprocal exchange, or crossover (CO), per chromosome pair between nonsister chromatids provides the physical connection that is required for the segregation of homologous chromosomes at the first meiotic division. The molecular mechanism of meiotic recombination has been described in by Spo11 ,3. Thereby Spo11 ,5.S. cerevisiae recombination hotspots result from the clustering of initiating DSBs at localized preferential sites, spreading over 50\u2013500 bp. The recombination events, both CO and NCO, extend in short intervals (<4 kb) surrounding these initiation sites . Most riewed in \u201310. Speriewed in ,12). A hitiation \u201316. Cons hotspot . Several hotspot ,19. In h hotspot ,21. Simi hotspot \u201324. Thes hotspot ,26. WithThe factors controlling the activity of recombination hotspots remain elusive. One approach has been to search for features related to the DNA sequence by comparing the genome-wide distribution of hotspots with the variation of various features along genomes. In budding yeast, one of the most striking feature of DSBs is their localization in intergenic intervals containing a transcription promoter, though transcription activity per se is not required \u20138. Howevcis of the initiation frequency [MSTM1a and MSTM1b, CO rates are mainly determined by factors other than their own sequence [Eb gene, are common to most haplotypes from common laboratory strains. Others, like the Ea and Psmb9 hotspots, are specific to one or a few haplotypes, though a significant rate of CO might remain undetected in other haplotypes due to the insufficient sensitivity of pedigree analyses [A second approach aims to find factors involved in hotspot activity control through the detailed analysis of individual hotspots. In budding and fission yeasts, the presence of open chromatin at initiation sites is important for the formation of DSBs ,28. At srequency ,32. At tsequence . In miceanalyses . The CO analyses ,34.TAP2 and \u03b2-globin), which have been well characterized by sperm typing, have been shown also to have CO activity in female meiosis [TAP2 hotspot, available data suggest that the CO frequency might be on average 20- to 40-fold higher in female than in male meiosis [Psmb9 gene (previously Lmp2) in the class II region of mouse MHC, defined as the Psmb9 hotspot [DNA sequence independent control of meiotic recombination is also illustrated by sex-specific differences in rate and distribution of CO as observed in many species. In human, and to a lesser extent in mouse, overall CO rates are significantly higher in female than in male . The formation of a high rate of CO at Psmb9 requires the presence of either the wm7 MHC haplotype, derived from Mus musculus molossinus, or the CAS3 MHC haplotype, derived from M. m. castaneus [wm7 haplotype but is active in both sexes carrying the CAS3 haplotype [wm7 fragment display a high CO rate in both sexes, demonstrating that the genetic element responsible for the lower CO rate in males is physically distinct from the element at the origin of the high CO rate at this hotspot [Psmb9 hotspot and gain insights into the factors controlling its activity, we adapted a PCR-based method recently developed for the direct molecular detection and analysis of both CO and NCO recombination products [Psmb9 hotspot. Moreover, the analysis of the distribution of exchange points among CO allowed us to infer initiation activity on each homolog within hybrid strains and thus to reveal a complex regulation of recombination initiation at Psmb9, involving the interaction of elements acting in cis and in trans.Several unique properties of the astaneus ,47. The aplotype . However hotspot . To get products ,14. We ePsmb9 have been obtained by crosses between lines that were all congenic to C57BL/10 (abbreviated as B10). The CO hotspot located near the 3\u2032 end of Psmb9 was identified first in hybrids between a laboratory strain and the strain B10.MOL-SGR(wm7H-2) (abbreviated as SGR). This strain contains a fragment of Chromosome 17 covering the MHC derived from a wild mouse M. m. molossinus (wm7 haplotype). The wm7 fragment covers an interval including H-2K and H-2D in the MHC, but its extent outside this 300-kb region had not been determined [wm7 fragment. It extends well beyond the MHC, covering approximately the proximal half of Chromosome 17 (D17Mit164 (4.1 cM), the closest marker to the centromere analyzed, and D17Mit35 (23.50 cM), respectively.The hybrids used here for analyzing recombination at termined ,48. We uosome 17 . The moswm7 haplotype described above. R209 is a recombinant line issued from a CO between SGR and B10.A at the Psmb9 hotspot [Psmb9 hotspot is identical to that of SGR, while the distal side is identical to that of B10.A. The breakpoint occurred at the center of the hotspot, between markers 38 and 70 ; second, the high CO activity is specific to female meiosis in hybrids with SGR, but present in both sexes in hybrids with R209.The lines used for the various crosses analyzed in the present study were B10, B10.A, SGR, and B10.A(R209) (abbreviated as R209), which differed from each other by their MHC haplotype A. B10.A  hotspot . The int8 and 70 B. ThereaPsmb9 hotspot activity in both male and female meioses in these various hybrids, we measured CO by direct detection of recombinant molecules in sperm and ovaries. In addition, we set to determine whether the variation in CO rates is specific to the CO pathway or not, by measuring the frequency of NCO products as well. Our previous analyses allowed us to determine the interval where most CO occurred and to define the region of initiation where high frequencies of NCO could be detected [To get precise evaluation and comparison of the detected ,14.5 sperm in a hybrid without the wm7 haplotype (B10 \u00d7 B10.A), demonstrating that the rate of CO in the 3-kb interval covered by our assay is lower than the genome average of 0.5 cM/Mb  and thuBsrFI polymorphic site, located close to the center of the hotspot, in most hybrids or at a nearby marker (marker 38) in the B10 \u00d7 B10.A hybrid, which is homozygous at BsrFI  displayed a 2- to 5-fold lower exchange density than the surrounding intervals , each of them following the overall distribution of CO .The numerous recombinant products recovered by our method allowed us to do a fine-scale analysis of the distributions of CO between male and female in the B10.A \u00d7 SGR hybrid, which has the highest density of polymorphisms around the center of the hotspot . The curPsmb9 hotspot. First, the presence of a wm7-specific element induces recombination initiation at the Psmb9 hotspot in cis and in trans, both on the wm7 chromosome and on its non-wm7 homolog  and 16 human hotspots evidenced a moderate variation in CO frequencies, up to 76-fold, but there is only one documented example of a mammalian CO hotspot that is active in some individuals and inactive in others [Psmb9 hotspot induced by the presence of the wm7 haplotype is by far the largest genetically controlled variation at a mammalian hotspot to date  or a limited number of loci. There is no global genome-wide or even chromosome-wide increase of CO, as evidenced by the normal number of Mlh1 foci on pachytene spermatocytes . Only little differences outside the Psmb9 hotspot have been found by pedigree analysis of the whole MHC between the hybrids that carry the wm7 haplotype and the ones that do not [Psmb9 .The i et al. . By prodt do not . MoreovePsmb9 hotspot) suggests that a specific interaction, either direct or indirect, between the recombination activator and the locus of the hotspot is involved. Several hypotheses could be proposed. One is that the activator is a gene, coding for a factor interacting with the Psmb9 hotspot. There are several examples in which factors, such as transcription or chromatin-modifying factors, are required for detectable levels of recombination initiation at specific yeast hotspots  and the hotspot. Cases of long-distance locus-to-locus associations have already been reported, such as between Igf2/H19 and Wsb1/Nf1, or between the H enhancer and one olfactory receptor gene promoter in olfactory sensory neurons [The finding of a haplotype-specific element activating recombination at a specific locus raises the question of what is the mechanism involved in this process. The size of the recombination activating element is not known. The specificity of the target . An  neurons ,53.cis-acting repressing element is present on the SGR chromosome. One could note that the repression of initiation was identical whether the SGR chromosome has been transmitted to the hybrid by its mother or father, eliminating the hypothesis that this cis-effect results from a mark dependent upon the sex of the parent having transmitted the chromosome (unpublished data). The element at the origin of the repression of recombination initiation on the SGR chromosome should be located in the interval differing between SGR and R209, which includes the marker 70 at the center of the hotspot and extends up to at least D17Mit35, 11 Mb centromere distal to Psmb9,  where a particular allele for a single SNP located at the hotspot center correlates with the repression in cis of recombination initiation [A gene conversion bias favoring the alleles from the SGR chromosome is observed for both NCO and CO products . This coo Psmb9, . The twoitiation , are intitiation ,32.Psmb9 hotspot, evaluated by pedigree analysis, has been reported previously to be female specific in hybrids carrying the SGR chromosome [trans. Like the cis effect described above, this SGR-specific regulation could be due to markers 70 and/or 87 or other SGR-specific elements in the interval from marker 70 to D17Mit35. The lowering of recombination rate in males could result either from an effect on the level of initiation or on the processing of recombination intermediates. Two types of sex-specific mechanisms could be invoked, either related to the presence of a diffusible factor or to a specific interaction between homologs. Consistent with the last hypothesis, interactions in trans between homologous chromosomes have been shown to modulate the frequency of recombination at S. cerevisiae hotspots [Eb hotspot showed that the rate of CO resulting from initiation on the chromosome of a particular haplotype (haplotype s) is modified depending on the haplotype of the homologous chromosome [cis of recombination initiated on the SGR chromosome, described above.The activity of the romosome . Our morhotspots ,55. Perhromosome . WhateveIn addition to the determinants controlling the rate of recombination, strain- and sex-specific differences have also been detected in the distribution of recombination products along the sequence of the hotspot.Psmb9 hotspot in B10 \u00d7 R209 is similar to the other mouse and human hotspots that have been characterized so far. In particular, the CO density peaks at the center of the hotspot and decreases progressively on both sides over a few hundreds bases [BsrFI-StyI interval  than at BsrFI and StyI, suggesting that most of the initiation occurs inside this interval . Therefore, the observation that most CO exchanges points are outside the BsrFI-StyI interval suggests that the gene conversion tracts associated with CO are bidirectional, extending on both sides of the initiating DSBs with a minimal length of about 300 bp overall. We found that two types of hypotheses  could explain this difference between the B10.A \u00d7 SGR and B10 \u00d7 R209 hybrids. With the first hypothesis, initiating DSBs would be distributed on a shorter interval in B10.A \u00d7 SGR than in B10 \u00d7 R209. Alternatively, a difference in the processing of recombination intermediates might result in longer gene conversion tracts in B10.A \u00d7 SGR than in B10 \u00d7 R209. This could be due to a higher density of heterozygosity near the initiation site. A similar situation has been observed in one individual at the human DPA1 hotspot, where the density of CO breakpoint was lower at the center of the hotspot, in an interval with a particularly high density of heterozygous SNPs, than in the neighboring intervals on both sides . The putative repressive alleles (from the SGR chromosome) represent the derived state of these two markers, which is consistent with the idea that the spreading of such repressing alleles in a population is favored in the presence of the active hotspot . Interestingly, at DNA2 and NID1 human hotspots, the repression also occurs specifically on chromosomes carrying the derived allele for a SNP located at the center of the hotspot [The regulation of recombination at the sequence . Second, hotspot .Our data and other studies on recombination hotspots thus reveal the various levels of hotspot control that could be either DNA sequence dependent or not and that are able to act locally or at distance. These controls are indeed consistent with the observation that a communication has to operate somehow along each chromosome arm to produce, among other things, at least one CO per chromosome arm. Given the current explosion of hotspots identified in mammals , understhttp://www.criver.com), B10.A , and B10.MOL-SGR and B10.A(R209) . B10.MOL-SGR was established by repeated backcrosses (13 generations) to the C57BL/10J background [The mouse lines used in this study were C57BL/10JCrl  by examining if the value of 0 was enclosed in the interval made by the estimate of the difference plus or minus 1.96 standard deviation . When thCO were detected either by a direct selection involving two rounds of allele-specific PCR or by the assay of parallel detection of CO and NCO described in . The CO:p > 0.1), with the exception of B10 \u00d7 SGR females, for which DNA extracts from three litters gave CO frequencies of 0.6 \u00b1 0.2%, 1.1 \u00b1 0.6%, and 1.6 \u00b1 0.8%, the two extreme values being significantly different from each other (0.02 < p < 0.05). Nevertheless, all three CO frequencies were significantly higher than the male CO frequency when analyzed separately and were pooled for generating the data presented in this study.For every hybrid, DNA extracts from at least two mice  or two litters  have been analyzed independently, with the exception of B10 \u00d7 SGR males for which only one individual has been analyzed. CO frequencies measured in different individuals of identical genotype were not significantly different . The PCR cycling conditions were 94 \u00b0C for 10 s, 55 \u00b0C for 30 s, and 72 \u00b0C for 30 s for 36 cycles.The sequences of the primers used for mapping the markers listed in the Figure S1(174 KB PDF)Click here for additional data file.Figure S2(45 KB PDF)Click here for additional data file.Table S1(52 KB DOC)Click here for additional data file.Table S2(60 KB DOC)Click here for additional data file.Table S3(72 KB DOC)Click here for additional data file."}
+{"text": "Arabidopsis were compared by using a 400,000 feature exon-specific oligonucleotide array. Around 16,000 single feature polymorphisms (SFPs) were detected in ~8,000 of the ~26,000 genes represented on the array. Allelic variation at these loci was measured in a recombinant inbred line population, which defined the location of 815 recombination breakpoints. The genetic linkage map had a total length of 422.5 cM, with 676 informative SFP markers representing intervals of ~0.6 cM. One hundred fifteen single gene intervals were identified. Recombination rate, SFP distribution, and segregation in this population are not uniform. Many genomic regions show a clustering of recombination events including significant hot spots. The precise haplotype structure of the recombinant population was defined with unprecedented accuracy and resolution. The resulting linkage map allows further refinement of the hundreds of quantitative trait loci identified in this well-studied population. Highly variable recombination rates along each chromosome and extensive segregation distortion were observed in the population.Recombinant populations were the basis for Mendel's first genetic experiments and continue to be key to the study of genes, heredity, and genetic variation today. Genotyping several hundred thousand loci in a single assay by hybridizing genomic DNA to oligonucleotide arrays provides a powerful technique to improve precision linkage mapping. The genotypes of two accessions of  Arabidopsis strains was hybridized to arrays representing nearly the entire coding region of the genome. Differences in hybridization intensity indicated differences in DNA sequence. The sequence differences, termed single feature polymorphisms, were then assayed in a population of 100 plants derived through inbreeding the progeny from the two parental strains. The precise location of the genetic recombination breakpoints was defined for each line. As a result, Singer et al. were able to generate one of the first very high-resolution genotyping data sets in a multicellular organism that allowed the construction of a high-resolution genetic map of Arabidopsis. This map will greatly facilitate attempts to make definitive associations between genotypes and phenotypes.A goal of many genetic studies is to discover the underlying genetic condition (the genotype) of a specific physical manifestation in an organism (the phenotype), such as diabetes in humans or leaf rust in cultivated wheat. A limitation to making such discoveries is the ability to resolve genotype. Gene arrays carry representations of the genome, called features, at high-density on a surface the size of a thumbnail. In this study, microarrays designed to measure gene expression were used to detect DNA sequence polymorphisms. DNA from two different  Plasmodium [Anopheles [Arabidopsis [A key discovery of classical genetics was the observation that some phenotypes do not segregate independently and are thus physically linked, making it possible to map a gene to a location on a chromosome. In an organism with an annotated genome sequence, linkage analysis goes beyond associating traits and discrete molecular markers: the molecular markers and traits co-segregate with known and characterized genomic regions. Linkage mapping resolution, that is, the size of the region confidently associated with a trait, is a function of marker density, recombination rate, and the proportion of the phenotypic variation due to genetic factors. An increase in any one of these factors can improve resolution. Technological advances have made it possible to genotype several hundred thousand loci in a single assay by hybridizing DNA to a high-density oligonucleotide array. This approach has been reported in yeast , Plasmodasmodium , Anophelnopheles , human [nopheles , and Arabidopsis . The undbidopsis . When inArabidopsis accession Landsberg erecta (Ler) and the reference strain Columbia (Col), ~4,000 SFPs were identified at a 5% false discovery rate (FDR) by using an Arabidopsis genome array that consisted of ~8,300 probe sets corresponding to ~7,000 genes [er, Kas-1, Lz-0, Bur-0, and Nd-1) and Col [2s are assayed collectively [In a comparison between the  and Col \u20139. Genotectively . BecauseArabidopsis lines should be nearly homozygous (99.2%) [Arabidopsis accessions Col and Ler followed by eight generations of inbreeding [http://arabidopsis.info/new_ri_map.html) and was constructed by placing new markers into existing framework markers by linkage analysis. This marker set is limited by more than 5% missing genotypes for over 80% of all available markers . These include, for example, all SNP markers that were scored in 68 of the 100 RILs [A lasting and far-reaching approach is to genotype independently each individual in a segregating population, preferably comprised of fixed recombinants such as RILs, which are derived from successive generation of self-pollination of progeny derived from a cross between two inbred lines. After eight generations of inbreeding,  (99.2%) . Thus, e (99.2%) . One sucbreeding . In addibreeding ,14, cleabreeding ,16, simpbreeding , amplifibreeding ,19, and breeding . The genbreeding  resulted100 RILs . In addier. These enabled us to measure variation of gene copy number and the distribution and density of SFPs across the genome. We subsequently identified 815 recombination breakpoints by genotyping 100 Col/Ler RILs. Further, we defined the exact location of the genes that border each genetic interval. Because SFP marker density greatly exceeds the number of recombination events in this population, only the number of recombination breakpoints, rather than marker density or genotyping information, limits the resolution of the resulting linkage map. The detailed information derived from the high-resolution genotyping of the recombinant population enabled the characterization of recombination hot spots and measurement of widespread segregation distortion.The aim of this study was to generate a high-density genetic linkage map and describe phenomena such as frequency and distribution of recombination that influence mapping as a gene discovery tool. We first used an exon-specific whole-genome array to identify a large number of significant SFP markers between the parental accessions Col and Ler as significant differences in hybridization intensity of genomic DNA to oligonucleotide arrays. Depending on the significance threshold, we identified 20,450 SFPs (FDR = 0.05) corresponding to 7,920 genes , 4 , and 5 (Resistance to Pseudomonas syringae cluster) [er transcript appeared not to hybridize, suggesting that the entire gene is not present in the Ler accession  . Often tccession . This coer [Next, we genotyped 100 RILs derived from a cross between Col and Ler  by arrayAmong the 98 RILs, we identified 31 lines with the greatest number of breakpoints over the five chromosomes. Therefore, these lines should be the most informative for mapping purposes  for which a breakpoint could be mapped within a single gene, ranging from one to four events per line. Therefore, intragenic recombination seems to occur frequently. Moreover, we observed seven instances where recombination occurred within the same gene in independent RILs. For example, a three-exon glycosyl hydrolase gene recombined in four different RILs  and a 13-exon metallo-\u03b2-lactamase gene recombined in three different RILs . Interestingly, in all instances the same pair of probes defined the recombination breakpoints. Although the exact location of the recombination event is not known, one explanation of this phenomenon is that RIL lines were not derived independently, i.e., one FSince there were many more SFPs than breakpoints in the population, recombination was not observed between most of the markers. While markers that co-segregate without exception have different physical positions in the genome, they are genetically redundant. To create a minimal set of informative mapping markers, the RILs were divided into intervals of markers exhibiting the same genotype pattern across the 98 lines. An interval was defined as the smallest region flanked by two recombination breakpoints across 98 RILs with the exception of the terminal intervals, which were adjacent to telomeres. An SFP marker in the middle of each interval was selected as a proxy and declared an informative marker. In total, 676 informative markers were identified . The phyer RILs can be found in We calculated recombination frequencies based on breakpoint locations and used the genotype information of each informative marker as input into MAPMAKER/Exp software  to buildTo assess the resolution of our SFP-based linkage map we compared it to a linkage map derived from publicly available marker data. Of 1,357 available markers total, 242 loci were amenable for linkage mapping after elimination of markers with more than 5% missing genotype information. The final map length was 397.1 cM, with an average map resolution of 1.67 cM and a maximum distance of 12.3 cM between two markers. The estimated number of breakpoints using this marker set was 1,025, compared to 815 breakpoints in the SFP-based marker map.Arabidopsis chromosomes, we compared the genetic distances between adjacent map intervals with their physical distances. The recombination rate was visualized by plotting the genetic distances between neighboring SFP markers versus the average physical distance for each map unit (p \u2264 0.001) indicating the existence of recombination hot spots. Six to eight significant hot spots were found on each chromosome  with the lowest recombination rates at the centromeres. Occasionally, other smaller regions along all five chromosomes exhibited depressed recombination rates as well. The largest section with the lowest recombination rate was in a region that comprises the heterochromatic knob [p-values \u2264 7.95 \u00d7 10\u221222).We calculated the average recombination rate for each chromosome from the slope of linear regression through the plot of the cM distance of each marker versus its physical position on the chromosome \u2013S11. Fortic knob  and the er alleles in the RILs. Based on genotype distribution of informative SFP markers in 98 RILs, we found significant aberrations from the expected segregation ratio of 1:1 for all chromosomes except for Chromosome 3 for which no significant segregation distortion was apparent . The genetic interval at this marker with the most significant test statistic contains only a single gene, coding for a cytosolic glutamine synthetase. This gene  contains an SFP as well.Next, we tested the fit of the expected equal segregation ratio of Col and Lapparent . The loner to the AtGenome1 Affymetrix array with features corresponding to ~7,000 genes [er by increasing the number of replicates and features on the array. We used an Arabidopsis whole genome array designed to detect ~26,000 distinct transcripts that represent ~10 Mb of sequence. Having identified ~16,000 (FDR = 0.01) and ~20,500 (FDR = 0.05) SFPs, this approach detected approximately 5-fold more SFPs than a preceding study. Approximately one-third of all genes harbor an SFP with one occurring every 0.5\u20130.6 kb of exon sequence. Using another method to detect SNPs between Col and Ler, a polymorphism rate of one SNP per 1,000 kb was reported [Arabidopsis accessions [Hybridizing DNA to a high-density oligonucleotide array can reliably detect copious DNA sequence polymorphisms. The number of SFPs detected with this approach is in part a function of the number of loci measured, corresponding to oligonucleotide array features. Approximately 4,000 SFPs were detected by hybridizing triplicate samples of Col and L00 genes . In thiscessions . These rArabidopsis, potato, barley, soybean, and maize [The distribution of SFPs along the chromosomes was not uniform with SFP density greatest near the centromeres, a phenomenon reported for amplified fragment length polymorphisms in nd maize ,26\u201329. Pnd maize . Thus, aer RIL population, only six have complete genotyping data and less than 20% were successfully genotyped in greater than 95% of the RILs. In our study the array features used to detect SFPs were derived from exon sequences and the exact genomic location of each marker is unambiguous. We array-genotyped all 100 individuals of the Col/Ler RIL mapping population for all ~16,000 significant SFP markers. We were able to reliably predict recombination breakpoints with an established statistical method that is routinely employed to detect changes in econometrics and stock market trends [2 population. Based on the breakpoint locations, we defined genetic intervals in which no recombination occurred across all 98 RILs. Only ~4% of the ~16,000 SFP markers were required to identify a representative informative marker for each interval. Thus, the genetic resolution of our map is limited only by the number of recombination breakpoints in the Col/Ler RILs population and not by the availability of markers. Even though resolution of this map is limited due to lack of introgression and population size, still 115 intervals harboring only a single were identified.Linkage mapping accuracy is in part dependent of genotyping accuracy. Genotyping errors lead to ambiguous marker locations and paucity of markers diminishes trait-mapping accuracy. Both, ambiguous markers and reduced mapping accuracy complicate candidate gene discovery. Of the 1,357 markers scored in the Col/Lt trends . It is aer our data usually was in perfect agreement with the public dataset . Also, there is complete agreement of the segregation distortion measured by Lister and Dean [To estimate the increase in resolution, we compared our linkage map with a linkage map we derived from the existing public marker set. Using stringent selection criteria for marker inclusion from the public set, we expected to find fewer breakpoints than with the SFPs. Surprisingly, the number of breakpoints estimated using the public marker set exceeded the number of breakpoints using SFPs by more than 200. This discrepancy is either due to genotyping errors or missing genotype data in the existing public dataset, erroneously inflating the recombination breakpoint estimate. On the other hand it also possible that we may have overlooked small intervals created by double crossovers. An alignment of marker genotypes of the public dataset with our SFP-marker genotype data is difficult, since for many of the public markers (e.g. restriction fragment length polymorphisms) the exact physical position is not known. In cases where we genotyped one entire chromosome to be either Col or Land Dean  with relThe total length of our SFP-based linkage map (422.5 cM) is considerably longer than that of the map derived from the previously published markers (397.1 cM), consistent with the observation that map length should increase with increasing marker density ,32. Alther RIL population was 285 kb/cM (3.5 cM/Mb). This is within the range of earlier reports estimating an average recombination rate of 221 kb/cM [Drosophila (2.9 cM/Mb) [One global measure of recombination rate is the relationship between physical distance and genetic distance. Our estimate of the genome-wide average recombination rate in the Col/L21 kb/cM  and 208 21 kb/cM . Compare21 kb/cM , 5-fold 21 kb/cM , 3-fold 21 kb/cM , and 1.29 cM/Mb) .bronze locus was 40\u201380-fold greater than the genome average [er genomic sequence is not completely known, variation in local recombination rates may also be due to large insertions/deletions in Ler. With a few exceptions at the telomeres, our estimates of local recombination rates are generally in good agreement with the localized recombination patterns described in Arabidopsis [Arabidopsis centromeres are recombinationally suppressed due to heavily methylated heterochromatin [Arabidopsis [We found a high variability of recombination rates along the chromosomes ranging from as low as ~2\u20133 Mb/cM (~0.3\u20130.5 cM/Mb) at centromeric regions to peaks of ~4\u201310 kb/cM (100\u2013250 kb/Mb) indicating recombination hot spots. The maximum local recombination rates were ~30\u201370-fold greater than the genome average. A similar phenomenon was reported in maize where recombination frequency at the  average . Non-uni average \u201341. Sincbidopsis ,34. Not hromatin ,42. We abidopsis , and humbidopsis .In mammals several recent studies suggest that haplotype blocks are largely defined by recombination hot spots and that those hot spots are clustered in small regions of 1\u20132 kb ,45,46. WArabidopsis [Except for Chromosome 3, segregation distortion for several Mb stretches was prevalent. Genetic elements that distort Mendelian segregation to enhance their own transmission  are thought to be a potent evolutionary force . Similarbidopsis ,13,18, bDrosophila, C. elegans, humans, mice, and plants [Arabidopsis, which is highly inbred [Arabidopsis can be explained by background selection eliminating unconditionally deleterious mutations [Another phenomenon that appears to be related to recombination is the positive correlation between recombination rate and nucleotide variability, also observed in this study and for d plants ,53\u201362. Td plants . While td plants  it is pry inbred . More liutations ,64,65 rautations ,67.er) RILs (eight generations of inbreeding) [Arabidopsis Biological Resource Center (ABRC) at the Ohio State University, Columbus, Ohio, United States. The accessions used in this study correspond to the first set of 100 RILs (CS1899), the parental lines were Columbia  and Landsberg erecta . Eight plants for each RIL were grown in one pot under long-day conditions  and pooled for analysis.Seeds of the Columbia/Landsberg (Col/Lreeding)  and the er (CS20) were conducted, respectively. For RILs 1 (CS1900) to 57 (CS1957) a single replicate was available, with exception of line 6 (CS1906) which was triplicated. RILs 58 (CS1958) to 100 (CS4686) were duplicated, except line 73 (CS1973) was triplicated, and lines 83 (CS1983), 84 (CS1984), and 89 (CS1989) were quadruplicated. Probe intensity values for replicate microarrays of RILs were averaged for genotyping. DNA was labeled by random priming with biotin14-dCTP . Hybridization, washing, staining, and scanning was carried out using the standard Affymetrix Eukaryotic protocol. GeneChip Suite 4.0  was used for image acquisition.Total genomic DNA was isolated from leaf tissue with the DNeasy Plant Mini Kit  according to the manufacturer's instructions. Four and six biological replicates of Col (CS933) and LArabidopsis GeneChip\u00ae array was designed by Torrey Mesa Research Institute and manufactured by Affymetrix, based on The Institute of Genomic Research  release of the Arabidopsis whole genome sequence, version 1.0, April, 2001. The 25-mer oligonucleotides on the GeneChip\u00ae array were designed to correspond to annotated exon sequences and were selected as perfect match probes. No mismatch oligonucleotides were incorporated in the array. Each annotated gene was represented by ~15 probes , totaling 403,108 features (18-\u03bcm feature size) on the array. Analyses were performed using CEL files generated by Affymetrix GeneChip\u00ae Suite 4.0 software. Arrays were background-corrected similar to the method described in the White Paper, \u201cStatistical Algorithms Description Document\u201d by Affymetrix (2002) . The probe intensity values were log-transformed and normalized to a mean of zero and standard deviation of one for each microarray. Prior to analysis, the custom array was re-annotated based on the TIGR genome release version 3.0, April 2003. After background correction and normalization 370,403 features, representing 26,136 genes were left for further analysis.A custom Arabidopsis genome sequence, release 3.0. Features with more than one perfect match or a second match with an e-value less than 0.05 were discarded, as were probes that overlapped by more than 21 bp, leaving 331,031 unique single locus features. To identify SFPs with significantly higher hybridization signal in Col than in Ler we calculated a FDR employing a permutation-based, non-symmetrical t-test statistic.To identify features that correspond to only a single genomic locus, the sequences of all features on the microarray were BLAST-searched against the TIGR n = 12,987) with a 0.01 FDR along with the added criteria that Col hybridization was above background were considered. From the parental array replicates we obtained two t-distributions for each genotype (Col or Ler). We defined Pr(Col) + Pr(Ler) = 1. Using the data on the parental lines, we calculated Pr(y | Col) and Pr(y | Ler). Using a 1:1 prior on Col:Ler, we calculated Pr(Col | y) = Pr(y | Col) / {Pr(y | Col) + Pr(y | Ler)}. A ratio of 1.0 was defined as Col genotype, a value of 0.0 was defined as Ler genotype, and for a value of 0.5, no genotype could be defined.To assign a parental allele genotype for each SFP in each RIL, only SFPs . We treated the remaining parental arrays as a test set with unknown genotypes. We assessed the accuracy of our genotyping method by comparing the predicted genotypes in the test-set to the known genotypes in the reference set. We replicated this procedure for all possible permutations of arrays. The accuracy of the predictions was slightly less than perfect (Col = 97% and Ler = 98%).Using either three Col or three Ler genotype, a process we termed \u2018SFP-calling.'Locations of recombination breakpoints were estimated based on the ratio of hybridization intensities derived from RIL genotyping B. SFPs wTo construct the genetic linkage map, MAPMAKER/EXP version 3.0  was modiFigure S1er and were therefore discarded.The values of the observed t-statistics (solid line) corresponding to 331,031 unique features are plotted against the expected \u201cnull\u201d distribution (dotted line) obtained after 210 permutations. The dashed lines represent the 1% FDR threshold. Every feature with a value above the cutoff was recorded as a highly significant SFP. Features scoring below the cutoff had similar or greater hybridization intensities in L(171 KB PDF)Click here for additional data file.Figure S2p-value was calculated and a Bonferroni multiple testing correction was applied to test for significance. Blue diamonds indicate windows with significantly higher SFP density . Position of centromeres are marked as black bars.The chromosomes were divided into 50-kb windows. Red triangles represent number of features per window. The number of SFPs per feature in each window was compared to the number of SFPs per feature in all windows using Fisher's exact test. A (2.0 MB PDF)Click here for additional data file.Figure S3er RIL population. The lines are arranged by CS number. SFP markers for each chromosome are plotted horizontally. Red indicates stretches of Col allele SFPs, green indicates the Ler genotype. The duplicated lines CS1935 and CS1936 are marked with black triangles and the duplicated lines CS1983 and CS1988 are marked with black stars.Each column represents a single accession from the Col/L(A) Genotyping results based on the computed likelihood ratio before SFP-calling and breakpoint determination. Black lines indicate features where parental allele could not be determined. Red lines in stretches of green and green lines in stretches of red indicate possible genotyping errors, recombination events that were not deemed significant or gene conversion events.(B) Genotyping results after SFP-calling and breakpoint prediction.(1.9 MB PDF)Click here for additional data file.Figure S4er RIL population. The lines are arranged by CS number. SFP markers for each chromosome are plotted horizontally. Red indicates stretches of Col allele SFPs, green indicates the Ler genotype. The duplicated lines CS1935 and CS1936 are marked with black triangles and the duplicated lines CS1983 and CS1988 are marked with black stars.Each column represents a single accession from the Col/L(A) Genotyping results based on the computed likelihood ratio before SFP-calling and breakpoint determination. Black lines indicate features where parental allele could not be determined. Red lines in stretches of green and green lines in stretches of red indicate possible genotyping errors, recombination events that were not deemed significant or gene conversion events.(B) Genotyping results after SFP-calling and breakpoint prediction.(1.0 MB PDF)Click here for additional data file.Figure S5er RIL population. The lines are arranged by CS number. SFP markers for each chromosome are plotted horizontally. Red indicates stretches of Col allele SFPs, green indicates the Ler genotype. The duplicated lines CS1935 and CS1936 are marked with black triangles and the duplicated lines CS1983 and CS1988 are marked with black stars.Each column represents a single accession from the Col/L(A) Genotyping results based on the computed likelihood ratio before SFP-calling and breakpoint determination. Black lines indicate features where parental allele could not be determined. Red lines in stretches of green and green lines in stretches of red indicate possible genotyping errors, recombination events that were not deemed significant or gene conversion events.(B) Genotyping results after SFP-calling and breakpoint prediction.(1.2 MB PDF)Click here for additional data file.Figure S6er RIL population. The lines are arranged by CS number. SFP markers for each chromosome are plotted horizontally. Red indicates stretches of Col allele SFPs, green indicates the Ler genotype. The duplicated lines CS1935 and CS1936 are marked with black triangles and the duplicated lines CS1983 and CS1988 are marked with black stars.Each column represents a single accession from the Col/L(A) Genotyping results based on the computed likelihood ratio before SFP-calling and breakpoint determination. Black lines indicate features where parental allele could not be determined. Red lines in stretches of green and green lines in stretches of red indicate possible genotyping errors, recombination events that were not deemed significant or gene conversion events.(B) Genotyping results after SFP-calling and breakpoint prediction.(3.0 MB PDF)Click here for additional data file.Figure S7er RIL population. The lines are arranged by CS number. SFP markers for each chromosome are plotted horizontally. Red indicates stretches of Col allele SFPs, green indicates the Ler genotype. The duplicated lines CS1935 and CS1936 are marked with black triangles and the duplicated lines CS1983 and CS1988 are marked with black stars.Each column represents a single accession from the Col/L(A) Genotyping results based on the computed likelihood ratio before SFP-calling and breakpoint determination. Black lines indicate features where parental allele could not be determined. Red lines in stretches of green and green lines in stretches of red indicate possible genotyping errors, recombination events that were not deemed significant or gene conversion events.(B) Genotyping results after SFP-calling and breakpoint prediction.(3.2 MB PDF)Click here for additional data file.Figure S8http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=3702).Horizontal bars next to each chromosome represent informative SFP markers used to construct the genetic linkage map. The position of the first and last SFP marker on each chromosome and their respective genome position on each chromosome are noted. Centromeres are depicted as thick black lines. Total chromosome length is shown below each chromosome. Due to high marker density in some parts of the genome not all markers can be resolved in this view. Schematic chromosome view was adapted from NCBI ((151 KB PDF)Click here for additional data file.Figure S9(A) Recombination rates were calculated as the genetic distance (in cM/50 kb) between pairs of neighboring informative SFP markers and plotted versus the average physical distance between the same markers. The average genome-wide recombination rate is marked as a dotted line.(B) Recombination variation visualized as a function of the cumulative genetic distance between adjacent informative SFP markers (in cM) versus the cumulative physical distance between the same markers. A regression line was fit to the data to determine the recombination rate for each chromosome. The location of the centromeres on each chromosome are marked with a black bar.(308 KB PDF)Click here for additional data file.Figure S10(A) Recombination rates were calculated as the genetic distance (in cM/50 kb) between pairs of neighboring informative SFP markers and plotted versus the average physical distance between the same markers. The average genome-wide recombination rate is marked as a dotted line.(B) Recombination variation visualized as a function of the cumulative genetic distance between adjacent informative SFP markers (in cM) versus the cumulative physical distance between the same markers. A regression line was fit to the data to determine the recombination rate for each chromosome. The location of the centromeres on each chromosome are marked with a black bar.(1.5 MB PDF)Click here for additional data file.Figure S11(A) Recombination rates were calculated as the genetic distance (in cM/50 kb) between pairs of neighboring informative SFP markers and plotted versus the average physical distance between the same markers. The average genome-wide recombination rate is marked as a dotted line.(B) Recombination variation visualized as a function of the cumulative genetic distance between adjacent informative SFP markers (in cM) versus the cumulative physical distance between the same markers. A regression line was fit to the data to determine the recombination rate for each chromosome. The location of the centromeres on each chromosome are marked with a black bar.(1.8 MB PDF)Click here for additional data file.Figure S12er alles accross 98 lines should result in a ratio of 1 and is depicted as a dotted horizontal line. SFP markers with allele ratios above the line indicate segregation distortion towards the Col allele, SFP markers with allele ratios below the line indicate segregation distortion towards the Ler allele. Empty diamonds represent SFP markers with no significant segregation distortion from the expected ratio of 1 between Col and Ler genotypes. Filled triangles represent markers that show a significant  segregation distortion towards the Col genotype.Segregation ratios of genotypes for each informative SFP marker were calculated across 98 RILs and plotted along the chromosome. The vertical scale shows allele ratios. The expected equal distribution of Col and L(2.8 MB PDF)Click here for additional data file.Table S1(1.4 MB TXT)Click here for additional data file.Table S2(1.1 MB TXT)Click here for additional data file.Table S3(228 KB DOC)Click here for additional data file.Table S4(30 KB DOC)Click here for additional data file.Table S5(1.3 MB DOC)Click here for additional data file.Table S6(199 KB TXT)Click here for additional data file.Table S7(384 KB DOC)Click here for additional data file.Table S8(40 KB DOC)Click here for additional data file.Table S9(1.5 MB DOC)Click here for additional data file.Table S10(35 KB DOC)Click here for additional data file.http://www.ncbi.nlm.nih.gov) identifiers for the genes and gene products discussed in this study include glycosyl hydrolase , metallo-\u03b2-lactamase , and cytosolic glutamine synthetase . Microarray data (.CEL files) have been deposited with ArrayExpress (http://www.ebi.ac.uk/arrayexpress/) under accession number E-TABM-135. The accession number for the array design (.CDF file) is A-AFFY-73.The National Center for Biotechnology Information (NCBI) ("}
+{"text": "Plasmodium falciparum. The parasite's short generation time, coupled with a high cross-over rate, can cause rapid LD break-down. However, observations of low genetic variation have led to suggestions of effective clonality: selfing, population admixture, and selection may preserve LD in populations. Indeed, extensive LD surrounding drug-resistant genes has been observed, indicating that recombination and selection play important roles in shaping recent parasite genome evolution. These studies, however, provide only limited information about haplotype variation at local scales. Here we describe the first (to our knowledge) chromosome-wide SNP haplotype and population recombination maps for a global collection of malaria parasites, including the 3D7 isolate, whose genome has been sequenced previously. The parasites are clustered according to continental origin, but alternative groupings were obtained using SNPs at 37 putative transporter genes that are potentially under selection. Geographic isolation and highly variable multiple infection rates are the major factors affecting haplotype structure. Variation in effective recombination rates is high, both among populations and along the chromosome, with recombination hotspots conserved among populations at chromosome ends. This study supports the feasibility of genome-wide association studies in some parasite populations.Understanding the influences of population structure, selection, and recombination on polymorphism and linkage disequilibrium (LD) is integral to mapping genes contributing to drug resistance or virulence in  Plasmodium falciparum and humans has been a potent selective force in the evolution of both species. The high mortality rate\u2014an estimated 1.1\u20132.7 million people die each year from malaria , where eN is the effective population size, r is the per-generation recombination rate, and f is the inbreeding coefficient; the nonparametric method estimates the minimum number of recombination events (Rh). We cannot separate the effects of e, r,N and f on individual estimate of a sample, but we can show the relationship of f on estimates of the effective population recombination parameter nonetheless. This is because the variation in estimates of recombination rates among populations is due to variation in transmission frequencies and/or f. The parametric methods have been shown to be robust in the context of alternative mutation models and have high power to detect recombination, even with SNP ascertainment bias [A key factor in the success of association studies is the detection of variation in LD and population recombination rates, within and between populations. Here we examined the evidence for variable recombination rates, among populations and along chromosomes, using recently developed parametric  and nonpent bias ,27.5 per Mb in the African populations  alone and in combination with SE Asia . The PNG population has the smallest Rh estimate but a large population recombination rate estimate; however, the rate estimate has a large confidence interval, due in part to the small sample size. When the PNG and SE Asian populations were combined, estimates of the effective population recombination rate  were more similar to SE Asia estimates alone  (see eN(1 \u2212 f) from our population recombination rate estimates  see , estimatstimates . The betation, j . These p, j [FST . We can p < 0.001; American, p < 0.001; PNG, p < 0.05) in all populations except African, for which the high levels of historic recombination invalidated the test. We next examined whether recombination rates were uniform along the chromosome, because variation in recombination rates will dramatically affect the effectiveness of association studies . The majP. falciparum clearly exhibit elevated crossing over, similar to those observed in human males  [P. falciparum populations. Additionally, these regions contain a high density of genes such as var, rifin, and stevor, whose products are implicated in cell-surface interactions [P. falciparum's evasion of host immunity.Although the overall population recombination rate is highly variable among populations, the chromosomal locations of major recombination hotspots were conserved. Subtelomeric regions in females) . The conractions  and are ractions . Increasractions . AlternaPopulation genetic models predict that the extent of LD is inversely proportional to the population recombination rate ,38. As en = 46), whereas the average block size for PNG was 56 kb, with only 11 blocks defined. Again, the relatively large blocks in PNG could be due to a small sample size and/or sampling from a small isolated area or population. Relatively high inbreeding frequency (0.915) [Critical for association studies is the identification of haplotype blocks and the minimal set of haplotype tagging SNPs (htSNPs) required to capture haplotype variation in a population sufficiently, which will reduce cost and effort. Haplotype blocks of various sizes were identified for the four populations B. The Af (0.915)  could alP. falciparum is to facilitate identification of genes responsible for important parasite traits, such as drug resistance and virulence. There is currently tremendous interest in using LD to map human disease genes. The present results suggest that LD mapping may, in some circumstances, be more effective in studying partially selfing species such as P. falciparum than out-crossing species, such as humans or Drosophila, because LD can persist over extensive genomic regions. The overall estimated population recombination rates clearly vary among populations, primarily due to different inbreeding and transmission rates, but the chromosomal locations of major hotspots are conserved. Population structure among sub-Saharan African parasites appears to be minimal because of high estimated recombination rates; however, very high marker densities may be required for mapping even newly arisen traits, because traces of LD between loci will be lost quickly. The presence of chromosomal segments with low population recombination rates in SE Asian and American parasites suggests it is possible to conduct genome-wide association mapping for certain phenotypes in these geographic locations, using relatively low densities of marker loci. This approach is likely to be particularly effective for genes involved in drug resistance, since the mutations involved have occurred recently, allowing little time for LD between marker and trait loci to be broken down. However, as shown in this study, recombination rates are not uniform across the chromosome, and, therefore, the location of the genes of interest will be highly relevant. Studying these hotspots will ultimately illuminate the as yet mysterious factors that direct the location and frequency of recombination in this and other species. The presence of LD in at least some populations, the recent appearance of mutations conferring drug resistances, and the use of high-density genetic maps make it practical to conduct genome-wide association studies in this relatively small genome.A primary objective in studying population recombination rate variation and haplotype maps in http://www.plasmodb.org/). DNA sequences covering SNP sites identified from five isolates in our previous study [http://www.phrap.org/) and Sequencher 3.1  to identify SNPs. All potential SNPs and discrepancies were verified by visually inspecting chromatogram traces.Predicted coding sequences of the 3D7 parasite were downloaded from PlasmoDB .Population structures were analyzed using the Structure 2 package . We ran Arlequin . InferenArlequin  using th(Rh) were calculated using the methodology of Myers and Griffiths [http://www.stats.ox.ac.uk/~mcvean/LDhat/LDhat1.0/LDhat1.0.html). The method extends the composite likelihood approach of Hudson [e,N which is inversely related to the rate of genetic drift, the per-generation rate of recombination, r, and for P. falciparum, the rate of outcrossing, 1 \u2212 f, where f is the inbreeding coefficient [eN in a population, we can only estimate the compound parameter of the recombination rate, 2Ner(1 \u2212 f). Such methods have also been used to develop an \u201ceffective recombination rate\u201d for malaria parasites [f) times faster [N/(1 + f) generations, the coalescence process is identical to the standard coalescent. Similarly, ancestral recombination graphs with inbreeding have rates of coalescence that are (1 + f) times faster and rates of recombination that are (1 \u2212 f) times slower than in a completely out-crossing situation [N/(1 + f) generations, the process looks like the out-crossing case but with a recombination rate that is (1 \u2212 f)/(1 + f) times slower than in the out-crossing case. In the case of inbreeding, 4N\u03bc is therefore replaced by 4N\u03bc/(1 + f), and 4Nr by 4Nr(1 \u2212 f).Nonparametric estimates of the number of recombination events riffiths . Model-bf Hudson , to allof Hudson , and adof Hudson . Under sfficient ,21. Witharasites . It has s faster . If timeituation . Again, P. falciparum [The compound population recombination rate parameter can be estimated from population genetic data using coalescent methods adapted specifically to account for the possibility of recurrent or back mutation and for an AT-rich genome such as that of lciparum ,33,40. Blciparum  and withlciparum . BecauseTo test the hypothesis of constant recombination rate in each population, we used coalescent simulations to generate the distribution of a test statistic, T,ijX, of the difference in log likelihood between the marginal maximum likelihood estimate of the recombination parameter \u03c1 and the global maximum likelihood estimate (assuming a constant recombination rate), scaled by the ratio of the physical distance between the sites, ij,d to the total length of the sequence analyzed, L. Coalescent simulations  were carried out as described previously [which is the sum, over all pairs of sites eviously . BecauseA parametric bootstrap was performed to obtain confidence intervals for the rate estimates for each population . Simulat2r and D\u2032 were calculated for all pairs of sites, and significance was assessed by randomizing the positions of segregating sites 10,000 times [D\u2032 and r2) for haplotype blocks and htSNP identification, and the major differences in numbers of blocks and htSNPs between populations remained the same regardless: D\u2032 is a measure of LD normalized by the largest LD value at the given allele frequencies, and r2 is the square of correlation coefficient of LD normalized by the variance in allele frequencies at the two loci. Haplotype blocks of various sizes were defined here as genomic regions with D\u2032 greater than or equal to 0.8 [Standard LD estimates 00 times . Plots o00 times . Haploty00 times . We usedl to 0.8 .Figure S1Parasites are color-coded as resistant to chloroquine (red), sensitive (black), or not tested (green).(79 KB PDF).Click here for additional data file.Table S1(29 KB DOC).Click here for additional data file."}
+{"text": "A central problem in understanding bacterial speciation is how clusters of closely related strains emerge and persist in the face of recombination. We use a neutral Fisher\u2013Wright model in which genotypes, defined by the alleles at 140 house-keeping loci, change in each generation by mutation or recombination, and examine conditions in which an initially uniform population gives rise to resolved clusters. Where recombination occurs at equal frequency between all members of the population, we observe a transition between clonal structure and sexual structure as the rate of recombination increases. In the clonal situation, clearly resolved clusters are regularly formed, break up or go extinct. In the sexual situation, the formation of distinct clusters is prevented by the cohesive force of recombination. Where the rate of recombination is a declining log-linear function of the genetic distance between the donor and recipient strain, distinct clusters emerge even with high rates of recombination. These clusters arise in the absence of selection, and have many of the properties of species, with high recombination rates and thus sexual cohesion within clusters and low rates between clusters. Distance-scaled recombination can thus lead to a population splitting into distinct genotypic clusters, a process that mimics sympatric speciation. However, empirical estimates of the relationship between sequence divergence and recombination rate indicate that the decline in recombination is an insufficiently steep function of genetic distance to generate species in nature under neutral drift, and thus that other mechanisms should be invoked to explain speciation in the presence of recombination. Despite the well-documented extent of lateral gene transfer among the prokaryotes (b) is predicated upon the success of multilocus sequence typing (MLST) for both precise strain characterization in the context of epidemiology .In MLST, internal fragments (approx. 500\u200abp) of seven house-keeping genes are sequenced from each strain , with each strain defined as a string of integers corresponding to the alleles at 140 loci (each of 500\u200abp) distributed around the chromosome. In each generation of the model, loci mutate with probability m and recombine with probability r, as previously described (\u03b8 (the population mutation rate), we define the population recombination rate \u03c1=2rN.We simulate populations of constant size , we use the allelic distance between the strain that donates the allele and the recipient strain  as a proxy for the sequence divergence between the strains. The probability of successful recombination in the distance-scaled recombination model declines in a log-linear fashion with increasing divergence between donor and recipient strains, as found to be the case in subtilis b, Escher6, we allow the simulation to run. At intervals, samples of 1000 strains are drawn at random and are used to examine the pattern of genotypic clustering. To display the clustering of genotypes in the samples of the simulated populations (the genetic cartography), we use a multidimensional scaling (MDS) algorithm implemented in R  by mutation (Hanage a). Therefore, we explore the patterns of clustering observed within simulated populations evolving with a fixed population mutation rate (\u03b8=2) and a range of population recombination rates, from \u03c1=0  to 20. In the initial simulations, recombination occurs at the same defined rate between any pair of strains. We then introduce the more plausible scenario of distance-scaled recombination, incorporating the log-linear reduction in recombination rate with increasing divergence between strains.The relative contributions of point mutation and recombination to the divergence of multilocus genotypes differ greatly among bacterial populations . In some5 generations for a clonal population with \u03b8=2. The diversification of the initially uniform population in the absence of recombination leads within about 250\u200a000 generations to distinct clusters of closely related strains. The initial cluster persists, but through stochastic drift it has become extinct by the 800\u200a000th generation. If we introduce recombination at the same rate as mutation , then diversification proceeds as under the totally clonal simulation, with multiple distinct clusters emerging . The probability of recombination occurring between strains with allelic distance D is given by \u03c1=\u03c10exp[\u2212\u03b1D] and the resulting relationship between \u03c1 and allelic distance is shown in figure 4a, corresponding to \u03b1=0.1. As shown in figure 4b , the initially uniform cluster rapidly forms distinct clusters, which then continue to diversify and form new clusters by the same process. Between the similar strains within these distinct clusters, the rate of recombination is high (figure 4a). Between strains in different clusters it is low, owing to the log-linear drop-off of recombination with genetic distance. The integrity of clusters is therefore maintained by frequent recombination. Major new clusters are formed rarely, as stochastic drift infrequently leads to the establishment of new strains that are sufficiently distant from the progenitor cluster that they can no longer be reabsorbed by recombination. The number of such clusters presumably increases monotonically as a function of \u03b8.n of 140 loci is shown for the entire population of 106 (as opposed to samples of 1000). This analysis is unable to detect the minor transient clusters visible in the MDS diagrams, but instead focuses on the major lineages of similar strains. Figure 5a displays the development of the clonal population shown in \u03b8=2, \u03c1=20), clear clusters fail to form, and the resulting population is instead highly diverse and diffuse . The effect of distance-scaled recombination (figure 5c) is clearly visible in the multiple resolved clusters that emerge.While any satisfying definition of bacterial species remains elusive, the present work demonstrates that distinct clusters of similar genotypes can emerge under many parameter values for both mutation and recombination rates. Distinct clusters fail to arise where there are high levels of recombination between strains, with no decline, or a slow decline, in the probability of recombination with increasing genetic distance. In this situation, subclusters appear to arise but become drawn back into the main population, presumably owing to the cohesive effect of recombination. In contrast, where recombination declines sharply with increasing genetic distance, separate clusters arise and then are maintained by distance-scaled recombination\u2014high rates of recombination within each cluster and low rates between different clusters. In this scenario, clusters arise even though rates of recombination between similar isolates are substantially higher than those that prevent clusters from emerging in simulations where recombination rate is not scaled to genetic distance. These distinct clusters are effectively \u2018species\u2019, and the cohesive role of recombination within a cluster, and low rates between clusters, provides an attractive parallel with the biological species concept of r) are determined in terms of sequence divergence (x) and are of the form log(r)=r0\u221218x  clusters observed within a sample of a natural population define clusters that are destined to remain distinct and which should each be given species designation, or are transient and destined to merge back into a single cluster, or are the consequence of inadequate sampling.\u03c1/\u03b8=1 and \u03c1/\u03b8=10 for situations where recombination is not distance-scaled, above which population cohesiveness is maintained and below which clonal clusters emerge, is not dependent on this assumption. Interestingly, Recombination is believed to often involve the replacement of small regions (a few kilobases) of a recipient chromosome with the corresponding region from a donor strain. An important caveat of our simulations is that studies of natural populations, and the general features of RecA-mediated recombination, suggest that the rate of recombination will depend on the local sequence similarities between the donor and recipient strains in the regions involved in the localized genetic exchange. In this work, we assume that recombination is a function of overall genetic distance, measured as the proportion of the 140 alleles that differ between strains. We chose this as our initial approach, as computationally it allows an examination of large populations defined at large numbers of alleles. Further developments of our simulations incorporating local measures of genetic distance will be described elsewhere. Our observation of a recombination threshold, lying between Bacteria exist as diverse populations that can be resolved into clusters which can be assigned to various taxonomic divisions . The study of these populations and their taxonomy can be enhanced by the widespread application of multilocus sequencing approaches, with the prospect of future sequencing technologies making it ever more feasible to sequence hundreds of genes from thousands of strains. Within this context, it is important that we have some theoretical means of describing what we expect to observe in nature, of interpreting what we observe, and of integrating these findings with the biology and ecology of the organisms under study. Future work should address the impact of selection and population subdivision  on the nature and dynamics of genotypic clustering, as well as better models of genetic distance, and it should explicitly attempt to compare the clusters derived from simulation with those observed among natural populations."}
+{"text": "Human recombination rates vary along the chromosomes as well as between the two sexes. There is growing evidence that epigenetic factors may have an important influence on recombination rates, as well as on crossover position. Using both public database analysis and wet-bench approaches, we revisited the relationship between increased rates of meiotic recombination and genome imprinting. We constructed metric linkage disequilibrium (LD) maps for all human chromosomal regions known to contain one or more imprinted genes. We show that imprinted regions contain significantly more LD units (LDU) and have significantly more haplotype blocks of smaller sizes than flanking nonimprinted regions. There is also an excess of hot-spots of recombination at imprinted regions, and this is likely to do with the presence of imprinted genes, per se. These findings indicate that imprinted chromosomal regions are historical \u201chot-spots\u201d of recombination. We also demonstrate, by direct segregation analysis at the 11p15.5 imprinted region, that there is remarkable agreement between sites of meiotic recombination and steps in LD maps. Although the increase in LDU/Megabase at imprinted regions is not associated with any significant enrichment for any particular sequence class, major sequence determinants of recombination rates seem to differ between imprinted and control regions. Interestingly, fine-mapping of recombination events within the most male meiosis\u2013specific recombination hot-spot of Chromosome 11p15.5 indicates that many events may occur within or directly adjacent to regions that are differentially methylated in somatic cells. Taken together, these findings support the involvement of a combination of specific DNA sequences and epigenetic factors as major determinants of hot-spots of recombination at imprinted chromosomal regions. Now that the finished reference sequence of the human genome is available, focus has shifted towards understanding fundamental aspects of its functions. Meiotic recombination between maternal and paternal chromosomes serves an important mechanistic and evolutionary role in the transmission of the genome. Although significant progress has been made towards fine-mapping meiotic recombination events along human chromosomes, the characterization of factors that influence the position and frequency of crossovers remains a challenge. These authors have used data generated by the International HapMap Project as well as experimental analysis of a collection of three-generation Centre d'Etude du Polymorphisme Humain (CEPH) families, to show that chromosomal regions containing imprinted genes  exhibit higher rates of meiotic recombination than nonimprinted chromosomal regions. This characteristic is common for all major human populations. The major sequence determinants of recombination rates are likely to be different at imprinted and nonimprinted regions. Moreover, epigenetic modifications associated with imprinted regions may play an important role in increasing the frequency of meiotic crossovers and determining their position. Taken together these results suggest that a complex series of factors control meiotic recombination in the human. In the human, as well as in other eukaryotes, sites of recombination are not randomly distributed along the chromosomes because of the presence of numerous hot-spots and cold-spots of recombination . Little Igf2 locus in sheep .) This excess of recombination hot-spots seems to be linked with the presence of imprinted genes at these regions. At control regions, we identified 91 hot-spots of recombination associated with one of 361 genes. At imprinted regions, we identified 112 hot-spots of recombination associated with one or several of 415 genes . However, 27 of these hot-spots were located inside the 41 genes known to be transcriptionally imprinted in human and shown on Haploview , suggesting that the difference in the number of hot-spots is due to the presence of imprinted genes, per se.The HapMap Project also provides the location of recombination hot-spots estimated from Phase I HapMap data (release 16a) using the coalescent method described in McVean et al.  and Wincm typing , the len 0.0293) D. .We extended an earlier analysis of meiotic recombination events at the 11p15.5 human imprinted cluster [p < 0.0001, Fisher's exact test). We attempted to fine-map these crossovers using an additional panel of 22 markers  and the second is found in intron 10 of the KCNQ1 gene, at the KCNQ1OT1 promoter .Because differential DNA methylation of maternal and paternal alleles is a characteristic feature of imprinted regions, we attempted to map more precisely the locations of crossovers with respect to differentially methylated regions (DMRs) in the 11p15.5 imprinted clusters. There are a number of well-characterized DMRs in this region \u201323, and IGF2/H19 DMR whereas the KCNQ1OT1 DMR is overlapped by 13 male recombinations and one female recombination. We localized  and rs4930001 , and the second to an 8.7-kb interval between rs4930125  and rs7924887 . Two paternal recombinations overlapped the KCNQ1OT1 DMR when additional SNPs were genotyped; both of these events were located between D11S4088 (position 2.676 Mb) and rs2283202 .Twenty of the 46 or 47 paternal recombinations telomeric to D11S4088 and one of the four or five maternal recombinations overlap one or the other of the two DMRs . Seven mD\u2032 data for all four major populations available in the HapMap Project. We reconstructed LDU maps for these populations over a region of about 1 Mb at human Chromosome 11p15.5 , that contains most of the known imprinted genes in this region (except ZNF215)  A.H19 gene and the other inside the KCNQ1 gene; black arrows in The pattern of plateaus (corresponding to blocks of low haplotype diversity) and steps (regions of high haplotype diversity) observed and the height of each step is thought to reflect the recombination history of the region . Indeed,H19 gene (see \u22128 per site per generation) [4 generations), nearly every variable site in our genome results from a single historical mutational event. This assumption is likely to remain true even for mutational hot-spots such as CpG dinucleotides, in which the frequency of both transitions and transversions is known to be one order of magnitude higher [We also used the collection of CEPH families to genotype ten SNPs in a region of about 30 kb that overlaps the imprinting center located centromeric of the gene see . We theneration)  relativee higher . This loe higher ,29 showsWe attempted to identify genomic characteristics that could account for the LDU/Mb differences between imprinted and control regions. First, we used the CPGPLOT and CPGREPORT programs in EMBOSS  and the We then attempted to determine whether any of these sequence classes could account for LDU differences between imprinted regions and their flanking control regions. We calculated LDU/Mb ratios for each bin and each population, and performed linear regression analysis with each of the DNA features shown in 2\u03c7 tests for each of the six enriched motifs with p < 0.0001). We also analyzed their global distribution at imprinted and control regions after masking for repeats. There is no significant difference between imprinted and corresponding control regions for any of these elements. Further, we performed linear regression analysis between LDU/Mb ratios at each bin and the density of each of these DNA motifs per Mb. After correcting for multiple testing  and for number of haplotype blocks/Mb (2r = 0.4118). There is also a positive correlation for the mean size of haplotype blocks between imprinted and control regions (2r = 0.2797) as well as for the total length of recombination hot-spots per bin (2r = 0.8018). We interpret these findings as an indirect argument that the chromosomal position of any given region is a major determinant for crossover activity and that this might act at a large scale. Specific DNA sequences and possible epigenetic factors are then able to modulate the frequency of meiotic recombination in a given region .One additional point suggested by the comparison of imprinted and control regions in Imprinted chromosomal regions have two unusual characteristics in terms of meiotic recombination: They have unusually high recombination rates compared with their flanking regions, and at least some imprinted regions exhibit heterochiasmy . The reasons for these characteristics are unknown. Although we found significant LDU differences between bins containing imprinted genes and flanking control bins of equal size, there was no significant enrichment or depletion of any sequence class. We note that we could not explain the higher LDU/Mb ratios at imprinted versus control regions by an increase in gene density in imprinted regions, suggesting that there is no correlation between transcription and meiotic recombination at these regions as seen in other organisms \u201339. Howe1 hybrids constructed between inbred strains (http://www.informatics.jax.org) despite the presence of identical DNA sequence between the two sexes.GC content is the only sequence feature that is correlated positively with LDU/Mb ratios in control regions after correcting for multiple testing. This is in agreement with previous observations that high GC content is a predictor of LD breakdown and implies an association with intense meiotic recombination ,20,31\u201334Little is known about what factors are associated with hot-spots of recombination. For at least a subset of hot-spots, the underlying DNA sequence does not seem to be the main or the only determining factor. For example, a recent comparison between humans and chimpanzees revealed that, despite about 99% identity between the two species at the level of DNA sequence, recombination hot-spots were found rarely at the same positions . AnotherThere are several hypotheses that have been proposed to explain heterochiasmy at imprinted loci. Paldi et al.  first suIn this respect, our earlier hypothesis  suggestsRegardless of the underlying mechanism, data accumulated so far supports genomic imprinting as a new source of natural variation in recombination, both between the two sexes and along the chromosomes. Higher rates of recombination at imprinted chromosomal regions might also explain the apparent high incidence of microdeletions recently described at several imprinted loci \u201356.DNA samples obtained from unfractionated nucleated peripheral blood cells from the Salt Lake City collection of CEPH/Utah pedigrees  were studied. All subjects gave informed consent under University of Utah Institutional Review Board\u2013approved protocol number 6090-96.http://cedar.genetics.soton.ac.uk/pub/PROGRAMS/LDMAP; [IGF2/H19 DMR (haplotype data). These maps assign for every SNP two locations, one in kb and one in LDU, based on pairwise association described by the metric \u03c1 = |D|/Q(1 \u2212 R), where D is the covariance in a 2 \u00d7 2 haplotype table and Q and R are the minor allele frequencies for the given pair of SNPs. For random samples, as in the case of data retrieved from HapMap, \u03c1 equals the maximum value of D\u2032.LD maps for each region were constructed using LDMAP program as described  and thehttp://csc-fserve.hh.med.ic.ac.uk/emboss/cpgplot.html). The content in CpG dinucleotides was analyzed by using the CPGREPORT program in EMBOSS (http://genopole.toulouse.inra.fr/bioinfo/emboss/cpgreport.html). Analysis of the other DNA sequence motifs  was performed by using the RepeatMasker program (http://www.repeatmasker.org).CpG islands, defined here as regions of at least 200 nucleotides with minimum 50% C+G content and minimum observed/expected ratios of 0.6, were determined by using the CPGPLOT program in EMBOSS  or lower to reject H0: no effect of indicated sequence class on LDU/Mb. For p-value of 0.0083 (0.05/6) or lower to reject H0: no effect of indicated DNA motif on LDU/Mb ratios.We attempted to determine which sequence classes are responsible for the difference in LDU/Mb between imprinted and control regions see  and 2 byhttp://www.cephb.fr) for the following markers: WIAF-1667 (rs3216), HRAS1, WIAF-991 (rs3059), MUC5, INS VNTR, TH TaqI, WIAF-3483 (rs1519), WIAF-3839 (rs1875), WIAF-645 (rs2193), WIAF 2696 (rs17081), and WIAF-3649 (rs1685). Recombination events were mapped by pedigree analysis between successive informative markers for which alleles were inherited from different grandparents.Physical positions of all markers used for this study were obtained from the National Center for Biotechnology Information's MapView. Primers for D11S2071, D11S1363, D11S4046, D11S1318, D11S4088, D11S1883, D11S988, D11S1758, and D11S1760 were all purchased from Invitrogen . Genotypes were determined as suggested by the manufacturer. Partial genotyping results were retrieved from the CEPH database , rs741815 (MspI), rs217233 (RsaI), rs217704 (MspI), rs1635150 (FatI), rs1635153 (RsaI), rs2285935 (MspI), rs217729 (MscI), rs3741216 (MseI), rs2067051 (FspI), rs2075745 (sequencing), rs2075744 (sequencing), rs2839698 (sequencing), rs2525881 (sequencing), rs2251375 (sequencing), rs2251312 (sequencing), rs2158394 (BbvI), rs2071095 (sequencing), rs4930098 (sequencing), rs2107425 (sequencing), rs2071094 (sequencing), rs2735972 (sequencing), rs2735971 (sequencing), rs2735470 (sequencing), rs2735970 (sequencing), rs2525882 (sequencing), rs4930101 (sequencing), rs2525883 (sequencing), rs7105554 (sequencing), rs2735469 (sequencing), rs2525886 (StuI), rs4930103 (sequencing), rs4929983 (sequencing), rs4929984 (sequencing), rs2735467 (sequencing), rs2735461 (BmrI), rs4930110 (sequencing), rs2525887 (sequencing), rs3890907 (sequencing), rs7396803 (sequencing), rs7950715 (sequencing), rs7950932 (AatII), rs7933247 (sequencing), rs3858516 (MspI), rs3858517 (sequencing), rs7125562 (sequencing), rs3858518 (sequencing), rs7950787 (sequencing), rs7107675 (sequencing), rs4384367 (StuI), rs3858520 (sequencing), rs4047059 (sequencing), rs3858521 (sequencing), rs4992750 (sequencing), rs4930125 (MspI), rs7124169 (sequencing), rs7115069 (sequencing), rs4930001 (TaqI), rs7115456 (FokI), rs7103445 (sequencing), rs7130909 (sequencing), rs7119087 (sequencing), rs4930003 (sequencing), rs7924887 (TaqI), rs4930144 (NcoI), rs4930145 (sequencing), rs7106395 (ApaI), rs7928968 (sequencing), rs7940766 (SphI), rs79335743 (sequencing), rs4141121 (sequencing), rs3888172 (NdeII), rs3858522 (sequencing), rs3858523 (FatI), rs3858524 (sequencing), rs3893552 (CfoI), rs7104645 (CfoI), rs7925515 (RsaI), rs7107076 (PstI), rs4930033 (NdeII), and rs7924489 (BfaI). At KCNQ1OT1 DMR, mentioned in their physical order from telomere to centromere, we genotyped: rs760419 (SacI), rs231357 (HpaII), rs231352 (XbaI), rs231904 (ApaI), rs231847 (HpaII), rs2283202 (HpaII), and rs189161 (ApaI). Genotyping SNPs found at restriction sites was achieved using standard 35-cycle three-step PCR with primers designed to flank the polymorphism and postamplification cleavage with the appropriate restriction endonuclease  and using the manufacturer's protocol. Genotyping SNPs found outside any restriction site was achieved using amplification with a high-fidelity DNA polymerase , 2% agarose gel electrophoresis, purification using the QIAEX II gel extraction kit  and subsequent bidirectional sequencing at a sequencing facility.Additional SNPs were genotyped for fine-mapping of recombinants that overlapped the IGF2/H19 DMR, we genotyped in a panel of 45 three-generation families the following ten SNPs in their telomere to centromere order: rs2839704 (RsaI), rs2839702 (AluI), rs2067051 (AatII), rs10732516 (CfoI), rs2525886 (StuI), rs7950932 (AatII), rs3858516 (MspI), rs4384367 (StuI), rs4930001 (TaqI), and rs7924887 (TaqI). Genotyping was achieved as described above.For linkage analysis at IGF2/H19 DMR were constructed by pedigree analysis. LD between SNP pairs was measured using the absolute value of Lewontin's D\u2032 where D\u2032 = 1 is reflective of complete LD and 0 corresponds to a state of complete equilibrium [Haplotypes at ilibrium .The FGT between each pairwise SNP was performed as previously published ,29.All statistics were generated by using Prism4.0 software (GraphPad).Table S1(80 KB DOC)Click here for additional data file.Table S2(80 KB DOC)Click here for additional data file.Table S3(80 KB DOC)Click here for additional data file.Table S4(80 KB DOC)Click here for additional data file."}
+{"text": "The 22q11.2 deletion syndrome is the most frequent genomic disorder with an estimated frequency of 1/4000 live births. The majority of patients (90%) have the same deletion of 3 Mb  that results from aberrant recombination at meiosis between region specific low-copy repeats (LCRs).As a first step towards the characterization of recombination rates and breakpoints within the 22q11.2 region we have constructed a high resolution recombination breakpoint map based on pedigree analysis and a population-based historical recombination map based on LD analysis.Our pedigree map allows the location of recombination breakpoints with a high resolution , and this approach has led to the identification of 5 breakpoint segments of 50 kb or less , that coincide with historical hotspots. It has been suggested that aberrant recombination leading to deletion (and duplication) is caused by low rates of Allelic Homologous Recombination (AHR) within the affected region. However, recombination rate estimates for 22q11.2 region show that neither average recombination rates in the 22q11.2 region or within LCR22-2 (the LCR implicated in most deletions and duplications), are significantly below chromosome 22 averages. Furthermore, LCR22-2, the repeat most frequently implicated in rearrangements, is also the LCR22 with the highest levels of AHR. In addition, we find recombination events in the 22q11.2 region to cluster within families. Within this context, the same chromosome recombines twice in one family; first by AHR and in the next generation by NAHR resulting in an individual affected with the del22q11.2 syndrome.We show in the context of a first high resolution pedigree map of the 22q11.2 region that NAHR within LCR22 leading to duplications and deletions cannot be explained exclusively under a hypothesis of low AHR rates. In addition, we find that AHR recombination events cluster within families. If normal and aberrant recombination are mechanistically related, the fact that LCR22s undergo frequent AHR and that we find familial differences in recombination rates within the 22q11.2 region would have obvious health-related implications. Low copy repeats (LCRs), are 10 to 400 kb long DNA blocks with a complex internal organization that show more than 95% identity between copies. Non-allelic homologous recombination (NAHR) between LCRs has been seen to mediate deletions and duplications in many genomic disorders. All of this supports the view that LCRs are essential players in a common mechanism that causes most genomic syndromes -4.de novo frequency of 1/4000 live births and it incorporates classical clinical disorders such as DiGeorge syndrome, Conotruncal Anomaly Face syndrome, or Velocardiofacial syndrome  . This test is a goodness-of-fit test based on the estimator of the cumulative distribution function. The test statistic is a Cramer-von Mises type of distance and it is implemented in the R Software by parametric bootstrap. The poisson.mtest of R was run with 10000 replicates.IGL), have permitted the location of 5 breakpoints to segments of 54 kb or less    Table . OverallD22S420-CATCH48), 18.31 to 19.09 Mb (CATCH23-D22S264) and 20.88 to 22.81 Mb (D22S306-D22S1174) are female-specific with no male recombination. Segments between 19.09 and 19.5 (D22S264-D22S311); 19.74 and 20.34 (CATCH38-CATCH35), and 20.58 and 20.81 (D22S539-CATCH29) are sections of exclusively male recombination. There are only two regions that present both male and female recombination events, those between 18.02 and 18.31 (D22S1623-CATCH23) and 20.81 and 20.89 (CATCH29-CATCH16).Recombination events do not spread evenly within the studied region and there are segments where crossovers tend to cluster and segments with little or no recombination. Furthermore, we find that we can divide the 22q11.2 region into segments that alternatively undergo male or female recombination with very little overlap  is of 2.1 cM/Mb : 1.6\u20132.76). If we concentrate on the 3 Mb TDR, the sex-averaged recombination rate increases to 2.6 cM/Mb (CI: 1.8\u20134.4). On the other hand, sex-specific female and male rates in the 6.5 Mb 22q11.2 region are 2.9 cM/Mb (CI: 1.9\u20134.5) and 1.4 cM/Mb (CI: 0.7\u20132.5), respectively. In the TDR sex-specific rates increase to 4.0 cM/Mb (CI: 2.2\u20136.9) in females and 2.0 cM/Mb (CI: 0.9\u20134.2), in males. Neither 22q11.2 recombination rates, nor those of the 3 Mb TDR included in the larger 6, 58 Mb region, differ significantly from chromosome 22 averages described in previous studies ,28. FromOur pedigree map allows the location of recombination breakpoints with a high resolution but sample size does not permit the accurate measure of recombination rates at a fine scale. However, recombination rate inaccuracies can be reduced by decreasing the resolution and for this reason we analyzed recombination rates in 14 intervals of 500 kb each . This anAn LD map was constructed based on 2074 SNPs from the HapMap project  that were analyzed in 400\u2013800 kb windows using the general model for recombination rate variation of the PHASE 2.1.1 software  to estimate the most probable hotspot within each of the 400\u2013800 kb windows into which the 22q11.2 region was divided. The program predicts LCR22-2, LCR22-3A and LCR22-4 to contain the main recombination hotspot of their 800 kb window . This result shows that certain families have a higher tendency to recombine within the TDR region than others.This observation suggests that certain haplotypes may be more prone to undergo AHR and NAHR events within the 22q11.2 region. To test this we analyzed the presence or absence of recombination events within TDR in families used to construct the pedigree map. This analysis shows a non random distribution of recombination events per family. Families tend to cluster in two extreme groups: one with no recombination events and another with more than 3 recombination events in this region. To test for the statistical significance of this observation we modeled the expected number of families having 0, 1, 2 and more that 3 recombination events as a Poisson distribution of mean 1.5. In a sample of 18 families, the observed number of families having 0, 1, 2 and more than 3 recombination events was of 8, 2, 1 and 7, respectively . This indicates that high and low recombining families do not show different origins for the TDR. Therefore, although we have found indications that certain individuals may undergo AHR in the TDR more frequently than others, we have not found any apparent differences within the TDR itself between such individuals.The knowledge of the detailed contemporary recombinational traits of a genomic region is based on the localization of the exact position of crossovers and the accurate characterization of recombination frequencies. However, previously published genetic maps of chromosome 22 provided very little information on the 22q11.2 region ,28. ThesThe resolution of a genetic map determines how precisely we know the position at which a crossover is located and is limited by the density of polymorphisms and the distance between the closest markers. On the other hand, the accuracy of the recombination rate of a particular genomic segment is a function of the number of meiotic events studied . The pedHowever, the particular traits of the 22q11.2 region warrant a point of caution on recombination rates because there may be inaccuracies in the LCR22 sizes calculated from the available human genome sequence drafts : The size of LCR22-3a may not be exact, as it is an estimation because of a sequence gap. In addition, recently it has been shown that LCR22-2 and LCR22-4 can be polymorphic in size in the normal population  and thus certain individuals may have larger or smaller LCR22s .Population-based LD maps which model historical recombination rates have been shown to be able to predict most contemporary recombination hotspots ,25,32. T2: p = 0, 0238)  between LCR22s has been seen to mediate most of the germline deletions and duplications in the 22q11.2 region. However, not much is known on a possible relation between normal meiotic recombination (AHR) and ectopic recombination (NAHR) in regions implicated in recurrent genome rearrangements. We find some support for a relation between high rates of AHR and NAHR in the 22q11.2 region. Our maps show that LCR22-2, LCR22-3a and LCR22-4 undergo frequent AHR and that LCR22-5 and LCR22-6 support little or no recombination. Interestingly, NAHR between the three LCR22s displaying frequent AHR account for nearly all described deletions in the 22q11.2 region. It is also suggestive that LCR22-2, the LCR that mediates most deletions and duplications within the 22q11.2 region, is also the LCR in which we have found the highest AHR rates. Furthermore, AHR breakpoints detected within LCR22-2 are mostly female and we show through a meta-analysis of published data that there is a significant excess of maternal deletions in del22q11.2 syndrome patients  and hereditary neuropathy with liability to pressure palsies  are caused by LCR-mediated duplications and deletions in 17p12.  females . Moreove females . These oOur study shows that LCR22s implicated in deletions and duplications are sites of frequent meiotic recombination (AHR) and that average recombination in the 22q11.2 region is similar to the chromosome average. Thus, aberrant recombination leading to 22q11.2 deletion syndrome can't be explained exclusively under a hypothesis of low regional AHR rates. This may reflect that the mechanisms causing NAHR in the 22q11.2 region and those in the regions causing SMS and CMT1A-HNPP may be different; or that available maps of the the 17p11-12 region do not have the resolution to determine AHR rates within the region's LCRs. Comprehensive high resolution maps of the 17p11-12 region may help solve this question.In addition, we also show that AHR events within the 22q11.2 region cluster in families. If a concordance between AHR and NAHR exists, we would expect families with high AHR levels to be more prone to deletions and duplications. Although we would need a large number of multiple generation pedigrees to prove this, we describe here a family with two female crossovers within LCR22-2: in one generation it was an AHR event and in the next generation a NAHR event that resulted in a 22q11.2 deletion. We have not found differences in allelic frequencies of markers within 22q11.2 between individuals which show AHR and those that do not. However, it has been seen that the genetic background outside of a particular region influences recombination rates and breakpoint location ,34. ThusIn any case, further characterization of recombination in the 22q11.2 region should provide more information on a potential relation between NAHR and AHR active regions. However, high throughput studies that could clarify if AHR and NAHR show the same breakpoint locations are hampered by the recombinational and genomic traits of the 22q11.2 region. On one hand, LCR22s are large (300\u2013400 kb) highly identical structures (>98% identity) making it very difficult to identify reliable polymorphisms that would allow localization of AHR breakpoints. And on the other hand, some of the most active LCR22s in NAHR and AHR may have higher female than male recombination rates, and thus sperm typing may not be the ideal technique to characterize AHR within these repeats.We present a high resolution recombination map of the 22q11.2 region based on pedigree data. Our map allows the location of recombination breakpoints with a high resolution , and this approach has led to the identification of 5 breakpoint segments of 50 kb or less , that coincide with historical hotspots. It has been suggested that aberrant recombination leading to deletion (and duplication) is caused by low rates of Allelic Homologous Recombination (AHR) within the affected region [The author(s) declare that they have no competing interests.LTJ carried out the molecular genetic studies, participated in the sequence analysis and in the draft of the manuscript. JR carried out clinical characterization of patients, data analysis and drafting of the manuscript. MST participated in the construction of the HapMap based recombination map and in the statistical tests. JF carried out the construction of the HapMap based recombination map and the statistical tests and participated in the drafting of the manuscript. DHS conceived the study, participated in the molecular genetic studies, analysed the data and wrote the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Markers used for the construction of the pedigree linkage map. The table depicts the markers used for the construction of the pedigree-based recombination map. It depicts the name of the marker, its position on the chromosome, PCR product size, amplification primers, type of repeat and observed heterozigosity in our study.Click here for file"}
+{"text": "This first determination of a virus recombination rate during a single multi-cellular host infection indicates that recombination is very frequent in the everyday life of this virus.Viral recombination can dramatically impact evolution and epidemiology. In viruses, the recombination rate depends on the frequency of genetic exchange between different viral genomes within an infected host cell and on the frequency at which such co-infections occur. While the recombination rate has been recently evaluated in experimentally co-infected cell cultures for several viruses, direct quantification at the most biologically significant level, that of a host infection, is still lacking. This study fills this gap using the cauliflower mosaic virus as a model. We distributed four neutral markers along the viral genome, and co-inoculated host plants with marker-containing and wild-type viruses. The frequency of recombinant genomes was evaluated 21 d post-inoculation. On average, over 50% of viral genomes recovered after a single host infection were recombinants, clearly indicating that recombination is very frequent in this virus. Estimates of the recombination rate show that all regions of the genome are equally affected by this process. Assuming that ten viral replication cycles occurred during our experiment\u2014based on data on the timing of coat protein detection\u2014the per base and replication cycle recombination rate was on the order of 2 \u00d7 10 An analysis of recombination of the cauliflower mosaic virus during an infection reveals that recombination is extremely frequent and provides the first range of estimates for a plant virus As increasing numbers of full-length viral sequences become available, recombinant or mosaic viruses are being recognized more frequently ,2,3. RecViruses can exchange genetic material when at least two different viral genomes co-infect the same host cell. Progeny can then become hybrid through different mechanisms, such as reassortment of segments when the parental genomes are fragmented , intra-mHowever, as discussed below, numerous experimental constraints have so far precluded an actual quantification of the baseline rate of recombination. First, many experimental designs have used extreme positive selection, where only recombinant genomes were viable e.g., ,20,21). ,21. 20,2Brassica rapa).Taken together, the currently available information indicates that no viral recombination rate has ever been estimated directly at time and space scales corresponding to a single multi-cellular host infection, although this level is most significant for the biology and evolution of viruses. This study intends to fill this gap by evaluating the recombination frequency of the cauliflower mosaic virus (CaMV) during a single passage in one of its host plants , badnaviruses , and caulimoviruses . Pararetroviruses are characterized by a non-segmented double-stranded DNA genome. After entering the host cell nucleus, the viral DNA accumulates as a minichromosome  whose trn planta  30]. Vi. Viin plThe detection of CaMV recombinants in turnip hosts has been reported numerous times. Some studies have demonstrated the appearance of infectious recombinant viral genomes after inoculation (i) of a host plant with two infectious or non-infectious parental clones ,33,34,35\u22125, across the entire genome. We thereby provide the first quantification, to our knowledge, of the recombination rate in a virus population during a single passage in a single host.In the present work, we aimed at answering this question. To this end, we have constructed a CaMV genome with four genetic markers, demonstrated to be neutral in competition experiments. By co-inoculating host plants with equal amounts of wild-type and marker-containing CaMV particles, we have generated mixed populations in which impressive proportions of recombinants\u2014distributed in several different classes corresponding to exchange of different genomic regions\u2014have been detected and quantified. Altogether, the recombinant genomes averaged over 50% of the population. Further analysis of these data, assuming a number of viral replications during the infection period ranging from five to 20, indicates that the per nucleotide per replication cycle recombination rate of CaMV is of the same order of magnitude, i.e., on the order of a few 10From Altogether, the proportion of recombinant genomes found in the mixed viral populations was astonishingly high and very similar in the ten co-infected plants analyzed .The inferred per generation recombination and interference rates, assuming that CaMV undergoes ten replication cycles during the 21 d between infection and sampling, are given for each of the ten plants in r1, r2, and r3 assuming 20 generations were equal to 0.05, 0.04, and 0.025, respectively . For example, the average recombination rates Inspection of One major breakthrough in the work presented here lies in the space and time scales at which the experiments were performed. Indeed, the processes occurring within the course of a single infection of one multi-cellular host are of obvious biological relevance for any disease. Previous studies on viral recombination suffered from major drawbacks in this respect, basing their conclusions on experiments relying on complementation among non-infectious viruses or between viruses with undetermined relative fitness, on phylogenetically based analyses, or on experiments in cell cultures. For reasons detailed in the Introduction, the first two methods either do not provide information on the frequency of recombination, but only its occurrence, or address the question at a different temporal, and often spatial, scale. Results from cell cultures, on the other hand, impose cell co-infection by different viral variants, potentially overestimating the frequency of recombination events. Our study circumvents these limitations by analyzing viral genotypes sampled from infected plants after the course of a single infection, and therefore the invasion and co-infection of cells in various organs and tissues is very close to natural.\u22125 to 4 \u00d7 10\u22125. The time length of one generation, i.e., the time required for a given genome to go from one replication to the next, is totally unknown in plant viruses. The only experimental data available on CaMV are based on the kinetics of gene expression in infected protoplasts, where the capsid protein is produced between 48 and 72 h [r and the number of generations, thereby allowing an immediate adjustment of r if the CaMV generation time is more precisely established. At this point, we must consider that all cloned genomes may not have been through all the successive replication events potentially allowed by the timing of our experiments. It was previously shown that about 95% of CaMV mature virus particles accumulate in compact inclusion bodies [More than half of the genomes r1, r2 = (1 \u2212 F)r2, and i12 = \u2212(F \u2212 i12)/(1 \u2212 F). Interestingly, this example also shows that our estimates of the recombination rate are conservative: that a fraction F of host cells are singly infected while others are multiply infected leads to an underestimation of the recombination rate.Our results show that interferences between pairs of loci are negative: a recombination event between two loci apparently increases the probability of recombination between another pair of loci. We believe that the most parsimonious explanation of these negative interferences is based on the way the infection builds up within plant hosts. Indeed, one can divide infected host cells into those infected by a single virus genotype and those infected by more than one viral genotype. In the former, analogous to clonal propagation, recombination is undetectable. In the latter, recombination is not only detectable but, as our results indicate, very frequent. Samples consisting of viruses resulting from a mixture of these two types of host cell infections will thus contain viruses with no recombination and viruses with several recombination events, thus yielding an impression of negative interference. These conceptual arguments are supported by mathematical models. It is indeed easy to show (detailed results not shown) that if a proportion r1, r2, and r3, calculated between markers a\u2013b, b\u2013c, and c\u2013d, respectively, we found evidence for recombination through the entire CaMV genome. The values for r1,r2, and r3 are remarkably similar, hence the recombination sites seem to be evenly distributed along the genome. We considered the template-switching model as the major way recombinants are created in CaMV. As already mentioned in the Introduction, hot spots of template switching have been predicted at the position of the 5\u2032 extremities of the 35S and 19S RNAs [As judged by 19S RNAs ,36,42. I19S RNAs . Due to \u22124 [To our knowledge, the viral recombination rate has never previously been quantified experimentally for a plant virus . In cont\u22124 ,15,19, lOther pararetroviruses such as plant badnaviruses or vertebrate hepadnaviruses have a similar cycle within their host cells, including steps of nuclear minichromosome, genomic size RNA synthesis, and reverse transcription and encapsidation. Nevertheless, vertebrate hepadnaviruses  infect hosts that are very different from plants in their biology and physiology, and this could lead to a totally different frequency of cell co-infection during the development of the virus populations. Thus, even though our results can be informative for other pararetroviruses because of the viruses' shared biological characteristics, they should not be extrapolated to vertebrate pararetroviruses without caution.We used the plasmid pCa37, which is the complete genome of the CaMV isolate Cabb-S, cloned into the pBR322 plasmid at the unique SalI restriction site . To analB. rapa cv, \u201cJust Right\u201d) grown under glasshouse conditions at 23 \u00b0C with a 16/8 (light/dark) photoperiod. Thirty days post-inoculation, all symptomatic leaves were harvested and viral particles were purified as described earlier [To generate the parental virus particles, plasmids pCa37 and pMark-S were mechanically inoculated into individual plants as previously described . All pla earlier .The resulting preparations of parental viruses, designated Cabb-S and Mark-S, were quantified by spectrometry using the formula described by Hull et al. . We fixeWe designed an experimental protocol for quantifying marker frequency within a mixed Cabb-S/Mark-S virus population after a single passage in a host plant. Twenty-four individual plants, inoculated as above with equal amounts of Cabb-S and Mark-S, were harvested 21 d post-inoculation, when symptoms were fully developed. The viral DNA was purified from 200 mg of young newly formed infected leaves according to the protocol described previously . After tTo identify and quantify the recombinants within the CaMV mixed populations, aliquots from ten of the 24 viral DNA preparations described above were digested by the restriction enzyme SalI, and directly cloned into pUC19 at the corresponding site. In each of the ten viral populations analyzed, 50 full-genome-length clones were digested separately by BsiWI, PstI, MluI, and SacI, to test for the presence of marker a, b, c, and d, respectively. In this experiment, with the marker representing an additional restriction site, we could easily distinguish between the Cabb-S and the Mark-S genotype at all four marker positions, upon agarose gel (1%) electrophoresis of the digested clones. Clones with none or all four markers were parental genotypes, whereas clones harboring 1, 2, or 3 markers were clearly recombinants. Due to the very high number of recombinants detected, markers eventually appearing or disappearing due to spontaneous mutations were neglected.Here we present the different methods we used to quantify recombination in the CaMV genome. Because all these methods assume that the different markers are neutral, we first discuss assumption.t-tests, for datasets where normality could not be rejected (seven out of eight cases), or Wilcoxon signed-rank non-parametric tests otherwise (marker c in the first dataset). In all cases p-values were larger than 0.05.We used two datasets to test the neutrality of markers, both resulting from plants co-infected with a 1:1 ratio of Mark-S and Cabb-S. The first consisted of viral DNA densitometry data derived from 24 plants (described above), where for each plant we have an estimate of the frequency of each marker in the genome population. The second consisted of the restriction of 50 individual full-genome-length viral clones obtained from one co-infected plant (described above), yielding an estimate of the frequency of each marker, and this was repeated on ten different plants. The frequencies of the different markers were 0.508, 0.501, 0.516, and 0.507 for markers a, b, c, and d in the first dataset and 0.521, 0.518, 0.514, and 0.524 in the second dataset. We tested whether these frequencies were significantly different from the expected value under neutrality, 0.5, using either There are several cautionary remarks regarding these analyses. First, in all cases we found an excess of markers. Unfortunately, the two datasets cannot be regarded as independent because, even though the methods through which the frequency estimates were obtained were different, the plants used in the second dataset were a subset of the plants of the first. We thus have only four independent estimates in each case, and there is minimal power to detect significant deviations from neutrality with such a small sample size. It should be noted at this stage that deviations from the expected value could also be caused either by slight deviations from the 1:1 ratio in the infecting mixed solution, or by deviations from that ratio in the frequency of the viral particles that actually get into the plants. Second, because of the relatively small sample sizes and low statistical power, the tests presented above could have detected only large deviations.The results clearly show, however, precisely that the markers do not have large effects, if any, and that therefore recombination estimates would be affected only very slightly by any hypothetical selective effects of the markers. Because of this, along with the fact that the introduced markers provoke silent substitutions in the CaMV genome, we assumed that markers were effectively neutral in the rest of the analysis.The dataset used to estimate the recombination frequency consisted of the 500 full-genome-length viral clones (50 from each of ten co-infected plants) individually genotyped for each of the four markers. As discussed in detail in the Results, recombination was very frequent and concerned all four markers. Indeed, approximately half of the genotyped clones exhibited a recombinant genotype. It was therefore meaningful to try to obtain quantitative estimates of recombination from our data.Our aim was to analyze viral recombination in a live host. Consequently, we had to deal with the fact that more than one viral replication cycle occurred during the 21 d that infection lasted in our experiment . Based on the kinetics of gene expression , we postn generations later as a function of their initial frequency and of the recombination parameters. Subsequently we calculated the maximum likelihood estimates of the recombination parameters and their asymptotic variances given initial frequencies  and frequencies after n generations . All algebraic and numerical calculations were carried out with the software Mathematica.To estimate the recombination rate between markers, we wrote recurrence equations describing the change in frequency of each genotype over one generation, assuming random mating and no selection . We then expressed the frequency of all possible genotypes r1 for the recombination rate between markers a and b, and the interference coefficients, e.g., i12 for interference between recombination events in the segments between markers a and b and b and c. To define these parameters we followed Christiansen [The recombination parameters are the recombination rates between two adjacent loci, e.g., stiansen , and in stiansen ). It is n generations, given the above stated initial frequencies and specified recombination parameters. For each combination of recombination parameters we calculated a Euclidean distance between the vector of the expected genotypic frequencies and the observed genotypic frequencies, and considered that the estimated recombination parameters were those yielding the minimal Euclidean distance. In all cases, the estimated recombination rates between pairs of loci were equal to the second decimal to those estimated algebraically from data for three or two loci.It proved impossible to carry out the calculations for four loci algebraically. Instead, we used a computer program to calculate the expected genotypic frequencies at all four loci after"}
+{"text": "Alu mobile element insertions, and these insertions have been implicated in non-homologous recombination, modulation of DNA methylation, and transcriptional regulation. If individual Alu insertions have even modest effects on local recombination rates, they could collectively have a significant impact on the pattern of linkage disequilibrium in the human genome and on the evolution of the Alu family itself.Recombination rates vary widely across the human genome, but little of that variation is correlated with known DNA sequence features. The genome contains more than one million AluY insertion loci in 347 individuals sampled from diverse populations, then used the SNP genotypes to estimate local recombination rates around the AluY loci. The loci and SNPs were chosen so as to minimize other factors (such as SNP ascertainment bias and SNP density) that could influence recombination rate estimates. We detected a significant increase in recombination rate within ~2 kb of the AluY insertions in our African population sample. To test this observation against a larger set of AluY insertions, we applied our locus- and SNP-selection design and analyses to the HapMap Phase II data. In that data set, we observed a significantly increased recombination rate near AluY insertions in both the CEU and YRI populations.We carried out sequencing, SNP identification, and SNP genotyping around 19 AluY insertion is significantly predictive of an elevated local recombination rate within 2 kb of the insertion, independent of other known predictors. The magnitude of this effect, approximately a 6% increase, is comparable to the effects of some recombinogenic DNA sequence motifs identified via their association with recombination hot spots.We show that the presence of a fixed  LINE-1 non-LTR retrotransposons and the Alu elements they mobilize continue to replicate in the human gene pool to this day [Alu retroposition, our genomes are littered with more than one million small (~300 bp), non-allelic regions whose DNA sequences are nearly identical to each other. Their recombinogenic impact is evident: these scattered homologies trigger non-allelic homologous recombination (NAHR) events that lead to translocations, deletions, duplications, and other chromosomal abnormalities and copy number variations [Alu insertions themselves [Alu repeats have been implicated in differential methylation states of the genome, in the translation response to cellular stress, and in the regulation of transcription [Alu insertions on the rates of allelic recombination events in the human germline remains largely unknown. It has been suggested that polymorphic Alu insertions may suppress recombination when found in the heterozygous state [Alu insertions may contain specific DNA sequence features capable of recruiting recombination-enhancing or -suppressing factors.Approximately one-half of the human genome consists of the remnants of past transpositional bursts . LINE-1 this day . As a reriations -6. Theseemselves -11. Alu cription . Howeverus state , and fixAlu elements and in other repeat sequences (e.g. THE1A/B elements), but some Alu elements carry those motifs [Alu subfamilies in hot spots , and consequently an association with higher recombination rates [Alu insertions lacking the motifs and higher recombination rates [Alu sequence is not uniquely nor highly recombinogenic in itself.Meiotic recombination rates in humans vary widely across the genome . The seae motifs . That ason rates . Howeveron rates . These nAlu insertions on local recombination rates is small, the sum of those effects over the very large number of Alu insertions in the human gene pool could have a significant cumulative impact on the structure of our genomes. Moreover, any effect of Alu insertions on recombination rate in their immediate vicinity could influence their own evolutionary fates, the evolution of the Alu retroposon family, and the evolutionary responses of the genetic pathways that regulate recombination itself.Since previous studies have analyzed recombination rate variation at a broad scale, or have focused mainly on hot spots, a less dramatic effect (not rising to the level that would be detected as a hot spot), or an effect mediated only by a minority of more recently-inserted copies, would have gone undetected. Yet even if the impact of individual AluY insertions. Of all the repeat families in the human genome, the AluY subfamily has the largest number of recently inserted copies. Any Alu-specific properties that affect recombination should be most apparent in young insertions, rather than older insertions that have accumulated many mutations that may have altered their properties. The high copy number of AluY insertions provides the statistical power needed to detect modest effects, and the homogeneity of the subfamily reduces the danger of missing an effect due to heterogeneity within the data set. Our question is: does the presence of an AluY insertion affect the local rate of recombination? We show that the presence of a fixed, young AluY insertion is significantly predictive of a modestly elevated local recombination rate.Here we focus specifically on the effect of recent (less than 10% diverged from consensus) Alu insertions on local recombination rates as directly and clearly as possible, we sought to eliminate or account for factors and biases that could affect recombination rate estimates. In short, we first constructed data sets that avoid complicating factors and biases and then used covariates in stepwise linear regression analyses to account for the remaining factors. The basic unit in our analyses is a ~50 kb region containing a single AluY insertion locus and common SNPs spaced at 4-5 kb intervals throughout each region. The exact size of any particular \"AluY region\" is determined by the locations of the first and last SNP ascertained for that region. By focusing on regions with just one AluY insertion, we avoid modeling complex interactions between multiple AluY insertions in one or several inter-SNP intervals. By maintaining uniformity of inter-SNP interval sizes, we avoid biases in the estimation of recombination rates on intervals of very different sizes. The frequency of common SNPs in the human population and our need for uniformly-sized intervals across many AluY regions constrain our choice of SNP spacing intervals. Under those constraints, the 4-5 kb SNP spacing best meets our goal of estimating recombination rates in small intervals. We used this same strategy to select AluY regions and uniformly-spaced SNPs from our own \"world diversity panel\" (below) and from the HapMap Phase II data.In order to address the effect of AluY regions and SNPs within them, we used the genotypes at those SNPs in various population samples to estimate the rescaled recombination rate parameter (\u03c1) for each inter-SNP interval. A typical AluY region, with \u03c1 estimates plotted for each inter-SNP interval, is shown in Figure AluY insertion locus in an inter-SNP interval significantly changes the recombination rate in that interval, relative to the rate in intervals that do not contain an AluY insert.After selecting p = 0.033) of the presence of a fixed AluY insertion on the local recombination rate in the African subset of our world population diversity sample  were excluded from the regression analyses out of concern that their recombination rate estimates might be downwardly biased (see Methods).We designed our first data by ascertaining evenly spaced common SNPs from a panel of samples drawn from Africa, Asia, and Europe, then genotyping those SNPs in our population samples from those continental groups (see Methods). Our stepwise linear regression analyses detected a significant positive effect . This large data set provides estimates of the inter-SNP recombination rate for every inter-SNP interval in the data [Alu elements on recombination. Our initial analyses of the HapMap data found that, in general: (1) longer-than-average inter-SNP intervals have lower-than-average estimated recombination rates (regardless of whether they contain AluY insertions or not); (2) inter-SNP intervals with AluY insertions in them are longer than intervals without them; and (3) AluY insertions are associated with both longer-than-average intervals and lower-than-average estimated recombination rates. Specifically, among 3,088,316 autosomal inter-SNP intervals with lengths between 10 and 10,000 bp for which recombination rates were estimated by the HapMap project, a linear regression of recombination rate  on interval length (log10) yields a significantly negative slope . Of those intervals, 107,189 contain at least part of an AluY insertion . Consistent with the overall pattern, those intervals are longer, on average, than intervals without an AluY insertion . Again consistent with the general pattern, the estimated recombination rate in these longer, AluY-containing intervals is lower than in the shorter intervals that lack AluY insertions .To increase the power to detect any association between the data . Before AluY in them  is unclear. It might be due to the difficulty of designing robust genotyping assays for SNPs near repeat sequences in the context of a high-throughput genotyping project, or perhaps these repeats are in fact associated with lower nearby genetic variation. We observed a similar pattern with LINE-1 insertions (not shown). The cause of the general association between estimated recombination rate and inter-SNP interval length in HapMap data may be an artifact of the estimation procedure, since regions of lower SNP density contain less information about past recombination events.The reason for the larger average size of intervals with an AluY insertions and local recombination rates did not account for this bias and were focused on larger effect sizes, which may explain why no AluY-specific effect was detected [We therefore eliminated the potentially confounding relationship between inter-SNP interval size and estimated recombination rate by selecting uniformly sized intervals (see Methods), re-estimating the recombination rates in those intervals, and also including interval length as a covariate in our regression analyses. Previous analyses of correlations between detected .AluY insertions were identified by RepeatMasker  and excluded known polymorphic insertions by comparison with dbRIP [AluY regions and uniformly-spaced SNPs within them  from the HapMap data using an adaptation of the method we used on our world diversity panel above (see Methods). We analyzed these data after removing the terminal and sub-terminal intervals from each region  to eliminate edge effects. Table 10(\u03c1) for these intervals and for the seven predictor variables defined for each inter-SNP interval: length, regional recombination rate, G+C content, \"core\" motif count, \"extended\" motif count, hot spot presence, and AluY presence (as detailed in Methods).To further test the initial results we observed in the African sample of our world diversity panel, we assembled a genome-wide data set of HapMap SNPs typed on the 30 Yoruba (YRI) parent-child trios . AluY inth dbRIP . We seleAluY insertion predicts a statistically significant (p < 0.00014) though modest (~5%) increase in recombination rate. The length of an interval has a significant but very small effect on the recombination rate in that interval, which implies that our strategy to eliminate the interval length factor was successful. Each of the other variables is independently predictive of the local recombination rate. The impacts of the regional recombination rate and G+C composition are the largest and most significant, as expected. The hot spot-associated recombinogenic motifs are associated with small, local variations in recombination rate independently of their association with hot spots. Since those motifs are present in a minority of hot spots [After accounting for all other effects in the model, we find that the presence of an ot spots , it is nAluY regions, we detected no effect of fixed AluY insertions on recombination in our European population sample. We then asked the same question using 5,344 AluY regions  and 30 CEU parent-child trios genotyped by the HapMap project. Means and standard deviations of the regression variables are shown in Table With our initial set of 14 AluY insertion is associated with an ~8% increase in the recombination rate in an interval (p < 1.7 \u00d7 10-7). The overall results are very similar to those observed with the YRI data. This similarity is expected, since the patterns of variation and linkage disequilibrium in the CEU population sample are correlated with those in the YRI sample because of their shared ancestry. The effect of interval length on recombination rate is small, as it was with the YRI data, and statistically insignificant in this case.Regression analysis Table  shows thAluY-containing intervals in the CEU data set also overlap a hot spot. While that does not mean that those hot spots overlap the AluY insertions themselves, we nonetheless checked for a potential interaction effect between hot spots and AluY insertions, since such an interaction could account for part of the AluY effect. We observed a significant interaction effect in the CEU HapMap data set . Independent effect sizes for AluY and hot spots were slightly but not significantly reduced  of the AluY regions, so the negative results obtained in our European and East Asian samples are probably due to a lack of statistical power. Although the 95% confidence intervals around the effect sizes estimated for the fixed AluY insertions in the sub-Saharan African and the HapMap YRI data sets do not overlap, the 99% confidence intervals do . TheAluY insertions affect the recombination rate in their immediate neighborhood. We first generated and analyzed a data set of AluY insertions and surrounding SNPs that were ascertained to limit extraneous factors and thus to maximize our ability to detect such effects. To test the observations gained from those data, we extended the ascertainment design and analyses to a larger set of AluY insertions and neighboring SNPs extracted from the HapMap Phase II data. Because AluY insertions are correlated with some sequence features  that are themselves associated with higher recombination rates or with recombination hot spots, we included those features as covariates in our analyses. We included hot spots themselves as proxies for the as-yet-unknown factors that presumably cause those hot spots.We have assessed whether AluY-containing interval was a strong predictor of that interval's recombination rate. While this yields no insight about the cause of that broad-scale variation, it allows us to factor out any effects at that scale. Even with the mean surrounding regional recombination rate already factored out, the G+C content of an inter-SNP interval is strongly predictive of its recombination rate. The G+C content itself is correlated with the \"core\" and \"extended\" hot spot-associated recombinogenic motifs, since they are GC-rich. Nonetheless, both of those motifs carry additional significant predictive power. As expected, the presence of a hot spot in (or overlapping) an interval has a much stronger effect, increasing the recombination rate by ~2.4-fold, on average. There is a slight association between hot spots and AluY insertions . Some degree of association would be expected under the hypothesis that AluY insertions increase the local recombination rate, since they would push that rate past the threshold for hot spots in at least some regions. There is also some evidence for a positive interaction between hot spots and AluY insertions . However, since many unknown factors may interact to generate recombination hot spots, and since an AluY-specific effect should be detectable independently from those factors and the hot spots they generate, we have attempted to factor out the effect of hot spots.As expected, the average recombination rate within ~15 kb on either side of an ent with ): inter-AluY sequences, we still find that the presence of a fixed AluY insertion has a significant positive impact on the recombination rate within the ~4 kb inter-SNP interval that contains it. A fixed AluY insertion appears to cause a twofold enhancement of the local recombination rate in the 14 AluY regions we genotyped in our sub-Saharan African sample. A smaller positive effect - a 6.4% increase over the surrounding intervals, on average - is strongly evident in the larger HapMap-based data sets, for both the YRI and CEU populations.After factoring out effects that are not specific to AluY insertions and the local recombination rate was found in the five regions genotyped in our world diversity panel, but a modest effect (as observed for fixed AluY insertions) would not be detectable in a data set of that size. We therefore turned to the HapMap YRI trio data set to test for a smaller effect of polymorphic AluY insertions on the local recombination rate. Using the methods we applied above to ascertain fixed AluY regions, we identified 552 polymorphic AluY regions based on the AluY loci in dbRIP [AluY elements on local recombination rates.No relationship between polymorphic in dbRIP . We examAluY on the local recombination rate is comparable to the effect of the stronger of the two recombinogenic motifs that we analyzed  cannot explain the recent effect of those insertions.The magnitude of the per-copy effect of a fixed ed Table . Given tAluY sequences might bind cofactors or influence chromatin structure in a way that influences the local recombination rate, as has been suggested for some short recombinogenic motifs [Alu insertions are typically flanked on both sides by target sites for LINE-1 endonuclease. This is because Alu insertions are created by LINE-1-encoded proteins [LINE-1 endonuclease cutting sites, and the original target sites are duplicated during the insertion event. Alu insertions may thus attract LINE-1 endonuclease, which creates double-strand breaks (DSBs) in the DNA that can then be resolved as recombination events. LINE-1 endonuclease generates large numbers of DSBs [LINE-1 activity might generate DSBs at a rate sufficient to affect recombination rates.c motifs . For exaproteins  at LINE- of DSBs , which sAluY element enhances the local recombination rate by approximately 6%. This effect is similar in magnitude to that observed for previously identified recombinogenic motifs. While the effect of each AluY element is relatively small, the presence of hundreds of thousands of these elements throughout the human genome implies that they exert a substantial effect on genome-wide recombination rates. Further research is needed to identify precisely the molecular mechanism responsible for this effect.In summary, we have demonstrated that the presence of a fixed AluY insertion, with no other young AluY insertions or known genes in the region. Nearly all of these less-diverged elements are of the AluY subfamily, so we restrict our analysis to AluY elements. We selected 19 such AluY-containing regions based on previous characterization [AluY element, and five are defined by AluY insertions that are still polymorphic for presence or absence in humans. We then identified a total of 206 SNPs in these regions by searching public databases and by resequencing 1 kb stretches of DNA at ~5 kb intervals flanking the AluY insertion loci in seven individuals of African, European, and East Asian ancestry . This ascertainment design delivers evenly spaced SNPs and reduces the ascertainment bias for common European SNPs that pervades most large publicly available data sets, such as the HapMap data. We then genotyped these SNPs in 347 individuals sampled from Sub-Saharan Africa (152), Europe (118), and East Asia (77) .\u00ae, Applied Biosystems).Sequencing of both strands in the targeted loci on the ascertainment panel of 21 individuals was carried out in our laboratory using an ABI 3100 sequencer (Applied Biosystems) and primer designs based on the human reference genome. SNPs were identified using PolyPhred [AluY region-by-continent data set, we used the default recombination rate model in PHASE 2.1  with a AluY region, in all individuals in the continental population sample) that exhibited more than 10 Mendelian inheritance conflicts were not analyzed. On a region-by-region basis, any individual with more than 50% missing data was removed .Where parent-offspring trios were available, we used them to obtain better haplotype reconstructions and recombination rate estimates. Within trios, genotypes that were incompatible with Mendelian inheritance were treated as missing data. Data subsets  as a function of seven variables:We then used stepwise-fitted linear regression  to test10 scale), which allows us to factor out and test for a potentially confounding relationship between interval length, recombination rate, and AluY presence or absence.(1) The length of the inter-SNP interval .(2) The mean (3) The G+C base pair composition of the interval. This is known to be correlated with recombination rates at broad scales ,15,34 an(4) The number of copies per interval of a 7-bp GC-rich \"core\" motif (CCTCCCT) that is associated with recombination hot spots .AluY copies, and their potential recombinogenic effects might explain some or all of any effect that AluY insertions might have on the recombination rate. Instances of each motif and its reverse complement were identified and counted in the UCSC hg18 reference human genome sequence.(5) The number of copies per interval of an \"extended\" degenerate motif (CCNCCNTNNCCNC) that is associated with recombination hot spots . The corper se, they do correspond to small (mostly <10 kb) regions where recombination rates several times higher than in the surrounding regions. In effect, we use the presence of a hot spot as a proxy for the unknown local genomic features that presumably cause hot spots.(6) An indicator variable, indicating whether or not an interval overlaps a hot spot . AlthouAluY insertion in the interval.(7) Lastly, the variable of interest in this work: an indicator of the presence (1) or absence (0) of an AluY insertions and the recombinogenic motifs that sometimes occur in them, we generated subsets of the HapMap data by removing all AluY regions where the focal AluY contained either recombinogenic motif. Our findings remained essentially unaltered, indicating that the effects of the motifs were well accounted for in the linear regression models.In an alternative test of the independence of the effects of AluY insertion, it was not possible to find such regions that were also free of copies of other repeat sequence families, because those are too common. If copies of other families affect recombination and are strongly correlated with young AluY insertions at the ~4 kb scale we used, those effects could cancel out or be confounded. To test this possibility for LINE L1, HERV, Alu repeats other than AluY, and DNA repeats (separately), we constructed additional variables that indicate whether an inter-SNP interval overlaps a repeat of that class or not . Those four classes account for the vast majority of non-AluY repeats in the genome. Adding these new variables into our linear regression models caused only trivial and statistically non-significant changes in the size of the effect of AluY repeats on recombination: the effect size coefficients changed by no more than 4% of the original estimate at most, and by only 0.7% on average. Thus other repeat sequences can be safely treated as uncorrelated background effects.Although it was possible to identify many ~50 kb regions in the human genome that contained exactly one young AluY insertions in our data are nearly always in the central interval of each region, where information about recombination events should be sufficient for unbiased estimates. Lower recombination rate estimates in terminal intervals due to an \"edge effect\" could cause recombination rates at internal intervals  to appear significantly higher than the local average.PHASE relies on the pattern of linkage disequilibrium between SNPs to infer the historical rates of recombination in the genomic intervals defined by those SNPs. For intervals at the end of a region of neighboring SNPs, however, there are no further SNPs on one side. This could limit the ability of PHASE to detect evidence of past recombination events, which could result in a downward bias in recombination rate estimates for those intervals. The AluY in the HapMap YRI and CEU samples , terminal intervals had a modestly but significantly lowered recombination rate . Sub-terminal intervals exhibited a similar effect in the YRI data set only . Other internal intervals  showed no position effects. The remaining data sets derived from our world diversity panel are all much smaller, and no edge effect was detected for the terminal or sub-terminal intervals there.We examined our data for edge effects by including additional indicator variables in the linear regression model described above. These variables indicated whether or not (1 or 0) and interval was terminal, sub-terminal, sub-sub-terminal, and so on, in its region. In the HapMap data sets, where each region has eleven intervals, this requires five variables. In the large data sets for fixed AluY in the YRI and CEU samples, and for polymorphic AluY in the YRI sample). In the smaller data sets derived from our world diversity panel, the AluY are not as tightly correlated with the central interval in a region; in one case, the AluY is in a sub-terminal interval. For these data sets, we nonetheless dropped all terminal intervals from all analyses. The exclusion of terminal and/or sub-terminal intervals has some quantitative impacts, but does not qualitatively affect the results of any of our analyses.In order to eliminate edge effects from our data, we removed the terminal and sub-terminal intervals from all linear regression analyses on the HapMap-derived data sets  the insertions have been mapped to a specific location in an autosome, (2) they are no more than 10% diverged from their respective AluY subfamily consensus sequences, (3) they are between 250 and 350 bp in length, (4) no more than 10% of any insertion consists of inserted non-AluY sequence, (5) no more than 10% of the subfamily consensus sequence is missing from the insertion. We identified 113,852 such AluY insertions.To extend our analysis to a different set of individuals and a larger set of loci, we turned to the publicly available HapMap data set . We anal Browser  \"rmsk\" d Browser ) for allAluY region and SNP ascertainment strategies that we used for our own genotyping project  to select comparable AluY regions and evenly-spaced SNPs from the HapMap data. Out of the AluY insertions identified as above, we selected only those that had no other AluY fragments  within 25 kb of the AluY locus. We used the more demanding 10% MAF threshold (instead of 5%) in order to obtain better recombination rate estimates. Among SNPs that met those criteria, we chose sets that maximized the uniformity of the inter-SNP interval lengths (as our own ascertainment procedure above did). We then ranked the HapMap AluY regions according to the evenness of SNP spacing and selected regions with the highest evenness for further analysis. AluY regions and SNPs were ascertained separately for the HapMap YRI and CEU data sets. For the analysis of polymorphic AluY insertions, AluY regions with 12 SNPs each were selected and constructed as above, after using liftOver [We then emulated the n dbRIP; ) within liftOver  to transAluY regions, SNP loci, genotypes, recombination rate estimates and all other predictor variables computed on inter-SNP intervals) are available from the authors on request.The SNPs discovered in this work have been submitted to dbSNP. All the data sets used in this work (Alu polymorphisms used in this study. MB participated in the conception, design and coordination of this study. LJ conceived of the study and participated in its design, coordination, and in manuscript preparation. All authors read and approved the final manuscript.DW participated in the conception of this study, designed and carried out the statistical analyses, and drafted the manuscript. WW participated in the design of the data collection strategy and in the ascertainment and genotyping of variants in our world diversity panel. YZ participated in the sequencing and genotyping. JX participated in designing the study and in preparing the manuscript. WT participated in genotyping of variants in the world diversity panel. DH participated in the ascertainment of"}
+{"text": "Among the three functions of DNA, mammalian replication and transcription can be subject to epigenetic imprinting specified by the parental origin of chromosomes, and although there is suggestive indication that this is also true for meiotic recombination, no definitive evidence has yet been reported.Kcnq1 transcriptionally imprinted domain showed significantly higher recombination activity in the CAST\u00d7B6 parental direction (p < 0.03). Characterizing hotspots within this domain revealed a cluster of three hotspots lying within a 100 kb span, among these hotspots, Slc22a18 showed a definitive parent of origin effect on recombination frequency (p < 0.02). Comparing recombination activity in the mouse Kcnq1 and neighboring H19-Igf2 imprinted domains with their human counterparts, we found that elevated recombination activity in these domains is a consequence of their chromosomal position relative to the telomere and not an intrinsic characteristic of transcriptionally imprinted domains as has been previously suggested.We have now obtained such evidence on mouse chromosome 7 by assaying meiotic recombination as it occurs in reciprocal F1 mice. A 166 kb region near the Similar to replication and transcription, we demonstrate that meiotic recombination can be subjected to epigenetic imprinting and hotspot activity can be influenced by the parental origin of chromosomes. Furthermore, transcriptionally imprinted regions exhibiting elevated recombination activity are likely a consequence of their chromosomal location rather than their transcriptional characteristic. DNA serves three major functions; it is replicated, providing the material for hereditary transmission from one generation to the next; it is transcribed, expressing its stored information as a variety of RNA products; and it undergoes meiotic recombination, generating population variation and substrates for evolution. Two of these processes, replication ,2 and trTranscriptional imprinting is characterized by the silencing of one parental-specific allele in the offspring -9, and aAmong the three functions of DNA, meiotic recombination is the only process that involves physical interactions between the two parental chromosomes. Meiotic recombination begins in meiosis I with a Spo11 mediated double strand break (DSB) .H19-Igf2 and Kcnq1 domains, show higher male recombination activity [In mammals, where recombination initiates prior to synapsis, meiotic crossovers occur at preferred 1\u20132 kb regions, known as recombination hotspots. Currently, no comprehensive model exists that accounts for the location and activity of recombination hotspots. Regional differences in recombination frequencies have been associated with both transcriptionally imprinted regions and regions near telomeres. Telomeric regions in both humans and mice generally have higher male than female recombination activity -15 and iactivity .H19-Igf2 and Kcnq1 imprinted domains, located on the distal region of chromosome 7, provide a model for examining if meiotic recombination hotspot can be subjected to epigenetic imprinting where recombination activity is affected by the parental origin of the recombining chromatids. Mapping recombination rates in this region, we found one region near the Kcnq1 transcriptionally imprinted domain subject to meiotic recombination imprinting as evidenced by recombination being much elevated in F1 animals arising from one parental direction of the cross versus the opposite. Fine mapping of recombination activity within this region to hotspot level resolution showed a cluster of three hotspots whose meiotic recombination activities are imprinted.The mouse H19-Igf2 and Kcnq1 imprinted domains in humans and mice [Kcnq1 domain, suggesting that recombination activities of hotspots within transcriptionally imprinted domains are influenced by their chromosomal position and not all transcriptionally imprinted domains exhibit elevated recombination activity.Additionally, while the imprinting mechanisms are identical in the and mice ,18, the H19-Igf2 and Kcnq1 transcriptionally imprinted domains on mouse chromosome 7  in 5,914 meioses of a cross between the C57/BL6J and CAST/EiJ strains , yielding a sex-averaged recombination rate of 0.14 cM/Mb, approximately 4 times lower than the genome average of 0.5 to 0.6 cM/Mb [Kcnq1 imprinted domain (142.727\u2013143.400 Mb), encompassing genes between Th and Nap1l4, contained 119 recombinants yielding a crossover activity of 2.98 cM/Mb, five times the mouse genome-wide average.We mapped crossover events within the .6 cM/Mb ,19 . None of the other intervals within the H19-Igf2 and Kcnq1 transcriptionally imprinted domains showed any significant differences in recombination activity between the two reciprocal parental crosses.We further mapped the recombination activity within this latter region to an average resolution of about 172 kb and compared the recombination activity between reciprocal parental crosses (B6\u2640 \u00d7 CAST\u2642 vs. CAST\u2640 \u00d7 B6\u2642) to detect if the chromosomal origin of the parental chromosome affects meiotic recombination. A meiotic recombination imprinting effect was found in a 166 kb region near distal side of the n Figure . This reKcnq1 domain to hotspot resolution, revealing five highly active hotspots. These hotspots were named according to their closest neighboring gene , while hotspots Kcnq1, Cdkn1c, Slc22a18 and Nap1l4 were mapped to a resolution of 2.3 kb or less. We considered the 11 kb Th interval as a single hotspot as it is unlikely that multiple hotspots will be found within such a short interval [Th, Cdkn1c and Nap114) were located in intergenic regions and two hotspots were found within introns; hotspot Kcnq1 within a large intron of 65 kb while hotspot Slc22a18 is located within a short 4 kb intron.To better understand whether meiotic imprinting influences recombination at a regional or hotspot level, we mapped the crossovers occurring in the e Figure , Table 1interval . Of the Cdkn1c, Slc22a18 and Nap1l4. These hotspots clustered within a 100 kb region , and, as a cluster, all three hotspots showed elevated recombination activity in CAST\u2640 \u00d7 B6\u2642 F1 mice regardless of whether the recombination occurs in the male or female germline . This differential recombination activity between reciprocal crosses was statistically significant for Slc22a18 (PFET = 0.02 without Bonferroni correction and PFET = 0.10 with Bonferroni correction), however, the number of crossovers at each of flanking hotspots, although consistent with a parent of origin effect, was not sufficient to provide low p values  and epiCdkn1c, even with 5,914 meioses, they do lean in the direction of suggesting that meiotic recombination imprinting regulates recombination activity by directing DSBs preferentially towards one chromatid. It is possible that DSB initiation is favored towards the paternal chromosome at all of the imprinted hotspots  clustered within 100 kb; unfortunately the lack of suitable SNPs precluded testing the remaining hotspots within this region. This is the first detailed examination of meiotic recombination imprinting at a specific hotspot.Although our data is limited by the number of recombinants observed at hotspot Slc22a18 region. This would require imprinting of gene function during meiosis, shifting the imprinted region from Slc22a18 to another site. It is also possible that a trans-acting gene controlling recombination in the Slc22a18 region is located on the X chromosome as reciprocal F1 males are XB6YCAST v. XCASTYB6; again, the B6 and CAST alleles of this putative gene would have to differ in their activating ability. In this context, we should point out that trans control of some hotspot activities, albeit by an autosomal locus, has been reported [We should also point out two alternative theoretical possibilities that, although unlikely, could explain our results. There could exist a trans-acting gene that is both subject to imprinting and whose B6 and CAST alleles differ in their ability to control recombination in the reported ,29.Kcnq1 domain (data not shown). It is likely that meiotic imprinted hotspots are not a common occurrence, and the challenge is now to find additional hotspots subject to meiotic recombination imprinting and characterize their molecular mechanism.We have expanded our analysis to over 10 Mb near the distal end of chromosome 7, but no other region showed a meiotic recombination imprinting effect bias similar to those observed near the H19-Igf2 and Kcnq1 transcriptionally imprinted domains showed elevated male recombination activities [H19-Igf2 region is in marked contrast to the human H19-Igf2 recombination pattern. In addition, the difference in recombination activity between the two transcriptionally imprinted domains in mice indicates that elevated recombination is not necessarily correlated with transcriptional imprinting.Human transcriptionally imprinted regions have been associated with elevated recombination frequencies ,5,16,30.It is likely that the location of hotspots relative to the telomeres has a greater influence on recombination activity. It appears that sex-biased recombination activity (or any recombination activity) is not a general characteristic of mammalian transcriptionally imprinted domains, and recombination within these imprinted regions is likely influenced by their relative position to the telomeres.Kcnq1 imprinted domain, and comparing recombination activity of F1 animals from reciprocal parents obtained evidence that meiotic recombination imprinting can influence crossover activity at a cluster of three closely spaced hotspots. These results suggest that, like replication and transcription, meiotic recombination can be subjected to epigenetic imprinting. However, any epigenetic marker for recombination is likely independent of DNA methylation as the methylation pattern of germ cells are reported to be erased and re-established prior to meiosis. Recombination activity in the H19-Igf2 and Kcnq1 chromosomal regions showed that transcriptionally imprinted mammalian regions do not necessarily have elevated recombination activity. The higher recombination activity observed at Kcnq1 is likely a consequence of their chromosomal location rather than their imprinted characteristic.We mapped five new recombination hotspots in the 2, 0.1 mg/ml gelatin, 0.45% v/v Nonidet P40, 0.45% v/v Tween 20, and 60 mg/ml proteinase K. After digestion, 100 \u03bcl of 100 mM Tris-HCl (pH 8.0) were added and samples were diluted 10\u00d7 in 10 mM Tris-HCl (pH 8.0) for genotyping.Mice were purchased from The Jackson Laboratory. The DNA samples used in this study were previously described elsewhere . They caAll progeny were initially genotyped using two SNP markers flanking the H19-Igf2 and Kcnq1 transcriptionally imprinted regions. Crossovers were detected as a transition from homozygous to heterozygous genotype or vice versa. Informative meioses were further mapped using 4 additional SNP markers to achieve a resolution of less than 200 kb. This broad-scale genotyping was carried out by KBiosciences (UK) using SNPs markers from the publicly available Perlegen SNP database [see additional file Kcnq1, CdKn1c, Slc22a18 and Nap1l4, where the Perlegen data was incomplete, additional SNPs were obtained by sequencing CAST and B6 genomic DNA. New assays were developed for the Chemicon Amplifluor SNPs HT FAM-JOE System . Primers were designed using the Amplifluor AssayArchitect software . Reactions were carried out in 384 well plates using 5 \u03bcl reaction volume consisting of 30 ng DNA, 0.5 \u03bcl of 10\u00d7 Reaction Mix S Plus, 0.4 \u03bcl 2.5 mM each dNTP, 0.25 \u03bcl 20\u00d7 FAM Primer, 0.25 \u03bcl 20\u00d7 JOE Primer, 0.25 \u03bcl SNP specific primer mix  and 0.025 \u03bcl Titanium Taq DNA polymerase . PCR was performed as suggested by the manufacturer. End-point discrimination of the alleles was carried out on an ABI 7900 HT Real-time PCR system .To fine map hotpots to less than 5 kb resolution, SNPs were obtained from the Perlegen SNP database. For hotspots SN, PP and KP conceived of the study and participated in the design of the experiments. LP, EP participated in the design and optimization of the study. SN carried out the primer design, SNP genotyping, analysis of the data, and drafted the manuscript. RM carried out the high resolution SNP genotyping and primer design.SNPs markers used in the study for mapping recombination events. The two tables provided represent the SNPs used in the study for mapping recombination events (Table ts Table  and the ts Table .Click here for file"}
+{"text": "He) at SSRs and allozymes than selfing or annual species. However, some of these tree taxa have surprisingly low levels of nucleotide diversity at the DNA sequence level, which points to recombination as a potential generator of genetic diversity in these organisms. In this study, we examine how genome-wide and within-gene rates of recombination evolve across plant taxa, determine whether such rates are influenced by the life-form adopted by species, and evaluate if higher genome-wide rates of recombination translate into higher He values, especially in trees.Despite its role as a generator of haplotypic variation, little is known about how the rates of recombination evolve across taxa. Recombination is a very labile force, susceptible to evolutionary and life trait related processes, which have also been correlated with general levels of genetic diversity. For example, in plants, it has been shown that long-lived outcrossing taxa, such as trees, have higher heterozygosity (He (0.83 \u00b1 0.29), and that trees have higher rates of genome-wide recombination than short-lived herbs and shrubs. A significant taxonomic component was further made evident by our models, as conifers exhibited lower recombination rates than angiosperms. This trend was also found at the within-gene level.Estimates of genome-wide (cM/Mb) recombination rates from 81 higher plants showed a significant phylogenetic signal. The use of different comparative phylogenetic models demonstrated that there is a positive correlation between recombination rate and Altogether, our results illustrate how both common ancestry and life-history traits have to be taken into account for understanding the evolution of genetic diversity and genomic rates of recombination across plant species, and highlight the relevance of species life forms to explain general levels of diversity and recombination. He) . These He. In the present study, we addressed these three key issues on higher plants by using a comparative phylogenetic approach on a large sample of average rates of recombination, estimated from total genetic map lengths and physical genome sizes, and mean values of He, calculated with SSR loci. We provide a first insight into the evolution of the genome-wide recombination rate across plant lineages, and show how this source of genetic variation is affected by different life traits once the phylogenetic signals of all parameters are accounted for. The control of such signals allowed us to discern whether species share similar levels of recombination due to common ancestry and/or to convergent life-history traits, such as growth habit, that have arisen independently in different lineages . Fin. FinHe. He at SSR loci were gathered for 81 higher plant species  that were classified according to their type of life-form . A preliminary standard correlation analysis (i.e. uncorrected for the phylogenetic relationships among species) revealed that these two traits were negatively correlated, and that trees had higher recombination rates than herbs but similar to shrubs , as the observed variance of the PICs for the recombination rate (0.0433) was much lower than expected by chance (0.2469).Estimates of genome-wide rate of recombination and bs Table . A set oHe , and marginally superior than in shrubs  between the genome-wide rate of recombination and He Fig. , and shoHe Fig. . The ind \u00b1 0.29 bHe, with a very similar value to the one obtained with the previous model (0.84 \u00b1 0.22). Furthermore, an important effect of life form, with conifer trees having significantly lower recombination rates than angiosperm trees and shrubs , a comparative analysis was performed on within-gene recombination rates recalculated from available nuclear gene DNA sequences retrieved from public databases  were lower in conifers than in angiosperms, while most of the non-conifer trees exhibited higher values than the non-domesticated herbs and shrubs, with the possible exception of Zea mays ssp. parviglumis. These results are obviously only exploratory, but they do open the door for extended comparisons once enough genomic data and physical genetic maps are available.The patterns obtained roughly point in the same direction than the trends observed at the genome-wide level  included, and the use of randomised datasets to determine significance, provided enough power to detect the presence (or absence) of a phylogenetic signal in our recombination rate data. The distribution of values was clearly non-random Figs.  &2, whic1 includeHe estimates at allozymes and SSRs . Furand SSRs ,33. This14 e.g. ,35], and, andHe e14 . Hown and He . On the n and He ,38,39]. Several studies have shown that the plant genome structure is highly heterogeneous and that recombination is not randomly distributed, occurring primarily within genes . SucThese similar levels of conservation in recombination rates inferred at different scales across plant species strongly differ from what has been reported for mammals. In these taxa, the rates of recombination at short scales appear to evolve faster than the rates at the genome-wide level , which sAmong the surveyed tree species, conifers seemed to be a remarkable exception. Most of the genome-wide recombination estimates for these taxa were far lower than those from angiosperms Figs. . Indeed,Arabidopsis), the genome regions where these elements occur have reduced levels of recombination , ,41, Arabon [e.g. ,41, but He along with low amounts of nucleotide diversity at candidate genes , we pooled all the data. Only those maps covering at least 60% of the genome were included in the database. Estimates of genetic map lengths (in cM) were corrected in order to account for variation in marker density across studies, and for undetected crossovers at distal terminal markers, as suggested elsewhere [He at SSR markers were also collected. Microsatellites were preferred to other codominant markers due to their increasing availability in the literature, to their putative neutrality and to their association with non-repetitive DNA in plant genomes, including trees [He values calculated from variation in at least five microsatellite repeats were included. Estimates based on population studies were favoured, but in some particular cases where such studies were not available , values determined from preliminary screen panels had to be used. The complete database and references to the primary literature are available in Additional file The average genome-wide recombination rate was calculated in cM/Mb for 81 plant species from 38 families including dicots, monocots and conifers. It was determined based on published estimates of total genetic map length and physical genome size as described elsewhere . Diploidlsewhere ,45,46. Elsewhere , or retrng trees ,49. Onlyet al. [Species were assembled in a phylogenetic tree with the program Phylomatic as implemented in Phylocom 3.41 . This pret al.  and adjuet al. .et al. [K statistic and its associated P-value were estimated from the variance of standardized contrasts, and compared with those obtained from a null model performed by reshuffling the trait values across the tips of the phylogeny. A significant phylogenetic signal was inferred at \u03b1 = 0.05 when the mean observed variance of the contrasts was lower than 95% of the values produced by the null model. The phylogenetic independent contrasts were calculated for both the recombination rate and He by using the APE package for R [The presence of a phylogenetic signal for the recombination rate was determined following the procedure of Blomberg et al. ,54. Briege for R .He and life-form, three independent Generalized Linear Models were built. The first model was a non-phylogenetic (i.e. without taking the phylogenetic information of species into account) GLM with a Gaussian distribution of errors, which was made between the (log-transformed) recombination rate of species as dependent variable, and their respective He and life forms as dependent variables. In the second model, the phylogenetic relationships of species were incorporated as a correlating matrix, obtained from the phylogenetic tree above, into the GLM by using the generalized estimating equation (GEE) procedure. Such a procedure is generally used to fit the parameters of a GLM when the observations are correlated or non-independent. In our particular case, the common ancestry of species is a source of non-independence, which was taken into account with the inclusion of the above-mentioned matrix. The third model was similar to the second one, but on it, it was assumed that conifers and angiosperm trees were different \"life-forms\". The GEE procedure used in these last two models was the one implemented in the APE package [In order to determine the putative correlations between species ancestry,  package .Populus tremula or from Balsas for Zea mays ssp. parviglumis.Original DNA sequences from nuclear genes of non-domesticated species were downloaded from GenBank or obtained directly from the authors , and edited and aligned with Lasergen SeqMan vs. 7 . Domesticated taxa were deliberately excluded because most studies in these species focused on genes related to domestication, which typically show low levels of polymorphism and have followed artificial selection. Only those sequences spanning at least 800 base pairs (bp), having a minimum of 10 segregating sites, and sampled for more than 20 chromosomes were taken into account. Similarly, only DNA sequences from regions with low genetic differentiation or from single populations were used for those species with known population structure. For example, only sequences from Sweden were considered for \u03b8\u03c0), the minimum number of recombination events (Rm) [\u03c1), and the recombination to mutation ratio (\u03b8/\u03c1). The first two statistics were computed using DnaSP vs. 4.2 [\u03c1 and \u03b8/\u03c1 were calculated with the composite-likelihood method of Hudson [rhothetapost software [Quercus crispula [Hordeum spontaneum [The aligned contigs were then used to estimate different diversity and recombination parameters such as the average number of nucleotide differences (nts (Rm) , the pop vs. 4.2 , while tf Hudson  implemenf Hudson , and witsoftware . Contrarcrispula  and Hordontaneum  and inclf: ratio of gene conversion to cross-over; He: mean expected heterozygosity; Mb: megabase; PIC: phylogenetically independent contrast; SSR: simple sequence repeats.cM: centimorgan; JPJ-C conceived the study, collected the data and wrote the manuscript, MV conceived the study, analysed the data, and edited the manuscript, SCGM conceived and coordinated the study, analysed the data, and edited the manuscript. All authors read and approved the final version of the manuscript.He) for 81 higher plant species classified according to their type of life-form. The rates of recombination were corrected following Hall & Willis (2005).Number of chromosomes and estimates of genetic map length, physical genome size, genome-wide rate of recombination and mean expected heterozygosity at SSR's (Click here for fileComparison of estimates of nucleotide diversity and recombination rates across different types of wild plant life-forms based on nuclear gene DNA sequences from population studies.Click here for file"}
+{"text": "Sexual reproduction depends on a specialized type of cell division called meiosis to generate the sperm and egg cells (gametes) that fuse to form an embryo. Meiosis carries out two important functions: recombination, which generates the diversity on which evolution acts, and reduction of the chromosome number from the full complement (diploid) to half (haploid). Every somatic cell in the human body contains 23 pairs of chromosomes: one set from the mother and one set from the father. When these cells divide, every daughter cell gets one copy of each pair of chromosomes. However, if the gametes contained both sets of chromosomes when they combined during fertilization, the embryo would have twice the normal amount of genetic information. Meiosis  avoids tIn many organisms including yeast, mice, and humans, an essential feature of meiosis is genetic recombination. Recombination creates diversity by mixing the genetic information from each parent into new combinations. Recombination events can be either a reciprocal exchange of DNA called a crossover or a nonreciprocal exchange called a gene conversion or noncrossover . It is tSaccharomyces cerevisiae, double-strand breaks occur within a few hundred base pairs of transcriptional start sites. However, only some of these hotspots  can be shown to be activated by transcription factors. The well characterized hotspot located within the promoter of the gene HIS4 is dependent on the transcription factors Bas1/Bas2 [Schizosacharomyces pombe also uses transcription factors to initiate some recombination. One of the best-characterized hotspots is the M26 allele of the ade6 gene [ade6 locus. It has been shown to be a binding site for the stress response transcription factor Atf1-Pcr1 and, as in S. cerevisiae, recombination is dependent on this transcription factor. However, the transcription factor binding sequence is not sufficient for hotspot activity even when the Atf1/Pcr1 is present, indicating that other chromosomal features are necessary [In all organisms analysed to date, recombination is initiated by a double-strand breaks in the DNA catalysed by a protein called Spo11 . In manyas1/Bas2 , Rap1 [9as1/Bas2  for fullas1/Bas2  transcriecessary . The opeecessary . Recent ecessary . Thus, rtrans-acting factors can be seen from the elegant work of Coop et al. [RNF12 gene. Interestingly this polymorphism is associated with high rates of recombination in males and lower rates in females, indicating that sex-specific factors influence its activity. Indeed, a colleague and I suggested that sex-specific hormonal control of transcription factors might account the differing patterns of recombination in male and female meiosis [Recombination frequencies are modulated by genetically determined factors in higher organisms as well. In humans, there is variation of total crossover frequencies from individual to individual , whereasp et al.  and Kongp et al. . Coop et meiosis , althoug meiosis .PLoS Biology identify a region of DNA that, when derived from a particular mouse strain, stimulates crossing over at hotspots that are located megabases away on the same chromosome, while repressing others and also acting on hotspots located on different chromosomes. This research identifies trans -acting factors in an experimentally tractable mammalian system. These two groups, using two very different experimental approaches, have defined a region of 5.3\u20136.7 megabases whose genotype can influence crossing over genome wide. This factor modifies the distribution of crossovers thus altering the genetic map with no loss of over overall crossing over.Unfortunately, humans are not an experimentally tractable organism and yeasts are not mammals. And indeed one of the catch 22's of recombination studies is that while sequence divergence and genetic diversity are necessary to study recombination, they themselves can influence the outcome . Thus, iMus musculus molossinus [cis and trans. By using sequence polymorphisms between two mouse backgrounds to map crossovers, the researchers defined the hotspot as a narrow region where recombination is initiated [Mlh1 [Mlh3 [S. cerevisiae [trans-acting factor that they have named Dsbc1 (double-strand break control 1).The group of de Massy has extensively analysed recombination at the Psmb9 locus using single-molecule crossover and conversion assays ,31,32. Wlossinus   and a laboratory mouse to specifically search for trans-acting loci affecting recombination on Chromosome 1. They found a 5.3-megabase region from the CAST/EiJ mouse that is contained within the region on Chromosome 17 found by Grey et al [trans-acting factors are the same, it is interesting to note that the source of the sequence in the wm7 haplotype could be Mus musculus casteneus.The Paigen group used an altogether different approach of interstrain crosses between a wild mouse ey et al . They haBoth groups have demonstrated that both crossovers and noncrossovers are affected, indicating that the factor(s) influence initiation. Both groups have found that some hotspots are stimulated, some suppressed, and others not affected at all, indicating, not surprisingly, that the control of recombination is complex, as in the yeasts. How Dsbc1/Rcr1 acts is not clear. Both groups speculate that it is influencing chromatin structure, although the Paigen group argue that the regions affected are small, since two very close hotspots are differentially affected. The identification the gene(s) encoding these factors will hopefully shed light on the mechanism of action and contribute greatly to our understanding of the regulation of the important process of meiotic crossing over."}
+{"text": "The very small baskets of 2F and 3F used via miniature ureteroscopes are very flimsy. Whenthe sheath is removed, it becomes possible to use an otherwise 3F basket via a 2F channel. (b)The operator can work the basket usingjust two fingers close to the instrument channel port. This is moreergonomic than working an opening mechanism at the end of the basket, because this latter systemtakes the operator's hand away from the instrument. (c) The basket can be detached more readily from the ureteroscope, should it become, impacted together with a stone within the ureter. This makesit possible to reinsert the ureteroscope alongside the basket and fragment the stone within the basket,provided that there is no reinforced section to the inner wire at the handle.The conventional use of a basket involves a metallic wire section that is contained within a polythene sheath. The wire basket can be withdrawn or protruded from the sheath using a handle. The advantageof this system is that the basket can be kept shut or open at will within the ureter. Thus one cankeep the basket closed in order to maneuver the basket past a stone before opening it above the stone.With the development of efficient and safe lithotripsy modalities becoming widely available and withminiaturization of these and the ureteroscopes, it is becoming less common to dilate the ureter.Therefore it is not frequently possible to extract a stone intact. Baskets still can be used secondarilyto extract the fragments. It is possible to use the basket wire without its sheath. The ureteroscopechannel effectively becomes the sheath, and the basket opens immediately on protruding it beyondthe ureteroscope. This has the following advantages: ("}
+{"text": "It has been recognized that the tumour markers alpha-fetoprotein (AFP) and human chorionic gonadotrophin (HCG) may show a transient elevation after the initiation of chemotherapy in non-seminomatous testicular cancer. We investigated the prognostic importance of these so-called marker surges in a cohort of patients treated with cisplatin combination chemotherapy between 1983 and 1991. A total of 669 patients were studied. Of 352 patients who had an elevated AFP at the start of treatment and for whom we had data at both day 1 and day 8, 101 (29%) had a surge. Of 317 patients for whom we had data for HCG, 80 patients (25%) had a surge. It was found that an AFP surge was a strong adverse prognostic factor for progression . There was no statistically significant difference in survival . There was no prognostic significance of a HCG surge, either for progression or for survival. To investigate whether a surge was an independent prognostic factor for progression and survival, multivariate Cox regression models were fitted using the independent prognostic factors for progression and survival and the surge/decline variable. An AFP surge was retained in the final model for progression. A HCG surge was of no prognostic importance for progression or survival. We conclude that an AFP surge has an adverse prognostic significance, independent of pretreatment characteristics."}
+{"text": "Begomovirus (family Geminiviridae), with potential recombination hot- and cold-spots also having been identified. Nevertheless, because very little is understood about either the biochemical predispositions of different genomic regions to recombine or what makes some recombinants more viable than others, the sources of the evolutionary and biochemical forces shaping distinctive recombination patterns observed in nature remain obscure. Here we present a detailed analysis of unique recombination events detectable in the DNA-A and DNA-A-like genome components of bipartite and monopartite begomoviruses. We demonstrate both that recombination breakpoint hot- and cold-spots are conserved between the two groups of viruses, and that patterns of sequence exchange amongst the genomes are obviously non-random. Using a computational technique designed to predict structural perturbations in chimaeric proteins, we demonstrate that observed recombination events tend to be less disruptive than sets of simulated ones. Purifying selection acting against natural recombinants expressing improperly folded chimaeric proteins is therefore a major determinant of natural recombination patterns in begomoviruses.With the development of reliable recombination detection tools and an increasing number of available genome sequences, many studies have reported evidence of recombination in a wide range of virus genera. Recombination is apparently a major mechanism in virus evolution, allowing viruses to evolve more quickly by providing immediate direct access to many more areas of a sequence space than are accessible by mutation alone. Recombination has been widely described amongst the insect-transmitted plant viruses in the genus  The exchange of genetic material between different virus species, called inter-species recombination, has the potential to generate, within a single genome replication cycle, an almost unimaginable number of genetically distinct virus strains, including many that might cause deadly new human, animal, or plant diseases. Many fear that inter-species recombination could provide viruses with quick access to evolutionary innovations such as broader host ranges, altered tissue tropisms, or increased severities. However, mounting evidence suggests that recombination is not an unconstrained process and that most inter-species recombinants that occur in nature are probably defective. It is suspected that networks of coevolved interactions between different parts of virus genomes and their encoded proteins must be kept intact for newly formed inter-species recombinants to have any chance of out-competing their parents. One category of coevolved interaction is that between contacting amino acids within the 3-D structures of folded proteins. Here we examine the distributions of recombination events across the genomes of a group of rampantly recombining plant viruses and find very good evidence that this class of interaction tends to be preserved amongst recombinant sequences sampled from nature. This indicates that selection against misfolded proteins strongly influences the survival of natural recombinants. Besides its vital cellular role in maintaining and repairing broken DNA molecules ,2, recomIn virology, two recombinational processes can be distinguished: genome reassortment and true recombination. Genome reassortment, also called pseudo-recombination, involves the exchange of intact genome components between viruses with multipartite genomes to yield viruses whose genomes are comprised of new combinations of components. True recombination, on the other hand, involves the exchange of genetic material between individual genomic molecules. The rearrangement of genetic information mediated by both true recombination and pseudo-recombination must yield fully functional and reasonably fit genomes for these processes to be easily detectable in nature. However, analysis of the functionality of recombinant genes ,9 and thWhile full accounts of experimentally verified intra-genome interactions are currently unavailable for any virus species, potential amino acid interactions within folded proteins can be inferred with reasonable accuracy given high resolution protein structural data. In the past five years, protein engineers have made substantial progress in the development of computational methods capable of accurately inferring degrees of recombination-induced fold disruption in experimentally generated chimaeras of proteins with known structures ,14,15. Arep) gene encoding a protein for which a high resolution crystal structure is available. In this paper we describe an expanded analysis of recombination amongst begomoviruses. We identify sets of unambiguously unique recombination events detectable in publicly available monopartite begomovirus DNA-A-like sequences and bipartite begomovirus DNA-A sequences. We then determine the distribution of recombination breakpoints across the analysed sequences and confirm the recombination hot- and cold-spots identified previously. We use a method called SCHEMA  (AY795983), ToLCYTV-[Dem] (AJ865341), and TYLCSV (X61153). The Protein Data Bank (http://www.pdb.org/) ID number for TYLCSV N-terminal region structure is 1L2M.The National Center for Biotechnology Information ("}
+{"text": "We studied the clinical significance of the soluble cytokeratin 19 fragment detected with monoclonal antibody CYFRA 21-1 in the sera of patients with histologically proven gastric cancer. Sera of 110 patients with gastric cancer were analysed for CYFRA 21-1 levels by a two-step sandwich enzyme immunoassay. There were no significant differences between CYFRA 21-1 levels and the histotype, depth of invasion or vessel invasion. However, CYFRA 21-1 was significantly higher in the presence of peritoneal metastases, liver metastases and extensive nodal involvement. When the positive cut-off value was defined as 5 ng ml-1, the CYFRA 21-1 in the stage IV and recurrent cases was 55.6% and 66.7%, respectively, which was as high as carcinoembryonic antigen (CEA) and greater than carbohydrate antigen 19-9 (CA 19-9). The positivities in stage I/II and III were zero and 5.9%, respectively, and false-positive rate in 76 patients with benign gastrointestinal disorders was 2.6%. There appeared to be no correlation between CYFRA 21-1 and CEA or CA 19-9. The patients with above 5 n ml-1 of CYFRA 21-1 had a significantly poorer prognosis. Multivariate analysis indicated that CYFRA 21-1 was an independent prognostic factor, while CEA and CA 19-9 failed to be of prognostic value. In conclusion, CYFRA 21-1 is a reliable tumour marker for gastic cancer in predicting very advanced cases, recurrence of the disease and overall poor prognosis."}
+{"text": "Tomato-infecting begomoviruses are widely distributed across the world and cause diseases of high economic impact on wide range of agriculturally important crops. Though recombination plays a pivotal role in diversification and evolution of these viruses, it is currently unknown whether there are differences in the number and quality of recombination events amongst different tomato-infecting begomovirus species. To examine this we sought to characterize the recombination events, estimate the frequency of recombination, and map recombination hotspots in tomato-infecting begomoviruses of South and Southeast Asia.Different methods used for recombination breakpoint analysis provided strong evidence for presence of recombination events in majority of the sequences analyzed. However, there was a clear evidence for absence or low Recombination events in viruses reported from North India. In addition, we provide evidence for non-random distribution of recombination events with the highest frequency of recombination being mapped in the portion of the N-terminal portion of Rep.The variable recombination observed in these viruses signified that all begomoviruses are not equally prone to recombination. Distribution of recombination hotspots was found to be reliant on the relatedness of the genomic region involved in the exchange. Overall the frequency of phylogenetic violations and number of recombination events decreased with increasing parental sequence diversity. These findings provide valuable new information for understanding the diversity and evolution of tomato-infecting begomoviruses in Asia. Bemisia tabaci) transmitted viruses in the family Geminiviridae. They inflict significant economic losses in many dicotyledonous crops including beans, cassava, cotton, melon, pepper, potato and tomato  and ToLCNDV-[Luf] were simple recombinants with only evidence of a single detectable recombination event involving a virus resembling ToLCPV sampled in the Philippines. While TreeOrderScan analysis also revealed an absence of recombination in two north Indian viruses, ToLCNDV-[PkT1/8] and ToLCNDV-[Luf]  to the pairwise distances of the fragments involved in exchange Fig. . In addiFinally, the variable recombination and diversity-dependent distribution of recombination hotspots in tomato-infecting begomoviruses is valuable new information that has emerged from this study. Perhaps this is the first report of variable recombination reported among tomato-infecting begomoviruses found in the same region. Further, recombinant forms, recombination hot spots and frequency of recombination documented in this study would provide new information for understanding the diversity and evolution of tomato-infecting begomoviruses in Asia. In addition to evolutionary considerations, understanding the implications of recombination observed in these viruses on efforts to develop resistant tomatoes through conventional breeding and genetic engineering are important and attempts should be focused on these issues for developing effective disease management strategies. Given that the N-terminal portion of rep is highly recombinogenic it is perhaps worrying that so many virus derived transgenic resistance strategies are focusing on this portion of the geminivirus genome -43. It mThe study sequences comprised 35 publically available (as on June 2006) complete Indian, Pakistani, Chinese, Bangladeshi, Sri Lankan, Malaysian, Thai, Philippine and Taiwanese tomato-infecting begomovirus DNA-A and DNA-A-like components  implemented in Splits Tree 4.3. PHI has been shown to powerfully identify the presence/absence of recombination within a wide range of sequence samples with a low false positive rate .The recombination breakpoint analysis was carried out using Recombination detection program RDP , GENECONTo examine phylogenetic support for each identified recombination event in the breakpoint analysis, we used the retained sequence position version of the TreeOrder Scan method  implemenEstimation of the frequency and mapping of the locations of recombination events was achieved by phylogeny compatibility analysis using the TreeOrder Scan method. First, the TreeOrder Scan program produces optimally ordered neighbor-joining trees for fragments of definite length along an alignment. In the next step, a pairwise comparison is made between trees constructed from each sequence fragment along the alignment. Then a phylogenetic compatibility value is computed as the number of times the phylogeny of one tree has to be violated to match the tree order observed in other trees constructed along the length of an alignment. In our case we assigned sequences to predefined groups based on their geographical origin and a bootstrap value of 70 per cent was used as threshold for scoring phylogeny violations. All pairwise compatibility values were calculated using trees constructed for 300 nucleotide sequence fragments separated by 100 nucleotides across the length of the analysed alignment. These compatibility values were then plotted on a phylogenetic compatibility matrix.The author(s) declare that they have no competing interests.HCP conceived and designed the study; HCP, MR executed the study and wrote the paper. Both the authors read and approved the final manuscript."}
+{"text": "Although recombination is essential to the successful completion of human meiosis, it remains unclear how tightly the process is regulated and over what scale. To assess the nature and stringency of constraints on human recombination, we examined crossover patterns in transmissions to viable, non-trisomic offspring, using dense genotyping data collected in a large set of pedigrees. Our analysis supports a requirement for one chiasma per chromosome rather than per arm to ensure proper disjunction, with additional chiasmata occurring in proportion to physical length. The requirement is not absolute, however, as chromosome 21 seems to be frequently transmitted properly in the absence of a chiasma in females, a finding that raises the possibility of a back-up mechanism aiding in its correct segregation. We also found a set of double crossovers in surprisingly close proximity, as expected from a second pathway that is not subject to crossover interference. These findings point to multiple mechanisms that shape the distribution of crossovers, influencing proper disjunction in humans. In humans, as in most sexually reproducing organisms, recombination plays a fundamental role in meiosis, helping to align chromosomes and to ensure their proper segregation. Recombination events are tightly regulated both in terms of their minimum number (the rule of \u201ccrossover assurance\u201d) and placement (due to \u201ccrossover interference\u201d). Accumulating evidence, however, suggests that recombination patterns are highly variable among humans, raising numerous questions about the nature and stringency of crossover assurance and interference. We took a first step towards answering these questions by examining patterns of recombination in gametes inherited by viable, non-trisomic offspring. We found that the minimum number of crossovers is tightly regulated at the level of a chromosome (rather than chromosome arm), but with a notable exception: in females, chromosome 21 appears to frequently segregate properly in the absence of a crossover. We also found a set of double recombination events in surprisingly close proximity, consistent with a pathway not subject to crossover interference. These findings suggest that there are multiple mechanisms of recombination in human meiosis, which may buffer the effects of inter-individual variation in rates. Like most sexually reproducing organisms, humans undergo meiotic recombination. This process plays an important role in evolutionary dynamics, generating new combination of alleles on which natural selection can act  far exceeds the number of chromosomes cf. . Foci cojunction .The role of recombination in human meiosis shapes the placement of crossovers as well as their number. When more than one crossing-over event occurs on the same chromosome, the events are not spaced randomly, but instead tend to occur farther apart than expected by chance. The more even spacing of events on chromosomes due to this \u201ccrossover interference\u201d may serve to further reduce the risk of non-disjunction Here, we used human pedigree data to assess whether the number of chiasmata is tightly regulated at the level of chromosomes or chromosome arms and to examine how often proper disjunction occurs in the absence of a chiasma. We also took advantage of the high spatial resolution of the data to investigate the spacing of crossover events.Our point of departure was the number of crossovers observed in transmissions to viable, non-trisomic offspring  We used the observed distribution of the number of crossovers in gametes to infer the distribution of chiasmata in the tetrads  To infer the distribution of the number of chiasmata in tetrads, we used two approaches: a likelihood method, variants of which have been applied in a number of studies Applying the approach to crossover data for each chromosomal arm separately, we found overwhelming evidence for frequent, proper disjunction in the absence of a chiasma . In bothcan segregate properly for the smaller chromosomes, because for the larger chromosomes, they rarely occur (as the recombination rate is simply too high). Indeed, simulations suggest that, even if nullichiasmatic chromosomes always segregated properly, we would have high power to detect their transmission only for the eight smallest chromosomes in males and for chromosomes 21 and 22 in females . Thus, in females at least, the requirement for one chiasma per chromosome is not absolute.To learn more about patterns of recombination underlying proper disjunction in humans, we used the high resolution of crossover locations in our data in order to better characterize crossover interference. Overall estimates of the strength of crossover interference are similar to those previously reported based on a smaller data set Because of the high density of our markers, we were able to identify a set of double crossovers in close proximity (<5 cM), distributed across families and genomic locations . Yet fewer than 1% of all conceptions are thought to be aneuploid for chromosome 21\u2014an estimate markedly lower than the fraction of nullichiasmatic transmissions that seem to segregate properly. This large discrepancy raises the possibility of a back-up mechanism in humans, similar to those that exist in Drosophila and yeast The absence of a chiasma on maternal chromosome 21 is known to be a risk factor for trisomy 21\u2014the main cause of Down's syndrome We previously estimated the location of crossover events in a large Hutterite (a founder population of European origin) pedigree that had been genotyped using Affymetrix 500 K genotyping arrays For these analyses, we focused on 52 overlapping, nuclear families of four or more genotyped offspring, as simulations suggested that our algorithm is highly reliable for families of more than three children (for K\u200a=\u200a5) http://genome.ucsc.edu/). Events were assigned to the p arm if the start of the interval within which they were localized was left of the centromere; remaining events were assigned to the q arm. When the intervals spanned the centromere boundary, we conservatively added the events to both arms; few events fell in this category  p, wherex chiasmata in a bivalent. For computational convenience, we assumed that x lies in a finite range 0\u2026xmax; we chose xmax\u200a=\u200a20. To obtain maximum likelihood estimates of p for each chromosome and chromosome arm, we employed the EM algorithm of This model assumes no chromatid interference in the distribution of chiasmata across chromatid pairs; in the Supplementary Methods in p0\u22650) to the constrained model (p0\u200a=\u200a0). To fit the latter, we utilized the same EM algorithm subject to the additional constraint that p0\u200a=\u200a0. Because the asymptotic distribution for the LRT statistic is known to provide a conservative test To test for the presence of nullichiasmatic bivalents among our sample of gametes (that necessarily underwent proper disjunction), we conducted a likelihood ratio test (LRT) of the unconstrained model  xp is x\u03b1/J, which equals the Poisson probability of x chiasmata (given a mean of 2\u03bb) and arises from a model of no chromosome interference. J controls the weight of prior information, and allows for deviation from this simple model. We explored values of J\u200a=\u200a0.1, 1 and 5. Results were similar across values of J (not shown); for ease of interpretation, we present the results for J\u200a=\u200a1. The Bayesian model was fit using Markov chain Monte Carlo (MCMC), which is described fully in the Supplementary Methods in The prior expectation of The gamma model, a standard model for crossover interference, was previously found to be a good fit to inter-crossover distances in humans and in a number of other organisms e.g., . In the Following Broman and Weber (2000) Text S1Supplementary methods, figures, and tables.(1.14 MB PDF)Click here for additional data file."}
+{"text": "Many common inference problems in computational genetics depend on inferring aspects of the evolutionary history of a data set given a set of observed modern sequences. Detailed predictions of the full phylogenies are therefore of value in improving our ability to make further inferences about population history and sources of genetic variation. Making phylogenetic predictions on the scale needed for whole-genome analysis is, however, extremely computationally demanding.In order to facilitate phylogeny-based predictions on a genomic scale, we develop a library of maximum parsimony phylogenies within local regions spanning all autosomal human chromosomes based on Haplotype Map variation data. We demonstrate the utility of this library for population genetic inferences by examining a tree statistic we call 'imperfection,' which measures the reuse of variant sites within a phylogeny. This statistic is significantly predictive of recombination rate, shows additional regional and population-specific conservation, and allows us to identify outlier genes likely to have experienced unusual amounts of variation in recent human history.Recent theoretical advances in algorithms for phylogenetic tree reconstruction have made it possible to perform large-scale inferences of local maximum parsimony phylogenies from single nucleotide polymorphism (SNP) data. As results from the imperfection statistic demonstrate, phylogeny predictions encode substantial information useful for detecting genomic features and population history. This data set should serve as a platform for many kinds of inferences one may wish to make about human population history and genetic variation. Since the first draft sequences of the human genome were completed, much of the sequencing field has turned to the problem of identifying common genomic variations and their distributions among human populations -3. TheseAll of these inference methods work by a common principle of superimposing a mathematical model of the evolutionary event or process to be detected on a model of neutral evolution in the absence of that process. For example, an inference of population substructure may compare whether observed SNP allele frequencies in the current generation are more consistent with what we expect to find in a single population under Hardy-Weinberg equilibrium or what we expect to see in two genetically isolated populations evolving independently over many generations. Any such inference could in principle be made more easily and accurately if we could observe not just the current generation, but also prior generations at various points in this evolutionary process. Information on these past genetic sequences, commonly encoded in phylogenetic trees or networks, is not generally directly observable but it too can be computationally inferred.Mycobacterium tuberculosis. Nonetheless, there remain substantial obstacles to the more general use of phylogeny-based inference for whole-genome analysis in eukaryotes. Phylogeny inferences may proceed from a more limited model of molecular evolution than do the downstream inference algorithms and may therefore fail to represent key evolutionary events. Even if the model is correct, the inferred phylogenies may be incorrect. While there is no information in the modern sequences that is not also found in the phylogenies, regardless of their accuracy, incorrect phylogenies may end up confounding our analyses.Our goal in this paper is to facilitate a general strategy for performing a range of statistical inferences from genetic variation data: using phylogenetic inferences from the variation data as a common starting point and treating these inferred phylogenies as the input to inferences about specific features of molecular evolution in a population. Similar ideas have previously been applied on smaller scales. Such phylogeny-based inferences have been developed for specific inference problems, such as the detection of likely recombination breakpoints . In addiPerhaps most limiting is that intra-species phylogeny inference is a computationally demanding task that would be intractable on genomic scales by any widely-used inference method. The simplest variant of the problem is maximum parsimony (MP) , which sIn the present work, we seek to enable widespread use of phylogeny-based inference for genome-wide analysis by creating a library of local human phylogenies across the human genome drawn from the HapMap variation data . We creaWe infer maximum parsimony phylogenies using a method developed in Sridhar et al. . The metThis study primarily uses data from the International Haplotype Map (HapMap Phase II)  for the Several additional datasets were used to study correlation of imperfection with other sequence features. We retrieved the set of nonsynonymous coding SNPs (ncSNPs) mapped to the build 35 genome using the Ensemble BioMart tool ,28, seleWe illustrate the concept of phylogeny-assisted genomic analysis using a simple tree statistic that we call phylogenetic imperfection. The imperfection of a phylogeny is defined as the difference between the number of point mutations found in the tree and the number of variant sites in the data set. In a purely mutational phylogeny, imperfection corresponds to the number of recurrent mutations needed to explain the data set. Figure Note that computing phylogenetic imperfection is NP-hard. While we do not provide a formal proof of that statement, it follows from the fact that knowing the imperfection of a dataset allows one to trivially compute the number of mutations found in the maximum parsimony tree. One could therefore use an efficient algorithm for computing imperfection to create an efficient algorithm for MP phylogeny inference. For example, one might repeatedly identify one possible node and edge on the periphery of an optimal tree whose elimination reduces the optimal parsimony score, then recurse on the remainder of the data to construct the rest of the tree.In order to test for regional variations in phylogenetic imperfection, we calculated mutual information between windows at varying genomic distances. We enumerated all pairs of 5-SNP windows across each chromosome, excluding those with overlapping SNPs. Each pair of windows was placed in a bucket according to the distance separating the central SNPs of the two windows. Bucket widths of 1 kb and 100 kbs were used in separate tests. We then treated the entries in these buckets as samples from two random variables, one variable corresponding to the imperfection of the upstream element of each pair and the other to the imperfection of the downstream element of each pair. We then calculated the mutual information of these two random variables as a measure of how informative an imperfection score at any one point on the genome is about those at varying distances along the genome.x1,..., xm drawn from a countable set of values {c1,..., cn}, where fi represents the fraction of points with value ci, the entropy of the sequence is defined asGiven a sequence of points x1, y1), ,...,, where fij is the fraction of points with the value , is calculated by the formulaThe joint entropy of a set of paired data points (H(x) + H(y) - H.The mutual information of the set is then defined as Im, where I is the calculated mutual information and m is the number of independent data points supporting it. We calculated this value for each window and used the minimum value of the statistic as an approximate upper bound on the p-value of the comparisons. The number of degrees of freedom is equal to the maximum observed imperfection score, 23 for these data.In order to establish statistical significance of mutual information scores, we used the fact that a mutual information score can be regarded as a log likelihood ratio statistic, which itself is approximately chi-square distributed for sufficiently large sample size. Many of the data points in a given bucket will be dependent on one another, even under the null hypothesis that different windows are independent of one another, because the same window may contribute to multiple pairs within a given distance. We therefore adopted a conservative estimate of significance by taking only a subset of pairs containing at most one pair for any given window. With this approximation, the significance of any given data point can be estimated by treating it as a chi-square statistic with value (2 ln 2)i is related to recombination rate r by a function of the form i = a(1 - ebr-) and using Newton-Raphson iteration to find the least-squares best fit parameters a and b. We calculated the correlation coefficients with the original data-set as well as with windows spanning recombination hotspots removed.In order to compare imperfection and fine-scale recombination rates, we first identified for each window in our data set the location of the central SNP in the window. We then retrieved the fine-scale recombination rate at each such SNP from the HapMap-supplied data. The result was two paired lists of data points. We calculated Pearson correlation coefficients for the two lists for each chromosome individually and for all chromosomes collectively. Statistical significance of the correlation coefficients was assessed by permutation test, randomly permuting one data set with respect to the other for 1,000 trials for each test reported. A curve was fit to the data points by proposing that imperfection We selected those windows of highest imperfection by summing imperfection computed in the CEU and YRI populations for common windows and selecting those with the highest sum. This analysis was performed using data from which recombination hotspots had been excluded. The analysis was run once for the set of all windows in the genome excluding hotspots and once for those windows centered on non-synonymous coding SNPs (ncSNPs). ncSNPs mapped to the genome were selected from Biomart ,28 usingOne might question whether statistics drawn from our phylogeny library could be biased by systematic errors in phylogeny inference. For example, MP inference can never produce trees larger than the true phylogenies and may therefore systematically underestimate phylogeny size. While there is no known ground truth by which we might definitively test for such biases, we can compare a subset of trees to those from a more statistically sound maximum likelihood (ML) method. Because of the high run-time of ML methods, we can compare only a small subset of the windows. We examined the first 200 5-SNP windows from chromosome 1. We constructed trees for these windows using the Phylip  ML infer. The server provides access to the preprocessed human phylogeny library and a front-end to a server to which users can supply their own data to be solved by our methods. In addition, users can directly download a full set of phylogenies for each chromosome in DOT format, a language for graph description developed for the Graphviz graph rendering package. The present analyses were based on inferences of a single phylogenetic tree per window of SNPs examined, but the server can also infer the network produced by the union of all maximum parsimony phylogenies for any given window. Source code will be provided upon request, although users must supply their own ILP solver to run it.The inferences were performed on a Pentium workstation computer running Linux. Code was written in C++ and uses the CPLEX 10 ILP solver for linear programming solution. Our inference algorithms and the phylogeny library are accessible through a web server at All other data processing and statistical computations were performed with code written in the Perl language. Graphics for the paper were prepared with SigmaPlot version 10 and Gnuplot version 3.7.. Table .The principle result of this study is the library of phylogenies, provided for download at In addition to providing a coarse visualization, the imperfection scores give us a statistic for assessing population conservation of the phylogenies. Over all chromosomes, the CEU data shows a mean imperfection of 0.30 and the YRI a mean imperfection of 0.55. These results may reflect the higher genetic diversity of African versus European populations. The two populations do, however, show a strong overlap in regions of high or low imperfection on the genome. For SNPs variant in both populations, the imperfections have a correlation coefficient of 0.49 between the populations when examining all windows or 0.36 when recombination hotspots are excluded. This correlation may reflect the in fluence of common histories prior to divergence of the two lineages, some inherent propensity of particular sites in the genome towards larger or smaller phylogenies, some combination of the two, or some systematic SNP-specific bias.-6). We believe this measure provides a very conservative estimate of significance, but it nonetheless establishes that the mutual information between imperfection scores cannot be attributed to chance even out to megabase distances along the genome.To further test the hypothesis that there is a conserved regional substructure to these patterns of variation, we examined the mutual information between imperfection scores at pairs of non-overlapping windows within each population. Mutual information assesses the degree to which the variability between the two sets of sites treated individually exceeds their variability when considered collectively. High mutual information indicates that two sites are highly predictive of each other, while low mutual information suggests that they are nearly independent. Figure We next sought to demonstrate how a library of inferred phylogenies would be useful in making genome-scale predictions of genomic features that indirectly depend on local evolutionary histories. We chose the example of fine-scale recombination rate, continuing with the imperfection statistic as a hypothetical predictor of that rate. Recombination rate might be expected to correlate with phylogeny size because recombination events will be misinterpreted as multiple recurrent mutation events and the imperfection statistic should therefore tend to be large where recombination has been frequent. While we do not have access to the ground truth for recombination rate, we can test our ability to predict an accepted inference of the recombination rate that was performed for the HapMap by the method of MacVean et al. ,35. FiguTables This analysis also allows us to reconsider the issue of conservation between the populations by examining how well mutual correlation with recombination rate explains correlation of phylogeny sizes between populations. The overall Pearson correlation between recombination and imperfection across all chromosomes is 0.40 for both populations, compared to a correlation of 0.49 between the imperfections of the two populations. These comparisons were likewise all determined to be significant with p-value < 0:001 by permutation tests. When hotspots are excluded, the overall correlations between imperfection and recombination rate drop to 0.36 for both populations. The correlation between imperfection scores for the two populations drops to 0.45. Collectively, these observations confirm that the imperfection scores are significantly influenced by other local genomic properties than just recombination rates.-26; 1.5-25) and the largest was . Figure i = a(1 - ebr-). A least-squares fit to this form resulted in the parameters a = 0:82 and b = 1:02 for the CEU data and a = 1:36 and b = 1:27 for the YRI data. Note that best-fit curves level off below the asymptote in both cases (a is the asymptote), suggesting that a single exponential cannot provide a good fit simultaneously to the low- and high-recombination rate windows. Subtracting out this best fit from the imperfection scores nonetheless reduced the correlation between imperfection and fine-scale recombination from 0.40 to 0.09 for CEU and from 0.40 to 0.11 for YRI while still preserving a correlation of 0.36 between the two populations after the fit was removed. This analysis again confirms that imperfection is strongly predictive of both recombination rate and other sequence regularities distinct from recombination rate.In order to better understand the relative sensitivity of imperfection to high versus low recombination rates, we plotted a histogram of mean imperfection versus local recombination rate. Given the uneven distribution of data points, we used exponentially increasing bin sizes for recombination rates. After removing bins with fewer than 100 data points, the bin with the smallest rate was . While there are greater differences between ncSNPs and general windows for larger imperfection scores, these could be explained by the small numbers of examples for the largest imperfection values. Selection against changes in protein code therefore appears to introduce at most a modest bias in window imperfection scores.A bias in imperfection scores might also be expected for SNPs found in repetitive regions of the genome. We might anticipate some excess of imperfection in this set from a greater frequency of genotyping errors or genome misassembly around repetitive elements. We might also anticipate a higher fraction of large imperfection scores due to genuine hypermutable sites, which are known to be associated with some short tandem repeat (STR) regions ,37. We tWe finally used the imperfection statistic to demonstrate one final value of a tree statistic in performing whole-genome analysis: identifying outlier data points. There are too many perfect windows to allow for an examination of individual cases of small imperfection, but we can examine those windows of highest imperfection. Based on the preceding analysis, we would expect these outliers to correspond predominantly to windows with high historical recombination. We therefore used the data prescreened to remove recombination hotspots so as to favor outliers produced through processes other than recombination. Table The results from the previous section suggest the absence of coding SNPs is more likely due to their scarcity in the full SNP set rather than any bias against them and we therefore chose to examine ncSNP outliers separately. Table In order to test for systematic biases in phylogenies introduced by inference from an MP method, we compared them to phylogenies inferred by a maximum likelihood (ML) method for a subset of 200 5-SNP windows. We found a mean phylogeny size of 5.67 mutations for the ML trees versus 5.53 for the MP trees. If we regard the ML trees as a close approximation to the ground truth, then we can conclude MP trees underestimate phylogeny size by an average of 2.5% on these data. We can therefore suggest that, while there is some systematic bias toward smaller trees with an MP method, the bias is relatively modest for small windows. The RMS distance between pairs of individuals for corresponding ML and MP trees is 0.112, suggesting that most individuals are in similar relative positions between the two trees. The Robertson-Foulds distance has a mean value of 0.54, indicative of a somewhat larger average variation when comparing trees by edges rather than by individuals. This mean Robertson-Foulds score can be interpreted as an average of just over one inconsistent edge between each pair of trees. Since we cannot guarantee the optimality of the ML trees by the ML criterion, these measures may in fact overstate the difference between the MP trees and ground truth. It is also possible, though, that the ML trees may themselves be biased relative to the ground truth and may therefore understate the bias in the MP trees. Our post-processing step to collapse sub-trees with identical sequence may also bias the geometries to more closely match those of MP trees. Future examination with other tree statistics or other methods of tree inference may also yield more dramatic differences than we observe here.We have used recent methodological improvements in fast phylogeny algorithms to construct a genome-wide library of local mutational phylogenies in the human genome. This library provides an unprecedented view of likely sequences of mutational events in local regions of the genome that may give us new insight into mechanisms of mutation and selective pressures on genomic scales and in individual genes of interest. Many forms of genomic analysis rely on indirect inferences of molecular evolution based on modern observed sequences and would likely benefit from accurate knowledge of full evolutionary histories. While we cannot observe these full histories, it is now possible to make reasonable inferences in local regions. We hope that this library will help enable a \"phylogeny first\" approach to whole-genome analysis tools based on the common hypothesis that good inferences of phylogenies will provide a stronger basis for statistical prediction of a broad class of genomic features than do raw variation data. We have demonstrated this approach with several sample applications of a simple tree statistic, imperfection, that measures the total size of a phylogeny.The imperfection tree statistic is predictive of fine-scale recombination rate. It may therefore be useful as an alternative method for estimating recombination rates. Moreover, it detects sequence regularities beyond the correlations for which recombination rate can account, which we conjecture is likely to include local mutation rate biases. Phylogenetic imperfection in conjunction with other measures of recombination rate may be a useful way to separate these possibilities. This result may also in part reflect the fact that recombination rate and mutation rate are themselves correlated ,45. It iThe imperfection statistic also allows us to test several hypothesis about molecular evolution on genomic scales. One such hypothesis is that there are significant regional biases in mutational propensities across the genome, beyond what can be accounted for by local signals such as recombination hotspots. Consistent with the hypothesis, imperfection shows a pattern of local correlation on multiple scales, from a strong peak for nearby but non-overlapping windows on the kilobase scale to a gradual decline in correlation on even megabase scales. Given that imperfection strongly correlates with recombination rate but shows significant cross-population correlation even after corrections for recombination rate, it is likely that these regional correlations reflect a combination of regional variation in recombination rate and regional variability in mutation rate. We cannot, however, yet determine the precise degree to which these two factors, or others unknown to us, might contribute to the overall regional variability. Because the information calculations excluded windows sharing SNPs, the very strong local peak on the kilobase scale could only derive from regions extremely dense in SNPs. It is therefore plausible that the fine-scale peak corresponds to local correlations in imperfection due to hypermutable regions of the genome. Further study of regional patterns for known sources of phylogenetic imperfection may help to separate these effects and detect any unanticipated contributing factors. By contrast, the imperfection statistic leads us to reject the hypothesis of significant variations in phylogenetic complexity between coding versus non-coding SNPs, or between SNPs in repetitive versus non-repetitive regions of the genome.While we use imperfection in the present study as an illustration of our proposed \"phylogeny first\" approach, there are many other tree statistics that may be informative for particular processes. Gene conversion, selective sweeps, and epistasis, among other processes, might all be anticipated to produce characteristic features of tree geometry by which they might be detected from a phylogeny library. Determining which statistics are informative for particular processes and how they compare to other inference methods is a broad problem that we plan to address in future work.Both authors participated in all stages of the design, execution, and analysis of the study and in the preparation of this manuscript."}
+{"text": "RNF212 and an inversion on chromosome 17q21.31) were previously reported in the Icelandic population, and this is the first replication in any other population. Of the four newly identified loci , results from expression studies provide support for their roles in meiosis. Each of the variants that we identified explains only a small fraction of the individual variation in recombination. Notably, we found different sequence variants associated with female and male recombination phenotypes, suggesting that they are regulated by different genes. Characterization of genetic variants that influence natural variation in meiotic recombination will lead to a better understanding of normal meiotic events as well as of non-disjunction, the primary cause of pregnancy loss.The number of recombination events per meiosis varies extensively among individuals. This recombination phenotype differs between female and male, and also among individuals of each gender. In this study, we used high-density SNP genotypes of over 2,300 individuals and their offspring in two datasets to characterize recombination landscape and to map the genetic variants that contribute to variation in recombination phenotypes. We found six genetic loci that are associated with recombination phenotypes. Two of these  markers of 2,315 individuals and their children from two Caucasian samples in a genome-wide association study to identify genetic variants that influence the number of meiotic recombination events per gamete. We found three loci that influence female recombination and three different loci that influence male recombination. Our results suggest that gender differences in recombination result from differences in the genetic regulation of female and male meiosis. Also, each identified locus only explains a small proportion of variance; together, each set of loci explains about 10% of the variation in the gender-specific recombination phenotype. This suggests a mechanism for variability in recombination that is essential for genetic diversity while maintaining the number of recombinations within a range to ensure proper chromosome segregation. Meiotic recombination is essential for cell division and is a key process that generates genetic diversity. It provides daughter cells with allelic compositions that differ from those of their parents. However, despite its important role, recombination frequency differs significantly between females and males, and also among individuals within each gender Errors in meiotic recombination lead to chromosomal abnormalities including nondisjunction; thus cellular processes must ensure proper meiotic recombinations RNF212RNF212 that were previously reported to be associated with recombination phenotypes in females and males, respectively. The remaining four loci were not known to contribute to individual variation in genome-wide recombination rates. These results provide new information to study the regulation of meiotic recombination.The genetic basis of individual differences in human meiotic recombination is poorly understood. An inversion on chromosome 17q21.31 We used genotypes from the Autism Genetic Research Exchange (AGRE) For the second population, we analyzed genotypes for \u223c500,000 SNP markers from members of 784 two-generation families from the FHS. This dataset provided us with recombination phenotypes for 654 mothers and 639 fathers, with an average of 2.86 children per individual . We observed 90,264 female and 57,054 male recombinations . The aveWe compared the recombination phenotypes in the AGRE and FHS collections  and found highly similar patterns. Previous literature reports mean maternal genome-wide recombination ranging from 38.4 to 47.2, and mean paternal genome-wide recombination ranging from 25.9 to 27.3 Recombination events are not distributed evenly across the human genome Using this approach, we identified 125 maternal recombination jungles and 69 paternal recombination jungles in the AGRE population. The average size of the maternal jungles was 2.1 Mb (range: 0.8 to 6.0), and that of the paternal jungles was 3.7 Mb (range: 1.1 to 11.1). In the FHS population, we identified 183 maternal recombination jungles, averaging 1.5 Mb (range: 0.5 to 4.9), and 86 paternal jungles, averaging 2.7 Mb (range: 0.5 to 8.6). The positions and sizes of recombination jungles throughout the genome were very similar for individuals from the AGRE and FHS collections .Recombinations tend to occur in the telomeric parts of chromosomes. Most of the paternal recombination jungles were found at the telomeric ends of each chromosome , while tAGRE\u200a=\u200a5.14\u00d710\u221212, PFHS\u200a=\u200a2.83\u00d710\u221249) and women  in both samples.We and others have shown that there are extensive individual differences in recombination phenotypes in both females To identify the DNA variants that influence individual variation in recombination phenotype, we carried out genome-wide association analysis. Since the distributions of female and male recombination phenotypes are different, for all the analyses, we studied female and male recombination phenotypes separately.RNF212, which was reported by Kong et al to be associated with recombination rate in the Icelandic population RNF212 has a P-value of 0.0009 in the paternal AGRE sample.First, we analyzed data from 511 females and 511 males from the AGRE samples. We treated the recombination phenotypes as quantitative traits. For genotypes, we used \u223c350,000 SNP genotypes that passed a quality filter. Then, we tested for association of the recombination phenotypes with SNP alleles using an additive model. A plot of the GWA results and a QQ-Plot are shown in To replicate the findings from the AGRE samples, we followed up approximately 0.5% of the markers  with further analysis in the 654 females and 639 males in the FHS sample. Many of the markers were found in blocks of linkage disequilibrium and are highly correlated.\u22128 and 10\u22125). For females, the list includes the inversion on chromosome 17q21.31 that was previously reported to be associated with recombination rate in the Icelandic population RNF212 on chromosome 4.\u22127 . There were two additional significant markers at this locus: rs4640231 (Pcombined\u200a=\u200a1.7\u00d710\u22125) and rs2732705 (Pcombined\u200a=\u200a8.4\u00d710\u22126). All three markers are highly correlated, with pairwise R2>0.8, and reside within a 900 kb region of strong LD. SNPs rs2668622 and rs2732705 are both approximately 20 kb upstream from gene LRRC37A, while SNP rs4640231 resides within an intron of gene CRHR1. This locus contains several additional genes, including IMP5, MAPT, STH, and KIAA1267 (combined\u200a=\u200a8.9\u00d710\u22126) with higher recombination frequency.The second most significant result was found on chromosome 17q21.31  at SNP rKIAA1267 . Stefanscombined\u200a=\u200a2.3\u00d710\u22125). SNP rs1797052 is approximately 50 bp upstream of gene PDZK1 which encodes a scaffold protein that regulates ion transport and second messenger cascade in epithelial cells Pdzk1 is expressed in ovaries of newborn mice where the oocytes are in prophase I.The third maternal association signal was on chromosome 1q21.1  at SNP r\u22128) of variation in recombination phenotype in the AGRE sample, 4.75% (P\u200a=\u200a1.14\u00d710\u22126) of the variation in FHS, and 5.9% (P\u200a=\u200a1.77\u00d710\u221214) variation in combined AGRE and FHS samples.To evaluate the collective impact of the three significant loci on the maternal genome-wide recombination phenotype, we built a model using stepwise linear regression. Markers rs1797052, rs2505089, and rs4640231 were used as predictor variables. The three loci explain 7.3% (P\u200a=\u200a3.56\u00d710combined\u200a=\u200a8.2\u00d710\u22128) (combined\u200a=\u200a7.9\u00d710\u22126), rs2014318 (Pcombined\u200a=\u200a4.8\u00d710\u22126), and rs4045481 (Pcombined\u200a=\u200a4.4\u00d710\u22127). All four markers reside within a strong LD block that includes RNF212, a gene that was previously reported to be associated with meiotic recombination by Kong and colleagues The strongest association signal for paternal recombination phenotype was observed on chromosome 4p16.3 at SNP rs11939380 (P.2\u00d710\u22128) . Three acombined\u200a=\u200a1.5\u00d710\u22127)  . This masolution . We also similar .combined\u200a=\u200a3.3\u00d710\u22126)  . This mane stage .\u22127), 5.0% of variation in FHS (P\u200a=\u200a1.28\u00d710\u22126), and 5.4% of variation in the combined AGRE and FHS (P\u200a=\u200a4.62\u00d710\u221213).We used markers rs11939380, rs11764733, and rs7863596 in a stepwise linear regression model to quantify the combined impact of the three loci on individual variation in genome-wide paternal recombination phenotype. The three loci account for 6.8% of variation in AGRE  in HapMap for each of these. Our surrogates for the Icelandic male SNP include rs4045481 and rs11939380, both of which had P-values on the order of 10\u22126 for male recombination in our combined dataset. Our surrogates for the Icelandic female SNP are rs6827357 and rs20114318. Both of these showed P-values on the order of 0.01 for females in our combined dataset. As in the Icelandic population, we observed opposite effects on male and female recombination at these SNPs and throughout the haplotype block. While the P-values for female recombination in our dataset fall far short of genome-wide significance, they do show a weak association and are quite consistent with the Icelandic results. It is particularly notable that this is the first replication of the curious opposite effects on male and female recombination previously observed.Our GWAS analysis replicated the previous findings that an inversion on chromosome 17q21.31 is associated with higher female recombination rates, and that variants in KIAA1462, and those on chromosome 1 near PDZK1 to be associated with recombination rates. These variants along with those on chromosome 17q explain approximately 6% of the total variation in female recombination phenotype in the AGRE and FHS samples. In males, we identified variants on chromosome 9 near UGCG and on chromosome 7 near NUB1 to be associated with recombination phenotype. In the mouse, the expression of Ugcg and Nub1 in prophase I further supports their potential roles during meiosis. The variants in RNF212 and those on chromosomes 7 and 9 explain about 5.4% of variation in male recombination.In addition to these known loci, we uncovered additional polymorphic regions that are associated with recombination phenotypes. In females, we found variants on chromosome 10 near a poorly characterized gene, Results from our genetic mapping study enhanced our understanding of meiotic recombination. It appears that gender differences in recombination rates and pattern result from differences in the regulation of female and male meiosis. Our genetic mapping results showed that DNA variants in different genes are associated with female and male recombination phenotypes; we did not find any variants that are significantly associated with both female and male recombination phenotypes. Second, we identified multiple unlinked SNPs that are associated with recombination phenotypes suggesting that multiple polymorphic regulators influence these phenotypes. This likely provides a mechanism for variability in recombination which is essential for genetic diversity while maintaining the number of recombination events within a range that ensures proper disjunction. Each of the variants that we identified explains only a small fraction of the individual variation in recombination. Together the three loci that contribute to female recombination explain less than 10% of the variation, and the same for male recombination. Unlike most essential cellular processes, recombination events must differ between individuals to maintain genetic diversity. However, the system cannot be so flexible that it fails to ensure proper segregation of chromosomes. Having many regulatory steps achieves the goal of allowing some range of events to occur while ensuring that the number of recombination events does not deviate too much to cause improper chromosome segregation or non-disjunction. Although, we have identified six variants that influence recombination events, we expect other variants still need to be identified. Characterization of genetic variants that influence natural variation in meiotic recombination will allow a better understanding of normal meiotic events as well as non-disjunctions which lead to chromosomal abnormalities, the primary cause of miscarriages.www.agre.org) and 784 families from the FHS collection . The AGRE samples consist of 2,883 individuals genotyped at 399,147 markers on the Affymetrix 5.0 SNP Chip platform. We excluded \u223c3,150 markers from analyses due to deviation from Hardy-Weinberg equilibrium (P<10\u22127) or Mendelian errors. The FHS includes genotypes at 500,568 markers from the Affymetrix 5.0 SNP Chip for 9,237 individuals. We excluded \u223c22,000 markers from analyses due to deviation from Hardy-Weinberg Equilibrium (P<10\u22127) or Mendelian errors.We obtained SNP genotypes from samples in two collections: Autism Genetic Research Exchange (AGRE) We identified recombination events for maternal and paternal sides separately in two-generation families with at least two children using an approach similar to that of Coop et al. To minimize spurious recombinations caused by genotyping errors, we required that each recombination event be supported by 5 or more consecutive informative markers.http://genomics.med.upenn.edu/recombination.The PERL module that we used for determining recombination phenotype is available for download at To identify the location and size of recombination jungles in the AGRE and FHS samples, we sorted and plotted all recombination events by base pair position . To modeTo identify the DNA variants that influence individual variation in recombination phenotype, we carried out genome-wide association analysis. Since the distributions of female and male recombination phenotypes are different, for all the analyses, we studied female and male recombination phenotypes separately. All association tests were performed using the PLINK software package GAA AGC CTG AGA TGT CAG CAG, Rnf212/R GGC TGG CTA CAG AGC GTA GAT, Nub1/F GTT ACA GGA TGC AGA CCC TGA, Nub1/R CAT CTG TCG AGG CAC TAG AGG, Ugcg/F GAC AGA GAA AGT GGG GTT GGT, Ugcg/R CTC CTG CCT GAT CTA GCA CAT, mActinb/F ATA TCG CTG CGC TGG TCG TC, and mActinb/R AGG ATG GCG TGA GGG AGA GC . Primer pairs were chosen to amplify across distant exons in order to avoid false positive amplification from contaminating genomic DNA. Quantitative PCR was performed using SYBR green mix (Quanta Biosciences) with ROX as a reference dye (Invitrogen) using Realplex Mastercycler 4S (Eppendorf) following the supplier's protocol. Melting curve analysis confirmed the simple nature of the amplified product for each gene. Relative expression (RE) was calculated following the \u0394\u0394Ct methodology with RE\u200a=\u200a2\u2212\u0394\u0394Ct with \u0394\u0394Ct\u200a=\u200a\u0394CtSample\u2212\u0394CtReference, and \u0394CtSample or Reference\u200a=\u200aCtGene\u2212Ctb-actin.Mouse male meiotic cells were purified by fluorescence activated cell sorting (FACS) as previously described Figure S1Recombination events and jungles on chromosome 22. Maternal (A) and paternal (C) recombination events are represented by horizontal black lines across chromosome 22. These lines \u201cstack\u201d upon each other in regions of high recombination activity. Derivatives resulting from curves fitted to the recombination events are shown for maternal (B) and paternal (D) data. Recombination jungles (gray) are identified at peaks in the derivative functions which correspond to regions with high recombination activity.(4.94 MB TIF)Click here for additional data file.Table S1Recombination events by chromosome.(0.01 MB PDF)Click here for additional data file."}
+{"text": "High yields of recombinants between 22% diverged genes have been obtained when the virus Red Gam pathway was active, and 100 fold less when the host Escherichia coli RecABCD pathway was active. The recombination editing proteins, MutS and UvrD, showed only marginal effects on \u03bb recombination. Thus, escape from host editing contributes to the high proficiency of virus recombination. Moreover, our bioinformatics study suggests that homeologous recombination between similar lambdoid viruses has created part of their mosaicism. We therefore propose that the remarkable propensity of the \u03bb-encoded Red and Gam proteins to recombine diverged DNA is effectively contributing to mosaicism, and more generally, that a correlation may exist between virus genome mosaicism and the presence of Red/Gam-like systems.Genome mosaicism in temperate bacterial viruses (bacteriophages) is so great that it obscures their phylogeny at the genome level. However, the precise molecular processes underlying this mosaicism are unknown. Illegitimate recombination has been proposed, but homeologous recombination could also be at play. To test this, we have measured the efficiency of homeologous recombination between diverged  Escherichia coli \u03bb virus as a paradigm, we show that such homeologous recombination is remarkably efficient. This finding has important implications in the field of virus genome evolution, as it may explain the high plasticity of viral genomes. It is also applicable to the field of biotechnology, and reveals viruses to be promising vectors for shuffling genes in vivo.Temperate bacterial viruses alternate between a dormant state, during which viral DNA remains integrated in the host genome, and a lytic state of phage multiplication. Temperate viruses have a characteristic genome organisation known as \u2018mosaic\u2019 \u2013 they contain \u2018foreign\u2019 segments that originate from related viruses. In pairwise alignments between a given virus and its relatives, the overall nucleotide sequence identity is around 50%. In contrast, the mosaic segments are 90% to 100% identical. How mosaics are generated is largely unknown, but it is likely that related viruses meet in the same bacterium and undergo random recombination, with emergence of the most robust recombinatory viruses. The prevalent hypothesis is that mosaics are formed by illegitimate recombination. We propose and demonstrate that an alternative driving mechanism, homologous recombination, is used for mosaic formation between similar but diverged viral sequences. Using the well known  Bacterial viruses (bacteriophages) are the most abundant and diverse life form and exhibit high levels of evolvability and adaptability A particularity of temperate virus genome evolution is their extensive sequence mosaicism i.e. recombination between related but diverged DNA sequences Little is known about the precise molecular processes underlying this viral genome mosaicism. In the case of fully sequenced lambdoid viruses isolated from enterobacteria, genomes are on average 50% identical, except for DNA sequence patches showing more than 90% identity. The apparent absence of any particular signals at the borders of sequence-similar patches has led to the proposal that they have probably been acquired by illegitimate recombination red\u03b1, red\u03b2 (the Red system) and the gam gene, all belonging to the pL-operon. Red\u03b1 is a double strand specific 5\u2032 to 3\u2032 exonuclease E. coli exonucleaseV (RecBCD), thereby protecting the ends of its linear genome from degradation .Recombination by the phage Red pathway was more efficient than recombination by the RecABCD pathway, especially for 22% divergence  had an eight-fold stimulating effect on RecABCD promoted recombination for 4% diverged sequences . This effect was less pronounced (two-fold) for 22% divergence. No stimulating effect of the mutS mutation was detected for recombination catalyzed by the phage Red system (mutS\u2019 lanes). Thus in this virus assay, mismatch repair operates a modest control on the fidelity of the bacterial, RecABCD pathway, and not at all on the phage Red pathway.The methyl-directed mismatch repair (MMR) MutL and MutS proteins, and to a lesser extent MutH and UvrD, inhibit homeologous recombination by preventing DNA exchange between diverged repeated chromosomal sequences uvrD mutant, recombination between identical sequences is increased, generally by a factor of 10 sgs1 mutant, a member of the RecQ helicase family E. coli, RecQ prevents illegitimate recombination E. coli uvrD and recQ mutants for a hyper-recombination phenotype both in RecA-mediated and Red-mediated events. The uvrD mutation had no effect on the recombination between identical sequences. However, similarly to mutS, it conferred a four-fold increase in recombinant frequency only at 4% divergence and only in RecA-dependent recombination. This suggests that it does not exert its distinct anti-recombinase activity on the \u03bb substrates (uvrD\u2019). RecQ did not prevent recombination in any of our substrates. Rather, recombination appeared slightly decreased in the recQ mutant, on 22% diverged sequences (recQ\u2019).In addition to its role in MMR, UvrD helicase has a distinct activity in preventing homologous recombination, such that in a oxa genes, encoding different beta-lactamases. Depending on recombination end-points, different gene combinations should form. A total of 152 phages scored as recombinants were used for sequencing the hybrid oxa copies. In all 304 oxa genes sequenced, a hybrid was found. This indicates that recombination indeed took place within the 800 bp of partial homology. Among these, a total of 136 new gene combinations were obtained.In our \u03bb constructs, the set of chosen diverged sequences were pairs of oxa7-oxa11 and oxa7-oxa5 pairs, respectively, allowed us to map precisely strand exchanges and to class recombination events into two main categories: the \u201cnon-symmetrical\u201d ones, for which the two joints are present in different intervals, and the \u201csymmetrical\u201d ones, for which the two joints occur in the same interval. Category \u201ccomplex\u201d includes more complex sequence patterns. Bacteriophage \u03bb recombines essentially in a non-reciprocal mode, but in our recombination assay, only the events that terminate as reciprocal at the DNA level can yield viable recombinants. However, such \u2018final\u2019 reciprocity can be reached by two successive non-reciprocal events The presence of 32 and 176 sites of polymorphism for the Chi2 test (p<0.0001). Precise positions of the joints in each pair of oxa sequence for the 22% diverged DNA are given in For the RecABCD promoted recombination between 4% diverged sequences, most events were non-symmetrical (81%), whereas only 17% were symmetrical . SimilarComplex recombination products, involving  more than two non-reciprocal events, were observed at similar but low frequencies under all conditions tested.ruvABC mutant strain (ruv\u2019). Efficiency of recombination between 22% diverged DNA via the RecABCD pathway, was decreased by a factor of 50 in the ruv mutant. In contrast, this mutation had no effect on the Red-mediated events for 22% diverged DNA, nor did it affect 4% diverged, RecABCD mediated recombination. Therefore, most of the recombination events observed between 22% diverged DNA in the RecABCD pathway are resolved by Ruv.To test whether the symmetrical events were processed by the RuvABC enzymes, that resolve Holliday junction in a symmetrical way, recombination frequencies were measured in a oxa gene were inspected , in contrast with RecABCD promoted events (10\u22126), can be interpreted in two ways: (i) Red\u03b1 and Red\u03b2 may be less sensitive to sequence divergence during heteroduplex DNA formation than RecABCD, and (ii) Red\u03b1 and Red\u03b2 may escape host factors that prevent RecA-mediated recombination. In support of the first option, Red\u03b2 promotes efficient annealing and integration of single strand oligonucleotides containing mismatches, a technique known as recombineering rac (in a recBC sbcA host background) were used successfully to recombine 30% diverged recA sequences \u22128)The remarkable efficiency of the Red promoted recombination between 22% diverged sequences  non-symmetrical recombinants between 22% diverged sequences. Still, the probability that the observed 17% symmetrical products were generated by chance during two successive non-reciprocal exchanges occurring in the same of the 137 possible intervals is very low. We propose that a fraction (\u223c2\u00d717%\u200a=\u200a34%) of all Red promoted events in our experimental set up are indeed cross-overs. Biochemical studies of the RecT protein, which belongs to the same family as Red\u03b2, have suggested that it might be able to generate three-strand intermediates Furthermore, the detailed analysis of joints produced via the Rec and Red pathways between 22% diverged DNA suggests again mechanistic differences which are compatible with the biochemical properties of the two systems: two hot spots are observed for the Rec products. RecA-promoted homologous recombination is expected to act more or less equally on all DNA sequences, but the absence of any single identical interval large enough to accommodate a MEPS  per single Petri dish, 40% of which represent different new genes. The yield of recombinant genes is orders of magnitude higher than when the same genes were carried in E. coli plasmids We demonstrate that, starting from pairs of similar genes, irrespective of their origin, phage genetic promiscuity can be exploited to generate large new gene families creating potentially interesting new biochemical entities. Even at 22% divergence, the Red recombination pathway can routinely create 10Can we relate our experimental results on homeologous recombination in \u03bb to the evolutionary history of lambdoid virus genomes? Our bioinformatic analysis showed that among all detected blocks of highly similar sequences (hits), about one half showed no flanking \u201cshoulder\u201d of moderate divergence, about 40% showed only one shoulder and the remaining hits were clearly framed by two shoulders. Even a single shoulder is compatible with an involvement of homeologous recombination. For example, a sequence block can be acquired by an homeologous recombination event (shoulder) at one junction, accompanied by an homologous event between identical sequences When shoulders were detected, their identity was in the range of 64% to 68%, and the hit sequences were on the average 94% identical. The 6% divergence of the hit sequence suggests that, at the time of recombination, the shoulders identity was about 70 to 74% . This isS. aureus virus analysed encode either a Red\u03b2 or Erf ortholog. It may be that one or more virus recombinase families remain unknown at present. Interestingly, viruses belonging to the family of T4, composed exclusively of virulent members, appear not to have a mosaic structure, but to consist rather, like bacteria, in a common backbone genome, interrupted by a few large variable regions If virus mosaicism is really related to the presence of Red\u03b2-like recombination enzymes, it should be possible to verify that all virus genomes exhibiting mosaicism encode such a function. Among the ten lambdoids from enterobacteria that were analysed here, only two encoded a Red\u03b2 ortholog. However at least one other family of virus recombinases, of which Erf is the best studied member, has been described Escherichia coli and \u03bb strains used in this study are described in All cI857ts mutation, were obtained by shifting cultures of lysogenic bacteria at a OD600 0.4 for 10 minutes to 45\u00b0C, followed by further incubation (up to 4 hrs) at 37\u00b0C. These primary stocks usually contained 1010 plaque forming units per ml.Lysogenization was performed as described by Cromie and colleagues ea10 gene (our unpublished observation), and a copy of Tn10 inserted into the rexA gene. A derivative obtained by G. Smith, \u03bb 1390, in which the pL promoter is inverted, was used as the starting material for our constructions Tn10 copies by a set of related oxa genes which diverge by 4% (between oxa7 and oxa11), 22% (between oxa7 and oxa5), or 52%  either oxa7, oxa11, or oxa5, inverted relative to the copy of oxa7 inserted into ea10, ii) the chloramphenicol-resistance (cmR) gene of pACYC184, and iii) a Chi site cI857ts was done using the protocole of Datsenko and Wanner The \u03bb 366 described by N. Kleckner oxa7-CmR cassette of \u03bbNec 4 by an oxa1-PhleoR cassette. To do this, a plasmid containing the cI to N region of \u03bb, in the native orientation of the pL promoter, interrupted by the oxa5-CmR cassette (pMAP189) was used to substitute a different cassette, made of the oxa1 gene flanking a PhleoR gene, giving plasmid pMAP195. The 3.2 kb AvaII-SapI fragment of pMAP195 was then gel purified and used to transform a C600 derivative lysogenic for \u03bb Nec4 and containing pKD46, and selecting phleomycin resistant transformants (1 \u00b5g/ml), in which the rightward oxa7-CmR cassette had been replaced by the oxa1-phleoR cassette.The construction to test 52% diverged sequences in the Red pathway (\u03bbNec8) was done by replacing the rightward recA and C600 P2. Recombinant frequency was calculated by determining the ratio of phages growing on the lawn selective for recombinants, over total phage count estimated by the sum of titers obtained on P2 and recA lawns.Phages were adsorbed on the selective host at an m.o.i. of 0.1 for 30 minutes at 37\u00b0C. Infected cells were diluted 100-fold in pre-warmed TB  supplemented with 0.1% maltose and 1 \u00b5g/ml thiamin, and grown at 37\u00b0C for 3.5 h when the first peak of phage production occurred. The supernatant was collected, filter-sterilized, and phage stocks were titrated on C600 \u2212 Gam\u2212 phages have lower burst sizes compared to Red+Gam+ phages in a wild type host, growth was performed under restrictive conditions, such that recombined phages could not propagate. This prevented possible enrichment, allowed us to measure the yield of recombinants produced during the last burst before phage harvest, and to deduce a recombinant frequency per generation. 100 \u00b5l of an over night (ON) culture of the respective host bacteria  or its mutS, uvrD, ruvABC or recQ derivatives for RecABCD-mediated recombination of \u03bb) were mixed with 100 \u00b5l of primary stock phages in 5 ml of top agar , and the mixture poured on LB plates. The plates were incubated ON at 37\u00b0C. Top agar was harvested and mixed with 3 ml Suspension Medium . The mixture was centrifuged and the supernatant titrated as for single step experiments.Recombination frequencies were estimated on phage stocks grown on plates to confluence, starting with an m.o.i. of 0.1. As Redgam\u2212 phages due to mutation was measured by plating a \u03bbcI857ts strain on a P2 lysogen, and found to be 5\u00d710\u22127. Therefore, contribution of mutagenesis to the scoring of Red-dependent, gam- recombinants was considered negligible.Background level of \u2212) and \u03bbNec6 (Gam+) produce rolling circle intermediates as a function of time, with the Gam- phage producing less than the Gam+ phage, as expected. Monomeric molecules migrate ahead of rolling-circle products, and dimer molecules of \u03bb are absent. A similar result was obtained when phages were adsorbed to the strains used for recombination scoring .\u03bb replicates by two distinct modes, theta type and rolling-circle type, which may be different substrates for recombination. However, all derivatives analysed in this work contain a Chi site, so they should produce rolling circle intermediates, even in the absence of Gam, as is the case when pL is inverted. We verified by Southern analysis that both types of constructs, with pL inverted or not, produced rolling circle intermediates in our growth conditions. To do so, phages were adsorbed to 1 ml of C600 cells grown to an OD of 0.5 , at an MOI of 1, at 37\u00b0C without agitation. Samples were withdrawn 0, 30 and 60 minutes after adsorption, cells were pelleted and resuspended in 100 \u00b5l of SET buffer , and incubated 10 min at 37\u00b0C. Lysis was then completed by adding 100 \u00b5l of SET supplemented with 5% SDS and bromophenol blue. Crude extracts were vortexed 1 minute, and loaded (30 \u00b5l) on a 15 cm-long, 0.5% TBE agarose gel supplemented with 40 \u00b5g/ml ethidium bromide. To achieve best separation, electrophoresis proceeded in TBE buffer with 40 \u00b5g/ml ethidium bromide for 3 h at 150 volts. This high migration voltage heated considerably both buffer and gel, and this appeared necessary to achieve best resolution, as the same gels run in the cold room did not allow to separate \u03bb from the bulk of chromosomal DNA as nicely. Under such conditions, the dimer and trimer of \u03bb, prepared by partial ligation, migrated faster than the rolling-circle intermediates, which co-migrated with the upper limit of the bulk of chromosomal DNA. Transfer, and hybridisation, followed classical protocols (the whole \u03bb genome was taken as a probe). Results on oxa gene to be sequenced. When the same pairs of oligonucleotides were used on the starting, non-inverted phages, no PCR product was obtained, ensuring that the recombinants analysed were not generated during the PCR itself.Single plaques of recombinants were purified by streaking, purified plaques were toothpicked and resuspended in SM. These crude phage particles were directly used for PCR amplification with oligonucleotides flanking the \u22128 and exhibiting more than 90% nucleotide identity, were kept for further analysis. For each hit, the pairs of left- and right- flanking DNA fragments were aligned using the Needleman-Wunsch algorithm. The size of the analyzed flanking region was 2 kb, with an additional 200 bp-long \u201canchor\u201d inside the hit. In cases where two hits were closer than 2 kb apart on one or both genomes, the flanking fragment size was set to the size of the smaller inter-hit intervals, and alignment was calculated only if fragments were longer than 100 bp. The alignment result was converted into a vector storing the percentage of identity (idperc) in each 100nt-long interval. The hit idperc value  was the integer value of the blast output. The background level of idperc  for a given genome pair was estimated by pooling values obtained in all vectors of this pair, and extracting the one third median. A shoulder was then defined as any interval of the vector (at least 100 nt long), directly flanking the hit, and in which all idperc values s, were such that b+10<s<h\u221210. Some flexibility was added to this rule, so as to permit any of the s values to be less than b+10, provided that its two neighbors were more than b+10.A flowchart is given as Vectors calculated as described above were used to detect regions similar to the shoulders in terms of idperc, but not placed at the flanking side of the hit. These heterogeneities will be called tentatively \u201cbumps\u201d. Cumulated bump length found at the vicinity of all hits, divided by the total length scanned , allowed to estimate the bump density. This density was then multiplied by the cumulated shoulder lengths, to give an estimation of the number of shoulders that correspond in fact to the background \u201cnoise\u201d of heterogeneity of all alignments.S. aureus bacteriophages was selected according to Kwan et al. : 187, 69, 53, 85, 2638A, 77, 42e, 3A, 47, 37, EW, 96, ROSA, 71, 55, 29, 52A, 88, 92, X2. Scripts were written in Python, using the Biopython parser for genbank files. BLAST 2.2.10 was downloaded from the NCBI.Ten genomes of lambdoid phages from enterobacteria were used: \u03bb, HK022, HK97, P22, 933W, HK620, N15, P27, D3, APSE. The set of 15 lactic acid bacteria infecting phages was selected according to Proux et al. : A2, Tuc2009, BK5-T, TP901-1, r1t, bIL67, c2, sk1, bIL170, bIL309, bIL285, bIL286, 7201, sfi19, sfi21. The set of 20 Figure S1Nucleotide sequence alignment of oxa genes used as recombination substrates. (A) oxa7 to oxa11 (4% divergence). (B) oxa7 to oxa5 (22% divergence). Alignments were performed with the Needleman-Wunsch algorithm.(0.03 MB DOC)Click here for additional data file.Figure S2Flowchart of the shoulder detection strategy.(0.02 MB DOC)Click here for additional data file.Figure S3Sketch of the different steps of the Lamda Nec contructions.(0.21 MB DOC)Click here for additional data file.Table S1Joints positions in recombinants obtained with 22% diverged DNA.(0.02 MB XLS)Click here for additional data file.Table S2Position of the mosaics detected among the enterobacteria bacteriophages.(0.03 MB XLS)Click here for additional data file.Table S3Position of the mosaics detected among lactic acid bacteria bacteriophages.(0.04 MB DOC)Click here for additional data file.Table S4Positions of the mosaics detected among Staphylococcus aureus bacteriophages.(0.14 MB DOC)Click here for additional data file.Text S1Construction of the Lambda Nec series.(0.03 MB DOC)Click here for additional data file."}
+{"text": "PLoS Genetics, Lee et al. DNA damage repair, loss of heterozygosity, and chromosome rearrangement are important aspects of genome stability, and all are tied to mitotic recombination. Despite the importance of mitotic recombination, the most basic questions about this process remain poorly understood. This is in part because mitotic recombination, in contrast to meiotic recombination, is rare on a per cell division basis Drosophila experiments Saccharomyces cerevisiae. They used this method to measure rates of spontaneous and induced mitotic recombination. Lee et al. have brought increased power to this assay by performing it in diploids with \u223c0.5% heterology between the sequences of homologous chromosomes. This design allowed mapping of RCOs at high resolution, and also allowed study of another aspect of recombination\u2014gene conversion . Recombinational repair of a DSB requires a template; when the homologous chromosome serves that role, it provides the opportunity for an RCO. Since there is also evidence that single-stranded nicks and gaps are recombinogenic At what point in the cell cycle does mitotic recombination occur? Whereas meiotic recombination occurs during meiosis, most mitotic recombination probably does not occur during mitosis, but during interphase. Analysis of gene conversion tracts associated with RCOs provides clues about when during interphase mitotic recombination takes place. Gene conversion is a nonreciprocal exchange of genetic information. Normal gene conversion between homologous chromosomes produces a 3\u22361 ratio of alleles ; howeverWhat is the molecular mechanism by which mitotic recombination is accomplished? The results presented by Lee et al. suggest that RCOs with different gene conversion tract lengths may be produced by different mechanisms. Short tracts may result from a DSB repair pathway involving heteroduplex formation followed by mismatch repair S. cerevisiae involve a DHJ intermediate Lee et al. argue that the very large conversion tracts (some up to 100 kb in length) may reflect a different process, gap repair Are there hotspots for mitotic recombination as there are for meiotic recombination? It is believed that some sites are hotter for DSB formation than others. Common fragile sites (CFSs), regions of the genome prone to chromosomal DSBs, are a normal feature of mammalian chromosomes, and analogous regions have been identified in yeast Many questions concerning mitotic recombination remain to be answered. Perhaps the most basic of these is what makes certain regions more prone to mitotic breakage and recombination than others? The approach of Lee et al. can address this question\u2014and others\u2014in an exciting new way by focusing on regions prone to spontaneous damage, as opposed to induced damage. These and other studies of mitotic recombination, a process both fundamental and far reaching, promise to continue to provide interesting insights into causes of genome instability."}
+{"text": "FST shows negative correlation with recombination rate, with FST reduced by 10% in the tenth of the genome with the highest recombination rate compared with the tenth of the genome with the lowest recombination rate (P\u226a10\u221212). This pattern cannot be explained by the mutagenic properties of recombination and instead must reflect the impact of selection in the last 100,000 years since human continental populations split. The correlation between recombination rate and FST has a qualitatively different relationship for FST between African and non-African populations and for FST between European and East Asian populations, suggesting varying levels or types of selection in different epochs of human history.Allele frequency differences across populations can provide valuable information both for studying population structure and for identifying loci that have been targets of natural selection. Here, we examine the relationship between recombination rate and population differentiation in humans by analyzing two uniformly-ascertained, whole-genome data sets. We find that population differentiation as assessed by inter-continental  A common assumption when analyzing patterns of human genetic variation is that most of the genome can be treated as \u201cnearly neutral,\u201d in the sense that the effects of natural selection on allele frequencies are very small compared with the influence of population demographic history. To test the validity of this assumption, we analyzed data from more than a million human polymorphisms and summarized allele frequency differences across populations. We find that, compared with the genome-wide average, allele frequency differences are 7% reduced on average in the tenth of the genome with the highest recombination rate and are 3% increased in the tenth with the lowest rate. Such a correlation cannot be explained by demography. Instead, the pattern reflects the fact that forces of natural selection have had a profound impact on patterns of variation throughout the genome in the last 100,000 years. FSTFST, it may be possible to learn about how much of the overall differentiation in allele frequencies across populations can be accounted for by natural selection.Single Nucleotide Polymorphism (SNP) allele frequency differentiation between human populations, usually measured by Wright's nucleotide diversity and recombination rate in many species, notably in DrosophilaArabidopsis lyrataDrosophila, humans, and maize, a positive correlation was also observed between interspecific sequence divergence and recombination rate Many studies have documented a positive correlation between A substantial body of research has explored an alternative, mechanistic explanation for the observed positive correlation between nucleotide diversity and recombination, which is the mutagenic effect of recombination FST and recombination rate if adaptation is local and selective sweeps drive alleles to high frequency in some but not all of the populations between which FST is measured. Selective sweeps are expected to extend less far in regions of higher recombination rate, and thus allele frequency differentiation is expected to be higher on average in regions of low recombination rate FST and recombination rate. While negative selection is expected to decrease population differentiation at the site under selection itself FSTIn this study, we examine the relationship between recombination rate and population differentiation in allele frequencies of ascertained polymorphisms. For this type of analysis, the mutagenic effect of recombination is not a confounder, and any observed correlation is expected to be the result of selection in human history since the split of the analyzed populations. Different types of natural selection are expected to affect patterns of allele frequency differentiation: Positive selection is predicted to produce a negative correlation between To empirically examine the correlation of recombination rate and allele frequency differentiation in human populations, we needed to examine data sets that were ascertained in a uniform way across the genome, in a manner that is independent of local recombination rate. We focused on two data sets: 1,110,338 Perlegen \u201cclass A\u201d SNPs Our primary set of analyses were carried out on 1,110,338 Perlegen \u201cclass A\u201d autosomal SNPs FST between the three population samples, which consisted of 24 individuals of European ancestry, 24 individuals of Han Chinese ancestry, and 23 African Americans \u22126). A linear regression of population differentiation as a function of recombination rate provides a reasonably good fit to the data, and predicts an average decrease of 0.0048 (4%) in FST for every 1 cM/Mb increase in recombination rate .To examine whether and how population differentiation depends on recombination rate, we assigned SNPs to equally-sized bins according to the recombination rate around them. For each bin, we estimated global population differentiation for the SNPs in that bin as the ion rate . As binnFST estimation that is due to a limited number of SNPs in each bin. (We did estimate standard errors in each bin via bootstrapping as presented in FST and recombination rate.) (ii) Because the regression did not incorporate this uncertainty, we could not apply the analysis to many recombination rate bins since as the number of SNPs per bin decreased the noise obscuring the signal increased. (iii) The analysis did not account for correlation between SNPs due to linkage disequilibrium (LD), which is important especially since LD is itself correlated to recombination rate.To characterize in more detail the relationship between population differentiation and recombination rate, we designed a more elaborate statistical framework that overcame three limitations of the correlation and regression analysis described above: (i) The previous analysis did not incorporate uncertainty in To overcome these limitations, we developed a bootstrapping framework for estimating several statistics that capture the relationship between recombination rate and population differentiation. The framework generates many data sets of the same size as the original using a Moving Block Bootstrap (MBB) FST and recombination rate remains extremely significant: r\u200a=\u200a\u22120.89\u00b10.06 (P\u226a10\u221212). Linear regression of FST as a function of recombination rate results in a best fitting relationship of 0.1280\u20130.0049\u03c1, which is very similar to the na\u00efve analysis; but, importantly, the bootstrapping framework allows us to perform hypothesis testing based on the standard error estimates across bootstraps (\u221212) as is a t-statistic for the significance of the linear regression coefficient: \u22126.09\u00b12.18 . We use 10 recombination rate bins in all following analyses.After applying the bootstrapping framework to the data set, the correlation between otstraps . In part\u22124) population differentiation: 0.1265\u00b10.0016 compared with 0.1212\u00b10.0006 for non-coding SNPs (ncSNPs).We cannot envision any demographic or mechanistic explanation that would produce a correlation between recombination rate and allele frequency differentiation as observed and we hypothesize that our observations reflect a history of natural selection. Natural selection is usually expected to increase population differentiation at linked neutral sites FST as a function of recombination rate is steeper for cSNPs than for ncSNPs , for FST between African Americans and Europeans and for FST between African Americans and Chinese, than for FST between Europeans and Chinese , as well as for African American\u2013Chinese FST , but no correlation with recombination rate for European\u2013Chinese FST .We next considered the effect of recombination rate on population differentiation between each pair of populations separately. A negative correlation is observed between all pairs of populations, but the pattern is qualitatively different across population pairs . The regFST between European and Chinese populations is driven by a dip in differentiation at very low recombination rate loci (\u22124) as well as quadratic (P\u200a=\u200a1.8\u00d710\u22125) terms. Conversely, quadratic regression gives a non-significant quadratic term for FST between African Americans and each of the other two populations and if anything is slightly convex. As expected, for single SNP analysis (without binning by recombination rate), linear regression is very significant for FST between African Americans and either non-African population (P\u226a10\u221212). For FST between Chinese and Europeans, however, linear regression is not significant (P\u200a=\u200a0.81), while a quadratic regression is very significant (P\u226a10\u221212).The weaker correlation for the ate loci , which iate loci . This cuFST of all three populations  and for FST between YRI and ASN (P\u200a=\u200a1.0\u00d710\u22125 and P\u200a=\u200a3.0\u00d710\u22124), but not for FST between CEU and ASN  corresponds to an average decrease of 4% in We considered various explanations for these observations, all involving natural selection. We first considered evolution favoring higher recombination rate in functionally important elements, which could potentially contribute to the higher recombination rate observed in genes, and which could also generate a correlation between recombination rate and allele frequency differentiation. However, we realized that this would generate a correlation in the opposite direction to what we observe: This is expected to result in a higher recombination rate in functionally important regions, which exhibit higher differentiation on average , leadingFST is directional selection; that is, hitchhiking linked to positively selected alleles (sweeps) or background selection linked to negatively selected alleles. Evidence for this explanation comes from the stronger negative correlation between population differentiation and recombination rate in coding regions, though we did not have enough data to establish the difference between coding SNPs and the rest of the genome with high statistical significance. Hitchhiking of recent, geographically localized selective sweeps, after the split of African and non-African populations is a potential explanation of these results, especially considering the magnitude of the effect we observed, since it is expected to increase population differentiation and to have a more marked effect in regions of lower recombination. Alternatively, background selection also has the potential to increase population differentiation, because it is expected to decrease within-population diversity at regions linked to loci under negative selection, which will have a more marked effect in regions of lower recombination.The only force we could identify that can explain the observation of a negative correlation between recombination rate and The different nature of the effect these two selective forces have on population differentiation should make it possible to distinguish them in finer-scale studies A striking observation in our study is the qualitatively different relationships between recombination rate and allele frequency differentiation for different pairs of populations, suggesting that selection has acted in different ways over different epochs of history. A possible explanation for the stronger correlation observed between African and non-African populations, compared to that between Europeans and East Asians, is the smaller effective population size in non-African population history compared with African history since they diverged. Although in general a reduced effective population size makes selection less efficient, it can increase the impact of background selection on patterns of genetic variation since weakly deleterious mutations are less efficiently purged from the population, thereby reaching higher frequencies which results in more extensive background selection when they are purged FST patterns between different pairs of populations is if selective sweeps were shared to different extents across populations. When an allele that arose in one population and is under selection enters a second population via migration, FST at linked neutral sites can actually be reduced between the two populations since hitchhiking effectively takes variation from the between-population component and injects it into the within-population component positive correlation between FST and recombination rate. Europeans and East Asians exchanged genes more recently than both did with Africans, and hence a larger fraction of selective sweeps are expected to be shared between these two populations, introducing a component of positive correlation between FST and recombination rate. The signature of global selective sweeps is expected to decay differently with genetic distance from the selected site than the decay due to local sweeps FST and recombination rate. A limitation of this explanation for our observations, however, is that the phenomenon of reduced FST due to a global selective sweep has only been demonstrated for populations that are much more diverged than human populations Another scenario that could potentially produce different FST and recombination rate in additional populations by studying data from HapMap 3, which genotyped 1,184 individuals from 11 populations FST and recombination rate, with an average decrease of 3% in global FST between all 11 populations for every 1 cM/Mb increase in recombination rate . If this suggestive result is verified, it will point to natural selection playing more of a role in allele frequency differentiation on chromosome X than on the autosomes. This observation is especially interesting in light of our recent finding that chromosome X exhibits higher allele frequency differentiation between Africans and non-Africans than would be expected from \u00be the effective population size of the autosomes The approach presented in this study allows not only a comparison of the effect selection has on allele frequency differentiation at different historical times, but also a comparison across different compartments of the genome. Repeating the analysis on Perlegen \u201cclass A\u201d X-linked SNPs , we observed a very significant correlation between global population differentiation of X-linked SNPs and recombination rate, with a correlation coefficient of \u22120.86 (P\u200a=\u200a0.001) when partitioning the data into 10 bins . The smaFST for high recombination rate, rather than the genome-wide average. This is in the same spirit of studies targeting regions of high recombination rate and far from functional elements to infer human demographic history FST in the Perlegen data set, the genome-wide estimate is 0.121, while it is 0.113 for the SNPs in the bin with 10% highest recombination rate  Models of demographic history would be expected to be more accurate if one used the prediction of ion rate . For stunucleotide diversity and recombination rate in Drosophila found it to be non-significant when recombination rate was estimated in 2 Mb windows and to be significant when finer-scale heterogeneity in recombination rate was considered in the analysis A limitation of this study is the genetic map available. We chose to use a pedigree-derived human genetic map In conclusion, we have shown that genome-wide human population differentiation in allele frequencies is significantly correlated with recombination rate on a megabase scale, demonstrating that natural selection has had a profound effect on allele frequency distributions averaged over the last hundred thousand years. While these results likely reflect the effects of hitchhiking and background selection, disentangling the strengths of these two forces will require extending the analyses presented in this paper. One important direction is to use genetic maps that have fine spatial resolution, which may shed light on the detailed distribution of selective coefficients that have shaped allele frequency differentiation. A second direction in which these results can be extended is to compare more populations of continentally diverse ancestry. This should facilitate an exploration of the relationship between recombination rate and population differentiation during different epochs of human evolution, and should allow a better understanding of how demographic history has shaped the impact of natural selection on patterns of human genetic variation.http://genome.ucsc.edu/cgi-bin/hgLiftOver) to convert genomic positions from build 34 (hg16) used in the Perlegen data set to build 35 (hg17) and discarded SNPs for which this conversion failed. We then estimated recombination rate around each SNP and discarded SNPs for which it could not be accurately estimated (see below). Following these filters, we were left with 1,110,338 autosomal SNPs with recombination rate estimates. Out of these, we also identified 21,391 coding SNPs according to the UCSC Known Genes track To examine the correlation between SNP allele frequency differentiation and recombination rate in a way that is not sensitive to the confounder of recombination rate-dependent SNP ascertainment, we limited our main analysis to autosomal Perlegen \u201cclass A\u201d SNPs We replicated our results in a data set of SNPs that were uniformly ascertained as polymorphic in exactly two chromosomes of the same ancestry and genotyped in all HapMap samples We determined recombination rate around each SNP based on the deCODE genetic map FST statistic as formulated in ref. FST estimates are almost identical to the estimates obtained based on the estimator of Weir and Cockerham FST over all population-pairs. We estimated pairwise and global FST across all SNPs in each recombination rate bin. We also estimated FST standard errors  The coefficients of the linear regression FST\u200a=\u200a0b+1\u03c1b, (ii) the correlation coefficient across bins, (iii) a t-statistic for the significance of the linear coefficient of the above regression, and (iv) a normalized regression coefficient 1/b0b. We estimated standard errors of these statistics as the standard deviation across resamplings. Hence, these standard errors account for the problem that nearby SNPs do not provide independent observations due to LD.We randomly resampled 1,000 data sets of SNPs from the set of all SNPs using MBB. For each of these sets, we started by stratifying resampled SNPs into bins according to their recombination rate, and then repeated the procedure that was used to analyze the original data set. Specifically, we estimated 1b/0b) for cSNPs than for ncSNPs (one-sided z-test) and for a significantly different ratio between different pairs of populations (two-sided z-test). We also reported hypothesis testing for whether 0b and 1b by themselves are higher in cSNPs than ncSNPs (one-sided z-test).Based on averaged estimates across resamplings and their standard errors, we performed two-sided z-tests for the significance of each statistic . We alsoFigure S1FST estimates as a function of the median recombination rate in each bin (solid line) is (A) 0.0855\u20130.0010\u03c1 (B) 0.1222\u20130.0048\u03c1 (C) 0.1371\u20130.0059\u03c1, and (D) 0.1434\u20130.0065\u03c1. The corresponding correlation coefficient estimates between FST and median recombination rate is (A) r\u200a=\u200a\u22120.691 (P\u200a=\u200a0.0269), (B) \u22120.960 (P\u200a=\u200a1.0\u00d710\u22125), (C) \u22120.954 (P\u200a=\u200a1.9\u00d710\u22125), and (D) \u22120.865 (P\u200a=\u200a0.0012). We emphasize that natural selection being the force behind the correlation between population differentiation and recombination rate can entail a  relationship between MAF and recombination rates since selection changes allele frequencies. Nevertheless, the correlation of population differentiation and recombination rate is very significant for all categories of common SNPs (B\u2013D). The results are not as significant, though a correlation is observed, for SNPs of low MAF (A), likely due to the effect of negative selection on allele frequencies.Relationship between population differentiation and recombination rate for different minor allele frequencies (MAFs). We divided 1,110,338 SNPs into 4 categories according to their MAF: (A) MAF\u22640.125, (B) 0.125<MAF\u22640.25, (C) 0.25<MAF\u22640.375, and (D) 0.375<MAF (\u22640.5). For each category, we partitioned SNPs into 10 bins according to the recombination rate around each SNP and presentation is similar to (1.15 MB EPS)Click here for additional data file.Figure S2FST estimates as a function of the median recombination rate in each bin is also presented (solid line), corresponding to 0.2272\u20130.0552\u03c1. The corresponding correlation coefficient between FST and median recombination is r\u200a=\u200a\u22120.860 (P\u200a=\u200a0.0014). For comparison, population differentiation based on all SNPs in all bins combined is also presented .Population differentiation in allele frequencies is inversely correlated with recombination rate on chromosome X. We placed 26,074 Perlegen \u201cclass A\u201d X-linked SNPs into 10 bins according to the recombination rate in a 3 Mb window centered on each SNP. The x-axis of all panels indicates the recombination rate, with the values indicated on the ticks corresponding to the edges between the 10 bins. For each bin, at an x-axis position corresponding to the median recombination rate across the SNPs at that bin, the figure presents global population differentiation between African Americans, Europeans, and Chinese. Error bars indicate \u00b11 standard error, which is estimated based on 1,000 moving block bootstraps over the SNPs in the bin. Linear regression of (0.01 MB EPS)Click here for additional data file.Figure S3Results when recombination rate is estimated in a 5 Mb window. The figure mirrors (1.12 MB EPS)Click here for additional data file.Figure S4Results when recombination rate is estimated in a 1 Mb window. The figure mirrors (1.15 MB EPS)Click here for additional data file.Figure S5Results when filtering regions near centromeres and telomeres. In the main analyses a SNP was discarded if the 3 Mb around it overlaps either a centromere or a telomere. To more cautiously account for the possibility of our results being sensitive to centromeric or telomeric regions, we repeated the analysis while also discarding SNPs for which the 3 Mb window around them is within 5 Mb of such a region . The figure mirrors (1.15 MB EPS)Click here for additional data file.Table S1FST as a function of recombination rate in uniformly-ascertained subsets of HapMap. The table mirrors FST between all three HapMap populations, as well as pairwise FST between each pair of populations.Bootstrapped correlation and regression coefficient estimates of (0.07 MB DOC)Click here for additional data file."}
+{"text": "Additionally, the methods used to measure recombination make a variety of assumptions about the underlying process, and often fail to account adequately for issues such as co-infection of cells or the possibility of multiple template switches between recombination sites. We have developed a HIV-1 marker system by making a small number of codon modifications in gag which allow recombination to be measured over various lengths between closely related viral genomes. We have developed statistical tools to measure recombination rates that can compensate for the possibility of multiple template switches. Our results show that when multiple template switches are ignored the error is substantial, particularly when recombination rates are high, or the genomic distance is large. We demonstrate that this system is applicable to other studies to accurately measure the recombination rate and show that recombination does not occur randomly within the HIV genome.Retroviral recombination is thought to play an important role in the generation of immune escape and multiple drug resistance by shuffling pre-existing mutations in the viral population. Current estimates of HIV-1 recombination rates are derived from measurements within reporter gene sequences or genetically divergent HIV sequences. These measurements do not mimic the recombination occurring  HIV's ability to generate and maintain high genetic diversity leads to multiple drug resistances and evasion from the immune system, eventually leading to immune failure and progression to AIDS. HIV maintains this diversity with a process of mutation  and recombination . Recombination is generally studied by inserting genes encoding non-viral fluorescent proteins. However, recombination in such modified HIV genomes may not accurately reflect the level of recombination occurring within a patient infected with HIV. Additionally, recombination will go undetected in regions where the parental genomes are identical, and this effect is often ignored. We have developed a novel experimental system which allows recombination to be measured between two very closely related HIV genomes. We have also developed statistical tools to accurately calculate the recombination rate, compensating for undetectable recombination in identical regions of the parental genomes. We show that our experimental system bypasses some of the pitfalls of fluorescent recombination experiments and our tools provide a strong quantitative foundation for future studies in this area. Viral diversity is one of the major obstacles to the successful eradication of HIV in vitro studies show that template sequence and nucleic acid structure are important determinants of the recombination process in vivo, where the vast majority of infected individuals are infected with a single virus which rapidly diversifies into a viral quasispecies over the course of infection Recombination has been studied extensively, by many groups, and is typically detected by monitoring the linking of marker points from co-packaged RNA genomes into a single DNA genome. One popular method of measuring recombination is through the use of retroviral reporter systems. These systems measure recombination within a \u2018foreign\u2019 gene insert, such as genes that code for antibiotic resistance proteins, surface protein markers, and/or fluorescent proteins Recombination is detected by monitoring the linking of marker points from separate RNA genomes into a single DNA genome. Regardless of the system in which it is measured, recombination is either detected or undetected between any two marker points. This is generally interpreted as one or zero recombination events, respectively. However, with increasing genomic distance and/or recombination rate, there is an increased likelihood that there will be multiple template switches between any two marker points which go undetected. Consequently, with high rates of recombination and/or genomic distances between marker points, there is a greater chance of underestimating recombination rates due to multiple template switches. These possibilities have been mentioned previously Here, we present a novel experimental method based on limited codon modification of the HIV genome which does not change the infectivity of the virus or any viral protein. This allows the measurement of recombination between closely related genomes analogous to those found in the quasispecies of an infected individual. This system measures recombination in different gene segments, allowing the identification of possible recombination \u2018hotspots\u2019, where template switches occur at higher frequencies. We then develop statistical tools to calculate an \u2018optimal recombination rate\u2019 that reproduces observed recombination frequencies, taking into account multiple template switches. These tools demonstrate the error in calculating crude recombination rates (that do not consider multiple template switches) and emphasize the necessity for careful data analysis. These tools also provide the basis to quantify statistical differences in recombination rates in various regions of the HIV genome, under different conditions, or infection with different target cells. Finally, our analysis allows for testing and subsequent validation of some inherent assumptions and sources of error in the experimental design. We compare our analytic procedure with previously published studies and find that our approach avoids some of the potential pitfalls of using reporter gene inserts.Recombination is measured by analysing the cDNA that results from infection with non-identical (heterozygous) co-packaged RNA genomes. The positions in which the RNA genomes differ are called marker points. Recombination is detected only when the resulting cDNA contains a mixture of marker points from both RNA strands. It is tempting to conclude that one template switch has occurred every time recombination is detected between a set of marker points, and that no template switches occurred elsewhere. However, any even number of template switches between two fixed marker points will lead to us observing no recombination, and any odd number will result in us observing a single recombination event . An impor\u200a=\u200ac/nl, where r is the rate of recombination events per nucleotide per round of infection (REPN), c is the number of template switches detected, n is the number of sequences, and l is the genomic distance over which recombination is measured. This crude formula assumes that between marker points, at most one template switch can occur. To calculate the theoretical expected error of the \u2018crude\u2019 recombination rate we first use the \u2018optimal\u2019 recombination rate equation (Eq. A) to determine the probability of observing recombination over different genomic distances. We then use the \u2018crude\u2019 recombination rate calculation on these probabilities and find that this calculation consistently underestimates the real recombination rate. At an actual recombination rate of 0.001 REPN (lower than the median recombination rate measured in T-cells in this study), the calculated crude recombination rate is 9% lower when measured over a distance of 100 nucleotides, and 37% lower when measured over a distance of 500 nucleotides : leotides . This erleotides . This ergag gene of wild-type (WT) HIV. This creates 5 regions (varying in length from 77 to 398 nucleotides) over which we can directly measure the recombination rate of a full length HIV genome  by introducing 6 codon modifications into the V genome . These mV genome . The recIn our experimental system, a template switch observed in the DNA provirus is most likely to be the result of viral recombination during reverse transcription of the two RNA molecules co-packaged in a heterozygous virion. However, it is possible that recombination could also have occurred during a number of steps in sample preparation and sequencing. To determine the potential bias within our experimental system, we quantified experimentally-induced recombination, as follows:Firstly, we tested the possibility of transfection-induced recombination which can occur via homologous recombination in the producer cell Secondly, we tested for PCR-induced recombination that may occur if the polymerase switches templates during PCR amplification of the viral sequences prior to sequencing. We measured this by performing two separate infections with either WT homozygous virus or MK homozygous virus . In thisFinally, we measured the rate of \u2018inter-virion\u2019 recombination that may have occurred if the target cells were multiply infected, and retroviral recombination was occurring between the RNA molecules of different virions. To do this we co-infected cells with homozygous WT and homozygous MK virions. Thus, any intra-virion recombination would be undetected, but both inter-virion recombination and PCR-induced recombination would be detected . 128 seqTo measure the biological rate of recombination we generated a mixture of heterozygous and homozygous virus by co-transfection. When equal amounts of two HIV plasmids are co-transfected, co-packaging of RNA into virions is random In determining recombination rates, it is easy to assume that transfection of equal amounts of WT and MK plasmid leads to the production of 50% heterozygous and 50% homozygous virus. However, variations in the level of co-transfection will lead to the production of a different proportion of heterozygous virions than expected. This will bias the calculation of recombination rates. Our design allows us to estimate the proportion of heterozygous virions in our experiments directly from the data  of fluorescent protein expressing cells and the MOI of viral infection. However these calculations are not easily comparable to calculations made for marker points separated by different genomic lengths. A clearer approach is to calculate the recombination rate in terms of \u2018recombination events per nucleotide per round of infection\u2019 (REPN), as this rate allows the prediction of the number of recombination events that will occur over any length of RNA. To demonstrate how our recombination rate calculation method can be applied to fluorescent protein studies, and to make a direct comparison of these recombination rates to our own, we analysed the data from Rhodes et al. 2005 M) is calculated. This ratio represents the probability of a single infection event resulting in the reconstruction of a functional GFP protein  is 4M. Using equation (A) (R(L)\u200a=\u200a4M converts M into the required recombination rate measured in REPN.Table 2, 3, 4, and 5 from Rhodes 2005 lists the total number of cells, infected cells, and green fluorescent protein positive (GFP+) cells when the recombination is measured over a genomic distance of 588, 300, 288 and 103 base pairs, respectively. From these ratios the GFP+ MOI/infection MOI (ratio denoted as tein see . Recombition (A)  with R if the variation in recombination along the gene is significantly different than that expected by random variation (indicating whether recombination is a random event); (ii) the optimal location for a recombination rate change (determining the marker point that separates any recombination \u2018hotspots\u2019 and \u2018coldspots\u2019); and (iii) whether a two recombination rate model better describes the observed experimental recombination data. Together, these analyses will help us to determine whether recombination occurs randomly across the viral genome.Crossover sites of the HIV-1 RT may consist of RNA sequence determinants that direct the RT to switch templates, and it has been suggested that RNA-RNA interactions can promote recombination gag. The experimental data displays significant variation from the expected frequencies of recombination to the observed frequencies (p\u200a=\u200a0.02) suggesting that recombination rates vary along the gene segments.We first use a chi-squared goodness of fit test to determine if the observed frequency of recombination and the expected frequency  \u22123 and 0.49\u00d710\u22123 REPN from sites 1\u20134 and 4\u20136 respectively)  . Comparictively) , indicatctively) . Howevergag gene, the frequency of multiple detectable template switches does not follow a Poisson distribution. We calculated this distribution to compute the expected frequency of multiple detectable template switches and compare this to our experimental results . This illustrates that our codon-modified markers have not significantly altered the RNA structure so as to bias the observed recombination rate.Recombination plays an instrumental role in the evolution of HIV Our HIV recombination marker system uses genetic marker points based on the codon modification of the authentic full length HIV genome without altering the amino acid sequences. Other groups have previously measured recombination rates on the HIV genome using the divergent RNA sequences found between or within HIV subtypes or within non-viral reporter sequences. Our procedure has several advantages over previously published methods. First, we rationally introduced marker points into the HIV genome at well defined locations, by avoiding RNA sequences that are known to be important for HIV replication. These marker points allow recombination to be monitored, but do not affect the HIV replication cycle, even over multiple rounds of replication . This isWe acknowledge that there are experimental complexities associated with the direct measurement of recombination by sequencing that can lead to the inclusion of non-viral recombination artifacts. Therefore, we carefully controlled for transfection-induced recombination, PCR-induced recombination and the effects of co-infection due to inter-virion recombination. In our study, transfection-induced recombination can be excluded as a source of error. We also show that inter-virion recombination, due to multiple infections of a cell, is not a significant source of error. By contrast, most retroviral reporter systems are biased by multiple infections. That is, in most retroviral reporter systems, multiple infections cannot be distinguished from single infections. This decreases the apparent total number of infection events, which is required to accurately calculate the recombination rate. To overcome this, these systems make use of MOI calculations which compensates for multiple infections. However, MOI calculations assume that infection events are independent and random. This is problematic in light of reports that double-infection occurs more frequently than predicted from random chance alone As recombination is measured by observing the linking of genetic marker points, all recombination systems are potentially biased by the occurrence of multiple template switches. A potential solution is to reduce the genomic distance between marker points and to evenly space them on the HIV genome. This effectively eliminates multiple template switches and any bias due to variations in genomic distance between marker points. However, it is impossible to modify the HIV genome in this way without drastically affecting the replication cycle. As a result, modifications that do not affect important RNA sequences or vary the amino acid sequences of viral proteins will always be unevenly spaced. Furthermore, increasing the frequency of marker points increases the genetic diversity between co-packaged RNAs. This is expected to decrease the observed recombination rate, as high levels of sequence identity between templates is required for efficient template switching \u22123 REPN in primary T-cells, which is a high rate of recombination, equivalent to 12.5 recombination events per genome every replication cycle. This is higher than when we apply our method to the data in Rhodes 2005 \u22123). However the measurements in our study are based on the HIV genome rather than non-viral reporter genes in previous studies We also calculate the theoretical estimate for the error when recombination is measured without compensating for multiple template switches and show that the width between marker points can dramatically affect the crude recombination rate estimation. For example, when the distance between marker points is 400 base pairs, an actual recombination rate of 0.001 REPN and 0.003 REPN would be crudely calculated to be 0.0007 REPN and 0.0011 REPN, respectively. This is a difference that could be interpreted as resulting from random variation alone. This effect becomes more important at higher recombination rates. This is especially significant as recombination has been reported to be 3-fold higher in macrophages than in T-cells gag gene. We tested whether a dual recombination rate model fitted the data better, but this did not reach significance at the 0.05 level (p\u200a=\u200a0.068). Therefore, the data imply that there are recombination \u2018hot-\u2019 and/or \u2018cold-spots\u2019 within the genome but this current dataset was not large enough to identify how, or precisely where, the recombination rate changes. Interestingly, comparative sequence analysis of inter-subtype recombinants also showed a reduction in recombination near the 3\u2032 end of gagOur measurements on the HIV genome demonstrate that recombination does not occur randomly. Firstly, our results suggests that two or more recombination events on the same RNA strand may be observed more frequently than expected, although this was not statistically significant  blood donors to the Red Cross Blood Bank. All biological samples were handled according to the Burnet Institute and the Alfred Hospital approved ethics guidelines that are in line with Australian Government regulation.g for 30 minutes, and then passed through a 0.45\u00b5m filter to remove cellular debris. Purified virus was concentrated by ultracentrifugation at 100,000\u00d7g through a 20% sucrose cushion and stored at \u221280\u00b0C. Virus was treated with 90units/mL benzonase (Sigma) for 15 minutes at 37\u00b0C to remove contaminating plasmid DNA before use.Homozygous virus was produced by transfection of 293T cells with either WT or MK pNL4-3. Heterozygous virus was produced by co-transfection of equal amounts of wild-type pNL4-3 and marker pNL4-3 into 293T cells. Transfections were carried out with polyethylenimine , and transfection efficiencies were measured using a reverse transcriptase assay gag was PCR amplified using the primers (EcoRI)NL3065s [GCAgaattcGAGCTAGAACGATTCGCAG] and (BamHI)NL4066a [TATggatccTGGATTTGTTACTTGGCTCATTG] and the following conditions: initial denaturation 98\u00b0C for 30 seconds, followed by 30 rounds of cycling at 98\u00b0C for 10 seconds and 72\u00b0C for 2 minutes. PCR amplification was done in the log-linear phase as determined by real-time PCR to minimize PCR induced recombination. The fragment was cloned into pGem7z (Promega) and sequenced using the M13F primer on an Applied Biosystems 3730\u00d7l . Recombination events were identified by sequence analysis.Stimulated PBLs were infected with equal amounts of either homozygous or heterozygous virus, as determined by a HIV-1 antigen (p24 CA) micro ELISA assay (Vironostika). Heat inactivated (2 hours at 56\u00b0C) control infections were carried out to confirm efficient removal of plasmid DNA for each sample. 6 hours post-infection 10\u00b5g/mL T-20 (Roche) was added to the cells to prevent second round replications. 24 hours post-infection cells were pelleted, lysed and full length reverse transcriptase products were quantified, as previously described AGAGATGGGTGCGAGAG] after isolation by transformation of E.coli.Controls were carried out to quantify the background rate of recombination produced by the experimental protocol itself. Transfection induced recombination was measured by harvesting plasmid DNA 36 hours post transfection directly from 293T by alkaline lysis as in plasmid DNA preparation from bacterial cells gag by site directed mutagenesis Wild-type HIV-1 pNL4-3 plasmid was obtained from the National Institutes of Health AIDS Research and Reference Reagent program, Division of AIDS, NIAID, NIH: pNL4-3 from Dr. Malcolm Martin 293T cells were obtained from the American Type Culture Collection and maintained in DMEM media (Invitrogen) supplemented with 10% vol/vol CCS (Hyclone) and Pen/Strep (Invitrogen). Primary human peripheral lymphocytes (PBLs) were isolated from two independent buffy coats of HIV-1 seronegative blood donors  by density gradient centrifugation over Ficol-Plaque Plus . PBLs were isolated by counter-current elutriation. The purity of PBLs was assessed by flow cytometry  and determined to be >95% pure based on forward scatter and side scatter characteristics. PBLs were stimulated for 2\u20133 days in RPMI-1640 (Invitrogen) supplemented with 10\u00b5g/mL phytohemagglutinin and transferred into fresh RPMI-1640 containing 50 units/mL Interleukin-2 (Roche) before infection.WP and MP be the proportion of experimentally observed nucleotide sequence data that is completely WT and MK respectively. WP and MP represents cDNA derived from homozygous WT and MK virions, and also cDNA derived from heterozygous virions in which recombination was not observed. Now let F be the fraction of cDNA derived from heterozygous virions that did not observe recombination. We then havew and m are the proportion of WT and MK constructs that were cotransfected into T cells to create the virions. Noting that m\u200a=\u200a1-w allows for solving the expected proportion of cDNA derived from heterozygous virions, 2mw. Thus, we do not need to rely on the estimated proportion of WT:MK virus, but can directly estimate it from our data.We co-transfect equal amounts of WT and MK DNA, in order to produce heterozygous virions. Assuming random co-packaging of viral RNA templates we expect that 50% of the synthesized cDNA to have derived from heterozygous sequences. However, differences in the proportions of the WT and MK sequences may affect the proportion of heterozygous virions (resulting in incorrect estimation of recombination rate). We calculate the expected proportion of heterozygous virions from the experimental data as follows. Let gag. Recombination is observed when a single sequence of DNA product contains both WT and MK markers. However, multiple template switches can occur between marker positions, and recombination can only be detected when there are an odd number of template switches. Thus, it is impossible to work out the exact frequency of recombination events. Rather, the data shows the probability of observing recombination (a switch from WT to MK between markers or vice versa) which is calculated as the number of recombination events observed divided by the number of sequences derived from heterozygous infection. Denote the probability of observing a recombination event between two marker positions separated by a genomic distance of L as R(L). Denote the recombination rate per nucleotide per round of infection as r. These two quantities then satisfy the following.[(L+1)/2] is the integer part of (L+1)/2 and C is the binomial coefficient for picking i unordered outcomes from L possibilities. Alternatively, when the genomic distance L is sufficiently large and the recombination rate r is sufficiently small  the following Poisson approximation holds 1L, 2,L3,\u2026,LkL, then the recombination rate, r, is calculated as the r value that minimises the chi-square valueiO and iE is the observed and expected number of template switches that is detected in region i respectively. The expected number of template switches is calculated as the multiple of i)R be the probability that a single cell has been infected n times with the HIV reporter virus. Let m be the MOI for the HIV reporter virus. Let GFPp be the probability of a single infection event resulting in the reconstruction of a functional GFP encoding region. That is, the probability that an infecting virion is heterozygous, and that recombination occurred between the two co-packaged RNAs such that both GFP deactivating mutations are eliminated. Then, the probability that a single cell has n infections that reconstitute a function GFP is given byGFPmp. Note that C is the binomial coefficient for picking i unordered outcomes from n+i possibilities. Thus, the GFP MOI equals GFPmp and division of the infection MOI, m, leaves GFPp, the probability that an infection event will reconstitute a functional GFP encoding region.Let E(L) and RR(L) be the probability of observing recombination over a genomic distance of L for the experimentally induced and RT induced recombination rates respectively. The cumulative probability of observing recombination after both effects, R(L), is given byERR is subtracted once as RE and RR are independent and not mutually exclusive events, and subtracted a second time to eliminate the cases where PCR template switch nullifies an RT template switch. This is then re-arranged to giveIn this assay, recombination can occur at two independent stages: The experimentally induced recombination, and the viral reverse transcription induced recombination. We measure the experimentally induced recombination alone, and the cumulative effect of experimentally induced recombination with the reverse transcription induced recombination. From this we calculate the reverse transcription induced recombination rate alone as follows. Let Ri(L)P above can be approximated by the Poisson distribution when the length, L, is sufficiently large, and the recombination rate, r, is sufficiently small. Under these conditions the Poisson coefficient is the product of the genomic length and recombination rate Lr. The probability of observing recombination is then approximated byr from experimental data we re-arrange to giveR(L) can be measured from experimental data as the proportion of heterozygous sequences over which recombination was observed.The binomial terms Figure S15 PHA stimulated PBMCs in triplicate. Seven 10-fold serial dilutions of each virus, and a no virus control were tested in triplicate. Supernatants were collected on days 3, 7, 10 and 14 post-infection and viral production was measured using a micro-RT assay. (B) Protein processing profiles of cellular and virion lysates. 293T cells were transfected with WT and MK plasmid. 36 hours post-transfection, cells were washed twice in DPBS and pelleted at 1,462\u00d7g for 10 min at 4\u00b0C. Viral particles were purified and concentrated by ultracentrifugation through a 20% sucrose cushion using a Beckman ultracentrifuge L-90 model (SW 41 rotor) at 100,000\u00d7g for 1 h at 4\u00b0C. Cell and virion pellets were lysed in TBS lysis buffer , 1 \u00b5M pepstatin, and 1 \u00b5M leupeptin) at a concentration of approx 1\u00d7107 cells or 40 \u00b5g of p24 per mL. Cell lysates were rapidly freeze-thawed three times to weaken the cellular membrane and cell debris was subsequently removed by centrifugation at 20,000\u00d7g for 30 min at 4\u00b0C. Lysates were mixed with 5\u00d7 loading buffer , incubated at 95\u00b0C for 5 min and resolved by SDS polyacrylamide gel electrophoresis (SDS-PAGE). Resolved proteins were transferred to a nitrocellulose membrane (Amersham). The membrane was incubated for 30 min in blocking buffer  at room temperature. Proteins were identified using pooled HIV-1 seropositive patient sera.(A) Replication kinetics of WT and MK virus. Equivalent levels of virus, as determined by a micro-RT assay, were added to 2\u00d710(1.52 MB TIF)Click here for additional data file."}
+{"text": "The success of high resolution genetic mapping of disease predisposition and quantitative trait loci in humans and experimental animals depends on the positions of key crossover events around the gene of interest. In mammals, the majority of recombination occurs at highly delimited 1\u20132 kb long sites known as recombination hotspots, whose locations and activities are distributed unevenly along the chromosomes and are tightly regulated in a sex specific manner. The factors determining the location of hotspots started to emerge with the finding of PRDM9 as a major hotspot regulator in mammals, however, additional factors modulating hotspot activity and sex specificity are yet to be defined. To address this limitation, we have collected and mapped the locations of 4829 crossover events occurring on mouse chromosome 11 in 5858 meioses of male and female reciprocal F1 hybrids of C57BL/6J and CAST/EiJ mice. This chromosome was chosen for its medium size and high gene density and provided a comparison with our previous analysis of recombination on the longest mouse chromosome 1. Crossovers were mapped to an average resolution of 127 kb, and thirteen hotspots were mapped to <8 kb. Most crossovers occurred in a small number of the most active hotspots. Females had higher recombination rate than males as a consequence of differences in crossover interference and regional variation of sex specific rates along the chromosome. Comparison with chromosome 1 showed that recombination events tend to be positioned in similar fashion along the centromere-telomere axis but independently of the local gene density. It appears that mammalian recombination is regulated on at least three levels, chromosome-wide, regional, and at individual hotspots, and these regulation levels are influenced by sex and genetic background but not by gene content. Identification of genes responsible for phenotypic traits is facilitated by linkage studies, which map their locations on chromosomes by genetic recombination analysis. This has been classically true since the first genetic maps were created The recombination process begins in the leptotene stage of meiosis I by initiation of double-strand breaks catalyzed by the topoisomerase SPO11; these are eventually processed by two alternative pathways into crossovers and non-crossovers. The first of these pathways, known as double-strand break repair (DSBR), yields predominantly crossovers whereas the second, sequence-dependent strand annealing (SDSA), yields predominantly noncrossovers In most organisms the number of crossover events on each bivalent is tightly regulated. At least one crossover per chromosomal arm is required for successful meiosis in most organisms, as observed by both genetic and cytological studies In many organisms of various taxonomic groups, genetic maps have different length in the two sexes  and Amplifluor system We studied recombination rates along the entirety of mouse chromosome 11 in the meioses of C57BL/6J (B6) and CAST/EiJ (CAST) F1 hybrids of both sexes at an average resolution of 127 kb. To test for potential effects parental imprinting might have on recombination, the F1 animals were produced by reciprocal crosses, and then backcrossed to C57BL/6J. Mapping the location of crossovers in these backcross progeny provided information on the recombination events arising in the F1 hybrids. A total of 5858 progeny were genotyped, of which 1465 were offspring of female B6xCAST, 1537 of female CASTxB6, 1343 of male B6xCAST, and 1513 of male CASTxB6. Backcross offspring were genotyped in four consecutive rounds with single nucleotide polymorphism (SNP) assays developed using competitive allele specific PCR  and was manifested by the presence of more multiple crossovers in female compared to male meiosis (p\u200a=\u200a10\u22124 by \u03c72 test). In total, we found 529 double crossovers, 10 triple crossovers and 1 quadruple crossover in the progeny of female hybrids, compared to 398 double and one triple crossover in the progeny of male hybrids. The frequency with which chromosomes with different numbers of crossovers were observed is summarized in We found 2537 recombination events in 3002 female meioses and 2292 recombination events in 2856 male meioses. The total lengths of female and male recombination maps of Chromosome 11 were 84.8 cM and 80.9 cM, which account for average rates of 0.716 and 0.683 cM/Mb, respectively, and a female: male ratio of 1.05. This length difference was statistically significant (p\u200a=\u200a0.018 by \u03c7\u22124 by randomization test)  . A totalon test) . Among ton test) . Signifion test) .The distribution of recombination rates over the entire chromosome showed a statistically significant difference between the two parental directions (B6xCAST and CASTxB6) in females (p\u200a=\u200a0.04) but not in males (p\u200a=\u200a0.15). Combined sex-averaged data showed more pronounced difference between the two directions (p\u200a=\u200a0.0026). No single interval showed statistically significant difference between the two directions in either females or males after correction for multiple testing.Interference operated on significantly shorter distances in females than in males as measured by the coefficient of coincidence (Z) t-test (p<0.0001). Plotting interference as a function of synaptonemal complex length revealed the same relation on chromosome 11 as on chromosome 1 \u2013 the coincidence curves overlapped, with Z\u200a=\u200a0.5 at 4.5 \u00b5m suggesting that interference acts similarly in males and females on the micron scale  and simple repetitive elements, GC content) were found to have significant correlations in four or more of the nine window sizes   and S4. PRDM9, a zinc finger protein with a histone H3 lysine-4 trimethylation activity, was recently identified as a gene determining hotspot positioning Our detailed analysis of recombination along mouse chromosome 11 provides an opportunity to determine the generality of recombination anatomy features and to test the effects of chromosome length while keeping the genetic resolution and genetic background constant The distribution of recombination events on chromosomes 1 and 11 follows a similar regional pattern. Regional peaks of higher- and lower-than average recombination activity spanning 5\u201310 Mb in size are present in the centromere-proximal half of the chromosome, followed by a substantially longer region of low recombination (30\u201340 Mb in size) in the middle third of the chromosome and generally elevated recombination rates in the telomere-proximal one-third to one-fourth of the chromosome. The recombination rates on most mouse chromosomes except the shortest chromosome 19 Our present results provide additional evidence for at least two other levels of control that regulate positioning and activity of crossover events, confirming prior results in mice Sex specific effects follow similar patterns on chromosomes 1 and 11. Female recombination is more evenly distributed along the chromosomes and is present in larger numbers of intervals at \u223c200 Kb resolution. The somewhat lower overall level of male recombination is concentrated in fewer intervals, albeit with higher activity; a substantial part of it is present at the 10\u201315 Mb near the telomeres, and is relatively low near the centromeres. At the local level, females and males tend to use similar sets of hotspots, but nearly half of all intervals exhibiting any activity were active in only one sex. Despite this, hotspots showing higher activity in one sex may be found in regions where the opposite sex generally shows a higher regional rate. In a 25-Mb interval on chromosome 1, where we reached almost entirely hotspot resolution (<8 kb), we estimated that females use more hotspots than males, although with lower activity per hotspots; the data presented here hints that this must also be true for chromosome 11 because we found recombination in more intervals in females than in males. Coop et al. Interference might also be involved in the presence of long regions with low recombination activity in the middle third of each chromosome. In male meiosis, the significantly higher recombination rate near the telomeres  determines to a great extent the positioning of the second crossover at distances near to or exceeding the interference distance, which is where the second peak of male recombination activity is located. This raises the interesting possibility that the decision to process double-stranded breaks into crossovers rather than non-crossovers may be implemented consecutively in a wave along the chromosome with the placement of the first crossover occurring near the telomere, where recombination rates are concentrated over a short span, followed by placement of a possible second crossover at a distance according to the rules of interference. It is not as clear whether this rule also applies to female rates. Further investigation of temporal placement of crossover events is needed to examine this hypothesis in detail.We found statistical evidence for possible involvement of imprinting in determining recombination activity over the entire chromosomes for both chromosomes 1 and 11, although not at the level of individual hotspots. Combining the data for both chromosomes confirmed this conclusion with increased statistical significance . However, the imprinting effect at any single hotspot is only quantitative; we did not find hotspots active in one parental direction but not the reciprocal. Examples of imprinting at individual hotspots have been found on mouse chromosome 7 We found significant correlations of recombination rates with GC content, DNA repetitive elements, LINE repetitive elements, and low complexity repetitive elements but not with gene density, transcription start sites and exons. It is possible that sequence elements controlling recombination hotspot activity may be more active when embedded in repetitive elements as is the case in humans Our present data confirm that the same general principles underlie the recombination landscapes of two different mouse chromosomes with the centromere-telomere axis of the chromosome and interference being the main factors regulating recombination on a regional level. Genetic background and sex determine to a great extent the actual placement and activity of recombination hotspots, resulting in at least three levels of recombination control \u2013 on entire chromosomes, on megabase scale, and at the level of hotspots. An open question is how local and distal factors shaping recombination rates, such as trans-acting DNA-binding proteins, chromatin structure, and interference, combine their effects to achieve similar regional recombination rates along the chromosomes when using different sets of hotspots.All animal experiments were approved by the Animal Care and Use Committee of The Jackson Laboratory .C57BL/6J and CAST/EiJ were obtained from The Jackson Laboratory, Bar Harbor, USA. F1 hybrids were produced by reciprocal crosses in which either strain was the female or male parent. These hybrids were then backcrossed to C57BL/6J and recombination was detected in their progeny. All parents and F1 hybrids were genotyped for three markers on each chromosome to ensure strain identity using DNA isolated from tail tips.http://phenome.jax.org/pub-cgi/phenome/mpdcgi?rtn=snps/door). All recombinants detected in the first round of genotyping were subsequently mapped to increased resolution until reaching the maximum hotspot resolution. In each round, the flanking markers from the previous round were retyped to confirm the validity of the recombinants. A total of 238,791 genotypes were produced. Of them, 11,696 did not amplify, 16,116 were inconclusive, and 104 were contradicting calls when retyped. These 27,916 genotypes were excluded from the analysis. A list of all markers used in this study is available as part of the Online Supporting Material  was applied to the slides to identify chromosome 11. Pachytene stage cells were re-located and the length of the chromosome 11 synaptonemal complexes determined using a Zeiss Axiovision measuring tool.http://www.r-project.org) on the untransformed data  as previously described P-values were then transformed into q-values based on Storey and Tibshirani q-value cutoff of 0.1  of 10%) was used to determine significant intervals.All the analyses were performed using R /{average [Proportion (XO in I_1) x Proportion (XO in I_2)]}. The averages in the numerator and denominator are overall all such pairs of intervals.http://genome.ucsc.edu/FAQ/FAQdownloads#download29) using data from NCBI Build 37 of the mouse genome. The density is the fraction of the genome within transcribed sequences or exon coding regions, respectively, calculated in 50 Kbp blocks. Transcription start site density represented the number of 5\u2032-gene ends per 50 kb. For exon and transcript coverage, overlapping between genes on both strands was treated as a continuous exon or transcript. Transcriptional starts only considered unique start sites; i.e., if two or more transcripts had a common start site, the site was only counted once.The exon and transcript data was downloaded from the UCSC MySQL server  and the genomic feature . The significance of the correlation was determined by 1000 bootstrap iterations, counting the number of correlations with an absolute value greater than the absolute value of the original correlation. Repetition of the bootstrap analysis found the results to be robust and no significant improvement was observed when using more than 1000 iterations.Nucleotide values for the DNA recognition sequence of PRDM9 alleles were obtained by extrapolating known C2H2 proteins to DNA mappings as compiled in the Zinc Finger Database Table S1Recombination data. All markers are presented with their dbSNP rs-numbers, and placed in increasing order of their positions according to NCBI Build 37. The number of crossovers and total number of samples tested are presented for each interval between the marker on the same row and the next marker.(PDF)Click here for additional data file.Table S2Intervals with sex-specific differences in recombination rates. Female and male numbers of recombinants are presented together with p-values of the difference calculated by Fisher's exact test and q-values correcting for multiple testing (see ting see . All int(PDF)Click here for additional data file.Table S3Correlations between recombination rates and different genomic features at different window sizes.To identify genomic patterns associated with recombination hotspots, we tested the correlation between recombination rates and genomic features. In total, 19 features were examined: the GC content, gene density, exon density, number of transcription start sites, and 15 classes of repetitive elements.interval between SNPs where recombination has taken place. Subdivision of these regions may result in a false positive. For example, if recombination events took place in a 100 kb region and this is divided in half, it is not known how many recombinations took place in either half. This will lead to false correlations for regions where recombination was falsely assumed.In order to compare recombination rate with genomic features, the chromosome was divided into several adjacent, non-overlapping windows. The minimum size of the window was determined by the average interval between SNPs used to identify recombination hot spots. Exact points of recombination are not known. Rather, it is the The distribution of these intervals was bi-modal with peaks around 50 kb and 200 kb. These densities were the result of the hotspot detection process as successive round of assays focused on smaller regions. Minimum window size must be at least equal to the largest of these peaks to minimize disruption. Based on these results, we tested for correlation in window sizes of 200 kb to 1,000 kb in 100 kb increments for a total of nine window sizes. Correlations were also performed for window sizes from 50 kb to 100 kb in 10 kb increments. Focus of the analysis was on the 200 kb to 1,000 kb range. Windows were defined beginning at 3 Mb and ending at 121.7 Mb, spanning all markers used to detect recombination.The recombination rate for each window was computed as the sum of the recombination rates of the observed regions. When a region fell across multiple windows, the each window received a fraction of the recombination rate determined by the fraction of the region overlapping the window. The window metric for transcription start sites and the degenerate motif were the total of occurrence within the window. For all other features, the window metric was the proportion of the window comprised of the feature. In the event of an overlap, e.g., overlapping genes, each position was considered only once.Correlations were computed using the Pearson correlation using the cor.test command in R and C++ code. The significance level for the C++ code was determined using 100,000 permutations of the data.(XLSX)Click here for additional data file.Table S4Correlations between recombination rates and different genomic features in 10-Mb segments along the chromosome.In addition to correlation across the entire chromosome 11, it is of interest to identify localized correlations between genomic features and recombination. The chromosome was divided into twelve sections of 10 Mb. The sectional analysis was performed twice for each section size category per window size. The first began at 3 Mb and proceeded through 123 Mb, which was truncated to 121.7 Mb. The second began at 121.7 Mb and continued to 1.7 Mb, truncated to 3 Mb. Correlations were calculated for the same genomic features as in (XLSX)Click here for additional data file.Table S5Correlation between recombination rates and inferred binding motifs of C57BL/6J and CAST/EiJ alleles of Prdm9. Allele-specific Prdm9 binding motifs were as described in C57BL/6J motif \u2013 GTnTCnTGnTGnTnnTnnnnnnTnnnnnnnTTnTGCAST/EiJ motif \u2013 GTnnTnTnnTGnnTnnnnnTnTnnnTnTTnTGCorrelations and their significance were calculated for window sizes of 200 kb, 400 kb and 500 kb as described for (XLSX)Click here for additional data file."}
+{"text": "Recombination of Hepatitis E Virus (HEV) has rarely been reported. In the present study, phylogenetic and recombination analyses were performed on 134 complete HEV genomes. Three potentially significant recombination events, including both intra-genotype and one inter-genotype, were identified by recombination detection analysis. Recombination events I and II occurred intra-genotype and inter-genotype, respectively, among three isolates, including the lineage represented by CHN-XJ-SW13 , E067-SIJ05C , and JJT-Kan , and lead to the recombinant swine isolate swCH31 (DQ450072). Recombination event III occurred between the lineage represented by the NA1 (M73218) and K52-87 (L25595), which resulted in the recombinant Xingjiang-1 (D11092). Our analyses proved that that recombination could occur between human and swine HEV strains, double recombination events existed in HEV, and recombination event could happen within ORF2 region of HEV. These results will provide valuable hints for future research on HEV diversity. Hepatitis E virus (HEV), a member of the genus Hepevirus, is a non-enveloped virus with a positives-stranded RNA genome of approximately 7.2 kb in length . HEV is believed to be transmitted by the faecal-oral route and its infection affects primarily young adults and is generally mild ,4. HEV aThe HEV genome has three partially overlapped open reading frames (ORFs). ORF1 is located at the 5'-terminus of the genome and encodes non-structural proteins. ORF2 is at the 3'-terminus of the HEV genome and encodes the viral capsid protein which has three glycosylation sites. ORF3 overlaps with either ORF1 or ORF2 . HEV isoRecombination is a relatively common phenomenon in positive-sense RNA viruses -13 and uThe study sequences comprised all of the available complete genome sequences of HEV from GenBank dated November 2009. Sequences were firstly screened to exclude patented and artificial mutants, and then aligned in the ClustalW program. The alignment was manually adjusted for the correct reading frame. The 5'-terminus non-coding region (about 25 nt) is highly conserved within all known 4 genotypes, therefore this region were removed before re-alignment. The remaining 134 HEV genomes were re-aligned to generate a phylogenetic tree using the neighbor-joining (NJ) method in MEGA4  with theThree potentially significant recombination events were found with a high degree of confidence judged by the above-mentioned six recombination detection methods Table . Fig 2A Recombination within the capsid gene has been suggested for other positive-strand RNA virus such as norovirus ,25. The Our analysis suggested that Xingjiang-1 (D11092) was a potential recombinant between lineage NA1 (M73218) as the minor parent and K52-87 (L25595) as the major parent Fig . XingjiaIn our study, Uigh179 (D11093) was revealed to be a potential recombinant , and swCH31 was proved to be produced by double recombination events which occurred among three potential parental strains belonging to two different genotypes. Moreover, it should be noted that recombination could occur between human and swine HEV strains, double recombination events existed in HEV, and recombination event can happen within ORF2 region of HEV. Other two isolates (AB097811 and D11093) may be potential non-natural recombinants happened in the lab. The present study could reminder us that recombination also contribute to the genetic variety of HEV.The authors declare that they have no competing interests.WZ and LC conceived the study. All authors performed recombination analysis and critically reviewed and approved the final manuscript. WZ wrote the paper.Identification of recombinant Uigh179. (A) BOOTSCAN evidence for the recombination origin on the basis of pairwise distance, modeled with a window size 200, step size 20, and 100 Bootstrap replicates; (B) Neighbor joining tree constructed using the recombinant region (1018-1979nt); (C) Neighbor joining tree constructed using the non-recombinant regions consisted of the rest of the genome.Click here for fileIdentification of recombinant swJB-H7. (A) BOOTSCAN evidence for the recombination origin on the basis of pairwise distance, modeled with a window size 200, step size 20, and 100 Bootstrap replicates; (B) Neighbor joining tree constructed using the recombinant region (1177-2805nt); (C) Neighbor joining tree constructed using the non-recombinant regions consisted of the rest of the genome.Click here for file"}
+{"text": "Recombination is known to play a role in the ability of various viruses to acquire sequence diversity. We consequently examined all available West Nile virus (WNV) whole genome sequences both phylogenetically and with a variety of computational recombination detection algorithms. We found that the number of distinct lineages present on a phylogenetic tree reconstruction to be identical to the 6 previously reported. Statistically-significant evidence for recombination was only observed in one whole genome sequence. This recombination event was within the NS5 polymerase coding region. All three viruses contributing to the recombination event were originally isolated in Africa at various times, with the major parent (SPU116_89_B), minor parent (KN3829), and recombinant sequence (AnMg798) belonging to WNV taxonomic lineages 2, 1a, and 2 respectively. This one isolated recombinant genome was out of a total of 154 sequences analyzed. It therefore does not seem likely that recombination contributes in any significant manner to the overall sequence variation within the WNV genome. West Nile virus (WNV) is a member of the family Flaviviridae, genus Flavivirus. West Nile virus is a positive-sense, single-stranded RNA virus that has 6 separate phylogenetically-distinct lineages which correlate well with the geographical point of isolation [Flaviviridae family including: hepatitis C virus [The species solation . Sequencsolation -4. In adsolation ,6. Recom C virus  and deng C virus ,9; and i C virus .Homologous recombination in single-stranded RNA molecules occurs via a template-switch , also cain silico techniques have been developed to assist in this endeavor. These algorithms function by comparing all possible combinations of three sequences at a time from a multiple sequence alignment to determine whether or not a nucleotide pattern signifying the presence of a recombination breakpoint exists within between any 3 sequences .Such recombination events in natural sequences are difficult to detect in the wet-lab due to the sequence similarity that exists between parental and daughter sequences at any putative recombination breakpoint . As a coTo manually detect phylogenetic incongruencies between different regions of the aligned genomes, we analyzed portions of the MSA containing: the complete NS5 coding region, the NS5 coding region lacking the recombinant region, or only the region within the NS5 coding sequence that showed evidence of recombination. MrBayes was then used to reconstruct separate consensus phylogenetic trees using the parameters described below. The topologies of these three trees were compared to confirm recombination within the region.When a Bayesian phylogenetic tree was reconstructed figure , we foun-2 to 7.235 \u00d7 10-8 , only one significant recombination event was detected  or the NS5 coding region without the recombinant region figure  both of. For theFlaviviridae family.The purpose of the present study was to examine a dataset consisting of multiple whole genome WNV sequences in order to determine the extent to which recombination contributed to the overall sequence variation within the this viral species and compare the contribution of recombination in WNV to that in other members of the We confirm the fact that WNV isolates can be grouped into 6 distinct phylogenetic clades or lineages ,18. WhetPrevious studies attempting to detect recombination in West Nile virus used only the envelope coding region . For ourFlavivirus genus has been reported as fairly frequent--an observation which may likely be attributed to the vector-vertebrate host life cycle that is exploited by these arboviruses [Hepatitis C virus species (Hepacivirus genus). Such events have mostly been reported between genomes belonging to different genotypes or subtypes [Although recombination within certain species of the oviruses , it is noviruses ,6,10. Resubtypes ,20; howesubtypes . Since Wsubtypes , its abiWe believe that this recombination event was identified because of the sequence variation existing between the two original parental lineages, and subsequently passed down through the progeny of the recombinant virus. Whether intra-lineage recombination is detectable is still unknown due to the high sequence similarity existing between such sequences. This idea is further supported by the previous observations that purifying selection pressure is present in arthropod-borne viruses , and thaIt is also important to realize that even though recombination was detected to have occurred between the SPU116_89_B and KN3829 sequences to yield the AnMg798 sequence, these are not likely the actual sequences that participated in the original recombination event. This statement is based on the knowledge that these sequences differ both in time and place of isolation, it is therefore probable that they are progeny of the original parental (and daughter) sequences. These extant sequences were likely flagged as having undergone a statistically significant recombination event due to the conservation of the original ancestral recombinant signal in the descendents.Unfortunately, the sequence and metadata associated with these isolates is insufficient to determine the temporal or geographical point of origin for either the ancestral parental or daughter sequences. Therefore, while we know that the strains were isolated from eastern Africa, it is impossible to determine whether the ancestral parental strains were originally located adjacent to each other geographically or whether a bird, mosquito, human or other host infected with one of the parental strains migrated to an area where the second parental strain was either present or endemic. Either of these possibilities would result in the introduction of one of the parental strains into the same territory as the other and would allow for co-circulation of both viruses within the local environment until they eventually infected the same host and the recombination event occurred. It is also impossible with the present amount of information to determine which organism was co-infected and produced the recombinant virus.in vitro that the WNV RNA polymerase is more likely to abort RNA replication after falling off of a template molecule than it is to reinitiate on a homologous RNA template [There are several possible biological reasons why recombination may be so rare in WNV and therefore why we were only able to detect recombination in only 1 of the 154 WNV whole genome sequences. First, it has been shown that the concentration of WNV in the blood throughout the human portion of the replication cycle is low , which mtemplate . This wiUsing bioinformatics analysis, we were able to detect only a single incidence of recombination in available sequenced isolates of WNV. And in addition, reports indicate that the capability of the RdRp to template switch-and by extension to cause recombination-in WNV is severely diminished. For these reasons recombination appears not to be a likely mechanism for the generation of sequence diversity in West Nile virus.. A multiple sequence alignment (MSA) of these genomes was constructed using MUSCLE [To look for recombination in WNV isolates, we used 154 whole genome Kunjin virus and West Nile virus sequences  ,30-38 toThe authors declare that they have no competing interests.BP assisted in the design of the study, created the multiple sequence alignment, reconstructed the phylogenetic trees, performed the recombination analysis, and drafted the manuscript. EL conceived of and participated in the design and coordination of the study, and helped to draft the manuscript. All authors read and approved the final manuscript.RDP3 Screenshot of Positive Recombination Results. Shows representative positive pairwise results from the RDP (top panel) and Bootscan (bottom panel) algorithms. Pairwise comparisons between the major and minor parents are shown in orange, between the minor parent and daughter sequence in purple, and between the major parent and the daughter sequence in blue. The area outlined in pink demarcates the region containing the recombinant signal.Click here for fileRDP3 Screenshot of Negative Recombination Results. Shows representative negative pairwise results from the RDP (top panel) and SiScan (bottom panel) algorithms. Pairwise comparisons between the major and minor parents are shown in orange, between the minor parent and daughter sequence in purple, between the major parent and the daughter sequence in blue, and for the nearest outlier sequence in white.Click here for fileTable of Sequence Names and GenBank Accession Numbers Used in this Study. additional table.Click here for file"}
+{"text": "Variations in the composition of the human intestinal microbiota are linked to diverse health conditions. High-throughput molecular technologies have recently elucidated microbial community structure at much higher resolution than was previously possible. Here we compare two such methods, pyrosequencing and a phylogenetic array, and evaluate classifications based on two variable 16S rRNA gene regions.Over 1.75 million amplicon sequences were generated from the V4 and V6 regions of 16S rRNA genes in bacterial DNA extracted from four fecal samples of elderly individuals. The phylotype richness, for individual samples, was 1,400\u20131,800 for V4 reads and 12,500 for V6 reads, and 5,200 unique phylotypes when combining V4 reads from all samples. The RDP-classifier was more efficient for the V4 than for the far less conserved and shorter V6 region, but differences in community structure also affected efficiency. Even when analyzing only 20% of the reads, the majority of the microbial diversity was captured in two samples tested. DNA from the four samples was hybridized against the Human Intestinal Tract (HIT) Chip, a phylogenetic microarray for community profiling. Comparison of clustering of genus counts from pyrosequencing and HITChip data revealed highly similar profiles. Furthermore, correlations of sequence abundance and hybridization signal intensities were very high for lower-order ranks, but lower at family-level, which was probably due to ambiguous taxonomic groupings.The RDP-classifier consistently assigned most V4 sequences from human intestinal samples down to genus-level with good accuracy and speed. This is the deepest sequencing of single gastrointestinal samples reported to date, but microbial richness levels have still not leveled out. A majority of these diversities can also be captured with five times lower sampling-depth. HITChip hybridizations and resulting community profiles correlate well with pyrosequencing-based compositions, especially for lower-order ranks, indicating high robustness of both approaches. However, incompatible grouping schemes make exact comparison difficult. Recently the HITChip, an oligonucleotide microarray for phylogenetic profiling of human intestinal tract communities, was developed High-throughput community analyses do not have to depend on sequencing. A number of phylogenetic arrays have been constructed that permit hybridization of nucleic acids extracted from environmental samples against arrays probes corresponding to single-stranded full or partial 16S rRNA genes i) selecting the most common classification from the best BLAST ii) the online RDP-classifier with bootstrap values\u226550% (see further below); iii) the online Greengenes classifier iv) selecting the nearest ancestral node in a phylogenetic neighbor-joining tree v) NAST alignments; or vi) a distance matrix containing counts of multimers found between sequences. The Greengenes and RDP-classifier produced the most accurate and stable results, especially for gut communities and gave sufficient evidence to support taxonomic classifications i above), the sequence was assigned to the hit that had the smallest global distance in a distance matrix based on MUSCLE A crucial part of community analysis is the classification of sequences into a taxonomic framework. A diverse range of methods has been used, with dramatic differences in classification results depending on both underlying algorithms and parameters. Due to the requirement for large datasets, classification methods based on parsimony and likelihood trees typically applied on Sanger-sequenced full-length 16S rRNA genes are not feasible. Liu and colleagues This study is a comparison of two high-throughput molecular methods http://eldermet.ucc.ie), by defining how much sequencing is necessary to sufficiently capture the community diversity at an affordable depth of sampling.In this study, we sequenced regions of the 16S rRNA gene at very high depth for a small number of samples (four), resulting in a majority of the estimated GIT microbial diversity being captured. We also noticed considerable differences between the two variable regions V4 and V6, both in terms of classification efficiency and captured diversity. The robustness of the HITChip and RDP-classifications of pyrosequencing reads were supported by their strong correlations at several taxonomic levels. In addition to providing useful comparisons of high-throughput technologies, variable regions and analysis protocols, this analysis acts as a pilot study for validating methodologies for a large-scale national metagenomics initiative , and 860,597 were half-plate runs of the V4 region from samples A, B, C and D (A/B/C/D-V4-0.5). In addition, V4 amplicons from the C and D samples were sequenced at a lower depth on another plate  as part of the larger group of subjects being analyzed by the full-scale Eldermet project, and are thus referred to as C-V4-0.1 and D-V4-0.1. Quality filtering removed 14% of V4 and 35% of V6 sequences  the much shorter V6 lengths; ii) that its hyper-variable and poorly conserved sequence impedes high-confidence classifications; and/or iii) that it is flanked on both sides with highly conserved sequences which add little classification information. Although the corresponding numbers for the V4 reads were much higher, there were significant differences at the genus level between samples A and B (65\u201370%), and samples C and D (\u223c89%). Following closer inspection, we found that a majority (\u223c60%) of the differences in these ratios were due to the higher numbers of unclassified genera within the Lachnospiraceae family in samples A and B, pointing towards the need for a more rigorous taxonomic classification within phyla largely dominated by yet uncultured phylotypes, such as is the case for the LachnospiraceaeBacteroidetes in samples A and B; the average genus bootstrap values for the two most numerous phyla were found to be 93% for Bacteroidetes and 71% for Firmicutes. The lower Bacteroidetes counts in samples A and B may be due to differential cell lysis of bacteria belonging to this phylum imposed by premature freezing and further processing of these fecal samples. This unexpected lack of Bacteroidetes has also been recorded in other studies, where fecal samples have been frozen immediately upon collection Bacteroidetes is the subject of a separate systematic study . Overall, these examples illustrate the significant impact that the overall community structure can have on the ability to classify large fractions of its members, even if the type of environment is the same.The number of reads that could be classified with a bootstrap value of 50% to a certain taxonomic rank fell as the order of the rank progressed towards genus-level . InteresLachnospiraceae Incertae Sedis.The classification efficiencies of the C/D-V4-0.1 samples were practically identical to the corresponding samples sequenced 4\u20135 times deeper. This was also supported by the 99.99% Pearson correlation between the genus classifications of C-V4-0.5 and D-V4-0.5, and C-V4-0.1 and D-V4-0.1 . In contDetermining community composition based upon a highly variable SSU region would indicate greater apparent community complexity (reflected in phylotype number) than would a less variable region As this is the deepest sequencing analysis imposed to date, upon individual-derived GIT communities, we discovered, as expected, the highest number of phylotypes in a single sample using both variable regions ) extra reads would need to be sequenced before detecting a new phylotype. For the hyper-variable V6 region, over 45 additional reads are needed for each new phylotype (>97.8% coverage). The coverage of the C/D-V4-0.1 samplings is still quite high, with over 150 extra reads per new phylotype discovery (>99.3% coverage), which again suggests that the substantial majority of the diversity can be captured by smaller samplings of this size .Diversity and evenness are more informative for describing community composition than simple phylotype richness levels. Community diversity, as reflected by the Shannon index, was highest in sample A and lowest in sample D, and is per definition generally correlated positively with the number of unique phylotypes and/or with greater community evenness. The high diversity values for V6 reads could be a consequence of higher sequence variability of the region. Thus, while the V6 amplicon sequences performed poorly for assigning taxonomies when compared with other regions, it was a better marker for capturing phylotype diversity and could therefore still be suitable for classification-independent and OTU-based  analysis.High evenness (0\u2264E\u22641) indicates less variation in the relative abundance of phylotypes, i.e. the number of reads per phylotypes in this case. As such, sample B contained the most even community whereas D contained the least. When \u2018scaling down\u2019 samplings for C and D the diversity index dropped somewhat, which can be expected, while there was a slight decrease in evenness for C but increase for D. This indicates that the sub-sampling was not completely uniform for all phylotypes.Firmicutes or a vast majority of non-Firmicutes and non-Bacteroidetes, we would in the light of previous studies strongly suspect a contamination or primer problem - a quality-check in other words. Secondly, we believe that the premature freezing of sample A and B could be one reason for the small Bacteroidetes counts, and must therefore show these results. Lastly, by studying the different phylum and genus profiles in Bacteroidetes, Firmicutes, Proteobacteria and Actinobacteria) are approximately in concordance with previous human adult gut studies Parabacteroides and 4 Akkermansia reads were found in C-V4-0.5, but none in C-V4-0.1; while 12 Leuconostoc and 4 Acinetobacter and Oxalobacter reads were found in D-V4-0.5, but none in D-V4-0.1. There was, in contrast, much less agreement between the community structures as revealed by classifications of the V4 and V6 amplicon sequence data. Since the majority of V6 reads could not be classified down to genus level, this significantly hampers meaningful comparisons using that region.While the number of subjects is too small to draw any well-founded biological conclusions, it is important to emphasize that the major aim of this study was to investigate the impact of different methods and variable regions upon the outcomes of the qualitative compositional analysis. However, there are three reasons why we still display groups of detected taxa here: Firstly, if we noticed a completely different composition for one or several of the samples, e.g. no As can be seen from the differences between the numbers of reads that could be classified down to genus level  and Bacteroidetes . In addition, MEGAN assigned 17\u201337% of the reads as \u201cunculturable organisms\u201d.Analysis revealed a core gut microbiota across the four individuals; at the phylum level, this core group consisted of species from Bacteroides in A-V4-0.5 and B-V4-0.5 compared with D-V4-0.5. Conversely, D-V4-0.5 has a reduced level of Firmicutes when compared with the others. Moreover, the C-V4-0.5 community has much higher levels of Actinobacteria compared with the other three datasets. Similar observations were also made from RDP-classifications, although only MEGAN assigned any of the A-V4-0.5 and B-V4-0.5 reads to phyla Streptophyta and Spirochaetes. See To compare the four communities with each other in a hierarchical way, we performed an all-against-all comparison using the MEGAN compare tool resulting in a comparison tree . One of Rikenellaceae, Lachnospiraceae and Erysipelotrichaceae families than MEGAN, whereas MEGAN assigned approximately ten times more reads to the Clostridiaceae than the RDP-classifier does. At the genus level, the low correlation for A-V4-0.5 (r\u200a=\u200a0.48), B-V4-0.5 (r\u200a=\u200a0.31) and C-V4-0.5 (r\u200a=\u200a0.47) is due to the RDP-classifier assigning approximately ten times more reads to the Alistipes, Shigella and Erysipelotrichaceae genera than MEGAN, and MEGAN assigning ten times more reads to the Clostridium genus than the RDP-classifier. Thus, depending on organisms of interest, investigators may need to apply due caution when using either of these methods on the taxa mentioned above.Direct comparisons of the RDP-classifier and MEGAN assignments show near-perfect correlations across all datasets at phylum, order and class levels with Pearson correlation coefficients of over 0.99 in each case . Howeveri) differences between the BLAST and Bayesian algorithms; ii) structural differences between the Bergey and NCBI taxonomies, the latter having deeper lineages and lower rank nodes; and iii) incompatible training datasets and query databases. An important advantage with the MEGAN software is that it is also applicable to shotgun metagenomic sequence data, and is not limited to rRNA genes. However, the RDP-classifier is advantageous in its higher speed, as MEGAN assignments also have to include relatively slow BLAST searches against nucleotide databases. The generally high correlations between the two approaches suggest that both methods can be confidently used provided that: i) that the BLAST query database is sufficiently extensive and of sufficient quality; ii) that the bit-score threshold is adjusted to fit the required taxonomy depth, e.g. allows lower scores if genus/species assignments are the target; and iii) that the assignments should not be taken as absolutely definite and questionable assignments should be examined in closer detail, and confirmed or rejected using alternative assignment methods.Since MEGAN assigns taxonomy based on BLAST output, it is dependent on both the BLAST algorithm and the query database, which is why it is important to use an extensive high-quality 16S rRNA gene database to optimize accuracy of the assignments. Even for strong BLAST hits, such assignments should be made with caution and are ultimately dependent on the quality of the query and subject sequences. In addition to cut-off thresholds discussed above, some factors that are likely to account for the discrepancies between RDP-classifier and MEGAN assignments are: We compared the classification results from the pyrosequencing approach with those obtained from using the hybridization-based method employed by the HITChip. Profiling using heat maps and hierarchical clustering is a standard output of HITChip analysis Clostridiales and Bacteroidales break down into many different families, which separately have much lower read numbers and intensities than their combinations of ranks above. As a result, these lower values drive down the correlation coefficients. Secondly, and as previously mentioned above, there are ambiguities between HITChip level-2 categories and RDP taxonomy in that a HITChip level-2 category can be either species, genus, family or more diffuse. This \u2018noise\u2019 has larger impact on family level than on lower-order ranks. The reason why most correlations using V6 sequences are lower than with V4 is that fewer V6 reads were classified with more than 50% bootstrap support.Despite the fundamental technological differences in these approaches, it was also possible to correlate number of reads in the pyrosequencing data with probe intensity levels all the way down to family level, after the 131 HITChip taxonomic level-2 groups had been converted into RDP taxonomy. Since not all of the 131 level-2 groups were consistently at genus level, and due to one-to-many and many-to-one relationships between the two grouping schemes, it was not possible to accurately compare genus-level assignments. Bacteroides hybridization intensity compared to number of pyrosequencing reads. It is therefore important to employ accurate, proofreading, thermo-stable DNA polymerases, as well as temperature gradients for the PCR reactions, in order to maximize the amplification specificity Shigella genus corresponds to the Serratia genus using the HITChip platform. Even though they belong to the same Enterobacteriaceae family, this clearly highlights the issue of ambiguous classifications between the systems for some taxa, which warrants closer inspection. BLAST searches of the same V4 sequences mainly hit E. coli species, whereby we identified V4 as well as concatenated V1+V6 sequences from a few known E. coli, Serratia and Shigella species (data not shown). An all-against-all BLAST search of full-length 16S rRNA genes, as well as V1+V6 and V4 fragments of sequences from these eight species revealed that some Serratia species had Shigella and E. coli strains as their strongest BLAST hits in terms of higher score and percent identity, as opposed of other Serratia species. In addition, some E. coli strains had stronger hits against Serratia and Shigella than against other E. coli strains. Indeed, it was recently observed that the RDP-classifier cannot distinguish between Escherichia and Shigella, and by default chose Shigella. This will be changed to default Escherichia classifications in a future version of the RDP-classifier. Again, this underlines the importance of not blindly accepting all classifications of full-length or fragmented SSU rRNA sequences without closer inspections of dubious cases, irrespective of approach. Since high-throughput sequencing of partial 16S rRNA genes is becoming both more common and larger in scale, an approach targeted at classifying as many sequences as possible to species-level would be useful. Such a classifier could be based on a carefully collated database, or training-set, comprising species where sequence variation within and between close genera is known. Nevertheless, we recommend always carrying out closer inspections or complementary analysis as reported here, when uncertain, or when there is particularly high sequence similarity between taxa.Looking at sample-specific deviations, sample A had, for some unknown reason, much higher To conclude, the overall strong correlations between these two culture-independent methods indicate their robustness relative to each other, as well as their capacity for in-depth profiling of diverse microbial communities. The RDP-classifier provides fast and accurate taxonomic assignments of most pyrosequencing reads. However, for species/strain-level resolution, either longer ribosomal sequences or additional experiments are required 5\u2032-AYTGGGYDTAAAGNG-3\u2032) and 802R (5\u2032-TACNVGGGTATCTAATCC-3\u2032) for the V4 region (RDP's Pyrosequencing Pipeline: http://pyro.cme.msu.edu/pyro/help.jsp); and 986F (5\u2032-CNACGCGAAGAACCTTANC-3\u2032) and 1027R (5\u2032-CGACRRCCATGCANCACCT-3\u2032) for the V6 region 2, 200 nM each primer, 200 \u00b5M dNTPs. The PCR conditions were 94\u00b0C for 50 seconds  followed by 40\u00b0C for 30 seconds , 72\u00b0C for 60 seconds in 35 cycles (extension), and a final elongation step at 72\u00b0C for 5 minutes. Two negative control reactions containing all components, but water instead of template, were performed alongside all test reactions, and were routinely free of PCR product, demonstrating lack of contamination with post-PCR product. The optimal annealing temperature for the primers, which included 454 adapters and barcode sequences, was empirically determined by gradient PCR using control reactions with initially purified bacterial genomic DNA, and validated on fecal microbial community DNA (data not shown).Fecal samples were collected from four elderly subjects aged 60\u201387 years. The Clinical Research Ethics Committee of the Cork Teaching Hospitals (CREC) granted full approval to the ELDERMET project on the 19th February 2008 (Ref: ECM 3 (a) 01/04/08). Formal written consent was obtained, on the basis of an Information Sheet/Safety Statement, following an ethics protocol that was approved by CREC, in compliance with pertaining local, national and European ethics legislation and guidelines to best practice. Subject A was male and the rest were females. Subject C had been diagnosed with ulcerative colitis, and subject D was taking an unknown antibiotic at the time of sampling. Samples from A and B were frozen at \u221280\u00b0C upon collection, whereas samples C and D were processed fresh from the same day as collection. DNA was extracted according to standard protocol . The following universal 16S rRNA primers were used for the PCR reaction: 520F (http://eldermet.ucc.ie).The 16S rRNA V4 and V6 amplicons were subsequently sequenced on a 454 Genome Sequencer FLX platform  according to 454 protocols, one plate each for the V6 region amplicons of samples A and B, and half a plate each for the V4 region amplicons of all four samples. In addition, V4 amplicons from samples C and D were also sequenced separately on another plate as part of a pooled total of ten samples from the full-scale Eldermet project (i) exact matches to primer sequences and barcode tags; ii) no ambiguous bases (Ns); iii) read-lengths not shorter than the main distribution (>150 bp for V4 and>60 bp for V6). For large-scale assignments into the new Bergey bacterial taxonomy Raw sequencing reads were quality trimmed according to published recommendations MEGAN was used for hierarchical tree constructions of the microbiota and tested as an alternative to the RDP-classifier for taxonomic assignments The HITChip oligonucleotide array was designed at Wageningen University, the Netherlands Table S1All 153 genera detected using the RDP-classifier with at least 50% bootstrap support.(0.04 MB XLS)Click here for additional data file.Table S2All MEGAN assignments of sequences from the four samples sequenced with half a pyrosequencing plate.(0.10 MB XLS)Click here for additional data file."}
+{"text": "Meiotic recombination alters frequency and distribution of genetic variation, impacting genetics and evolution. In the budding yeast, DNA double strand breaks (DSBs) and D loops form either crossovers (COs) or non-crossovers (NCOs), which occur at many sites in the genome. Differences at the nucleotide level associated with COs and NCOs enable us to detect these recombination events and their distributions.We used high throughput sequencing to uncover over 46 thousand single nucleotide polymorphisms (SNPs) between two budding yeast strains and investigated meiotic recombinational events. We provided a detailed analysis of CO and NCO events, including number, size range, and distribution on chromosomes. We have detected 91 COs, very close to the average number from previous genetic studies, as well as 21 NCO events and mapped the positions of these events with high resolution. We have obtained DNA sequence-level evidence for a wide range of sizes of chromosomal regions involved in CO and NCO events. We show that a large fraction of the COs are accompanied by gene conversion (GC), indicating that meiotic recombination changes allelic frequencies, in addition to redistributing existing genetic variations.This work is the first reported study of meiotic recombination using high throughput sequencing technologies. Our results show that high-throughput sequencing is a sensitive method to uncover at single-base resolution details of CO and NCO events, including some complex patterns, providing new clues about the mechanism of this fundamental process. Meiosis is essential for eukaryotic sexual reproduction and reduces the number of chromosomes in half to generate haploid cells -3. To enDrosophila melanogaster, Caenorhabditis elegans, mammals, Arabidopsis thaliana, and maize [Saccharomyces cerevisiae, molecular and biochemical studies have identified key intermediates of meiotic recombination, starting with DNA double strand breaks (DSBs) and D-loops [Meiotic recombination has been studied extensively using model systems, including the budding and fission yeasts, nd maize -3. In th D-loops ,5. A por D-loops . A thirdHIS4 locus) and artificially generated (such as ones induced by the HO endonuclease) recombination hotspots as substrates; therefore, the molecular details of crossovers are not available on a genome-wide level. In addition, NCO/GC has been investigated using a small number of markers or by inference at a population level. Recently, meiosis between two strains of the budding yeast has been analyzed using microarrays, providing valuable information on the frequency of CO and NCO events on a genome-wide scale [Because recombination occurs at many sites in the genome, it is important to investigate recombination at the whole-genome level. Genome-wide genetic detection of crossovers has been done in many genetic systems, resulting in the construction of genetic maps, as well as producing other information. However, previous molecular studies usually relied on the use of naturally occurring . Therefore, we re-sequenced the S288C (12\u00d7 coverage) and RM11 (15\u00d7 coverage) genomic DNAs using the Illumina technology and obtained > 4.4 and 5.2 million reads, respectively  with meiotic spores (not shown). We cultured one set of four spores in a rich medium and isolated DNAs from these four cultures. These DNAs were sequenced using the 454 technology, resulting in approximately 300,000 to 416,000 reads, or 3.6\u00d7 to 4.9\u00d7 coverage, of each of the four meiotic products  and a higher coverage than the short reads from spore 4, using the S288C genome as a reference (Table 2 = 0.985). In addition, the genotypes of the four meiotic products indicated that the four meiotic chromatids had participated in 35, 44, 52, and 51 COs, respectively. Among the 91 CO events, 37 did not show a detectable GC (details not shown), 48 were associated with a single detected GC ; nevertheless, all COs involving spore 4 were still detectable because flanking markers were still observed. Because NCOs were detected using the SNP information for each spore in the chromosomal context, reduced SNP coverage in spore 4 likely caused a decrease in NCO detection, providing another possible explanation for under-estimation of the NCO number.From the sequence information, we estimated the minimum and maximum sizes of the COs, as illustrated in the example shown in Figure Nevertheless, at least 28 COs had minimal sizes of greater than 1.0 kb, with the largest minimum size being over 7 kb  and Broad Institute  respectively. The four haploid meiotic products from the same meiosis were sequenced by using Roche GS20/FLX pyrosequencing technology to detect COs, NCOs and other recombination events. The S288C and RM11-1a genomic DNAs were sent to Fasteris  for re-sequencing by using Illumina sequencing technology to verify SNPs between these two parental references. The public S288C and RM11-1a genomic sequences were used for BLAST analysis to map the newly obtained sequences from the high throughput shotgun sequencing technologies.The public whole genome sequences of the S288C and RM11 strains were downloaded from NCBI  and the software is available online at We have also written an additional set of scripts to perform the bioinformatic analyses in this study. More information will be provided if requested.JQ carried out the bioinformatics analysis; HM, AJW and YH performed the cell culture, DNA preparation and PCR experiments; LPT prepared DNA library and conducted Roche/454 sequencing; HM and JQ carried out the genomic studies and drafted the manuscript; HM, SCS and JQ produced the final version of the manuscript; HM and SCS designed the study. All authors read and approved the final manuscript.Supplemental figures and tables. 10 supplemental figures are displayed for selected COs and GCs with PCR results. The positions of all 91 COs and 21 GCs are listed in two tables respectively.Click here for file"}
+{"text": "People have focused on estimating the lower bound of minR, because it is also a valid lower bound for the true number of recombination events occurred. Current approaches for estimating the lower bound are under the assumption of the infinite site model and do not allow for recurrent mutations. However, recurrent mutations are relatively common in genes with high mutation rates or mutation hot-spots, such as those in the genomes of bacteria or viruses.An important method to quantify the effects of recombination on populations is to estimate the minimum number of recombination events, minR under the infinite site model. Their performances were compared to other bounds currently in use. The new lower bounds were further extended to allow for recurrent mutations. Application of these methods were demonstrated with two haplotype data sets.In this paper two new algorithms were proposed for estimating the lower bound of minR under the infinite site model. After extension to allow for recurrent mutations, they can produce robust estimations with the existence of high mutation rate or mutation hot-spots. They can also be used to show different combinations of recurrent mutations and recombinations that can produce the same polymorphic pattern in the sample.These new algorithms would help to obtain a better estimation of the lower bound of  Estimating minR is by no means an easy task, so that most of the previous work focused on the lower bound of minR, which is also a valid lower bound of the true number of recombination events occurred.Recombination is an important mechanism for shaping genetic polymorphism. Estimating the effects of recombination on polymorphism plays important roles in population genetics . One dirmR, which is based on the four-gamete tests under the infinite site model. For each pair of polymorphic sites, if there are four distinctive haplotypes (four-gamete), the data is said to be inconsistent and at least one recombination must occur in that interval. Assuming all overlapping four-gamete intervals are caused by the same recombination event, mR is obtained by counting the total number of non-overlapping four-gamete intervals. Of course, there is a large chance this assumption does not hold. So mR can be quite conservative. Hein and his colleagues , needed to obtain a recombinant j given a set, \u2212j,m of its possible ancestors. The the crucial part of the algorithm is computing the recurrenceBafna and Bansal  proposeds Figure , which v\u00f8 et al.  suggeste\u00f8 et al.  further \u00f8 et al.  introducwhereh [c] represents the allele type of sequence h at site c and j[c] \u2260 h[c] is true only when the two allele types are not missing and different to each other. I  can be interpreted the minimum number of recombinations needed to explain the first c informative sites of sequence j with h [c] as the parent of j [c]. Thens is the number of informative sites of sequences in set m = -jm \u222a j.where I[\u2212jm] can be larger than one if more than one recombination is needed to produce sequence j. In such situations, some recombination products are not presented in the sample and are called recombination intermediates [jI [\u2212jm] with j = 10110 and \u2212jm = {00000, 10100, 00011, 11111, 11001} as in Figure mediates . Figure sR  that gives the minimum I\u2032  of all h \u2208 \u2212j.m Song et al. . With this extension, they will be presented as fiR , foR , faR  and fuR . We can allow different number of continuous recurrent mutations with different combinations of rc and mc. For example, the procedure with mc = 3 and rc = 2 will prefer one recurrent mutation than a double recombination crossover (gene conversion) at a single inconsistent site, but will prefer a double crossover than two or more recurrent mutations at continuous sites. So that mc = 3 and rc = 2 can be used as a conservative lower bound of minR with the assumption that a small number of mutation hot-spots are present and distributed evenly on the sequence. If per bp recombination rate (r) and mutation rate (\u03bc) are known, the procedure with mc = lg \u03bc and rc = lgr will find the maximum likelihood estimation of the number of recombination events. We need to be careful about the interpretation of these extended bounds. They are just conservative estimations of the corresponding lower or upper bounds under the infinite site model.This simple extension can be easily applied to foR  and fuR  is the fully determined number of recurrent mutations associated with a particular order, which can be used to show different combinations of recurrent mutations and recombinations that can produce the same polymorphic pattern. We will show this usage in Examples.Another usage of this extension is to show what combination of recurrent mutations and recombinations can produce the same observed inconsistency. The lower and upper bounds under the infinite site model are of one extreme, which show the minimum number of recombination events required to produce the pattern if there is no recurrent mutations. The maximum parsimony tree method used in the phylogenetic study is of another extreme, which shows the minimum number of recurrent mutations needed to produce the pattern if there is no recombination. Because a byproduct of \u03b8 = 4N \u03bc and population recombination rate \u03c1 = 4Nr, where N is the effective population size and \u03bc and r are mutation rate and recombination rate per gene per generation, respectively. With different combinations of \u03b8  and \u03c1 , 10,000 independent samples were simulated with sample size n = 10. The ms program  = 0i = 4 to nfor m =first i sequences of Msubset i is redundantif sequence uR [m] = uR[\u2212im]elseuR [m] = iI [\u2212im] + uR [\u2212im]uR [M]return Algorithm A.2 An algorithm for computing IR or oR with fixed orderCompute_IR or oR with fixed orderM of all sequencesinput: Set Ireturn: Rlocal variable:n: number of sequences in Mm: a subset of M\u2212jm: a subset of m by removing sequence ji = 1 to 3for m =first i sequences of Msubset dR[m]=0, IR[m]=0i = 4 to nfor m =first i sequences of Msubset i is redundantif sequence dR [m] = dR [mi\u2212]IR [m] = IR [\u2212jm]elsedR [m] = A [\u2212lm] + dR [\u2212im]IR [m] = max{l + IR [\u2212im], dR [\u2212im] + iI [\u2212im]}IR [M]return Algorithm A.3 An algorithm for computing aR with fixed orderCompute_Ra with fixed orderM of all sequencesinput: Set aRreturn: local variable:n: number of sequences in Mm: a subset of Mm\u2032: an augmented sequence set of m_jm: a subset of m by removing sequence jjp: hypothetical parent sequence of sequence ji = 1 to 3for m =first i sequences of Msubset dm\u2032 =\u00f8, R[m] = 0, aR[m] = 0i = 4 to nfor m =first i sequences of Msubset i is redundant in m \u222a m\u2032if sequence \u2212im\u2032 = m\u2032, dR [m] = dR [\u2212im], aR [m] = aR [\u2212im]elsei is an indirect witnessif sequence m\u2032 = m\u2032 \u222a ipaR [M]return IR is a valid lower bound of minR given a particular order of the sequences. This conclusion is true not only when all recombination intermediates are unknown, but also in the case if some \u201ctrue\u201d recombination intermediates are recovered in the order. If an indirect witness j introduces exactly one mutation into sequence set m, then forming a jp  by replacing the mutant allele with the \u201cwild-type\u201d allele of that site will recover the last recombination intermediate (LRI) that leads to j via one mutation. For example, in Figure j introduces n (n \u2265 2) mutations into sequence set m, there are multiple possible LRIs of j but only one of them is the \u201ctrue\u201d LRI. However, if we form a jp by replacing the alleles on the mutant sites of the true LRI with missing data, jI[-j \u222a pjm] must be less than or equal to jI[\u2212jm \u222a true LRI of j], since in calculating I a missing data is never regarded as different to any alleles. Similarly, kI[\u2212jm \u222a jp \u222a kS] must be less than or equal to kI[\u2212jm \u222a true LRI of j \u222a kS], where k is a possible offspring of j and kS is a set of other possible parent sequences of k. So that, by augmenting the jp and then follow the procedure of IR we can get an estimation less than or equal to that with augmenting true LRIs. Then the procedure a)(R must produce a valid lower bound.Here we present a simple proof for Algorithm A.3 as a valid lower bound. Bafna and Bansal  has prov"}
+{"text": "Using cutoff values selected for 95% specificity in the benign group (3.0\u2009ng\u2009ml\u22121), CYFRA 21-1 showed higher sensitivity for ICC (87.0%) than three commonly used markers including \u03b1-fetoprotein (17.4%), carcinoembryonic antigen (34.8%), and carbohydrate antigen 19-9 (60.9%). Serum CYFRA 21-1 increased in ICC from stages I/II to IV . CYFRA 21-1 concentration increased with extent of local invasion, but not nodal status. Serum CYFRA 21-1 represents a useful diagnostic test for ICC that offers high sensitivity. CYFRA 21-1 reflected differences in tumour burden, suggesting applicability to staging and follow-up.Using an electrochemiluminescence immunoassay, CYFRA 21-1 concentrations were measured in sera from 187 patients with primary liver cancer (164 with hepatocellular carcinoma (HCC) and 23 with intrahepatic cholangiocarcinoma (ICC)) and 87 patients with benign liver diseases. Concentrations of CYFRA 21-1 were significantly higher in patients with ICC ( The assay, using an Elecsys 2010 analyser , is based on the ability of an electrochemically luminescent molecule, a trisruthenium (II) complex, to be repeatedly excited by tripropylamine. The system can be applied to both competitive and sandwich-format immunoassays. CYFRA 21-1 was recognised by two mouse monoclonal antibodies, a biotinylated monoclonal cytokeratin 19-specific antibody (Ks 19-1) and a monoclonal cytokeratin 19-specific antibody (BM 19-21), directed against two different epitopes of a fragment of cytokeratin 19. In the first incubation, Ks 19-1 and BM 19-21 labelled with a ruthenium complex were allowed to react, forming a sandwich complex. The next incubation followed addition of streptavidin-coated microparticles, so the sandwich complex could bind to the particulate solid phase via interaction of biotin and streptavidin. The reaction mixture then was aspirated into the measuring cell, where the microparticles were captured magnetically upon the surface of the electrode. Unbound reactants were removed with a phosphate-tripropylamine buffer. Application of voltage to the electrode then induced chemiluminescent emission that was measured by a photomultiplier.For comparison, conventional tumour markers  were measured by a chemiluminescent immunoassay (CLIA).U-test. To compare abilities of tumour markers to distinguish patients with primary liver cancers from those with benign liver disease, receiver operator characteristic (ROC) curves, which correlate true- and false-positive rates (sensitivity and (1\u2212specificity)), were constructed using the ROCKIT program  and those with benign liver disease . Distributions of serum CYFRA 21-1 concentrations for HCC , ICC , and benign liver disease are shown in Figure 1U-test, P<0.0001) or HCC (P<0.0001).Significant differences in CYFRA 21-1 concentration (median and interquartile range) were noted between patients with primary liver cancer  than other markers in patients with HCC. In patients with ICC, the most sensitive marker was CYFRA 21-1 (87.0%). Although CA 19-9 showed relatively high sensitivity in ICC patients (60.9%), the sensitivity of CA 19-9 was 33.5% in HCC patients.Table 2P<0.0001). For patients with ICC, the AUC was 0.53\u00b10.08, 0.81\u00b10.05, 0.86\u00b10.06, and 0.95\u00b10.03 for AFP, CEA, CA 19-9, and CYFRA 21-1, respectively. A significant difference was noted between the AUC for CYFRA 21-1 and those for CEA (P=0.0196) and AFP (P<0.0001); on the other hand, no significant difference was noted between the AUC for CYFRA 21-1 and that for CA 19-9 (P=0.0913). In the ICC group, ROC analysis demonstrated that CYFRA 21-1 was superior to the other markers.Receiver operator characteristic curves were constructed to compare the ability of the four markers to differentiate between patients with malignant and benign liver disease. Curves for HCC  for stages I/II, III, and IV, respectively. An overall tendency towards an increase in serum concentration was observed from stages I/II to IV, and a significant difference was noted . No significant difference was evident for serum CEA or CA 19-9 concentration between tumour stages . The serum CYFRA 21-1 concentration also differed significantly according to the T factor by the TNM classification (P=0.0038). Tumour size and vascular invasion were related to serum CYFRA 21-1 concentration, while serum CYFRA 21-1 concentration did not differ according to nodal status.For 23 patients with ICC, CYFRA 21-1 concentrations were compared according to disease stage . Importantly, sensitivity of serum CYFRA 21-1 for HCC was low in this study (17.1%). Although the sensitivity of CA 19-9 was relatively high in our patients with ICC (60.9%), its specificity for ICC was limited; serum CA 19-9 was elevated in 33.5% of HCC patients. Serum CYFRA 21-1 therefore may be a particularly useful marker for distinguishing ICC from HCC in a radiologically demonstrated hepatic tumour. However, our study could not clarify whether screening for serum CYFRA 21-1 detects very early ICC, since only two patients had a stage I tumour. Apparent sensitivity of a tumour marker in a study is influenced by several factors, particularly numbers of patients in early or advanced stages of cancer. Some investigators have indicated that serum CYFRA 21-1 may be useful for early detection of non-small-cell lung cancer, where CYFRA 21-1 elevations were common even in patients with early stage disease (Tumour markers such as CA 19-9 and CEA can be used in combination not only for diagnosis of gastrointestinal malignancies but also for monitoring during and in follow-up treatment. Some investigators have recommended that a possible diagnosis of ICC should be considered when a hepatic tumour is associated with high-serum CEA concentration, since serum CEA had relatively high sensitivity in patients with ICC (When two or more tests are available for use in diagnosis, comparison of ROC curves often will indicate which is best. The diagnostic test with the ROC curve enclosing the largest area is most accurate. For example, a high degree of specificity and sensitivity of CYFRA 21-1 for diagnosis of non-small cell lung cancer was shown by ROC curve findings (et al, 1995; Previous studies have validated CYFRA 21-1 as a marker for monitoring disease in patients with various cancers, especially since CYFRA 21-1 concentrations and the sensitivity of CYFRA 21-1 increased progressively with clinical stage (In conclusion, serum CYFRA 21-1 should be a useful diagnostic test for ICC given its outstanding sensitivity. Serum CYFRA 21-1 concentrations reflected differences in ICC tumour burden, so this marker also could be applied to staging and monitoring. Prospective studies should be performed to evaluate the real impact of serum CYFRA 21-1 as a marker for ICC."}
+{"text": "The ability of pathogens to escape the host's immune response is crucial for the establishment of persistent infections and can influence virulence. Recombination has been observed to contribute to this process by generating novel genetic variants. Although distinctive recombination patterns have been described in many viral pathogens, little is known about the influence of biases in the recombination process itself relative to selective forces acting on newly formed recombinants. Understanding these influences is important for determining how recombination contributes to pathogen genome and proteome evolution. Most previous research on recombination-driven protein evolution has focused on relatively simple proteins, usually in the context of directed evolution experiments. Here, we study recombination in the envelope gene of HIV-1 between primary isolates belonging to subtypes that recombine naturally in the HIV/AIDS pandemic. By characterizing the early steps in the generation of recombinants, we provide novel insights into the evolutionary forces that shape recombination patterns within viral populations. Specifically, we show that the combined effects of mechanistic processes that determine the locations of recombination breakpoints across the HIV-1 envelope gene, and purifying selection acting against dysfunctional recombinants, can explain almost the entire distribution of breakpoints found within this gene in nature. These constraints account for the surprising paucity of recombination breakpoints found in infected individuals within this highly variable gene. Thus, the apparent randomness of HIV evolution via recombination may in fact be relatively more predictable than anticipated. In addition, the dominance of purifying selection in localized areas of the HIV genome defines regions where functional constraints on recombinants appear particularly strong, pointing to vulnerable aspects of HIV biology. Recombination allows mixing portions of genomes of different origins, generating chimeric genes and genomes. With respect to the random generation of new mutations, it can lead to the simultaneous insertion of several substitutions, introducing more drastic changes in the genome. Furthermore, recombination is expected to yield a higher proportion of functional products since it combines variants that already exist in the population and that are therefore compatible with the survival of the organism. However, when recombination involves genetically distant strains, it can be constrained by the necessity to retain the functionality of the resulting products. In pathogens, which are subjected to strong selective pressures, recombination is particularly important, and several viruses, such as the human immunodeficiency virus (HIV), readily recombine. Here, we demonstrate the existence of preferential regions for recombination in the HIV-1 envelope gene when crossing sequences representative of strains observed to recombine in vivo. Furthermore, some recombinants give a decreased proportion of functional products. When considering these factors, one can retrace the history of most natural HIV recombinants. Recombination in HIV appears not so unpredictable, therefore, and the existence of recombinants that frequently generate nonfunctional products highlights previously unappreciated limits of the genetic flexibility of HIV. Pathogens, and viruses in particular, are subject to strong selective pressures during infection and often have characteristically high degrees of genetic variation Several studies have focused on the impact of recombination on the evolution of proteins, particularly in relation to directed evolution experiments Adaptation of pathogens, either to on-going immune pressures within individual hosts or following transmission to new hosts of the same or different species, can result in infectious outbreaks that constitute major threats for public health Although recombination in HIV has been shown to occur at all phylogenetic levels . This gene encodes two polypeptides (gp120 and gp41) that form a heterodimer at the surface of the viral particle. Trimers of these heterodimers are the functional units that are responsible for binding to the cellular receptors and co-receptors and ultimately lead to viral entry into target cells env are also the targets of all the neutralising antibodies identified to date env in the absence of selection, and assaying the functionality of recombinant genes, we produce an empirical model of HIV recombination that accurately describes recombination patterns found in viruses sampled throughout the HIV pandemic.Sufficient inter-subtype recombinant sequences have been sampled to permit the detailed characterisation of variation in the locations of breakpoints both within individual genes env sequences from primary HIV-1 isolates belonging to either different group M subtypes or group O  envelope E. coli, the system enabled identification of the recombinants based on the presence of a lacZ reporter gene  was determined by a permutation test . Each of the six identified breakpoint clusters contained at least one breakpoint cluster that constituted a statistically significant recombination \u201chot-spot\u201d (p<0.01). While these recombination-prone regions covered only slightly more than half of the whole gene (55.3%), they included 81.6% of all the breakpoints (337/413) mapped. These six hot regions are areas where recombination occurs preferentially during HIV replication, irrespective of the parental strains involved.The regions of the envelope gene that were studied were chosen so as to obtain 700 to 1,500 nucleotides overlapping windows, spanning the whole of ce pairs , a recomion test  could beenv genes.We next investigated the fate of these recombinants with respect to their establishment in the natural HIV-1 population. The fixation of a recombinant gene within a population is dependent on the interplay of multiple factors. Nevertheless, an obligatory component of evolution is undoubtedly the elimination by purifying selection of viruses that express dysfunctional proteins. To evaluate how profoundly this aspect of natural selection might influence the pattern of breakpoints generated by the mechanism of recombination, we determined the relative functionality of a subset of recombinant env also encodes a well-known functional RNA structure, the Rev responsive element (RRE). For the recombinants containing breakpoints in the RRE region the functionality of this RNA module was therefore also tested. Being involved in the regulation of the timing and the balance among the various forms of unspliced and partially or completely spliced RNAs, RRE is essential for viral replication \u2212) In addition to encoding the proteins that coat the viral membrane, \u2212-Luc plasmid, to generate viral particles pseudotyped with the recombinant envelope of interest. The functionality of the recombinant envelopes was then tested after transduction of HEK 293T-CD4+-CCR5+ cells at a multiplicity of infection of 0.1, by measuring luciferase expression in these cells 48 hours after transduction. Since target cells cannot synthesize new viral envelope proteins, infection was limited to reverse transcription and, potentially, integration. The luciferase values observed therefore reflected the relative success of viral entry into the target cells. For this analysis recombinants derived from parental env sequences that yielded the strongest positive signals in this single cycle test were chosen  was inferred. The same approach used in env gene and the lack of breakpoints in the majority of its internal regions in recombinants from the database.Having defined a pattern of recombination in the absence of selection and the approximate probabilities of recombination events in various parts of env gene was determined using the positions of 133 unambiguously unique recombination breakpoints detectable within 230 env sequences. Following the same procedure described above, but using a 50 nucleotides window to enable detection of breakpoint clusters at the same resolution as in our experimental system, we identified a series of recombination hot- and cold-regions within the gene  tend to use overlapping genes expressed in different reading frames and to encode proteins that have multiple functions. The HIV envelope encodes for such proteins  folding . Unravelin vivo replicative capacity) are complex and poorly understood at present. The fixation of a recombinant gene within a population is likely to depend on the interplay of multiple factors. Although combining cell culture functionality data with recombination rate heterogeneity is an oversimplified view of this process, the pattern of recombination predicted by our empirical model matches remarkably well the breakpoint distributions observed in nature , and maintained at 37\u00b0C with 10% CO2. MT4 cells were maintained in RPMI 1640 medium supplemented with 10% foetal calf serum and antibiotics at 37\u00b0C with 5% CO2.HEK 293T, and CD4The parental isolates used in this study were A-115, A-120, A-899 env fragments from group M subtypes A, C, D and G, and from group O viral DNA were amplified by PCR from infected PBMCs obtained from patients and cloned in plasmids , which differ for the genetic marker present downstream (in the sense of reverse transcription) of the sequence in which recombination is studied ; a 50 nucleotides window was then considered , beginning from the 5\u2032 border of the sequence studied and the number of breakpoints (indicated as a\u2013bniXY) falling within the window was counted. The resulting recombination rate per nucleotide in the sliding window a\u2013bSwiXY isa\u2013bNXY is the total number of breakpoints characterized for the a\u2013bRWXY pair, and 50 is the size in nucleotides of the sliding window, and F the frequency of recombination observed in the whole region studied, as defined in the previous chapter. The sliding window was then displaced with a 10 nucleotides increment  across the recombination window, and a\u2013bRi+10XY, a\u2013bRi+20XY, \u2026 were computed. The various R values were reported in the graph as a function of the position of the midpoint of the window along the gene (i.e. the position of the 25th nucleotide of each sliding window). For the pooled dataset reported in iSwp stands for the sliding window at position i for the pooled dataset, iRp for the corresponding recombination rate, and q is the number of recombination window including position i, recombination rate at position i is calculated asThe recombinant and parental sequences of each pair of isolates tested were aligned using CLUSTAL X For simulating the distribution of 133 breakpoints based on the combined effects of (i) the mechanistic recombination rate and (ii) selection for functional recombinants, local recombination rate data used to generate the graph in env genes were reconstituted, using an overlapping PCR procedure. We separately amplified the region from the 5\u2032 end of the acceptor gene  to the breakpoint position (using a specific primer encompassing the region of the breakpoint) and from the 3\u2032 end of the donor gene  to the breakpoint position . These PCR products, overlapping by approximately 30 nucleotides around the breakpoint site, were mixed at equal ratios and used as templates to generate the full-length recombinant env gene using primer Topo5\u2032 and Donor3\u2032. All PCR reactions were run with Phusion DNA polymerase  for 30 cycles. PCR products were gel purified and ligated to pCDNA3.1 Topo . For RRE functionality assays, a portion of the envelope gene containing the RRE of pNL4.3-Env\u2212-Luc (nucleotides 7646 to 8046) was replaced with the corresponding sequence of parental or recombinant envelope genes or, as a negative control, a 400 nt sequence from the Drosophila melanogaster desoxynucleoside kinase gene (\u0394dNK). All constructs were verified by sequencing.Full-length sequences of recombinant \u2212-Luc containing either a parental or recombinant RRE sequence or \u0394dNK. Forty-eight hours post transfection, supernatants were filtered trough a 0.45 \u00b5M filter and p24 levels were determined using the HIV-1 p24 enzyme-linked immunoabsorbent assay kit .HIV particles were produced by co-transfection of HEK 293T cells with an expression vector for a CCR5-tropic (ADA) HIV-1 envelope \u2212-Luc and either an empty expression vector or an expression vector encoding either a parental or a recombinant env. For each individual recombinant variant, prior to their use for transfection, clones were verified by sequencing of the region encoding the recombinant gene as well as the vector-encoded promoter for its expression. Supernatants, containing virus stock, were harvested 48 h post transfection, and filtered trough a 0.45 \u00b5M filter. Production of viral particles was tested using an enzyme linked immunoassay for HIV-p24 antigen detection  and 20 ng of p24 were used to infect 105 293T CD4+-CCR5+ cells in 24 wells plates. Forty-eight hours later, cells were washed twice in PBS and lysed in 25 mM Tris phosphate, pH 7.8, 8 mM MgCl2, 1 mM dithiothreitol, 1% triton X-100, and 7% glycerol for 10 min in a shaker at room temperature. The lysates were centrifuged and the supernatant was used to measure luciferase activity using a GloMax 96 Microplate Luminometer  following the instruction of the luciferase assay kit . For samples that yielded negative results in the luciferase assay, plasmids from at least three independent bacterial clones were tested.Reporter HIV-1 particles were produced by co-transfection of HEK 293T cells with pNL4.3-Envhttp://hiv-web.lanl.gov/). The alignment was reduced to subtype reference sequences (3 strains for each where available), 53 CRF strains (2 strains for each where available) and finally 197 apparently unique recombinants. Recombination was analyzed using the RDP rdp3beta30 rdp3 program manual (http://darwin.uvigo.es/rdp/rdp.html), the approximate breakpoint positions and recombinant sequence(s) inferred for every potential recombination event, were manually checked and adjusted where necessary using the phylogenetic and recombination signal analysis features available in rdp3. Breakpoint positions were classified as unknown if they were (1) detected at the 5\u2032 and 3\u2032 ends of the alignment but could have actually fallen outside the analysed region; or (2) within 20 variable nucleotide positions or 100 total nucleotides of another detected breakpoint within the same sequence . All of the remaining breakpoint positions were manually checked and adjusted when necessary using mainly the MAXCHI and 3SEQ methods (using three sequence scans and the MAXCHI matrix method) but also the LARD matrix method  HIV Sequence Database  essentially as described in Lefeuvre et al. Click here for additional data file.Table S1Mutation and disruption value for gp41 and gp120 datasets real and simulated recombination events.(0.04 MB DOC)Click here for additional data file."}
+{"text": "G1 and G2, with both mutation and recombination events, defined on overlapping sets of extant units the objective is to compute a consensus network G3 with minimum number of additional recombinations. We describe a polynomial time algorithm with a guarantee that the number of computed new recombination events is within \u03f5 = sz (function sz is a well-behaved function of the sizes and topologies of G1 and G2) of the optimal number of recombinations. To date, this is the best known result for a network consensus problem.We address the problem of studying recombinational variations in (human) populations. In this paper, our focus is on one computational aspect of the general task: Given two networks Although the network consensus problem can be applied to a variety of domains, here we focus on structure of human populations. With our preliminary analysis on a segment of the human Chromosome X data we are able to infer ancient recombinations, population-specific recombinations and more, which also support the widely accepted 'Out of Africa' model. These results have been verified independently using traditional manual procedures. To the best of our knowledge, this is the first recombinations-based characterization of human populations.We show that our mathematical model identifies recombination spots in the individual haplotypes; the aggregate of these spots over a set of haplotypes defines a recombinational landscape that has enough signal to detect continental as well as population divide based on a short segment of Chromosome X. In particular, we are able to infer ancient recombinations, population-specific recombinations and more, which also support the widely accepted 'Out of Africa' model. The agreement with mutation-based analysis can be viewed as an indirect validation of our results and the model. Since the model in principle gives us more information embedded in the networks, in our future work, we plan to investigate more non-traditional questions via these structures computed by our methodology. Reconstructing the recombinational history of a DNA fragment has proved to be a difficult problem and can only be achieved at small scales. Nonetheless the reconstruction of the history of long fragments, is of great interest to geneticists. Although the mutational history of adjacent fragments is independent, this is not true for recombinational history: thus merging adjoining networks add a new level of richness in complexity in terms of the suite of recombination events that shape variations within and across populations (both populations substructures as well as possible migratory history).Four Gamete Rule , and the segmentation is a collection of non-overlapping intervals. For example, if F = 5, a possible segmentation of interval  is: S = {, , }. The three individual segments are s1 = , s2 =  and s3 =  with S = {s1, s2, s3}. For convenience, the three segments are denoted simply by the consecutive integer labels 1, 2 and 3 and to keep clarity of exposition, S is written simply as S = {1, 2, 3}. Then each feature f is written as s: f where s is the segment label that the feature f belongs to.Associated with a network S, the labeling of the edges of G are as follows: (1) Mutation edge: Every mutation edge e incident on a node v, has a non-empty label, lbl. Each member, s: f, of the label is interpreted as feature f in segment s.  Further, each element appears at most once in an edge label in G. (2) Recombination edge: The two recombination edges, e1 and e2, incident on a recombination node v are labeled by sets of segment labels lbl1 and lbl2 with lbl1\u2260 lbl2. For example lbl1 = {1, 3} denoting that e1 is labeled with the segment labels 1 and 3.For a segmentation follows:  Mutations \u2208 S, Restricted is the network obtained by doing the following two operations:(1) Removing all recombination edges in G that do not have the element s in the true edge label lbl'. (2) From each mutation edge label in G, removing the elements of the form s: f, for any f, from the edge label. For a concrete example see Figures Restricted, where S' \u2286 S.For a segment G is always associated with a segmentation S of the F features, hence written as . Note that G cannot be any arbitrary network. It must satisfy the following: for each s \u2208 S, Restricted is devoid of recombinations. Such a network is termed compatible. The Consensus Compatible Network Problem is defined as follows [G1, S1) and  with no common features (thus S1 \u2229 S2 = \u2205), the task is to compute a compatible network  with the minimum number of additional recombination nodes such that  is isomorphic to Restricted and  to Restricted. follows : Given tG, S) simply as G, and segmentation S will be clear from context.In the remainder of the paper, we refer to . A leaf is at level 0. The method gets its name from the need to give one of three possible assignments, Dominant (D) or Subdominant (S) or Recombinant (R), to nodes at each iteration, which is central to this scheme.The same level is also associated with any edge G have t roots. For root vi introduce an incoming edge ei, 1 \u2264 i \u2264 t. Then the height of G is defined as level). Let lmax (lmin) be the maximum (minimum) of the heights of G1 and G2. For a fixed level l, let , e is an edge in Gi | level = l}. Then intersection nl \u00d7 ml matrix Xl is defined as Xl had dimensions (nl + 1) \u00d7 (ml + 1) as this extra last row (column) with header '-\u03d5-' is required to take care of elements that are not covered by the rest of the columns (or rows). An empty entry is shown as '\u2205'. In X1 the exact entries can be computed and for Xl, l > 1 and the non-empty entries are identified by '{\u00b7}'. Further, let xl be the number of non-empty entries in Xl. See Figure Let Xl are given a DSR assignment. Note that at least two conditions are required for a viable compatible network G3. (Rule 1): Each row (column) in matrix Xl has at most one dominant. If the row (column) has no dominant, then it has at most one subdominant. (Rule 2): A non-recombinant element can have another non-recombinant in its row or its column but not both. As a result of the DSR assignments to the entries on Xl, the rows and columns also get implicitly assigned as follows. A row (column) that has a dominant entry is assigned dominant. A row (column) that is not assigned dominant but has a subdominant in the row (column) gets assigned subdominant. A row (column) that has only recombinants in the row (column) is assigned recombinant. Note that only dominant rows (columns) contribute to entries in Xl', l' > l. Figures greedy optimization approach, we include a third rule. (Rule 3): Minimize the number of recombinants in Xl. Complete examples are worked out in Figures The non-empty entries of G3 be NDSR. Let the optimal number of new recombinations be Nopt. We use the following definition of the true approximation factor:In this section, we compute the approximation factor ,9 of theG1 and G2 let zl = max where nl > 0 and ml > 0 are the number of nodes at level l in G1 and G2 respectively. Further, let Z be the sum of all zl over all the levels (excluding the leaf level). Let Lv(G) be all the leafnodes (extant units) reachable from node v in G. For each level, l > 0, i.e. excluding the leafnodes, consider G1), 1 \u2264 i \u2264 nl, where each vi is at level l in G1. Similarly consider G2), 1 \u2264 i \u2264 ml, where each ui is at level l in G2. Let xl be the number of non-empty intersections between the two collection of sets and let Y be the sum of xl over all the levels (excluding leaf level). Note that if G1 and G2 are the same (isomorphic) graphs then Y = Z and Nopt = 0.For given graphs Proof: Let Nmax (Nmin) be the maximum (minimum) number of new recombinations produced by the DSR scheme over all possible DSR assignments. Then we first show the following:Nopt\u2264 Nmax holds . Next we have to show that Nmin \u2264 Nopt holds as well. For this we need a few more characterizations of the network.Clearly Y be the set all given haplotypes (or taxa). A split or bipartition is written as Z1|Z2 where Z1 and Z2 are nonoverlapping subsets of Y with Y = Z1\u222a Z2. A tripartition Z1|Z2|Z3 is defined similarly. In earlier works  and recombinant edge(s) with s in its label. For any v, note that there is a unique s-path from a root to v. Further, let v be a recombination node and lbl1 and lbl2 be the labels of the two incoming (recombination) edges u1v and u2v respectively. For s1 \u2208 lbl1 but s1 \u2209 lbl2, let feature f1 be such that s1 : f1 is in the label of the closest mutation edge on the s1-path from v. Then F1 is the set of all such features. F2 is defined similarly. For example in G1 of Figure a. Here lbl1 = {2}, lbl2 = {3} and the descriptor for this node is F1|F2 = {2:4}|{3:5}. For the recombination node labeled 'R', lbl1 = {4}, lbl2 = {2, 3} and the descriptor is F1|F2 = {4:7} | {2:9, 3:8}.For a fixed segment Lv(G) be all the leafnodes (extant units) reachable from node v. Let s: f be in the label of the unique incoming edge on mutation node v and then let Ls: f (G) be the same as Lv. Two compatible networks G1 and G2 on the same segmentation S are isomorphic , written as G1 \u2261 G2, if the following two conditions hold: (1) For each element s: f in G1, Ls: f (G1) = Ls: f (G2) and viceversa, and, (2) For each recombination node v in G1 with descriptor F1|F2, there exists a recombination node in G2 with the same descriptor and viceversa.Let up or down an element in the mutation edge label to obtain G' such that G' \u2261 G. Our convention will be to bubble down the element of the mutation edge label, towards a leafnode. A network G is in the canonical form (1) if no node has only one outgoing edge and (2) if no element of any mutation edge label can be bubbled down to obtain G' with G' \u2261 G. For example see Figure It is possible to bubble edge and  if no elLemma 1 Let G3 be the consensus of G1 and G2 which are in canonical forms, with lmax (lmin) as the maximum (minimum) of the heights of G1 and G2. Then there exist some X-matrices, X1, X2,..., whose DSR assignments produce G3. This is written as G3 \u2245 X1, X2, ...,Back to the proof: We have to show that Nmin \u2264 Nopt holds. Assume the contrary, i.e., Nopt <Nmin. In other words, the optimal number of new recombinations is even lower than the minimum produced by the algorithm over all possible choices. Then consider this network Nopt new recombinations. Then by Lemma 1, there exist a sequence of X-matrices X1, X2, ..., Xl. Thus by these choices of the algorithm Nmin \u2264 Nopt must hold, again leading to a contradiction.Nopt \u226e Nmin. Here ends the proof of correctness of Eqn 3. Next, we give a few characterizations ofHence the DSR assignment to facilitate the counting of the new recombinations.v be a recombination node in G3 with labels lbl1 and lbl2 on the two incoming edges and descriptor F1|F2. The recombination event is new if, without loss of generality, lbl1\u2286 S1 and lbl2\u2286 S2. In other words, this recombination node is a result of the consensus of G1 and G2 (and not a recombination that existed in G1 or G2). A new recombination node v is of two types: Let e1 (e2) be a mutation edge in G1 (G2) with a label in F1 (F2). Without loss of generality, let level = l. Then the recombination is of Type I at level l if level = l and is of Type II at level l if level > l. Further, let the number of (non-empty) entries assigned dominant be X-matrix Xl. Then the following can be verified.Let Lemma 2 The number of Type I recombination events at level l in G3 is The number of Type II recombination events at level l in G3 is \u2264 Also, the number of recombination events in a network is bounded below (Nmin) by the number of Type I recombination events and above (Nmax) by the sum of the number of Type I and Type II recombination events.B with V partitioned into (1) nl nodes, corresponding to the rows and (2) ml nodes corresponding to the columns of Xl. The adjacency matrix Xl where an empty set entry is replaced with 0 and a non-empty set entry with 1. Let the number of connected components [B be Cl. Each connected component corresponds to an island in Xl which is a collection of rows and columns of Xl. Thus Xl is fragmented into Cl islands, Xl,i, written as: Xl = Xl,1 + Xl,2 + ... + yl,i, will be written simply as Xl,i have xl,i non-empty entries and let the number of entries assigned Y (D or S or R) in Xl,i be nl,i, ml,i) by Rules 1 and 2.We now give tighter bounds on mponents  of graphLemma 3 For each island Xl,i:Xl,i and Eqn 5 from Eqn 4 follows from using Rule 3 in island Back to the proof: Next, let Nc max(\u2265 Nmax) and Nc min(\u2264 Nmin) be some computable functions of the input . In Hapmap II , this seN = 30), Europeans , and a pooled sample of Chinese and Japanese .Further, we used only the haplotypes in the hemizygous males to avoid any phasing errors. These errors would manifest as phantom recombination events. The populations used were Yorubans from Nigeria , l should be much larger than when they are in LD.As a preprocessing step, exploiting the coherence seen in the data, each haplotype is recoded using blocks of H and let the number of SNPs be F. Further, let V be a column vector of size H. Since the SNPs are assumed to be bi-allelic, V which represents the value of a SNP in the H samples is binary. We use two schemes, based on the mode of definition of the F vectors, to estimates the p-value. The range of values of l seen in our data is 2 \u2264 l < 15 and we study the p-value estimates in this range using two schemes.Let the number of samples be V1, V2, ..., VF are defined randomly. In other words, each entry of each V is picked independently and uniformly from a set of two alleles. We use 10000 replicates and the distribution of the number of g-sized patterns is shown in Fig p-values estimated based on this scheme is shown in the table below. The p-values are \u2248 0.0 for every value of l.In this scheme, V vectors are plucked from the X-Chromosome of the database (but the SNPs span the entire chromosome) and any untyped SNP  in the vector is given a value in agreement with the allele frequency of that column. Further, we use only those V 's that have MAF \u2265 0.1. We again use 10000 replicates and for each replicate, we randomly permute the F vectors. The distribution of the number of g-sized patterns is shown in Fig While the RandV scheme is not incorrect, we make some domain-dependent modifications to design another scheme. In the PermV scheme we (i) mimic the allele frequencies seen in the input data and (ii) use the population distribution, by ethnicity, of the screened samples in the chromosomal region. The individual l has an insignificant p-value, then the subsequent analysis risks becoming unreliable. We then reduce the grain size. An alternative is to discard the offending SNPs of the block, thus fragmenting the region. In our experiments we used a grain size g = 5 and the p-values obtained for this on all the regions were acceptable. The haplotypes are re-coded as sequence of these SNP patterns for the combinatorial analysis discussed in the Methods section.If for a block, We show a sample network of a short segment of the chosen region in Figure Mutation-based studies of genetic diversity have shown exactly the same pattern: a larger diversity in Africans, and variation outside of Africa that is partially a subset of that in Africa. Our recombination-based results follow the same pattern, and, as the mutation data, fit the the \"Out of Africa\" model  for the We have addressed the problem of studying recombinational variations in human populations. One of the contributions of this work is a guaranteed upper bound on the approximation factor  in a greedy polynomial time algorithm to construct a consensus network. Such an assurance is of significance when dealing with data where there are no other reasonable means of cross-checking results. To date, this bound is the best known result for this problem. We use this scheme to study recombinational imprints in an appropriate segment of X chromosome from three populations. While the upper bound on the approximation is our theoretical contribution, our second contribution is the results on this data: With our preliminary analysis, we are able to infer ancient recombinations, population-specific recombinations and more, which also support the widely accepted 'Out of Africa' model. The agreement with mutation-based analysis can be viewed as an indirect validation of our results and the methodology. In our future work, we plan to investigate more non-traditional questions via the networks computed by our methodology.The authors declare that they have no competing interests.The work is a result of the synergistic efforts of all the authors. However, the brunt of each author's involvement is as follows. Design and analysis of the mathematical models: LP. Design and implementation of the algorithms: AJ. Design and implementation of the experiments: MM, FC and JB. Further, LP and JB were involved in conceiving and planning the recombinations project."}
+{"text": "The Red proteins of lambda phage mediate probably the simplest and most efficient homologous recombination reactions yet described. However the mechanism of dsDNA recombination remains undefined.Here we show that the Red proteins can act via full length single stranded intermediates to establish single stranded heteroduplexes at the replication fork. We created asymmetrically digestible dsDNA substrates by exploiting the fact that Red\u03b1 exonuclease activity requires a 5' phosphorylated end, or is blocked by phosphothioates. Using these substrates, we found that the most efficient configuration for dsDNA recombination occurred when the strand that can prime Okazaki-like synthesis contained both homology regions on the same ssDNA molecule. Furthermore, we show that Red recombination requires replication of the target molecule.in situ assay for recombination, which showed that recombination generated mixed wild type and recombinant colonies; and (ii) the predicted asymmetries of the homology arms, which showed that recombination is more sensitive to non-homologies attached to 5' than 3' ends. Whereas beta recombination can generate deletions in target BACs of at least 50 kb at about the same efficiency as small deletions, the converse event of insertion is very sensitive to increasing size. Insertions up to 3 kb are most efficiently achieved using beta recombination, however at greater sizes, an alternative Red-mediated mechanism(s) appears to be equally efficient. These findings define a new intermediate in homologous recombination, which also has practical implications for recombineering with the Red proteins.Hence we propose a new model for dsDNA recombination, termed 'beta' recombination, based on the formation of ssDNA heteroduplexes at the replication fork. Implications of the model were tested using (i) an  Homologous recombination (HR) is central to all replicating cells because it is a main pathway for the rescue of replication fork catastrophes ,2. When Single-strand binding proteins involved in HR promote the formation of joint molecules in two different ways, either strand invasion or annealing. Strand invasion requires a RecA/RAD51 superfamily member to mediate the search for complementarity between the single-stranded DNA (ssDNA) region and double-stranded DNA (dsDNA) through a triple-stranded intermediate termed a displacement loop (D-loop). Annealing is mediated by single-strand annealing proteins (SSAPs) between complementary ssDNAs . By sequHR is also central to the technologies of gene targeting and recombineering. Gene targeting is the process whereby the genome of a living cell is altered by the introduction of recombinant DNA into a specific site, mediated by the endogenous HR machinery -9. RecomS. cerevisiae [et al [et al [The standard model for replacement targeting by HR involves 5' to 3' resection at both ends Figure , followerevisiae . They fae [et al  for a dol [et al  who propE. coli exonuclease, RecBCD [et al [Here we focus on recombination mediated by the Red proteins of \u03bb phage. The Red operon includes a 5' to 3' exonuclease, Red\u03b1 -21, an S, RecBCD ,25. Wher, RecBCD ,27. Kuzm, RecBCD  argued c, RecBCD ,30 preseD [et al  providedD [et al ,32. ThisD [et al ,34.et al [Whereas this model explains oligonucleotide-directed HR, the mechanism of Red-mediated dsDNA HR remains unexplained. The standard model for replacement HR has been favoured ,35,36. Het al  proposedet al , serves et al . The bidet al . HoweverAn accidental discovery led us to reconsider the conundrum of Red-mediated dsDNA HR. Inadvertently we noticed a significant number of very late growing colonies produced by a boiled dsDNA control. Examination of these colonies revealed that they all contained the intended recombination (data not shown). Although we later found that boiled dsDNA is very inefficient compared to optimal recombineering practice, this unexpected observation led us to re-evaluate our presumptions and consider a new model for replacement HR by Red Figure . Rather E. coli chromosome. Recombination was scored as colonies that acquired resistance to the corresponding antibiotic under conditions where all antibiotic resistant colonies were due to the intended recombination, as evaluated by DNA analyses (data not shown). The recombination reactions were carried out with our standard protocol, which has been optimized for convenience and productivity. All experiments were performed in recA strains.Most recombination experiments described here employed linear substrates that included 50 nt/bp of continuous sequence identity to the target molecules at each end (termed the 'homology arms'), flanking a gene encoding resistance to an antibiotic. The target molecules were intact circles, being either plasmids, Bacterial Artificial Chromosomes (BACs) or the In the absence of RecA, dsDNA recombination by the Red proteins requires replication, however the mechanism remains undefined . To defiE. coli strain that contained Red\u03b1\u03b2\u03b3 with or without expression of Pi (strains GB2005 and GB2005-pir respectively). Recombination only occurred in the presence of Pi, demonstrating a need for replication of the R6K plasmid before recombination , which can separate complementary single-strands by gel electrophoresis [Previous ideas about Red recombination with dsDNA substrates have assumed that the reaction initiates with action by Red\u03b1 exonuclease to create a symmetrically resected ssDNA/dsDNA intermediate  resistance gene into a BAC  and so restore kanamycin resistance. As expected from previous observations, the oligonucleotide that can serve as a primer for Okazaki-fragment synthesis (Lg) produced more recombinants than the complementary oligonucleotide , indicating the two reactions are not identical. As shown before [mutS effect on ssDNA recombination  in a recombination assay in the presence of Red\u03b1 as well as Red\u03b2 (and Red\u03b3). The experimental design is shown in Figure E. coli chromosome. In both cases, the target was established in both orientations (bla and inv-bla), which alters the recombination reaction with respect to the direction of replication. Using an asymmetric substrate (OP), SSCP revealed that Red\u03b1 rapidly generated the ssDNA intermediate in vivo  5' phosphothioates or 5' end hydroxylation enhanced recombination of the LSP because they convey resistance to 5' - 3' exonuclease activity; (ii) this enhancement is amplified when the 5' end of the other strand is phosphorylated because rapid degradation of the unfavourable strand increases the yield of full-length, single-stranded, LSP; (iii) when both 5' ends are blocked to the exonculease, it is possible that another activity such as a helicase separates the strands so that the full-length LSP can initiate recombination.As a further test, we designed an experiment to evaluate the recombination efficiencies of symmetrically resected dsDNA intermediates. A pair of phosphothioates were symmetrically placed at increasing distances from the 5' ends of a substrate as illustrated in Figure Taken together, this evidence supports a new model for Red replacement HR mediated through a single-strand that forms a heteroduplex at the replication fork, as illustrated in Figure in situ recombination assay based on colony colour. On MacConkey agar, cells carrying an intact malK gene give a red colour whereas mutants are white [malK gene and the other to restore it. After brief incubation to permit recombination, cells were plated out at single cell dilution and cultured until the colony colour was apparent , we performed these experiments as a time course of brief incubation before plating. As presented in Table The beta recombination model predicts that the recombination intermediate is initially a heteroduplex on the lagging strand of both mutant and parental strands. If this heteroduplex is replicated, the product should be one daughter that is parental and one that is mutant. To look for this possibility, we developed an re white . The asst Figure . BecauseThe beta recombination model implies that the homology arms are not equivalent. That is, the homology arm at the 3' end of the LSP should anneal first, followed by annealing of the 5' LSP homology arm. Also, the homology arms on the other strand should be unimportant. These asymmetries permit certain tests.First, we tested the impact of adding non-homologous sequence to the 3' or 5' ends of the LSP Figure . When thSecond we tested the impact of altering the length of the 3' or 5' homology arms of the LSP by making one homology arm shorter  in a BAC. These insertions were then deleted by a short (100 bp) fragment to restore the neo gene. The 100 bp fragment was generated in the four variations of 5' phosphorylation and hydroxylation as illustrated. In a complementary assay to examine larger regions, one homology region was first inserted at various distances from the other around a BAC from 0.5 to 50 kb  for replacement targeting to achieve similarly sized deletions (<1 kb) in the target molecule. To determine whether larger deletions or insertions influence the mechanism, we built assays for the experiments of Figure b Figure . Then thIn contrast to deletions, varying the insertion size revealed a vital insight. The efficiency of beta recombination, that is the preference for the LSP over its complementary strand, decreased with increasing size Figure . At 1 kbTo establish whether Red dsDNA recombination can operate through another mechanism(s), we compared replacement recombination, also known as 'ends-out', with 'ends-in' recombination using the same target and homology regions Figure . As descWe present a new model for replacement targeting by the lambda Red pathway based on a heteroduplex intermediate that incorporates only one strand of the dsDNA substrate, which we term 'beta' recombination Figure . In contin vivo assay based on phage infection and restriction cleavage, it has been recently shown that Red-mediated dsDNA recombination requires replication [The reliance of Red recombination on replication was identified a long time ago . Howeverlication . Here weE. coli is not sensitive to events behind it. Support for the idea that the two homology arms in a dsDNA substrate are not equivalent for Red recombination has been recently published [The beta recombination model Figure  implies ublished . These ain situ assay to see if replication of the heteroduplex generated one wild type and one recombinant daughter, which should be visible as colony sectoring  in two different assays but did not see any discontinuity or any substantial loss of efficiency up to deletions of 50 kb. Taken together with evidence supporting the subsequent replication of the heteroduplex after establishment Figure , it appein vitro ,23. AlteAlthough we present evidence that Red\u03b2 recombination with dsDNA is mediated via solo ssDNA intermediates, our evidence does not exclude additional mechanisms. Indeed, we found circumstances where less efficient levels of recombination appear to be evidence of another mechanism Figure , which cThe beta recombination model also has some practical implications. As with oligonucleotide-directed mutagenesis, knowledge of the direction of replication can be used to optimize recombineering efficiencies. For many applications, the additional efficiency achieved is not necessary, particularly because the OO, SS and even PP configurations usually deliver more than enough product for DNA engineering exercises. However in certain cases, such as high throughput recombineering ,60, the Several other practical points emerged; (i) two consecutive phosphothioates increased recombination efficiency, presumably because they stabilized the 5' end against exonucleases whilst being permissive for the further steps of recombination. Notably the dsDNA substrates with phosphothioates at both 5' ends were the second-most efficient configuration in our experiments. We suggest that these substrates are also utilized by beta recombination, however are made single-stranded by a helicase activity; (ii) identical DNA fragments produced by PCR or restriction digestion usually differ with respect to phosphorylation at their 5' ends. This can lead to different recombination efficiencies; (iii) heterologous extensions beyond the homology arms are better tolerated at 3' but not 5' LSP ends; (iv) shorter cassettes are significantly more efficiently incorporated than longer, which has implications for high throughput and complex recombineering tasks.We present evidence supporting a model for homologous recombination mediated by Red\u03b2 acting via a single stranded heteroduplex intermediate formed at the replication fork. Although other mechanisms are not excluded, it appears that the remarkable efficiency of Red recombination utilizes this single stranded intermediate. The model has several practical implications for recombineering when highly efficient applications are required.recE and recT, and DLP12 prophage ybcC that encodes a putative exonuclease similar to the Red\u03b1, were deleted to generate GB2005. Both deletions were done by insertion of a selectable marker (kan) flanked by lox66 and lox71 sites; subsequently the selectable marker was removed by Cre recombination. The mutS and sbcB deletion strains were generated in a similar way by removing the whole open reading frame of the respective genes, however the cassette used for deletion was the puromycin resistant gene (puro) flanked by rox sites. The puro cassette was subsequently excised by Dre recombination [pir gene plus a selectable marker (kan) flanked by lox71 and lox66 sites in the ybcC locus. And then the selectable marker was removed by Cre recombination.All the strains and substrates used in this work were generated by recombineering. GB2005 is a derivative of HS996. The Rac prophage bination . GB2005-All recombination reactions were performed as follows unless stated. Cells carrying a pSC101 vector, either BAD-Red\u03b1\u03b2\u03b3 or BAD-Red\u03b2 were passaged by inoculation of 0.5 ml from a fresh overnight culture into 25 ml LB, 5 \u03bcg/ml tetracycline and grown at 30\u00b0C for 2 hours. Then protein expression was induced by addition of L-arabinose to 0.2% and grown at 37\u00b0C for 45 minutes followed by centrifugation at 0\u00b0C, resuspension in ice cold 10% glycerol and transfer to an ice cold Eppendorf tube. The cells were then washed 2 times with ice-cold 1 ml of 10% glycerol in the Eppendorf tube and then diluted to 600 \u03bcl ice cold 10% glycerol. 30 \u03bcl were used for each electroporation in pre-chilled 1 mm Eppendorf 100 \u03bcl cuvettes using an Eppendorf 2510 set at 1350 V. After electroporation, the cells were resuspended in L-broth and incubated at 37\u00b0C for 45 minutes before plating. All experiments were repeated three times using 50 ng of co-electroporated plasmid as an internal control for electroporation efficiency.The sequences of the oligonucleotides used for recombineering can be found in Additional file amp) plus the 3' end of the pir gene into a R6K-cm-pir* plasmid that carried only the 5' end of the pir gene. The PCR template was pR6K-amp-pir*. Both pR6K-cm-pir* and pR6K-amp-pir* were constructed from pR6K-hyg-pir. The recombinants were identified and counted on ampicillin plates (100 \u03bcg/ml).The replication origin in the R6K-amp plasmid was exchanged using a PCR product containing the blasticidin resistance gene (bsd) and the pBR322 origin of replication. A plasmid was built to serve as template for the PCR reaction and homology arms to the R6K plasmid were added by the PCR reaction. Then, co-electroporation of 200 ng of the R6K-amp plasmid DNA with 200 ng of PCR product into cells expressing Red\u03b1\u03b2\u03b3 under arabinose induction in presence (GB2005-pir) or absence (GB2005) of the Pir protein was followed by plating onto blasticidin (50 \u03bcg/ml) plates. The restoration of a functional pir gene in a R6K\u03b3 ori plasmid was done by recombining a cassette containing the ampicillin resistance gene  for 1 hour at 37\u00b0C, followed by purification using gel extraction kit . 2.5 volumes of denaturating buffer  was added to 1 volume of digestion product before boiling for 5 minutes at 95\u00b0C and placing on ice. 20 \u03bcl were loaded per each lane containing 10 \u03bcl from the boiled sample and 10 \u03bcl from the unboiled sample. Native polyacrylamide gel electrophoresis was used for SSCP overnight (14 hours) at 50 V. ssDNA recombination was performed by electroporating 2 pmoles of ssDNA generated from the in vivo digestion experiment were prepared using 5 vials of competent cells (each 40 \u03bcl), which were each transformed with 170 ng of asymmetrically phopshorylated bsd cassette. 1 ml of L-broth was added to the cells and they were incubated 5 minutes at 37\u00b0C. After extracting the DNA using a standard plasmid mini-prep, the 5 DNAs were pooled and loaded as above on an SSCP gel.The samples for the were generated by PCR using differentially end-modified oligonucleotides. Four different kinds of modification were exploited: normal unmodified 5' ends (O oligonucleotides), phosphorylated 5' ends (P oligonucleotides), insertion of 2 phosphothioate linkages between the first and the second and the second and the third nucleotides starting from 5' end (S oligonucleotides) and both phosphorylated 5' ends combined with 2 phosphothioate linkages (PS or SP oligonucleotides).amp) into the neo gene of pBelo-BAC11-neo* in both orientations. The same cassette was also inserted in both orientations in the ara-leu locus on the chromosome. The BACs used for deletion experiments were generating by inserting fragments of different sizes into the NcoI site of the neo gene. The 4 bp insertion is the same neo* used previously [neo gene. The bigger deletion series used a mouse pax8 BAC containing a cassette (neo) inserted at different distances from a chosen point . The same rpsL-bsd cassette was used for the amplification in the ends-in and ends-out experiment.were done by electroporating 2 pmoles and plating 50 \u03bcl of the 1 ml resuspension. The pBelo-BAC-bla and pBelo-BAC-inv-bla were generated by inserting the ampicillin resistance gene  was deleted by replacement with the blasticidin resistance gene. This was restored with a cassette containing the missing 300 bp plus 50 bp of further homology to malK either side. To obtain a high efficiency of recombination (~1/500 colonies), 1 \u03bcg of a PS cassette was electroporated and 100 \u03bcl of 106 dilution were plated on MacConkey agar plus maltose. The experiment was performed at 30\u00b0C to minimize the number of replication forks. The restoration of a functional malK gave higher efficiency of recombination (probably due to the shorter length of the transformed cassette (400 bp) and was used for the experiment in Table1.Part of the MM, AE, JF and AF performed the experiments. YZ made the initial discovery. MM, AE, JF, YZ and AFS designed the experiments. AFS wrote the paper. All authors approved the final version.Supplementary information. Oligonucleotides usedClick here for file"}
+{"text": "Entamoeba histolytica, contributing to the genetic heterogeneity of this unicellular eukaryote. In this study, we demonstrate that this genetic heterogeneity is an inherent feature of the cell cycle of this organism. Chromosome segregation occurs on a variety of novel microtubular assemblies including multi-polar spindles. Cytokinesis in E. histolytica is completed by the mechanical severing of a thin cytoplasmic bridge, either independently or with the help of neighboring cells. Importantly, cytokinesis is uncoupled from the nuclear division cycle, both temporally and spatially, leading to the formation of unequal daughter cells. Sorting of euploid and polyploid cells showed that each of these sub-populations acquired heterogeneous DNA content upon further growth. Our study conclusively demonstrates that genetic heterogeneity originates from the unique mode of cell division events in this protist.Accumulation of multiple copies of the genome in a single nucleus and several nuclei in a single cell has previously been noted in  Entamoeba histolytica re-duplication of DNA followed by segregation on atypical and diverse microtubular structures is frequently observed. In this parasite, cell division is erratic, so that each daughter cell may contain one or more nuclei and sometimes no nuclei. This uncoupling of cell cycle events and survival of daughter cells with unequal DNA contents leads to genetic heterogeneity in E. histolytica. Our study highlights the inherent plasticity of the Entamoeba genome and the ability of this protist to survive in the absence of strict regulatory mechanisms that are a hallmark of the eukaryotic cell cycle.Proliferating eukaryotic cells regulate their DNA synthesis, chromosome segregation, and cell division with great precision so that daughter cells are genetically identical. Our study demonstrates that in proliferating cells of the protist pathogen  Drosophila, and protists, show striking differences in regulating the transmission of genetic information during proliferation Entamoeba histolytica is one such protist parasite that proliferates in the intestinal lumen of human beings often causing severe disease in the host. Indeed this parasite is responsible for millions of cases of dysentery and liver abscess world wide especially in developing countries Eukaryotic cells undergo two major events during proliferation- the nuclear cycle, when the whole genome is duplicated and segregated equally into two nuclei and cytokinesis, the physical separation of a mother cell into two daughter cells. Sequential progression of events during the cell cycle is enforced by checkpoint proteins E. histolytica cells exhibit variations in DNA content, which may vary several folds within a population E. histolytica trophozoites with multiple nuclei were observed in infected intestinal tissue suggesting this is an intrinsic property of this parasite and not due to in vitro culture conditions E. histolytica trophozoites E. invadens during conversion of cysts to trophozoites and vice versa Entamoeba genome Axenically grown E. histolytica cells due to multiple rounds of DNA duplication, it has not been clear how polyploid amoebae partition their genomes. Bipolar microtubular spindles are not frequently visible in E. histolyticaE. histolytica cells during their axenic growth include- a) multiple cycles of replication of the genome without nuclear or cell division, b) nuclear division without cytokinesis and c) polyploidization from over-replication of the genome followed by segregation on multipolar mitotic spindles.Most eukaryotes segregate their genomes once duplication is complete. While more than 2n genome content accumulates in some E. histolytica cells in axenic culture.In this study, we demonstrate: a) the formation of atypical microtubular structures during genome segregation; b) multiple microtubule organizing centers (MTOCs) and multi-polar spindles are formed in polyploid nuclei; c) cell division is spatially and temporally uncoupled from the nuclear cycle; d) cell division can be asymmetric, thereby producing either uni-nucleate, multi-nucleate or anucleate daughter cells. In summary, asynchrony between nuclear division and cytokinesis in a fraction of the population combined with segregation of the polyploid genome on multi-polar spindles accounts for the extreme variation of genomic DNA content in individual E. histolytica HM-1:IMSS trophozoites were maintained axenically and routinely sub-cultured every 48\u201372 h in TYI-S-33 medium containing 10% adult bovine serum at 37\u00b0C E. histolytica HM-1:IMSS cells were sub-cultured every 24 h for 3\u20134 days followed by serum starvation Ethanol fixed cells were stained with 4\u2032-6-Diamidino-2-phenylindole  for 10 min, washed once with 1\u00d7 PBS and then scanned for DNA content of individual nuclei E. histolytica HM-1:IMSS cells were grown on coverslips in 24-well plates at 37\u00b0C, fixed directly with warm 3.7% formaldehyde for 15 min and permeabilized with 0.1% Triton X-100 for 10 min. Fixed cells were stained with polyclonal anti-Eh \u03b2-tubulin antibody E. histolytica HM-1:IMSS trophozoites were plated on 35-mm plastic culture dishes filled with growth medium at 37\u00b0C. After the cells adhered, the medium was replaced with fresh growth medium. The dish was kept inside an incubator  at 37\u00b0C and under 5% CO2 flow system  which was fitted to the Axiovert 200 M fluorescence microscope . Cells were visualized under a 20\u00d7 phase contrast objective. The time-lapse images were captured with 1 sec interval for the indicated time, then analyzed and further processed by Axiovision v4.6 software .E. histolytica HM-1:IMSS cells (1\u00d7108 cells) were harvested 48 h after sub-culture, washed with 1\u00d7 PBS and incubated with 1 \u00b5M DNA binding dye- Vybrant DyeCycle Orange for 1 h . Cells were passed through a 40 \u00b5m nylon mesh  to remove aggregates and debris before sorting the cells. Vybrant DyeCycle Orange stained cells were excited at 488 nm in a flow cytometer  and emission was measured through a 585/42 Band Pass filter for analyzing the DNA content. On the basis of DNA content analysis , cells were demarcated in four different electronic gates and sorted at 4\u00b0C. The sorted cells were washed with 1\u00d7 PBS and resuspended in 2 ml TYI-S-33 medium. Half the cells were inoculated into growth medium and harvested after 3 days. The remaining cells were fixed in 70% ethanol for analysis of the nuclear DNA content and number of nuclei in each cell.Asynchronously growing E. histolytica is arrested when cells are incubated in serum free media for at least 12 h, followed by re-initiation within 2 h after addition of serum E. histolytica nuclei contain heterogeneous amounts of DNA. 1 h after addition of serum the nuclei show a dramatic homogenization and reduction of DNA content  with DNA at the two ends of bi-directionally extending MT fibers  and b) wThe most frequent structures visible at 2 h\u20134 h after serum addition were the intermediates shown in Importantly, several nuclei with high DNA content were seen that contained two, three or four MTOCs . BipolarE. histolytica uses novel MT structures for chromosome segregation mostly originating from a single pole. Multi-polar spindles are also observed and may account for the rapid generation of DNA content heterogeneity from polyploid cells. Another unique feature is the use of multiple modes of segregation, as suggested by the diverse MT structural intermediates and inter-cellular variation in DNA content.In summary, E. histolytica (data not shown). Therefore, based on earlier reports E. histolytica cell division events were assisted by helper cells while 45% (18 out of 40) involved independent mechanical severance of the cytoplasmic bridge. We also discovered that 20% (8 out of 40) of the cell division events in E. histolytica were not completed. In these cases, the connecting cytoplasmic bridges became unusually long and thin but were not finally severed. Instead, the cytoplasmic bridge contracted and the two \u2018dividing halves\u2019 fused together without division . It was observed that P1 cells had a higher percentage of bi-and multi-nucleated cells while P4 cells showed a homogenous population of uni-nucleated cells after growth  and E. invadensEntamoeba, unlike the finely regulated cell division in bacteria, yeasts and higher eukaryotes. While endogenous Entamoeba proteins may affect the rate of cell division as deduced from increased multi-nucleation in different mutants D. discoideum which shows variations in its mode of cell division. Multi-nucleated Myosin II-null D. discoideum cells, when allowed to adhere on substrate, undergo a cell cycle-uncoupled, inefficient cytofission Cytokinetic processes in E. histolytica cells with aphidicolin or taxol did not lead to a significant increase of nuclei in different mitotic stages (data not shown). Thus the entire nuclear cycle appears to be poorly controlled, resulting in leaky phenotypes that are apparent in polyploid nuclei. In spite of leaky regulatory mechanisms, S-phase, genome segregation and nuclear division are temporally coupled. Multiple MTOCs and multi-polar MT spindles possibly facilitate a return towards euploidy for polyploid nuclei.The nuclear cycle was clearly defined between initiation of DNA synthesis and completion of nuclear division. That a significant number of nuclei continued accumulation of DNA after doubling their DNA content emphasizes the absence of stringent regulatory mechanisms preventing re-replication that are seen in other eukaryotes. Heterogeneity of MT structures also suggests a lack of strict control of genome segregation mechanisms. It may be noted that even after serum synchronization, the maximal number of nuclei with MT structures and bi-nucleated cells were only around 20%. Treatment of Entamoeba and few other organisms can bypass these surveillance mechanisms and continue their life cycles. How does Entamoeba preserve its genetic composition in the absence of cell cycle regulation? The answer possibly lies in its survival as a parasite, dependant on its surroundings, where plasticity and heterogeneity are favored over precision and homogeneity.Strict regulation of the cell division cycle has been considered to be the very basis of survival for eukaryotes. Indeed an unregulated cell cycle leads to growth arrest, aneuploidy and tumorigenesis in yeasts and higher eukaryotes. While prokaryotes use overlapping parallel processes of DNA synthesis, segregation and cell division, eukaryotes ensure completion of the preceding stage before initiation of the next, with tight surveillance to ensure the same. Clearly Figure S1E. histolytica trophozoites. (A) Cell number increases continuously rather than in a step-wise fashion. Cell number was counted at different time points (0\u201312 h) after serum starvation and addition and plotted. Error bars indicate\u00b1S.D. (n\u200a=\u200a3). (B) Growth rate is dependant on cell density. Log phase E. histolytica HM-1:IMSS cells were inoculated in TYI-S-33 medium at different cell densities- 1\u00d7104, 5\u00d7104 and 10\u00d7104 cells/ml. Subsequent growth of these cells after 20 and 40 h is shown graphically. Error bars indicate\u00b1S.D. (n\u200a=\u200a3).Effect of cell density on the growth rate of (0.30 MB TIF)Click here for additional data file.Figure S2E. histolytica. Log phase E. histolytica HM-1:IMSS cells were incubated with in fresh medium at 37\u00b0C to induce cell division events. Cytokinesis was visualized under a 20\u00d7 phase contrast objective of the Axiovert 200 M microscope and time-lapse images were captured at 1 sec intervals. During cell division, cytoplasmic constriction led to the extension of a cytoplasmic bridge (arrowhead) between two dividing halves. This bridge could either (A) rupture independently or (B) with the assistance of a helper or midwife cell (star). Arrows show ends of the severed cytoplasmic bridge. Bar represents 20 \u00b5m.Two modes of cell division in (3.47 MB TIF)Click here for additional data file.Video S1E. histolytica.Mechanical rupture of cytoplasmic extension leads to cell division in (3.75 MB MOV)Click here for additional data file.Video S2E. histolytica.Helper cell assisted cell division in (0.39 MB MOV)Click here for additional data file.Video S3E. histolytica.Aborted cytokinesis in (9.98 MB MOV)Click here for additional data file."}
+{"text": "In this paper, we highlight the need for acknowledging the importance and impact of both physical and emotional closeness between the preterm infant and parent in the neonatal intensive care unit. Physical closeness refers to being spatially close and emotional closeness to parental feelings of being emotionally connected to the infant . Through consideration of the literature in this area, we outline some of the reasons why physical closeness and emotional closeness are crucial to the physical, emotional and social well-being of both the infant and the parent. These include positive effects on infant brain development, parent psychological well-being and on the parent\u2013infant relationship. The influence of the neonatal unit environment and culture on physical and emotional closeness is also discussed.Culturally sensitive care practices, procedures and the physical environment need to be considered to facilitate parent\u2013infant closeness, such as through early and prolonged skin-to-skin contact, family-centred care, increased visiting hours, family rooms and optimization of the space on the units. Further research is required to explore factors that facilitate both physical and emotional closeness to ensure that parent\u2013infant closeness is a priority within neonatal care. In this paper, we highlight the importance and potential impact of both physical and emotional closeness and the deleterious effects of separation between a preterm infant and the parent during neonatal care.Physical closeness in a neonatal intensive care unit (NICU) ranges from skin-to-skin contact between parent and infant, to parents being in the unit but not in physical contact with their infant. Emotional closeness describes how parents can experience anything from feelings of strong and consistent love, care, affection and/or connection to emotional disconnection and alienation from their infant. Although \u2018physical closeness\u2019 may facilitate \u2018emotional closeness\u2019 and The brain of a preterm infant is immature and vulnerable and, therefore, preterm infants are at a risk for abnormal brain development and later developmental problems. However, they also have large brain plasticity and potential for injury compensation. A growing body of evidence in both humans and animals suggests that brain development and later development may be influenced by the quality of care given to preterm infants including physical and emotional closeness and parent empowerment. Mother\u2013infant interaction in early postnatal life, or lack of it in case of separation, can mediate variations in offspring phenotype, including emotional and cognitive development, with long-term health consequences. Environmental factors can influence gene expression through epigenetic mechanisms to provide the \u2018plasticity\u2019 necessary to respond to variations in environment . Term inThe evidence suggests many benefits of early parent-preterm infant closeness during hospital care.In future, we need to explore facilitating and inhibiting factors to be able to implement strategies supporting closeness.Attention should be paid to both architectural structure and organizational culture in the neonatal units to support both the physical and emotional needs of parents and infants.Skin-to-skin contact, developmental care and other interventions supporting parenting and parental involvement in infant care have been shown to have the potential to enhance neurological and neurobehavioural outcomes of preterm infants \u2013b13. ParA preterm birth has been associated with poor psychological functioning in mothers and fathers, and in more negative parental interactive behaviours with their infants. Higher prevalence of depression in parents of preterm infants compared with those of full-term infants may be explained by interrupted psychological processes during pregnancy, a stressful birth, concern for their infant\u2019s well-being and NICU experiences \u2013b24. HowParental attachment to the infant, also called psychological bonding, begins and is strengthened throughout pregnancy . After bA recent meta-analysis  was undeFeeding is one of the most prominent care-giving activities in a NICU, in which the transition from tube feeding to breastfeeding is complicated by the degree of prematurity, emotional exhaustion, mother\u2013infant separation, institutional authority and by a view of breastfeeding as a productive process, thereby preventing mothers\u2019 experiences of breastfeeding as reciprocal and \u2018successful\u2019,44. EarlEvidence-based architecture has provided research on the benefits of different options concerning the physical structure of a neonatal unit. There is a trend towards single family room design when building new units , which sThere are ways, even in traditional open-bay units, to increase parent\u2019s facilities to be close to the infant, for example, by providing comfortable chairs and/or beds for them. Parents\u2019 presence can also be promoted by improving privacy by visual separation and ear phones when other families\u2019 issues are discussed in the same room. There is a very large variation between the neonatal units as to the extent to which they offer such facilities. One survey reported that reclining chairs were offered for parents in 11\u2013100% of units and beds in 0\u2013100% of units in different European countries . Based oParallel to structural changes, there is an ongoing change in the care culture in neonatal units to support parenting in the context of neonatal intensive care. Even though there has been a change in the attitude in neonatal care towards a more family-centred approach, there is still a medical and technical focus and there seems to be a gap between care policies/practices and evidence from family and infant research . FurtherTo facilitate physical contact between parents and their infants, neonatal unit staff need to welcome parents\u2019 participation in the care but also guide parents when adapting parental touch into daily care, as touch may induce stress in very ill infants . In a geLarge and systematic differences related to cultural and contextual issues in neonatal units, such as parental involvement, implementation of family-centred care and staff practices, might influence differences shown in breastfeeding rates, maternal depression, and short- and long-term outcomes of the children . There iThere is increasing evidence supporting the benefits of early parent\u2013infant closeness during hospital care of preterm infants. Both physical and emotional parent\u2013infant closeness should be facilitated in neonatal units taking into account the socio-economic, political and cultural variations in different countries. To better understand the issues, we need to explore what facilitates and inhibits closeness and consider implementing strategies that enable closeness. These strategies include optimizing the spatial configuration of the neonatal unit; providing chairs/beds/privacy within the given architectural design; developing a nurturing unit culture by removing all restrictions with regard to parents being on the unit and including them as empowered players in the care effort. The most important consideration is paying attention to developing an organizational culture that supports the formation of parent\u2013infant relationships, that is, the physical and emotional needs of parents and infants."}
+{"text": "Adjuvants serve as catalysts of the innate immune response by initiating a localized site of inflammation that is mitigated by the interactions between antigens and toll like receptor (TLR) proteins. Currently, the majority of vaccines are formulated with aluminum based adjuvants, which are associated with various side effects. In an effort to develop a new class of adjuvants, agonists of TLR proteins, such as bacterial products, would be natural candidates. Lipopolysaccharide (LPS), a major structural component of gram negative bacteria cell walls, induces the systemic inflammation observed in septic shock by interacting with TLR-4. The use of synthetic peptides of LPS or TLR-4 agonists, which mimic the interaction between TLR-4 and LPS, can potentially regulate cellular signal transduction pathways such that a localized inflammatory response is achieved similar to that generated by adjuvants.We report the identification and activity of several peptides isolated using phage display combinatorial peptide technology, which functionally mimicked LPS. The activity of the LPS-TLR-4 interaction was assessed by NF-\u03baB nuclear translocation analyses in HEK-BLUE\u2122-4 cells, a cell culture model that expresses only TLR-4, and the murine macrophage cell line, RAW264.7. Furthermore, the LPS peptide mimics were capable of inducing inflammatory cytokine secretion from RAW264.7 cells. Lastly, ELISA analysis of serum from vaccinated BALB/c mice revealed that the LPS peptide mimics act as a functional adjuvant.Our data demonstrate the identification of synthetic peptides that mimic LPS by interacting with TLR-4. This LPS mimotope-TLR-4 interaction will allow for the development and use of these peptides as a new class of adjuvants, namely TLR-4 agonists. Lipopolysaccharide (LPS) is the major structural component of gram negative bacteria and is composed of three distinct domains; lipid A, a core oligosaccharide chain, and an O-antigen DrosophilaInflammatory cytokine secretion occurs upon the initial interaction between LPS and its receptor, toll like receptor 4 (TLR-4), present on APCs such as macrophages and dendritic cells Adjuvants are substances that accelerate and/or enhance an antigen specific immune response as antigens alone are not recognized by the immune system H. influenzae lipooligosaccharide (LOS) to be possibly developed into a H. influenzae vaccine in vivo immunization experiments as determined by the increased levels of antibodies in mice that received a vaccine containing the LPS peptide mimic and a prostate cancer specific antigen. Therefore, the peptides identified in this study functionally mimic LPS and have the potential to be developed into a novel TLR-4 agonist adjuvant.As mentioned, the potent inflammation induced by LPS activation of APCs via TLR-4 suggests LPS to be an optimal adjuvant only if the inflammation remains localized. One way to exploit the inflammatory properties of LPS such that it can be used as an adjuvant but lack its detrimental side effects is through identification of synthetic LPS peptide mimics using Phage display peptide libraries. To date, no studies have used LPS as a target to identify peptides from Phage display libraries but one study identified peptide mimics of Phage display technology is a powerful tool used to identify peptides which can be used in many down stream applications such as identification of specific inhibitors or activators of certain target proteins The main event which occurs upon binding of LPS to TLR-4 is nuclear localization of the transcription factor NF-\u03baB, which upon binding to its promoter, results in transcription of inflammatory cytokines; an event at the heart of septic shock Inflammation results from binding of nuclear NF-\u03baB to its promoter, thus initiating transcription of various cytokines. Development of the LPS peptide mimics identified in this study as an adjuvant would require them to induce secretion of pro-inflammatory cytokines, which in turn activate the immune system and initiate an antigen specific immune response. Provided that a broad range of cytokines and chemokines are secreted during an inflammatory response, we utilized antibody array membranes to determine which cytokines/chemokines were secreted in response to the LPS peptide mimics RS01 and RS09. Although the values obtained for each cytokine are not quantitative but rather qualitative, they did serve in giving one an idea as to the various inflammatory cytokines secreted. These values were calculated and presented as IDV, which is the density of each spot compared to the density of the internal positive controls present on each membrane. Values for the various cytokines and chemokines detected are presented in in vivo. The antigen used for our in vivo adjuvant study is a 15-mer peptide, known as X-15, which has been observed to possess prostate tumor protective properties in vivo when administered with an adjuvant in vitro, only RS09 was capable of producing a robust X-15 antibody response when compared to Alum and RS01 in vivo. This significant increase in X-15 specific antibody concentration with RS09 was observed on day 28 (white bar) post vaccination as shown in Weakly or non-immunogenic antigens require an adjuvant that can activate the innate immune system and subsequently initiate an antigen specific immune response. Having observed that the RS01 and RS09 LPS peptide mimics identified in our study were not only capable of inducing NF-\u03baB nuclear translocation but also induced inflammatory cytokine secretion from RAW264.7 macrophages, we next determined if they could function as an adjuvant Adjuvants provide a bridge between antigens and APCs of the immune system Various adjuvants such as QS-21, a saponin derived from the bark of the soap tree, and oil based emulsions are being evaluated in clinical trials for their efficacy. Currently, alum based adjuvants and monophosphoryl lipid A, a bacterial product, remain the only FDA approved adjuvants in vivo significance and credence for adjuvant activity. Interestingly, for the nuclear translocation experiments, both by Western blotting and fluorescence microscopy, LPS was used as a positive control and displayed similar activity to that of RS01 and RS09 indicating our peptides to be true LPS peptide mimics. It is important to mention that the kinetics of nuclear NF-\u03baB translocation was greater for LPS that both RS01 and RS09 in HEK-BLU\u2122-4 and RAW264.7 cells. This infers that LPS generates a more rapid and robust immune response compared to RS01 and RS09 but this is a favorable observation with respect to developing RS01 and RS09 into adjuvants. Ideally, we want the immuno-stimulatory response of that observed with RS01 and RS09 and not that of LPS, which can potentially lead to an exaggerated immune response as that observed in septic shock syndrome.Identification of compounds which mimic LPS by initiating the essential inflammatory events that are required during an immune response and thus be developed into a potential adjuvant was the goal of this study. Several LPS peptide mimotopes identified in this study were capable of mimicking two essential events that are observed during LPS induced inflammation; namely activation of cells via TLR-4, resulting in nuclear translocation of NF-\u03baB and secretion of inflammatory cytokines. Consistently, all the peptides chosen to assay for their NF-\u03baB activating ability, using the TLR-4 expressing transgenic HEK-BLU\u2122-4, displayed differential activity while other peptides were non-activating. Due to the fact that the HEK-BLU\u2122-4 cell line expresses TLR-4 exclusively, it confirmed that these peptides acted as mimics of LPS. LPS activation of TLR-4, resulting in initiation of a signal transduction cascade culminating in NF-\u03baB activation/nuclear translocation, was also observed to be true for the two peptides assayed for in our study (RS01 and RS09). Both peptides RS01 and RS09 were observed to initiate nuclear translocation of NF-\u03baB in the murine macrophage cell line, RAW264.7 as well as in HEK-BLU\u2122-4. This observation using RAW264.7 was more significant to this study as it is a macrophage cell line and hence interaction with TLR-4 thus ensuing NF-\u03baB activation lend One critical event addressed in our study was if our LPS peptide mimics were capable of inducing secretion of cytokines that initiate an inflammatory response. Provided that both RS01 and RS09 were active at the level of NF-\u03baB nuclear translocation, both RS01 and RS09 were assayed for cytokine expression studies. Inflammatory cytokine secretion in RAW264.7 was similar for LPS, RS01, and RS09. The cytokines detected ranged from pro-inflammatory cytokines such as TNF-\u03b1, IL-1\u03b2, and IL-12p70 to chemokines such as MCSF, GCSF and GM-CSF, which are crucial chemo attractants and activators of macrophages and leukocytes. All of the cytokines detected cooperate in activating the innate immune system, in response to antigen, thus initiating inflammation. Initiation of this inflammatory response is what defines an adjuvant, such as the LPS peptide mimics identified in this study.in vivo experiments were performed in BALB/c mice. Knowing fully well that results observed in in vitro experiments do not always correlate or translate into in vivo experiments, both peptides (RS01 and RS09) were individually used as an adjuvant in the animal studies and the immunogen used was a prostate cancer specific antigen, X-15. Interestingly, only one peptide, RS09, was capable of increasing X-15 specific antibodies in vivo. The fact that RS01 did not react as RS09 in vivo needs further examination but can be contributed to various factors. First, it may very well be that the concentration of RS01 used as an adjuvant may not be optimal to activate APCs in vivo, thus requiring further experiments with varying RS01 concentrations. Secondly, the RS01 peptide may need to be administered as an emulsion such that it remains localized when administered with an immunogen. In our experiments, both RS01 and RS09 were not formulated as an emulsion with the X-15-KLH immunogen but added in a PBS suspension. Nevertheless, our observation that RS09 increased antibody production in a vaccine setting suggests that this LPS peptide mimic can function as an adjuvant and thus serve as a novel candidate to be considered as a new class of TLR-4 agonist adjuvants.Lastly, in order to validate our claim that these LPS peptide mimics can act as adjuvants, RAW264.7 and HEK293 cells were purchased from ATCC  and were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) , penicillin 10,000 IU/ml, streptomycin 10,000 \u00b5g/ml , Plasmocin\u2122 antibiotic 2.5 mg/ml , and 2 mM L-glutamine (Mediatech). HEK-BLUE\u2122-4 cells were purchased from Invivogen and were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) , penicillin 10,000 IU/ml, streptomycin 10,000 \u00b5g/ml (Mediatech), Normocin\u2122 100 \u00b5g/ml (Invivogen), 1\u00d7 HEK-BLUE\u2122 selection antibiotics mixture (2 ml/500 ml complete media) (Invivogen), and 2 mM L-glutamine (Mediatech).Escherichia coli O111B4J5 cells. Although it is not known by the manufacturer as to which structural component of LPS is recognized by the antibody, it is specific to LPS and has been used in various publications 11) were added to the well and allowed to adhere at room temperature after which non-binding phages were washed away and bound phages eluted. Eluted phages were subsequently amplified and used for further panning so as to enrich for LPS antibody specific phages. The panning procedure described was repeated three times. Lastly, twelve random phage clones were selected from three rounds of panning and specificity to LPS antibody (black bars) was confirmed by ELISA using HSP70 antibody  (white bars) as a negative control. The species for both the anti-LPS and anti-HSP70 antibodies used were mouse. Bound phages were detected by using a HRP labeled anti-M13 phage antibody (Abcam) followed by adding the HRP substrate SIGMAFAST\u2122 OPD  and absorbance measured at 490 nm using a microplate reader . The panning, titer determination, and ELISA experiments were performed according to the manufacture's protocol. Once their reactivity was determined, the DNA encoding the peptide sequence from each positively reacting phage clone was purified using QIAprep Spin M13 Kit  and were sequenced by Genewiz  using the primers supplied in the kit (New England BioLabs). The LPS peptide mimics sequenced were synthesized by Genemed Synthesis and their purity was greater than 95% .Identification of the LPS peptide mimics was performed by using a 7-mer Phage display peptide library referred to as Ph.D.-7 . Panning was performed according to manufactures specifications using a LPS specific antibody as the target. The LPS antibody  used for the panning was a monoclonal antibody, which was produced by vaccinating mice with whole 4 cells, were added per well and incubated for approximately 20 h after which the supernatant from each well was collected and placed into a new 96-well plate. One hundred eighty micro liters of HEK-BLUE\u2122 detection media (Invivogen), alkaline phosphatase detection substrate, was added to each well and incubated for 1\u20133 h at 37\u00b0C. After a noticeable color change, the absorbance was taken at 630 nm using the microplate reader (Bio-Rad).The LPS peptide mimics synthesized were dissolved in endotoxin free water (HyClone) at a concentration of 1 \u00b5g/ul with the exception of peptide 4 which was dissolved in a solution of 1% DMSO made in endotoxin free water at a 1 \u00b5g/ul concentration. All of the peptide stock solutions and stored at \u221280\u00b0C until they were used. Each of the 12 peptides (RS01-RS12) was added to 96-well plates in triplicates in a total volume of 20 \u00b5l. The total volume required in each well was made up with endotoxin free water (HyClone). HEK-BLUE\u2122-4 cells , 5\u00d7106 cells) using NE-PER, nuclear and cytoplasmic extraction reagent kit . Manufacturer's protocol was followed to separate cytoplasmic and nuclear fractions. Nuclear and cytoplasmic lysates (10 \u00b5g protein) were subjected to 12% SDS\u2013PAGE under reducing conditions (presence of \u03b2-mercaptoethanol) as described earlier. Briefly, the proteins were transferred to Immobilon-P membranes  at 220 mA for 2 h and membranes were blocked with 4% dried milk in TBST  for at least 2\u20133 h on a shaker at room temperature. Subsequently, the membranes were incubated overnight at 4\u00b0C with either NF-\u03baB p65 , I\u03baB-\u03b1 , Actin , or HDAC1 (Santa Cruz Biotechnology) antibodies in TBST on a shaker. Membranes were then washed three times with TBST and then incubated with the respective secondary antibody for 2 hrs at room temperature on a shaker. After four washes with TBST and one wash with TBS, membranes were developed by ECL (Pierce) and detected on HyBlot CL\u2122 autoradiography film .Cytoplasmic and nuclear protein extracts were prepared from HEK-BLUE\u2122-4, HEK293, and RAW264.7 cells   overnight at 4\u00b0C followed by incubation for 45 min at room temperature with Alexa Fluor\u00ae 488 labeled goat anti-rabbit (1\u2236250) . The slides were then mounted with Vectashield\u00ae containing DAPI . Cells were visualized using the Axiovert 200 M microscope HEK-BLUE\u2122-4 and RAW264.7 cells were seeded in 8-chamber slides  at a density of 2\u00d7106 cells per well of a six well plate and allowed to adhere overnight at 37\u00b0C. Cells were then stimulated with LPS peptide mimics for 24 h at 37\u00b0C after which the cell culture supernatant was collected and assayed for various secreted inflammatory cytokines by using the mouse inflammation antibody array-1 kit . Briefly, the membranes provided were blocked with 1\u00d7 assay diluent followed by incubation with the cell culture supernatant overnight at 4\u00b0C. The blots were the incubated with biotin labeled anti-cytokines followed by incubation with avidn-HRP (1\u2236250). The blots were then developed using ECL (Pierce) and detected on HyBlot CL\u2122 autoradiography film (Denville Scientific). Detailed instructions for detection of inflammatory cytokines were provided by the manufacturer.RAW264.7 cells were seeded at a density of 1\u00d710in vivo when administered with an adjuvant Eight week old male BALB/c mice  were divided into 4 groups (3 mice per group). The antigen used in these studies is a 15-mer peptide, which has been observed in our lab to possess anti-prostate cancer activity in rats and produced a robust antibody response 2SO4 and the absorbency was taken at 490 nm and referenced at 405 nm.X-15 peptide specific antibody was determined by direct ELISA. X-15 peptide was re-suspended in a solution of 0.25% glutaraldehyde-PBS and 5 \u00b5g peptide/100 \u00b5l was added to each well of a 96well micro titer plate and incubated overnight at 4\u00b0C. The plates were washed with PBST  three times and then wells blocked with 5% milk-PBS for 2 h at room temperature. The plates were washed with PBST once. Then, 100 \u00b5l of mice sera was added at the given dilution (1\u2236200) and incubated at room temperature for 2 h. The plates were then washed with PBST four times and 100 \u00b5l of horse radish peroxidase (HRP) labeled anti-mouse IgG (1\u22365000 in 2% milk) was added to each well for 1 H at room temperature. The plates were washed five times with PBST and developed by adding 100 \u00b5l of the HRP substrate, OPD\u2013hydrogen peroxide (Sigma). The reaction was stopped by adding 50 \u00b5l of 4 N HEthics Statement: The animal protocol used by our laboratory in order to test the adjuvanticity of the LPS peptide mimics was approved by our academic institution's  Institutional Animal Care and Use Committee (IACUC), protocol approval number: 62-12-0610. The animals were allowed to acclimate one week prior to initiating the experiment and were at no time deprived of food or water. At the time of experimentation, the animals were anesthetized via 3% isoflurane inhalation and monitored daily to make sure they did not have any adverse side effects. When blood was required for analyses, the animals were once again anesthetized with 3% isoflurane and blood was collected via retro-orbital sinus bleed by the veterinary technicians from the Department of Comparative Medicine of New York Medical College. At all times during the experimental period, animals were not subjected to any stress."}
+{"text": "Ethanol abuse is linked to several acute and chronic injuries that can lead to healthproblems. Ethanol addiction is one of the most severe diseases linked to the abuse ofthis drug. Symptoms of ethanol addiction include compulsive substance intake andwithdrawal syndrome. Stress exposure has an important role in addictive behavior formany drugs of abuse (including ethanol), but the consequences of stress and ethanolin the organism when these factors are concomitant results in a complex interaction.We investigated the effects of concomitant, chronic administration of ethanol andstress exposure on the withdrawal and consumption of, as well as the preference for,ethanol in mice. Male Swiss mice  were exposed to an ethanolliquid diet as the only source of food for 15 days. In the final 5 days, they wereexposed to forced swimming stress. Twelve hours after removal of the ethanol liquiddiet, animals were evaluated for ethanol withdrawal by measuring anxiety-relatedbehaviors and locomotor activity. Twenty-four hours after evaluation of ethanolwithdrawal, they were evaluated for voluntary consumption of ethanol in a\u201cthree-bottle choice\u201d paradigm. Mice exposed to chronic consumption of ethanol haddecreased locomotor activity during withdrawal. Contrary to our expectations, aconcomitant forced swimming stress did not aggravate ethanol withdrawal.Nevertheless, simultaneous ethanol administration and stress exposure increasedvoluntary consumption of ethanol, mainly solutions containing high concentrations ofethanol. These results showed that stressful situations during ethanol intake mayaggravate specific addiction-related behaviors. Alcohol addiction can be conceptualized as a set of cognitive, behavioral andphysiologic symptoms that indicate a loss of control of substance use by individuals,along with continued use of the substance despite adverse consequences. Symptoms ofethanol addiction include compulsive substance intake and withdrawal syndrome  .Several animal models have been developed to study alcohol addiction. In general, theyinvolve forced exposure of animals to alcohol for prolonged periods. A useful model toinduce behavioral and neurologic changes related to addiction is forced consumption ofethanol as the only source of food in a liquid diet for several weeks. Rodents exposedto this regimen show behavioral and neural alterations related to ethanol use .Changes in patterns of ethanol consumption are also features of alcoholism. Animalstreated chronically with ethanol previously show increased consumption of ethanol in a\u201ctwo-bottle choice\u201d paradigm and in operant procedures 45.Individual risk factors for the development of abuse and addiction of alcohol areincompletely understood. Nevertheless, acute and chronic stress have an important rolein motivation for the abuse of addictive drugs . For exaIn general, chronic administration of ethanol or stress exposure enhances addiction-likebehaviors. However, if these two factors are present simultaneously, the interactionbecomes complex. Alcohol has anxiety-reducing properties and can relieve stress but actssimultaneously as a stressor and activates stress-response systems . AlcoholWe investigated the effects of concomitant, chronic administration of ethanol and stressexposure upon the withdrawal and consumption of, as well as the preferences for, ethanolin mice.The experimental protocol was approved by the Ethics Committee for Animal Utilizationof Universidade Federal de Uberl\u00e2ndia (CEUA 120/11). Experiments were conductedaccording to the principles of the Brazilian College of Animal Experimentation, whichare based on the Guidelines for the Care and Use of Laboratory Animals .ad libitum(except during theliquid-diet procedure). Experiments were carried out during the light phase of thecycle, and animals were tested randomly across this time period (8\u201310 mice pergroup).Male Swiss mice  were transferredto our animal facility \u22655 days before the start of experimentation and housed ingroups of 4-5 per cage. The room was maintained at 23\u00b12\u00b0C on a 12-h light-dark cyclewith access to water and food The procedure for chronic administration of ethanol was adapted from experiments withintake of a forced liquid diet undertaken by Bonassoli et al. . The liqad libitum.Bottles were weighed before and after exposure to mice to evaluate diet consumptionper animal group; any remaining food was removed after 24-h exposure. One bottle ofdrinking water was available simultaneously with the liquid diet. Mice were kept ingroups with no restricted volumes of the diet to reduce the stress related toisolation or food restriction.Animals allocated in plastic cages  had free access to bottles containing a solution composed ofSustagen M\u00af  at 28.5 g/100 mL and no chow. The liquid diet was the only source of food available to mice; it wasprepared fresh every day and presented to animals at the same time (12 pm). Thisliquid diet provided all necessary nutrients for rodents and was presented in alarger volume than normally eaten to ensure consumption Liquid diet was administered for 15 days. It was distributed in three cycles of 5days, with a 2-day interval without the diet between each diet cycle. This procedure mimics a kindling mechanism in alcoholwithdrawal in which repeated experiences of withdrawal intensify its symptoms . Groups Over 5 consecutive days, mice from the stress group were placed in a cylindrical 5-Lcontainer [22 (height)\u00d717 cm (diameter)] filled with 3.5 L of water, from which micecould not escape. On days 1, 3, and 5, mice remained in the water for a single trialof 15 min. On days 2 and 4, mice underwent three trials of 6 min with intervals of 5min. After each swimming session, mice were towel-dried and returned to their homecages. Stress procedures were undertaken at different schedules (9 am to 5 pm). Thecontrol group comprised mice not exposed to stress.Ethanol withdrawal was evaluated by behavioral analyses in the elevated plus maze(EPM) and open field (OF) for 12 h and 14 h, respectively, after final exposure tothe liquid diet. All behavioral tests were conducted between 9 am to 12 pm.The EPM comprises a plus-shaped wooden apparatus elevated 38.5 cm above floor levelwith two open arms [30 cm (length)\u00d75 cm (width)\u00d70.25 cm (height)] and two closed arms[30 cm (length)\u00d75 cm (width)\u00d715 cm (height)] connected by a common central platform[5 cm (length)\u00d75 cm (width)].Mice were placed in the central platform of the EPM facing an open arm and had theirbehavior video-recorded by a camera fixed to the roof for 5 min for analyses of the:number of entries (arm entry = 4 paws in the arm) in closed arms; percentage ofentries in open arms [\u00d7100]; percentage of time spent in open arms [\u00d7100)]; number of head dips (exploratory movement of the head over theside of the maze); stretched attend postures . Behavioralanalyses were carried out using the X-Plo-Rat 2005 software .The OF is a circular arena , 30 cm in diameter, surrounded bytransparent walls  with its circular floor divided by lines into fourcentral and eight peripheral quadrants of equivalent area.Mice were placed in the middle of the apparatus and the percentage of time spent inthe center \u00d7100), time spent in each central quadrant  and number of quadrants crossed was quantifiedover 5 min for assessment of peripheral, central and total locomotion using theOpenFLD software .Voluntary consumption of ethanol was evaluated using the \u201cthree-bottle choice\u201dparadigm 24 h after evaluation of ethanol withdrawal as described above.ad libitumduring this experiment. Bottles were presented to miceat the same time each day (12 pm).Every other day, for 9 days, mice housed individually in home cages [19 (width)\u00d730(length)\u00d713 cm (height)] were exposed to three bottles simultaneously: one containingfresh water, one containing ethanol 4% in fresh water (v/v) and another containingethanol 8% in fresh water (v/v). Every day the positions of the bottles wereinterchanged, with no preference given to the side of placement. Only fresh water wasavailable during the days that consumption was not measured. Food was availableviabottles placed in empty cages. Amount of liquid lost in theseempty cages was subtracted from the respective solution exposed to mice. Values ofethanol consumption are reported relative to the body weight of mice (g/kg), inpreference to ethanol [\u00d7100] and in preference to bottles containing 4% or 8% of ethanol [\u00d7100]. Amount of liquid lost by evaporation or leakage was measuredStatistical analyses were done using the Statistica software .Data are reported as means\u00b1SE of 8-10 animals per group. Results of EPM and OFexperiments were analyzed by two-way analysis of variance (ANOVA) considering thefactors \u201cchronic ethanol\u201d (ethanol\u00d7vehicle) and \u201cstress\u201d (stress\u00d7control). Voluntaryconsumption of ethanol and body weight were analyzed by three-way ANOVA consideringthe factors \u201cchronic ethanol\u201d, \u201cstress\u201d and \u201ctime\u201d. If ANOVA showed significantdifferences (P\u22640.05), a planned comparison test between the groups of interest wasundertaken.5,160=7.68, P\u22640.05).Body weight of mice in groups did not differ from each other throughout the experimentalprocedure . Two-wayNo significant differences were found for mouse behavior in EPM . All gro1,32=9.72,P\u22640.05) in peripheral locomotion but not for the stress factor or interaction, showing adecrease in peripheral locomotion in those groups  in total locomotion but not for the stress factoror interaction, showing a decrease in total locomotion in those groups . Mice from ethanol-treated groupsspent more time in the central part of the apparatus than vehicle-treated groups .In terms of OF behaviors , two-waye groups . Two-waye groups . The perd groups . No diffd groups . Animalsd groups , and two1,28=13.63, P\u22640.05) and the interaction between ethanol, stress and timefactors .On days 1 and 3, no significant differences were found between experimental groupsrelating to total consumption of ethanol (P>0.05). On day 5, the ethanol/controlgroup and ethanol/stress group consumed more ethanol compared with the vehicle/controlgroup and vehicle/stress group (P\u22640.05). On day 7, the ethanol/control group andethanol/stress group consumed more ethanol only when compared with the vehicle/stressgroup (P\u22640.05). On day 9, the ethanol/stress group consumed more ethanol when comparedwith all other groups (P\u22640.05).1,29=12.15, P\u22640.05) and theinteraction between ethanol, stress and time factors .The total ethanol preference was changed by treatment. Three-way ANOVA showedsignificant differences for the ethanol factor . On day 5, the total ethanolpreference of the ethanol/stress group was significantly greater than the ethanolpreference of the vehicle/control group and vehicle/stress group (P\u22640.05). On this day,the ethanol/control group had higher preference scores only when compared with thevehicle/control group (P\u22640.05). On day 7, the ethanol/stress group had greaterpreference for ethanol solutions when compared with all other groups (P\u22640.05). On day 9,the only difference found in total ethanol preference was between the ethanol/stressgroup and vehicle/stress group, in which the ethanol/stress group had a higherpreference for ethanol solutions.1,29=6.85, P\u22640.05) and interaction between ethanol, stress and timefactors . On day 1, the ethanol/control group consumedmore 4% ethanol solution only when compared with the ethanol/stress group (P\u22640.05). Onday 3, consumption of 4% ethanol solution of the ethanol/control group was greater thanall other groups (P\u22640.05). On day 5, the ethanol/control group consumed more 4% ethanolsolution compared with the vehicle/control group and vehicle/stress group (P\u22640.05). Ondays 7 and 9, the ethanol/stress group consumed more 4% ethanol solution when comparedwith the vehicle/stress group (P\u22640.05).The ethanol/control group showed increased consumption of 4% ethanol solution. Three-wayANOVA for consumption of 4% ethanol solution showed significant effects for the ethanolfactor . On day 1, the ethanol/control group hada higher preference for 4% ethanol solution when compared with the ethanol/stress group(P\u22640.05). On day 3, the ethanol/control group had the greatest scores for preference of4% ethanol solution (P\u22640.05). On day 5, the preference of the ethanol/control group for4% ethanol solution was higher only when compared with the vehicle/control group(P\u22640.05). On day 7, the ethanol/stress group had higher preference for 4% ethanolsolution than groups that did not receive ethanol  (P\u22640.05). No differences between groups were found for preferenceof 4% ethanol solution on day 9.Preference for 4% ethanol solution was altered in the ethanol/control group. Three-wayANOVA for preference for the 4% ethanol solution showed a significant effect of theethanol factor  and a trend ofsignificance for the interactions between stress and ethanol factors. On day 1, the ethanol/stress group consumedsignificantly more 8% ethanol solution than the vehicle/control group and vehicle/stressgroup (P\u22640.05). On day 3, the ethanol/stress group consumed more 8% ethanol solutiononly when compared with the vehicle/control group (P\u22640.05). On day 5, the ethanol/stressgroup showed increased consumption of 8% ethanol solution compared with all experimentalgroups (P\u22640.05). On days 7 and 9, the ethanol/stress group consumed more 8% ethanolsolution compared with the ethanol/control group and vehicle/stress group (P\u22640.05).Animals in the ethanol/stress group consumed more 8% ethanol solution than animals inall other groups. Three-way ANOVA for consumption of 8% ethanol solution showed asignificant effect of the ethanol factor  and a trend of significance for the stress factor. No changes were found in preference for 8% ethanolsolution on day 1. On day 3, the preference for 8% ethanol solution of theethanol/stress group was greater than the preference for 8% ethanol solution of thevehicle/control group and vehicle/stress group (P\u22640.05). On days 5 and 7, theethanol/stress group had higher preference for 8% ethanol solution than all other groups(P\u22640.05).Preference for the 8% ethanol solution was also greater in animals of the ethanol/stressgroup. Three-way ANOVA showed a significant effect of the ethanol factor. However, no differences werefound between groups during the experiment on voluntary consumption of ethanol (data notshown).Three-way ANOVA for fluid intake (water + ethanol 4% + ethanol 8%) showed a significanteffect of the time factor .Ethanol withdrawal in animal models can be assessed through several behavioral andphysiologic alterations after cessation of ethanol exposure. Protocols can varyaccording to the animal species, strains, time after cessation of ethanol consumption,and test apparatus employed . DespiteSigns of ethanol withdrawal syndrome start to appear when levels of alcohol in bloodapproach zero. The type, duration and severity of these signs are dependent on theamount of ethanol administered and duration of treatment. In general, anxiety related toethanol withdrawal appears 6-15 h after drug discontinuation . Our expIn the OF apparatus, ethanol-treated mice showed decreased locomotor activity. Indeed,alterations in locomotor activity in the OF are, in general, used to indicate ethanolwithdrawal. In rats, removal of ethanol could result in hyper-locomotion andhypo-locomotion whereas, in mice, hypo-locomotion is seen more commonly thanhyper-locomotion ,222324Time spent at the center of the OF was increased in ethanol-treated animals. Despite useof this behavior in the measurement of anxiety in animal models , in our Psychomotor stimulation induced by drugs of abuse reflects activation of thedopaminergic mesolimbic pathway induced by these substances. This property seen inanimal models is shared by all drugs known to cause addiction in humans . SimilarExposure to stressful situations results in changes in locomotor activity andanxiety-like behavior in mice and rats. For example, chronic restraint stress increaseslocomotor activity  and coulConcomitant exposure to stress and ethanol results in complex interactions. For example,stress and ethanol alone cause impairment of memory function in object recognition testsand the y-maze apparatus. Concomitant stress/ethanol exposure reverses these effects.Alcohol also blocks stress-induced increases in anxiety-like behaviors in the plus mazetest. However, alcohol cannot block weight loss and increases in plasmaticcorticosterone levels induced by stress . Inthe Data from experiments on voluntary consumption of ethanol showed that pre-exposure toethanol caused an increase in the consumption of, and preference for, ethanol. Thisincrease was observed only for 4% ethanol solution. Scholars have shown increasedconsumption of ethanol or self-administration of ethanol after forced and chronicpre-exposure to ethanol in rats and mice 353637A large body of work examining the impact of acute or sub-chronic stress on ethanolconsumption has been conducted on rodents. Several stress procedures have been employedand, despite a general observation that stress is associated with increased drinking ofalcohol, the literature reveals equivocal findings: increased, decreased, or no changein alcohol consumption . Humans Animal housing during testing of voluntary consumption of ethanol was probably not asignificant stressor that would increase ethanol intake in mice because the effect ofisolation stress in mice is significant only if isolation starts during early ages andnot during adulthood . NeverthThe increase in ethanol intake in mice co-exposed to stress and ethanol in our studydoes not seem to be related to an attempt to alleviate the symptoms of ethanolwithdrawal. First, the ethanol/stress group did not show higher levels of ethanolwithdrawal compared with the ethanol/control group. Second, increased consumption of,and preference for, ethanol was long-lasting (continuing to appear on the last day ofvoluntary consumption of ethanol), whereas withdrawal  was short-lived.Hence, concomitant exposure to ethanol and stress may result in long-lasting neurologicadaptations that aggravate ethanol addiction. The relationship between stress andethanol drinking is complex because of many ethanol-related factors , along with stress-related factors  that interact with several biologic variables  .In summary, chronic pre-exposure to ethanol led to a decrease in locomotor activityrelated to withdrawal of this substance, an increase in voluntary intake of ethanol, andpreference for low-concentration ethanol solutions. Concomitant stress did not aggravateethanol withdrawal, but potentiated the intake of and preference for ethanol, therebychanging patterns of voluntary consumption towards highly concentrated ethanolsolutions."}
+{"text": "Tests al., 2015). This tal., 2015). In thial., 2015). An intin vitro systems for hepatotoxicity, because they may improve the throughput and avoid difficulties due to interspecies extrapolation, because human cells can be used . Howeveeif, 2014; Ghallabeif, 2014, 2014; Cam; Camin val., 2015; Driesseal., 2015; Tolosa al., 2015; Grinberal., 2015). Other"}
+{"text": "The purpose of the present study was to examine the combined effects of aging and lifelong ethanol exposure on the levels of monoamine neurotransmitters in different regions of the brain. This work is part of a project addressing interactions of aging and lifelong ethanol consumption in alcohol-preferring AA (Alko Alcohol) line of rats, selected for high voluntary consumption of ethanol. Intake of ethanol on the level of 4.5\u20135 g/kg/day for about 20 months induced only limited changes in the neurotransmitter levels; the concentration of noradrenaline was significantly reduced in the frontal cortex. There was also a trend towards lower levels of dopamine and 5-hydroxytryptamine (5-HT) in the frontal cortex, and towards a lower noradrenaline level in the dorsal cortex. Aging was associated with a decreased concentration of dopamine in the dorsal cortex and with a declining trend in the striatum. The levels of 5-HT in the limbic forebrain were higher in the aged than in the young animals, and in the striatum, there was a trend towards higher levels in older animals. The data suggest that a continuous intake of moderate amounts of ethanol does not enhance the age-related alterations in brain monoamine neurotransmission, while the decline in the brain level of dopamine associated with aging may be a factor contributing to age-related neurological disorders. Both aging and chronic ethanol consumption are associated with several deficits in the brain. The impairments of cognitive and motor function have been linked with a number of deleterious morphological and functional changes involving different areas of the central nervous system (CNS). The contribution of aging and chronic ethanol consumption to the development of deficits may be separate or combined. The interactions of aging and chronic ethanol exposure have, however, been addressed in relatively few studies. 1 and D2 receptors in the nigrostriatal and mesocorticolimbic systems as well as in striatal dopamine transporter density have also been observed [Age-related deficits in motor and cognitive function have been attributed to impairment of monoaminergic neurotransmission ,2. Severobserved ,11,12. Tobserved .2 receptors [A receptor subunit expression in a selective manner [Previous studies on the interactions of aging and chronic ethanol exposure suggests that the age-related decline in monoaminergic functions is not drastically enhanced by ethanol. Administration of ethanol for six weeks was not found to accentuate the age-related loss of dopamine Deceptors . Human teceptors . A remareceptors ,15. Furte manner .The purpose of the present study was to examine further the combined effects of aging and lifelong exposure to ethanol on the levels of monoamine neurotransmitters in different regions of the brain. Since age-related changes in the metabolism and distribution of ethanol in the body can be a contributing factor to ethanol-induced damage, the levels of ethanol and acetaldehyde in the blood were also measured. This work is part of a project addressing the interactions of aging and lifelong ethanol consumption in the alcohol-preferring AA and the alcohol-avoiding ANA line of rats, selected for high and low ethanol consumption, respectively ,22,23,2467, and 5 male and 5 female rats from the generation F71 were used. The rats were housed in group cages  under standard conditions with a free access to standard rat food (RM1(E)SQC, SDS, Witham, UK). The experimental procedures were approved by the Institutional Animal Care and Use Committee at Alko Group Ltd. . The animal model used and the protocol for ethanol administration have been described in detail in previous studies ,23,24. In = 19) and the old control group (n = 12). Voluntary ethanol consumption of the animals was measured at the age of 3 months, and again at the age of 24 months, by offering a free choice between water and 10% (v/v) ethanol in individual cages for 3 weeks [71 (n = 10). They had free access to food and water throughout the experiment. The AA rats from generation F67 were randomly assigned to the old ethanol group  in both the ethanol group and the control group at the age of 12 months. Blood samples of 50 \u00b5L were taken from the tip of the tail immediately before (0 min) as well as 60 and 120 min after administration of ethanol. The blood hemolysates were stored at \u221220 \u00b0C until analysis with headspace gas chromatography ,26. The At the age of 24 months, after a one-week ethanol-free washout period, the rats were decapitated under deep sodium pentobarbital anaesthesia. The brains were immediately removed from the skull and dissected on ice into the dorsal part of the cerebral cortex, the frontal cortex, the striatum, the limbic forebrain , the hippocampus, the hypothalamus, and the cerebellum. The tissue samples were frozen on dry ice and stored at \u221275 \u00b0C. The concentration of noradrenaline, dopamine, and 5-HT were measured by high performance liquid chromatography (HPLC), as described in detail previously .vs. old control, old control vs. ethanol). Student\u2019s t-test was used to compare body weights and ethanol consumption between the old control and the ethanol-exposed group, while the concentrations of acetaldehyde and ethanol and the metabolism of these were tested with the Mann-Whitney U test.The normally distributed data on body weights and ethanol consumption are expressed as mean \u00b1 SEM. The monoamine, ethanol and acetaldehyde concentrations are given as median . The overall differences in brain monoamine concentrations were analyzed by using the non-parametric Kruskal-Wallis test, followed by the Conover-Inman test  and 23 months .Voluntary consumption of ethanol at the age of 3 or 24 months did not differ significantly between the control group and the ethanol group . There wi.e., before the administration of ethanol, because the rats in the ethanol group had consumed ethanol during the night before, and all ethanol and acetaldehyde had not been metabolized (The blood concentrations of ethanol and acetaldehyde were significantly higher in the ethanol-exposed group than in the controls at time point 0 min, abolized . The ratThe concentrations of monoamine transmitters in different areas of the brain are presented in ca. 4.5\u20135 g of ethanol/kg/day for 20 months, and the rate of ethanol and subsequent acetaldehyde elimination were significantly increased in the ethanol consuming animals, probably as a result of chronic exposure to ethanol. The AA rats acquire a high level of voluntary ethanol intake in about three weeks, when given a free access to ethanol solution with water and food freely available [A receptor subunits [The present study addressed the interaction of aging and lifelong ethanol consumption on the CNS concentrations of monoamine neurotransmitters in the alcohol-preferring AA rats. The underlying idea was to test, whether chronic ethanol consumption enhances the age-related changes in the CNS, as has been hypothesized ,30. The vailable . In earlsubunits ,20,21,222 receptors in rats, and that the age-related decline in the density of dopamine transporter in human type 2 alcoholics was similar to the controls [Earlier studies on monoamine neurotransmitters have revealed higher brain levels of dopamine and noradrenaline in the AA rats than in the alcohol-avoiding ANA rats . The dopcontrols ,12. ThesThe level of ethanol consumption reached in the present study was estimated to result in peak nocturnal blood ethanol levels of about 10\u201320 mM, which can be considered intoxicating ,32. The 1 and D2 receptors [Aging was associated with a decreased concentration of dopamine in the dorsal cortex and with a declining trend in the striatum. The results are in line with earlier reports showing reduced concentrations of dopamine in the brain of aged rats, especially in the dopamine rich areas ,4,5,7. Teceptors ,11. Theseceptors . In the old control group, the concentration of 5-HT in the limbic forebrain was higher than in the young animals, and in the striatum there was a trend towards higher levels in the old controls. The data on 5-HT reported in the literature are, however, somewhat conflicting. In a study by Woods and Druse , an age-There were no significant alterations with aging in the brain levels of noradrenaline. These data are consistent with the study by M\u00edguez and others , where tThe present study addressed the combined effects of aging and chronic ethanol consumption on brain monoamine neurotransmitters using the alcohol-preferring AA line of rats as a model. The results showed that lifelong, continuous consumption of mildly intoxicating amounts of ethanol induced only modest and regionally selective changes in the monoamine neurotransmitter levels. These results along with previous data suggest that chronic intake of moderate amounts of ethanol does not potentiate the age-related alterations in neuronal structure and functions, but ethanol-induced neuronal changes are essentially different from those associated with aging. Age-related decline in the brain dopamine concentration supported the idea of dopaminergic neuronal functions contributing to age-related neurological dysfunction, e.g., impaired control of movement and posture."}
+{"text": "Background: Some drugs of abuse down regulate the expression of cystine/glutamate (xCT) antiporter in the nucleus accumbens (Acb) after extinction or withdrawal. The altered level of xCT exchanger in Acb, a structure involved in ethanol reinforcement, may contribute to the pathological glutamatergic signaling, linked to addiction. We hypothesized that the expression of xCT may be changed in Acb and whole brain also in non-dependent , ethanol-dependent rats, as well as, during ethanol withdrawal.Methods: Wistar rats were made ethanol-dependent by chronic exposure to an alcoholic milk beverage (from 2.4 to 7.2% v/v ethanol). Ethanol non-dependent rats were exposed to a similar, but non-alcoholic liquid diet and self-administered ethanol (10%) twice a week. Withdrawal in ethanol-dependent rats was studied at 12 h after the last ethanol-enriched diet exposure. Immediately after the measurement of somatic signs of withdrawal, Western blot analysis with a polyclonal antibody against xCT was carried out in a na\u00efve control group, non-dependent and ethanol-dependent rats as well as withdrawal rats, in order to study the level of xCT expression in Acb and whole brain.Results: Non-dependent rats self-administered an average dose of 1.21 \u00b1 0.02 g/kg per session (30 min). Daily ethanol consumption during chronic exposure to the alcoholic beverage ranged from 6.30 \u00b1 0.16 to 13.99 \u00b1 0.66 g/kg. Ethanol dependent rats after suspension of the ethanol-enriched diet have shown significant somatic signs of withdrawal. Western blotting analysis of Acb lysates revealed that xCT was over expressed in ethanol-dependent rats whereas in whole brain preparations xCT was over expressed in both non-dependent and ethanol-dependent rats compared to control group. On the contrary, xCT expression during withdrawal was down regulated in Acb and restored to control level in whole brain preparations.Conclusions: The changes of xCT expression in both Acb and whole brain following ethanol dependence and withdrawal indicate that xCT might represent a novel therapeutic target for the treatment of ethanol addiction. The development of ethanol dependence is posited to involve numerous changes in brain neurotransmission that lead to characteristic physiological signs upon abstinence from ethanol.Increased glutamatergic neurotransmission appears to mediate the reinforcing properties of ethanol and changes are considered responsible of affecting many aspects of neuroplasticity associated with ethanol dependence  among which the Slc7a11 gene, has been shown to be expressed at higher levels (1.54-fold), whereas other authors have shown that ethanol, dose-dependently, increases the xCT exchanger expression in mouse hepatic stellate cells  and to the Ministry of Health , and in strict accordance with the European Council directives on the matter [n. 2007/526/CE]. All possible efforts were made to minimize animal pain and discomfort and to reduce the number of experimental subjects.Ethanol solutions (v/v) obtained by dilution of ethanol  , weighing 175\u2013225 g at the beginning of the experiment, were housed in pairs in Plexiglas cages. The colony room was maintained under controlled environmental conditions  under a 12-h light/dark cycle .Male Wistar rats (Four groups of rats were utilized for this study:n = 8). These rats were fed the non-alcoholic liquid diet.Ethanol non-dependent rats allowed to self-administer ethanol twice a week . These rats were fed the alcoholic liquid diet.Ethanol dependent rats (n = 17) after suspension of the ethanol-enriched diet.Ethanol dependent withdrawn: rats (n = 6).Control rats that was used only for xCT measurements, fed the non-alcoholic liquid diet  with (dependent) or without ethanol (non-dependent). Non-dependent rats  drank for 30 min (twice a week) the \u201cdesired\u201d amount of ethanol. Instead, the dependence was induced by \u201cforced\u201d ethanol liquid diet  or without (control and ethanol non-dependent) ethanol fresh whole cow milk, 910\u2013970 ml /l;ethanol 25\u201375 ml/l;vitamin A 5000 IU/lsucrose 17 g/l.This mixture (with or without ethanol), freshly prepared daily, according to the method of Uzbay and Kayaalp , supplieTraining was conducted in modular operant chambers, located in ventilated soundproof environmental cubicles (Med Associates Inc. USA). Each chamber was equipped with a non-retractable drinking cup (capacity 0.50 ml) and two nose-poke holes located 3 cm to the left and right of the cup. A white light placed above the active hole and an orange light placed above the inactive hole were used as environmental stimuli. Only the active nose-poke hole set off the dipper-delivering solution (0.1 ml) into the drinking cup in 3.05-second period. Explorations at both the active and inactive nose-poke holes were recorded. In particular, recording at the inactive hole served to control for specificity of the response in the operant chamber. The availability of liquid was signaled by a house light placed on the wall in front of the drinking cup that would light up for the duration of liquid delivery. Following each delivery, there was a 2-second time-out period during which responses had no consequences and the white light placed above the active hole went off. An infrared head detector was located in the reservoir and recorded all signals during the entire session. The chambers were interfaced to a computer equipped with software that ran the programmed sessions and recorded the data. For operant ethanol (5\u201310% v/v) self-administration, rats were trained to nose-poke under a fixed-ratio 1 (FR1) schedule of reinforcement, in which each response resulted in 0.1 ml of solution delivery. From day 1 to day 6, rats were permitted to nose-poke explore for 5% ethanol solution. Starting on day 7, the ethanol percentage was gradually increased, with daily increases of 1% up to the final concentration of 10%. Following the acquisition, after a stable baseline of responding was reached, operant self-administration of ethanol was then increased to a FR2 schedule until the self-administration behavior was stable and subsequently, the schedule requirement was increased to a FR3 , 4.8% (4 days) and 7.2% (14 days) ethanol. This diet composition and regimen has been reported to result in a significant correlation between ethanol-containing liquid diet consumption and blood ethanol level after 21 days of treatment, as reported by Kayir and Uzbay . Rat's bWithdrawal in ethanol-dependent rats was studied at 12 h after the last ethanol-enriched diet exposure. Withdrawal behavioral signs were determined exactly at 12 h after ethanol suspension. Each subject was placed under white light conditions in Plexiglas observation chambers (25 \u00d7 20 \u00d7 25 cm) and observed for 5 min by an observer blind to the subject's treatments. The following somatic signs of withdrawal were recorded: body tremors (BT), tail rigidity (TR), vocalization (VOC) and ventro-medial limb retraction (VmLR). We used a rating scale adapted from Macey et al.  as folloTo measure anxiety-like responses upon ethanol withdrawal, the elevated plus maze (EPM) test was used. The test was performed immediately, after 12 h after ethanol suspension. The apparatus consisted of 2 gray Plexiglas open arms and 2 black enclosed arms , with similarly shaped arms opposite to each other. The 5-min test procedure began when the animal was placed in the center of the maze, facing an open arm. The time (min) spent in open arms and the number of open arm entries were scored and used as measure of anxiety-like behavior  and whole brain sections  were suspended in saline and subsequently homogenized as described below.Immediately after the behavioral observations, rats were intra-peritoneally injected with 1.3 g/kg of ethylic urethane . Under deep anesthesia, rats were sacrificed and brains removed and immediately frozen at \u221280\u00b0C (4 h) before being sectioned. Brains were rapidly dissected into coronal sections on an ice-cooled metal plate using a scalpel. The brain regions were identified according to the rat brain atlas . Homogenization was carried out with a Dounce homogenizer using 20 strokes of the loosely fitting pestle. The lysates were sonicated with an ultrasonic homogenizer  for 20 s on ice at 20% amplitude, and centrifuged at 12,000 \u00d7 g for 15 min at 4\u00b0C. The protein content of supernatants was measured according to Bradford , 1 mM \u03b2-glycerophosphate, 2.5 mM sodium pyrophosphate, 1 mM NaBradford , using bhttp://imagej.nih.gov/ij/).Aliquots of protein lysates (80 \u03bcg) were separated on 12% SDS gel Laemmli,  and tranU-test. Numbers of open arm entries were analyzed by two-way ANOVA. Time spent in open arms were analyzed by one-way ANOVA. In the presence of overall significant main effects and interactions , the Least Significant Differences (LSD) post-hoc test was performed.All values are expressed as mean (\u00b1 s.e.m.). Ethanol intake values (in dependent rats) were analyzed by one-way ANOVA. Rat body weights were analyzed by two-way ANOVA (repeated measure). The 4 different withdrawal signs  were assessed by individual comparison among individual means using the non-parametric Mann-Whitney t test, assuming a p < 0.05 as statistically significant. A power analysis for t-test with the free software G*Power 3.1 (http://www.gpower.hhu.de/) was also carried out. The results of this analysis gave a power (1-\u03b2 err prob = 0.95) with a sample size of 3 and an \u03b1 level of 0.05. Being the power higher than 0.80  of 3 different experiments \u00b1 s.e.m. and analyzed by unpaired Student's Non-dependent rats, allowed to self-administer ethanol (10%) twice a week, self-administered an average dose of 1.21 \u00b1 0.02 g/kg per session (30 min).F = 127.18, p < 0.0001].Daily ethanol consumption during chronic exposure to the alcoholic beverage (from 2.4 to 7.2% v/v ethanol) ranged from 6.30 \u00b1 0.16 to 13.99 \u00b1 0.66 g/kg. One-way ANOVA revealed a significant increase in ethanol consumption along the exposure time , time  and a significant group x time interaction  revealed that the alcoholic beverage was responsible of a significant loss of body weight in ethanol-dependent rats.Average body weights in ethanol-dependent rats showed a progressive decrease from the beginning to the end of the study compared with ethanol non-dependent groups. However, significant main effects of group , of open-closed/session entries  but not a significant treatment x open-closed/session entries interaction  indicating a significant difference for entries into open arms between withdrawal vs. ethanol non-dependent group (p < 0.0001) and ethanol dependent group and a significant difference for entries into total arms between withdrawal vs. ethanol non-dependent group (p < 0.0001). In addition, there was a non-significant difference between withdrawal and ethanol-dependent group both into open arms and into total arms entries  = 11.86, p = 0.00014] indicated a significant difference for time spent into open arms between ethanol non-dependent vs. ethanol-dependent (p = 0.0015) and between ethanol non-dependent vs. withdrawal groups (p < 0.0001)  Figure .p < 0.05) and non-dependent rats (p < 0.05). Following 12 h withdrawal in dependent rats, the level of xCT expression with respect to control (p < 0.05), non-dependent (p < 0.05) and ethanol-dependent (p < 0.05) samples, was significantly down regulated. The results of 3 experiments, expressed as A.U., are shown in Figure The expression of xCT in Acb and whole brain homogenates was investigated by Western blot analysis. The antibody recognizes a band of about 40 kDa, which corresponds to the more active xCT isoform . The level of protein was even more increased in brain of rats dependent from ethanol, and this increase was significantly different from control group (p < 0.05) and ethanol non-dependent (p < 0.05). Following withdrawal, the level of xCT expression was restored to the level of control group . On the other hand, the xCT expression was strongly decreased in Acb homogenates of ethanol-dependent animals after 12 h withdrawal. These changes in xCT expression could be responsible for alterations in glutamate levels in the Acb that may occur in response to chronic ethanol exposure and that may contribute to the pathological glutamate signaling linked to withdrawal-induced behavior. The profound down-regulation in the expression of xCT in the Acb, following 12 h of withdrawal in dependents rats could be also linked to the recidivism for ethanol abuse after a period of abstinence  have higher levels of xCT expression than control group, and a further significant increase of xCT in ethanol-dependent rats, in which xCT expression was reduced to control values after 12 h withdrawal. These data suggest that an intermittent , or a long-term ethanol exposure (in the liquid diet), cause an increase of the xCT in the whole brain. Interestingly, these results are in agreement with data obtained from Lin et al. , who repThe activity of xCT contributes to the maintenance of a cellular redox balance, sufficient to protect cells from oxidative damage  could be useful for the management of ethanol withdrawal symptoms. xCT is also over-expressed in the whole brain homogenates from both non-dependent and ethanol dependent rats and restored to control level following ethanol withdrawal, probably as a consequence of the brain oxidative stress induced by ethanol exposure and by ethanol deprivation in withdrawal, respectively. Overall, these findings indicate that xCT expression is altered in both the Acb and the whole brain. xCT might therefore represent a novel therapeutic target for the treatment of ethanol abuse.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Recently, Bin Zhao and colleagues from the Chinese Academy of Science in Beijing and University of California, Sacramento, have published a review about identification of cardiotoxic compounds by rapid screening methods  derived cardiomyocytes have been introduced and several gene and microRNA cardiotoxicity markers have been identified . Meanwhal., 2015). Currenal., 2015, 20139]in vitro al., 2015; Grinberal., 2015), kidneyal., 2015; Bulacioal., 2015) and neual., 2015; Shinde al., 2015), which al., 2015; Vartak al., 2015; Ghallabal., 2015; Schliesal., 2015; Hoehme"}
+{"text": "Aim. To study the differences between acute presentation-autoimmune hepatitis (A-AIH) and chronic autoimmune hepatitis (C-AIH). Methods. Through long-term follow-up, 80 patients were included in our study by using the revised international autoimmune hepatitis group (IAIHG) score and were divided into acute and chronic groups for comparison. Results. No significant difference was found in the gender, age, IAIHG score (pretreatment/posttreatment), definite diagnosis rate, extrahepatic autoimmune disease, onset time, or treatment before biopsy between the acute and chronic groups. In terms of clinical symptoms, A-AIH patients were more prone to jaundice, anorexia, yellow urine, and detesting oil than C-AIH patients, but melena only occurred in chronic group (P < 0.05). The acute group exhibited more severe injury upon histological evaluation, with lobular inflammation and bile duct injury, especially central necrosis of the lobule, more pronounced in this group (P < 0.05). Conclusion. A-AIH had manifestations of acute hepatitis and presented cholestasis. Serum indicators could preliminarily distinguish A-AIH and C-AIH. Histologically, the primary manifestation of A-AIH was lobular inflammation, which was usually accompanied by lobular central necrosis. For the diagnosis of A-AIH, more attention should be paid to long-term follow-up. This study was registered at ClinicalTrials.gov (identifier: NCT02994537). Typical autoimmune hepatitis (AIH) is a chronic and nonspecific inflammatory disease that is primarily characterized by the presence of autoantibodies, elevated alanine aminotransferase (ALT), aspartate transaminase (AST), and immunoglobulin G (IgG) levels, interface inflammation, lymphoplasmacytic infiltration, and hepatocyte rosetting \u20133. The cThis study enrolled patients who visited the West China Hospital of Sichuan University from October 2013 to November 2016 with suspected AIH. Through long-term follow-up [the median follow-up time for all patients was 14  months], we ultimately included 80 patients with a probable and definitive diagnosis of AIH based on the 1999 revised IAIHG score (a score \u226510 indicates probable AIH before treatment and a score \u226516 indicates definite AIH before treatment) , 16. Of Fasting blood samples were collected from the patients, and routine blood, biochemical, and coagulation function examinations were implemented within 3 days before or after the liver biopsy (or implemented at the time of admission). Other blood test results acquired within 1 month before or after the biopsy were considered acceptable . The labLiver samples were acquired by ultrasound-guided percutaneous needle biopsy of the liver. The tissues were fixed in 10% formaldehyde , embedded in paraffin, and used for haematoxylin and eosin (H&E) staining, immunohistochemical staining for CK7  and CD138 , and Masson trichrome staining to examine the histological characteristics. Finally, two pathologists (CL and JL) from the Pathology Department of West China Hospital (certified by CAP) interpreted the samples. The Scheuer score system was used to classify the inflammation grade G0\u20134) and fibrosis stage (S0\u20134) of the liver tissues . The pat and fibrt-test, the Mann\u2013Whitney U test, and the Chi-square test (P < 0.05 was considered significant). Receiver operating characteristic (ROC) curves were used to acquire the cut-off values of valuable parameters. All statistical tests were performed using SPSS version 18.0 .Continuous variables that conformed to the normal distribution were expressed by mean \u00b1 SD, while continuous variables which did not conform to the normal distribution were expressed using the median and interquartile range. Categorical variables were expressed as numbers (percentages)  between the patients with acute-presentation and chronic AIH. The onset time of the A-AIH patients was 6.5  months, whereas the onset time of the C-AIH patients was 16  months (P = 0.054) , but melena only occurred in chronic group (P = 0.038). Other less common symptoms include itching, diarrhea, vomiting, heart fatigue, and shortness of breath.Eighty patients were included, of which 32 40%) patients had A-AIH and 48 (60%) patients had C-AIH. Thirteen 16.25%) were males, and 67 (83.75%) were females, with a male-to-female ratio of 1\u2009:\u20095.2. No significant difference was found in the gender, age, IAIHG score (pretreatment/posttreatment), definite diagnosis rate, extrahepatic autoimmune disease status, or the composition of treatment and the time of treatment before biopsy . Liver enzymes: ALT and AST were higher in the acute group , and ALP and GGT were higher than in the chronic group . ALB was higher in the chronic group (P < 0.001), whereas GLB was higher in the acute group (P = 0.001). Moreover, the cut-off value of ALB deduced by ROC curve was 36.9\u2009g/L (see P < 0.001) and the INR was greater (P < 0.001) in the acute group. IgG was higher in the acute group (P < 0.001). In the acute group, 28 (87.5%) patients had an ANA titre greater than or equal to 1\u2009:\u2009100   see .P < 0.001), lobulitis (P = 0.001), interface inflammation (P = 0.001), rosettes (P < 0.001), periportal lymphocytes (P < 0.001), plasma cells (P < 0.001), neutrophils (P = 0.001), monocytes (P < 0.001), eosinophils (P = 0.002), bile duct injury (P < 0.001), centrilobular necrosis (P = 0.005), lobular neutrophils (P < 0.001), monocytes (P < 0.001), eosinophils (P = 0.002), and eosinophilic bodies (P = 0.05) were all significantly different between the acute and chronic groups , and centrilobular necrosis  between the acute-onset and acute-on-chronic groups were statistically different.A-AIH was primarily performed as acute hepatitis in histology. No significant difference in the fibrosis stage (S) was found between the acute and chronic groups. Conversely, the inflammation grade (G) . However, the median onset time was significantly lower in the acute group than in the chronic group , possibly because the acute group included patients with acute-onset AIH and acute exacerbation of C-AIH. The results might have been different if we enlarged the sample and divided the A-AIH patients into acute-onset AIH and acute exacerbation of C-AIH groups for separate analyses.Previous reports differ in their descriptions of the onset age of A-AIH , 19, 20.P = 0.015) had an INR > 1.5. Additionally, ALB was lower in the acute group in our study, which also indicated worse A-AIH conditions. Severe AIH patients exhibit severe destruction of the liver tissue, which directly hampers the production of ALB in the liver and explains the difference in ALB between the two groups. Kessler et al. suggested that ALB might play a role in the acute phase response; thus, hypoproteinaemia was a suitable indicator of A-AIH [P = 0.012] and IgG  levels than patients with S \u2265 3. As a result of inflammation, AIH can cause the destruction and proliferation of bile ducts. Duct involvement was more clearly observed in A-AIH than in C-AIH [P < 0.001 and P = 0.003, resp.). The severe lobulitis in A-AIH may have made the bile duct injury more apparent. This result is consistent with the above studies and indirectly confirms Czaja and Carpenter's opinion that destruction and deficiency of bile ducts cannot rule out the diagnosis of AIH [P = 0.042). This result may be due to the reason that patients with acute exacerbation of C-AIH were included in the acute group. Both the acute and chronic groups in our study included AMA (+) patients . The liver functions of all of the patients were improved even when they only used the standard immunosuppressive treatment without ursodeoxycholic acid (UDCA), and their ALP and GGT levels were decreased or even returned to normal levels. Therefore, abnormal values of the above blood indicators are still likely to be due to the bile duct injury caused by inflammation in A-AIH. Leung et al. found that the AMA appearance may be caused by the oxidative stress induced by liver injury [In this study, we only used serum indicators to judge A-AIH without distinguishing acute and chronic histological characteristics; therefore, a portion of the A-AIH patients corresponded to acute exacerbation of C-AIH. However, Abe et al. divided acute and chronic AIH patients using histological characteristics and found that the A-AIH patients also met our blood conditions for A-AIH . This fiof A-AIH . In our of A-AIH , 13, 19.of A-AIH . Miyake of A-AIH . This fiof A-AIH . Therefoof A-AIH . Thus, w.6 16.5, .6\u2009g/L ans of AIH , whereasP = 0.005). Eleven (78.6%) of the 14 patients had S < 3. Sequential liver biopsies may reveal that A-AIH with centrilobular necrosis gradually appears as a typical AIH with manifestation, thereby assisting with the diagnosis [P = 0.099), with 50% and 31.25% of patients in the acute and chronic groups, respectively, corresponding to S \u2265 3 (P = 0.098). Because AIH can suddenly be exacerbated after insidious onset, determining whether acute AIH itself can appear as obvious fibrosis is difficult.A number of studies have reported that A-AIH exhibits more severe histological characteristics than C-AIH , 12, andiagnosis . Therefoiagnosis ; thus, aiagnosis , 27. Amoiagnosis . In our This study has several limitations. For example, the sample size of the A-AIH group was not sufficiently large. Additionally, the results of A-AIH were affected by the C-AIH. In clinical work, we have found that AIH concurrent with viral hepatitis and drug-induced AIH are not uncommon. Therefore, in this study, we also examined viral hepatitis markers in the patients and tracked their medication histories. Through long-term follow-up, we ruled out the possibility of drug-induced liver injury. Finally, patients whose IAIHG scores conformed to the possible diagnosis of AIH were included in this study, but for some patients we could not exclude an effect caused by viral hepatitis.In conclusion, A-AIH is not uncommon and may not have features of typical AIH, and it is characterized by significantly elevated bilirubin and transaminase. Therefore, serum indicators can preliminarily distinguish A-AIH and C-AIH. Histologically, A-AIH is mainly manifested as acute lobular inflammation with clear centrilobular necrosis, and bile duct injury is not uncommon. Moreover, A-AIH may be difficult to diagnose based only on the IAIHG score. More attention should be paid to long-term follow-up, and new diagnostic criteria for A-AIH should be developed."}
+{"text": "Adolescents primarily consume alcohol in binges, which can be particularly harmful to the developing frontal cortex and increase risk for an adult alcohol use disorder. We conducted a study investigating immediate and long lasting changes to the prefrontal cortex (PFC) transcriptome to determine the molecular mechanisms underlying adult ethanol behavioral sensitivity following binge ethanol in adolescence. DBA/2J mice were orally dosed with 4 g/kg ethanol intermittently from day 29 to 42. Adolescent mice were tested for anxiety-like behavior and ethanol sensitivity using the loss of righting reflex task. As adults, mice were tested for cognitive changes using the novel object recognition task, ethanol-induced anxiolysis and ethanol sensitivity. Adolescent binge ethanol altered ethanol sensitivity in young mice and led to lasting memory deficits in the object recognition test and greater ethanol sensitivity in adulthood. Using genomic profiling of transcripts in the PFC, we found that binge ethanol reduced myelin-related gene expression and altered chromatin modifying genes involved in histone demethylation at H3K9 and H3K36. We hypothesize that ethanol\u2019s actions on histone methylation may be a switch for future transcriptional changes that underlie the behavioral changes lasting into adulthood. Alcohol is the most commonly abused intoxicant among adolescents with 8.7 million underage youth reporting consumption in the past month . RemarkaConsuming alcohol in adolescence can be particularly harmful, as it may delay or disrupt critical ongoing neurodevelopment with profound consequences in adult brain structure, connection and function. In particular, prefrontal cortex (PFC) is a brain region undergoing dramatic changes in structure and synaptic connectivity during adolescence  and showEthanol exposure, either during adolescence or adulthood, is often associated with reduced white matter in the frontal cortex, cortical atrophy and cognitive impairments. White matter degradation  and disrEthanol exposure also results in changes in the regulation of gene transcription through epigenetic modifications to chromatin and histones. Epigenetic modifications to histones positively and negatively regulate gene expression and may be one mechanism underlying the long lasting cognitive deficits and behavioral sensitivity to ethanol. Indeed, adolescent intermittent ethanol exposure leads to global alterations in histone methylation , histoneThe molecular mechanisms underlying ethanol-induced persistent changes in PFC development are currently unknown. We hypothesize that adolescent ethanol causes persistent alterations in PFC gene expression networks, contributing to behavioral alterations during adolescence and adulthood. Here, we use an adolescent binge ethanol exposure model in DBA/2J mice to assess behavioral responses in both adolescence and adulthood. We investigated the molecular basis for these identified changes by performing genome-wide expression profiling of PFC during both adolescence and adulthood, and epigenetic studies on global histone methylation. Our studies identified strikingly different immediate and long-lasting transcriptional responses to adolescent ethanol exposure and implicate alterations in histone methylation in the long-lasting behavioral responses to adolescent ethanol.ad libitum for the entire experiment. After a week acclimation to the animal facility, mice were habituated to the gavage procedure with 0.1% saccharin on PND 27 and 28 and then divided into two treatment groups: ethanol treated and control. In experiment 1, DBA/2J males (n = 45) and females (n = 32) were orally dosed with 4 g/kg ethanol (25% w/v in water by gavage) or water intermittently (2 days on/2 days off) on PND 29, 30, 33, 34, 37, 38, 41, and 42. At this dose, blood ethanol concentrations reached 313 mg/dL 1 h after gavage . These levels are similar to previously published levels in C57BL/6 mice used to model adolescent binge ethanol and display deficits in myelin . DBA/2J mice were used since they are known to have robust behavioral responses to acute ethanol  and haven myelin . Mice wen = 24/sex) were treated intermittently with ethanol exactly as in experiment 1, but were not behaviorally tested. Tissue was collected for gene expression studies at PND 43 (n = 22) and PND 66 (n = 19). Across both experiments, 14 mice were lost due to issues surrounding gavage (five controls and nine ethanol-treated mice). All surviving animals appeared normal on the basis of grooming behavior, appearance and feeding. Given that it was not an aim of the present study to examine hormonal regulation of the long-term effects of binge ethanol during adolescence, estrous cycles were not controlled or monitored in female mice. All animal housing and care was conducted with the approval of the Virginia Commonwealth University IACUC Committee and in accordance with the NIH Guide for the Care and Use of Laboratory Animals  box conflict model for anxiety-like behavior was conducted using a standard commercial  apparatus from Med Associates  with an open field (27.3 cm \u00d7 27.3 cm \u00d7 20.3 cm) divided into equally sized light or dark compartments by a black plastic partition with an opening in the middle to allow for light\u2013dark transitions. Animal position and locomotor activity was monitored by infrared photobeam breaks. Following a 1-h acclimation period to the behavioral room, mice were placed in the center of the light chamber facing the entrance to the dark chamber. Studies consisted of a 5-min test session, initiated once the animal entered the dark compartment. Anxiety-like measures were reported as percent time spent in the light and percent distance traveled in light to control for locomotor activity. An increase in either measure was interpreted as decreased anxiety-like behavior.In separate groups of animals exposed to ethanol or water gavage as adolescents, mice were tested at PND 66 for acute ethanol-induced anxiolysis in the light\u2013dark model. After 1-h habituation to the behavioral room, mice were injected with 2 g/kg ethanol  or an equivalent volume of 0.9% saline. Mice were placed back into their home cage for 5 min to avoid the ethanol locomotor activation phase routinely observed in DBA/2J mice. LD box anxiety-like measures and total locomotor distance were then measured for 5-min as above.After 1-h habituation to the test room, mice were dosed with a sedating/hypnotic ethanol dose  and returned to home cages until they exhibited loss of righting reflex (LORR), defined by the inability to right themselves three times in 30 s after being in the supine position in a V-shaped trough. LORR was calculated by subtracting time of onset of LORR from recovery time .We used the novel object recognition task to measure PFC-mediated recognition memory . Novel oTotal RNA from PFC of experiment 2 was isolated using STAT 60 Reagent  and RNeasy mini kit  according to the manufacturer\u2019s protocol. RNA concentration was determined by absorbance at 260 nm and RNA quality was assessed by Experion automated electrophoresis  and 28S:18S ratios. All RNA RQI values were >9.0, and 260/280 ratios were between 1.9 and 2.1.\u00aeMouse Transcriptome Arrays . Each array was processed through quality control, normalization using Expression Console and the Transcriptome Analysis Center , and bioinformatics pipelines previously established  signals were generated with Expression Console . Since the TAC program does not perform the desired two-way ANOVA, the limma package  algorithm (S-Score). S-scores follow a standard normal distribution across all transcript IDs, with a mean = 0 and standard deviation = 1. S-scores were then evaluated by false discovery methods (SAM) for significant deviation from normality. Pairwise S-scores were generated for each sex as ethanol treated versus control and averaged together for each biological replicate. Thus, nine ethanol responsive S-scores  were generated for the adolescent data and nine S-scores were generated for the adults. Data was collapsed over sex to increase power and focus on age-related differences. Significant differentially expressed S-scores were determined using One-Class SAM  for each well using the provided software and normalized to PPP2r2p, Ublcp1 and B2M as endogenous controls. Relative changes in gene expression were normalized to the control male group.To confirm the microarray findings on candidate genes, PFC total RNA from experiment 2 was reverse transcribed to cDNA using the iScript cDNA kit . Real-time PCR was performed using the CFX System (Bio-Rad) for SYBR Green-based detection using standard protocols , 2013. Bn = 3\u20134/group) using the Total Histone Extraction kit  according to manufacturer directions. Global protein methylation levels of H3K9 and H3K36 were determined using a colorimetric ELISA assay using the EpiQuik Global Pan-Methyl histone H3-K9 and H3-K36 quantification kits  per manufacturer\u2019s protocols. Absorbance was determined using a spectrophotometer at 450 nm. The results were calculated using a standard curve following the manufacturer\u2019s instructions, and protein levels were expressed as ng/\u03bcg.To validate the microarray findings on histone methylation, a separate cohort of mice was treated with ethanol during adolescence as described in experiment 2. Histones were extracted from adolescent PFC tissue at PND 43  = 386.05, p < 0.001 and Expt. 2: F = 359.673, p < 0.001]. Two-way repeated measures ANOVAs only showed significant differences in body weights between males and females . No effect was found for treatment .Binge ethanol treatment in DBA/2J mice during adolescence did not significantly alter body weight during the treatment period. All groups significantly increased body weight over the course of the treatment  and the percent distance traveled in the light  were not significantly different between treatment groups  or sexes . Locomotor activity, however, was significantly increased in ethanol exposed adolescents. The total distance traveled and the time spent in ambulation was significantly increased in ethanol exposed mice . Both males and females exposed to ethanol showed a robust, significant increase in locomotor activity  and ambulatory time (43 and 72% increase) although there were no differences between males and females.Twenty-four hours after the last dose of ethanol, anxiety-like behavior in the light\u2013dark assay was not altered by ethanol exposure in DBA/2J adolescents. The percent time in the light  and sexes . However, treatment with 4 g/kg ethanol gavage from postnatal day 29 to 42 reduced the time sedated in the loss of righting reflex test . We found a significant main effect of treatment in DBA/2J mice for LORR duration , but no significant effect of sex  or interaction between sex and ethanol treatment . DBA/2J adolescents had a 20 and 22.7% reduction in sleep time following a history of ethanol exposure in males and females, respectively.Intermittent binge ethanol during adolescence reduced the sedative/hypnotic response to ethanol in DBA/2J males and females at PND 46. The latency to lose the righting reflex was similar between treatment groups . Only a trend toward a decrease in recognition memory was found to be affected by ethanol exposure after a 1-h delay, primarily driven by females . We did not find significant effects of sex at either inter-interval delay . Nor did we find a significant interaction between treatment and sex . Together, this data suggests that adolescent binge ethanol in DBA/2J mice may selectively damage the frontal cortical connections, because novel object recognition was decreased after a short (5 min) but not a long (1 h) delay. We may also be uncovering a sex-specific effect, where females are more strongly impacted by adolescent ethanol than males. There were no significant differences between groups for time investigating the objects during the training sessions .To estimate the long-term effects of binge ethanol during a period of frontal cortical development, we measured \u201cPFC-mediated\u201d short term memory and \u201cperirhinal/hippocampal-mediated\u201d longer term memory using the novel object recognition test . In DBA/F = 2.99, p = 0.089; distance: F = 2.077, p = 0.115] or adolescent treatment groups . Acute ethanol (2 g/kg i.p.) significantly increased both the percent time  and distance traveled  in the light compartment as compared to saline treatment, indicating a significant ethanol anxiolytic-like response . Prior ethanol exposure during adolescence did not interact with these measures. Total distance traveled during the assay, however, was significantly higher in mice treated with acute ethanol  as compared to saline treated counterparts. Some attributes of juvenile locomotor activation may persist into adulthood. When tested as adults in the LD box, mice exposed to adolescent binge ethanol showed increased locomotor activity when injected with acute 2 g/kg ethanol, as compared to the saline treated mice . A significant interaction among all three factors  revealed that in ethanol treated adults, females exposed to binge ethanol had greater locomotion than control females, while males did not.Anxiety-like behaviors in the light\u2013dark box following saline or ethanol (2.0 g/kg i.p.) treatment were similar in adult mice exposed to binge ethanol as adolescents versus controls. Percent time and distance in the light were not significantly different between sexes , but shorter in females . In adults, pretreatment with adolescent ethanol increased the time sedated in the loss of righting reflex test. Adults had a 6.5 and 36.9% increase in sleep time following a history of ethanol exposure in males and females, respectively . We found a significant main effect of treatment for LORR duration , and a significant effect of sex , but no significant interaction between the two . Overall, females had a shorter LORR duration than males.Three weeks after the last ethanol binge, mice exposed to ethanol as adolescents were more sensitive to the sedative/hypnotic effects of high dose ethanol as compared to controls. The latency to lose the righting reflex was similar between treatment groups , Mal , Mbp , and Ndrg1  than males. Binge ethanol exposure during adolescence significantly reduced expression of Mag , Mbp , Mobp , and Plp . Effects appear to be stronger in males, as a significant interaction between treatment and sex was found for Mag , Mbp , and Plp , where expression was lower in ethanol exposed males versus control males. Expression of two myelin related genes not significantly altered by ethanol in our microarray analysis, Mal and Ndrg1, were also unchanged by binge ethanol using qPCR . To see if these gene expression changes persisted, we also surveyed myelin expression by qPCR in adult PFC at PND66. None of the myelin-related genes were significantly altered by adolescent ethanol exposure  or sex  in adult animals, consistent with the microarray results.Both the Figure 7) in a separate cohort of mice. At PND 43, 24 h after the last gavage treatment, all three H3K36 methylation protein levels were significantly decreased in ethanol treated males as compared to control males . Global levels of H3K9 mono-, di-, or tri-methylation were not altered by adolescent binge ethanol .Since genes involved in histone demethylase activity, specifically at H3K9 and H3K36, were reduced in ethanol exposed adolescent mice, we quantified global histone methylation protein levels for mono-, di-, and tri-methylation at H3K9 and H3K36 . Similar to prior reports . Future studies will be needed to directly test this effect and the persistence of locomotor sensitization.Additionally, in our model, adolescent binge ethanol may promote prolonged locomotor sensitization. While testing for anxiety 24 h after the last binge, ethanol exposed mice traveled farther in the light\u2013dark apparatus than controls. In adulthood, a priming injection of 2 g/kg ethanol while testing for ethanol-induced anxiolysis, increased locomotor activity in females with a history of binge ethanol. In rodents, adolescents are more sensitive to low dose ethanol\u2019s locomotor stimulating and locomotor sensitization effects than adults . Swiss mAt the dose used in these studies, DBA/2J mice did not display withdrawal-induced anxiety. Twenty-four hours after the last ethanol binge, basal anxiety in the light\u2013dark apparatus was similar between ethanol-exposed and control mice. Others have reported withdrawal-induced anxiety in adolescent rats , althougFigure 3). Females showed a trend for deficits with the longer, perirhinal-mediated delay. Together with the locomotor activity, this could suggest that females may be more sensitive than males to the prolonged effects of adolescent ethanol exposure. Alternatively, as the novel object recognition task is based on novelty-seeking, mice that spend less time investigating a novel object may be experiencing neophobia. Future studies investigating the effects of binge ethanol on neophobia and/or other anxiety-related tasks are needed to investigate this possibility. Importantly, using different ethanol exposure paradigms and different cognition tasks, others have reported that adolescent rats and mice exposed to ethanol display deficits in reversal learning and in object recognition that persist into adulthood . However, differences in myelin-related gene expression did not persist into adulthood, 3 weeks after the last ethanol dose. It is plausible that myelin expression may recover over time after cessation of ethanol exposure since continued abstinence from alcohol partially reverses the white matter loss in uncomplicated alcoholics . H3K9me3 was recently identified as the histone mark underlying transcriptional changes in glutamate or GABA synapses on oligodendrocyte precursor cells (OPCs) as they mature into myelin-forming oligodendrocytes  pathway were significantly decreased in the adolescent PFC. Interpreting the role of these epigenetic modifications is complicated by the fact that lysine can be mono-, di-, or tri-methylated, and the degree of methylation can differentially influence gene expression. For example, H3K9me2 is enriched in transcriptionally silent euchromatic domains, while H3K9me3 mediates heterochromatin formation by forming a binding site for HP1 and participates in gene silencing at euchromatic sites . Each epdrocytes . In OPCsH3K36 methylation, alternatively, is associated with active transcription. H3K36me is enriched in coding regions of active genes, while H3K36me2 has a role in double strand break repair . H3K36meRecent studies in alcohol and other drug dependence are beginning to identify the role of histone methylation and other epigenetic changes in addiction-related phenotypes. In adolescent rats, intermittent ethanol upregulated histone acetyl transferase (HAT) activity and histone acetylation in the PFC . SystemiA growing consensus is developing to suggest a role for histone methylation in addiction. For example, adolescent intermittent ethanol increases H3K4me2 in the promoter regions of cFos, Cdk5, and FosB in the PFC . H3K9me1Epigenetic marks and the enzymes that add or remove these modifications fluctuate in expression throughout development. We hypothesize that ethanol-induced perturbation of histone methylation during crucial developmental periods, such as adolescence, may cause widespread genetic dysregulation as seen with myelin and glutamate signaling-related gene expression in our studies here. Such responses could affect normal developmental trajectories and cause the persistence and/or emergence of ethanol behavioral pathology in adulthood. Future studies will seek to causally connect discrete epigenetic modifications with specific gene expression and behavioral sequelae resulting from adolescent ethanol exposure.S-score algorithm to work for the MTA 1.0 microarrays. MM provided resources, experimental interpretation and critical review of the manuscript.The study was conceived, designed, executed analyzed, and written by JW. qPCR studies were conducted by TM. GH and SA adapted the The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Ethanol is a widely used psychoactive drug whose chronic abuse is associated with organ dysfunction and disease. Although the prevalent metabolic fate of ethanol in the human body is oxidation a smaller fraction undergoes nonoxidative metabolism yielding ethyl glucuronide, ethyl sulfate, phosphatidylethanol and fatty acid ethyl esters. Nonoxidative ethanol metabolites persist in tissues and body fluids for much longer than ethanol itself and represent biomarkers for the assessment of ethanol intake in clinical and forensic settings. Of note, the nonoxidative reaction of ethanol with phospholipids and fatty acids yields bioactive compounds that affect cellular signaling pathways and organelle function and may contribute to ethanol toxicity. Thus, despite low quantitative contributions of nonoxidative pathways to overall ethanol metabolism the resultant ethanol metabolites have important biological implications. In this review we summarize the current knowledge about the enzymatic formation of nonoxidative ethanol metabolites in humans and discuss the implications of nonoxidative ethanol metabolites as biomarkers of ethanol intake and mediators of ethanol toxicity. \u00a9 2016 IUBMB Life, 68(12):916\u2013923, 2016 The consumption of ethanol has a widespread social tradition among many populations worldwide. Whereas moderate ethanol intake has been regarded beneficial to cardiovascular health, chronic alcohol abuse is associated with an increased risk of pancreatitis, cardiomyopathy, liver disease and cancer EtG is formed by transfer of a glucuronyl moiety from uridine 5\u2032\u2010diphospho (UDP)\u2010glucuronic acid to ethanol Fig. . This rein vitro. Among them, UGT2B7 and UGT1A9 exhibited highest ethanol glucuronidation activities Km values of ethanol glucuronidation exceed physiologically attainable ethanol concentrations in vitro studies using recombinant SULTs, members of the 1A, 1B, 1C, 1E and 2A subfamilies are able to catalyze sulfonation of ethanol. Based on its high expression in liver SULT1A1 has been suggested to be a major contributor to hepatic EtS formation in vivo is currently unknown.The human genome encodes for 22 UGTs, which are divided into three subfamilies, termed UGT1A, UGT2A and UGT2B. UGTs are localized at the endoplasmic reticulum with active sites facing the lumen. Each UGT isoform shows a tissue\u2010specific expression pattern. Liver, gastrointestinal tract and kidney express the highest levels of UGT isoforms EtG and EtS exhibit extended half\u2010lives in body fluids as compared to nonmetabolized ethanol and have been used as biomarkers for recent ethanol intake and abstinence monitoring. After a single event of ethanol intake the time frame of detectable serum EtG and EtS exceeds that of blood ethanol by 4\u20138 h in vitro and to cause allodynia in rats after intrathecal administration in vivo remains to be established.Phase II modifications increase water solubility and facilitate excretion of metabolites PEth is formed by transphosphatidylation of phospholipids with ethanol, which was first observed by Alling et al. in vitroin vitroin vivo has not been addressed. Cell culture studies indicate that PEth turnover occurs at slower rates compared to PA indicating that PEth is more resistant to further metabolic conversions 2, PC phospholipase C and PA phosphohydrolase The transphosphatidylation of phospholipids and ethanol is catalyzed by phospholipase D (PLD) Due to slow PEth elimination rates, detection of blood PEth permits verification of ethanol intake even after several days of abstinence. The majority of blood PEth is associated with erythrocytes whereas only a minor fraction can be found in leukocytes and plasma 2+in vitro including Na+/K+\u2010ATPase, protein kinase C, phospholipase C and cytosolic phospholipase A2Because PEth formation occurs at the expense of PA upon activation of PLD it has been suggested that this reaction interferes with PLD\u2010mediated cellular processes in vitro and to accumulate FAEE in vivo after ethanol intake. Among them, highest FAEE levels have been consistently reported in liver and pancreas. Detectable amounts of FAEE are formed within minutes in cultured cells and perfused organs and dose\u2013response relationships have been observed for FAEE synthesis rates and extracellular ethanol concentrations FAEEs are formed through the enzymatic esterification of ethanol with FAs. These ethanol metabolites have been described first by Goodman and Deykin in total body lipid extracts of rats acutely intoxicated with ethanol and were later found in multiple tissues of rodents subjected to acute or chronic ethanol exposure O\u2010acyltransferase (AEAT) transfers acyl moieties from acyl\u2010CoA to ethanol  esterifies ethanol with free FAs whereas acyl\u2010CoA\u2010ethanol\u2010nol Fig.  69, 78, FAEE depositions in hair have been proposed as suitable markers for the retrospective detection of alcohol abuse and the monitoring of abstinence 2+ levels ultimately associated with cellular dysfunction and cell death in vitro and in vivoSince the identification of FAEE in organs commonly damaged by ethanol such as heart, brain, pancreas and liver, an increasing number of studies linked FAEE formation to ethanol toxicity. Toxic cellular effects ascribed to FAEE include inhibition of cell proliferation, destabilization of lysosomes, mitochondrial depolarization and induction of apoptosis in vitro studies. The characterization of enzymes and signaling pathways mediating effects of nonoxidative ethanol metabolites in vivo is thus inevitable to improve our understanding of nonoxidative ethanol metabolites as biomarkers and bioactive molecules.Although the quantitative contribution of nonoxidative pathways to human ethanol metabolism is low, the resultant metabolites have important analytical and biological implications. The detection of nonoxidative ethanol metabolites in body fluids, hair and neonatal matrices provides a valuable tool for the monitoring and retrospective assessment of ethanol intake. Different elimination rates of nonoxidative ethanol metabolites permit a wide range of analytical time frames for the verification of ethanol intake ranging from hours to months after termination of ethanol consumption. The enzymatic reaction of ethanol with cellular lipids generates bioactive metabolites such as FAEE and PEth, which have been shown to interfere with cellular signaling pathways and organelle function and may therefore contribute to specific manifestations of ethanol toxicity. Although considerable research has been performed regarding the enzymology of nonoxidative ethanol metabolism our current knowledge is limited mainly to"}
+{"text": "Elevated alcohol intake after abstinence is a key feature of the addiction process. Some studies have shown that environmental enrichment (EE) affects ethanol intake and other reinforcing effects. However, different EE protocols may vary in their ability to influence alcohol consumption and stress-induced intake. The present study evaluated whether short (3 h) or continuous (24 h) EE protocols affect ethanol consumption after periods of withdrawal. Mice were challenged with stressful stimuli (24 h isolation and restraint stress) to evaluate the effects of stress on drinking. Male C57BL/6 mice were subjected to a two-bottle choice drinking-in-the-dark paradigm for 15 days . Control mice were housed under standard conditions (SC). In the first experiment, one group of mice was housed under EE conditions 24 h/day (EE24h). In the second experiment, the exposure to EE was reduced to 3 h/day (EE3h). After the acquisition phase, the animals were deprived of ethanol for 6 days, followed by 2 h ethanol access once a week. Animals were tested in the elevated plus maze (EPM) during ethanol withdrawal. During the last 2 weeks, the mice were exposed to 24 h ethanol access. A 1-h restraint stress test was performed immediately before the last ethanol exposure. EE24h but not EE3h increased anxiety-like behavior during withdrawal compared to controls. Neither EE24h nor EE3h affected ethanol consumption during the 2 h weekly exposure periods. However, EE24h and EE3h mice that were exposed to acute restraint stress consumed less ethanol than controls during a 24 h ethanol access. These results showed that EE reduces alcohol intake after an acute restraint stress. Alcohol addiction is a complex psychiatric disorder strongly influenced by environmental factors . Animal Considering the strong influence of environmental factors on alcohol addiction, there has been increased interest in models that control the environment, either positively or negatively. The introduction of objects that allow animals to voluntarily exercise, play, and interact with different toys provides the animals with a positive environment that can help them better cope with stress. These environmental manipulations are called environmental enrichment (EE) , 12, whiEE decreases psychostimulant self-administration and drug-seeking behavior , 18. MicWhile positive environmental conditions, as the EE, may reduce the reinforcing effects of drugs, stressful conditions tends to increase these effects and play an important role in determining the vulnerability to addiction . EpidemiThere are evidences that EE can reduce drug-seeking behavior induced by cues, stress and stress-induced disruptions of the hypothalamic-pituitary-adrenal axis , 31, 32.Fifty adult male C57BL/6 mice, 8\u201310 weeks old, were housed in groups of five or six in large transparent polycarbonate cages (42 cm length \u00d7 28 cm width \u00d7 21.5 cm height) in a room with controlled temperature (22 \u00b1 1\u00b0C) and a 12 h/12 h light/dark cycle (lights off at 9:00 AM). The animals had free access to food and water and were acclimatized to the reverse cycle for at least 2 weeks before the experiments. Red incandescent lights were used so that the investigators could handle the mice during the dark phase. All experimental procedures were approved by the Ethical Committee for Animal Use of the Instituto de Ci\u00eancias Biom\u00e9dicas, Universidade de Sao Paulo, Brazil (protocol no. 143).The drinking in the dark (DID) protocol was used to assess voluntary ethanol intake and modified from previous described methods . The aniVarious plastic objects and toys, such as houses, pipes, ramps, ladders, balls and metal or plastic running wheels (one running wheel and one house per cage was maintained during the entire experiment) were added in the home cage of EE group. The objects  were purchased in pet shops. Their positions were changed three times per week to maintain environmental novelty. Exposure to EE began the day following the acquisition phase and continued throughout the experiment.A single test session in the EPM was performed during the dark phase of the light/dark cycle to be consistent with the timing of the DID procedure. The apparatus comprised two open arms  and two closed arms  in a plus configuration that extended from a common central platform (10 cm \u00d7 10 cm). The apparatus was elevated 50 cm above the floor. The animals were taken to the experimental room 15 min before testing for adaptation to the new environment. The mice were placed in the central platform facing an open arm and the behaviors were evaluated in a single 5 min session. Each trial was recorded with a digital camera. The recorded data included entries into and time spent on the open arms , total entries into both the open and closed arms, latency to the first open arm entry, and stretched attend posture. The first entry was recorded when the animal placed all four paws in a specific arm.On the last day of the consumption protocol, the mice were placed in an individual ventilated polypropylene tube (diameter of 3 cm and length of 11.5 cm) for 1 h before re-exposure to the DID test. The procedure was realized in the dark and the animals started the ethanol consumption immediately after the restraint stress procedure.g for 10 min at 4\u00b0C to separate plasma and then stored at -20\u00b0C until the time of the assay. The plasma was used to quantify blood ethanol concentrations (BECs) using an enzymatic assay and Analox GL6 Multiassay Analyser . Blood ethanol concentrations are expressed as milligrams of ethanol per milliliter of blood (mg/ml). Following the acquisition phase, the animals were randomly distributed into two groups: standard housing conditions  and EE for 24 h/day . After six days of ethanol deprivation, the mice were offered two bottles containing either 20% ethanol or tap water for 2 h only, once a week, for 4 weeks. The mice were tested in the elevated plus maze (EPM) on week 5. On weeks 5 and 6, mice were given 24 h free access to ethanol and the consumption was measured 2 and 24 h from the start of drinking. Next, in order to evaluate if restraint stress alters ethanol consumption, mice were subjected to a 1-h restraint stress session before being given 24-h free access to ethanol at week 6 of the experiment. Ethanol consumption can decrease immediately after exposure to a restraint stress [The main purpose of this experiment was to evaluate whether continuous EE (24 h/day) could alter ethanol consumption after periods of withdrawal and after a stressful situation. The experimental design is shown in t stress , so we an = 10) and EE3h (n = 10). In this experimental procedure, the objects were placed in the cages immediately after lights were off (9:00 AM) and then removed after 3 h (12:00 PM). Cages of the control mice were manipulated by the experimenter as a control for the disturbances caused by manipulating the objects in the EE3h cages. Considering that in Experiment 1 we observed no significant differences in ethanol consumption during the first five re-exposures to ethanol, we limited the re-exposures to 4 weeks in Experiment 2. During re-exposures at weeks 3 and 4, intake was measured twice . The EPM test was performed on the 3rd week, and the animals were exposed to 1-h restraint stress on the 4th week, immediately before the ethanol consumption test. Considering the differences in ethanol consumption between the EE and SC groups during the 24 h of ethanol access after stress exposure in Experiment 1, we measured plasma corticosterone levels in this experiment. Blood samples were collected after euthanasia, and plasma corticosterone levels were determined in duplicate using a Corticosterone EIA Kit  according to the manufacturer\u2019s instructions.This experiment followed similar experimental design , with thn = 9) had access only to the ethanol bottle during the 2h re-exposure tests. Water bottles were not offered , with day as the repeated measure. Ethanol intake (g/kg) over 2 and 24 h was analyzed using a two-way repeated-measures ANOVA, with housing condition as the between-subjects factor and week as the within-subjects factor. Significant interactions were followed by the Newman-Keuls  done in ). The EPF14,280 = 11.05, p < 0.05). By the end of the acquisition phase, the mice reached stable levels of ethanol consumption, i.e., no differences were found among the last 5 days  and fewer entries into the open arm  when compared with the SC group (t = 0.08), suggesting no difference in locomotor activity between mice from SC and EE24h groups (U = 42) or stretched attend posture .EE24h elicited anxiety-like behavior , reflecth groups . We alsoF1,19 = 1.42, p > 0.05) and no housing condition \u00d7 week interaction . While EE did not alter 2-h ethanol consumption during the five re-exposures (weeks 1\u20135), a significant decrease in 2-h ethanol intake was observed in both the SC and EE groups after restraint stress on week 6 .F1,19 = 3.28, p > 0.05) or housing condition \u00d7 week interaction . However, after a restraint stress protocol, mice consumed more water during the first 2 hours of exposure to the 2-bottles compared to the previous weeks .F1,19 = 20.01, p < 0.05) and the housing condition \u00d7 week factor interaction . No differences were found in ethanol intake over the 24 h ethanol access between the SC and EE groups in week 5. After the restraint stress, ethanol consumption of control mice was similar to that observed in the previous week, but the EE group exhibited lower ethanol consumption in week 6 compared with the consumption in week 5. In addition, the EE group consumed less ethanol than the SC group after the stress exposure. Regarding water consumption, the ANOVA revealed a significant effect of week  but no effect of housing condition  and no housing condition \u00d7 week interaction   . Both grF14,266 = 3.13, p < 0.05). During the last 5 days, mice reached stable levels of ethanol consumption and no differences were found among these days (t = 1.02), number of open arm entries (t = - 0.27), or total number of arm entries in the EPM  and number of stretched attend posture (t = 1.75) did not differ between groups (data not shown). Together with the previous experiments, these results indicate that only continuous exposure to EE induced an anxiety-like effect in mice.Consistent with the data from Experiment 1, the analysis of the 15-day acquisition phase revealed an increase in ethanol consumption after the first ethanol deprivation period when compared to the previous day, with a significant effect of day  and increase in water consumption  compared with weeks 2 and 3  and no housing condition \u00d7 week interaction . In F1,18 = 0.52; p > 0.05) and no housing condition \u00d7 week interaction .Similar to Experiment 1, EE3h did not alter the consumption of either ethanol or water during the weekly 2 h DID sessions. After exposure to acute restraint stress (week 4), both groups exhibited a decrease in ethanol consumption  and week  and a housing condition \u00d7 week interaction . Similar to Experiment 1, no differences were found in ethanol intake over 24 h between the SC and EE groups on week 3. In addition, the SC group exhibited no differences in ethanol intake between weeks 3 and 4. The EE3h group though consumed less ethanol after acute stress in week 4 compared to week 3 and less ethanol than the SC group in week 4  or weeks  on water consumption were found, with no housing condition \u00d7 week interaction .Environmental-related differences in corticosterone levels were investigated at the end of this experiment. The EE and SC groups did not differ in plasma corticosterone levels after 24 h ethanol intake  or restricted EE (3 h/day) consumed less alcohol over a 24 h period after an acute stressful stimulus compared to mice living in a standard condition.In this study, mice reached intoxicant levels of BECs when exposed to intermittent two-bottles choice DID test. It is important to consider that although the DID protocol has been previously shown to result in pharmacologically relevant BECs (> 1 mg/ml) in 2 h sessions , the supWe found that continuous EE exposure increased anxiety-like behavior. Previous studies reported contradictory results of EE effects on anxiety, which showed decreased, unchanged or even increased anxiety-like behavior in animals that lived in an enriched environment . ThIn both humans and animals, one common symptom of ethanol withdrawal is the manifestation of anxiety disorders, due to activation of anxiety-related circuitry. It is known that ethanol withdrawal-induced anxiety may facilitate relapse to ethanol drinking in consequence of its negative reinforcing properties . We hypoTwenty-four hours of free access to ethanol uncovered differences between groups in both experiments, likely resulting from exposure to stress. Animals that were housed under EE conditions exhibited a reduction of ethanol consumption compared with the previous week without stress exposure. However, ethanol consumption in the SC groups during these two re-exposures did not differ. Notably, both groups exhibited a decrease in ethanol consumption 2 h after stress, what is in agreement with . The strOver 24 h access to ethanol EE groups exhibited lower ethanol consumption compared with the previous week without stress and also compared with SC mice. Although SC and EE groups showed differing levels of alcohol intake following restraint stress in Week 6 relative to Week 5, such result may reflect a maintenance of the reduced intake in the EE group but not in the SC group after stress. Thus, an alternative hypothesis is that EE made these mice susceptible to the restraint stress-induced decrease in alcohol drinking. To support this hypothesis, EE24h increased anxiety in those mice as revealed by the elevated plus maze test, suggesting higher susceptibility to the effects of stressful stimuli. However, it is also important to emphasize that EE3h induced similar reduced ethanol intake, but did not increase anxiety-like behavior or altered the corticosterone levels measured at the end of the 24 hours of ethanol exposure. In previous study, we have demonstrated that EE prevented stress-induced increase in glucocorticoid receptor signaling in the basolateral amygdala of rats, without preventing the rise in corticosterone serum levels after acute restraint stress .Importantly, no differences in the first 2 h of ethanol intake were observed after acute stress exposure between SC and EE. This was associated with a significant decrease in ethanol intake and an increase in water intake after the restraint stress protocol. It is possible that restraint stress caused a considerable dehydration. A previous study reported a marked increase in total urine production and decrease in osmolality after immobilization stress in rats . The dysIn conclusion, we raised the hypothesis that this positive stress induced by EE could help the animals better cope with aversive situations, thus reducing stress reactivity , 53 and S1 AppendixExperimental procedures and results.(DOCX)Click here for additional data file.S1 FigF3,24 = 12.56, p < 0.05). The data are expressed as mean \u00b1 SEM. *p < 0.05, compared with the previous re-exposures.Gray bars represent the measure of ethanol intake after exposure to 1-h restraint stress. Ethanol intake was converted to percent of basal ethanol consumption. Basal ethanol consumption was calculated by averaging the absolute consumption of the last 5 days of acquisition phase, and converted as 100% = week 0, and then all values of ethanol intake were converted to percentage of this basal consumption. Upon the fourth re-exposure after stress, the mice exhibited lower ethanol consumption compared with the previous weeks Click here for additional data file."}
+{"text": "Andrew Seale and colleagues discuss the development of a global strategy to counter sexually transmitted infections. Sexually transmitted infections (STIs) present significant health and economic challenges in all countries and yet are rarely prioritised for coordinated strategic attention.The 2016 World Health Assembly adopted a global health sector strategy on STIs for 2016\u20132021, including ambitious 2020 and 2030 goals aligned with broader sustainable development goals and targets of ending disease epidemics as public health concerns by 2030.The strategy requires actions at the country level, guided and led by governments, supported by the World Health Organization (WHO) and other partners.A number of barriers frustrate efforts to take the response to STIs to scale, including insufficient incidence data and disease surveillance, and political resistance to scientifically-proven and often cost-effective interventions and approaches.Country-level success in strategy implementation requires that WHO, Ministries of Health, and broader stakeholders look beyond the interventions required for effective STI management to also consider the broader context, processes, and politics of STIs when building and strengthening responses.Evaluating progress towards the strategy\u2019s 2020 coverage targets and 2030 coverage and impact targets will be the key success-measurement tool, yet limiting analysis to the frame of coverage and impact targets alone will deny important opportunities to drive action and to evolve policies and programmes in dynamic contexts.Exploring and assessing the implementation context, political interest, and potential of health policies can ensure early identification of challenges and opportunities when focused on national-level policy uptake and execution.This paper applies an analytical approach to the global strategy that includes an investigation of 3 domains: process, programmatic, and political. Key questions are proposed to guide exploration of these domains to help identify and address barriers to, and leverage solutions for, policy success.In May 2016, the World Health Assembly (WHA) adopted a global health sector strategy on sexually transmitted infections (STIs) for 2016\u20132021 . The newBeyond HIV, STIs are rarely prioritised for comprehensive action despite a considerable disease burden and clear health and economic arguments . Like otWhile defining and measuring a policy\u2019s success requires an evaluation of its uptake and implementation, it can be beneficial to also explore the following: how well the policy\u2019s technical content and goals are grounded in the latest science and evidence; the power dynamics, political, and operational context of the strategy; and the broader policy environment that provides context to the policy .This paper proposes that an exploration of 3 domains, \u201cprocess, programmatic, and political\u201d , can helIn the absence of large and well-funded public sector programmes, STI responses are often fragmented, with many uncoordinated service providers from the public, private, and not-for-profit sectors. STI services often fall outside the essential service packages of health financing systems\u2014presenting significant challenges to strategic coordination, equitable service provision, and quality assurance. In addition, STIs, like many other health issues linked to human behaviour, can trigger strong reactions from political, religious, and other cultural commentators. The role of public health professionals is to navigate the politicised and often polarised context of health to ensure that evidence-based policies and programmes are appropriately prioritised and supported .This paper is the first of a series to be published as part of a PLOS Collection, highlighting the importance of strengthening the response to STIs as part of the broader 2030 Agenda for Sustainable Development.While there are no standard evaluation tools available for measuring the potential success of newly adopted global public health policies and strategies, there are numerous frameworks that can help guide implementation and assessment. This paper adapts Marsh and McConnell\u2019s policy assessment framework  Table 1Table 1 tWe draw on systematic documentation of key steps in the strategy\u2019s development process that comprises meeting reports; concept notes developed for consultations and other events; email correspondence; analysis of news and social media reporting and web coverage; analysis of consultations, including 5 regional consultations and a 2-month public online consultation; correspondence from Geneva-based missions to the WHO Secretariat; official records and reports from the Executive Board and WHA; and written comments from nongovernmental organisations (NGOs) and interest groups, including those with WHO observer status.In 2014, when the process to develop a new global strategy for STIs started, the context for vertical, communicable, disease-focused programmes at WHO was considerably challenging. The organisation was focused on the following: WHO reform and making sense of the Millennium Development Goals (MDGs), preparing for the \u201cpost-2015 era\u201d to be later elaborated in the 2030 Agenda for Sustainable Development, strengthening health systems and Universal Health Coverage (UHC), and reprofiling the importance of noncommunicable diseases . In addiHIV financing, a key source for also financing other STIs, had been criticised for skewing health systems in many countries , and theGlobal Strategy for the Prevention and Control of Sexually Transmitted Infections: 2006\u20132015. Policy leads from the 3 areas assessed the programmatic and political environment and concluded that a more integrated approach was appropriate for HIV, viral hepatitis, and STIs. The departments also recognised the strategic importance of encouraging stronger programmatic linkages across the strategies. Consequently, a decision was made to \u201cpackage\u201d the 3 as interlinked strategies\u2014applying UHC as an organising framework to promote integration and a systems focus and to help secure political buy-in both inside WHO and with stakeholders. A cross-departmental strategy-development management team was established to coordinate and oversee the development of the overall strategic approach and its 3 disease components.While the WHO HIV Department and Global Hepatitis Programme were preparing to develop strategies on HIV and viral hepatitis, the WHO Department of Reproductive Health and Research (RHR) was also preparing to develop a follow-up strategy to the Amendments to the strategies were organised in stages: an initial draft of each strategy informed by technical experts was used as a basis for external consultation, revised drafts were produced after the external consultation for internal review, drafts were then prepared for sharing at the Executive Board in January 2016, and the final drafts were prepared for the May 2016 WHA.Early changes focused on ensuring the strategies were well organised and comprehensive, whereas later amendments were more focused on addressing areas that lacked political consensus, for example, relating to key populations and the Trade-Related Aspects of Intellectual Property Rights. Member States also raised concerns during consultation related to the impact of resource constraints on national programmes and the need to achieve a comprehensive approach to STIs.The cost and resources used in the strategy development process can influence how stakeholders view a policy during its implementation phase\u2014a cost-efficient and clear process is likely to signal an efficient and clear strategy . The devKey costs included those required for a series of regional, public, and expert consultations; consultancy support for coordination and project management; materials production; and modelling to cost out the strategies. Other resources were leveraged from existing sources, including staff time, the use of departmental website pages, and engagement from existing technical and civil society reference groups. In-kind support was also secured from partners including Member States, for example, Brazil and South Africa hosted regional consultations; Brazil, France, Egypt, Myanmar, and Zimbabwe supported a WHA Technical Briefing; and Brazil and France cohosted information sessions for Geneva missions in 2015 ,13.Implementation of the Global Strategy for Prevention and Control of Sexually Transmitted Infections: 2006\u20132015 for the WHA [Key learning for the 2016\u20132021 strategy on STIs was leveraged from understanding the progress and challenges from implementing the previous strategy, which is outlined in the progress report  the WHA . The repAdditional funding for STI prevalence studies, stronger surveillance systems and STI programmes;Reprioritisation of STI prevention and support for innovations, including STI vaccines and STI rapid diagnostic tests, and multipurpose prevention technologies to strengthen linkages to broader sexual and reproductive health and rights (SRHR) issues;Taking successful, evidence-based STI programmes among key populations to scale;Greater collaboration with the NGO sector;Neisseria gonorrhoeae.A critical focus on antimicrobial resistance, particularly in The 2016\u20132021 strategy also draws on agreed language from WHO\u2019s 2004 global reproductive health strategy to propose a comprehensive approach to SRHR that includes improving antenatal, delivery, postpartum, and newborn care; providing high-quality services for family planning, including infertility services; eliminating unsafe abortion; combating STIs, including HIV, reproductive tract infections, cervical cancer, and other gynaecological morbidities; preventing intimate partner violence and sexual- and gender-based violence; and promoting sexual health and human rights .While the WHO HIV department tracks, in real time, both policy uptake and implementation in relation to its normative guidance , the 3 gTracking and reporting progress is particularly challenging for the STIs strategy because of the lack of key data for STIs, including the lack of global baselines for syphilis and gonorrhoea incidence. In the absence of data, the strategy proposes the following: establishing global incidence baselines by 2018, assessing progress towards service coverage targets for 2020, and measuring impact through assessing incidence trends in 2030 in the context of ambitious targets aligned with the elimination of STIs as public health concerns .The targets recognise that a concerted effort to rapidly scale up effective evidence-based interventions and services can achieve the goal of ending STI epidemics as public health concerns by 2030:Treponema pallidum incidence globally ;90% reduction of Neisseria gonorrhoeae incidence globally ;90% reduction in 50 or fewer cases of congenital syphilis per 100,000 live births in 80% of countries;Sustain 90% national coverage and at least 80% in every district  in countries with the human papillomavirus vaccine in their national immunisation programme.70% of countries to have STI surveillance systems in place that are able to monitor progress towards the relevant targets;70% of countries have at least 95% of pregnant women screened for HIV and/or syphilis, 95% of pregnant women screened for HIV and/or syphilis with free prior and informed consent, 90% of HIV-positive pregnant women receiving effective treatment, and 95% of syphilis-seropositive pregnant women treated with at least 1 dose of intramuscular benzathine penicillin or another effective regimen;70% of key populations for HIV to have access to a full range of services relevant to STIs and HIV, including condoms;70% of countries provide STI services or links to such services in all primary, HIV, reproductive health, family planning, and antenatal and postnatal care services;70% of countries deliver HPV vaccines through the national immunisation programme;N. gonorrhoeae.70% of countries report on antimicrobial resistance in While the steps for global-level evaluation and reporting are clear, they are likely to be challenging at regional and national levels at which STIs lack an institutional home, focal point, or champion. Building a sense of national accountability and ownership for building and sustaining progress is critical and will require considerable technical support and resources. Formally reporting back to the WHA will require input from Member States and WHO and should, as far as possible, also encourage inputs from broader stakeholders.The global strategy-development stakeholder consultation process was well documented throughout . Member Several speakers at the WHA highlighted the importance of building on signs of political will and interest as the strategy moves to implementation, as noted in an intervention made by the International Planned Parenthood Federation (IPPF):A renewed global focus on key infections, such as syphilis, gonorrhea, and human papillomavirus, has the tremendous potential to mitigate the often-hidden impact on still birth, cervical cancer, HIV transmission, and infertility worldwide. For these ambitious strategies to become a reality, it requires political support, financial investment, and integrating with existing health systems, including community-based service providers. We call on the Member States gathered here to show the leadership that is required in all fora, including at the High-Level Meeting on Ending AIDS in New York in June.\u2014IPPF statement to the 69th WHA [69th WHA .Given the high level of competing health issues and WHA agenda items, \u201cpolitical popularity\u201d  for the A number of issues that WHO maintains are evidence-based yet, to some countries, are politically challenging, include those related to the following: the provision of comprehensive sexuality education, the recognition of sexual and reproductive health and rights, and meeting the sexual health needs of \u201cspecific populations\u201d including men who have sex with men and transgendered people as well as other groups such as prisoners, people who use drugs, and mobile populations.The term \u201csexual and reproductive health and rights\u201d was proposed in the strategy and, despite opposition to its inclusion from some Member States, there was no request during WHA proceedings to open up the document for amendment, and the terminology remains intact. This term may well be further debated at the national level as national STI policies are developed.The global strategy calls for countries to explicitly address the needs of a number of named population groups, ensure that laws and policies that promote human rights and gender equality are in place, and ensure that steps are taken to address legal, regulatory, and policy barriers that encourage stigma, discrimination, and violence. In some countries, the key implementation challenges may not be related to weak health systems and the strengthening laboratory or surveillance infrastructure but may require work at the political and policy levels to create an environment that facilitates strategy implementation.Marsh and McConnell encourage policymakers to explore positive, negative, and neutral unintended consequences that may arise during policy development and implementation ,19. An uAt different moments during strategy implementation it will be necessary to pull focus on different challenges, opportunities, or bottlenecks that may be characterised as either political, process, or technical in nature. For example, volatile, hostile, or apathetic political contexts might require the prioritisation of work at a political level.Exploring the global strategy development process with the use of questions adapted from the Marsh and McConnell framework helps highlight several critical learning points for future STI strategy development processes at both global and national levels:Process: Deliberately and systematically documenting and monitoring strategy-related process and discourse should be a core and budgeted function of the team responsible for STIs. Optimal implementation requires an institutional home that connects policies with planning, research, political, and implementation functions [unctions .Technical: The STI field is politicised and technically complex\u2014ensuring that STI work remains evidence-based and supports and reinforces broader health policy goals, for example, UHC, tackling drug resistance, and the elimination of mother-to-child transmission of diseases, offers important opportunities for building stakeholder engagement and ownership. Strong public health policies should also include a focus and reflectivity on monitoring for, and responding to, unintended consequences [equences .Political: Systematically assessing political interest and/or resistance among key internal and external stakeholders can helpfully inform the strategy or policy development process. Adopting management approaches that are encouraged to appreciate power differentials, partnerships, and systems [ systems  and enga systems  offer opThe global strategy\u2019s 2020 coverage targets and 2030 coverage and impact targets provide a strong framework for evaluating progress towards eliminating STIs as public health concerns. Yet, given that the context for this work is both politicised and highly dynamic, it is important that evaluation looks beyond coverage and impact targets, otherwise important opportunities to drive comprehensive action and to evolve policies to changing contexts may be overlooked. This paper proposes that expanded assessment includes deliberate analysis of the political context and policy process alongside assessment of progress towards targets and the extent to which technical priorities have been taken on board. The questions proposed in"}
+{"text": "P<0.05) compared to pullets of G1 group, while it was 6.9 days less (P>0.05) compared to G2. However, significantly higher (P<0.05) plasma levels of LH and FSH in pullets of G1 as compared to pullets belonging to G3 group corresponded with the higher (P<0.05) cumulative egg production during the experimental period, while these attributes in G2 group didn\u2019t differ from either G1 or G3 groups. Pullets of G1 group had significantly higher levels (P<0.05) of GnRH-I, FSH-\u03b2, and LH-\u03b2 mRNA abundances at 43 weeks of age than other two groups and this corresponded with the percent (hen day) peak egg production (75.38%) in pullets in this G1 group that was attained at 32 weeks of age, while the peak production of 71.24% was attained at 30 weeks of age in G3 group. There was no effect of lighting schedule on body weight of pullets, recorded during experimental period, at all occasions; belonging to three groups  and receiving varying hours of photo-stimulation (P>0.05). It was inferred that the optimum lighting schedule for Chinese native breed Pengxian yellow pullets during 10 weeks of pre-pubertal growth period is short hours of photo-stimulation (i.e 8L:16D).The study was conducted to optimize lighting schedule for pre-pubertal (12 to 22 weeks) Chinese native breed Pengxian yellow pullet. A total of 414 healthy pullets (10 weeks), with similar body weight were randomly distributed into three groups (n = 138) and housed in individual cages for up to 12 weeks of age in light controlled rooms and provided normal lighting schedule (10L:14D). At 12 to 18 weeks of age, pullets were housed in three rooms, having varying lighting schedule viz. G1 (8L: 16D), G2 (10L:14D), or G3 (12L:12D). From 19th week onwards lighting schedule was gradually increased every week in incremental manner till all groups started receiving 16L:8D lighting schedule. The age at first egg, weight of first egg laid, percent peak hen day egg production, concentration of plasma luteinizing and follicle-stimulating hormones and expression of genes regulating synthesis or/and secretion of hypothalamic gonadotropin-releasing hormone-I (GnRH-I), and pituitary LH-\u03b2 and FSH-\u03b2 were studied during experimental period (12 to 43 weeks of age) of this study. The result indicated that pullets of long day length (G3) group had higher plasma levels of FSH and LH and also better mRNA expression that regulates synthesis or/and secretion of GnRH-I, FSH-\u03b2, and LH-\u03b2 before egg laying. The age at first egg (151.3 days) in pullets of G3 group receiving longer lighting hours (12L:12D) was 8.8 days less ( The age at which pullets sexually mature has a direct influence on their laying performance, and genetic stocks have optimal ages at which they reach sexual maturity to produce the maximum possible egg mass . Among tWhen the chicken perceives day length to be sufficient to initiate reproductive development (effective minimum of 11 to 12 h), light energy is converted into nerve impulses in the hypothalamus, where it is translated into hormonal signals . The extPengxian yellow chickens are a unique native chicken breed from Chengdu Plain, Sichuan Province, China. This chicken breed is widely adaptable and has nutritious meat, but reproductive performances need to be improved. Therefore, to create an optimal light program for the late growth period of Pengxian yellow chickens, the effects of different light programs from 12 to 18 weeks on egg production traits and plasma FSH and LH concentrations, and gene expression of hypothalamic GnRH-I, pituitary LH-\u03b2, and FSH-\u03b2 were determined in the present study.All procedures were approved by the Animal Care and Welfare Committee of Sichuan Agricultural University.Four hundred and fourteen healthy Pengxian yellow chicken pullets of similar body weight (1072.2\u00b158.6 g) at 10 weeks of age were divided into three light-controlled rooms (n = 138) and reared in individual cages. Birds were subjected to a feeding program with daily administration of feed and water, as recommended by the Pengxian Yellow Chicken Breeder Management Guidance.Birds were kept under the normal photoperiod of 10 h in light (L):14 h in darkness (D) (10L: 14D) with a full light spectrum achieved by warm white fluorescent lamps (white light: 15 lux) from 10 to 12 weeks of age. Light intensities were determined by a light intensity meter . From 12 to 18 weeks of age, pullets were placed in rooms provided with different light programs: 8L: 16D in room 1 , 10L:14D in room 2 , and 12L:12D in room 3 . From 19 to 22 weeks, the light programs were 9, 10, 11, 12 L in G1; 10.5, 11, 11.5, 12L in G2; and 12, 12, 12, 12 L in G3. Beginning at 22 weeks, the day length was gradually increased by 0.5 h/week, until 16L: 8D was applied .The age at first egg (AFE), first egg weight (FEW) and total egg production during 43 week (TE43W) was individually recorded. Thirty chickens were randomly selected to measure the fasting body weight every two weekends from 12 to 24 week, and at the age of first egg (BWFE) and the 43 week of age (BW43W).Heparinized blood samples were drawn from the brachial veins of the randomly selected 10 chickens at 8:00 AM every two weekends from 12 to 18 weeks of age, and every four weekends from 18 to 38 weeks, and at 43rd week. The blood was centrifuged at 3000 rpm for 15 min at 4\u00b0C. Then, the supernatant was collected to determine plasma FSH and LH concentrations. Plasma FSH and LH concentrations were measured using the commercially available ELISA kits, CSB-E06867h for FSH, and CSB-E12690h for LH , according to manufacturer\u2019s instructions for respective kits. Standards and samples were assayed in a volume of 50 \u03bcl in duplicate. The minimum detectable concentration of FSH and LH using these kits is typically less than 1 mIU/ml and 0.5 mIU/ml, respectively.Five chickens were randomly selected from each treatment and killed by cervical dislocation at the end of 18 weeks, 22 weeks (approximately 5% egg laying reached in the earliest group), 24 weeks (approximately 5% egg laying reached in the latest group), or 43 weeks. The entire hypothalamus and pituitary tissues were collected from each sacrificed chicken. All tissues were excised and rinsed in PBS, snap frozen in cryogenic tubes in liquid nitrogen, and then stored at \u221280\u00b0C.Frozen tissues were pulverized in liquid nitrogen, and approximately 50 mg of powder was transferred to an RNase-free tube with TRIzol reagent and total RNA was isolated following the manufacturer\u2019s instructions . RNA integrity, quality, and quantity analyses were performed with the Bioanalyzer 2100  according to The RNA 6000 Nano chip assay was performed according to manufacturer\u2019s instructions. All total RNA samples were stored at \u221280\u00b0C. Reverse transcription was performed with 2 \u03bcg of total RNA using PrimeScript RT Master Mix Perfect Real Time reaction kit  according to the manufacturer\u2019s instructions.\u2212\u0394\u0394CT method [Real-time Polymerase chain reaction (PCR) primers were designed by Primer Premier 5 , and theT method .P<0.05.All statistical analyses were performed using SPSS 17.0 . Differences between means were evaluated by Tukey\u2019s test for multiple comparisons. Data are presented as least squares means \u00b1 standard error of the mean (SEM), and values were considered statistically different at P<0.05) than short G1 program, while it was 6.9 days lower (P>0.05) than G2 program, but the first egg weight (FEW) was lower (P<0.05) compared with the other two light-treatment groups. Egg production rate rapidly increased in G3, and peaked at 30 weeks, which was 2 weeks earlier than other two treatments (32 weeks), but the rate (71.22%) at peak was lower than that in G1 (75.38%) and G2 (72.77%). Cumulative egg production during the 43 weeks of the experimental period was greater in the short light photo-stimulated group  than in the medium  and long  light photo-stimulated groups.Laying performances are presented in P>0.05; data not shown).However, there was no effect on body weight from 12 to 24 weeks, and at AFE and 43 weeks among the three groups after photo-stimulation .Plasma FSH concentrations were higher in the long lighting (G3) than short lighting (G1) photo-stimulated group from 16 to 30 weeks P<0.05; . Then, tP<0.05), whereas the reversed results were found from 38 to 43 weeks, when G1 had higher LH concentrations  in medium (G2) and long lighting (G3) photo-stimulated groups than in the short lighting treatment group (G1), and the G3 had higher (P<0.05) LH-\u03b2 mRNA abundance compared with the other two groups. At the age of 22 weeks, the three genes had entirely different expression patterns. The mRNA expression of GnRH-I in G3 was higher than that in G1 (P<0.05), but similar to that of G2. G2 and G3 had the same FSH-\u03b2 mRNA expression, which was higher than that in G1 (P<0.05). The LH-\u03b2 mRNA abundance was similar in G1 and G2, but lower than that in G3 (P<0.05).Photo-stimulation significantly impacted the expression of hypothalamic GnRH-I, and pituitary LH-\u03b2 and FSH-\u03b2 transcripts . At 18 wP<0.05) than those in G2 and G3 at 43 weeks.The mRNA expression patterns of GnRH-I, FSH-\u03b2, and LH-\u03b2 were similar in 24 and 43 weeks. There were no significant differences found among three groups in any of the genes at 24 weeks. However, expression of the three genes in G1 were higher , who found that transferring pullets from short to long days tends to stimulate ovarian activity, whereas transferring from long to short days suppresses ovarian development . AdditioHowever, the cumulative egg production during our 43 weeks experimental period was lowest in G3, even though the AFE was the earliest. Not surprisingly, because overall egg size can be manipulated with a lighting program during the rearing period, and advanced sexual maturity would reduce egg mass throughout the laying period because of aging of the reproductive tract and reduction in the rate of recruitment or yellow-yolky follicles as well as an increased incidence of follicular atresia, internal ovulation and the production of membranous or soft shelled eggs ,20. AddiIn our study, no significant differences were observed among the three treatments based on the average live body weights of chickens during the growth period and 43 weeks, which was consistent with the results of Banks and Koen (1998), who did not find a significant effect of lighting system during the growth phase on the average live body weight of birds during the production stage . HoweverPhotoperiodic responses are dependent on interactions between endogenous circadian clocks and encephalic photoreceptors . Unlike We demonstrated changes in plasma FSH and LH concentrations from 18, 22, 24, and 43 weeks. All data sets showed that hormonal changes under different photoperiods were closely related to reproduction. Pullets reared in long day length displayed higher plasma FSH and LH concentrations in the initial laying stage. This concur with Sharp\u2019s, who reported similar increase in level of these hormones when laying hens were first exposed to short photoperiods and then transferred to long photoperiods. However, when the procedure was reversed, the FSH and LH concentrations decreased . SimilarBased on the findings of this study it was concluded that day length during the growth period (12 to 18 weeks) can affect laying performance and these effects are mediated through alteration in the concentrations of gonadal hormones, which in turn is regulated through expression of related genes in the hypothalamic-pituitary-gonadal axis of female Pengxian yellow chickens. The optimal photoperiod for enhanced egg-laying in Pengxian yellow chickens of 12 to 18 weeks was found to be 8L: 16D."}
+{"text": "The aim of this study was to determine the diagnostic value of colostrum antibody concentrations in identifying Bovine Viral Diarrhoea Virus (BVDV) PI (persistently infected) calf carrying beef heifers following an experimental infection. Colostrum was collected within 12 hours of parturition and tested in undiluted, 1:5, 1:10, 1:100, 1:200, and 1:500 dilutions using an enzyme-linked immunosorbent assay (ELISA) for BVDV antibody. Cows were determined to be carrying a PI calf based on positive quantitative Real Time-Polymerase Chain Reaction and antigen ELISA result on pre-colostral serum and ear notch samples collected from their calf. The median ELISA sample-to-positive (S/P) ratio for colostrum collected from heifers that carried a PI calf were significantly higher than the median ELISA S/P ratio for colostrum collected from heifers that did not carry a PI calf at dilutions of 1:100, 1:200, and 1:500. This study provides further evidence for increased antigenic stimulation  Colostrum contains high concentrations of maternal antibodies that are selectively transferred into the mammary gland from the serum of the dam prior to calving. Concentrations of antibodies in bovine colostrum can be up to five  to 10 tiTwelve beef heifers were experimentally infected with BVDV-type 1c by co-mingling with a PI dairy cow from day 90, post artificial insemination . All cowColostrum was collected within 12 hours of calving and stored at \u221280 \u00b0C until testing could be performed. The colostrum samples were tested as undiluted samples, as well as at dilutions of 1:5, 1:10, 1:100, 1:200, and 1:500. Samples were diluted using the diluent supplied with the ELISA kit and tested in triplicate using the IDEXX BVDV Total Ab Test. Results were expressed as sample-to-positive (S/P) ratios.p-value < 0.01 considered significant. A two-graph receiver operating characteristic analysis (TG-ROC) was performed to determine DSe, DSp, and 95% confidence interval (CI) of the antibody ELISA for the detection of a PI calf for each dilution, or no dilution. The diagnostic sensitivity (DSe) and diagnostic specificity (DSp) were calculated using the following equations:A Mann-Whitney U test was performed to identify significant differences between colostrum from heifers carrying PI calves and heifers that did not carry PI calves at each dilution, with a p < 0.05), 1:200 (p < 0.01), and 1:500 (p < 0.01)  . For und < 0.01) .The TG-ROC for DSe and DSp for each dilution are shown in The purpose of this study was to determine the diagnostic value of colostrum BVDV antibody concentrations in identifying PI calves following an experimental infection of beef heifers. Previous studies ,6,7 havein utero by the BVDV viraemic PI calf. This study does not make any recommendations regarding the replacement of other PI detection methods with colostrum antibody testing, but rather, this study highlights the fact that colostrum can be used for PI calf detection and may be used in conjunction with other methods of detection.This study provides further evidence for increased antigenic stimulation i.e., BVDV antibody concentrations) supersede the ability of the ELISA to measure beyond the maximal S/P threshold. Additionally, colostrum may also benefit tests that demonstrate poor test characteristics, such as the poor diagnostic sensitivity experienced when testing for Johne\u2019s disease. This approach, while tested here in beef heifers, could most readily be applied in dairy cows, where colostrum is routinely and easily collected by the producer.The improvement in DSe observed in this study when colostrum was diluted, highlights the ability to improve the diagnostic utility of a test when disease-specific antibody concentrations ("}
+{"text": "Luman-deficient mice. One question that remained was how LUMAN deficiency affected the stress response at the cellular level leading to the changes in the physiological stress response. Here, we found that LUMAN interacts with GR through a putative nuclear receptor box site and can activate GR in the absence of a ligand. Further investigation showed that, when activated, LUMAN binds to the glucocorticoid response element (GRE), increasing the activity of GR exponentially compared to GR-ligand binding alone. On the other hand, we also found that in the absence of LUMAN, cells were more sensitive to cellular stress, exhibiting decreased secretory capacity. Hence our current data suggest that LUMAN may function both as a transcriptional cofactor of GR and a hormone secretion regulator, and through this, plays a role in stress sensitivity and reactivity to stress.LUMAN/CREB3, originally identified through its interaction with a cell cycle regulator HCFC1, is a transcription factor involved in the unfolded protein response during endoplasmic reticulum stress. Previously using gene knockout mouse models, we have shown that LUMAN modulates the glucocorticoid (GC) response leading to enhanced glucocorticoid receptor (GR) activity and lower circulating GC levels. Consequently, the stress response is dysregulated, leading to a blunted stress response in the  The secretion of glucocorticoids (GCs) is induced by neuroendocrine responses to stress in mammals and has numerous downstream effects. Aberrations in this response have been linked to common mental disorders, such as depression and anxiety, as well as various metabolic diseases and cancers . UnderstDrosophila that has been implicated in secretion; the mammalian homologs are proteins belonging to the CREB3 family , resulting in elevated GR activity  membrane-bound transcription factor that is involved in ER stress and the related UPR  as well activity . HoweverIn this paper, we examine the mechanism behind the role LUMAN plays in regulating GR activity. Here, we present data that indicates LUMAN binds to GR through the LxxLL motif and that it alters GR activity through this interaction, as well as binding to the glucocorticoid response element (GRE). These results indicate that LUMAN acts as both a transcription factor and co-factor leading to alterations in GR activity. We further examined LUMANs role in the cellular stress response and found that in the absence of LUMAN, the cells are more sensitive to cellular stress, leading to decreased secretory capacity of the cell possibly leading to altered GC release. It is clear that LUMAN plays a dual role in the stress response, working at both the whole animal level, as well as the cellular levels.ad libitum. To obtain sufficient mice in certain circumstances pups from LUMAN KO/HET, mice were cross fostered onto CD1 dams. Due to low LUMAN KO pup survival, heterozygote mice were used in all experiments except the behavior assays where LUMAN KO mice were used. Mice were euthanized by cervical dislocation and tissues were collected either in liquid nitrogen for protein and mRNA extraction or in 4% Paraformaldehyde for histological analysis.This study followed the Canadian Council of Animal Care guidelines and was approved by the Animal Care Committee at the University of Guelph. The LUMAN gene knockout mouse line was generated in collaboration with the International Gene Trap Consortium . Chimeri2 humidified atmosphere at 37\u00b0C and passaged every 2 to 3 days. Cells were plated 24 h prior to transfection and allowed to grow to 60% confluence prior to transfection. Cells were transfected by polyjet transfection reagent (SignaGen Laboratories) as per the manufacturer\u2019s instruction.All cell types were grown in monolayer culture in Dulbecco\u2019s modified Eagle\u2019s medium (high glucose) supplemented with 10% (vol/vol) fetal bovine serum (Invitrogen), 100 IU/ml penicillin, and 100 g/ml streptomycin. All cultures were maintained in a 5% COP-value < 0.05.Blood samples (100 to 150 \u03bcl) were collected in the active cycle (1100 to 1300 h) from the saphenous vein of the hind limb; serum was separated and stored at -80\u00b0C. Hormone levels were detected using a CRH enzyme-linked immunosorbent assay (ELISA) kit  as per the manufacturers\u2019 instructions, and detected using a POLARstar Omega plate reader . Statistical analysis was performed using a two-way ANOVA with repeated measures. Data were deemed significant at a Supplementary Table S1.Total RNA was isolated using Trizol  from adult mouse tissues. cDNA was synthesized from total RNA using SuperScriptIII reverse transcriptase (Invitrogen) and oligo(dT) . Transcript levels were measured by quantitative RT-PCR (qRT-PCR) using PerfeCTa SYBR green Supermix with 6-carboxy-X-rhodamine (ROX)  and primers against the mouse genes. Samples were run on a StepOnePlus Real-Time PCR System  and subjected to standard curve analysis, and arbitrary values were represented, adjusting for primer efficiencies. For primer sequences see \u00ae BCA protein assay reagent  according to the manufacturer\u2019s instructions. The blots were visualized using ECL  on Amersham Hyperfilm ECL  or using the ChemiDoc XRS + imaging system (Bio-Rad).Tissues were homogenized in Trizol  RNA was extracted and the phenol phase was frozen at -80\u00b0C until protein extraction was done. Isopropanol precipitation was performed to isolate the protein. Total protein was quantified using PiercePrimary antibodies were used at the following dilutions: GR polyclonal antibody  at 1:400, Creb3 polyclonal antibody (Proteintech), Lamin polyclonal antibody  at 1:1000, and Tubulin monocloncal antibody . Secondary horseradish peroxidase (HRP)-conjugated antibodies were used at 1:10,000 (Promega).Renilla luciferase) to correct for transfection efficiency. Assays were independently repeated at least five times, and results are shown with standard error. Statistical analysis was done using a one-way ANOVA and a Tukey test, the data had to be log transformed to meet the assumptions of normality.HEK293 cell cultures were grown to approximately 70% confluence prior to transfection using polyjet (SignaGen Laboratories) using manufacturer\u2019s instructions. The cells were co-transfected in a 12-well plate with 0.3 \u03bcg of MMTV-luc, 0.3 \u03bcg of GR, 0.05 \u03bcg of pRL-SV40 (Promega), and 0.2 \u03bcg of either pcDNA3.1, pcLUMAN, pc N terminal LUMAN, LxxLL KO N-terminal LUMAN, \u0394 AD N terminal LUMAN, or \u0394DBD N Terminal LUMAN. At 16\u201318 h post-transfection, the medium was replaced to allow the cells to recover for 8 h. Dexamethasone was then added and incubated for 12 h. The cells were harvested, and dual luciferase assays were carried out according to the manufacturer\u2019s instruction (Promega). Reporter activity was calculated as relative luciferase activity , 36 h after transfection the cells with treated with Dexamethasone (100 nm) (or ETOH for control), 12 h after treatment the cells were collected using the Genetex: Fractionation of Membrane/Cytoplasmic and Nuclear Proteins protocol. In brief, cells were collected in cold PBS, spun down, and resuspended in a hypotonic buffer, after a 15-min incubation detergent (NP40) was added, mixed, and the samples were centrifuged, the supernatant was kept as the cytoplasmic fraction. The nuclear pellet was re-suspended in cell extraction buffer, incubated for 30 min after which the sample was centrifuged, and the supernatant was transferred to a new tube as the nuclear fraction. These samples were then either stored at -80 freezer or run immediately on an SDS page gel.For lysis and co-immunoprecipitation of various LZIP constructs and the GR, HEK293 cells were transfected with indicated vectors using Polyehtyleneimine as per manufacturer\u2019s instructions . Media was changed after 6 h, 40 h after transfection cells were crosslinked using 1% paraformaldehyde (Sigma) for 10 min and were then lysed in RIPA buffer  supplemented with 1 mM PMSF as well as 10 \u03bcg/ml aprotinin and leupeptin at 4\u00b0C for 10 min. After centrifugation , the indicated antibody was immediately added to supernatant and incubated on a rotator at 4\u00b0C for 4 h. Immunoprecipitation was performed using Sera-Mag SpeedBead Protein A/G  following the manufacturer\u2019s protocol. The lysates and immunoprecipitates were detected by Western blot using the antibodies indicated by measurement with Pierce ECL Western blotting substrate .Supplementary Table S1.m-Hippo-E14 cells were cultured in 10-cm plates and either left untreated or were treated with 100 nM of DEXamethasonee. The chromatin immunoprecipitation (ChIP) assay was performed using the Chromatrap ChIP-seq Protein G kit following the manufacturer\u2019s instructions. Briefly, after cross-linking in 1% formaldehyde, the cells were lysed and sonicated yielding fragments 200\u2013600 bp. A 10% aliquot of the precleared chromatin was taken as input, and the rest was incubated with either 2 \u03bcg of CREB3 (Proteintech) or 2 \u03bcg of rabbit IGG followed by immunoprecipitation. After reversing the formaldehyde-induced cross-linking, the chromatin DNA was used in Q-RTPCR, using primers that bind in the promoter region of each gene within 200 bp of a GRE site, for primer sequences see ts0-45  and incubated at 40.5\u00b0C for 18\u201320 h to allow VSVG accumulation in the ER. Under treatment cells were incubated with 200 nM Brefeldin A for 3 h. Cells were then transferred to 32\u00b0C and incubated for specific time periods  to allow the VSVG to move to the Golgi/PM. The cells were fixed the specific time period using 4% PFA. Cells were subsequently visualized and analyzed with a confocal microscope . VSVG was considered ER associated if VSVG could be visualized within ER compartments, whereas VSVG was considered Golgi associated once VSVG entirely co-localized with the Golgi marker GM130. Data were expressed as a percentage of total cell number in each condition. Lentiviral infection of Gaussia Luciferase (GLuc)  was done in mouse embryonic fibroblasts and the conditioned media was collected and assayed to assess the level of secretion. The efficiency of infection was calculated and used to standardize the data; 48 h after infection, media were changed, and 50-\u03bcl media samples were harvested at various time points for analyses for GLuc activity to determine the rate of secretion. For the Gluc assay, statistical analysis was done using a two-way ANOVA post hoc Tukey test; for the VSVG a two-way ANOVA post hoc Dunnett\u2019s t-test was used.Mouse embryonic fibroblasts were infected with an adenoviral vector expressing YFP\u2013VSV-G2. Glass cover slips were mounted in 50% glycerol/500 pmol DAPI solution and sealed with nail polish. Images were visualized with a confocal microscope .Cells were fixed for 5 min in ice-cold methanol and blocked for 60 min in 10% goat serum at room temperature. Antibody incubations  were for 30 min at 37\u00b0C with 5% COpost hoc Tukey test or Dunnett\u2019s test, or a two-tailed student t-test. Results were considered significant when p < 0.05.All the assays were independently repeated at least three times, and results are shown with standard error. Statistical analysis was done using a one-way or two-way ANOVA with t(4) = 19.313, p = 2e-16] . When both N-terminal LUMAN and DEX were administered the reporter activity increased dramatically compared to either factor alone . There is no activation of the reporter with full-length LUMAN expression when compared to the control  (pcDNA); however, significant activation was observed once DEX was added  but the effect appeared to be dampened compared to DEX treatment alone  .To assess how LUMAN alters GR activity, a dual luciferase assay was performed in HEK293 cells to allow for the overexpression of various LUMAN constructs. The data shown indicates that N-terminal LUMAN can activate the MMTV (mouse mammary tumor virus) reporter, which contains GREs , in the Figure 1A). The LxxLL KO mutant without treatment was still able to moderately activate the reporter . When treated with DEX, a dramatic increase in activation was seen compared to DEX alone similar to cells overexpressing N-terminal and treated with DEX . With overexpression of \u0394AD, no difference in activation was seen in the absence or presence of DEX when compared to the control values   . However, the \u0394AD mutant appears to produce a very unstable protein that is not detectable through Western blot or immunocytochemical techniques but expression of the construct has been confirmed through q-RT-PCR . The \u0394DBD mutant does not affect GR activity in the absence of DEX , however, under DEX treatment the \u0394DBD mutant induces GR activity significantly when compared to DEX alone . Interestingly, this enhanced activation seen with the \u0394DBD mutant and DEX is significantly lower when compared to N terminal + DEX or the LxxLL KO mutant + DEX  , indicating different mechanisms may be at play.To determine the regions required for activation, various deletion mutants of LUMAN, LxxLL KO (NR box mutant), \u0394AD (activation domain), and \u0394DBD (DNA binding domain mutated) were tested  and cellular fractionation , we found that full length LUMAN appeared to be predominantly located in the cytoplasm, while the N-terminal LUMAN, LxxLL KO and \u0394DBD were localized in the nucleus. GR was predominantly localized in the cytoplasm until treated with DEX which caused it to translocate to the nucleus .Through immunostaining .Mouse embryonic day 18 hippocampal cells (m-hippo-E18) were used to search for LUMAN targets due to the relatively high LUMAN expression found in these cells. As well, these cells are physiologically relevant when investigating HPA axis regulation. Using chromatin immunoprecipitation, we found that in un-treated (NT) cells, LUMAN did not bind to any of the GR responsive gene promoters examined. In cells treated with DEX (100 nM), however, LUMAN bound to the promoter region of each of the genes that contain GC respond elements (GREs): period homolog 1 (Per1), and dopamine decarboxylase (DDC) and FK506 Binding Protein 5 (FKBP5) , and transfected LUMAN protein interaction with transfected GR protein in HEK293 cells . The results show that LUMAN interacts with both endogenous and transfect GR protein through the NR box.To investigate if the LUMAN protein interacts with GR, coimmunoprecipitation experiments were performed to examine endogenous protein interaction in m-hippo-E18 cells (Luman knockout (KO) strain. We found that LUMAN KO cells were more sensitive to Brefeldin A (BFA), but showed no significant to other stressors . In the Gaussia Luciferase (Gluc) assay  assay, several ER and Golgi stressors were used . These results indicate that in control experiments (no treatment or mock treatment with ethanol), there was no difference in flux through the secretory pathway  . When these cells were treated with a low level of BFA (200 nm), secretion was delayed in the KO cells when compared to WT . . These results were consistent with the VSVG assay   , in this assay a temperature sensitive VSVG mutant was transduced into the cells which were cultured at 40\u00b0C causing the protein to be retained in the ER. Once placed at a permissive temperature (32\u00b0C), the protein moved through the secretory pathway and we observed the protein location at different time points. Confirmation that treatment with 200 nM BFA induced LUMAN cleavage is shown in Supplementary Figure S2 to indicate that LUMAN is active under these conditions.To investigate potential differences in cellular secretion, two lines of mouse embryonic fibroblasts (MEFs) were used in these experiments, a wildtype (WT) strain and a Figure 4A). Under control conditions, LUMAN was not bound to the promoter region of any genes that were examined, however, under treatment with BFA, LUMAN bound to the UPRE-containing gene promoters. Each gene examined  encodes a protein that is an integral component of COPII vesicles. The expression of the five main components of COPII vesicles were then examined using qRT-PCR from both the hippocampi of WT and Luman-deficient mice , as well as WT and KO MEF cell lines . Without treatment, only Sec23 and SAR1 genes showed a significant difference between Luman-deficient and WT samples of the mouse hippocampus   . However, in WT cells , when treated with BFA, we see a significant increase in all COPII components compared to control or untreated levels , this overall increase in expression of these genes is not observed in the Luman KO cells;  . This indicates that the Luman KO cells exhibit a defective response to the BFA that is normally seen in WT cells.Given that BFA treatment is the only condition under which we observed differences in secretion, and BFA is known to inhibit the formation of COPII vesicles, we wanted to investigate if LUMAN is involved in the formation of these vesicles. To investigate if LUMAN affects COPII vesicle formation we assessed the expression of the major components that make up these vesicles in relation to LUMAN levels. Chromatin immunoprecipitation was performed using m-Hippo-E18 cells under control conditions (no treatment or ethanol) and cells treated with BFA (1 \u03bcM) . When the LxxLL motif was mutated (LxxLL KO), activation was still observed without DEX. Under DEX treatment a dramatic increase in activation was observed to be comparable to that seen with N-terminal LUMAN . This suggests that LUMAN acts as a coactivator of GR through binding at the protein level as well as alternative mechanisms. When activated via DEX, LUMAN translocates to the nucleus, and acts as both a transcription factor binding to the GRE in the promoter of the GR gene , and a cofactor, binding to GR . When LUMAN is unable to bind directly to DNA (\u0394DBD), there is no activation seen without DEX treatment , suggesting that the ligand-independent activation of GR, seen with N-terminal LUMAN, is facilitated through LUMAN\u2019s transcriptional activity. However, the \u0394DBD mutant can still enhance GR activity under DEX treatment. Taken together, these data suggest that LUMAN plays a dual role as a transcription factor, binding to promoter regions in DNA, and as a co-factor of GR, altering the GR-mediated stress response. The Co-activator ability of LUMAN likely functions through ligand-mediated binding to GR through the AF-2 domain, as \u0394DBD LUMAN was still able to act as a coactivator in the presence of DEX  this does not necessarily eliminate secretion as a possible mechanism through which LUMAN works. Regulation of CRH secretion is complex and occurs through numerous mechanisms, including immune regulation through interleukin-1\u03b2, in addition to neuropeptides such as norepinephrine (NE), serotonin , this could contribute to CRH secretion regulation. Previously we have shown that in the Luman-deficient mice there appear to be less storage vesicles in the adrenal medulla, which are believed to contain catecholamines (CA). However, no difference was found in the level of circulating CA, indicating other mechanisms may be at play (We have identified LUMAN, which is highly expressed in neuroendocrine tissues, as a potential factor that can selectively increase the secretory capacity in cells that play an important role in HPA axis function. Although no significant difference was observed in the stress-induced secretion of CRH between erotonin  and braierotonin . In the  at play . Taking In conclusion, LUMAN alters GR activity through binding GR via the LxxLL motif, and it also acts as a transcription factor, binding GREs independently of GR. Additionally, LUMAN alters the secretory capacity of cells when the secretion demand is high, through altering gene expression of the components of COPII vesicles. We therefore postulate that LUMAN plays dual roles in the stress response, regulating secretion at the cellular level, and acting as a cofactor of GR. It is clear that LUMAN plays key roles in the stress response, altering stress sensitivity; this suggests LUMAN as a potential factor that may be involved in the development of stress-related pathologies.JP designed the study, executed the experiments, analyzed and interpreted the data, wrote and edited the manuscript, made the figures, and submitted the paper. TT helped to design Co-IP experiments, completed the Co-IP experiments, and edited the paper. NM and RL helped in designing the study and interpreting data along with edits.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Oryza rufipogon Griff.) is the most closely related ancestral species to Asian cultivated rice (Oryza sativa L.). It contains various valuable traits with regard to tolerance to cold, drought and salinity, flowering diversity and many quantitative trait loci with agronomic important traits. Flowering is one of the most important agronomic traits. However, flowering-related transcriptome and how to be regulated by miRNAs have not been estimated in O.rufipogon. To identify how the genes and miRNAs regulating flowering in O.rufipogon. Three O.rufipogon RNA libraries, two vegetative stages (CWRT-V1 and CWRT-V2) and one flowering stage (CWRT-F2) were constructed using leaves tissue and sequenced using Illumina deep sequencing. 27,405, 27,333, 28,979 unique genes were obtained after mapping to the reference genome from CWRT-V1, CWRT-V2 and CWRT-F2, respectively. Then differentially expressed genes (DEGs) were screened and got 1419 unique genes are likely to involve in flower development. Detailed information showed that MADS box and floral meristem identity genes, such as MADS 1, MADS14, Hd1 are involved in common wild rice. Then, combined analysis of miRNA and mRNA expression profiles was performed. Twenty three known miRNA-mRNA pairs and five new candidates were presented an anti-correlationship. Interestingly, 12 miRNAs were negatively correlated with 20 mRNAs encoding flowering-related proteins, indicating that miRNAs regulated target genes to promote flowering in CWRT-F2 group. The results provided here genomic resources for flowering related genes and how these flowering genes were regulated by miRNAs in common wild rice.Common wild rice (The online version of this article (10.1007/s13258-018-0688-y) contains supplementary material, which is available to authorized users. Hd1-Hd3a and Ghd7-Ehd1-Hd3a/RFT1 module    , is distributed only at lower latitudes in the tropical and subtropical regions of Asia and Oceania  gene family, and over-expression of miR156 results in many more tillers, delay of flowering, and small panicles -like transcription factors, and over-expression of miR172 promotes early flowering and severe reduction in panicle branching  TFs. Overexpression of miR171 delays flowering in barley and rice , a class of 20\u201324 nt, non-coding, small RNAs. These miRNAs down-regulate flowering-related genes via complementarity of the 9\u201311th nucleotide positions at the 5\u2032 end of the miRNAs with the target gene  according to the manufacturer\u2019s instructions. RNA samples that met the requirements were used to construct the sequence libraries. mRNA sequencing samples were prepared using the RNA-seq sample preparation kit . Following the Illumina manufacturer\u2019s procedures, mRNA was purified from 10\u00a0mg of the pooled total RNA using polyT oligo-attached magnetic beads. Fragmentation buffer was added to disrupt the mRNA into short fragments. Reverse transcriptase and random primers were used to synthesize the first strand cDNA from the cleaved mRNA fragments. The second strand cDNA was synthesized using buffer, dNTPs, RNase H, and DNA polymerase I. The double strand cDNA was purified with QiaQuick PCR extraction kit  and washed with EB buffer for end repair and single nucleotide A(adenine) addition. Finally, sequencing adaptors were ligated to the fragments. The required fragments were purified by agrose gel electrophoresis and enriched by PCR to construct a cDNA library. The cDNA libraries were named with CWRT-V1 (leaf sample from one-flowering sub-group), CWRT-V2 (leaf sample from one-flowering sub-group) and CWRT-F2 (leaf sample from double-flowering sub-group).Japonica reference sequences (http://rice.plantbiology.msu.edu) using SOAP aligner/soap2 . Clean reads were mapped to After calculating the gene expression level, the differentially expressed genes (DEGs) were screened by comparison of their expression levels. the method described by Audic and Claverie  was usedOsActin (GenBank:AB047313)  and each cDNA was amplified by real-time PCR with the gene-specific primers using the SYBR green method. Each dilution was replicated three times. The mean of three replications was used in determining the absolute value of the slope of log (input amount) versus \u0394CT. The relative quantitative method (\u0394\u0394CT) was used to calculate the fold change of target genes , 7,088,016 (98.01%) and 7,108,858 (99.35%) clean reads . Between the CWRT-V1 and CWRT-F2 libraries, 1740 unigenes were significantly up-regulated, while 982 unigenes were significantly down-regulated. The up-regulated and down-regulated transcripts were shown in Fig.\u00a0In order to identify flowering-related gene expression, we utilized the set of genes identified by DGE analysis for each of the three libraries. In theory, DGEs derived from comparison of CWRT-F2 vs CWRT-V1 represented only the genes that were expressed differentially between flowering and vegetative stages, as well as between different materials. Similarly, DGE gene sets derived from CWRT-V1 versus CWRT-V2 represented only the differentially expressed genes in the vegetative stages from the two sub-groups. Through comparison of DGE expression data between the V1 and V2 sub-groups, V2- and F2 sub-groups, and V1 and F2 sub-groups , indicating these genes were related to flowering. Other genes, such asOsMADS14 and Hd1, were strongly up-regulated in the CWRT-V1 library, indicating that these genes were related to floral meristem differentiation.MADS box genes are parts of a large family which regulates several types of developmental traits, including flower development in plants. To identify MADS box genes putatively involved in flower development, we screened the 1419 flowering-related genes. Through this heuristic search we found 12 genes involved in the flower transition and flower development  have been found to participate in flowering from CWRT-V1 and CWRT-F2 libraries , have been reported to be involved in controlling flowering time. One gene (LOC_Os01g62660.1\u2014a putative MYB family transcription factor), targeted by miR164, was up-regulated by miRNAs between CWRT-V1 and CWRT-F2 libraries.In order to screen the miRNA-mRNA pairs for a role in regulation of flowering, target genes related to flowering were retrieved. In total, 12 miRNA-mRNA interacting pairs were identified that related to flowering Table\u00a0. Among tIn addition to analyze the interactions between known miRNAs and mRNAs, we also found 4 new miRNA-mRNA pairs involving in flowering. All of the four previously-unknown miRNAs were up-regulated during flowering stage, except ru-miR4 which was down-regulated. Two targets of oru-miR135 were down-regulated; these were LOC_Os05g27930.1, a predicted as AP2 domain containing protein, and LOC_Os11g45740.1, an MYB family transcription factor. A target (LOC_Os06g24070.1) of oru-miR180 was a predicted MYB-like DNA-binding domain containing protein. LOC_Os09g39410.1, a putative male sterility protein, was up-regulated by oru-miR4.Quantitative RT-PCR experiment was then performed to verify the relationship between miRNA and mRNA pairs. Eight differentially expressed miRNAs and 17 mRNAs were randomly selected for this qRT-PCR experiment. Comparison of the qPCR and sequencing data showed similar trends in gene expression for most miRNAs and mRNA, with the exception of some differences in fold changes Fig.\u00a0. We alsoCommon wild rice is a useful resource for improvement of cultivated rice, with many potentially valuable genes for introgression. This work used next-generation sequencing technologies to investigate transcriptomic changes of a double-flowering common wild rice, compared with normal common wild rice, to discover flowering-related genes. 1419 differentially expressed mRNAs potentially involved in flowering were screened. Several flower meristem differentiation and flower stage developmental genes were up-regulated significantly in the reproductive stage. Besides DEGs, 44 differentially expressed miRNAs related to flowering time were identified in the previous study Supplementary material 2. Table S2 Differentially expressed genes identified in the three cDNA libraries. (XLSX 642 KB)Supplementary material 3. Table S3 The miRNAs negatively correlated with their target genes from two databases (CWRT-V1 and CWRT-F2). (XLSX 17 KB)"}
+{"text": "In the current study, we tested adults\u2019 temporal and numerical processing under cognitive load, a task that compromises attention. Under the premise of a common magnitude system, one would predict cognitive load to have an identical impact on temporal and numerical judgments. Inconsistent with the common magnitude account, results revealed baseline performance on the temporal and numerical task was not correlated and importantly, cognitive load resulted in distinct and opposing quantity biases: numerical underestimation and marginal temporal overestimation. Together, our data call into question the common magnitude account, while also providing support for the role of attentional processes involved in numerical underestimation.Prominent theories suggest that time and number are processed by a single neural locus or a common magnitude system e.g., . However In contrast, durations are overestimated in the presence of negatively valenced stimuli1  underlying numerical and temporal processing. Because distinct patterns of estimation occur in the presence of emotional faces \u2013 only angry faces lead to temporal overestimation, but both angry and happy faces lead to numerical underestimation \u2013 some have explained these results by the differential effects of arousal and attention on quantitative processing . While pIn the current study, adults made temporal and numerical judgments under cognitive load \u2013 a distracting, working memory task \u2013 in order to assess the likelihood of the common magnitude system. Under the premise of a common magnitude system, one would predict altered attention from the cognitive load manipulation to identically impact numerical and temporal judgments. However, if numerical and temporal processing are dictated by distinct cognitive systems, temporal and numerical biases under cognitive load may not track together.Mage = 19.15 years). After exclusions (see criteria below), there were 71 participants with complete data.Eighty Boston College undergraduates participated in this study for course credit or cash compensation  and the order of the blocks within each task (baseline vs. cognitive load) were counterbalanced. However, the order remained consistent within each participant \u2013 if the participant completed the cognitive load trials first in the temporal bisection task, s/he would also complete the cognitive load trials first in the numerical bisection task.In the numerical bisection task, participants were first familiarized to a small (15 dots) and a large (60 dots) standard value (modeled after 2). Thus, individual dots were smaller as the number of dots in the array increased. The other half of the dot arrays controlled for dot size such that each dot, regardless of the numerosity of the array, had an area of 4.01 cm2. Thus, dot arrays with fewer dots also had a smaller cumulative surface area (cumulative areas ranged from 59.9 to 239.99 cm2).In the baseline block of the numerical task, participants then completed additional practice trials in which they were presented with arrays containing intermediate numerosities  in addition to the standard values and were asked to indicate whether the numerosity of the display was more similar to the small or large standard. Each numerosity  was shown once in a randomized order, resulting in seven baseline practice trials. Participants completed these baseline practice trials to familiarize them to the demands of the task. After completing the practice trials, participants then completed the baseline test trials, during which each of the seven numerosities were presented 12 times each in a random order, resulting in a total of 84 test trials. Dot arrays were presented for 750 ms. For each numerosity, there were twelve different configurations of dots. Within each array, the size of all dots was held constant; however, dot sizes varied across arrays. Half of the arrays controlled for cumulative surface area, such that regardless of the numerosity, the cumulative area of the array was held constant  for 750 ms and were told to remember and alphabetize the letters. Participants were then presented with the dot array. After making their numerical judgment , participants were shown a text box in which they were instructed to type the four letters in alphabetical order . The participants first completed seven practice trials (one with each numerosity), and then completed 84 test trials (12 displays of each numerosity). During test, participants were only asked to type the letters alphabetically on a random two-thirds of the trials; however, participants did not know when they would be required to type the letters in alphabetical order, thus they were required to perform the working memory task on every trial in anticipation of receiving the prompt. The progression of the cognitive load trials can be found in The temporal bisection task was identical to the numerical bisection, except participants saw a blue oval in the center of the screen for a specified duration instead of a dot array. Participants were familiarized to two standard durations, a short standard (400 ms) and a long duration  and an additional three participants only completed one trial type (baseline or cognitive load). Thus, performance on the task or block that was not completed was coded as missing data.NBaseline = 1, NCognitiveLoad = 2; Time: NBaseline = 1; NCognitiveLoad = 2).Data from participants who performed poorly on test trials involving the standard values  were excluded .To assess participants\u2019 accuracy on the cognitive load task, we calculated the percentage of trials during which each participant correctly alphabetized the letters for the numerical and temporal bisection separately. Participants who typed in the letters without alphabetizing them were removed from the cognitive load analyses (Two dependent measures were taken from the bisection task:(1)Relative Point of Subjective Equality (PSE). The PSE corresponds to the value at which 50% of the responses were classified as \u201clarge\u201d (or \u201clong\u201d). First, the proportion of responses during which the participant judged the numerosities (or durations) as being closer to the large (long) standard was plotted as a function of the stimulus numerosity (or duration) and these data were fit with a Cumulative Gaussian function . Because PSE varies based on the range of values for each task (15\u201360 for number and 400\u20131600 for time), we calculated a Relative PSE for each task and trial block separately. The Relative PSE was calculated by dividing each participant\u2019s PSE by the geometric mean of the standard values , thus allowing for direct comparisons between temporal and numerical performance.n as per . These c(2)Relative Difference Limen (DL). The DL is a measure of the participant\u2019s consistency in responding and corresponds to the value halfway between the set sizes corresponding to a 75% probability of a large/long response and a 25% probability of a large/long response. Outliers were replaced with the next largest/smallest value within the range . Again, we calculated the Relative DL by dividing each participants\u2019 DL by the geometric mean of the standard values.p\u2019s > 0.05); thus, we collapsed data across these variables in the subsequent analyses.First, we confirmed that the order in which participants completed the bisection task  and/or the block order  did not interact with our variables of interest . Neither the order in which participants completed the bisection tasks  nor the order of the blocks (baseline vs. cognitive load) interacted with our variables of interest .The common magnitude account would predict a correlation between baseline performance on the numerical and temporal bisection. However, performance on the baseline numerical and temporal tasks was not correlated  = 0.723, p = 0.472 .Next, we tested whether cognitive load accuracy  differed as a function of the task . This was done to ensure that cognitive load affected participants in each task approximately equally. A paired samples F = 22.063, p < 0.001, Figure 2). No other main effects reached significance, p\u2019s > 0.2. To follow up on the Task \u00d7 Block interaction, we next conducted paired samples t-tests comparing the baseline and cognitive load trials within the numerical and temporal task separately. Cognitive load trials  were significantly underestimated compared to baseline trials  in the numerical bisection, t(75) = -4.634, p < 0.001, See Figures 4A whereas cognitive load trials  were marginally overestimated compared to baseline trials  in the temporal bisection, t(75) = 1.890, p = 0.063, See Figures 4B providing support for the role of attention in numerical processing by indicating numerical underestimation under cognitive load. Lastly, we conducted additional paired samples t-tests to compare numerical and temporal processing in each block separately. Performance at baseline was comparable on the numerical and temporal task during the baseline trials t(73) = -1.990, p = 0.05. However, under cognitive load performance, the relative PSE on the numerical task was significantly greater than the temporal, t(71) = 2.743, p = 0.008, emphasizing the unique effect of cognitive load on the two bisection tasks.In order to directly compare biases on the numerical and temporal task, we conducted a 2  \u00d7 2 (Block: baseline versus cognitive load) repeated measures ANOVA on the Relative PSE. There was a significant Task \u00d7 Block interaction, F = 4.841, p = 0.031, M = 0.147, SE = 0.006) was significantly lower to that of the temporal task , indicative of more consistent responding in the numerical task across both Blocks. No other main effects or interactions reached significance, p\u2019s > 0.8 .In order to test the effects of cognitive load on the consistency of participants\u2019 responding, we conducted identical repeated measures ANOVA on the Relative DL in both the numerical and temporal tasks. There was a main effect of task, Understanding how quantity processing occurs in the real world is critical for assessing prominent theories of quantity processing and can also shed light on the cognitive mechanism(s) underlying these processes. Previous research identified numerous similarities in processing quantities such as time and number, leading to the prominent common magnitude system theory see . HoweverFirst, the common magnitude system would predict performance on comparable temporal and numerical tasks to be correlated. Replicating previous work, our baseline data revealed no correlation between performance on our temporal and numerical tasks see . This fiThe common magnitude system would not only predict a correlation between temporal and numerical processing, but also temporal and numerical biases to track in the same direction under identical conditions. Despite this, several studies have demonstrated unique temporal and numerical biases in the presence of emotional content . While tOur study also aimed to further explore the effect of attention on temporal and numerical processing. While previous work has suggested heightened arousal leads to temporal overestimation, but altered attention leads to numerical underestimation , attentiarousing stimuli on temporal judgments across different timing tasks. Although angry faces lead to temporal overestimation in bisection, estimation, and production tasks, emotion does not impact temporal performance on reproduction or generalization tasks  demonstrating inconsistencies in representing different types of quantity within individuals, and (b) showing numerical underestimation, but slight temporal overestimation during an attention distracting task. Although our findings suggest that attention is critical for numerical processing, more work is needed to shed light on This study was carried out in accordance with the recommendations of Institutional Review Board, Boston College. The protocol was approved by the Institutional Review Board, Boston College. All subjects gave written informed consent in accordance with the Declaration of Helsinki.KH and MK completed all data collection. KH wrote the manuscript. MK, KJ, and SC provided thoughtful feedback on the manuscript. All authors contributed to the design of the study and approved of this version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Meloidogyne chitwoodi commonly known as Columbia root-knot nematode or CRKN is one of the most devastating pests of potato in the Pacific Northwest of the United States of America. In addition to the roots, it infects potato tubers causing internal as well as external defects, thereby reducing the market value of the crop. Commercial potato varieties with CRKN resistance are currently unavailable. Race specific resistance to CRKN has been introgressed from the wild, diploid potato\u00a0species Solanum bulbocastanum into the tetraploid advanced selection PA99N82\u20134 but there is limited knowledge about the nature of its resistance mechanism. In the present study, we performed histological and differential gene expression profiling to understand the mode of action of introgressed CRKN resistance in PA99N82\u20134 in comparison to the CRKN susceptible variety Russet Burbank.Histological studies revealed that the nematode juveniles successfully infect both resistant and susceptible root tissue by 48\u2009h post inoculation, but the host resistance response restricts nematode feeding site formation in PA99N82\u20134. Differential gene expression analysis shows that 1268, 1261, 1102 and 2753 genes were up-regulated in PA99N82\u20134 at 48\u2009h, 7\u2009days, 14\u2009days and 21\u2009days post inoculation respectively, of which 61 genes were common across all the time points. These genes mapped to plant-pathogen interaction, plant hormonal signaling, antioxidant activity and cell wall re-enforcement pathways annotated for potato.M. chitwoodi resistant and susceptible potato genotypes after nematode inoculation. The knowledge generated in the present study has implications in breeding for CRKN resistance in potato.The introgressed nematode resistance in PA99N82\u20134 is in the form of both pattern-triggered immune response and effector-triggered immune response, which is mediated by accumulation of reactive oxygen species and hypersensitive response (HR). Salicylic acid is playing a major role in the HR. Polyamines and suberin (a component of the Casperian strip in roots) also play an important role in mediating the resistance response. The present study provides the first ever comprehensive insights into transcriptional changes among  Meloidogyne chitwoodi Golden, O\u2019Bannon, Santo & Finley commonly known as the Columbia root-knot nematode (CRKN) is one of the most severe pests of potato in the Pacific Northwest (PNW). This nematode was first reported in several areas in the PNW in 1977  and mapped to potato chromosome 11, there is limited understanding of the underlying resistance mechanism  in addition to genes that are related to ROS production and HR in the resistant roots. For example, genes involved primarily in regulation of ROS, such as superoxide dismutase (SOD) and glutathione transferase were up-regulated in PA99N82\u20134 roots after nematode infection. These are a major part of the scavenging system that clears the free radicals after HR and act as antioxidants that protect the host tissue from further damage. In addition, phenylalanine ammonia lyase (PAL) and chalcone synthase B (CHS), the major genes involved in the phenylpropanoid and flavonoid pathways, were up-regulated during the resistance response. These genes are known to be induced by wounding, salinity stress, and pathogen attack [CHS up-regulation would indicate oxidative stress in resistant roots. Altogether, our data support the hypothesis that CRKN infects resistant PA99N82\u20134 roots but triggers strong defense responses as it attempts to establish a feeding site. In addition, PAL indicates a SA-accumulation during the resistance response.Previous work involving root penetration assay in PA99N82\u20134 reported HR around the head of nematode juveniles, suggesting that the nematode triggers a strong defense response while attempting to establish feeding sites, at around 7dpi . The stun attack , 42 and n attack . CHS up-RPM1, RSP2, SGT1, PIK1, EDS1, HSP90 up-regulated in PA99N82\u20134. Although R-genes RPM1, PIK1, and RSP2 are not known to be involved in nematode resistance, the upregulation of these genes suggests that transcriptional control of R-genes in general may be released, allowing for their enhanced expression [SGT1 and HSP90 also points to a modulation of R-protein levels in resistant roots. EDS1 is known to be involved in signal amplification and protection of SA-dependent defense response pathways [WRKY was also up-regulated in PA99N82\u20134. Members of the WRKY gene family exhibit functional redundancy and the contribution of individual members in a resistance response is indistinct. WRKY genes have been indicated to play a significant role in Mi-1 mediated gene-for-gene resistance response to bacterial pathogen in Arabidopsis [Mi-1 mediated resistance to aphids and nematodes in tomato [Plant resistance proteins (R-protein) often contain putative nucleotide-binding sites (NBS) and leucine-rich repeats (LRR) domains. When we searched our transcriptome data for R-genes and their signaling partners, we found pression . The enhpathways . In addibidopsis  and Mi-1n tomato . Recentln tomato . It is cPRb1 in tomato, and thereby contribute to cold stress induced disease resistance [Up-regulation of the genes involved in polyamine biosynthesis during the resistance response in PA99N82\u20134 is interesting as conjugates of polyamine such as spermine and spermidine have been reported to accumulate during the activity of the plant resistance mechanism to various pathogens , 50. Ressistance . Higher sistance , 54. PAssistance , 56, howCell-wall reinforcement by the deposition of cell-wall constituents has been observed to be PAMP induced, and occurring as a late response to various pathogens . In PA99M. chitwoodi resistance mechanism in PA99N82\u20134. Once these genes are validated, the data can be used to develop molecular markers linked to the resistance trait to facilitate marker-assisted-selection for development of CRKN resistant potato varieties for the PNW potato production region of the United States.Our proposed model of plant-nematode resistance interaction suggests that J2\u2019s enter the roots of both resistant and susceptible potato plants and the nematodes migrate to the vasculature where they attempt to establish feeding sites. With nematodes in and around resistant host root tissue, PTI is triggered as an early response. Subsequently, when nematodes migrate more deeply into the root vasculature and secrete a suite of molecules (effectors) to initiate feeding site formation, one or more of these effectors are recognized by the R-gene(s) present only in the resistant host. This interaction between the nematode effector and host R-gene activates gene expression leading to ETI. ETI triggers the accumulation of SA, which subsequently results in ROS accumulation and HR. We believe that ETI based HR inhibits feeding site formation and thus nematodes fail to develop further. Eventually, juveniles die or migrate out of the root system. The resistance response also activates the ROS scavenging system in the host. It seems that primary and secondary scavenging systems alike are activated to lessen or prevent the impact of ROS activity on the host cells. The role of polyamines in resistance response mechanisms warrants further research; it may act as both HR mediator and the ROS scavenger. We also hypothesize that suberin plays a crucial role in cell wall re-enforcement of the resistant host root tissue to prevent it from further nematode attacks Fig.\u00a0. UltimatMeloidogyne chitwoodi) is a potato pest of economic significance in the Pacific Northwest of the United States of America. It negatively impacts potato yield and tuber quality. Current control practices are limited to the use of hazardous chemical fumigants and nematicides. Development of nematode resistant potato varieties could be a far more effective approach to reduce damage to the crop, but resistant potato varieties for commercial distribution are unavailable. Resistance to this nematode was identified in wild potato species and later bred into advanced potato selection, but the underlying resistance mechanism is largely unknown. Based on histological and gene expression data, the nematode can enter both resistant and susceptible potato roots, but the resistant plant inhibits feeding site formation, a major event in nematode parasitism. The presence of the nematode inside the resistant root tissue triggers an immunological response that restricts further development of the nematode. This is the first-ever report of gene expression analysis characterizing the resistance response to CRKN in potato. The knowledge generated by this study has implications for potato breeding, thus reducing chemical inputs to the crop, and easing the environmental impacts of potato production.Columbia root-knot nematode (M. chitwoodi (race 1) resistant breeding clone PA99N82\u20134 and susceptible cultivar Russet Burbank were procured from the Potato Tissue Culture Lab (Nuclear Seed Potato Program), University of Idaho, Moscow, Idaho, USA. Plantlets were grown for four weeks in a 2:1 sand: soil mixture in one-gallon clay pots in tightly regulated greenhouse conditions (18.5\u2009\u00b0C and 20\u2009h light). M. chitwoodi race 1 eggs were acquired from the United States Department of Agriculture, Agriculture Research Service, Prosser, Washington, USA. Eggs were extracted from 10-week old infected tomato roots using 40% bleach solution, suspended in distilled water and held in petri dishes for ten days at 24\u2009\u00b0C under dark condition to promote hatching. At regular intervals, 1\u2009ml of the hatching solution was applied to a hemocytometer and observed under a microscope for juveniles. Subsequently, hatched second stage juveniles (J2) were counted and stored in glass bottles at 4\u2009\u00b0C.Tissue culture plantlets of Four replicates each of PA99N82\u20134 and \u2018Russet Burbank\u2019 were included for each of five different time points: 24 hpi, 48 hpi, 7 dpi, 14 dpi and 21 dpi. The replicates were inoculated with 1200 freshly hatched J2\u2019s each by pipetting J2 suspension in equidistant shallow holes made around the root surface. Root tissue of three of the replicates was collected for RNAseq studies and one replicate was subjected to microscopic examination in order to determine the progression of the infection. Whole root tissue was washed thoroughly under running tap water, dried carefully with paper towels, snap-frozen in liquid nitrogen and stored at \u2212\u200980\u2009\u00b0C until RNA isolation.Microscopic examination of the inoculated root tissue (24 hpi to 21 dpi) was performed to confirm the progression of infection and to select the time points for RNAseq. Roots were washed thoroughly under running tap water and stained with fuchsin-glycerin as described by Bybd . Roots wThree biological replicates each of nematode inoculated PA99N82\u20134 and \u2018Russet Burbank\u2019 at time points: 48\u2009h, 7\u2009days, 14\u2009days and 21\u2009days post inoculation were used for RNA extraction. Total RNA was extracted from whole root tissue using the Plant RNA Maxi kit  following the manufacturer\u2019s protocol. Approximately 7\u201312.5\u2009g of each root was ground thoroughly in liquid nitrogen using RNase-free pestle and mortar. Lysate was transferred through homogenization RNA maxi column, followed by RNA precipitation with absolute ethanol. The precipitated mix was then applied to HiBind RNA maxi spin column and membrane bound RNA was washed several times with the RNA wash buffers provided in the kit. RNA was eluted from the column membrane with RNase-free diethyl pyrocarbonate (DEPC) treated water and stored at \u2212\u200980\u2009\u00b0C. RNA integrity was checked by running a bleach agarose gel ; and iniLibrary preparation and sequencing was performed at the CGRB, Oregon State University, Corvallis, Oregon using NEBNEXT\u00ae ULTRA\u2122 RNA Library Prep Kit . The libraries were sequenced using an Illumina Hiseq3000 instrument (1X150bp) .Solanum tuberosum reference genome (Group Phureja DM1\u20133 v3.4) using Hisat2. Differential gene expression analyses were performed using Cuffdiff. Fragments per kilo base per million mapped reads (FPKM) was calculated for each transcript in three replicates each of PA99N82\u20134 and \u2018Russet Burbank\u2019 considering the fold change (FC)\u2009\u2265\u20091 as significant. Heatmaps were prepared using Heatmapper [Raw data quality was assessed using FastQC  with defatmapper . Three rSolanum tuberosum as preferred species; GO terms were searched for three major aspects: biological processes, molecular functions and cellular components with threshold p-value \u22640.01. In order to perform the pathway search, S. tuberosum gene IDs (PGSCDMG) of significant genes were converted to Uniprot IDs using gProfiler [S. tuberosum as the reference species [Gene ontology (GO) categories were assigned to the differentially expressed genes (FC\u2009\u2265\u20091) based on annotations in the PlantTFDB 4.0  using ReProfiler . Uniprot species .https://phytozome.jgi.doe.gov/pz/portal.html) and primers were designed using Oligo Analyzer 3.1  with the following parameters: Tm: 55\u201360\u2009\u00b0C, Length: 12\u201330, GC content: 40\u201358% with no secondary structures. Primers were synthesized from Integrated DNA Technologies . Details of the primers is presented in Table\u00a018 , 1\u2009mM dNTPs  and PCR grade water. cDNA diluted to 1/5 times provided a template for qPCR amplifications using Quant Studio 3 Real-Time PCR system . Two technical replicates of each of the three biological replicates along with no RT control (NRT) and no template control (NTC) were used in qPCR reaction for each transcript. The 26S proteasome regulatory subunit (RPN7) gene was used as endogenous control [\u03b4\u03b4ct method [qPCR validation was performed using the top ten significant genes up-regulated in the resistant clone PA99N82\u20134 with respect to the susceptible cultivar \u2018Russet Burbank\u2019. The shortlisted gene sequences were downloaded from Phytozome . All genes colored red are significantly up-regulated in PA99N82\u20134; green colored genes have been characterized for Solanum tuberosum in KEGG pathway. The image was generated using KEGG Mapper search and color pathway tool found at https://www.genome.jp/kegg/tool/map_pathway2.html.Additional file 3: Figure S2. Schematic representation of plant hormone signal transduction taking place during the nematode resistance response based on the differentially expressed genes (up-regulated in PA99N82\u20134). All genes colored red are significantly up-regulated in PA99N82\u20134; green colored genes have been characterized for Solanum tuberosum in KEGG pathway. The image was generated using KEGG Mapper search and color pathway tool found at https://www.genome.jp/kegg/tool/map_pathway2.html."}
+{"text": "New compounds with the general formulae [CuX2(INH)2]\u00b7nH2O (X = Cl\u2212 and n = 1 (1); X = NCS\u2212 and n = 5 (2); X = NCO\u2212 and n = 4 (3); INH = isoniazid, a drug widely used to treat tuberculosis) derived from the reaction between the copper(II) chloride and isoniazid in the presence or absence of pseudohalide ions (NCS\u2212 or NCO\u2212) were synthesized and characterized by infrared spectrometry, electronic absorption spectroscopy, electron paramagnetic resonance (EPR) spectroscopy, elemental analysis, melting points and complexometry with 2,2\u2032,2\u2032\u2032,2\u2032\u2032\u2032-tetraacetic acid (EDTA). The characterization techniques allowed us to confirm the formation of the copper(II) complexes. The Cu(II) complexes were loaded into microemulsion (MEs) composed of 10% phase oil (cholesterol), 10% surfactant [soy oleate and Brij\u00ae 58 (1:2)] and 80% aqueous phase (phosphate buffer pH = 7.4) prepared by sonication. The Cu(II) complex-loaded MEs displayed sizes ranging from 158.0 \u00b1 1.060 to 212.6 \u00b1 1.539 nm, whereas the polydispersity index (PDI) ranged from 0.218 \u00b1 0.007 to 0.284 \u00b1 0.034. The antibacterial activity of the free compounds and those that were loaded into the MEs against Staphylococcus aureus ATCC\u00ae 25923 and Escherichia coli ATCC\u00ae 25922, as evaluated by a microdilution technique, and the cytotoxicity index (IC50) against the Vero cell line (ATCC\u00ae CCL-81TM) were used to calculate the selectivity index (SI). Among the free compounds, only compound 2 (MIC 500 \u03bcg/mL) showed activity for S. aureus. After loading the compounds into the MEs, the antibacterial activity of compounds 1, 2 and 3 was significantly increased against E. coli  and S. aureus . The loaded compounds were less toxic against the Vero cell line, especially compound 1 (IC50 from 109.5 to 319.3 \u03bcg/mL). The compound 2- and 3-loaded MEs displayed the best SI for E. coli and S. aureus, respectively. These results indicated that the Cu(II) complex-loaded MEs were considerably more selective than the free compounds, in some cases, up to 40 times higher.The aim of this study was to construct a nanostructured lipid system as a strategy to improve the  The ability of bacteria to acquire resistance to drugs that are used as therapeutic agents has become a significant problem because there is a daily increase in the microbial resistance to the currently used antibiotics . The proCopper is the third most abundant transition element in the human body and is present in the active site of enzymes that participate in oxidative reactions, such as cytochrome oxidase and superoxide dismutase. Furthermore, it has long been recognized that copper compounds are capable of inhibiting a wide variety of fungi and bacteria ,4.The Cu(II) ion has a tendency to interact with molecules to yield coordination compounds with different properties, including antibacterial activity. A coordination compound or metallic complex is the product of a Lewis acid-base reaction in which neutral molecules or anions  bind to a central metal atom (or ion) by coordinate covalent bonds .2], TTA = 2-tenoyltrifluoroacetone, which was synthesized and characterized by Xu et al.  (HL = 4-[(E)-(2-hydroxy-4-methoxyphenyl)methyleneamino]benzoate) against E. coli and S. aureus and showed MICs of 500 \u03bcg/mL for both bacteria.There has been an increasing interest in the literature on the investigation of copper(II) complexes with antimicrobial activity . The comu et al. , showed in vivo experiments. Therefore, researchers have sought alternatives to produce these metallic compounds through technological strategies to effectively compartmentalize this diverse group of molecules and modify their behavior in the body \u00b7H2O (1), 2(INH)2]\u00b75H2O (2), 2(INH)2]\u00b74H2O (3), \u00ae 58 (1:2)] and 80% aqueous phase (phosphate buffer pH = 7.4). Then, the antimicrobial activity of the Cu(II) compounds was evaluated on two different bacterial strains (Staphylococcus aureus and Escherichia coli) and tested on VERO cells  to determine their cytotoxicity (IC50).This study reports the preparation and spectroscopic characterization of three copper(II) complexes containing isoniazid (INH) as a ligand, IR spectroscopy is one of the most widely used physical methods for inferring the binding mode of the isoniazid ligand. The most important IR frequencies of the new copper(II) complexes and their assignments are presented in 2 group and/or pyridine ring as well as by the carbonyl oxygen. IR spectroscopy allows us to obtain valuable information regarding the participation of these groups in the coordination. When the nitrogen of the -NH2 group is involved in the coordination, there is a negative shift in the \u03bdNH mode (\u0394 = \u03bdligand \u2212 \u03bdcomplex)  (X = SNC\u2212 (2) and NCO\u2212 (3)), consists of two isoniazid ligands coordinated by the nitrogen atom of the -NH2 group and the carbonyl oxygen atom, forming two five-membered chelate rings and two pseudohalide groups. For compound 2, the two thiocyanate groups are likely terminally coordinated by the sulfur atoms, whereas the cyanate pseudohalides are terminally linked by the nitrogen atoms in compound 3.For complexes The diameter of the ME particles was 125.6 \u00b1 1.804 nm. After the incorporation of the complexes, there was a small variation in the particle diameter size, ranging from 158.0 \u00b1 1.060 to 212.6 \u00b1 1.539 nm. All values are smaller than 1.0 \u03bcm, which is characteristic of one ME , TTA = 2-tenoyltrifluoroacetone compound studied by Xu et al.  (HL = 4-[(E)-(2-hydroxy-4-methoxyphenyl)methyleneamino]benzoate), which exhibited an MIC of 500 \u03bcg/mL [E. coli and S. aureus.Regarding the activity against 00 \u03bcg/mL . There a3 (IC50 from 325.3 to higher than 500). The compounds also exhibited higher selectivity index values, even though they still are not ideal (SI higher than 10).Moreover, as shown in 2\u00b72H2O, isoniazid (INH), polyoxyethylene-20 cetyl ether (Brij\u00ae 58), potassium cyanate and rezasurin were purchased from Sigma-Aldrich . Methanol, dimethylsulfoxide (DMSO), dimethylformamide (DMF) and tetrahydrofuran (THF) were purchased from Merck Sharp & Dohme Ltd. . Dulbecco\u2019s modified Eagle\u2019s medium (DMEM), fetal bovine serum, gentamicin sulfate, and trypsin/EDTA were purchased from Vitrocell Embriolife . Soy phosphatidylcholine was purchased from Lipoid . All the solutions were prepared using deionized water from a Millipore instrument .Amphotericin-B (AMB), cholesterol (CHO), CuCl3 of CH3OH and added dropwise to a green solution of CuCl2\u00b72H2O  in 15 cm3 of the same solvent, producing a light green suspension. After stirring for 3 h, the solid was filtered, washed with methanol and vacuum-dried at room temperature. Yield: 52%. The compound is soluble in dimethylsulfoxide and dimethylformamide. M.p. = 153 \u00b0C (dec.). Anal. Calcd for C12N6H14O2Cl2Cu (%): C, 33.8; N, 19.7; H, 2.38; Cu, 15.6. Observed: C, 31.8; N, 21.4; H, 2.47; Cu, 15.3 [Approximately 80.4 mg (0.586 mmol) of isoniazid was dissolved in 5 cmCu, 15.3 .3 of CH3OH and added to a solution of 50 mg (0.293 mmol) of CuCl2\u00b72H2O in 15 cm3 of the same solvent. After stirring this suspension for 5 min, 47.5 mg (0.0586 mmol) of sodium thiocyanate (NaSCN), dissolved in 5 cm3 of water was added to the mixture and stirred for 3 h. The dark green solid was isolated by filtration, washed with methanol and vacuum-dried at room temperature. The compound is soluble in methanol, dimethylsulfoxide, dimethylformamide and tetrahydrofuran. Yield: 40%. M.p. = 149 \u00b0C. Anal. Calcd for C14N8H24O7S2Cu (%): C, 30.9; N, 20.6; H, 4.45; Cu, 11.7. Observed: C, 31.5; N, 20.2; H, 2.46; Cu, 11.0.Approximately 161 mg (1.17 mmol) of isoniazid was dissolved in 10 cm3 of CH3OH was added to a solution of 50 mg (0.293 mmol) of CuCl2 2H2O in 15 cm3 of the same solvent. After stirring this suspension for 5 min, 47.6 mg (0.0587 mmol) of potassium cyanate (KNCO) dissolved in 5 cm3 of water was added to reaction medium, producing a dark blue suspension. The mixture was stirred for 5 h, and the resulting precipitate was isolated by filtration. The product was thoroughly washed with methanol and dried in vacuum at room temperature. The compound is soluble in methanol, dimethylsulfoxide, dimethylformamide and tetrahydrofuran. Yield: 33%. M.p. \u2265 250 \u00b0C. Anal. Calcd. for C14N8H22O8Cu (%): C, 34.0; N, 22.7; H, 4.49; Cu, 13.0. Observed: C, 34.0; N, 18.0; H, 3.06; Cu, 13.6.A solution of 161 mg (1.17 mmol) of isoniazid in 10 cm\u22121. The samples were prepared as KBr pellets (~10 mg complex/100 mg KBr) that had previously been dried at 120 \u00b0C.The vibrational spectra in the infrared region were registered on a Nicolet FTIR-Impact 400 spectrometer , in the range 400\u20134000 cm\u22123 mol\u00b7L\u22121 solutions of the complexes in methanol.The electronic spectra were recorded on a Lambda 14P spectrophotometer  using quartz cells with a 1.00 cm optical length and 1.0 \u00d7 101 in Wilmad quartz tubes . Usually, the standard conditions for recording the spectra were 15 G modulation amplitude, 7.96 \u00d7 103 or 3.56 \u00d7 104 receiver gain, and 2 or 4 scans at 77 K.The EPR spectra were recorded on a Bruker EMX instrument  working at X-band . DPPH  was used as a magnetic field calibrator (g = 2.0036), and the measurements were performed with a frozen dimethylsulfoxide solution of complex The melting points of the samples (~5 mg complex) were determined using the MQAPF-302 instrument , which reaches a maximum temperature of 350 \u00b0C.The elemental analyses were performed at the Central Analitica at IQ University of S\u00e3o Paulo, Brasil using a CNH 2400 Perkin-Elmer instrument (Perkin Elmer), which determines the percentage of carbon, hydrogen and nitrogen in the samples with a precision of \u00b10.5%.3 solution (70% w/w). After cooling, 1.0 mL ammonium acetate buffer solution (0.2 mol\u00b7L\u22121) and a known excess quantity of EDTA solution that was sufficient to complex all the metal present in the sample were added. The pH was adjusted to 5.0 (\u00b10.1) and the xylenol orange indicator was added in a sufficient quantity to observe a yellow color. Then, the solution was subjected to titration with a ZnCl2 solution (0.01 mol\u00b7L\u22121), which was previously standardized with EDTA. The turning point was observed by the appearance of pink color. The copper content was calculated using the following equation:Cu = the copper content; MCu = the molar mass of copper; CEDTA = the concentration of the EDTA solution; VEDTA = the volume of the EDTA solution; CZnCl2 = the concentration of the ZnCl2 solution; VZnCl2 = the volume of the ZnCl2 solution; and msample = the mass of the weighed sample [To analyze the copper content, 5.00 mg of the samples were weighed on an analytical balance with an uncertainty of 0.01 mg. The sample was digested by the addition of five drops of a hot HNOd sample .et al. [i.e., cholesterol), 10% surfactant  and soy phosphatidylcholine in a proportion of 2:1) and 80% aqueous phase . The mixture was sonicated using a rod sonicator  at 700 watts in discontinuous mode for 10 min with 30 s incubations in an ice bath every two minutes during the sonication process. After sonication, the MEs were centrifuged at 11,180\u00d7 g for 15 min to eliminate the waste released by the titanium rod sonicator.The MEs were prepared as described by Bonif\u00e1cio et al. , with thThe microemulsion droplet size and distribution were determined by an optical particle analyzer  using dynamic light scattering. All samples (MEs with and without inorganic compounds) were diluted in Milli-Q water (100 \u03bcL of sample in 900 \u03bcL of deionized water) and placed in the instrument. The analyses were performed in triplicate.After obtaining the MEs, the copper(II) complexes were loaded into the nanostructured lipid system. A complex (0.0100 g) was added to the MEs (2 mL) and the mixture was homogenized and sonicated for 5 min at room temperature in discontinuous mode to facilitate the incorporation of the material into the microemulsion at a concentration of 5000 \u03bcg/mL. The inorganic compound-loaded nanostructured lipid systems were characterized by measuring the mean diameter and polydispersity index.Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922) was determined by the microdilution method, according to the standard reference method M7-A6 CLSI (2006) [1, 2 and 3 were loaded into the microemulsions at an initial concentration of 2000 \u03bcg/mL. At first, 100 \u03bcL of each compound loaded into the nanosystem were added to 96-well microplates containing 80 \u03bcL/well of Mueller-Hinton broth, and then a two-fold serial dilution was performed to obtain concentrations ranging from 7.81 \u03bcg/mL to 8000 \u03bcg/mL. Ampicillin and the microemulsions without the compound were used as positive and negative controls, respectively. The bacterial inocula were standardized at 1.0 \u00d7 107 CFU/mL and the microplates were incubated at 37 \u00b0C for 24 h. Then, 30 \u03bcL/well of a resazurin solution (0.01%) were added, and, after incubation at 37 \u00b0C for 2 h, the minimum inhibitory concentration (MIC) was determined. Bacterial growth changes the blue resazurin dye to pink, and the blue color indicates growth inhibition. MIC was defined as the lowest concentration that is able to inhibit at least 90% of bacterial growth. All tests were performed in triplicate.The antibacterial activity against I (2006) . Both ofet al. [2 in 10 mL DMEM supplemented with 10% fetal bovine serum, gentamicin sulfate (50 mg/L) and amphotericin B (2 mg/L) and incubated at 37 \u00b0C and 5% CO2.The cytotoxicity of the free complexes diluted in DMSO and those incorporated into the nanostructured lipid systems was measured on normal epithelial cells (VERO ATCC CCL-81) as described by Pavan et al. . The cel5 cells/mL using DMEM [4 cells/well and incubated at 37 \u00b0C in an atmosphere of 5% CO2 for 24 h to allow the cells to attach to the plate. Dilutions of the test compounds were prepared to obtain concentrations from 500 to 1.95 \u03bcg/mL. The dilutions were added to the cells after the media was removed, and any cells that did not adhere were incubated for an additional 24 h. The cytotoxicity of the compounds was determined by adding 30 \u03bcL of resazurin developer and read after a six-hour incubation. The samples were analyzed using a microplate Spectrafluor Plus (TECAN\u00ae) reader and excitation and emission wavelengths of 530 and 590 nm, respectively. The cytotoxicity (IC50) was defined as the highest concentration of the compound that retained the viability of at least 50% of the cells.This technique consists of collecting the cells using a solution of trypsin/EDTA, centrifugation (2000 rpm for 5 min), counting the number of cells in a Newbauer chamber and then adjusting the concentration to 3.4 \u00d7 10ing DMEM . Next, 250 value by the MIC value. An SI greater than or equal to 10 indicates that the test compound can be applied at a concentration that is ten-fold higher than the MIC value without exhibiting cytotoxicity [The selectivity index (SI) can be calculated by dividing the ICtoxicity .E. coli and S. aureus and decrease the cytotoxicity of the studied compounds. Our findings suggested that the Cu(II) complexes may be promising antibacterial candidates when they are incorporated into the MEs described in this study.The synthesis, characterization, and antibacterial activity of copper(II) complexes bearing an isoniazid ligand that were incorporated into nanostructured lipid system were reported in this work. The nanostructured lipid system was used as a strategy to improve the antibacterial activity against"}
+{"text": "Neuroepithelium-specific knockout of Cxcr7 does not recapitulate the PN phenotype in Cxcr7 knockout, suggesting that CXCR7 acts non-cell-autonomously possibly from the pial meninges. We show further that CXCR7 regulates pontine migration by modulating CXCL12 protein levels.Long distance tangential migration transports neurons from their birth places to distant destinations to be incorporated into neuronal circuits. How neuronal migration is guided during these long journeys is still not fully understood. We address this issue by studying the migration of pontine nucleus (PN) neurons in the mouse hindbrain. PN neurons migrate from the lower rhombic lip first anteriorly and then turn ventrally near the trigeminal ganglion root towards the anterior ventral hindbrain. Previously we showed that in mouse depleted of chemokine receptor CXCR4 or its ligand CXCL12, PN neurons make their anterior-to-ventral turn at posteriorized positions. However, the mechanism that spatiotemporally controls the anterior-to-ventral turning is still unclear. Furthermore, the role of CXCR7, the atypical receptor of CXCL12, in pontine migration has yet to be examined. Here, we find that the PN is elongated in Cxcr7 knockout due to a broadened anterior-to-ventral turning positions. Cxcr7 is not expressed in migrating PN neurons  Tangential migration is often deployed by neurons that migrate over long distances, sometimes across brain compartments, to distant destinations7. Such long-distance tangential migration usually involves multiple changes of migratory directions through varied tissue environments, hence demands a complex set of underlying guidance mechanisms. While much has been learned of the guidance of tangential migration owing in part to its shared mechanisms with the guidance of growing axons10, mechanisms that underlie changes of migratory directions are still incompletely understood.During development new born neurons migrate radially or tangentially from the progenitor zones to their final destinations16. PN neurons are destined to form the pontine nuclei, an amalgamation of pontine gray nucleus and reticular tegmental nucleus, which form a part of the precerebellar system that relays information from the rest of the CNS to the cerebellum19. These neurons are born from the lower rhombic lip, a progenitor zone lining the dorsal edge of the posterior hindbrain , anteriorly migrating PN neurons make a sharp turn ventrally, heading orthogonally towards the ventral midline  secreted from the pial meninges and its receptor CXCR4 expressed in the migrating PN neurons regulate two key processes of pontine migration13. First, disruption of CXCL12/CXCR4 signalling results in some PN neurons migrating deep in the hindbrain parenchyma without migrating anteriorly, owing to a loss of the chemoattraction that usually confines the pontine migratory stream to the pial surface of the hindbrain. Second, in both Cxcr4 and Cxcl12 mutant mice, many PN neurons that migrate superficially turn ventrally at positions posterior to gV root, suggesting that CXCL12/CXCR4 signalling is important for the anteriorly migrating PN neurons to reach the gV root before turning ventrally. The mechanism of how CXCL12 imposes spatial/temporal regulation on the anterior-to-ventral turning in PN neurons is still unknown.The migration of PN neurons in the mouse hindbrain is an excellent model to investigate the guidance mechanisms underlying long-distance tangential migration29 which plays diverse cellular functions, depending on its cellular and tissue context, and biological conditions. It acts either as a scavenger receptor to shape CXCL12 availability and distribution, a modulator of CXCL12 downstream signalling via heterodimerization with CXCR4, or in some cases an active signalling receptor31. Since the role of CXCR7 has not yet been examined in pontine migration, we reasoned that unravelling the role of CXCR7 might lend clues to this question.CXCR7 is a later identified atypical receptor of CXCL12Here, we examined the role of CXCR7 in the migration of PN neurons by analysing its expression pattern and phenotypes in Cxcr7 knockout mice. We find that CXCR7 regulates the anterior-to-ventral turning positions of migrating PN neurons and the shape of the resultant PN. We provide evidence that CXCR7 regulates this process non-cell-autonomously, possibly through controlling CXCL12 protein levels.33. We found that Cxcr7 was detected in PN neurons only after their arrival at the PN region but not during their tangential migration  in developing mouse hindbrains at stages when PN neurons migrate towards the future pontine nuclear region Fig.\u00a0A,B. PN nion Fig.\u00a0 online.FWe next analyzed PN formation in Cxcr7 knockout mice (Cxcr7\u0394/\u0394) on whole mount (WM) and sectioned hindbrains. Wild type (WT) or Hetero E17.5 hindbrains showed a prominent PN in the anteroventral hindbrain straddling across the ventral midline shown by ISH Fig.\u00a0A, n\u2009=\u20094.15. In Cxcr7\u0394/\u0394 hindbrains, however, the anteriorly migrating PN neurons turned ventrally over a much wider anteroposterior span  knockout mice34. Importantly, Nes-Cre line should not affect Cxcr7 expression in the pial meninges of the hindbrain as the meningeal cells around the hindbrains are derived from the mesodermal precursors36. We first confirmed the specificity of Nes-Cre mediated recombination by crossing Nes-Cre mice with a Cre-responder line Z/EG  and found that the electroporated PN neurons migrated normally, differing from the electroporated Cxcr7\u0394/\u0394 hindbrains which showed elongated PN . As expected, Cxcr7\u0394/\u0394 showed a higher CXCL12 level than the wild type, with a 1.5 fold increase on average  PN neurons took anterior-to-ventral turnings at positions posterior to the normal turning point  The PN in Cxcr7 knockout mice elongates beyond both the anterior and posterior limits of the normal PN, whereas in Cxcr4/Cxcl12 knockout mice ectopic pontine clusters are all posteriorized; (2) In Cxcr4/Cxcl12 knockout mice, a portion of PN neurons fail to migrate superficially due to a loss of attraction to the pial meninges. These neurons form a deep posteriorized ectopic cluster. Such a defect is not present in Cxcr7 knockout mice. These differences suggest that depletion of Cxcr7 does not simply compromise CXCL12 signalling.The PN phenotype in Cxcr7 knockout mice is distinct from that in Cxcr4 (or Cxcl12) knockout miceThe elongated PN phenotype in Cxcr7 knockout mice appears to stem largely from a dysregulated earlier event when PN neurons undergo anterior-to-ventral turning around gV. A portion of PN neurons turn prematurely, while another delay turning, contributing to the posteriorized and anteriorized elongation of the PN, respectively. The ectopic turning positions form a continuum with the normal turning position resulting in one elongated PN. This aspect contrasts with the Cxcr4/Cxcl12 knockout mice in which premature turning takes place at a few discrete and sporadic locations leading to separate ectopic clusters. This difference again implies that CXCR7 and CXCR4 act via different mechanisms.The non-cell-autonomous function of CXCR7 was first implied by Cxcr7 expression patterns, and later evidenced by tissue-specific conditional knockout experiments. Cxcr7 is not expressed at detectable levels in PN neurons throughout their migratory phase. While it is expressed in some other hindbrain neuroepithelial cells, none of them is positioned close enough to influence the migrating PN neurons. By contrast, Cxcr7 is strongly expressed in the pial meninges on which PN neurons migrate. This expression pattern implies that CXCR7 might regulate pontine migration non-cell-autonomously. This possibility is strongly supported by neuroepithelium-specific conditional knockout of Cxcr7. Nestin-Cre mediated recombination reduced Cxcr7 expression to undetectable levels in almost all hindbrain structures that express Cxcr7 without affecting its expression in the pial meninges. The fact that PN in these mice do not show anterior\u2013posterior elongation suggests that CXCR7 expressed from an extra-neural tube source regulates the normal pontine migration. Although direct evidence is still lacking, the pial meninges is highly likely to be this source of CXCR7. The non-cell-autonomous role of Cxcr7 is further supported by the normal migration of PN neurons that were specifically depleted of their Cxcr7 expression via in utero electroporated of Cre. It is intriguing that the PN was smaller in Nes-Cre:Cxcr7fl/\u0394 hindbrains. The reason for this is still unclear. One possibility is that Cxcr7 expressed in PN neurons after their arrival at the PN region and in other hindbrain structures may regulate the survival and/or production of PN neurons directly or indirectly.29, much effort has been made to understand how CXCR7 interacts with CXCL12/CXCR4 axis in biological systems that are known to utilize CXCL12 signalling44. It has emerged that CXCR7 is largely an atypical receptor of CXCL12 and one of its atypical functions is to act as a scavenger by modulating CXCL12 concentration via CXCR7-dependent CXCL12 endocytosis and subsequent degradation40. Our study suggests that CXCR7 might also serve such a function for the developing pontine system. The expression pattern of Cxcr7 and the neuroepithelium-specific conditional knockout pointed to the importance of CXCR7-expressing pial meninges, which also secrete the ligand CXCL12. We showed that dissociated hindbrain meningeal cells endocytose CXCL12 mainly via CXCR7. CXCR7-mediated CXCL12 endocytosis sends CXCL12 to intracellular degradation pathway40, hence clearing CXCL12 from extracellular space and reducing the availability of CXCL12 as a ligand40. Indeed, we demonstrated a 1.5 fold increase in CXCL12 level in Cxcr7\u0394/\u0394 hindbrain lysate, indicating that CXCR7 serves to keep CXCL12 at a moderate level in hindbrains in vivo. The CXCR7 overexpression experiment lends further support to the scavenger role of CXCR7. An excessive amount of CXCR7 by overexpression generated a pontine migration phenotype resembling mutants with depleted CXCL12 signalling13. Two explanations can be envisaged for this phenotype: (1) overexpressed CXCR7 in PN neurons may lead to inhibition of CXCR4 signalling via interaction of or competition between the two receptors45, exerting a dominant-negative effect cell-autonomously; (2) an excessive expression of CXCR7 reduces available CXCL12 in the environment via endocytosis-mediated sequestering, which in turn affects pontine migration non-cell-autonomously. Our data showed that an overexpression of CXCR7 affected the migration of both electroporated and non-electroporated PN neurons, hence in favour of the second possibility.Since the discovery of CXCR7 as the second receptor of CXCL1246. In the former, CXCR7 acts from the cortical interneurons which co-express CXCR7 and CXCR441. Whereas in the latter, CXCR7 acts from tissues surrounding the migrating neurons, resembling the scenario presented in this study46. Defects in the migration of cortical interneurons and GnRH neurons are thought to be caused mostly by a reduction of cell surface CXCR4 that is triggered by the elevated level of CXCL12 in Cxcr7\u0394/\u039446. However, we do not think this is the case for PN neurons for two reasons. (1) CXCR4 immunoreactivity on the surface of PN neurons was unchanged in Cxcr7 knockout mice  neurons49, which collaboratively mediate Netrin signalling50. Since anteriorly migrating PN neurons already express DCC and Robo349, their responsiveness to Netrin would need to be silenced to prevent premature turning. The phenotype of premature turning has been reported in several mice mutants, including Robo1/2, Slit1/2/3, Phox2A, Unc5C, Ezh253. At least some of these molecules, including Unc5C and Ezh2, are thought to function via down-regulating the Netrin pathway52. We have previously reported premature anterior-to-ventral turning of PN neurons in Cxcr4/Cxcl12 mutants13. However, how CXCL12 signalling is involved in this process is still unclear. CXCL12 signalling might play a modulatory role in silencing premature responsiveness to Netrin-1 in PN neurons. Alternatively, it may play an instructive role in determining the anterior-oriented polarity of PN neurons via a chemokine gradient. Analysis of Cxcr7 knockout mice in this study showed the intriguing phenotype of both premature and delayed anterior-to-ventral turning. This bimodal defect cannot be easily explained by merely assuming a silencing role of CXCL12, hence pointing to an instructive role of CXCL12 via forming a gradient. We have previously observed a posterior-low anterior-high graded distribution of CXCL12 immunoreactivity along the anterior migratory path of PN neurons13. PN neurons might be directed by this gradient to migrate anteriorly until reaching a saturation concentration of CXCL12 at which these neurons could no longer sense the gradient and turn ventrally near gV  0.5. For expression studies and in utero electroporation, timed pregnant ICR mice  were used. In total, 30\u201335 animals were used for this study. All experimental protocols for animal maintenance, breeding and manipulations were approved by the Institutional Animal Care and Use Committees of Osaka University and National Institute of Genetics, and were conducted in accordance with the Guidelines for the Welfare and Use of Laboratory Animals of the two institutes.The generation of Cxcr7 knockout (\u0394) and floxed (fl) mice67. A plasmid with nucleotide 103\u20131,139 of Cxcl12 mRNA (Accession number D21072) was used to generate Cxcl12 riboprobe. pCAGGS-NLS-Cre and pCAGGS-NLS-EGFP are provided by Dr. Yasuto Tanabe , and pCALNL5-EGFP by Dr. Kenta Yamauchi . The Barhl1 plasmid for generating Barhl1 riboprobe is a kind gift from Dr. Tetsuichiro Saito . Coding sequence of full length mouse Cxcr7 (Genbank accession: BC015254) was obtained by RT-PCR from total RNA of mouse embryonic brain and subsequently cloned into pCAGGS vector with a multiple cloning site inserted66 to construct pCAGGS-Cxcr7FL. pCAGGS-Cxcl12-mCherry was cloned by fusing mCherry coding sequences  to the c-terminus of the mouse Cxcl12 coding sequence (Genbank accession: NM_021704).The DNA construct for generating Cxcr7 riboprobe for in situ hybridization and the expression constructs pCAGGS-EGFP and pCAGGS-mCherry have been described before64. Basically, sections were subjected to proteinase K treatment (1\u00a0\u03bcg/ml) and post-fixed in 4% PFA for 30\u00a0min. Hybridization buffer contained 50% formamide, 1% SDS, 5xSSC (pH 4.5), 50\u00a0\u03bcg/ml yeast tRNA, 50\u00a0\u03bcg/ml Heparin in RNase-free water. Riboprobes were used at 1\u00a0\u03bcg/ml. Hybridization was carried out overnight at 70\u00a0\u00b0C for Barhl1 riboprobe, and at 65\u00a0\u00b0C for Cxcr7 riboprobe.To obtain embryos for ISH, pregnant mice were killed by cervical dislocation and embryos were taken out from the uterus. Mouse hindbrains (E14.5 and E15.5) with or without the overlying pial meninges were dissected out from mouse embryos in phosphate-buffered saline  and fixed in 4% paraformaldehyde  at 4\u00a0\u00b0C for 6\u20137\u00a0h. The tissues were then cryo-protected in 30% sucrose (in PBS) overnight at 4\u00a0\u00b0C and embedded in OCT . Frozen sections were obtained with a cryostat at 20\u00a0\u03bcm. Hybridizations were performed essentially as previously described13. Briefly, the fixed hindbrains were permeabilized in 100% methanol. After rehydration, the hindbrains were treated with 10\u00a0\u03bcg/ml Proteinase K for 20\u00a0min and post-fixed in 4% PFA and 0.1% glutaraldehyde. Hybridization buffer contained 50% Formamide, 1.3xSSC (pH 4.5), 5\u00a0mM EDTA, 0.5% CHAPS, 50\u00a0mg/ml yeast tRNA, 200\u00a0\u03bcg/ml Heparin and 0.2% Tween-20. Hybridization was carried out with 2\u00a0\u03bcg/ml Barhl1 riboprobe at 70\u00a0\u00b0C overnight.For Barhl1 ISH on WM hindbrains, mouse hindbrains  with meninges removed were dissected out from mouse embryos and fixed in 4% PFA at 4\u00a0\u00b0C for overnight. ISH procedure was performed as previously described64. The sections were blocked with 10% goat or horse serum in PBSTx (0.2% Triton-100) for 1\u00a0h followed by incubation with primary antibodies at 4\u00a0\u00b0C overnight. After washing with PBSTx, the sections were then incubated with the secondary antibodies at room temperature for 2\u00a0h. Slides were counter-stained with 0.03% 4,6-diamidino-2-phenylindole . The primary antibodies used were: rabbit anti-BARHL1 (anti-BARHL1) polyclonal antibody , chick anti-GFP polyclonal antibody , rabbit anti-PAX6 polyclonal antibody , rabbit anti-Laminin polyclonal antibody , goat anti-CXCR4 polyclonal antibody , goat anti-DCC polyclonal antibody , goat anti-ROBO3 polyclonal antibody  and mouse anti-CNTN2 monoclonal antibody . The secondary antibodies used were cy3-donkey anti-rabbit IgG  for BARHL1 and PAX6 and laminin antibodies, Alexa488-donkey anti-chick IgG  for a GFP antibody, cy3-donkey anti-goat IgG  for CXCR4, DCC and ROBO3 antibodies, cy3-goat anti-mouse IgM  for a CNTN2 antibody.Pregnant mice were killed by cervical dislocation and embryos were taken out from the uterus. Hindbrains were dissected out and fixed in 4% PFA at 4\u00a0\u00b0C for 6\u20137\u00a0h, or overnight for E18.5 hindbrains. Frozen sections were prepared in the same way as those for ISH as described above. Immunohistochemistry was performed as previously described68 with some modifications. Briefly, pregnant mice were anesthetized with Pentobarbital Sodium . The uterus was exposed after abdominal incision and approximately 2\u00a0\u03bcl of plasmid  was injected into the IV ventricle of E12.5 embryos. Five square electric pulses  were applied using a forceps-type electrode  connected to a square-pulse generator .In utero electroporation was performed essentially as previously described4 cells were seeded onto a 12\u00a0mm round coverslip placed in a 24 well plate in 500\u00a0\u03bcl of culture medium comprising DMEM-Glutamine (0.06%)-FBS (10%). Four hours after plating, dead and floating cells were removed and fresh culture medium was added. The dissociated meningeal cells were cultured for 3\u20134\u00a0days before endocytosis assay.Pial meninges overlying E13.5 hindbrains from ICR mice were peeled off and torn into small pieces in ice-cold calcium/magnesium free Hanks solution. The meningeal pieces were then treated with 2.5\u00a0ml of 0.1% Trypsin at 37\u00a0\u00b0C for 12\u00a0min with occasional rocking. Trypsin reaction was then inhibited by addition of 2.5\u00a0ml of DMEM and 10% fetal bovine serum (FBS). Tissues were then washed twice in DMEM-FBS (10%) and dissociated by trituration using a glass Pasteur pipette. Triturated cells were then passed through a 70\u00a0\u03bcm cell strainer and the cell numbers were counted. Approximately 6\u2009\u00d7\u200910COS7 cells were transfected with pCAGGS-Cxcl12-mCherry plasmid or pCAGGS-mCherry as a negative control using FuGENE 6 transfection reagent (Promega) and cultured in DMEM-Glutamine-FBS (10%) for 3\u00a0days before the conditioned medium were removed for the endocytosis assay.Medium of cultured meningeal cells was removed and replaced with DMEM-glutamine without FBS and incubated at 37\u00a0\u00b0C for 45\u00a0min. The cells were then placed on ice and washed twice with cold binding medium (DMEM with 0.1% BSA and 20\u00a0mM HEPES). Cxcl12-mCherry conditioned medium (diluted 1:4 in cold binding medium) was laid onto cells, and binding was performed on ice for 2\u00a0h. Cells were then washed twice with cold binding medium. The cold binding medium was then replaced with 500\u00a0\u03bcl of warm culture medium of DMEM-Glutamine-FBS (10%) for each well. One \u03bcl of 1\u00a0mM CCX773  was added to half of the wells, and the other half received 1\u00a0\u03bcl of 1\u00a0mM CCX704 , so that the final concentration of the added reagent was 2\u00a0\u03bcM in each well. Endocytosis was then allowed to take place in a 37\u00a0\u00b0C incubator for 2\u00a0h. Cells were then washed twice with cold binding medium. Surface bound Cxcl12-mCherry was stripped by two washes with acid wash buffer , 1.5\u00a0min each time. The cells were then washed in PBS and fixed in 4% PFA for 20\u00a0min at room temperature before DAPI staining and mounting for imaging. Quantification of mCherry positive vesicle-like particles in cells was performed manually.E14.5 Cxcr7\u0394/\u2009+\u2009and Cxcr7\u0394/\u0394 hindbrains with the overlying pial meninges attached were used to prepare tissue lysates. Briefly, hindbrains of desired genotype were quick frozen in liquid nitrogen and stored at -80\u00a0\u00b0C. On the day of lysate preparation, 200\u00a0\u03bcl of RIPA buffer  with proteinase inhibitor  was added to each sample, which was then homogenized by a probe type sonicator. Tissue lysate was cleared by centrifugation and the protein quantity was measured by a Pierce BCA Protein Assay Kit (Thermo Scientific) according to the manufacturer\u2019s instruction.CXCL12 ELISA was performed using a Quantikine ELISA mouse CXCL12 kit (R&D Systems) following the manufacturer\u2019s instruction. Protein concentration of each sample used ranged between 2.5\u00a0mg/ml to 3.0\u00a0mg/ml. CXCL12 quantity was measured as ng per mg of tissue lysates. Plates were read by an iMark Microplate Absorbance Reader (Bio-Rad).Fluorescence and bright-field images on sections as well as dissociated meningeal cells and fluorescence images on whole mount electroporated hindbrains were captured with a CCD camera  attached to an upright epifluorescence microscope  at 1,296\u2009\u00d7\u20091,030 pixel resolution. Objective lens used were: 2\u2009\u00d7\u2009Plan Apo with numerical aperture (NA) 0.08 (Olympus), 4\u2009\u00d7\u2009UPlan Apo with NA 0.16 (Olympus), 10\u2009\u00d7\u2009UPlan Apo with NA 0.40 (Olympus) and 20\u2009\u00d7\u2009UPlan Apo with NA 0.70 (Olympus). Whole hindbrains after ISH were imaged with a Stage Multiviewer System (Keyence) at 1,024\u2009\u00d7\u20091,280 pixel resolution. Adobe Photoshop CS3 or Adobe Photoshop CC were used to adjusted contrast and brightness of images and to assemble figures.Quantification of PN elongation was performed on parasagittal sections of hindbrains with the PN visualized either by Barhl1 ISH or immunohistochemistry. Three parameters were measured: (1) the length of PN along anterior posterior axis; (2) the distance between the anterior tip of PN and the midbrain flexure and (3) the distance between the posterior tip of PN and the point radially opposite the pontine flexure. Among all sections of a given brain, the sections containing the maximums of parameter (1) and (3) and the minimum of parameter (2) were chosen for comparison between the Cxcr7 WT/Hetero and the knockout mice. Each measurement was normalized for hindbrain size differences using one of the wild type samples as a standard. The distance between the pontine flexure and the midbrain flexure was used as an indicator of the hindbrain size.p\u2009<\u20090.05 were considered statistically significant.Statistical analyses were performed using Prism 8 (GraphPad) and Supplementary file1"}
+{"text": "Pluripotent embryonic stem cells (ESCs) are derived from early embryos and can differentiate into any type of cells in living organisms. Induced pluripotent stem cells (iPSCs) resemble ESCs, both of which serve as excellent sources to study early embryonic development and realize cell replacement therapies for age-related degenerative diseases and other cell dysfunction-related illnesses. To achieve these valuable applications, comprehensively understanding of the mechanisms underlying pluripotency maintenance and acquisition is critical. Ubiquitination modifies proteins with Ubiquitin (Ub) at the post-translational level to monitor protein stability and activity. It is extensively involved in pluripotency-specific regulatory networks in ESCs and iPSCs. Ubiquitination is achieved by sequential actions of the Ub-activating enzyme E1, Ub-conjugating enzyme E2, and Ub ligase E3. Compared with E1s and E2s, E3s are most abundant, responsible for substrate selectivity and functional diversity. In this review, we focus on E3 ligases to discuss recent progresses in understanding how they regulate pluripotency and somatic cell reprogramming through ubiquitinating core ESC regulators. In culture, embryonic stem cells (ESCs) can indefinitely self-renew while maintaining pluripotency . These cin vitro  and the external mono-layer trophectoderm . The ICMin vitro . EmbryonUbiquitination is a fundamental process post-translationally modifying proteins with a single Ub (monoubiquitination) or a poly-Ub chain (polyubiquitination) to regulate protein stability or activity ,36. Ub i2+ ions [2+ ions and phospholipids of intracellular membranes [In general, ubiquitination is achieved by three continuous catalytic reactions . The Ub-2+ ions . Distinc2+ ions . Beside 2+ ions . Accordi2+ ions . Besidesembranes ,60. The embranes ,62. To dembranes . The HERembranes . The RBRembranes . The RINembranes . To dateOct4-null zygotes can bypass the cleavage stage but stall at the blastocyst stage due to impaired ICM, suggesting its critical role in pluripotency regulation [Oct4 depletion impairs self-renewal and leads to cell differentiation into the trophectoderm lineage [Oct4 results in ESC differentiation into primitive endoderm and mesoderm [Oct4 belongs to the Pit-Oct-Unc (POU) transcription factor family. It contains three major modules, including the conserved DNA-binding POU domain in the middle separating the two transactivation domains, respectively, at the N and C terminus ,68,69. Tgulation ,77. In E lineage ,78. Stri lineage ,80. Howe2+ and phospholipid binding is involved in this modification, the C2 domain is demonstrated required by the enzymatic activity of the HECT domain [WWP2 depletion increases the protein level of OCT4 in human ESCs [WWP2 depletion can only be observed in differentiated ESCs with retinoid acid (RA) treatment, but not in the unperturbed counterpart cells [Wwp2-null mouse ESCs remain undifferentiated with a normal protein level of Oct4 [Wwp2 knockout increases the efficiency of Yamanaka factors-derived iPSC formation [Wwp2 is the first identified E3 capable of mediating Oct4 ubiquitination. It belongs to the Nedd4 ligase family and contains four WW domains separating a N-terminal C2 domain from the HECT catalytic domain at the C terminus . Wwp2 caT domain . Wwp2-meT domain ,83,84. F of Oct4 . In vitr of Oct4 . Mutatio of Oct4 . Consistormation . TherefoWwp2 depletion has no impact on Oct4 stability in ESCs suggests that multiple E3s could be coordinated to monitor Oct4 stability for robust maintenance of pluripotency. Itch is another Nedd4 family E3 capable of modifying Oct4 [Itch depletion results in ESC differentiation and reduces the efficiency of iPSC formation [The observation that ing Oct4 . Similaring Oct4 . It is uing Oct4 . In ESCsing Oct4 ,86. The ormation ,90,91. Tormation . Trim32 ormation . Trim32 ormation . PHD finormation ,95,96. Iormation . Moreoveormation . HoweverSox2-null embryos cannot survive due to failure in normal epiblast formation [Sox2 depletion in ESCs results in polyploidy formation and trophectoderm differentiation [Ube2s deletion does not drive ESCs to differentiate but reinforces the pluripotent state through inducing a set of pluripotency-related genes including Esrrb, Nanog, Lin28a, and Sall4 [Oct4, Sox2, Klf4, and c-Myc to efficiently support pluripotency [Sox2 contains a conserved HMG DNA-binding domain and a C-terminal transactivation domain ,99. In vormation . Sox2 dentiation ,107. Howntiation ,107,108 ntiation ,109. Intntiation . Of notentiation . What isntiation . Unmethyntiation . The APCntiation . Among tntiation . In mousntiation . In thisnd Sall4 . These gipotency . APC/C-Uipotency .early embryo specific NK (ENK) that was initially identified in mouse ESCs. Compared with other NK protein family members, it shares low sequence similarity and is exclusively involved in ESC maintenance and embryonic development [Nanog can be ubiquitously detected in all blastomeres, and is subsequently restricted to the ICM and the subsets of the epiblast cells including the primordial germ cells. It starts to decline during primitive streak formation [Nanog-null embryos exhibit impaired ICM and die at 4.5 d.p.c due to failure in forming the primitive ectoderm [Nanog deletion results in ESC differentiation into endoderm lineages [Nanog overexpression confers ESCs resistance to exogenous induction of differentiation [Nanog expression is not homozygous in ESCs under the serum culture condition, but stochastically fluctuates [Nanog-low ESCs can self-renew, they lose na\u00efve pluripotency, failing in differentiation into germ lines [F-box and WD40 domain-containing protein 8 (Fbxw8) is the only E3 identified mediating Nanog ubiquitination [Fbxw8 complex [Fbxw8-mediated ubiquitination of Nanog requires ERK1-activated phosphorylation signal. Moreover, Fbxw8 depletion results in Nanog accumulation, consequently enhancing self-renewal and preventing ESCs from differentiation [Fbxw8 deletion impairs embryo growth due to abnormal development of placenta [Fbxw8 in the developmental process of embryos. Moreover, it will be of interest to uncover whether this ligase complex is involved in regulating na\u00efve pluripotency or monitoring the fluctuating expression of Nanog in serum-cultured ESCs.Nanog is encoded by elopment ,117,118.elopment . The expormation ,117,120.lineages ,117,121.ntiation ,117. Howuctuates . Althougrm lines . K48- anrm lines . To datetination . F-box ptination ,128,129. complex . In mousntiation . In vivoplacenta ,132. HowSkp2 ligase complex, SCFFbxw7 complex, and TRIM6 [Fbxw7-null embryos die at E10.5. Fbxw7 deletion results in c-Myc accumulation, which prevents mouse ESC differentiation [Fbxw7 deletion promotes iPS cell formation, which, however, cannot be reversed by c-Myc depletion, indicating the existence of other substrates in the reprogramming process [TRIM6-depleted ESCs exhibit increased stability of c-Myc, TRIM6 elevation fails in reducing the stability of c-Myc but activates Nanog expression. Furthermore, TRIM6 manipulation-resulted Nanog elevation could not confer ESC independence of LIF signal, which appears inconsistent with the previous finding that elevated Nanog inhibits LIF withdrawal-induced ESC differentiation [C-Myc oncoprotein belongs to the basic helix-loop-helix (bHLH) transcription factor superfamily, extensively involved in regulating cell metabolism, proliferation, differentiation, and apoptosis ,134. In nd TRIM6 ,147,148.nd TRIM6 ,146,149. process . TRIM6 entiation ,117. Trintiation . The intntiation ,152,153.Klf2, Klf4, or Klf5 fails in driving ESC differentiation, but simultaneous triple knockdown of all these three genes results in loss of ESC identity [Klf2 deletion [\u03b2-TrCP to capture Klf4 for polyubiquitination and proteasomal degradation, which subsequently results in ESC differentiation [\u03b2-TrCP and thus enhances Klf4 stability [Klfs belong to the zinc finger-containing transcription factor family and are characterized by three kr\u00fcppel-like C2H2 zinc finger DNA-binding domains. Although all Klfs have a similar DNA binding consensus, they function diversely through interacting with context-dependent partners via their variable N-terminal region . There aidentity . Howeverdeletion . Moreovedeletion ,161. Duedeletion ,162. Simdeletion . Interesdeletion . ERK1/2-ntiation . On the ntiation ,168,169.ntiation . At the ntiation . ERK inhtability ,165. As Ring1A and Ring1B results in ESC differentiation [Pluripotent cells exhibit a unique epigenetic landscape, which is largely marked by histone modifications ,171. Comntiation ,182,183.ntiation . In addintiation ,185. HowPluripotent ESCs and iPSCs exhibit unique transcriptomic, epigenomic, and proteomic signatures, which are precisely orchestrated by the interconnected regulatory network. Ubiquitination governs proteostasis and is one of the most abundant modification signals to monitor protein stability and activity. Therefore, ubiquitination is involved in nearly all protein-dependent cellular processes, including pluripotency maintenance and cell fate decision. In pluripotent ESCs, Ub/proteasome pathway-related genes are highly activated, and over one thousand proteins are marked by Ub signals ,8,9,10."}
+{"text": "Acid-sensing ion channels (ASICs) are proton-gated members of the epithelial sodium channel/degenerin (ENaC/DEG) superfamily of ion channels and are expressed throughout the central and peripheral nervous systems. The homotrimeric splice variant ASIC1a has been implicated in nociception, fear memory, mood disorders and ischemia. Here, we extract full-length chicken ASIC1 (cASIC1) from cell membranes using styrene maleic acid (SMA) copolymer, elucidating structures of ASIC1 channels in both high pH resting and low pH desensitized conformations by single-particle cryo-electron microscopy (cryo-EM). The structures of resting and desensitized channels reveal a reentrant loop at the amino terminus of ASIC1 that includes the highly conserved \u2018His-Gly\u2019 (HG) motif. The reentrant loop lines the lower ion permeation pathway and buttresses the \u2018Gly-Ala-Ser\u2019 (GAS) constriction, thus providing a structural explanation for the role of the His-Gly dipeptide in the structure and function of ASICs. Chicken2+-permeability  . Negativ50 for cASIC1 is\u00a0~6.7 , extensive 3D classification of the pH 7.0 dataset did not indicate the presence of either open or resting channels. This observation is consistent with previous electrophysiological analysis of steady-state desensitization curves for cASIC1, which demonstrated very little proton-evoked current after conditioning with\u00a0~pH 7.0 solution  and high pH resting (pH 8.0) conformations at estimated resolutions of\u00a0~2.8 and 3.7 \u00c5, respectively, as estimated by gold-standard FSC \u20135. Whilesolution . Accordisolution .In accord with previously solved structures, the homotrimeric ASIC1 channel resembles a clenched fist , harboriNumerous experiments have implicated residues within the pre-TM1 region of ASICs and ENaCs in both gating and selectivity . Indeed,The quality of the 2.8 \u00c5 density map of the desensitized channel was sufficient to build amino terminal residues into the density map, beginning with Val 17, in the context of the previously determined desensitized state structure  PDB 4NY. The preWhile the quality of the resting channel density map that includes the pre-TM1 residues was not sufficient for unambiguous model building , no signSeparated by more than 400 residues in the amino acid sequence, the GAS and HG motifs are highly conserved amongst ENaC/DEG and ASIC channels  and haveIn structures of both desensitized and resting cASIC1-SMA channels, the \u2018upper\u2019 ion permeation pathway is comprised of TM2a residues and contains a closed gate between Gly 432 and Gly 436, in agreement with existing X-ray and cryo-EM models . However+ selectivity of ASICs  lacked ordered amino terminal residues  were expressed in HEK293S GnTI- cells and membrane fractions were isolated as previously described (Recombinant full-length acid-sensing ion channels (escribed . Membran8 EGFP tag was removed via overnight thrombin digestion at room temperature (RT) using a ratio of cASIC1 to thrombin of 25:1. The following day, the cASIC1-SMA protein was purified via size-exclusion chromatography (Superose 6 10/300) using a mobile buffer composed of TBS supplemented with 1 mM DTT. A single peak fraction was collected and concentrated to\u00a0~1 mg/ml for cryo-EM sample preparation.The Ni-NTA bead suspension was then transferred to a XK-16 column and subject to two washes, first with three column volumes of TBS containing 10 mM imidazole and last with three column volumes of TBS containing 30 mM imidazole. The cASIC1-SMA protein was eluted with TBS containing 250 mM imidazole, and peak fractions were pooled and concentrated to\u00a0~5 mg/ml. The HisQuantifoil holey carbon grids (R1.2/1.3 200 mesh Au) were glow discharged for 1 min at 15 mA, carbon side facing up. For structure determination of cASIC1-SMA particles at high pH, purified protein at\u00a0~1 mg/ml was used immediately for grid preparation. For structure determination at low pH, the pH of the sample was adjusted to 7.0 by addition of MES, pH 6.0, following concentration of purified protein to\u00a0~1.0 mg/ml. A 4 \u03bcl droplet of sample, applied to the carbon side of the grid, was blotted manually with pre-cooled filter paper  and the grids were vitrified in ethane/propane mix using a custom-built manual-plunge apparatus housed in a 4\u00b0C cold room with 60\u201370% relative humidity.- \u00c5\u22122.For the resting channel structure at high pH, data were collected on a Titan Krios cryo-electron microscope (ThermoFisher) operated at 300 keV. Images were recorded on a Gatan K3 camera positioned after an energy filter (20 eV slit width) operating in super-resolution mode with a binned pixel size of 0.648 \u00c5. Data were collected with SerialEM  and dose- \u00c5\u22122.For the desensitized state structure at pH 7.0, data were recorded on a Titan Krios cryo-electron microscope operated at 300 kV and equipped with a spherical aberration corrector. Images were recorded on a Gatan K2 Summit camera in super-resolution mode with a binned pixel size of 1.096 \u00c5. Data were acquired using Leginon  and doseab-initio model was generated in cryoSPARC V2 and used for iterative rounds of 3D classification and refinement in cryoSPARC V2. For the pH 7.0 dataset, per-particle CTF estimation was performed using Gctf. Final reconstructions for both datasets were obtained via non-uniform refinement (C3 symmetry) in cryoSPARC V2.Images were motion corrected using UCSF MotionCor2  and CTF Using UCSF Chimera , the X-rHEK293S GnTI- cells were provided by kindly provided by Dr. Gobind Khorana  and no f In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:This study presents high-resolution structures of the resting and desensitized chicken ASIC1a channel in its native membrane environment, obtained by single-particle cryo-electron microscopy following detergent-free extraction. Whereas in previous structures of detergent solubilized ASIC1 the N-terminus of the protein was not resolved, suggesting that it is disordered, in the novel structures an N-terminal pre-membrane segment that harbors the highly conserved HG motif forms an ordered reentrant loop that lines the entire cytoplasmic half of the transmembrane pore. This arrangement provides explanations for a variety of functional observations from earlier studies, significantly advancing our understanding of ASIC structure and function.Decision letter after peer review:eLife. Your article has been reviewed by three peer reviewers, including L\u00e1szl\u00f3 Csan\u00e1dy as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Kenton Swartz as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Youxing Jiang (Reviewer #2); Stephan A Pless (Reviewer #3).Thank you for submitting your article \"Conserved His-Gly motif of acid-sensing ion channels, implicated in gating and ion selectivity, is a reentrant 'loop'\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. In recognition of the fact that revisions may take longer than we typically allow, until the research enterprise restarts in full, we will give authors as much time as they need to submit revised manuscripts.Summary:This study presents high-resolution structures of the resting and desensitized chicken ASIC1a channel in its native membrane environment, obtained by single-particle cryo-EM following extraction using styrene maleic acid (SMA) copolymers. The overall structures are similar to those obtained previously for detergent solubilized channels. However, whereas in the detergent solubilized structures the N-terminus of the protein was not resolved, suggesting that it is disordered, in the SMA structure an N-terminal pre-membrane segment that harbors the highly conserved HG motif forms an ordered reentrant loop that lines the entire cytoplasmic half of the transmembrane pore. This arrangement provides explanations for a variety of functional observations from earlier studies, significantly advancing our understanding of ASIC structure and function. The somewhat unexpected positioning of the conserved HG motif near the ion permeation pathway is also relevant for studies on other ENaC/DEG channel family members. In addition to scientific insight, there is also important methodological contribution. The study provides a good example of detergent-free extraction of a membrane protein directly from the cell membrane using styrene maleic acid (SMA) copolymers for structure determination.Essential revisions:1) Given that the SMA-assisted sample preparation has not been used on ASICs before, the reviewers have discussed whether they should request from the authors to demonstrate that the ASIC1a channel is still functional when prepared with this approach. Considering the difficulty of performing experiments in the present situation, we do not request such experiments to be done, but the authors should discuss or allude to this issue in the Discussion section.2) The manuscript is clearly written, but the discussion is rather concise and falls somewhat short of providing enough depth and context for those not directly familiar with the ASIC literature. It would benefit from more detail with regards to the following topics:2.1) It would be helpful if the authors could provide additional context concerning previous functional and structural data, i.e. where the present structure validates/clashes with previous observations. This is particularly evident with regards to the fact that some of the previous ASIC structures had noticeably different orientations/conformations of the TM helices. For example, in one of their previous studies , the following was stated: \"A careful review of electron density maps of the initial cASIC1a structure  and the delta13-PcTx1 complexes  provides no evidence for swapping of the TM2 helices as we observe in the low-pH desensitized state and in the MitTx complex. Thus, we conclude that the swap in TM2 does not occur in the low-pH and high-pH PcTx1 structures or in the initial cASIC1a structure.\" How do the authors rationalize the present structure in light of these earlier findings? While the construct in Jasti et al., 2007 lacked most of the N-terminus, there is no immediately obvious reason why the construct used in Bacoguis and Gouaux, 2012 would not have shown this re-entrant loop.2.2) Related to this, could the authors speculate on why/how the residues in TM2b might impact ion selectivity? It would seem that the present structure makes it likely that the functional effects observed with mutants in this area were indirect in nature (unless of course the open state structure adopts a very different conformation in this part of the channel).2.3) Although necessarily somewhat speculative, it would be helpful if the authors could expand on their discussion with regards to the implications of the presence of the lipids (subsection \u201cDensity features suggest TMD-membrane interact\u201d) and the missing C-terminus , respectively. In other words, how do these findings compare to related (trimeric) channel structures? What could be undertaken to get more insight into these aspects? etc.2.4) The authors suggest that the constriction formed by the conserved histidine of the HG motif might serve as a selectivity filter (subsection \u201cPre-TM1 residues form the lower ion permeation pathway\u201d). Can the authors propose a chemical mechanism by which a histidine side chain would explain the ion selectivity pattern of ASIC channels? Essential revisions:1) Given that the SMA-assisted sample preparation has not been used on ASICs before, the reviewers have discussed whether they should request from the authors to demonstrate that the ASIC1a channel is still functional when prepared with this approach. Considering the difficulty of performing experiments in the present situation, we do not request such experiments to be done, but the authors should discuss or allude to this issue in the Discussion section.We have included an additional paragraph in the Discussion section to address this point.2) The manuscript is clearly written, but the discussion is rather concise and falls somewhat short of providing enough depth and context for those not directly familiar with the ASIC literature. It would benefit from more detail with regards to the following topics:2.1) It would be helpful if the authors could provide additional context concerning previous functional and structural data, i.e. where the present structure validates/clashes with previous observations. This is particularly evident with regards to the fact that some of the previous ASIC structures had noticeably different orientations/conformations of the TM helices. For example, in one of their previous studies , the following was stated: \"A careful review of electron density maps of the initial cASIC1a structure  and the delta13-PcTx1 complexes  provides no evidence for swapping of the TM2 helices as we observe in the low-pH desensitized state and in the MitTx complex. Thus, we conclude that the swap in TM2 does not occur in the low-pH and high-pH PcTx1 structures or in the initial cASIC1a structure.\" How do the authors rationalize the present structure in light of these earlier findings? While the construct in Jasti et al., 2007 lacked most of the N-terminus, there is no immediately obvious reason why the construct used in Bacoguis and Gouaux, 2012 would not have shown this re-entrant loop.Given the history of multiple conformations \u2013 i.e. domain swapped vs continuous \u2013 at the TM2 helix of cASIC1 x-ray structures as well as the subject matter of this work, we recognize that a more comprehensive overview of this disparity is warranted. To this end, we have provided a synopsis of TM heterogeneity in cASIC1 structural studies in the Discussion section as well as our interpretation of these past results in light of the present study. Briefly:With regards to the conformation of TM2 helices (Discussion section): While domain-swapped TM2 helices and GAS belt constrictions are now established structural characteristics of functional channels in desensitized, toxin-stabilized open, and resting conformations, x-ray structures of ASIC1 channels bound to the gating modifier toxin, PcTx1, harbor continuous TM helices, indicating that a subset of conformational states outside of the canonical proton-dependent gating pathway may deviate from the domain-swapped architecture. While the capacity of ASICs to adopt both domain-swapped and continuous TM2 helices is supported by both x-ray structures and evolutionary analysis, the functional relevance of a \u2018dual-mode\u2019 lower pore architecture remains enigmatic.With regards to the pre-TM1 reentrant loop (Discussion section): In light of the structural heterogeneity at the lower pore of ASICs, the presence of lipid-like densities along the reentrant loop of cASIC1-SMA channels is particularly notable. Indeed, these studies represent the first structures of an ASIC not solubilized by detergent. We speculate that a lipid-like environment, maintained by virtue of detergent-free, SMA-mediated protein extraction and purification methods, may be important for maintaining the integrity of the lower pore structure of ASIC1 channels. Accordingly, structures of the cASIC1-SMA complex provide evidence of an ordered pre-TM1 reentrant loop in the high pH resting and low pH desensitized conformations.2.2) Related to this, could the authors speculate on why/how the residues in TM2b might impact ion selectivity? It would seem that the present structure makes it likely that the functional effects observed with mutants in this area were indirect in nature (unless of course the open state structure adopts a very different conformation in this part of the channel).We have expanded the Discussion section to include an overview of the potential contribution of TM2b residues to selectivity in ASICs. As outlined in the comment, we acknowledge that the structure of a full-length cASIC1 channel in a lipid-like environment and in a proton-activated open state may adopt a different conformation than indicated by existing structures. Currently, however, our structural data does not provide evidence of a direct contribution made by TM2b residues to the ion channel pore and thus we conclude that the effects of TM2b mutations are likely indirect in nature, such as may be observed if mutations at TM2b altered the conformation of the lower pore.2.3) Although necessarily somewhat speculative, it would be helpful if the authors could expand on their discussion with regards to the implications of the presence of the lipids (subsection \u201cDensity features suggest TMD-membrane interact\u201d) and the missing C-terminus , respectively. In other words, how do these findings compare to related (trimeric) channel structures? What could be undertaken to get more insight into these aspects? etc.7 channels, which harbor large structured intracellular terminal domains (Discussion section), concluding that \u2018Contrary to P2X receptors, the intracellular carboxy termini of ASICs is predicted to be largely disordered, does not appear to contribute to channel gating and is instead likely to serve as a nexus for interactions with cytoplasmic proteins, thus highlighting the need for future studies to pursue the structure of ASICs in complex with cellular binding partners in an effort to better illuminate the contribution of these residues to ASIC biology.\u2019We believe that the presence of elongated lipid-like densities, especially adjacent to the reentrant loop, is indicative of how our detergent-free protein handling methods retained a lipid-like environment surrounding the TMD and protected the integrity of the reentrant loop residues. We believe that this hypothesis supports our observation of disordered pre-TM1 reentrant loop residues in x-ray and cryo-EM structures of detergent-solubilized channels and have expanded the Discussion section to include these points. We also discuss the disordered carboxy terminus and the contrast to recent structures of trimeric P2X2.4) The authors suggest that the constriction formed by the conserved histidine of the HG motif might serve as a selectivity filter (subsection \u201cPre-TM1 residues form the lower ion permeation pathway\u201d). Can the authors propose a chemical mechanism by which a histidine side chain would explain the ion selectivity pattern of ASIC channels?We have expanded on our initial hypothesis of His 29 may contribute to ion selectivity of ASICs and have included this in the Discussion section. However, while the presence of a previously unobserved constriction in the pore of cASIC1 in intriguing and may indicate involvement in selectivity, these concepts are, at this stage, speculative given the limitations of our current data. We hope that future studies will address the lack of a structure of a proton-activated (open) ASIC in a lipid-like environment as it will provide insight to the conformation adopted by the lower pore and reentrant loop when in an activated and ion conducting conformation."}
+{"text": "To study any disease, researchers need convenient and relevant disease models. In cancer, the most commonly used models are two-dimensional (2D) culture models, which grow cells on hard, rigid, plastic surfaces, and mouse models. Cancer immunology is especially difficult to model because the immune system is exceedingly complex; it contains multiple types of cells, and each cell type has several subtypes and a spectrum of activation states. These many immune cell types interact with cancer cells and other components of the tumor, ultimately influencing disease outcomes. 2D culture methods fail to recapitulate these complex cellular interactions. Mouse models also suffer because the murine and human immune systems vary significantly. Three-dimensional (3D) culture systems therefore provide an alternative method to study cancer immunology and can fill the current gaps in available models. This review will describe common 3D culture models and how those models have been used to advance our understanding of cancer immunology.Cancer immunotherapy has revolutionized cancer treatment, spurring extensive investigation into cancer immunology and how to exploit this biology for therapeutic benefit. Current methods to investigate cancer-immune cell interactions and develop novel drug therapies rely on either two-dimensional (2D) culture systems or murine models. However, three-dimensional (3D) culture systems provide a potentially superior alternative model to both 2D and murine approaches. As opposed to 2D models, 3D models are more physiologically relevant and better replicate tumor complexities. Compared to murine models, 3D models are cheaper, faster, and can study the human immune system. In this review, we discuss the most common 3D culture systems\u2014spheroids, organoids, and microfluidic chips\u2014and detail how these systems have advanced our understanding of cancer immunology. Cancer immunotherapy represents a scientific breakthrough. Treatments such as immune checkpoint inhibitors, chimeric antigen receptor (CAR) T cells, and cytokine therapy, among others, are extending patients\u2019 lives and in some cases offering cures. While each treatment works through a different mechanism, all cancer immunotherapies have the same goal\u2014to enhance the patient\u2019s own immune system to recognize and eliminate the cancer. The FDA has approved immunotherapy for at least 19 different cancer types. In 2019 alone, the FDA approved 15 immunotherapy regiments . If. If41]. The homogenous nature of spheroids can be exploited to create highly controlled experimental conditions. To explore immune cell-cancer cell interactions in a spheroid system, researchers can add exogenous immune components, such as immune cells derived from cell lines or from healthy human donors, or even cytokines that mimic immune cell presence. The limited number of cellular components in these 3D cocultures grants greater clarity into specific cell-cell interactions that are nearly impossible to deconvolute in complex in vivo experiments. Further, cell-cell interactions in spheroids are more physiologic than cell-cell interactions in 2D culture systems. Therefore, spheroid co-cultures provide convenient and interpretable methods for exploring immune cell-cancer cell crosstalk. Spheroid immune cell-cancer cell cocultures have revealed novel and potentially exploitable mechanisms behind cancer immunoediting.For example, interferon gamma (IFN\u03b3) is an anti-tumor cytokine released by activated T and NK cells. IFN\u03b3 participates in cancer cell elimination by inhibiting cancer cell proliferation, enhancing apoptosis, abrogating tumor angiogenesis, and activating certain immune cells . By expoTransforming growth factor beta (TGF-\u03b2) is an immunosuppressive cytokine also involved in immunoediting. Similar to Liu et al., Stuber et al. used exogenous cytokine to interrogate its function. Unlike Liu et al., Stuber exposed the immune cells (in this study CAR T cells), not the cancer cells, to exogenous cytokine . In vitrCreating an immunosuppressive microenvironment is critical for cancer cells to escape immune destruction. Multiple studies have employed spheroids to determine how cancer cells interact with monocytes to create a pro-tumor growth and immunosuppressive tumor microenvironment. Using either PBMCs or cell line-derived monocytes, Raghavan et al. showed that ovarian cancer spheroids cocultured with monocytes were more invasive and less sensitive to chemotherapy in vitro . When thCytokines are well-studied mediators of cancer cell-immune cell crosstalk, but there are additional methods for cellular communication, one of which is release and uptake of extracellular vesicles . Cancer Deficient antigen presentation is another mechanism by which cancer cells evade immune destruction . AntigenThe majority of onco-immunology research to date studies immune cell and cancer cell interactions. However, in patient tumors, the stroma is a critical tumor component, consisting of dense extracellular matrix and heterogeneous cell populations that are predominantly fibroblasts. This stroma can comprise as much as 90% of the tumor volume . In someChimeric antigen receptor (CAR)-modified T cells and NK cells represent a recently emergent pillar of cancer immunotherapy. CARs are engineered receptors that target T or NK cells to recognize and lyse cells that express a specific antigen. The most well-known example is anti-CD19 CAR T cells used to treat acute lymphoblastic lymphoma . CAR celUnlike spheroids, organoids derived from tumors can maintain the complex multicellular, 3D microenvironment and fill a gap in methodology required for the development of CAR cells against solid malignancies. In a proof-of-concept study, Jacob et al. demonstrated patient derived glioblastoma organoids retained similar histology, microvasculature and cellular heterogeneity as the primary tumors they were derived from . Some ofSince organoids more accurately reflect clinical response to CAR therapy compared to spheroids or 2D cultures and are more amenable to screening approaches than murine models, Schnalgzer et al. developed a method to use organoids for CAR cell efficacy screening . In thisWhile immunotherapy provides long lasting remissions for some patients, the majority of patients, approximately 87%, do not respond to treatment . These tIn the previously described tumor derived organoid models, host-derived immune cells in these cultures are either lost rapidly or maintained for about a week before they are rapidly lost prohibiting the application of these methods to assess the efficacy of immunotherapies in these tumors ,73. To cThe Votanopoulous study demonstrates that immune cells collected from locations other than the tumor microenvironment can accurately reflect tumor immune responses in 3D cultures. However, the ideal culture system would utilize tumor infiltrating immune cells as opposed to exogenously added immune cells. In 2018, Neal et al. showed the addition of IL-2 to air-liquid interface organoid culture preserves tumor epithelial cells, stromal components and CD4+ and CD8+ T cells for up to 28 days . Tumor iIn 2018, Jenkins et al. demonstrated tumor pieces derived from both murine and human tumors embedded in collagen containing 3D microfluidic chips\u2014termed \u201corganotypic tumor spheroids\u201d\u2014continue to grow and maintain immune cell composition . This teImmune checkpoints are inhibitory receptors expressed by activated immune cells to facilitate self-tolerance. However, some of these pathways are co-opted by malignant cells facilitating immune evasion. Immune checkpoint inhibitors block these inhibitory receptor-ligand interactions restoring anti-cancer immunity . SeveralNovel combinatorial therapies that enhance anti-PD-1 efficacy in otherwise resistant tumors is also an active area of research . Deng etPerhaps the most exciting potential of microfluidic chips is the ability to model and investigate tumor and immune cells\u2019 relationships with vasculature. Tumor-associated blood and lymphatic vasculature play a critical role in tumor growth and immune evasion . 2D systUsing intricately engineered microfluidic chips, Cui et al. studied how endothelial cells impacted monocytes and vice versa in glioblastoma . They foAdditional 3D culture methods, such as scaffolds, fall outside of the three broad categories presented . Scaffolds are 3D matrices that lack cells and are often used to recapitulate extracellular matrix. Several techniques can be used to create scaffolds including: (1) pre-made porous scaffolds, usually made with natural or synthetic biomaterials; (2) cells which secrete extracellular matrix; and (3) decellularized extracellular matrix derived from tissue  91]. Sc. Sc91]. Engineered porous scaffolds have been used to investigate the impact of the extracellular matrix biophysical properties on immune cells and cancer-immune cell interactions. Wong et al. engineered hydrogels with adjustable stiffness and found that soft extracellular matrix alters stromal cell cytokine and chemokine production, enhancing stromal recruitment of monocytes . Alanso-One elegant study that used cell-secreted matrix investigated the differences between aged and young fibroblast-derived extracellular matrix. This group found that aged extracellular matrix enhances melanoma cell motility, while simultaneous reducing T cell motility . The difTo study the impact of cancer-derived matrix versus healthy tissue-derived matrix, some researchers use decellularization techniques to generate patient-derived cell-free extracellular matrix . These tScaffolds can also be used to study immunotherapy. In one study, Wolf et al. implanted a biological scaffold  along with B16-F10 melanoma cells in mice. They found that the addition of urinary bladder matrix inhibited melanoma cell growth in a CD4+ T cell and macrophage dependent manner . Zhang eUnlike microfluidic chips that allow for laminar flow through a culture system, dynamic cell culture allows for movement of the cells themselves. These dynamic cell culture systems can be used as techniques to create already discussed models. Spinner bioreactors can be used to create spheroids and organoids. They employ a propeller that continuously spins cells in suspension, thereby reducing cellular adhesion and enhancing homogenous distribution of nutrients and oxygen  109]. T. T109]. 3D culture systems provide a tremendous opportunity to explore cancer immunology, but they are not without limitations. The increased complexity of 3D systems can make inter- and intra-experiment reproducibility difficult . 3D cultThe past decade has witnessed tremendous strides to advance our understanding of the anti-cancer immune system. These advances span a spectrum from basic to clinical research. As the biology revealed becomes increasingly complex, so too must the models used to study that biology. 3D culture systems have addressed these research needs by providing complex yet interpretable platforms. 3D culture systems have thus far been used to discover new insights into immunotherapy distribution, immune cell penetration, cancer-induced immunosuppression, CAR cell development and much more. There remain additional cancer-immunology related fields where 3D culture systems have yet to be applied, including but not limited to alterations in regulatory T cell migration and activity, myeloid-derived-suppressor cell biology, and vaccine development. As 3D technology cost decreases, accessibility increases, and conceptual applications swell, these technologies will undoubtedly continue to gain popularity\u2014perhaps replacing 2D culture methods altogether."}
+{"text": "Fusarium graminearum is a global fungal pathogen of wheat and other small grains, causing Fusarium head blight (FHB) disease, also known as wheat scab. We report here the annotated genome of a deoxynivalenol/15-acetyl-deoxynivalenol-producing Brazilian strain called CML3066, isolated from FHB-symptomatic wheat spikes collected in 2009. Fusarium graminearum is a global fungal pathogen of wheat and other small grains, causing Fusarium head blight (FHB) disease, also known as wheat scab. We report here the annotated genome of a deoxynivalenol/15-acetyl-deoxynivalenol-producing Brazilian strain called CML3066, isolated from FHB-symptomatic wheat spikes collected in 2009. Fusarium graminearum is the main pathogen causing Fusarium head blight (FHB), an important cereal disease worldwide , isolated in 2009 in Rio Grande do Sul state, Brazil . This strain was isolated from a symptomatic wheat spike with 21.5% FHB incidence (The ascomycete fungus orldwide . The F. F. graminearum CML3066 was extracted from mycelia grown for 3 days in potato dextrose broth (PDB) medium using a cetyltrimethylammonium bromide (CTAB) protocol  and the SMRT analysis portal using the PacBio data. The PacBio assembly was manually gap filled and further scaffolded using Lastz v1.04.03 alignments with the complementary Illumina assembly, resulting in four complete chromosomes from telomere to telomere with no gaps or N bases. Reference sequence statistics were extracted from Geneious v8.1. The genome annotation of CML3066 was done using the MAKER v2.30  calling was performed with SAMtools using default settings. SNP effects were predicted using SnpEff 4.2. Comparison of SNP frequencies along all four chromosomes of both CML3066 and PH-1  revealed11\u2013PRJEB12819. The accession numbers for the assembled chromosomes and mitochondrial genome are LT222053 to LT222057. The secretome and effector predictions can be found at https://github.com/ana321wood/Secretome_CML3066_Feb2020/blob/master/Secretome_CML3066_Feb2020_AMW.txt.The raw data and assembled/annotated sequences have been deposited in the European Nucleotide Archive (ENA). The study accession number is"}
+{"text": "This study was performed to evaluate the role of carrot when administered concurrently with a conventional antiulcer treatment, pantoprazole, in alleviating gastric and duodenal ulcers in female experimental animals. The study involved standard animal models to determine the ulcer preventive effect using pylorus ligation, ethanol, and stress induced acute gastric ulcer models and duodenal ulcer models involving cysteamine. Acetic acid-induced chronic gastric ulcer and indomethacin-induced gastric ulcer models were used to evaluate the ulcer healing effect. Carrot fruit (500 mg/kg) and its co-administration with pantoprazole produced significant protection in an ethanol- and stress-induced acute gastric ulcer and cysteamine-induced duodenal ulcer. The healing of the acetic acid-induced chronic gastric ulcer was also augmented with this combination. Both total proteins and mucin contents were significantly increased in indomethacin-induced gastric ulcers. Similarly, in pylorus ligation, the pepsin content of gastric juice, total acidity, and free acidity were reduced. Overall, both ulcer preventive effects and ulcer healing properties of the pantoprazole were significantly enhanced in animals who received the co-administration of carrot fruit (500 mg/kg).The carrot plant  Daucus carota L) belongs to the family Apiaceae. The edible part of a carrot is a taproot that gets its unique color due to the presence of \u03b2-carotene that is metabolized into vitamin A after human consumption. Carrot fruits are reported to cleanse the intestines as well as act as a diuretic. They are the source of nutrition and help in maintaining an acid\u2013base balance. They are regarded as commonly used vegetables for vision maintenance. The beneficial effect of carrot and its active constituent, \u03b2-carotene, is also reported for liver function. Additionally, carrots provide relief from diarrhea, constipation, intestinal inflammation, weakness, illness, and in the treatment of rickets. In addition to \u03b2-carotene, the protective actions of carrot are also attributed to its other constituents, such as riboflavin, A-retinol, niacin, A-carotenoid, vitamins A, B6, B12, C, E, and K, thiamin, pantothenic acid, and folate [A diet enriched with fruits and vegetables obviates gastrointestinal manifestations, including the prevention of new gastric or duodenal ulcers and healing of already formed ulcers . Carrot Although the concurrent use of herbal therapies and home remedies, along with conventional modern medicinal products, is commonly found for the management of many diseases and ailments, there is a need to standardize their combined use to overcome the possible herb\u2013drug interaction. Their concomitant use may either decrease or increase the therapeutic value of one another .Clostridium difficile infection [Even though carrot fruit is employed in a number of traditional medicinal systems in India for a variety of ailments in the gastrointestinal system, so far, there is no scientific report to confirm the ethnopharmacological claim. We also felt it necessary to determine the biological role of carrot in the presence of conventional antiulcer drugs, such as potent acid suppressor agent, proton pump inhibitor (PPI), and pantoprazole, as many patients use carrot with these drugs. Although PPI is a potent antiulcer agent, overdependence on this class of agent may lead to an increased risk of bone fracture , mineralnfection . Additionfection , dementinfection , gastricnfection , and chrnfection . This hanfection . Thus, tPreliminary phytochemical investigation of the carrot suspension confirmed the presence of carotenoids and phenolic compounds. The presence of carbohydrates, triterpenoids glycosides, saponins, tannins, alkaloids, steroids, proteins, amino acids, and flavonoids were also observed .50 values of 6 \u00b5g/mL, while carrot showed at 312 \u00b5g/mL. IC50 is the concentration of an inhibitor at which 50% inhibition of the response is seen  with pantoprazole showed a significant increase in ulcer healing compared to pantoprazole administered alone, though such an effect was not observed with the combined use of low dose of carrot (200 mg/kg) with pantoprazole . Ulcer hThe gastric antisecretory as well as antiulcer effect of carrot was observed only in higher dose (500 mg/kg) in pylorus ligated rats. However, the lower dose (200 mg/kg) of carrot reduced free acidity and total acidity of the gastric juice. The use of pantoprazole alone or in combination with high dose of carrot (500 mg/kg) showed excellent effects . MoreoveAs shown in Similar to earlier effect on ulcers, high dose of carrot (500 mg/kg), pantoprazole and their combination reduced ulcer index and increased gastric mucin content in animals with gastric ulcers induced by indomethacin . FurtherDaucus carota fruit and its additive effect with the antiulcer drug pantoprazole. The Daucus carota plant is traditionally used as an antiulcer agent in several regions of the world [The present work showed gastric antisecretory and gastric cytoprotective effects of he world . An earlhe world . The curThe standard antiulcer methods used for the evaluation of antiulcer activity were followed. Only female rats of reproductive age used to minimize hormone mediated bias that would have occurred in case of mixed gender. It is observed that the ratio of men to premenopausal women for ulcer development is high, ranging from 1.9:1 to 3.1:1 . The aceCarrot is used traditionally in different forms. Scientific studies on its pharmacological effects have been reported using different extracts, ranging from polar aqueous extract to non-polar solvents ,19. SomeCarrot is known to contain several constituents that include phenolics, flavonoids, and volatile oils. It is a rich source of \u03b2-carotene and pectins . PhenoliSince carrot contains a wide variety of constituents with varying effects, it can be assumed that one single constituent may not be responsible for its antiulcer action. Furthermore, carrot prevented the development of ulcers and increased ulcer healing by more than one mechanism, including gastric antisecretory, gastric cytoprotective, and antioxidant effects, as shown in different models used in this study. It is possible that each of the ulcer healing and ulcer preventive effects may be due to one or more constituents of the carrot preparation. We would like to emphasize that this study was not meant to identify or isolate chemical constituents responsible for the antiulcer effect, but rather to verify the traditional claim that carrot fruit possesses antiulcer action. Moreover, it is very unlikely that carrot or its isolated constituents may be used alone as antiulcer drugs, as several traditional medicines having a more potent effect than carrot have at lower dose and some of them are being used. The low dose of carrot (200 mg/kg) did not show cytoprotective potential or a weak effect in ulcer models. Hence, the effect of a combination of carrot with pantoprazole (proton pump inhibitor) was evaluated. The additive effect seen with this combination could be due to the combined antiulcer action of each agent and/or there may be some pharmacokinetic interactions. Further studies on pharmacokinetics may provide information about the potential interaction between carrot and these drugs.Institutionally bred albino Wistar rats  in the weight ranging between 150 and 200 g were used in this study. The Institutional ethical committee approved the experimental protocol of this study with the number KCP/IAEC-22/2008-09 dated 1 December 2008. Standard conditions were followed before and during the experimentation for the maintenance of animals as proposed by Committee for the Purpose of Control, and Supervision on Experiments on Animals (CPCSEA).Daucus carota) fruit was prepared by steam boiling of carrot. Light cooking is known to increase its antioxidant property [The suspension of Carrot (property . Carrot property .(Daucus carota) was done to determine the presence of phytochemicals, like tannins, phytosterols, carbohydrates, flavonoids, proteins, glycosides, and saponins [The phytochemical analysis of aqueous suspension of boiled carrot fruit saponins . Hager\u2019sAn adequate amount of carrot was dissolved in 98% methanol to prepare stock of the aqueous solution of carrot (10 mg/mL). Using an appropriate dilution from the stock solution, working solutions of 10, 20, 30, 40, 80, 100, 120, 140, 180, 200, 250, 400, and 800 \u03bcg/mL were prepared. The antioxidant potential of carrot solution and gallic acid (standard) was determined on 1, 1-diphenyl-2-picrylhydrazyl (DPPH) .The experimental rats were divided into six groups. Group I received a vehicle (1 mL/kg), while group II and III were given low  and high  doses of carrot solution. The animals of group IV were administered with pantoprazole (20 mg/kg)  (PZL), whttp://www.scioncorp.com). The ulcer index was calculated [At the end of 10 days treatment of animals, as per the protocol of the group described above, animals were kept under fasting conditions for 24 h and the abdomen was opened under light ether anesthesia . A cylinlculated . The ulclculated .ad libitum. Ether anesthesia was used to anesthetized animals and pyloric sphincter was ligated, drugs as per the experimental group were administered intraduodenally subsequent to the ligation of pylorus. No food or water were offered to animals during the post-surgery period. Animals were sacrificed 6 h after pyloric ligation [Experimental animals were kept for 36 h fasting prior to pyloric ligation with water ligation . Gastricligation . AdditioEthanol was administered to experimental animals after keeping them under fasting conditions for 36 h. Drug was administered to the animals based on the group protocol described above 1 h prior and post ethanol administration. Subsequently, animals were sacrificed, and the stomach was isolated. Then, both ulcer score and ulcer index were calculated based on the method described elsewhere .Animals were administered with drugs based on the experimental group 30 min before stress induction. Stress was induced by keeping them in a restraint cage for 3 h at 2 \u00b0C for 3 h. At the end of 3 h, stomachs were isolated after sacrificing animals. Then, the ulcer score and ulcer index were calculated .All experimental animals used in this model were administered with indomethacin 5 mg/kg orally for five days. Indomethacin solution was prepared daily with sodium carbonate adjusted to pH 7.4 with HCl. Subsequently, they are treated with their respective drug regimen for five days, animals were sacrificed . Both ulExperimental animals received drugs as per their group protocol 30 min before the dose of cysteamine hydrochloride (400 mg/kg) orally. The second dose of drug was administered and so the second dose of cysteamine on the same day after an interval of four h . Animalsp < 0.05 was considered significant.One-way analysis of variance (ANOVA) followed by Dunnett\u2019s comparison test was used to determine the statistical significance of interventions in the study. All values are expressed as mean \u00b1 SEM and Daucus carota fruit and its combination with pantoprazole obviate the formation of gastric and duodenal ulcers and enhance gastric ulcer healing. The antioxidant profile of carrot together with the gastric antisecretory properties of some of the active constituents of carrot preparation and probable gastric cytoprotection offered by vitamin A or beta-carotene may be responsible for its antiulcer effect. Overall, both ulcer preventive effects and ulcer healing properties of the pantoprazole were significantly enhanced in animals who received the co-administration of carrot fruit (500 mg/kg).To conclude,"}
+{"text": "In contrast, HCV+ patients showed higher mean levels of PBMC cytokine values for IL-5 and TNF-\u03b1 (p < 0.0001). As for neutrophils, HCV+ patients showed significantly lower mean levels of IFN-\u03b1, IFN-\u03b3, IL-2, IL-4, IL-6, IL-9, and IL-10 (p < 0.0001). In contrast, the neutrophils from HCV+ patients showed higher mean levels of IL-5, IL-12, and TNF-\u03b1 (p < 0.0001). Th1\u2013Th2 cytokine ratios suggested a lower Th1 bias in HCV+ subjects as compared to HCV\u2212 subjects. Our results suggest that chronic HCV infection brings about an immunomodulatory effect not only on neutrophils, but also to a lower extent on PBMCsThis study investigated the influence of Hepatitis C virus (HCV) infection on the cytokine production profiles of the peripheral blood monoculear cells (PBMC) and neutrophils in chronically na\u00efve HCV-infected patients. Seventy-five genotype-4 na\u00efve HCV-infected patients (HCV+) and healthy subjects (HCV\u2212) were enrolled. The neutrophils and the PBMC were separated by density gradient sedimentation and stimulated with a mitogen. The culture supernatants were evaluated for levels of IFN-\u03b1, IFN-\u03b3, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, and TNF-\u03b1 using anti-cytokine antibody MACSPlex capture beads. The PBMC cytokine profiles of HCV+ patients showed significantly lower mean values for IFN-\u03b3, IL-2, IL-6, IL-9, and IL-10 ( Neutrophils are basic effector components in inflammatory processes. They are among the first cells to reach the site of infection and have a wide range of effector mechanisms, including phagocytosis, production of oxygen radicals, secretion of cytokines and chemokines, formation of neutrophil extracellular traps, and interactions with other immune cell populations ,2,3. NeuIn contrast, a Th2 profile appears to be implicated in HCV pathogenesis and disease severity . Strong Interestingly, the role of neutrophils in anti-viral immunity is not yet fully understood ,3,15. WhWhile some studies have documented the immunomodulatory effect of HCV infection in inflammation and antiviral immune responses ,21,22,23We initially recruited 86 chronically na\u00efve HCV-infected patients with compensated liver disease, as well as 75 healthy controls (age- and sex-matched). Patients were inducted from two hospitals in Kuwait (Mubarak Al-Kabeer and Al-Amiri). The 86 subjects were genotyped; 75 of them were genotype-4, and these subjects were included in this study. p < 0.0001). In contrast, statistically higher mean levels of IL-5, IL-9, and TNF-\u03b1 (p < 0.0001) were produced by the PBMC in HCV+ patients. However, no statistically significant differences were detected in the production of IFN-\u03b1, IL-4, and IL-12 when the HCV-infected patients were compared with the healthy subjects (p > 0.05).p < 0.0001). In contrast, we observed higher mean levels of IL-5 and IL-12 (p < 0.0001). However, no significant differences were detected in the levels of TNF-\u03b1 when the HCV-infected patients were compared to the healthy subjects (p > 0.05).The cytokine production profiles of neutrophils from HCV+ patients and HCV\u2212 subjects are shown in Our results showed no correlation between the ten cytokines tested and the HCV viral load .Keeping in mind that the relative levels of the Th1 and Th2 cytokines are as important as, if not more important than, the absolute levels of cytokines, per se, we calculated the ratios of Th1\u2013Th2 cytokines, as these ratios can indicate the dominance of the cytokine patterns. As shown in The ratios of IL-6/IL-5, IL-6/IL-4, IFN-\u03b3/IL-5, and IFN-\u03b1/IL-5 showed lower differences in the HCV+ patients versus the HCV\u2212 individuals . In contrast, a stronger Th1-cytokine bias was seen in 12 out of the 24 combinations in the neutrophils of the HCV+ patients, as compared to the HCV\u2212 individuals\u2019 ratios involving IL-2, which showed higher differences in the HCV+ versus HCV\u2212 subjects. The ratios of IL-2/IL-9 and IL-2/IL-10 were 10,000- and 1000-fold, respectively. In addition, IL-2/IL-4 and IL-2/IL-5 ratios were 58- and 30-fold higher, respectively, in the HCV+ patients.Neutrophils play a vital role in innate immunity ,2. We hyIFN-\u03b1 has been used for the treatment of chronic HCV infections . PegylatIL-2 exerts a wide range of remarkable effects on the immune system . In chroIL-6 is a potent cytokine that controls a wide range of in vivo activities and is recognized for its role in shifting from nonspecific innate immunity to extremely specific, adaptive immunity against infection ,33. FurtOur results showed a significant increase in the production of IL-9 by the PBMC in HCV-infected patients as well as a significant decrease in the neutrophils. A similar result in the PBMC in HCV-infected patients was documented by Ali et al., suggesting a direct link between the production of IL-9 and liver disease progression . SimilarWe observed a significant increase in the production of TNF-\u03b1 by the PBMC in HCV+ patients. Previous studies have reported a similar increase in TNF-\u03b1 levels by the resultant PBMC, thyrocytes, and monocytes of HCV infection ,42,43. APrevious studies investigated the Th1/Th2 bias during HCV infection ,40,46,479/L, eosinophil count > 350/\u03bcL, platelets < 50 \u00d7 109/L, seropositivity for hepatitis B virus (HBV) and human immunodeficiency virus (HIV), alcohol or drug dependence, serious comorbid conditions, severe psychiatric disorders, treatment with antiviral or immunosuppressive agents before enrollment, and diabetes.A statistical power analysis was conducted to determine the sample size to be studied; the sample size obtained by power calculation for the simple random sample was 75 subjects, assuming a 95% rate of change in HCV infection, a 95% confidence interval, and a maximum accepted error of 0.05. Eighty-six na\u00efve adult chronic HCV patients with compensated liver disease (HCV+) (Child\u2013Pugh\u2013Turcotte class A), aged 18 years old and above, were selected from the Al-Amiri Hospital and the Mubarak Al-Kabeer Hospital in Kuwait. The same number of healthy control subjects (HCV\u2212) were recruited. Criteria for inclusion in the study were the presence of anti-HCV antibody, HCV RNA detectable by a polymerase chain reaction, fluctuating or persistently elevated alanine aminotransferase (ALT) and aspartate aminotransferase (AST) , and compensated liver disease (Child\u2013Pugh\u2013Turcotte class A). Criteria for exclusion included clinical evidence of hepatic decompensation , serum albumin <30 g/L, total serum bilirubin >50 \u03bcmol/L, prothrombin time >4 s above control, serum creatinine >140 mmol/L, hemoglobin <110 g/L, total leukocyte count < 2 \u00d7 10This three-year study was initiated after obtaining ethical approval from the Human Research Committee of the Ministry of Health from February 2018 to January 2021. Written informed consent was obtained from all participants. Eighty-six sex- and age-matched healthy control subjects were included. Healthy control subjects were screened for HBV, HCV, and HIV, and only candidates negative for these tests were included in the study. Furthermore, healthy control subjects were tested for ESR and CRP, and only candidates negative for these tests were included in the study to exclude active inflammatory disorder. Eight milliliters of venous blood was collected in EDTA tubes from each subject before antiviral treatment. A fresh sample was obtained from each patient and processed within one hour for PBMC and neutrophil isolation. Additional samples were subjected to the following laboratory investigations: complete blood count (using CELL-DYN 1700); liver function tests including ALT, AST, total bilirubin, direct bilirubin, and serum albumin  as well as \u03b1-fetoprotein ; and, finally, viral load was measured by Quantitative HCV RT-PCR  and HCV diagnostic tests as well as HCV genotyping .The PBMC were isolated from fresh whole blood by Ficoll-Hypaque density-gradient centrifugation  as described previously in . Freshly5 cells/mL, and stimulated as described previously in [Neutrophils were isolated from fresh whole blood using a mixture of sodium metrizoate and Dextran 500 . Brieflyously in . The purously in .5 cells per well and then stimulated with PHA  at a concentration of 5 \u03bcg/mL for 96 h. The proliferation of PBMC and neutrophils by PHA was evaluated by radiolabeled thymidine uptake. Our standardization experiments have shown that optimal proliferation of PBMC and neutrophils was seen at 96 h (data not shown). Each sample was cultured with PHA alone to serve as a control. Supernatants were collected for cytokine evaluation on day four and stored at \u221280 \u00b0C.Neutrophil and PBMC were aliquoted separately into 96-well tissue culture plates at a density of 10Supernatants from cultures of PBMC and neutrophil were tested for cytokine production by using the flow cytometry bead-based array with a MACSPlex Cytokine kit, according to the manufacturer\u2019s instructions . MACSPlex Cytokine kit detects human IFN-\u03b1, IFN-\u03b3, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, and TNF-\u03b1. Samples were developed using a MACSQuant Analyzer 10 and were evaluated using the Express Mode option of the MACSQuantify 2.8 software .p < 0.05 was considered statistically significant and designated as * p < 0.05, ** p < 0.01, and *** p < 0.001. Standard deviation (SD) was represented by error bars.Statistical significance was analyzed using Prism 9 software . Viral loads were converted on a logarithmic scale (log10) for statistical analysis. The correlations between cytokines and HCV viral loads were established using Pearson\u2019s correlation coefficient. All statistical analyses were two-sided, and Our results shed light on the immunomodulatory effect of HCV infection on both PBMC and neutrophils in na\u00efve, chronically HCV-infected patients. This study provides new information on the effects of HCV infection on neutrophils. A well-accepted dogma in immunology is that effective host immunity in chronic HCV infection involves producing a robust Th1-type  response and lower Th2-type cytokine response. The results described above suggest that chronic HCV infection activates an immunomodulatory effect, not just on the PBMC (which had been reported in earlier studies), but also on the neutrophils, which had not been described previously in the literature. A lower Th1-cytokine bias was detected in the Th1\u2013Th2 cytokine ratios for both the PBMC and the neutrophils. Due to the complex nature of the cytokine networks, the exact roles of these cytokines in HCV infection/disease are not yet completely understood. Additional studies will be required to examine these mechanisms, which will be valuable for designing effective antiviral therapies. The limitations of this study were the small sample size, 95% purity of neutrophils isolation assay, and that the bulk of participants were genotype-4; the availability of other genotypes would have allowed enhanced comparative results. Studies on larger sample sizes and better purity neutrophil isolation techniques would offer valuable information that would strengthen the conclusions of this study."}
+{"text": "We used logistic regression to assess the association between unhealthy dietary pattern, defined by low adherence to Mediterranean Diet Score (MDS), and weight related complications, defined by the Edmonton Obesity Staging System (EOSS). We repeated the logistic regression models by age and socio-economic disadvantage strata in sensitivity analyses. We also repeated the main analysis on a propensity score matched dataset (n = 3364). Complications by EOSS \u22652 was present in 3036 (60.1%) participants. There was no statistically significant association between unhealthy dietary pattern and weight related complication ). The null association remained the same after repeating the analysis on three age and five socio-economic indexes for areas strata. The finding persisted after the analysis was repeated on a propensity score matched dataset. We found no evidence to support the hypothesis that unhealthy dietary pattern was associated with weight related complications in this cross-sectional study of the Australian population with overweight or obesity.We hypothesized that unhealthy dietary pattern would be associated with weight related complications among overweight. We analysed data from the Australian Health Survey conducted from 2011 to 2013. A total of 5055 adults with at least overweight (body mass index \u226525 kg/m Overweight and obesity is a major global health issue. It is estimated that more than 1.9 billion adults (aged 18 years and over) worldwide had overweight and obesity in 2016 ,4,5. StuThe Edmonton Obesity Staging System (EOSS)  has becoUnhealthy dietary pattern may be a useful indicator of weight related complications, as it has been consistently associated with an increased prevalence of overweight and obesity in population-wide studies ,13. FurtWe present this study according to the journal\u2019s formatting requirements and the STROBE guideline for reporting cross-sectional studies .2) and not pregnant or breast feeding at the time of the survey (n = 5055). Since a comprehensive description of the methodology used in this study has already been published [The Australian Bureau of Statistics (ABS) conducted the Australian Health Survey (AHS) in 2011\u20132013 that contained the National Nutrition and Physical Activity Survey (NNPAS), the National Health Survey (NHS), and the National Health Measures Survey (NHMS). Study participants who were in the NHS or NNPAS and gave consent to the NHMS provided urine and blood samples; the samples were then tested for a range of chronic disease biomarkers. We used data from the NNPAS and NHMS, with 9435 fully responding adults. For the present study, we selected participants who were adults (aged 18 years or over) with at least overweight  and was conducted according to Australian law (Census and Statistics Act 1905)  and the The NNPAS was conducted from May 2011 to June 2012 . It was All survey questions are described in the AHS User Guide .The EOSS variable was created using chronic disease biomarkers , measured blood pressure, and self-reported long-term health conditions. Specific criteria and thresholds were used to classify study participants in one of the EOSS categories (0\u20134) . Study pWe created our Mediterranean Diet Score (MDS) variable according to one of the most common methods used to assess adherence to Mediterranean diet pattern ,24. The We considered the following range of demographic and behavioural covariates in our statistical analyses. Demographic variables included sex, age, country of birth, marital status, highest year of school (determined by asking participants \u201cWhat is the highest year of primary or secondary school completed?\u201d), Socio-Economic Indexes For Areas (SEIFA)  , and houStudies with the same sample size as ours (comparing groups of size 2019 and 3036) have 90% power to detect a difference in proportions from 0.50 in group 1 to 0.55 in group 2 and statistically significant at the 0.05 significance level. We conclude that our study is well powered to detect any clinically meaningful differences in EOSS risk category associated with poor diet.Out of the 12,366 dwellings in the actual sample, 9519 adequately or fully responded to the first interview of the NNPAS, with an estimated response rate of 77%. As BMI was calculated from objectively measured weight and height, with scales and stadiometers, selection of the overweight sample was error free.We presented the characteristics of study participants by EOSS categories 0\u20131 vs. 2\u20134 as counts and percentages and tested for differences between these two groups using Chi-square tests. We used logistic regression to assess the association between low adherence to MDS (scores 0\u20134)  vs. high adherence to MDS (scores 5\u20139)  associated with EOSS 2\u20134 (dependent variable). We fitted five models to assess the association: unadjusted (Model 1), adjusted for SEIFA, sex, age, country of birth, marital status, hours usually worked each week, and level of highest education (Model 2), adjusted for whether exercise last week met 150 min recommended guidelines and smoking status (Model 3), adjusted for dieting (Model 4), and adjusted for energy (Model 5). n = 3438) (n = 3364) (We fitted models using MDS tertiles  and quar = 3438) . We furt = 3438) . We repe = 3364) . We perf2) of whom 3036 (60.1%) were classified into the EOSS 2\u20134 group indicating clinically significant weight related complications   .To our knowledge, this is the first study to comprehensively examine the association between unhealthy dietary pattern and weight related complications. In this nationally representative subsample of the Australian population with overweight and obesity, we found no evidence of an association between unhealthy dietary pattern (low adherence MDS) and weight related complications (EOSS \u2265 2) in the unadjusted analysis and after controlling for covariates. Moreover, this null finding persisted after sensitivity analyses with mean dietary intake of two 24 h dietary recalls, in stratified models by age and SEIFA categories, and after our application of the PSM technique. Based on the results of our cross-sectional study, unhealthy dietary pattern was not found to be a useful indicator of weight related complications in the overweight Australian population.Our null association is consistent with another cross-sectional study of the AHS data set which reported no association of the MDS, using the same definition as ours, with the presence of diabetes and cardiovascular disease after controlling for covariates  and anotThe null association reported herein was unexpected given that there is strong expert opinion favouring the Mediterranean diet pattern for better cardiovascular health outcomes ,33 and eThere are several plausible explanations for the apparent lack of consistent findings on unhealthy dietary pattern and having or developing weight related complications. First, several limitations in the accuracy and reliability of dietary assessment methods in research are generally well known ,40. For We found no evidence to support the hypothesis that unhealthy dietary pattern (defined by low adherence to the Mediterranean diet pattern), was associated with an increased likelihood of having weight related complications among individuals with overweight and obesity in Australia. Although the null association reported herein is consistent with a growing body of conflicting evidence on the health benefits of the Mediterranean diet, future studies should seek to improve the accuracy and frequency of dietary assessments to reduce several plausible sources of bias."}
+{"text": "Genetic diversity of livestock is vitally important as it enables the adaptation of future populations to changing environments. Therefore, preserving a sufficiently large genetic diversity is key. However, for many local cattle populations, little is known about their genetic diversity such as inbreeding level, effective size etc. We studied the genetic diversity of two local Belgian red cattle populations (Belgian Red and Belgian White Red cattle) using state-of-the-art genomic techniques. These tools assessed diversity at the population and individual level, and allowed the positioning of these two breeds in an international context of 52 other (European) cattle breeds. Accordingly, we contribute to the general knowledge of European red cattle, and more specifically we help the breeders, breed organization and the government to manage the genetic diversity of both breeds.st analyses. Genomic inbreeding coefficients based on runs of homozygosity were estimated at 7.0% for Belgian Red and 6.1% for Belgian White Red cattle, and both populations had a low effective population size . PCA, Fst and admixture analyses revealed the relationship to 52 other international breeds, where they were closest related to some Belgian, French, Scandinavian and Dutch breeds. Moreover, Fst analyses revealed for Belgian Red cattle a signature of selection on BTA6, adjacent to the KIT gene. This study gains important knowledge on the genetic diversity of these two small local red cattle breeds, and will aid in their (genetic) management. Genetic diversity is increasingly important for researchers and society. Small and local populations deserve more attention especially, as they may harbor important characteristics. Moreover, small populations are at greater risk and their genetic management is often more challenging. Likewise, European red cattle populations are threatened, as they are outcompeted by more specialized cattle breeds. In this study, we investigate the genetic diversity of two local Belgian red cattle breeds: Belgian Red and Belgian White Red cattle. A total of 270 animals were genotyped via medium density SNP arrays. Genetic diversity was assessed using runs of homozygosity screening, effective population size estimation and F Recently, we have seen a catch-up in studies of the genetic diversity of local cattle populations ,2,3,4, aVlees van het rood ras van West-Vlaanderen\u201d). The BRD population counts approximately 350 heads . Li. LiBos tR cattle . TherefoFurthermore, the subdivision of BR into BRD and BRM was visible from the PCA . For somKIT, that differentiates the breed from all other breeds included in the analysis. Therefore, this study contributes to the genomic evaluation of small local (red) cattle populations but benefits also from publicly available information. The results are key to aid governments, herdbooks and breeders in their breeding and conservation decisions.This study reveals for the first time the genome-wide genetic diversity of both Belgian Red and Belgian White Red cattle and puts them in an international context. Both population\u2019s genetic diversity is threatened, with effective population sizes below the FAO guidelines. Belgian Red seemed closest related to Maine Anjou and Belgian Blue cattle, whereas Belgian White Red appeared to be closer related to Improved Red, French Red Pied Lowland and Holstein cattle. Furthermore, Belgian Red cattle harbors a variant on BTA6, adjacent to"}
+{"text": "Clear aligner technology has become the preferred choice of orthodontic treatment for malocclusions for most adult patients due to their esthetic appeal and comfortability. However, limitations exist for aligner technology, such as corrections involving complex force systems. Composite attachments on the tooth surface are intended to enable active control of tooth movements. However, unintended tooth movements still occur. In this study, we present an effective attachment design of an attachment that can efficiently induce tooth movement by comparing and analyzing the movement and rotation of teeth between a general attachment and an overhanging attachment. The 3D finite element modes were constructed from CBCT data and used to analyze the distal displacement of the central incisor using 0.5- and 0.75-mm-thick aligners without an attachment, and with general and overhanging attachments. The results show that the aligner with the overhanging attachment can effectively reduce crown tipping and prevent axial rotation for an intended distal displacement of the central incisor. In all models, an aligner with or without attachments was not capable of preventing the lingual inclination of the tooth. Traditionally, fixed appliances have been used in the orthodontic treatment of malocclusions. However, they are fast becoming the least patient-preferred choice for orthodontic treatment due to reported patient discomfort in chewing, maintaining oral hygiene ,2,3, as Although aligner technologies have improved significantly, there are still limitations in cases where corrections involve complex force systems. Tooth torque and rotation, as well as bodily movements, still pose a challenge with aligner technology . The intYokoi et al.  investigAlthough unintended tooth tilting and rotation phenomena were reduced due to the attachments, the moment by the distance between the attachment position and center of the tooth caused the tipping, rotation, and inclination in terms of the mechanism of tooth movement ,22. For The hypothesis of this study was that overhanging attachment would effectively control tipping, rotation and inclination compared to general attachments. Therefore, the purpose of this study was to derive an effective attachment design that can efficiently induce tooth movement by comparing and analyzing the movement and rotation of teeth between a general attachment and an overhanging attachment.The 3D FE model for the orthodontic treatment was created using mandibular cone-beam computed tomography (CBCT) images used in our previous studies A 20,23,,23,24. T10.5-mm-thick aligner with the NA20.5-mm-thick aligner with the GA30.5-mm-thick aligner with the OA40.75-mm-thick aligner with the NA50.75-mm-thick aligner with the GA60.75-mm-thick aligner with the OAThe aligners with 0.5 and 0.75 mm thickness were created to cover the teeth and part of the gingiva. The aligners were designed using Boolean merging, subtraction, and offsetting functions of SolidWorks . The created aligners were classified as aligners with no attachment (NA), aligner with general attachment (GA), and aligner with overhanging attachment (OA). The surface of the teeth was used as the base to construct the aligners to mimic the actual thermoforming of an aligner for orthodontic treatment . The comLinear elastic material properties were assigned to the teeth, cancellous and cortical bones, gingiva, and attachments, as shown below in The birth and death FE analysis method described by Zhou et al.  was emplTo resolve the contact overlaps, process 2 was further divided into two steps. In the first step, the elements of the dental arch comprising of the teeth, cortical and cancellous bones, gingiva and PDL were \u201cdeactivated\u201d. The imported rigid teeth and deformed aligner were again \u201ctied,\u201d and a displacement of 0.1 mm in the opposite direction to process 1 was applied to the center of rotation of the central incisor. This generated stresses in the aligner and also resolved the contact mismatch between the aligner and the teeth of the deactivated dental arch. In the second step of process 2, all deactivated elements were \u201creactivated\u201d. The rigid teeth were deactivated, and the stresses in the aligner were allowed to relax. The relaxation of the stresses in the aligner induced motion in the teeth and thus generated stresses in the PDL, gingiva, and bones. The same processes were followed for the aligners with attachments. Both sides of the alveolar bone were fixed in all directions of movement.In our study, a 0.1 mm of mesial displacement was applied to analyze the movement of central incisors according to various attachment models.After the displacement was applied, the movements of the teeth for crown tipping, shaft rotation, and lingual inclination were evaluated .The highest crown tipping for the 0.5-mm-thick aligner models was measured for the NA (0.394\u00b0). The GA tipping was measured to be 0.389\u00b0, whereas the OA was measured to be 0.377\u00b0 . The valAll models recorded the same buccal inclination of 0.084\u00b0 for the 0.5-mm-thick aligner models . For theThe NA recorded the highest axial rotation for both the 0.5- mm and 0.75-mm-thick aligner models . GA measured 0.13\u00b0 for the 0.5-mm-thick aligner and 0.025\u00b0 for the 0.75-mm-aligner. OA recorded the lowest axial rotation for all models. For the 0.5-mm thick aligner, the value of the OA was lower than the NA and the GA  . In the The peak von Mises stress (PVMS) values and distributions in the aligner and the attachment, as well as the maximum principal stress (MPS) distributions in the cancellous and cortical bones and the PDL are shown in In 0.75-mm-thick aligner models, the peak von Mises stress (PVMS) values and distributions in the aligner and the attachment, as well as the maximum principal stress distributions in the cancellous and cortical bones and the PDL are shown in The highest MPS values were recorded in the cortical bones for all models. The MPS values of the cortical bone increased with increasing aligner thickness except for OA c. SimilaDespite the growing global demand for clear aligners for the orthodontic treatment of malocclusions, there are still concerns regarding the efficiency of clear aligners to achieve complex tooth-controlling movements. This could be attributed to the lack of clarification on the force/moment-transmission mechanism of aligners . ContrarComposite attachments on tooth surfaces have been demonstrated to result in desirable tooth movements ,39,40. SThe results of our study suggest that for a 0.1 mm distal translation planning for the mandibular central incisor using an aligner, there should be expected crown tipping, axial rotation, and inclination. The aligner force acts on the clinical crown and not through the center of resistance of the tooth, thus producing unintended movements. This means that during treatment with aligners, tooth movements unintended by the orthodontist will occur. When a standard 0.5-mm-thick aligner without any attachment is replaced by a 0.75-mm-thick aligner with the NA, crown tipping, axial rotation, and lingual inclination are not significantly altered. Conversely, the presence of the GA on the tooth surface can reduce axial rotation by 62.86% for a 0.5-mm-thick aligner and 26.47% for a 0.75-mm-thick aligner, respectively. For both aligner thicknesses, crown tipping and lingual inclination did not vary significantly. This observation is consistent with Ho et al. , who repThe stress distribution patterns in the cancellous bone, cortical bone, gingiva, and PDL were similar. The MPS values for the cortical bone, cancellous bone, and gingiva were not significantly different in both 0.5-mm- and 0.75-mm-thick aligner models, indicating a similar bone response. The residual aligner PVMS in the GA models were the highest for both aligner thickness models. The OA residual aligner PVMS was about 1.7 times more than NA, whereas the GA residual aligner PVMS was about four times more than NA. It can thus be concluded that the presence of attachments on the surface of the tooth will induce more stress in the aligner, which leads to more tooth movement. Extremely high PVMS values were measured for the GA. Thus, we predicted that for the aligner with the GA, there would be a high risk of yield of the attachment and a high possibility of detachment of the attachment. The highest stress in the incisor PDL was concentrated at the middle part in the distal region. Tensile stresses were mainly recorded on the distal side while compressive stresses were located on the mesial mid-region. The stress values measured for the PDL in all models were within 97\u2013106 MPa in tension and 98\u2013106 MPa in compression. These values are within the magnitude of stress that can alter the PDL for the onset of bone remodeling ,44.Our study did not account for the effect of the masseter muscle while wearing the aligner and other masticatory movements. The effect of the masseter muscle and masticatory movements must be considered as the masseter muscle has been reported to influence craniofacial characteristics, malocclusions and asymmetry . The OA Based on the results of our study, we confirmed that the OA can control the orthodontist\u2019s unintentional tooth movement better than the GA. The OA is considered to reduce the risk of detachment of the attachment during orthodontic treatment by showing desirable stress distributions and reducing the stress concentration between the attachment and the aligner. Therefore, the OA is an effective attachment design on the surface of the tooth that can efficiently induce bodily tooth movement with minimal unintended axial rotation and crown-tipping tooth movements."}
+{"text": "Polypeptoids have attracted a lot of atteSDntion because of their unique structural characteristics and special properties. Polypeptoids have the same main chain structures to polypeptides, making them have low cytotoxicity and excellent biocompatibility. Polypeptoids can also respond to external environmental changes by modifying the configurations of the side chains. The external stimuli can be heat, pH, ions, ultraviolet/visible light and active oxygen or their combinations. This review paper discussed the recent research progress in the field of stimulus-responsive polypeptoids, including the design of new stimulus-responsive polypeptoid structures, controlled actuation factors in response to external stimuli and the application of responsive polypeptoid biomaterials in various biomedical and biological nanotechnology, such as drug delivery, tissue engineering and biosensing. Responsive polymer materials can respond to changes in the external environment , such asPolysarcosine is the polypeptoid with great water solubility, making it an outstandingly interesting candidate for the synthesis of amphiphilic block copolymers. Polysarcosine is poly(N-methyl glycine) (PNMG). It was reported first by Wesseley and coworkers in the 1920s and found good biological properties . InteresPolypeptoids have low cytotoxicity and good biocompatibility because of their structural similarity to polypeptides  18,19,2,21,22,23With specific external stimulation, the macromolecular morphology and conformation of the polymers change accordingly, leading to the change of the physical and chemical properties of the polymers. cp) transition due to dehydration to form a hydrophobic domain P(NEG32-r-NBG17) and grafted it onto silicon substrate by thiol-ene click reaction (32-r-NBG17) nanostructures decreases, forming a collapsed pattern. After cooling, the polymer chain stretched out to create a relaxing pattern. Surface modified with temperature-responsive polymer, whose characteristics change with temperature, can be widely used in surface-based sensor technology (PxMy) block copolypeptoids with different block ratios. When the temperature was higher than Tcp, spherical micelles with a diameter of about 50 nm formed in water. After annealing and crystallization, micelles transformed into fibre intermediates and further packed into larger complex three-dimensional structures with different shapes, such as flower (P70M23), oval (P70M42 and P70M76) and irregular shapes (P70M153 and P70M290) . Ol. Ol79]. ansition . The synansition . cp of the polymer aqueous solution can be adjusted between 27 \u00b0C and 37 \u00b0C by controlling the molecular weight. Meanwhile, the molecular weight of these alternating copolymers can be as high as 15 kg\u00b7mol\u22121. The alternating copolymer synthesized by the Ugi reaction not only shows good water solubility (100 mg\u00b7mL\u22121), but also has the ability to resist protein aggregation [Ring-opening polymerization can be used to prepare polypeptoids with long molecular chains, but it is challenging to design and synthesize polypeptoids with controllable sequences. Solid-phase submonomer synthesis method can achieve polypeptoids with absolute sequence order but suffers low efficiency. Tao et al. found that amino acids can react with aldehydes and isocyanates in sequence to form polypeptoid structures. Polypeptoids with controllable sequences can be easily synthesized by this iterative Ugi reaction of amino acids, aldehydes and isocyanates . The Ugiregation .The polymers with pH responses can show the conversion of different folding states in different pH environments. The sequence-controlled pH-responsive peptoid oligomers can be prepared using a solid-phase submonomer synthesis method by repeating bromoacylation and displacement steps ,86. VaryBy combining pH-induced conformational changes with fluorescence intensity changes, polypeptoids can be used as biocompatible pH sensors. Amelia et al. labeled Nscp oligomer with the fluorescent group 4-N, N-dimethylamino-1,8-naphthalenediimide (4DMN) . In diffPolypeptoids coating can be used as surface material of hospital equipment with antifouling performance to prevent the growth of bacteria. Amelia et al. synthesized oligopeptoids containing (s)-N-(1-carboxyethyl) glycine (Nsce), (s)-n-1-(naphthylethyl) glycine (Ns1npe) and N-(2-aminoethyl glycine) (Nae). In phosphate buffer brine, the synthesized products can be adsorbed on the bare silica surface. The adsorption of water-soluble oligopeptoids on the silica surface can be affected by changing pH due to the electrostatic interactions ,91. Morecp of polymer decreased from 54 \u00b0C to 22 \u00b0C when pH increased from 13.2 to 13.6. Such polymers have both pH and thermal response properties and can be used in specific biomedical scenarios [Li et al. introduced amino groups into peptoid side chains through ring-opening polymerization and click chemistry. The results showed that the polymer was always soluble in water at pH \u2264 12.9. When pH increased to 13.2, LCST behavior was observed during heating. The Tcenarios .Light has become a valuable, and convenient external stimulus because light can be controlled in space and time and the light source is environmentally friendly and easy to obtain. Photo-responsive polypeptoid is a kind of polymer that can produce corresponding physical or chemical changes under the irradiation of light . The main chain structure of polypeptoid is not photo-responsive. The photosensitive group can be introduced into the side chains of polypeptoid to achieve the overall photoresponse performance. These photo-responsive groups can be azobenzene, spiropyran, o-nitrobenzyl, coumarin, anthracene, cinnamic acid, thymine and diarylethene . Many azO-nitrobenzyl group is stable in an acidic and alkaline environment and has highly controllable photochemical properties ,97. Li eCompared with normal cells, there are higher concentrations of reactive oxygen species in tumor and inflamed tissues ,101,102.This review discussed the structural design and functional applications of different responsive materials constructed from polypeptoid frameworks. Polypeptoids have excellent biological properties such as low cytotoxicity and good biocompatibility, making researchers constantly introduce mature, responsive units to achieve their responsive properties. Many researchers have designed and prepared different polypeptoid structures responsive to environmental changes . However, the research mainly focuses on temperature response and pH response, and other responsive polypeptoids are still underexplored. According to the different responsiveness, polypeptoids can be used in drug delivery, tissue engineering, antifouling coatings for medical devices, intelligent surfaces, biosensors, etc. In the past ten years, responsive polypeptoid materials have been continuously developed. Polypeptoids show a wide application prospect in many fields, but it is still difficult to be commercialized or go to the clinical trial stage. Future work includes introducing more responsive units into polypeptoid side chains to find more suitable molecular structures for different specific scenarios. Stimuli-reponsive polypeptoids can also be combined with DNA, glycoprotein and other materials to accelerate their clinical applications."}
+{"text": "The studied food trucks met the standards of food safety and hygiene with a low mean level (45.2%), which was seen in monitoring thermometers/cold chain loggers, proper record of activities, proper disposal of food product waste, and proper practice of handwashing techniques. There were significant associations  found between temperature readings and mesophilic microbial load. Efforts should be increased to reduce food loss\u00a0by continuous monitoring of these trucks during mass gathering\u00a0events.During any event, food- and waterborne diseases represent a health risk, so food should be kept in a chilled state while being supplied in the trucks before distribution to consumers. The study aimed to evaluate temperature conditions, microbial contamination of food trucks, and their compliance to the basic\u00a0local and international standards of food safety during a mass gathering event (pilgrimage). Fifty food trucks were evaluated for proper food storing and microbial contamination (load). A food truck inspection checklist was made to check if the trucks followed the standards of food safety and hygiene. The results showed that 90% of the trucks\u2019 refrigerators were between 3 and 5\u00b0C. The number of total mesophilic and psychrotrophic bacteria in the contact surfaces varied between 1.93-6.16 (mean 4.0433) and 0.08-4.50 (mean 3.3340) log CFU\u00a0(colony-forming units)/100 cm Makkah city (Western region of Kingdom of Saudi Arabia (KSA)) is one of the most crowded cities during mass gatherings (pilgrimage) in the world;\u00a0hence, food and drinks products should be properly transported, handled, and stored. Generally, transportation of food products between KSA regions is done by trucks equipped with refrigerators. These trucks or vehicles loaded with food products should meet certain standards of food safety and hygiene. The main\u00a0requirements of these standards are the temperature monitoring to keep optimum storage,\u00a0employee hygiene,\u00a0provision of equipment, and cleaning/sanitary conditions ,2. TempeThe study was conducted during August (2018) by monitoring the temperature and microbial load of 50 refrigerated food transport trucks coming from different regions of KSA and destined to Makkah city. The selected food trucks were packed with bottled water, bottles of refreshments, juices, milk, loaves of bread, and pastries. The trucks were also evaluated for their compliance to food safety and hygiene standards.Monitoring of storage temperatureThe field test was designed and conducted successfully with 50 data loggers inserted in 50 transport trucks randomly distributed in three places , which started loading in the period 17-21 August 2018 (6-9/12/1439 H). The test was performed by inserting data loggers  2 from each truck. The swabs were transported back to the laboratory under cold conditions (4 \u00b1 1.0\u00b0C) and processed within 1 h. Each bag containing swabs was diluted into 1/10 with sterile saline and shaken for 2 min. After serial dilution, 1 ml of the suspension from each dilution was inoculated to plate count agar (for 48 h at 37\u00b0C) and plate count agar (10 days at 6.5 \u00b1 0.5\u00b0C) to examine the total count of mesophilic and psychrotrophic bacteria, respectively [Swab\u00a0samples\u00a0from internal surfaces of the trucks, which were moistened with buffered peptone water, were obtained from the interior sides of each truck by rotating on the internal surface with an area of 100 cmInspection checklistA food truck inspection checklist was made to check if the trucks followed the standards of food safety and hygiene. The checklist included permission, safety and storage, employee hygiene, equipment, and cleaning/sanitary conditions.Statistical analysisStatistical analysis was used to study the associations (chi-squared test) and correlations (Pearson's correlation) between the temperatures and microbial load. The study variable, a p-value of <0.05, was considered as statistically significant.2, respectively , but no significant correlation between temperature values and total psychrotrophic count (p > 0.05) to be concluded Table . The pre2 with a mean value of 4.0433 log CFU/100 cm2 while the total number of psychrotrophic bacteria was 0.08-4.50 log CFU/100 cm2 with a mean value of 3.3340 log CFU/100 cm2. Psychrophilic microorganisms have been described as microorganisms capable of appreciable growth at refrigeration temperatures. Such microorganisms can grow at temperatures lower than 15\u00b0C. One study\u00a0[3. Similar observations were seen where the bacterial count changed significantly with effect of temperature [In order to provide an effective storage life during Hajj (pilgrimage), the foods need to be stored at least substantially within 2-6\u00b0C. These low temperatures are needed to preserve the flavor, odor, color, and texture of the food by retarding chemical changes, the action of food enzymes, and by eliminating the growth of microorganisms capable of growth near to this range. Food trucks loaded with numerous containers of bottled water and meals are distributed everywhere in KSA regions, particularly in Makkah, during Hajj season when millions of people come together in a specific small location for doing Hajj rituals. Temperature data recorded during the study period since the start of transporting the food products from different regions of the KSA to Makkah city were found quite consistent with temperatures ranging mainly from 3 to 5\u00b0C. Our results are similar to the mean temperature of the complete cold chain of food products in Europe which was found between 3.5 and 5\u00b0C . Some flne study\u00a0 found deperature -15. Moniperature . In coolperature ,18.\u00a0Resuperature ,14. The perature ,20. In gperature . Similarperature ,23 becauperature ,20,22. TThe hygiene evaluation of the studied food trucks showed a variability in temperature and microbial profiles due to to the excessive times of opening doors of the trucks while distributing food to consumers. The low mean level of the standards was seen in monitoring thermometers/cold chain loggers, proper record of activities, proper disposal of food product waste, and proper practice of hand-washing techniques. There were significant associations (p < 0.05) found between temperature readings and mesophilic microbial load. Efforts should be increased to reduce food loss by continuous monitoring of these trucks during pilgrimage events."}
+{"text": "The increased incidences of diet-related non-communicable diseases (NCDs) such as diabetes, obesity, and cardiovascular diseases among adults are becoming the chief public health concern in most Arab countries. Economic expansion has contributed to a nutrition shift from a traditional seasonal diet to Westernized eating habits coupled with a sedentary lifestyle. Despite the rising concern for NCD mortality, public health policies are inadequately addressed. This narrative review aims to discuss the effectiveness of nutritional interventions focusing on diet and physical activity in the management of NCDs among Arab adults. A comprehensive literature search was performed using different database platforms such as Cochrane reviews, Scopus, and PubMed for articles published between 1 December 2012 and 31 December 2021. Fifteen recent research articles addressing NCDs, mainly diabetes and obesity, from different Arab countries were included in this review. Structured lifestyle interventions involving behavioral therapy approaches and personalized goals for diet and physical activity were found to improve specific health outcomes in most studies. Significant improvements in health outcomes were reported for longer-duration interventions with follow-ups. A combination of both online and face-to-face sessions was found to be effective. It is important to identify barriers to physical activity for a culturally acceptable lifestyle intervention and conduct further studies to evaluate interventions for the long-term maintenance of health outcomes. Globally, non-communicable diseases (NCDs), such as cardiovascular diseases (CVD) and diabetes, are responsible for around 41 million deaths annually ,3. PhysiRegionally, increased incidences of type-2 diabetes, obesity, cancer, CVD, and other diet-related NCDs among adults are becoming the main public health concern in most Arab countries ,6. The iPopulations in the Arab region have experienced a nutritional shift characterized by a transition from a traditional, more diverse, and seasonal diet high in fruits, whole grains, and vegetables to Westernized diets that are high in refined carbohydrates, trans fats, saturated fats, salt, and sugar ,7. High Considering the gravity of the rising problem of nutrition-related NCDs, studies have addressed the requirements for a healthy lifestyle and culturally adaptable dietary patterns to address the public health concerns in Arab countries ,14,15. FDespite the rising concern and the risk factors for NCD mortality, public health policies are inadequately addressed in the Arab regions . MoreoveThe Arab League is comprised of 22 countries, namely Syria, Oman, the United Arab Emirates, Saudi Arabia, Mauritania, Bahrain, Lebanon, Yemen, Sudan, Iraq, Libya, Egypt, Jordan, Palestine, Djibouti, Qatar, Somalia, Morocco, Comoros, Tunisia, Algeria, and Kuwait . A comprFifteen lifestyle-intervention-based articles representing eight Arab countries, namely Bahrain , Egypt , Oman 3, the occSeven studies focused on intervention programs to combat type 2 diabetes ,36,37,42The intervention-based studies had different study designs, including randomized controlled trials ,38,40,42In general, the interventions provided participants with education on diet and physical activity ,40,41,42Some interventions were work-site initiatives ,41, whilCommon health markers were evaluated in nearly all studies, with the inclusion of BMI (body mass index) in all studies ,40,41,42Nutrition knowledge and behaviors were mainly evaluated through standardized questionnaires corresponding to each program ,36,37,41Physical activity was also mainly evaluated through standardized questionnaires ,34,39,41All studies included an educational aspect related to diet and physical activity. Twelve studies assessed nutrition knowledge, behaviors, and physical activity levels ,39,41,42p \u2264 0.001) [p < 0.05) [p < 0.001) [The interventions in the studies conducted in Palestine and Saudi Arabia by Rashed et al. and Sani et al. were associated with significant improvements in diabetes knowledge among participants (\u2264 0.001) ,37. Simi < 0.05) ,26,36,41 < 0.05) . Similar< 0.001) .p = 0.003); dietary fiber (p = 0.002); and some micronutrients, such as vitamins B2 (p = 0.01), B3 (p < 0.001), B12 (p = 0.041), B6 (p < 0.001), vitamin E (p = 0.003), phosphorus (p < 0.001), copper (p = 0.03), potassium (p = 0.01), magnesium (p < 0.001), sodium (p = 0.01), and iron (p = 0.01) [Other studies assessed the intake of specific food groups and nutrients ,39,41,42 = 0.01)  and Bahr = 0.01) ,41. A he = 0.01) ,42. A st = 0.01) ,32.p < 0.01) were reported among participants 6 and 12 months after the intervention [p < 0.001) in both the intervention and control groups after the three-year worksite intervention [In the worksite- and healthcare-setting-based interventions conducted in Bahrain and Egypt by Al Saweer et al.  and Metwrvention ,33. A strvention . Studiesrvention ,39. Howervention  in Saudirvention . Moreovervention  evaluatervention . Furtherrvention . Althougrvention .This review evaluates the effectiveness of lifestyle interventions among adults in the Arab region based on the interventions\u2019 effects on modifiable health indicators. Overall, intensive lifestyle interventions involving behavioral therapy approaches and personalized goals related to diet and physical activity were found to improve specific health outcomes in most studies ,39,41,42The majority of NCD prevention programs addressed diabetes, prediabetes, overweight, and obesity ,38,39,42Intervention studies in Tunisia, Bahrain, Saudi Arabia, Egypt, and the UAE that involved and assessed both dietary habits and physical activity behaviors showed improved health outcomes ,33,39,41Studies in the UAE and Saudi Arabia also reported significant weight loss (\u22654\u20135%) among participants post-intervention, with program durations varying from 12 weeks to a year ,28,38. AMost programs were performed face-to-face ,39,40,41Most of the studies reported herein used questionnaires to assess physical activity levels or dietary habits and behavior, which can result in subjective responses by the participants ,36,37,41Studies in Palestine and Egypt reported sociodemographic differences between participants, where more women compared to men were found to be obese and showed limited participation in physical activity during program implementation due to sociocultural and environmental barriers ,35. PhysThe limitation of this review is that comparisons between studies become challenging due to the differences in the study designs, modes of delivery (online versus face-to-face), and program durations. The durations of the various interventions were less than a year ,39,40,42This is the first review to assess diet and physical activity incorporated in their respective interventional programs and how such interventions impact an individual\u2019s lifestyle and work in combating diet-related non-communicable diseases among adults in Arab countries. Personalized, goal-oriented, and longer-duration lifestyle interventions combining diet and physical activity were found to be effective in improving health outcomes. Moreover, considering the mode of delivery for behavioral therapy, a combination of both online and face-to-face sessions was found to be effective and convenient.Although most interventional studies showed improved health outcomes, some studies did not show any significant differences between the intervention and control groups in terms of physical activity. Hence, it becomes incumbent to identify barriers to physical activity for a culturally acceptable lifestyle intervention program resulting in long-term positive behavioral changes and improvements in health outcomes. The limitations of this review relate to variations in the research design, mode of delivery, and program length. Thus, more studies are needed to assess the effectiveness of multicomponent interventions with longer durations on NCD management."}
+{"text": "The in vivo incremental area under the curve (iAUC) for glucose showed a strong linear relationship with the predicted GL . In summary, the model previously developed to predict the GI and GL of breakfast cereals was both accurate and precise for infant cereals and could be considered a simple tool to support nutritionally responsible product development.Designing cereal-based products with appropriate metabolic responses is of high interest to the food industry in view of the potential health impact of the product. The objective of this study was to test whether a model that used the nutrient composition of breakfast cereals to predict their glycemic index (GI) and glycemic load (GL) could also accurately predict the GI and GL for complete  infant cereal prototypes. Four independent studies measured the postprandial glucose response of 20 complete infant cereal prototypes (51\u201376 g/100 g glycemic carbohydrates) in healthy adults. The predictions were strongly correlated with the measured values for both the GI (r = 0.93,  Cereal grains are a major component of the adult diet since they contribute important nutrients . LikewisCereals are an important source of glycemic carbohydrates, which are the carbohydrates in foods that are digested, absorbed and metabolized , and thuThe glycemic index (GI) and glycemic load (GL) of foods are impacted by carbohydrate type and quantity , as wellThe aim of this work was to use data gathered in four studies performed between 2016 and 2019 during the development of complete infant cereals to test whether this model was also predictive for complete infant cereals prepared with water that considerably differ from breakfast cereals in many aspects. Regarding infant cereals, first, in terms of the nutrient composition, there are much higher levels of protein; second, there are changes in viscosity, which are known to impact the PPGR ; and thiThis paper presents the results of four independent in vivo studies that measured the PPGR of a total of 20 infant cereal prototypes. A flow chart providing information about each study can be found in Twenty samples of either precooked, dried cereal flours (5 samples in study A) or finished complete infant cereal prototypes  were characterized for their nutrient composition using standard analytical methods . The modFour independent studies were conducted over different steps of product development between 2016 and 2019 at the accredited Glycemic Index Research Unit at Temasek Polytechnic, Singapore. The studies were approved by the Parkway Independent Ethical Committee (PIEC/2015/015 and PIEC 2017/009) in Singapore and were performed according to international standards [Each study consisted of 5 test samples and 3 glucose reference samples . Within each study, under fasting (10\u201314 h) conditions, 20 healthy subjects consumed all products in a crossover design, with one product per day and at least two days of washout between the test days. Two days was considered appropriate, as previous studies showed that even glycemic response testing on consecutive days did not seem to influence the variability of glycemic response tests compared with longer intervals and it did not cause any data drift under conditions of an earlier diet .Two fasting, baseline (t = \u22125 min and t = 0 min) capillary blood samples were obtained. Following the second fasting blood sample, the product was consumed and the glycemic response was measured for 120 min postprandially, with blood being sampled at 15, 30, 45, 60, 90 and 120 min.2  and average fasting glucose ranging between 3.6 and 4.7 mmol/L .The subjects allocated to these studies were healthy males aged 21 to 55 years , with BMIs ranging between 18.5 and 26.1 kg/mSince the four studies were designed at different steps of product development, the protocols were adapted to specific project needs, leading to different serving sizes or the addition of reference samples. These specificities are highlighted in the study flow chart in As can be seen from the study flow chart, the serving sizes of the infant cereal prototypes were adapted to adults and were thus greater than the typical serving size for infants. For study A, the portion size was lower than for the other studies to ensure the acceptability and tolerance of the flour samples.The primary endpoints were the GI for the studies featuring the glucose reference  and the 2 h incremental area under the postprandial glycemia curve (2h-iAUC) for study B. The GI and GL were determined using commonly accepted equations :(1)GI=2hIn vivo measures of the 2h-iAUC, GI and GL are tabulated using the mean and standard error (SE) over all analyzed subjects in The model previously developed to predict the GI of breakfast cereal as a function of its nutrient composition quantifies both the impact of glycemic carbohydrates and the GI-lowering effect of other macronutrients using a model that can be written as follows:ix is the relative amount (g/100 g) of the ith glycemic carbohydrate  and GIi is its GI; jx is the relative amount (g/100 g) of the jth other macronutrient  and jb is its GI-modulating power. The individual GI and GI-modulating power of the different nutrients are tabulated for all relevant nutrients [In this equation, utrients . For staAs an example, using Equation (3), the GI of sample A1, which featured 2.1 g sucrose, 49.0 g starch, 9.4 g soluble fiber, 6.1 g insoluble fiber, 0.6 g fat, 27.0 g protein, 3.3 g ash and 2.5 g moisture, was predicted as follows:The predicted eGI of sample A1 was 70 as a result of featuring fully gelatinized starch (GI = 100) and sucrose (GI = 62); additionally, it took into account the GI-modulating powers that were different for soluble fibers (0.3), insoluble fibers (0.1), fat (0.6), protein (0.6), ash (0.1) and water (0). In this example, the calculation was made directly using the powder composition. The reconstituted product would lead to the same estimate since the GI-modulating power of water is considered null in the model.The estimated GL (eGL) for a serving of 50 g was derived from the estimated eGI using the standard GL (Equation (2)). The amount of available carbohydrates in this sample was 51.1 g/100 g (with 2.1 g sucrose and 49.0 g starch), and therefore, 25.55 g for a serving of 50 g. Consequently, the predicted eGL for a serving of 59 g of sample A1 was as follows:Both the eGI and eGL were predicted independently of the in vivo data and could, therefore, be estimated for the model prototypes of study B for which no in vivo estimates of the GI and GL were available due to the absence of a reference.In vivo measures of the 2h-iAUC, GI and GL of individual prototypes are summarized using the mean and standard error (SE) to quantify the precision of the estimates . Model pFor study B, the eGL was compared with the incremental area under the curve (2h-iAUC) of the PPGR curves using a bivariate chart that represented means as dots and the standard errors (SEs) as error bars, as well as the Pearson correlation to quantify the strength of the linear relationship.p-value < 0.01), and the model was not regressed to the mean, as shown by the fact that the range was the same for both the in vivo and predicted GI values.The in vivo GI of the 15 samples tested in studies A, C and D ranged between 62 and 91, with a mean of 72 and a standard deviation (SD) of 8.3. The three samples with a GI higher than 75 were precooked, dried flour samples. The predicted eGI of the same samples ranged between 62 and 89, with a mean of 72 and an SD of 9.1 . The prepooled of 4.58. This standard error was larger than the standard deviation of the difference between the in vivo estimate and the model predictions, that is, SD = 3.37. The Bland\u2013Altman plot for the GI (The standard error (SE) of the in vivo GI estimates ranged between 3.4 and 5.4, with an average SEr the GI  further p-value < 0.01), and the model was not regressed to the mean, as shown by the fact that the range was the same for both the in vivo and predicted GL values.The in vivo GL of the 15 model prototypes ranged between 16.6 and 34.0 g of glucose equivalent with a mean of 22.6 g and an SD of 5.4 g. The predicted GL of the same model prototypes ranged between 17.8 g and 33.4 g with a mean of 22.6 g and an SD of 5.8 g . The prepooled of 1.43. This standard error was larger than the standard deviation of the difference between the in vivo estimate and the model predictions, that is, SD = 1.08. The Bland\u2013Altman plot for the GL (The standard error (SE) of the in vivo GL estimates ranged between 1.0 and 2.0, with an average SEr the GL  further p < 0.01), and the in vivo variability was again larger than the imprecision of the prediction, as shown by the fact that the regression line crossed all error bars (mean \u00b1 SE).The five infant cereal prototypes of study B were not part of the previous results since neither the GI nor the GL could be estimated in vivo due to the absence of reference glucose during testing. Since the available carbohydrate content was similar between studies, it was possible to compare the in vivo incremental area under the curve (iAUC) with the predicted eGL . The linIn the present study, we showed that a model that was previously used to predict the GI of breakfast cereals based on the nutritional composition could also predict the GI of complete infant cereal prototypes, which differed substantially in terms of the nutrient composition, processing and serving size to breakfast cereals.The 15 finished complete infant cereal prototypes  had GI values that ranged between 63 and 72, with a mean of 67. These values were close to the values reported in previous literature, which showed GIs of commercial infant porridges and gruel ranging from 67 to 75  and wereIn the current study, the differences that we observed in the GI between the precooked, dried flour samples and the finished infant cereal prototypes were related to the macronutrient composition: the finished model prototypes contained significantly more fat, which can modulate the GI, while the flour samples in study A contained almost no fat but significantly more starch, which augmented the GI response. Higher protein contents further lowered the GI.The present results showed that the model previously developed to predict the GI and GL of breakfast cereals was also valid for infant cereals and could be considered a simple tool to accelerate nutritionally responsible product development that also applies in the case of infant cereals. The strength of the model lies in the fact that it quantifies both the impact of glycemic carbohydrates and the impact of GI-lowering nutrients, such as protein, fiber and fat, independent of their origin . It is remarkable that the model works similarly well for infant cereals and breakfast cereals considering the differences in nutrient composition, viscosity and serving sizes. This demonstrated that the model properly integrates changes in viscosity that are directly induced by nutritional composition and that it, therefore, needs no physical assessment of viscosity to deliver accurate and precise predictions.Additionally, in the case of infant cereal prototypes, the model could reliably be used for the prediction of GI and appeared to be independent of small differences in the serving size of model prototypes  and the quantity of available carbohydrate . The results showed the relevance of the eGI and eGL as indices that need to be monitored during product development.The results further showed that the eGL can be used as a good predictor of the PPGR. This observation was supported by previous studies in adults, which showed that meal GL is associated with incremental serum glucose and total AUC up to 5 h postprandially ,28. ThisThe results showed that the total amount of glycemic carbohydrates was insufficient to predict the GI, as exemplified by model prototypes C2 (65.3 g/100 g glycemic carbohydrates induced GI = 67 and eGI = 66) and D1 (57.0 g/100 g glycemic carbohydrates induced GI = 73 and eGI = 69). However, the effect of carbohydrates was very important for the GI and GL, and glycemic carbohydrates impacted the GI differently, with fructose (GI = 20), isomaltulose (GI = 32) and lactose (GI = 46) being less glycemic than sucrose (GI = 62), which was less glycemic than glucose, maltose or any digestible glucose polymer, such as fully gelatinized starch (GI = 100). Consequently, the complete infant cereal prototypes with the highest GIs were not those with the highest amounts of sucrose, but those with the highest amounts of glucose, maltose or starch. Other macronutrients, such as fat, protein and viscous soluble fiber, reduced the GI and, therefore, need to be considered in addition to glycemic carbohydrates. For example, a previous study showed that adding protein decreased the incremental PPGR, measured meal GI and meal GL , and theThese data showed that the GI and GL of complete infant cereal prototypes can be predicted from the macronutrient composition of the finished product using the same model that was previously established for breakfast cereals. Although this extends the scope of its usage, the previously discussed limitations of the model remain unchanged: its simplicity captures neither the differences between protein or fat types nor the potential impact of bioactives, such as polyphenols or ferulic acid . AnotherBy combining data from in vivo studies in healthy adults, we showed that the model previously developed to estimate the GI and GL of breakfast cereals was both accurate and precise for infant cereal prototypes, even though these differed significantly from breakfast cereals in terms of nutrient composition, viscosity, texture and serving size. This model can serve as a simple screening tool to facilitate the development of infant cereal-based products with a PPGR that is more appropriate for health. The model quantifies the impact of not only the glycemic carbohydrates but also of the GI-lowering nutrients, such as proteins, viscous soluble fibers and fats, which represents a significant strength in terms of the applicability of the model for different infant cereal products. Moreover, we provided data to support the association reported in the adult literature between the GL and the measured PPGR."}
+{"text": "Austropuccinia psidii infects young tissues of Eucalyptus plants until they are two years old in the nursery and field, causing Myrtaceae rust. The characteristics making older eucalypt leaves resistant to A. psidii and the reason for the low levels of this pathogen in older plants need evaluations. The aim of this study was to evaluate the morphological differences between Eucalyptus grandis leaves of different growth stages and two plant ages to propose a visual phenological scale to classify E. grandis leaves according to their maturation stages and to evaluate the time of leaf maturation for young and adult plants. A scale, based on a morphological differentiation for E. grandis leaves, was made. The color, shape and size distinguished the leaves of the first five leaf pairs. Anatomical analysis showed a higher percentage of reinforced tissue, such as sclerenchyma-like tissue and collenchyma, greater leaf blade thickness, absence of lower palisade parenchyma in the mature leaves and a higher number of cavities with essential oils than in younger ones. Changes in anatomical characteristics that could reduce the susceptibility of older E. grandis leaves to A. psidii coincide with the time of developing leaf resistance. Reduced infection of this pathogen in older plants appears to be associated with a more rapid maturation of their leaf tissues.The fungus  Eucalyptus plantations in Brazil are among the most productive in the world, with approximately 40 m3 ha\u22121 year\u22121 [Eucalyptus clones can improve pulpwood production [Eucalyptus grandis (W. Hill) Maiden is one of the most commonly used for this purpose [Austropuccinia psidii (G. Winter) Beenken [Eucalyptus forestry industry [1 year\u22121 . Adequatoduction . Eucalyp purpose . This sp purpose ,8, but m Beenken ,9. This industry ,11.Austropuccinia psidii, the etiologic agent of Myrtaceae rust, occurs mainly in Eucalyptus nurseries and on young plants in the field. This fungus is found on plant parts younger than two years [Austropuccinia psidii generally penetrates directly through the cuticle and epidermis by appressorium [Eucalyptus\u00a0leaf age [Austropuccinia psidii does not infect the leaves of susceptible eucalypt plants from the fifth leaf stage onward [wo years , such aswo years ,13,14. Aessorium ,16. Howeleaf age ,17. Auste onward ,16.Myrtaceae [Eucalyptus leaves on A. psidii resistance and the factors making older leaves resistant need to be better understood. This represents a key step to developing a viable method to manage eucalypt rust efficiently [Eucalyptus leaf age on the production of antimicrobial compounds and on A. psidii pre-infection success have been studied [The effect of plant-growth stages on pathogen resistance is age-related resistance, developmental resistance or ontogenic resistance and has been reported in yrtaceae  and otheyrtaceae . Host tiyrtaceae . Resistayrtaceae . The inficiently . The eff studied ,21,22,23E. grandis leaves at different growth stages were studied. A visual scale to classify the eucalypt leaves relative to their stage of maturation and the time for leaf maturation of young and adult plants in the field using a scale was proposed. The hypothesis was that the age-related resistance of E. grandis to A. psidii includes morphological defense mechanisms.The morphological characteristics of E. grandis leaves of young and adult plants at six and 20 months old, respectively, is proposed. The evaluation was conducted in Santa Branca (23\u00b024\u2019 S and 45\u00b051\u2019 W), S\u00e3o Paulo, Brazil, with quartizarenic soil in the area. Cultural treatment and plant fertilization were applied as recommended by the forest company . Thirty branches of young and adult plants were collected at the top, median and lower plant heights from three E. grandis clones in the field  at \u201cVotorantim Celulose e Papel (VCP)\u201d commercial plantations, with 6 to 10 leaf pairs per branch, at different development stages per clone and age  for 48 h  and stored in 70% ethanol. The samples were dehydrated in a graded ethanol series and embedded in glycol methacrylate resin [2 of leaf surface was calculated. The anatomical sections were embedded in historesin and stained with Sudan IV before measuring the thickness of the adaxial and abaxial cuticle.The leaf growth stages were defined and used in scale proposed with three leaves per developmental class, from 6- and 20-month-old plants classified according to their anatomical characteristics. The leaves per stage were cut in the third middle region of the midrib and the adjacent internervural area. The leaf cuts were fixed in a solution of formaldehyde, acetic acid and 70% ethanol  . PrincipE. grandis leaf stages  and with a longer maturation period. The transition from stages 1 to 3 and 1 to 5 was 10 days faster in older than in younger plants, which may explain no occurrence of this disease in the former in the field due to leaf escape during periods of high susceptibility. This phenomenon may reduce the occurrence of the disease due to a shorter exposure period for leaves more susceptible to rust and this could reduce the epidemic period [The leaf scale proposed made it possible to evaluate the periods of leaf-stage change in 6-month-old and 20-month-old l stages , 2 and 3E. grandis) and older leaves (above the fourth leaf stage) of Eucalyptus spp. to rust is similar to that found in rubber- Pseudocercospora ulei pathosystems  and the higher occurrence of this fungus on young rubber trees is due to the new shoots sprouting every month [A. psidii in older plants may be due to a shortened period of high susceptibility associated with more rapid leaf maturation, similar to that reported for the Micosphaerella sp. and Teratosphaeria sp. on Eucalyptus plants [E. globulus \u00d7 E. urophylla, and E. urophylla \u00d7 E. grandis is faster reducing the susceptibility to the Mycosphaerella spot [A. psidii, both in the nursery and in the field, and is an important tool for breeders. This work provides additional information about the mechanisms of resistance of eucalypt plants to A. psidii.The higher resistance of adult plants  compared to younger plants under two years old.The lower occurrence of the fungus"}
+{"text": "Gallium nitride (GaN) has a wide energy band gap and a high power density, efficiency, switching frequency, and electron carrier mobility, having broad applications in digitization. Because GaN has high potentials, this study performed a bibliometric analysis on the publications of GaN indexed in the Web of Science database from 1970 to 2023. A performance analysis of the 15,634 publications was performed using Harzing\u2019s Publish or Perish tool, while science mappings were performed with VOSviewer software. The results show that there has been an uptrend in the on-going research on GaN, especially in the past decade. Most of the documents are within the fields of physics, engineering, and materials science. The United States has the highest number of publications and the most impactful research. The United States is also actively collaborating with other countries to gain deeper insights into GaN. The analysis shows that the concentration of GaN research is slowly moving towards the development of high-voltage operations. From germanium and silicon to gallium arsenide ,2,3, resOverall, the industry has recognized silicon as the initial generation semiconductor and gallium arsenide as being the next generation semiconductor . In Indu7 cm/s and electron mobility of 990\u20132000 cm2/Vs as compared with SiC, which is 650 cm2/Vs [Even though GaN and SiC are the modern-day semiconductors, there are some differences between them. As a field-effect transistor, GaN does not have body diode. Therefore, GaN does not have reverse recovery loss . The swi0 cm2/Vs ,16. In s0 cm2/Vs .\u22121 [In 1875, Paul-\u00c9mile Lecoq de Boisbaudran, a French chemist, discovered gallium in a sample of mineral sphalerite. De Boisbaudran performed a test using spectroscopy and found a pair of violet lines which signaled eka-aluminium. The earliest pure gallium was then collected through electrolysis, with the measured density of 5.9 g ml\u22121 ,20. The \u22121  in 1973 \u22121 ,23.\u22121K\u22121 and good heat dissipation imply that GaN is suitable to be used in 5G base stations [GaN is hard and has a strong chemical stability and a melting point reaching up to 1700 \u00b0C . It alsostations . In the A bibliometric analysis examines the scientific performances of a specific topic in a scholarly database . Bibliomh-indexes, and g-indexes [h-index means the \u201ch\u201d number of publications that has received \u201ch\u201d number of citations, which is used to assess the quality of a research achievement; the g-index involves the \u201cg\u201d number of publications, whereby the average citation is \u201cg2\u201d and above [h-index if the h of the researcher\u2019s total number of papers (N) has been cited at least h times while the remaining papers (N-h) do not have greater than h citations, respectively. A high h-index shows that a researcher has consistently produced a high number of impactful papers [g-index shows the largest number of the top g papers that received at least g2 citations together. The g-index is different from h-index, where a high h-index requires a high number of quality publications. However, a high g-index can be attributed to only a small number of papers [A performance analysis involves the use of citation metrics such as citation counts, citation impacts, -indexes ,37. Citand above ,39,40. Il papers . When a f papers ,43,44.Meanwhile, scientific mapping shows the knowledge dynamics in the topic. Scientific mapping shows the collaborative networks of authors and relationships among the keywords ,46. For Roccaforte and Leszczynski  summariz3) over liquid gallium (Ga) at around 1000 \u00b0C [1932: The first polycrystalline GaN material was synthesized by flowing ammonia  for the invention of efficient blue LEDs, which has enabled bright and energy-saving white light sources ,63.2019: Zhang et al.  demonstr\u22121 [There are several applications of GaN-based materials in optoelectronic devices. The nitride-based optoelectronic devices such as LEDs and LDs are applied in lighting, communications, and quantum applications . GaN LDs\u22121 ,67. Whit\u22121 ,69. Such\u22121 . GaN LED\u22121 . Moreove\u22121 . Satelli\u22121 .This paper performs a bibliometric analysis on GaN publications indexed in the Web of Science database ,73. ThisFor the initial phase, the topic of study, \u201cGallium nitride\u201d, was first identified for the bibliometric analysis. Scientific literature on GaN was then searched on the Web of Science database because of its wide coverage and high-quality peer-reviewed papers, which also allows for bibliographic information extraction . Data weh-index, and g-index according to year, country, and source title were obtained with Harzing\u2019s Publish or Perish [In the second phase, the data were exported in the plain text file format for the statistical analysis of bibliometric information such as years, author names, subject areas, document types, source titles, keywords, and countries. After that, intensive citation analysis using Harzing\u2019s Publish or Perish 8 and bibliometric mapping using VOSviewer version 1.6.18 were performed ,78. The r Perish . Then, Vr Perish .This section contains the results of the bibliometric analysis on GaN from 1970 to 2023 as of 9 December 2022. However, according to the Scopus database, the first indexed paper was published by Margrave  in 1956,From 1991 to 1999, there has been an increase in the number of papers, from 16 documents in 1991 to 426 documents in 1999. Even though there were fluctuations in the number of publications from 2000 to 2009, the number of publications increased from 2010 (with 416 publications) and the number of publications peaked in 2020 with 1177 documents. There was a slight drop in the number of papers in 2021 with 1091 publications. Even though there are only 740 publications listed in 2022, 17 papers have been published for 2023 as of 9 December 2022, which clearly show there is ongoing research on GaN.h-index (h) of 58 was recorded for 2000. This means that there were 58 documents that have received at least 58 citations. The highest g-index (g) of 131 was recorded for 2003. This implies that there are 131 documents with at least 17,161 citations in 2003.The 15,634 publications have been categorized into various subject areas. Most of the GaN publications are under physics (8250), engineering (6634), and materials science (5197). GaN is also related to chemistry (1607), science technology and other topics (1528), optics (1337), crystallography (827), telecommunications (805), computer science (762), and energy fuels (716). The top 20 subject areas are tabulated in h-index (h) and g-index (g) of 162 and 292, respectively. This implies that there were 162 documents that have been cited 162 times or more while there were also 292 documents with a total citation of 85,264. Even though China had the second highest contribution in terms of the TP value, China had small C/P and C/CP values of only 13.72 and 16.60, respectively, which lagged behind Japan, England, Germany, Poland, France, and Taiwan. Researchers from more than 100 countries have contributed to the literature of GaN from 1970 to 2023 as of 9 December 2022. The top three countries with the highest TP are the United States (4685), China (2808), and Japan (1531). Among the 373,603 total citations received from all 15,634 documents, the United States received 158,750 citations, which was more than 42% of the total citations. Documents from researchers in the United States were also the most impactful, as the documents have the highest C/P of 33.88 and C/CP of 38.93. Moreover, the United States also had the highest Authors may collaborate with researchers across countries to produce better quality publications from impactful research for greater insights. Scientific collaboration, which is an intellectual cooperation, allows for knowledge, resource, and technology sharing among researchers in different regions. The synergy from these collaborations can be studied with a co-authorship analysis using VOSviewer software version 1.6.18 . In the There are eight clusters in total. 19 countries, including Bangladesh, Belarus, Canada, Egypt, India, Iran, Iraq, Kazakhstan, Lebanon, Malaysia, Nigeria, Pakistan, Saudi Arabia, Thailand, Tunisia, Turkey, and the United Arab Emirates are in a similar cluster (red). The second cluster (green) consists of Algeria, Austria, Czech Republic, France, Germany, Greece, Israel, Jordan, Moldova, New Zealand, Romania, and Slovakia. The third cluster (blue) consists of Argentina, Brazil, Columbia, Cuba, Denmark, Mexico, South Africa, and Spain. The fourth cluster (yellow) is made up of countries such as Belgium, England, Ireland, Italy, North Ireland, Serbia, Switzerland, and Wales. The fifth cluster (purple) includes countries such as Indonesia, Japan, Morocco, Philippines, South Korea, Taiwan, the United States, and Vietnam. Croatia, Lithuania, the Netherlands, Poland, Portugal, Scotland, and Ukraine make up another cluster (light blue). The brown cluster consists of China and Singapore.Journal of Crystal Growth published 626 papers, followed by Applied Physics Letters (624), Journal of Applied Physics (506), IEEE Transactions on Electron Devices (339), Proceedings of SPIE (312), Physical Review B (205), IEEE Access (201), IEEE Electron Device Letters (194), Thin Solid Films (193) and Materials Research Society Symposium Proceedings (187).There are about 210 source titles that have published papers related to GaN. The sixth most cited paper by De Walle and Neugebauer  presenteThe keyword co-occurrence map of VOSviewer studies the connections among the keywords. An advantage of the keyword co-occurrence map is that it allows researchers to identify key concepts and how these key concepts are connected to form sub-domains that may be the hotspots of research . Table 8n-type GaN, oxidation, p-type GaN, and yellow luminescence.From The trend of the GaN publication can be viewed with the overlay visualization map. In this map, the node color reflects the period the documents with the keyword was published. Darker colors imply that the key concepts (sub-domains) have been a long focus in the GaN research . Figure h-index of 188.Citation metrics of the 15,634 documents on GaN publications from 1970 to 2023 as of 9 December 2022 have been extracted from Harzing\u2019s Publish or Perish tool and tabulated in This paper presents a bibliometric analysis of the scientific literature of GaN listed in the internationally recognized Web of Science database from 1970 to 2023 as of 9 December 2022. The first three papers indexed in 1970 are titled \u201cOptical studies of the photons and electrons in gallium nitride\u201d by Manchon et al. , \u201cPreparJournal of Crystal Growth published by Elsevier with TP of 626, impact factor of 1.830, citation indicator of 0.51, CiteScore of 3.5, and h-index of 155.The scientific literature of GaN are mostly articles (67.16%) and proceeding papers (29.70%). Publication has been largely centered in the United States with 4685 total documents, 158,750 total citations, 33.88 citations per paper, and 38.93 citations per cited paper. The top source title that publishes GaN papers is the The country co-authorship network found that the United States has the largest total link strength of 1343, which implies that the United States is actively collaborating with other countries on GaN research areas. The highest link strength (245) is found between China and the United States. The keyword co-occurrence map is represented by five clusters. The first cluster is of high importance as the first cluster is also having the darkest color in the overlay visualization map, which implies that the first cluster has long been a focus in GaN research.It is important to note that even though ongoing research has been performed on the thermostability and electronic properties of GaN, there is an increasing concentration on the application of GaN in next generation devices, especially for satellites and 5G technologies and beyond. GaN is often studied for its applications in the areas of power electronics, power amplifier, wide band gap semiconductors, sensors, and switches that have high potential to drive digitization and further industrialization. The outstanding properties of GaN as a semiconductor make it attractive to be applied in these areas for future advancement."}
+{"text": "Raw data obtained by ultra-high pressure liquid chromatography\u2013mass spectrometry, and processed lipid compositional data are presented alongside detailed methodology. Data were obtained as bovine liver lipid extract oxidizes, initiated by 2,2\u2032-Azobis(2-amidinopropane) dihydrochloride, at 0, 6 and 24 h post initiation. Lipid oxidation data in the presence and absence of some supplements with antioxidant properties was obtained. The supplements used were grape seed extract, pine bark extract, milk thistle extract, hawthorn extract and turmeric extract. Specifications Table\u2022These data record the changing lipid profile of a complex lipid mixture as it undergoes oxidation and the effect of 5 plant extract supplements on lipid oxidation. 15 lipid classes and the absolute amounts of 378 individual lipids were quantified.\u2022Researchers with an interest in oxidative stress and antioxidant plant extracts will benefit from these data.\u2022Analyzed data can be used to parameterize mechanistic models of lipid oxidation and inhibitors of lipid oxidation.\u2022Raw data can be reanalyzed in the future as the field of oxidative lipidomics develops.\u2022The methodology developed can be used to quantify the antioxidant effects of other compounds.1This dataset provides raw HPLC-MS/MS data 2Data presented are the absolute amounts of the individual quantified lipids and their chemical identities obtained as a bovine liver lipid extract is oxidized using the peroxidation agent 2,2\u2032-Azobis(2-amidinopropane) dihydrochloride (AAPH). The antioxidant effect of five different plant extract supplements formed the basis of the experiment, which contrasts lipid oxidation in the presence of these to a control, no supplement, dataset. These data support a recent publication Raw mass spectrometry files have been deposited at Mendeley Data Data for the absolute amounts of individual lipid species obtained (arithmetic mean \u00b1 standard deviation) are provided as supporting information. Table S1 shows the total absolute amount (nmoles per 10 \u00b5L of oxidation assay) for each lipid class identified . Lipid classes identified were phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylglycerol (PG), lysophosphatidylcholine (LysoPC), lysophosphatidylethanolamine (LysoPE), hydroxyphosphatidylcholine (PC(OH)), hydroxyphosphatidylethanolamine (PE(OH)), plasmenylphosphatidylethanolamine (Plasmenyl-PE), plasmanylphosphatidylethanolamine (Plasmanyl-PE), plasmenylphosphatidylcholine (Plasmenyl-PC), plasmanylphosphatidylcholine (Plasmanyl-PC), sphingomyelin (SM), diacylglycerol (DG) and triacylglycerol (TG). Notation of lipids in the accompanying tables uses the Lipidmaps recommendation Tables S2 to S16 show the individual lipid species identified and quantified using the methodology. These are DG (Table S2), LysoPC (Table S3), LysoPE (Table S4), PC (Table S5), PC(OH) (Table S6), PE (Table S7), PE(OH) (Table S8), PG (Table S9), PI (Table S10), Plasmanyl-PC (Table S11), Plasmanyl-PE (Table S12), Plasmenyl-PC (Table S13), Plasmenyl-PE (Table S14), SM (Table S15) and TG (Table S16). 3The following materials and methods were used throughout the study as described in full in our recent publication Bovine polar lipid extract , Best Naturals Grape Seed Extract 400 mg Tablets , Milk Thistle 3500 mg Tablets High Strength Silymarin , Super Strength Hawthorn Berry Extract Capsules . Simply Pure Organic Turmeric Capsules x 90, 600 mg, , Pine Bark Extract 400 mg, 95% Proanthocyanidins . Water , acetonitrile , methanol (HPLC grade \u2265 99.9 %), chloroform , isopropanol , ammonium formate , Trizma (Sigma Aldrich) and 2,2\u2032-Azobis(2-methylpropionamidine) dihydrochloride (Sigma Aldrich).3.1HPLC-MS) was performed on a hybrid quadrupole Orbitrap mass spectrometer  coupled to an ultra-high-performance LC system . Lipids were separated using reversed phase chromatography  with a solvent gradient consisting of solvent A; (60:40 v/v); water: acetonitrile and 10 mM ammonium formate and solvent B; (90:10) isopropanol: acetonitrile and 10 mM ammonium formate at a flow rate of 200 \u00b5L/min. Full details of the method have been published previously 3.2Thermofisher raw format (.raw) file were converted to mzXML files using MSConvert (Proteowizard) 3.3Lipid quantifications were performed relative to the isotopic standard spiked in at the Bligh-Dyer extraction stage . PE, PE(OH), plasmanyl-PE and plasmenyl-PE species were quantified to the PE standard 15:0-18:1(d7) PE (5.3 \u00b5g/mL), PC, PC(OH), plasmanyl-PC and plasmenyl-PC were quantified to the PC standard 15:0-18:1(d7) PC (150.6 \u00b5g/mL). DG, TAG, PI, PG and SM lipids were quantified relative to peak areas corresponding to 15:0-18:1(d7) DG (8.8 \u00b5g/mL), 15:0-18:1(d7)-15:0 TAG (52.8 \u00b5g/mL), 15:0-18:1(d7) PI (8.5 \u00b5g/mL), 15:0-18:1(d7) PG (26.7 \u00b5g/mL) and d18:1-18:1(d9) SM (29.6 \u00b5g/mL), respectively. Lyso PE and lyso PC were quantified relative to peak areas corresponding to 18:1(d7) lyso PE (4.9 \u00b5g/mL) and 18:1(d7) lyso PC 23.8 \u00b5g/mL). All data are expressed as the mean average plus/ minus the standard deviation of 3 different samples (n\u00a0=\u00a03).3.4Liposomes were prepared in amber HPLC vials from 40 \u00b5L of bovine polar lipid extract and 10 \u00b5L of plant extract solution (1 mg/mL in methanol). After drying under nitrogen, water (200 \u00b5L) was added, and samples were vortexed to mix and lyophilized overnight. Dry lipid films were hydrated with buffer  and resuspended by vortexing (10 min) and rested (20 min) at room temperature. After sonication (20 min) and resting (20 min) 4 freeze thaw cycles were performed. Before use in the oxidation assay liposomes were equilibrated (60 min) at room temperature. No supplement controls were prepared in the same way, omitting the addition of the plant extract solutions at the first step.Oxidation assays were initiated by mixing equal volumes  of liposome solution and AAPH solution , incubating for 0, 6 and 24 h in a water bath (37\u00b0C). Reactions were terminated by freezing and after thawing 10 \u00b5L of samples were removed and lipids were extracted using the Bligh Dyer protocol Julia Bahja: Conceptualization, Methodology, Investigation, Writing \u2013 review & editing; Nicolas A. Stewart: Data Curation, Methodology, Investigation, Writing \u2013 review & editing; Marcus K. Dymond: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing \u2013 original draft, Writing \u2013 review & editing, Visualization, Supervision, Project administration.The authors confirm that this research meets all the ethical criteria for publication in Data in Brief. This research does not involve studies with animals or humans and does not require a detailed ethical statement.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
+{"text": "Although usually mild to moderate in severity, postoperative pain after peroral endoscopic myotomy (POEM) is common. There are no studies that have addressed minimizing postoperative pain in patients undergoing POEM for achalasia. We hypothesized that intraoperative topical intra-tunnel irrigation with ropivacaine would result in a significant reduction in pain scores in the postoperative period.A double-blind, randomized, placebo-controlled trial was conducted at the Kingston Health Sciences Center. Patients received either 30\u00a0mL of 0.2% ropivacaine or 30\u00a0mL of placebo irrigated topically into the POEM tunnel after completing the myotomy and prior to closing the mucosal incision. The primary outcome was pain post-POEM at 6\u00a0h assessed by the Numeric Rating Scale (NRS). Secondary objectives included assessing pain score at 0.5, 1, 2, 4\u00a0h post-POEM and on discharge, Quality of Recovery (QoR-15) scores at discharge, narcotic requirement, adverse events, and patients\u2019 willingness to have the procedure done on an outpatient basis.P = 0.171). No statistical difference was seen in the pain scores. Overall usage of post-procedural narcotics was low with no differences between the two groups. Fifty percent of patients in both groups were willing to have the procedure done as an outpatient.A total of 20 patients were enrolled. For the primary outcome of pain post-POEM at 6\u00a0h, the NRS was 1.1 in the placebo group and 2.4 in the ropivacaine group (95% CI of the difference: \u22123.2 to 0.6, The addition of intra-procedural tunnel irrigation with 30\u00a0mL 0.2% ropivacaine did not lead to reduced post-POEM pain. Achalasia is a disorder of esophageal motility characterized by a loss of enteric neurons resulting in impaired relaxation of the lower esophageal sphincter (LES) and absence of esophageal peristalsis . There aPOEM has emerged as a minimally invasive treatment for achalasia and is the endoscopic equivalent to surgical myotomy. It is a first line treatment for achalasia and the preferred treatment for type 3 achalasia . A pooleAlthough usually only mild to moderate in severity, postoperative pain after POEM is common. There are no studies that have addressed minimizing postoperative pain in patients undergoing POEM for achalasia. We currently use a multimodal approach to pain management with topical lidocaine, ketorolac, and liquid acetaminophen.Ropivacaine is a commonly used local anesthetic in other minimally invasive surgeries. In a randomized controlled trial in patients undergoing laparoscopic cholecystectomy, shoulder pain which was assessed for up to 72\u00a0h post-operatively was significantly decreased in patients that received 10\u00a0mL of 0.25% bupivacaine instilled into the gallbladder bed versus patients that received 10\u00a0mL of normal saline .We hypothesized that intraoperative topical intra-tunnel irrigation with ropivacaine would result in a significant reduction in pain scores and decreased requirements of additional analgesics in the postoperative period.This was a randomized, double blind, placebo-controlled trial conducted at the Kingston Health Sciences Center (a tertiary care academic center) from June 2019 to December 2020. The operator and patients were blinded to the treatment. The research pharmacist was not blinded. Patients were randomized by an independent research pharmacist using blinded block randomization. All procedures were performed by a single operator (RB) as described previously .All patients 18 years of age and older undergoing POEM for achalasia who were able to provide informed consent were approached for participation. The diagnosis was based on high-resolution esophageal manometry (HRM) using the Chicago classification 3.0 when available  , chronic pain taking regular opioids , and patients unable to give informed consent were excluded.The study solutions were prepared prior to the procedure by an independent research pharmacist and stored as per pharmacy standards. The study solutions consisted of either 30\u00a0mL of saline or 30\u00a0mL of 0.2% ropivacaine in 30 cc syringes. Both solutions were clear, colorless and could not be distinguished from one another based on appearance or consistency. On the day of the procedure, the study solution for each patient was obtained in a sealed envelope with anonymized randomization code. During the POEM procedure, after confirming the adequacy of the myotomy, the study solution was instilled into the tunnel through the working channel of the gastroscope. The mucosal incision was then sealed with hemostatic clips.After the POEM procedure, pain was assessed by a blinded clinical research assistant at 0.5, 1, 2, 4 and 6\u00a0h as well as on discharge. The Numeric Rating Scale (NRS) and the Visual Descriptor Scale Score (VDS) are validated pain assessment tools that were used to assess and record pain scores .NRS: The patient was asked to rate their pain on a scale of 0\u201310, 0 representing no pain, and 10 representing the worst pain they have ever felt in their life.1) VDS: The patient was asked to indicate verbally the severity of their pain as one of the following: no pain, slight pain, mild pain, moderate pain, severe pain, extreme pain, most intense pain imaginable.2) This validated measure captures the patient\u2019s initial post-operative health condition and captures global assessment of patient\u2019s recovery , 11. The1) Post-POEM pain at 6\u00a0h as assessed via the NRS.1) Post-POEM pain scores assessed by the NRS and Visual Descriptor Scale (VDS) at 0.5, 1, 2 and 4\u00a0h and on discharge (24\u201330 hours post-POEM)2) Quality of Recovery (QoR-15) score  at disch3) Post-POEM opioid analgesic requirement4) Adverse events5) Patient\u2019s willingness to have the procedure performed as an outpatientAnesthesia and post-operative care were protocolled for patients in this study. After intravenous induction and endotracheal intubation, anesthesia was maintained with sevoflurane and pain managed with fentanyl , as needed to minimize the effect on post-procedure pain. No long-acting opioids (morphine/hydromorphone) were administered. Immediately prior to extubating, all patients were given dexamethasone 6\u00a0mg intravenous (IV), ondansetron 4\u00a0mg IV and ketorolac 30\u00a0mg IV. The occurrence of post-POEM pain in the Post Anesthesia Care Unit (PACU) was managed with morphine 1\u20132\u00a0mg IV every 5\u00a0min as needed as per anesthesia standard practice. Post-POEM nausea and vomiting were treated with haloperidol 0.5\u00a0mg IV \u00d7 2 doses and dimenhydrinate 25\u00a0mg IV every 30\u00a0min \u00d7 2 doses as required. Post-POEM all patients were started on regular liquid acetaminophen 650mg orally every 4\u00a0h, 2% viscous lidocaine 15\u00a0mL orally four times per day, sucralfate suspension 1\u00a0g orally four times daily and ketorolac (as needed) 30\u00a0mg IV every 6\u00a0h.This is a pilot study as there is a lack of studies to base the calculation of the sample size. A power calculation was performed for the primary outcome NRS score at 6\u00a0h post-POEM. A baseline NRS of 5 was assumed. We thought a clinically significant difference would be a reduction in NRS from 5 to 2. To detect a difference in the mean NRS score from 5 to 2, with SD estimated conservatively at \u00b12, 10 patients would be required in each group, with alpha set at 0.05 and power of 90%. Data are presented as frequencies and percentages, means (\u00b1 standard deviation) or median (range) where appropriate. T-tests were used to compare the mean values for the two groups. All calculations were conducted in SPSS v23 .No industry-related funding was received to support this study or compensate study investigators. The study protocol was approved by the health sciences research ethics board at Queen\u2019s University (DMED 2186-18). All patients were voluntarily consented during their clinic visit by a dedicated research coordinator. The study is registered on clinicaltrials.gov NCT03702647 .A total of 20 patients were enrolled, 10 in each group . BaselinP = 0.171), respectively (P = 0.372), respectively. No adverse events occurred with medications administration and there was no evidence of local anesthetic systemic toxicity. No adverse events occurred during or after the POEM procedure. No differences were seen in QoR-15 scores at discharge in either group . Three out of 10 patients used a as needed dose in the placebo group and 2 out of 10 in the ropivacaine group. At 0.5-h post-POEM, one patient in the placebo group used 1\u00a0mg of morphine. At 1-h post-POEM, two patients in the placebo group used 1\u00a0mg of morphine each and one patient in the ropivacaine group used 1\u00a0mg of morphine. At 2 and 4\u00a0h post-POEM, one patient in each group used 1\u00a0mg of morphine. After 4\u00a0h post-POEM, there was no opioid requirement in either group. No patients required haloperidol or ketorolac. Fifty percent of patients in both groups were willing to have the procedure done as an outpatient.P = 0.02)  and 0.9 (SD 1.5) in the placebo group versus 4.2 (SD 2.5) and 1.3 (SD 0.7) in the ropivacaine group with no statistical difference. These results are similar to prior published studies reporting post-POEM pain. In a 2017 review by Misra et al., the average first pain score was 4.6  in the PACU post-POEM and 3.3 once the patient was on the regular hospital floor . In a 20At our centre, a multimodal approach to post-POEM pain management with the use of topical viscous lidocaine, ketorolac, and liquid acetaminophen is used. In both groups, post-POEM requirement of opioids was low within the first 4\u00a0h, and no patients required opioids after 4\u00a0h. Pain scores steadily decreased over time in both groups as seen in Fifty percent of patients in both the placebo group and ropivacaine stated that they would be willing to have the procedure done as an outpatient. In a 2019 study looking at outcomes of 103 POEMs, 62.4% of patients were discharged safely on the same day . Their rThe strengths of this study include its design as investigators, patients and outcome assessors were blinded to the intervention. Despite no significant difference in pain scores between groups, we demonstrated that the use of a multimodal non-opioid regimen was adequate for all, with opioids rarely being needed. Limitations include this being a single centre, single operator study and thus generalizability is limited. There was a relatively small sample size, and there is a possibility that a small statistically significant difference between the groups was missed, although the clinical significance of such a difference would be negligible. Our baseline assumption for the primary outcome was a NRS of 5 but the results were much less than expected with a NRS of 1.1 in the placebo group. Therefore, our study would be underpowered to detect a difference. However, given the small difference in pain scores between the two groups, finding such a difference would not be clinically significant and we will not pursue a larger trialIn summary, the addition of intra-operative tunnel irrigation with 0.2% ropivacaine did not lead to reduced pain post-POEM. However, with the regular use of a multimodal post-POEM pain regimen with topical viscous lidocaine, IV ketorolac and liquid acetaminophen good pain control was achieved for all patients with minimal requirement of opioids."}
+{"text": "The covalent modification of target proteins with ubiquitin or ubiquitin-like modifiers is initiated by E1 activating enzymes, which typically transfer a single modifier onto cognate conjugating enzymes. UBA6 is an unusual E1 since it activates two highly distinct modifiers, ubiquitin and FAT10. Here, we report crystal structures of UBA6 in complex with either ATP or FAT10. In the UBA6-FAT10 complex, the C-terminal domain of FAT10 binds to where ubiquitin resides in the UBA1-ubiquitin complex, however, a switch element ensures the alternate recruitment of either modifier. Simultaneously, the N-terminal domain of\u00a0FAT10 interacts with the 3-helix bundle of UBA6. Site-directed mutagenesis identifies residues permitting the selective activation of either ubiquitin or FAT10. These results pave the way for studies investigating the activation of either modifier by UBA6 in physiological and pathophysiological settings. UBA6 is an E1 enzyme that can activate both ubiquitin and FAT10. Here, the authors employ X-ray crystallography and biochemical techniques to explain this dual specificity, and identify UBA6 variants that are selectively impaired in the activation of either ubiquitin or FAT10. Ubiquitylation is carried out by a sequential enzymatic cascade of E1 activating enzymes, E2 conjugating enzymes and E3 ligating enzymes. In the presence of Mg-ATP, E1 catalyzes the acyl-adenylation of ubiquitin, initially forming a ubiquitin-AMP adduct. Subsequently, the E1 catalytic cysteine attacks the ubiquitin-AMP intermediate to form a thioester bond between the cysteine and the C-terminal glycine of ubiquitin, resulting in the formation of a covalent E1~ubiquitin adduct. Ubiquitin is then transferred to the active site cysteine of the E2 in a transthioesterification reaction. Finally, E3 enzymes catalyze the ligation of ubiquitin to their target substrates3.The posttranslational modification of target proteins with ubiquitin alters their structure, function, and/or localization6. Different lines of evidence suggest that UBA6 does not simply represent a backup system for UBA1: (1) So far UBA6 and USE1  are the only E1 and E2 which have been identified to be involved in FAT10ylation5. (2) UBA1 and UBA6 display distinct E2 selectivities, which partially depends on their C-terminal, E2-recruiting ubiquitin fold domains. These distinct E2 preferences permit the two E1 enzymes to direct ubiquitin to distinct subsets of E3 enzymes and consequently substrates. (3) UBA1 and UBA6 function in spatially distinct ways with ~99% of all ubiquitylation events being initiated by UBA17. Although UBA6 is widely expressed in human tissues and cell lines, its expression is ten-fold lower compared to that of UBA1 in various cell lines5, however, UBA6 expression can be upregulated, e.g. during dendritic cell maturation or hyperthermic stress9.For many years UBA1 was thought to be the only E1 that activates ubiquitin, until in 2007 a second ubiquitin activating enzyme was discovered. This protein, referred to as UBA6, is present only in vertebrates and sea urchins and shares 40% sequence identity with UBA1 , a member of the UBL family10, is a two-domain protein with each domain folding into the \u03b2-grasp architecture also observed for ubiquitin11. FAT10 is expressed in mature dendritic cells and B cells, but it is also induced by the proinflammatory cytokines \u03b3-interferon and tumor necrosis factor \u03b1 in cells derived from various tissues. FAT10 targets proteins for rapid proteasomal degradation, with FAT10, in contrast to ubiquitin, being also degraded by the proteasome along with its substrate11. While ubiquitin can be efficiently transferred to many E2 enzymes by both UBA1 and UBA6, FAT10 exhibits a considerably higher selectivity since it is charged to USE1 only and USE1 solely accepts this modifier from UBA65. Moreover, the higher selectivity of FAT10ylation towards USE1 is also reflected in the auto-FAT10ylation of USE1 in cis12, which only takes place when the FAT10 C-terminal domain is present11. Parkin has been recently identified as the first E3 enzyme of FAT1013.Interestingly, UBA6 was found to activate ubiquitin and FAT10 both in vitro and in vivo14. UBA6-mediated proteasomal degradation was reported to be involved in brain-associated physiological and pathophysiological states in mice16. Interestingly, UBA6 was found to be overexpressed in human brains from patients with Alzheimer\u2019s disease17. The tumor suppressor protein p53 is a FAT10 substrate and a double-negative regulation of FAT10 and p53 was observed to be critical in the control of tumorigenesis18, which is in line with the overexpression of FAT10 in many cancer cell types19. In hepatocellular carcinoma cells (HCCs), FAT10 is overexpressed and FAT10ylation facilitates degradation of the Wnt\u2010induced secreted protein\u20101 (WISP1) by the proteasome. As WISP1 suppresses proliferation of hepatocellular carcinoma cells, its FAT10ylation-mediated degradation promotes tumor progression20.Since ubiquitylation and FAT10ylation are involved in multiple cellular processes, it is not surprising that malfunctions in one or more components of this system lead to a variety of diseasesDue to the involvement of UBA6-mediated ubiquitylation and FAT10ylation in various cellular processes in both physiological and pathophysiological settings, it is imperative to study the underlying processes and decipher the molecular basis for the dual specificity of UBA6. Ultimately, targeting of UBA6 with specific inhibitors would not only permit the analysis of the consequence of blocking the entire FAT10ylation pathway and those ubiquitylation events which are catalyzed by UBA6, but to also develop alternative therapeutic approaches. Here, we report structures of UBA6, in complex with ATP and FAT10, and identify residues which selectively interfere with either the activation of ubiquitin or FAT10.1221) at a resolution of 3.3\u2009\u00c5  aligned C\u03b1 atoms. This larger rmsd is due to the aforementioned motions of the FCCH, SCCH and UFD domains, which are linked to the core via flexible loops  selectively recruit the E2s and subsequently transfer the UBLs from the E1s to the E2s26. With respect to UBL differentiation, the residue corresponding to R72 of ubiquitin is the primary specificity determinant and hence is of special importance for its activation by UBA1. The corresponding residues in NEDD8, SUMO1\u20133 and FAT10 are Ala, Gln/Glu  and Tyr, respectively  site, while a Ca2+-ion appears to be present in the Mg(2) site , the Uba1-ubiquitin-acyladenylate complex (PDB entry 4nnj) at 2.4\u2009\u00c5 resolution and the Uba1-ATP complex (this study) three structures of Uba1 are now available, which are highly relevant for the adenylation reaction Fig.\u00a0. A compa23, we focused on the yeast Uba1-ATP complex due to its higher resolution and the fact that only the triphosphate moiety of ATP could be visualized in the human UBA1-ATP complex, nevertheless, the structural differences described below also apply to UBA1. Fig.\u00a0The structure of the Uba1-ATP complex provides an excellent framework to compare it to the UBA6-ATP complex as they both represent the same step in the activation cascade. Although the structure of human UBA1 in complex with ATP is available11 in which Cys7 and Cys9 were substituted with Thr, Cys134 was replaced with Leu and Cys160 and Cys162 were replaced with Ser (referred to as FAT10-C0) was generated. Since extensive initial crystallization attempts with wild-type UBA6 did not result in well diffracting crystals, a chimeric protein, referred to as UBA6chim, was utilized. In this protein the SCCH domain (residue 623 to 889) of UBA6 was replaced with its counterpart (residue 631 to 889) from human UBA1, resulting in a protein with enhanced stability. Activity assays with FAT10-C0 showed a robust activation by UBA6 and transthioesterification to USE1  would interact with UBA6. One hypothesis would posit a placement of the NTD in the large cleft between the AAD and FCCH present in the UBA6 structure. Hence, we generated the UBA6-FAT10 complex and solved its structure by molecular replacement with full-length UBA6 as search model. Due to superior stability and solubility a FAT10 variant described earlierchim, which could be positioned by molecular replacement using a search model from which the SCCH domain was omitted. The two SCCH domains were localized subsequently by molecular replacement with the corresponding domain of UBA1 (PDB entry 6dc6), followed by extensive rebuilding. Surprisingly, only a single FAT10 moiety was present, which was assembled from the crystal structure (PDB entry 6gf1) of its NTD11 and the NMR structure of its C-terminal domain  with the loop connecting the two domains apparently exhibiting high flexibility. The overall structure of the UBA6chim-FAT10 C0 complex revealed that FAT10 covers the AAD, IAD and 3HB domains of UBA6chim and engages in numerous interactions distributed over a smaller and a larger interface involving the NTD and CTD, respectively  the interface areas amount to 1621 \u00c52\u00a0and 1561\u00a0\u00c52, respectively,\u00a0which clearly exceeds the value for the CTD in the UBA6-FAT10 interface.The P1 crystals contain two copies of UBA6ely Fig.\u00a0. The UBAchim-FAT10 complexes  differ substantially from the corresponding residues of ubiquitin (71Leu-Arg-Leu-Arg-Gly-Gly76), and a key question regarding the dual specificity of UBA6 is how the respective specificity determinants R72 and Y161 can both be recognized by UBA6. The UBA6chim-FAT10 structure clearly revealed that the same binding pocket used by Uba1 to recognize R72 of ubiquitin is recruited for the binding of Y161 of FAT10 , it is oriented in such a way that it exclusively interacts with the 3HB inserted into the IAD. These interactions are polar and primarily rely on the electrostatic complementarity of a positively charged region in the NTD involving residues K55, K58, R60 and K61 and a negatively charged patch in the 3HB formed by E320, E324, D370 and D374, with S64 of FAT10 and N318 of UBA6 contributing additional polar interactions Fig.\u00a0. At the After superimposing UBA6 and Uba1 in complex with ubiquitin and comparing in detail the interactions involving the selectivity determinants Y161 of FAT10 in the UBA6-FAT10 complex Fig.\u00a0 and R72 This analysis predicts that elimination of the negatively charged D616 should weaken the interaction between UBA6 and ubiquitin, while showing no effect for UBA6-catalyzed FAT10ylation. Hence, we engineered the D616A variant and analyzed its activity with both protein modifiers. While FAT10ylation levels for the variant remained at wild-type levels (105% of wild-type), ubiquitylation was severely impaired resulting in a residual activity of 22% for the mutant Fig.\u00a0. D591, tThe counterpart of E601 in Uba1 is Q576 (Q608 in UBA1), which, albeit being polar, cannot contribute towards the neutralization of the positively charged R72 in the same way as predicted for E601 Fig.\u00a0. Hence, 29 (PDB entry 1z2m) reveals that the relative orientation of the two Ubl domains in both of these modifiers is similar  retains the outward movement of the FCCH observed for UBA6  and yeast Uba1 (residues 10\u20131024), which are referred to as UBA1 and Uba1, respectively, were cloned with a C-terminal His-tag in the pET23b vector and an N-terminal His-tag in the\u00a0pET28a vector, respectively, and transformed into E. coli BL21 (DE3) RIL cells for expression. Wild-type FAT10 was N-terminally tagged with a His6-SUMO tag in the pET28a vector, while a cysteine-free FAT10 (FAT10-C7T/C9T/C134L/C160S/C162S) variant, referred to as FAT10-C0, was N-terminally tagged with a His6-maltose-binding-protein-tag followed by a TEV cleavage site in the pETM41 vector. The desired mutations were generated using site-directed mutagenesis with specifically designed primers (Supplementary Table\u00a0chim) in which the SCCH of UBA6 was replaced by its counterpart from human UBA1 was engineered using sequence and ligation independent cloning (SLIC). The respective plasmid DNAs were isolated using the Mini-prep kit (Fisher Scientific UK) and DNA sequences were verified by automated DNA sequencing.Human UBA6 (residues 35\u20131052) and its variants containing a glutathione S-transferase (GST) tag followed by a TEV cleavage site at the N-terminus and a HisE. coli BL21 pRARE strain and cells were grown in LB medium. Expression was induced by adding 0.2\u2009mM isopropyl-\u03b2-D-thiogalactopyranoside (IPTG) followed by overnight growth at 15\u2009\u00b0C. Proteins were purified by glutathione affinity chromatography, cleavage of the GST-tag with TEV protease, Ni-NTA affinity chromatography and size-exclusion chromatography. Proteins were concentrated in buffer containing 25\u2009mM Tris-HCl pH 8, 500\u2009mM NaCl, 1\u2009mM TCEP and aliquoted prior to storing at \u221280\u2009\u00b0C.UBA6 and its variants were expressed in the E. coli BL21 (DE3) strain in LB medium and expression was induced by addition of 0.1\u2009mM of IPTG and subsequent overnight growth at 16\u2009\u00b0C. UBA1 was purified by Ni-NTA affinity chromatography, followed by anion exchange and size-exclusion chromatography. For Uba1 hydrophobic interaction chromatography replaced the anion exchange chromatography.UBA1 and Uba1 were expressed in the E. coli BL21 Rosetta II cells, respectively, in LB medium after induction with 0.2\u2009mM IPTG followed by overnight growth at 20\u2009\u00b0C. FAT10 proteins were purified by Ni-NTA affinity chromatography and subsequent cleavage of the His6-SUMO tag with the SUMO protease ULP1 for FAT10 and cleavage with TEV protease\u00a0for FAT10-C0. FAT10 proteins were further purified by cation exchange and size-exclusion chromatography. Expression and purification of USE130 and ubiquitin31 were carried out as described.The FAT10 wild-type and FAT10-C0 as well as its variants were expressed in 2 for 30\u2009min at 30\u2009\u00b0C. The resulting inorganic phosphate was detected with the BIOMOL-GREEN Reagent (Enzo Life Sciences). 50\u2009\u03bcL of each reaction was transferred into 96-NUNC microwell plates (Thermo Fisher Scientific) and 100\u2009\u03bcL BIOMOL-GREEN reagent was pipetted to each well. After 5\u2009min 15\u2009\u03bcL of 34% (w/v) sodium citrate were added  followed by absorbance measurements at 620\u2009nm using a CLARIO star plate reader . Each sample was measured in triplicates in two independent experiments. The data were normalized against a control containing 1\u2009mM ATP, 2\u2009mM MgCl2 and 40 U pyrophosphatase in assay buffer. The data displayed a linear correlation with the concentration of Uba1 (wild-type and variants) and the specific activity was derived by a linear fit.Eight different concentrations (0\u20136\u2009\u03bcM) of Uba1 or its variants, 80\u2009\u03bcM ubiquitin and 40 U of inorganic pyrophosphatase  in assay buffer  were incubated in the presence of 1\u2009mM ATP and 2\u2009mM MgCl2. The reactions were conducted at room temperature for the indicated times and were stopped by adding protein loading buffer without reducing agent , except when noted otherwise. SDS PAGE with 4\u201320% gradient gels was used for analysis. To test the transfer of FAT10 from UBA6 to USE1, 9\u2009\u03bcM USE1 was mixed with UBA6 and Mg-ATP (as described above) and the respective FAT10 wild-type or FAT10-C0. The reaction conditions and analysis were as described for the E1 activity assay.To test the functionalities of the purified E1s, 3\u2009\u03bcM of the respective E1 enzyme was mixed with either 20\u2009\u03bcM of unlabeled FAT10\u00a0wild-type, FAT10-C0 or FAT10-C0 variants (for UBA6) or 3\u2009\u03bcM of ubiquitin , which was labeled with the 800CW infrared fluorescent dye , in the presence of 2.5\u2009mM ATP and 2.5\u2009mM MgClC625A variant or the Uba1 wild-type was mixed in a 1:1.5 molar ratio with 1\u2009mM ATP and 2\u2009mM MgCl2 and incubated at 4\u2009\u00b0C overnight. In case of the UBA6-FAT10 complex the chimeric UBA6variant (UBA6chim) was incubated with FAT10-C0 in a 1:1.5 molar ratio at 4\u2009\u00b0C overnight. Protein crystals were obtained by vapor diffusion experiments, either in sitting drop plates or hanging drop plates at 4\u2009\u00b0C. The UBA6 C625A-ATP complex was crystallized at a protein concentration of 4\u2009mg/ml against a reservoir solution containing 0.12\u20130.16\u2009M Ca-acetate, 0.08\u2009M Na-cacodylate pH 6.5,\u00a013\u201315% w/v PEG 8000, 16\u201320% v/v glycerol. The Uba1-ATP complex was crystallized at a concentration of 12\u2009mg/ml from 0.2\u2009M (NH4)2SO4, 0.1\u2009M HEPES pH 7.5 and 25% PEG 3350. The UBA6chim-FAT10-C0 complex was crystallized at a concentration of 5\u2009mg/ml from 0.5\u2009M LiCl, 0.1\u2009M Tris pH 8.4 and 25% PEG6000. All crystals were harvested in mother liquor supplement with 20\u201330% glycerol as cryo-protectant and flash cooled in liquid nitrogen for subsequent data collection at 100\u2009K. Diffraction data were collected at the following synchrotron facilities: UBA6-ATP, P14 at DESY/EMBL in Hamburg; UBA6-FAT10, ID 30A-3 at ESRF-EBS in Grenoble; Uba1-ATP, BL14.1 at BESSY in Berlin.For the UBA6/Uba1-ATP complexes either the UBA6C625A-ATP complex was solved by molecular replacement (MR) with Phaser32 using the yeast Uba1 structure22 (PDB entry 3cmm) as a search model in a sequential domain by domain approach against a dataset belonging to space group P21221 collected at a wavelength of 0.9672\u2009\u00c5. Based on a packing analysis two copies of Uba6 were predicted to be present in the asymmetric unit. The core of Uba1 consisting of its AAD, IAD and FCCH was used as search model for the core of UBA6 and the resulting structure was refined with Refmac33 accounting for the substantial conformational changes in the FCCH. Subsequently, another round of MR searching for two copies of the SCCH domain was conducted and the resulting model was refined as before. Next, another round of MR was carried out to locate the two copies of the UFD, followed by refinement, which resulted in a model of the UBA6-ATP complex. After further refinement with Refmac and manual rebuilding with Coot34 including modeling of the bound ATP, which was clearly visible in the electron density maps, phases were improved by two-fold averaging with DM. The model was extensively rebuilt and refined with Refmac and Phenix35. At this point the C2 dataset became available and, due to superior diffraction, refinement was continued and completed against this dataset. Anisotropy of the diffraction data was corrected with the Staraniso server  from Global Phasing Limited. Data collection statistics are summarized in Table\u00a01221 dataset as search model with Phaser and refined with Phenix incorporating tight ncs restraints and TLS refinement.The structure of the UBA6chim-FAT10 complex was also solved by molecular replacement with Phaser using the UBA6-ATP complex as search model after the AAD had been removed. The AAD was subsequently positioned by molecular replacement followed by extensive model building. The remaining density was first interpreted by positioning the C-terminal domain of FAT10 (PDB entry 6gf2), followed by the placement of the N-terminal domain (PDB entry 6gf1). Initial refinement employed rigid body refinement to accommodate domain reorientations. Model building was conducted with Coot and refinement with Phenix. The protein structures were analyzed using The PyMOL Molecular Graphics System, Version 2.0 Schr\u00f6dinger, LLC. The secondary structure depiction was generated using ESPript 3.036.The structure of the Uba1-ATP complex was solved by molecular replacement with Phaser using the structure of yeast Uba1 in complex with ubiquitin, omitting ubiquitin from the search model. The structure of the UBA6Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting Summary"}
+{"text": "Edwardsiella piscicida-induced enteritis is essential for global aquaculture. In the present study, we identified E. piscicida as a lethal pathogen of the big-belly seahorse  and revealed its pathogenic pattern and characteristics by updating our established bacterial enteritis model and evaluation system. Conjoint analysis of metagenomic and metabolomic data showed that 15 core virulence factors could mutually coordinate the remodeling of intestinal microorganisms and host metabolism and induce enteritis in the big-belly seahorse. Specifically, the Flagella, Type IV pili, and Lap could significantly increase the activities of the representative functional pathways of both flagella assembly and bacterial chemotaxis in the intestinal microbiota (P < 0.01) to promote pathogen motility, adherence, and invasion. Legiobactin, IraAB, and Hpt could increase ABC transporter activity (P < 0.01) to compete for host nutrition and promote self-replication. Capsule1, HP-NAP, and FarAB could help the pathogen to avoid phagocytosis. Upon entering epithelial cells and phagocytes, Bsa T3SS and Dot/Icm could significantly increase bacterial secretion system activity (P < 0.01) to promote the intracellular survival and replication of the pathogen and the subsequent invasion of the neighboring tissues. Finally, LPS3 could significantly increase lipopolysaccharide biosynthesis (P < 0.01) to release toxins and kill the host. Throughout the pathogenic process, BopD, PhoP, and BfmRS significantly activated the two-component system (P < 0.01) to coordinate with other VFs to promote deep invasion. In addition, the levels of seven key metabolic biomarkers, Taurine, L-Proline, Uridine, L-Glutamate, Glutathione, Xanthosine, and L-Malic acid, significantly decreased (P < 0.01), and they can be used for characterizing E. piscicida infection. Overall, the present study systematically revealed how a combination of virulence factors mediate E. piscicida-induced enteritis in fish for the first time, providing a theoretical reference for preventing and controlling this disease in the aquaculture of seahorses and other fishes.Uncovering the mechanism underlying the pathogenesis of  We believe that this study will help enrich our knowledge of Edwardsiella-induced enteritis and develop appropriate prevention and control strategies for fish pathogens in aquaculture.In the present study, we aimed to determine the pathogenic characteristics of 22.1Mysis, and residual feed and feces were siphoned out 2 h after each feeding session.Big-belly seahorses were maintained and treated in accordance with the guidelines of Animal Ethics Experimentation approved by the Animal Care and Use Committee of Ludong University (document number: LDU-RB20210308NXY-9). Healthy big-belly seahorses were collected from the Wendeng Seahorse Center of Ludong University, Yantai 264025, Shandong Province, China. Male and female seahorses were maintained in ponds connected to a central circulation system with mechanical and biological filtration, ultraviolet sterilization, and a protein skimmer that continuously aerates water  at Ludong University for 2 weeks before the experiments. Plastic plants were used as holdfasts. The seahorses were fed three times per day  with frozen E. piscicida (cfu/mL) via intraperitoneal (IP) injection  under the same culture conditions mentioned above, except that the circulating water was turned off. After 24 h, the seahorses were fed normally, feces were siphoned out, and seawater was supplemented to maintain normal water levels. The number of deaths was recorded daily to calculate survival rate, and the seahorses were switched to new tanks every week for 21 days. The appropriate combination for research model construction was determined according to the survival rate and pathological characteristics of the seahorses.To construct the research model, seven groups were set up  to determine the appropriate combination of seahorse size  and challenge dose of njection . In deta2.2E. piscicida-induced enteritis in big-belly seahorses were examined.Using the optimal combination of seahorse size and challenge dose, 200 big-belly seahorses  were equally separated into two groups (Con and EP groups) with 50 males and 50 females per group, and a new research model was constructed. Both growth-related and pathological parameters of the big-belly seahorses listed in the established evaluation system were recorded on days 0, 1, 5, 9, 15, and 21 as previously reported . In addiE. piscicida-induced enteritis in big-belly seahorses. To further reveal the pathogenesis of E. piscicida-induced enteritis in big-belly seahorses, 60 seahorses  were divided into two groups . After repeating the model construction steps, intestinal samples were collected at key pathogenic time points for integrated metagenomics and metabolomics analyses.The established evaluation system was updated by redefining the scoring range and supplementing the scoring system with new parameters according to our previously established principles . Disease2.3The intestine samples randomly collected from the seahorses in the Con and EP groups (n = 3) were fixed in Bouin\u2019s solution. Within 24 h, the tissues were dehydrated in an alcohol-xylene series and embedded in paraffin. The samples from different intestinal segments were cut into 8-\u03bcm-thick sections and stained with hematoxylin and eosin  .The sect2.4\u00ae Premix Ex Taq\u2122  on a Bio-Rad CFX96 Touch machine  according to a previously reported method (\u2212\u0394\u0394Ct method (Intestine samples (n = 5) randomly collected from the Con and EP groups on days 0, 1, 5, 9, 15, and 21 were used to extract total RNA using Trizol Reagent . cDNA was synthesized using the PrimeScript RT Reagent cDNA Amplification Kit with a gDNA Eraser . q-PCR analysis was performed to evaluate gene expression using a SYBRd method . The seqt method .Fifteen seahorses from each group were randomly selected, and the frequency of their gill cover movements per minute was recorded to calculate the RR .2.5To eliminate the potential sex-related differences and obtain better matching results of metagenomic and metabolomic sequencing analyses, eight intestinal samples per group, one male and one female seahorses, were randomly collected and thoroughly ground in liquid nitrogen. Half of each sample was used for metagenomic sequencing, and the other half was used for metabolomic sequencing.E. piscicida infection on the composition, diversity, structure, function, VF, and ARO of intestinal microbiota, four samples from each group were randomly selected for metagenomic sequencing, and a paired-end sequencing approach was used to obtain raw data  analysis of all eight samples from each group was used for untargeted metabolomic sequencing. Chromatographic separation was performed on a Waters UPLC Acquity I-Class PLUS  system with mass spectrometric detection using a Waters UPLC Xevo G2-XS QTOF attachment (Waters Corp.). The samples were analyzed in both positive and negative ion modes. All raw data were collected using MassLynx software  and entered into Progenesis QI  software for further analysis . Linear discriminant analysis effect size (LEfSe) was used to screen biomarkers of intestinal microbiota using the criteria linear discriminant analysis (LDA) > 3 and P < 0.05 , and \u03b2-diversity analyses were conducted to evaluate the structure of the intestinal microbiota, especially for the bacteria and their function, VFs and AROs, and metabolites at different levels by BMK Cloud platform (P < 0.05 .https://cloud.majorbio.com/page/tools/). The affiliations of VFs and AROs with bacterial species were determined using data from the non-redundant gene set construction. Potential metabolic biomarkers (PMBs) and KMBs were identified according to previously reported criteria   . The fol2.6t-test in SPSS software . Structural differences in the intestinal microbiota, function, VF levels, and AROs were determined using the PERMANOVA algorithm (http://www.biocloud.net/). Results with P < 0.05 were considered significant and those with P < 0.01 were considered highly significant.Experimental data are presented as the mean \u00b1 standard deviation and analyzed using an independent samples 33.15 cfu/mL of E. piscicida was the same as that of the Con group (100%), which is suitable for model construction. Whereas, in the other EP groups, the time to death and survival rate appeared to positively and negatively correlate with body weight and challenge concentration, respectively. After the reconstruction of the research model, typical pathological changes associated with bacterial enteritis, such as intestinal epithelial dissolution, focal bleeding, villus atrophy, separation between the lamina propria and submucosa, thickened lamina propria and muscularis mucosae, vascular distorted congestion, and a large amount of inflammatory necrosis in the muscle layer and serosal surface, were observed (5cfu/mL) were reduced, especially on day 9 (P < 0.05) , anti-inflammatory factors (IL-10 and IL-2), antimicrobial peptides , and Toll-like receptor 5 (TLR5) significantly increased on day 9 and decreased to different extents thereafter (ZO-1 were similar to those of the immune genes (P < 0.05), recovered thereafter, and remained at the level of the Con group (P < 0.05), peaked on day 9, and decreased there after until day 21 , whereas the difference between the Con and E21D groups was not significant (P > 0.05)  but not between the Con and E21D groups (P > 0.05). The Shannon and Simpson indices of \u03b1-diversity in the E9D group were significantly lower than those of the Con and E21D groups (P < 0.01), but the ACE and Chao richness indices were not significantly different among the three groups (P > 0.05)   with Chlamydia, Enterobacter, Yersinia, Pantoea, Salmonella, Xenorhabdus, Klebsiella, and Arthrobacter but negatively correlated  with Lactobacillus, Microbacterium, Enterococcus, Acinetobacter, Mycobacteroides, Flavobacterium, and Thalassococcus   and the activities of 28 positively correlated functional pathways  were significantly increased (P < 0.01), whereas the relative abundance of Lactobacillus, Enterococcus, Microbacterium, Acinetobacter, Mycobacteroides, Aeromonas, and Burkholderia and the activities of 11 positively correlated functional pathways  were significantly decreased (P < 0.05) in the E9D group. Notably, the activities of eight functional pathways, including bacterial chemotaxis, flagellar assembly, lipopolysaccharide biosynthesis, phosphotransferase system, bacterial secretion system, QS, ABC transporters, and TCS, increased significantly (P < 0.01) in the E9D group  (P < 0.01)  Table S6P < 0.05), including 126 VFs that were extremely significantly increased (P < 0.01)  (P < 0.05)  and negatively  correlated with 28 significantly increased and 11 significantly decreased (P < 0.05) intestinal microbiota functions (P < 0.05) (P < 0.01) (P < 0.05) in the E9D group were identified  Table S63.5P < 0.05; 623 upregulated and 1145 downregulated) were identified  were identified  (P < 0.05) , including15 were core VFs (CVFs) and the other 19 of the top 50 VFs in abundance. As shown in E. piscicida infection. For instance, in the E9D group, the relative abundance of VFs associated with motility, adhesion, and invasion of pathogens significantly and simultaneously increased with the functional activity of flagella assembly and bacterial chemotaxis (P < 0.01). The relative abundance of the effector delivery system-related VFs significantly and simultaneously increased with the functional activity of the bacterial secretion system (P < 0.01). The relative abundance of the iron uptake system-related VFs increased with the functional activity of ABC transporters of the intestinal microbiota (P < 0.01), whereas the levels of L-Proline, Taurine, Glutathione, Uridine, Xanthosine, and L-Glutamate significantly decreased (P < 0.05). Similarly, the relative abundance of toxin-related VFs significantly and simultaneously increased with the functional activity of LPS biosynthesis. The relative abundance of the regulation-related VFs significantly and simultaneously increased with the functional activity of TCS of the intestinal microbiota (P < 0.01), whereas the levels of KMBs L-Malic acid and L-Glutamate significantly decreased (P < 0.05) (P < 0.05). The content of L-Malic acid and L-Glutamate related to TCS significantly decreased after E. piscicida infection (P < 0.05), as did the levels of L-Proline, Taurine, Glutathione, Uridine, Xanthosine, and L-Glutamate in relation to ABC transporters (P < 0.05)  5C; 7A4E. piscicida infection inhibited growth and induced typical pathological features of enteritis in big-belly seahorses, similar to our previous findings on E. tarda-induced enteritis in lined seahorses , largemouth bronze gudgeon (Coreius guichenoti), and pearl gentian grouper (Epinephelus lanceolatus \u2642 \u00d7 E. fuscoguttatus \u2640)  and the activities of their positively correlated 28 functional pathways, but decreased the abundance of the probiotic microbiota  and opportunistic pathogens . This suggests that E. piscicida infection may enhance the competition for nutrients against autochonous microbiota and certain pathogenic bacteria by increasing the activities of functional pathways such as chemotaxis and QS, induce dysbiosis of the intestinal microbiota, and finally cause enteritis.Systematic studies exploring relevant omics datasets will enable scientist to describe the complexity and characteristics of interactions in the host-pathogen network, and identify new targets or biomarkers for pathogenic infections , 42. In tatus \u2640) , 26, 43.tatus \u2640) . Bacteritatus \u2640) . Flagelltatus \u2640) . The bacntestine , inducinntestine . The phontestine . ABC trantestine , 51. TCSntestine . QS is aumophila . In the E. piscicida infection for the first time, of which 15 CVFs may play a key role in pathogenesis. Referring on previously reported VFs of other bacterial pathogens, E. piscicida may rely on Flagella, Type IV pili, and Lap for adhesion and infection   . The ABCambicus) . TCS regambicus) , convertambicus) . Pyrimidambicus) . In thiseostasis , 76 and tabolism  and immutabolism , 79. ColE. piscicida infection in big-belly seahorses. Significant upregulation of KVFs associated with motility, adherence, and invasion may allow E. piscicida to adhere, bind to host intestinal epithelial cells, and invade or be internalized into host tissues and cells by increasing the activities of bacterial chemotaxis and flagellar assembly of the intestinal microbiota  can be found below: The animal study was reviewed and approved by the Animal Care and Use Committee of Ludong University (document number: LDU-RB20210308NXY-9).LZ and FW, conceptualization, methodology, investigation, formal analysis, data curation, visualization, resources, writing - original draft, writing- review and editing. LJ, investigation, formal analysis, data curation, visualization, and resources. HY and LG, visualization, data curation, and investigation. YT and XS, investigation and formal analysis. XZ, investigation. CL, sample collection and investigation. ZM, visualization. YX, resources. QL, writing-review and editing and conceptualization. KW, supervision, validation, funding acquisition, writing-review & editing, and conceptualization. All authors contributed to the preparation of article and approved the submitted version."}
+{"text": "Epigenetic status\u2013altering mutations in chromatin-modifying enzymes are a feature of human diseases, including many cancers. However, the functional outcomes and cellular dependencies arising from these mutations remain unresolved. In this study, we investigated cellular dependencies, or vulnerabilities, that arise when enhancer function is compromised by loss of the frequently mutated COMPASS family members MLL3 and MLL4. CRISPR dropout screens in MLL3/4-depleted mouse embryonic stem cells (mESCs) revealed synthetic lethality upon suppression of purine and pyrimidine nucleotide synthesis pathways. Consistently, we observed a shift in metabolic activity toward increased purine synthesis in MLL3/4-KO mESCs. These cells also exhibited enhanced sensitivity to the purine synthesis inhibitor lometrexol, which induced a unique gene expression signature. RNA-Seq identified the top MLL3/4 target genes coinciding with suppression of purine metabolism, and tandem mass tag proteomic profiling further confirmed upregulation of purine synthesis in MLL3/4-KO cells. Mechanistically, we demonstrated that compensation by MLL1/COMPASS was underlying these effects. Finally, we demonstrated that tumors with MLL3 and/or MLL4 mutations were highly sensitive to lometrexol in vitro and in vivo, both in culture and in animal models of cancer. Our results depicted a targetable metabolic dependency arising from epigenetic factor deficiency, providing molecular insight to inform therapy for cancers with epigenetic alterations secondary to MLL3/4 COMPASS dysfunction.  The COMplex of Proteins Associated with Set1 (COMPASS) family members MLL3 and MLL4 are the major H3K4 histone lysine mono-methyltransferases functioning at enhancers . FunctioKMT2C and KMT2D, respectively) and their cofactor, the H3K27 demethylase UTX (KDM6A); the prevalence of mutations affecting these factors indicates their broad roles as tumor suppressors  has identified a panoply of somatic mutations affecting the chromatin-modifying enzyme factors that regulate enhancers across a wide range of human tumor types. The most frequently mutated factors include the H3K4 mono-methyltransferases MLL3 and MLL4  and exons 16\u201322 of KMT2D (MLL4) (https://doi.org/10.1172/JCI169993DS1). Successful knockout of MLL3 and MLL4 was confirmed by Western blot analysis using antibodies against N-terminal and mid-protein regions of MLL3, N- and C-terminal regions of MLL4, the pan-COMPASS subunit RBBP5, and the NCOA6, UTX and PTIP subunits unique to the MLL3/4 branch of COMPASS   suggest that KO cells are preferentially more sensitive to the depletion of these genes by sgRNAs  . Similar day 21) . To vali day 21) . The nory sgRNAs . OverallDue to the emergent cellular dependence on nucleotide synthesis pathway genes we observed in MLL3/4-KO cells, we performed liquid-chromatography (LC) tandem mass spectrometry-based (MS/MS-based) steady-state metabolite profiling to globally assess the metabolome of WT and MLL3/4-KO cells . Among t15N-(amide)-glutamine and 13C-hypoxanthine. The 15N-glutamine tracing study revealed that MLL3/4-KO cells exhibit significantly increased flux through de novo purine but not pyrimidine synthesis  analysis demonstrated that the vast majority of variance in gene expression was explained by PC1 (94%), which effectively separated the samples by genotype (We hypothesized that MLL3/4-KO cells would have enhanced sensitivity to purine synthesis inhibition due to their increased use of and dependence on purine nucleotide synthesis pathways. WT and MLL3/4-KO cells were treated with lometrexol (LTX), a de novo purine synthesis inhibitor that specifically targets glycinamide ribonucleotide formyltransferase (GART). The purine salvage pathway nucleobase hypoxanthine (HPX) was added to bypass the LTX-inhibited de novo purine synthesis pathway . We obsegenotype . HPX alogenotype . The expgenotype . The difgenotype . Pathwaygenotype . When angenotype . In contgenotype . Examinigenotype , which wgenotype . InteresTo investigate whether the differential purine biosynthesis inhibition sensitivity in the presence or absence of MLL3/4 is due to the loss of catalytic or catalysis-independent activity, we compared the effects of LTX treatment in WT, MLL3/4 \u0394SET , and MLLPadj< 0.01), it is difficult to dissect which of these significant gene/protein signature changes lead to the metabolic dependency shift and other cellular defects seen in MLL3/4-KO cells. Therefore, as a complement to the RNA-Seq approach that we used to identify transcriptomic changes, we also used a tandem mass tag (TMT) approach to identify proteomic changes between WT and MLL3/4-KO cells. In summary, we identified 7,379 total collapsed proteins, 7,096 quantified proteins, and 57,479 quantified peptides. PC analysis demonstrated the separation of genotype by PC1 using all 7,096 proteins identified in TMT (P < 0.01) identified 343 proteins upregulated and 384 proteins downregulated in MLL3/4-KO cells (Kmt2d), NCOA6, UTX (Kdm6a), and PTIP (Paxip1)  . Pathway(Paxip1) , terms c(Paxip1) . Among t(Paxip1) . The sub(Paxip1) , in acco(Paxip1) . It is i(Paxip1) . Further(Paxip1) , suggestRnf213 and Dppa3, due to the unavailability of efficient shRNAs)  . Ncoa6 w shRNAs) . First,  shRNAs) . Interes targets . A signi COMPASS . Then, w COMPASS . Individgene set . A numbeNqo1 gene locus in MLL3/4-KO versus WT cells, while other marks remained the same or were diminished   and epigminished . Nqo1 anKO cells , H and IWe also considered the intriguing possibility that metabolic reprogramming in MLL3/4-deficient cells might be the consequence of a higher order chromatin structural change due to MLL3/4 loss. To investigate this potential mechanism, we performed Hi-C in WT and MLL3/4-KO mESCs to explore the relationship between epigenetic alterations and chromatin. The loop number in MLL3/4 KO, at 13,695, was higher than in WT, which was 10,118, and MLL3/4 KO had more open chromatin  than WT cells . To quanMLL4 is highly mutated in a variety of hematological malignancies and solid tumors. Some of the loss-of-function mutations are believed to function as driver mutations, conferring competitive advantages for clonal expansion . Given oNext, we sought to examine whether colorectal cancer cells bearing MLL4 mutations exhibited elevated sensitivity to LTX treatment. Along with 8 colorectal cancer cell lines were selected for comparison, including MLL4 WT  and MLL4 mutant  cell lines . It is w15N-glutamine tracing in MLL4 WT (SW1417 and Caco2) and MLL4 truncation mutation (RKO and HCT116) colorectal cancer cells and demonstrated that mutant cells exhibited increased flux through de novo purine synthesis relative to their WT counterparts . Mice were euthanized when the tumor size reached 1,000 mm3. LTX treatment significantly inhibited the s.c. tumor growth  or vehicle control (DMSO) i.p. when tumor size reached 100 mmOur study combined a CRISPR dropout screen with metabolomics, transcriptomics, and proteomics approaches, presenting evidence of direct link between epigenetic alteration and metabolic dependency shift . We demoKMT2C) and MLL4 (KMT2D) are frequently found in a broad spectrum of cancers, and some are thought to behave as oncogenic drivers  inhibitors for MLL4-mutant cancer  and LIF as described previously , 10 ng/mL choleratoxin (Sigma-Aldrich), 0.005 mg/mL insulin (Lonza), 0.005 mg/mL transferrin (Sigma-Aldrich), 100 ng/mL hydrocortisone (Sigma-Aldrich), 20 ng/mL hEGF (Sigma-Aldrich), and 10% FBS (Sigma-Aldrich). Caco2 and HT55 were grown in DMEM (Thermo Fisher Scientific) with 20% FBS. SW1417, SW480, HCT116 and RKO were grown in DMEM with 10% FBS. DLD1 were grown in RPMI-1640 (Thermo Fisher Scientific) with 10% FBSeviously . The lenFor CRISPR knockout of MLL3 and MLL4, mESCs were electroporated with plasmids containing sgRNAs in the px459 backbone, selected with puromycin  for 48 hours, and grown in 2i/LIF medium without puromycin until the cell clones were ready to be picked. gRNA sequences used in this study are listed as follows: MLL4 KO, TGGGGATGGACAGCCCGACG (left), GGTATAATCAATCCGTCCTT (right); MLL3 KO, CATATGCTGTAGGAACCGTA (left), TTGGGACAGGTACGAAAATA (right).LTX , WDR5-0103 , OICR-9429, MI-463 , MI-503 , MTX , SHIN1 , Piericidin A , Phenformin , thymidine , inosine , and HTX  were used with concentrations and durations specified for different experiments.The following antibodies are used in this study: anti-H3K4me1 , anti-H3K4me2 (generated in house), anti-H3K4me3 , anti-H3K27ac , H3K27me3 , anti-MLL3 NT (generated in house), anti-MLL3 MT (generated in house), anti-MLL4 NT (generated in house), anti-MLL4 CT (generated in house), anti-MLL2 (generated in house), anti-SET1A (generated in house), anti-Menin , anti-MLL1C , anti-RBBP5 , anti-NCOA6 , anti-UTX , anti-PTIP , ASH2L , H3 Ser10-p (CST 53348), CDT1 , Cyclin B1 , Geminin , Cyclin E1 , Cyclin A2 , p-cdc2 , PARP  Caspase3 , anti-GART , anti-PAICS , Hsp90 , and anti-\u03b2-tubulin . Western blot analysis was performed as previously described  for 15 or 21 days before harvesting. Genomic DNA was extracted, and the library was constructed. After sequencing the library, data analyses were performed with MAGeCK RRA algorithm or MLE module  . A totalE module . Data viE module .RNA-Seq and ChIP-Seq samples were sequenced with Illumina NovaSeq technology, and output data were processed with bcl2fastq. Sequence quality was assessed using FastQC v 0.11.2 , and quaP values less than 0.01 were differentially expressed. Batch effects were removed using ComBat-Seq on the raw read counts  or 100 \u03bcM 13C-HTX  was added 1 hour before metabolite collection. To collect metabolites, cells were fixed in 80% HPLC-grade methanol in LC-MS water and kept at \u201380\u00b0C for 15 minutes. Next, cells were scraped off the plates on dry ice and transferred to 10 mL conical tubes. Scraped cells were centrifuged, and supernatant (extract) and a second methanol wash were pooled. Extracts were completely dried with Nitrogen gas N-EVAP. Cell pellets were resuspended in 8M urea and a Bradford assay was used to quantify protein concentration for normalization purposes.The metabolomics study was performed by BIDMC Mass Spectrometry Facility at Beth Israel Deaconess Medical Center. For global steady state metabolomics, cells were grown to approximately 80% confluency and washed with respective medium. Fresh medium was added 2 hours before metabolite collection. For tracing studies, cells were washed with metabolite-free medium and medium containing 4 mM TMT study was performed by the Thermo Fisher Scientific Center for Multiplexed Proteomics at Harvard Medical School. Samples were prepared in 0.5 mL lysis buffer . Protein quantification was performed using the micro-BCA assay from Pierce. After protein quantification, lysates were immediately reduced with TCEP and alkylated with iodoacetamide. Approximately 300\u03bcg of each sample was precipitated using methanol/chloroform. Digestion was performed using LysC and trypsin. Approximately 100 \u03bcg of each sample was labeled with 6 TMT10-plex reagents. A small aliquot of each sample was combined and analyzed by LC-MS2 to evaluate labeling efficiency and mixing ratios. Peptide N terminal ends were labeled >99% by TMT reagents. Samples were combined in full, desalted, and fractionated by HPLC bRP. The sample was fractionated and divided into 2 sets: Set 1 consisted of 12 fractions, each fraction in this set was made up of the orange numbers for an entire column, e.g., 1, 25, 49, 73; Set 2 consisted of 12 fractions from the black numbers for an entire column. One complete set (12 fractions) from HPRP was analyzed on an OrbitrapEclipse mass spectrometer using a real time search method. Peptides were separated using a gradient from 5% to 30% acetonitrile in 0.125% formic acid for over 90 minutes. Peptides were detected (MS1) and quantified (MS3) in the Orbitrap. Peptides were sequenced (MS2) in the ion trap. Peptides were selected for sequencing in MS1 scans. MS2 spectra were used for identifying peptides, and MS3 spectra were used for quantification via TMT reporter ions. mMS2 spectra were searched using the SEQUEST algorithm against a Uniprotcomposite database derived from the mouse proteome, known contaminants, and reverse compliment sequences. Peptide spectral matches were filtered to a 1% FDR using the target-decoy strategy combined with linear discriminant analysis. Proteins were quantified only from peptides with a summed SN threshold of \u2265100. Quantified protein and peptide numbers did not include contaminant or reverse sequence identifications.6 cells, in 0.4 mL of cell culture media with matrigel (BD Bioscience) at 1:1 ratio, were injected in the right flank of mice under anesthetization by isoflurane. Mice were randomly assigned to vehicle  and LTX treatment  groups when the size of tumor reached at 100 mm3 (day 6 after implantation). The tumor sizes were measured on alternate days and the mice were euthanized when the tumor size reached 1,000 mm3. LTX used in the animal studies was custom synthesized by Enamine Ltd.Six-week-old female athymic mice  were purchased from Envigo and housed under aseptic conditions. HT55 or HCT116 cells were implanted into the flank of athymic mice as previously described . Brieflyt test was applied for statistical analysis between 2 groups. The survival information for the mice was summarized by the Kaplan-Meier plots, and the difference was analyzed by the log-rank (Mantel-Cox) test. The statistical analysis was performed using GraphPad Prism 9. P values of less than 0.05 were considered significant.All data were obtained from at least 3 replicates and were expressed as mean \u00b1 SD, as indicated in the figure legends. A 2-tailed Student\u2019s All animal procedures were approved by the IACUC at Northwestern University and performed in accordance with the IACUC guidelines.Next-generation sequencing data sets have been deposited at Gene Expression Omnibus (GEO) with accession number GSE200120. All data are available in the main text or the materials.ZZ, KC, and AS conceptualized the project. ZZ, ETB, KC, FY, NSC, RH, IBS, and AS developed the methodology. ZZ, KC, JW, CNP, JMZ, YI, QW, and KJ performed the investigations. ZZ, QW, RH, and IBS were responsible for visualization. AS acquired funding for the project and supervised the project. ZZ and AS wrote the original draft of the manuscript. ZZ, SRG, NSC, RH, IBS, and AS reviewed and edited the manuscript."}
+{"text": "Incorporating 0.05\u00a0M KPF6 into the 1\u00a0M KFSI in DME electrolyte solution decreases the number of solvent molecules surrounding the K ion and simultaneously leads to facile K+ de\u2010solvation. During the electrodeposition process, these unique features can lower the exchange current density between the electrolyte and K\u2010metal anode, thereby improving the uniformity of K electrodeposition, as well as potentially suppressing dendritic growth. Even under a high current density of 4\u00a0mA cm\u22122, the K\u2010metal anode in 0.05\u00a0M KPF6\u2010containing electrolyte ensures high areal capacity and an unprecedented lifespan with stable Coulombic efficiency in both symmetrical half\u2010cells and full\u2010cells employing a sulfurized polyacrylonitrile cathode.Batteries using potassium metal  anode are considered a new type of low\u2010cost and high\u2010energy storage device. However, the thermodynamic instability of the K\u2010metal anode in organic electrolyte solutions causes uncontrolled dendritic growth and parasitic reactions, leading to rapid capacity loss and low Coulombic efficiency of K\u2010metal batteries. Herein, an advanced electrolyte comprising 1\u00a0M potassium bis(fluorosulfonyl)imide (KFSI) + 0.05\u00a0M potassium hexafluorophosphate (KPF 6 salt to 1\u00a0M KFSI dissolved in a DME electrolyte regulates the solvation sheath structure of K ions. This strategy greatly stabilizes the K\u2010metal anode by suppressing the dendritic growth of K and minimizing electrolyte depletion in K\u2010metal batteries, eventually extending the lifetime of K\u2010metal full batteries.The addition of 0.05\u00a0M KPF In this regard, there is an ongoing search for sustainable energy substitutes that can guarantee economic growth and further development on a long\u2010term basis. To date, lithium\u2010ion batteries (LIB) are the dominant technology and have been located at the center of the endeavor to address the aforementioned issues owing to their high\u2212energy density and satisfactory running time for various electronic applications. However, the shortage of lithium and other valuable elements could threaten the energy supply because the most directly available resources are geographically concentrated at limited sites. Hence, beyond LIBs, other technologies are attracting extensive attention, particularly alkali\u2010metal batteries, given their high theoretical capacity and the low redox potential of alkali\u2010metal anodes.Natural energy resources face radical depletion and environmental pollution is continuously increasing. These matters are the important issues of our time, and the world is at a defining moment.4, 5 Thus, KMBs have been extensively investigated as a complementary technology to commercial LIBs in the future. Metallic potassium as an anode provides a high specific capacity of 687 mAh g\u22121, which is almost 2.5 times that of the graphite anode with potassium (279 mAh g\u22121 based on KC8), and generally surpasses the capacity that can be achieved with most available anodes in rechargeable potassium batteries. Owing to the extremely high chemical reactivity of K\u2010metal, however, its successful utilization in KMBs has been hampered by critical issues. Most importantly, dendrite growth is a ubiquitous key challenge for all alkali\u2013metal anodes, appearing to be especially severe with K\u2010metal due to its higher reactivity. Generally, K dendrites have a porous structure with a mossy or needle\u2010shaped morphology, which can expose a large surface area of fresh K\u2010metal, leading to excessive electrochemical reaction with the electrolyte component and a continuous breakdown/re\u2010construction of the solid electrolyte interphase (SEI) during cycling. Further, fast\u2010charging rates (high current densities) certainly accelerate K dendrite growth. The resulting K dendrites produce isolated electrochemically inactive \u201cdead K\u201d and can penetrate the separator, eventually leading to earlier cell failure, and can incur further safety hazards.Rechargeable potassium metal batteries (KMBs) are rapidly gaining scientific attention based on the inherent superiorities of K\u2010metal anodes, such as low standard electric potential ([Li: \u22123.04\u00a0V vs Na: \u22122.71\u00a0V vs K: \u22122.93\u00a0V] vs SHE) and the high natural abundance of potassium resources (Li: 0.0017\u00a0wt.% vs Na: 2.36\u00a0wt.% vs K: 2.09\u00a0wt.%).14 Thu and the use of a 3D host structure and/or artificial SEI are being initially explored. A retrospective look at studies on Li\u2010metal and/or Na\u2010metal undoubtedly shows that developing well\u2010engineered electrolytes with regulated solvation chemistry via the smart combination of salts/solvents/additives is the most effective and critical method of stabilizing K\u2010metal anodes. This is because the solvation sheath of the potassium ions can be modulated to enable dendrite\u2010free K deposition and improve the stability of the SEI layer without complicated and time\u2010consuming procedures. In previous studies on K\u2010metal anodes, either potassium hexafluorophosphate (KPF6) or potassium bis(fluorosulfonyl)imide (KFSI) was used as the main electrolyte salt in carbonate\u2010ester or ether solvents. Those studies found that the use of KFSI as a salt is a better choice for cleverly designing an effective electrolyte for reversible K plating/stripping via electrochemistry because the electrolyte can form a robust fluorine\u2010rich SEI layer and afford dense K deposition on K\u2010metal surface. Impressive improvements in the stability of K\u2010metal anodes using KFSI\u2010based electrolytes have been achieved; however, the capacity loading and the fast\u2010charging rates are generally unsatisfactory (\u2264 1 mAh cm\u22122 and/or \u2264 1\u00a0mA cm\u22122). Even worse, current KMBs have complex battery components and require a large amount of electrolyte solution due to limitations in the current research technology. Namely, the achievements are still far below those required for high\u2010energy and high\u2010power battery applications. In order to further enhance the applicability of KMBs under practical conditions (high capacity loading with fast\u2010charging rate) and achieve cycling stability of the K\u2010metal anode, hence, it is no doubt that the development of advanced electrolyte solutions is vital at the current stage.To address the persistent problems facing K\u2010metal anodes, some strategies such as electrolyte modulation28 and6 to 1\u00a0M KFSI dissolved in 1,2\u2010dimethoxyethane (DME) improved the uniformity of K electrodeposition and simultaneously enhanced the mechanical rigidity of the SEI layer, thereby significantly suppressing dendritic growth on K\u2010metal anode surface. The modified electrolyte employing 0.05\u00a0M KPF6 enables long cycling stability of the K\u2010metal anode in the K | K symmetrical cells as well as ensures an unprecedented lifespan and stable Coulombic efficiency of a high\u2010energy K\u2013metal full battery with sulfurized polyacrylonitrile cathode.In this study, we report an important discovery for stabilizing the K\u2010metal anode by regulating the electrolyte solution. The addition of an optimal amount of 0.05\u00a0M KPF22.1 In this study, we designed an advanced electrolyte by modulating the baseline electrolyte with KPF6 salt. In order to confirm the fundamental properties of the modified electrolyte, density functional theory (DFT) calculations and Raman spectroscopy analysis were initially conducted. First, the molecular energy levels such as lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) energy levels of the solvent and salts for the modified electrolyte are displayed in Figure\u00a06 and DME, suggesting that KFSI salt readily decomposed during the electrochemical reduction (plating) process and plays a key role in determining the chemical components of the SEI layer. Corresponding to the lower HOMO level of KPF6 than KFSI salt, we also confirmed that the addition of KPF6 in the electrolyte can improve the high voltage stability of the baseline electrolyte from linear sweep voltammetry analysis  has a lower solvation than that of KFSI\u2013DME (\u22120.53\u00a0eV); this implies that the addition of 0.05\u00a0M KPF6 in the baseline electrolyte can facilitate the K+ desolvation and diffusion kinetics during the plating process. Raman spectroscopy analysis showed that the incorporation of 0.05\u00a0M KPF6 into the baseline electrolyte changed the K+ solvation structure  were higher than that for the baseline electrolyte. This demonstrates that the addition of 0.05\u00a0M KPF6 lowers the proportion of free solvent in the baseline electrolyte. In addition, the statistical number of the coordinated solvents for baseline and modified electrolytes were precisely analyzed using molecular dynamics (MD) simulation. We first optimized the molecular structure . The g(r) is the probability of finding a particle at a distance r from another tagged particle. Therefore, we can know how much DME solvent is combined around K+ through the cumulative number (red line) corresponding to each radius value, which has a similar meaning to the coordination number. For 1\u00a0M KFSI in DME electrolyte  are 1.7 and 11.7 at second solvation shell (2.16\u20133.6 \u00c5), meanwhile, the coordination number of K+ with FSI\u2212 at first solvation shell are 1.4 and 9.2 at second solvation shell in 1\u00a0M KFSI in DME with the addition of 0.05\u00a0M KPF6  are 0.019 and 0.042 at the second solvation shell (4.64\u20136.76 \u00c5)  Figure\u00a0. For coo8 Figure\u00a0, otherwir Figure\u00a0. A combi2.26), initially, X\u2010ray photoelectron spectroscopy (XPS) analysis was carried out of the K\u2010metal anode after 5 cycles in asymmetric K | Cu cells  and 531.5\u00a0eV (C\u2013O\u2013C) are associated with the decomposition of DME solvent and that at 530\u00a0eV is derived from the reduction of the KFSI salt , was also observed in the F 1s spectrum of the baseline electrolyte due to some extent of salt/solvent decomposition. The addition of 0.05\u00a0M KPF6 to the baseline electrolyte enhanced the formation of a KF\u2010rich SEI layer, which provides mechanical strength and thus helps to suppress the dendritic growth of K and large volume changes of the K\u2010metal anode during multiple plating/stripping processes. The XPS results for the SEI layers formed with different electrolytes were corroborated by Raman spectroscopy. To further verify the thickness and organic/inorganic components of the SEI layer, therefore, HR\u2010TEM (high\u2010resolution transmission electron microscopy) analysis of the SEI layer was conducted at a low temperature of \u2212110\u00a0\u00b0C. For HR\u2010TEM analysis, all samples were carefully prepared using an asymmetric cell comprising of K\u2010metal as anode and free\u2010standing carbon\u2010nanotubes film as K+ host (K/CNT). In K/CNT cells, K\u2010metal was deposited and stripped on CNT film over 20 cycles at a current density of 1\u00a0mA cm\u22122 and capacity loading of 4 mAh cm\u22122  analysis for HR\u2010TEM data for the collected SEI on the CNT film and the results are displayed in Figure 6 in the baseline electrolyte can mitigate solvent and/or salt decomposition and further enhance the stability of the SEI layer on the K\u2010metal surface.The C 1s spectrum was deconvoluted into three peaks with binding energies of 284.8 (C\u2013C), 286.4 (C\u2013O\u2013C), and/or 287.8\u00a0eV (C=O), which are attributed to the reduction of the solvent Figure\u00a0.55]55[5t Figure .[37]n Figure\u00a0.[56]2.36\u2010containing electrolytes were assembled. The deposition of K\u2013metal on the Cu\u2013foil at current densities of 1.0 and 4\u00a0mA cm\u22122 was investigated after the disassembly of the cells. The SEM images in Figure\u00a0\u22122, the 0.05\u00a0M KPF6\u2010containing electrolyte produced a uniform K\u2010deposit film compared to the baseline electrolyte. Cross\u2010sectional samples of the deposited K were prepared using FIB. The cross\u2010sectional SEM images were precisely compared, showing that the 0.05\u00a0M KPF6\u2010containing electrolyte , potassium was uniformly deposited on the entire Cu\u2010foil in the 0.05\u00a0M KPF6\u2010containing electrolyte  analysis with a focused ion beam (FIB), where K | Cu asymmetric cells employing the baseline and 0.05\u00a0M KPFe Figure\u00a0 led to ae Figure\u00a0. This tre Figure\u00a0. In conte Figure\u00a0. As a re6 in the baseline electrolyte through atomic force microscopy (AFM) analysis. AFM is advantageous in this aspect because of its high\u2010resolution imaging as well as force probing capabilities along the surface normal on metallic anode. First, topographic AFM images and corresponding thickness histogram of deposited K in baseline and 0.05\u00a0M KPF6\u2010containing electrolyte were compared in Figure\u00a06\u2010containing electrolyte produced the uniform K\u2013deposit morphologies with an average thickness of \u2248300\u2013400\u00a0nm , adhesion distance, adhesion force, and the curvature radius of the probe (\u224810\u00a0nm), respectively, and the maxd and maxF are the point of maximal adhesion distance and the adhesion force for retract curve. The SEI layer with 0.05\u00a0M KPF6\u2010containing electrolyte showed a higher Young's modulus (7.613\u00a0GPa) than with baseline electrolyte (6.708\u00a0GPa). This clearly indicated that the SEI layer induced by the 0.05\u00a0M KPF6\u2010containing electrolyte contained a relatively larger fraction of KF compound compared to the baseline electrolyte. Such AFM results are in good agreement with the combination study of DFT, MD, Raman, XPS, and TEM analysis that the addition of 0.05\u00a0M KPF6 in the baseline electrolyte provides effective functionalities to suppress the dendritic growth of K.The Hertz model that is applicable in the case of small tips and stiff samples with a small adhesion is preferably adopted for calculating Young's modulus of the SEI according to the following equation.6 to the baseline electrolyte effectively suppressed the growth of potassium dendrites. Operando OM observations were performed under dynamic conditions using the customized electrochemical cell  analysis provided solid evidence that the addition of 0.05\u00a0M KPF+ to K, and thus, critically affects the electrodeposition of potassium metal with different electrolytes. As shown in Figure 6 in DME is 0.77 \u00b5A cm\u22122, and that employing the electrolyte comprising 1\u00a0M KFSI in DME is 1.14 \u00b5A cm\u22122. Based on these experimental results, phase\u2010field modeling coupled with cellular automaton was used to probe the electrodeposition of potassium metal with different electrolytes. The reaction describing the deposition of potassium metal can be expressed as.Exchange current density is a key parameter for describing the intrinsic kinetics of electron transfer at the electrode in the reduction of Ktrolytes.65 As J, j0, and \u03b7 are the Faradic current density, exchange current density, and overpotential, respectively. F is the Faradic constant of 96\u202f485 C mol\u22121. R is the molar gas constant of 8.314 J mol\u22121 K\u22121, and T is the temperature of 25 \u00b0C. Moreover, \u03b1 and \u03b2 are the anodic and cathodic charge\u2010transfer coefficients, where the condition \u03b1 + \u03b2 = 1 holds for a single\u2010electron transfer reaction.Calculations for the above electrochemical reaction were performed by applying the Butler\u2013Volmer equation to describe the relationship between the overpotential and local current density, which are bridged by the exchange current density:Figure\u00a06 in DME, with a dense morphology having no obvious internal holes , and a large fraction of electrolyte (flood condition) was employed because of the serious uncontrollable dendrite problems  measurement  compared to the baseline electrolyte (1.717 \u00d7\u00a010\u22123 S cm\u22121); this could lead to uniform K+ flux distribution on K\u2010metal surface, consequentially suppressing the K dendrite growth. The importance of the solvation structure was confirmed by studying K plating/stripping in asymmetric K | Cu cells. Potassium metal with a capacity of 2 mAh cm\u22122 was plated on Cu\u2010foil at 2\u00a0mA cm\u22122 and the plated K was stripped at 1.0\u00a0V during 50 cycles  in the voltage profile. This is because once the dendrite is formed during the plating process, the SEI layer should be broken and this re\u2010exposes the fresh K\u2010metal surface to the electrolyte, and the SEI forms again, accelerating electrolyte depletion. Finally, these side reaction chains result in increased thickness of the SEI upon repeated plating/stripping and thus slows K ion diffusion. In contrast, the modified electrolyte with 0.05\u00a0M KPF6 exhibited very stable plating/stripping reactions with small voltage polarization (\u0394V= 0.287\u00a0V) during 50 cycles  is 50. The average CEs for the baseline electrolyte and 0.05\u00a0M KPF6\u2010containing electrolyte were 97.2% and 99.3%, respectively. This difference indicates that the addition of 0.05\u00a0M KPF6 to the baseline electrolyte improves the K plating/stripping reaction kinetics with minimal loss of potassium during cycling. To understand the effect of 0.05\u00a0M KPF6 in the modified electrolyte on the cycling behavior of the K | Cu asymmetric cell, the cycled K\u2010metal anodes and separator collected from the asymmetric cells after 20 cycles (for the baseline electrolyte) and 50 cycles (for the 0.05\u00a0M KPF6\u2010containing electrolyte) were investigated. As seen in the top\u2010view and cross\u2010sectional SEM images . The K | K symmetric cell employing the baseline electrolyte showed unstable plating/stripping behavior, eventually failing after 210\u00a0h , the lifetime of the K | K symmetric cells employing the 0.05\u00a0M KPF6\u2010containing electrolyte was extended to over 600\u00a0h , the K | K cell maintained a stable polarization voltage and could be cycled over 700\u00a0h in the 0.05\u00a0M KPF6\u2010containing electrolyte . The K | K symmetric cell was initially tested under a very high current density of 4\u00a0mA cmh Figure\u00a0 and b\u20101.h Figure\u00a0. The imph Figure\u00a0. Even une Figure\u00a0. On the 6\u2010containing electrolyte, the relatively larger fraction of organic compounds is observed from the C 1s and O 1s spectra while the P\u2013F bonds are only detected in P 2p spectra due to the higher decomposition level of DME and PF6\u2212. Noted that even worse, the presence of P\u2013F bonds (reduction products of PF6\u2212) can easily produce the corrosive HF through the hydrolysis reaction with a trace amount of water in the electrolyte solution, further accelerating the cell failure. Finally, the effect of the addition of 0.05\u00a0M KPF6 to the baseline electrolyte on the rate capability of the K | K cell cells was evaluated , and thereafter, the cell operated continuously over 500\u00a0h when the current density was restored to 1\u00a0mA cm\u22122.Compared to the chemical components in the SEI layer for 0.05\u00a0M KPF2.5 The Fourier transform infrared (FTIR) spectroscopy and Raman spectroscopy data showed the typical SPAN structure comprising a covalently fixed sulfur in the PAN structure  batteries have attracted substantial interest as one of the KMBs because of the abundance of potassium and low associated costs. Herein, K\u2013S batteries were fabricated using a pyrolyzed polyacrylonitrile\u2010sulfur (SPAN) cathode. SEM imaging revealed that the SPAN particles have a spherical morphology with an average diameter of 100\u2013150\u00a0nm , was modified by adding the 0.05\u00a0M KPF46, TCI) were respectively dried under vacuum at 80 and 110 \u00b0C using a vacuum oven (Buchi). 1,2\u2013Dimethoxyethane  was purified using vacuum\u2013dried 4 \u00c5 molecular sieves over the course of 3 days. The baseline electrolyte was prepared by dissolving 1\u00a0M KFSI in DME. The baseline electrolyte was modified by adding 0.05\u00a06 and 0.1\u00a0M KPF6. In this work, the unit of mol kg\u22121 was denoted as M.Potassium bis(fluorosulfonyl)imide  and potassium hexafluorophosphate (KPFPolyacrylonitrile (PAN) (Sigma\u2013Aldrich) was homogeneously mixed with elemental sulfur (PAN:sulfur = 1:4 weight ratio). The PAN and sulfur mixture was converted to sulfurized polyacrylonitrile (SPAN) powder by calcination at 350 \u00b0C for 6\u00a0h under argon gas.\u03c0 potassium metal foil and conducted using the VMP3 (Bio\u2010Logic) instrument set for galvanostatic cycling . The rate performance also was investigated using the K | K symmetric\u2010cell assembly method mentioned above at 1, 2, 3, 5, 7, and 10\u00a0mA cm\u22122 and 1 mAh cm\u22122. To observe HR\u2010TEM images of thickness of SEI layers formed by baseline electrolyte and 0.05\u00a0M KPF6\u2010containing electrolyte, K | CNT asymmetric cells were assembled with 15\u2013\u03c0 potassium metal foil and free\u2010standing CNT film at a current density of 1\u00a0mA cm\u22122 and an areal capacity of 4 mAh cm\u22122 for 20 cycles. K | Cu asymmetric cells were fabricated with 15\u2013\u03c0 potassium metal foil and Cu\u2013foil using VMP3 (Bio\u2010Logic) at a current density of 1\u00a0mA cm\u22122 and areal capacity of 1 mAh cm\u22122. Electrochemical impedance spectroscopy (EIS) measurements were performed over the frequency range of 1\u00a0MHz to 1 mHz with a perturbation amplitude of \u00b1 10\u00a0mV using VMP3 (Bio\u2010Logic). The full cell was prepared with SPAN powder as the cathode and K\u2013metal as the anode. The cathode was prepared by casting a slurry containing the active materials, carbon black (Super P), and PAA binder (8:1:1 by weight percent) onto an Al foil\u2013coated Cu current collector. The average loading of the active materials was \u22481.8\u20132.0\u00a0mg cm\u22122. The full cell for the electrochemical measurements employed 2032 coin cells. The full cell was typically cycled in constant\u2010current mode at 4\u00a0mA cm\u22122 and 1 mAh cm\u22122 at 1.0\u20133.0\u00a0V.For the K | K symmetric\u2013cell tests with a variation of the areal capacity, current density, and amount of electrolyte, the cell was assembled with 15\u2013Esolv) were performed using the Vienna ab initio simulation (VASP) package. The generalized gradient approximation (GGA) with Perdew\u2013Burke\u2013Ernzerhof (PBE) exchange\u2010correlation functional was employed to optimize molecule geometry. The wavefunction cutoff energy was set to 400\u00a0eV with the energy and force convergence threshold criteria of 10\u22126\u00a0eV and 0.02\u00a0eV \u00c5\u22121, respectively. The molecules were added in a cubic box with a size of 15 \u00d7 15 \u00d7 15 \u00c53. For Esolv calculation, an implicit solvation model was employed and implemented in the VASPsol module developed by the Hennig group. The solvent dielectric constant was set to 7.2 for the DME. The Esolv was calculated using the following formula equation:Etot;sol and Etot;vac are the total energies of the system under vacuum and solvent environments, respectively. To visualize molecule models, the VESTA program was used. Molecular dynamics simulation was carried out by GROMACS 2020.2 software. The number of molecule 100 KFSI/900 DME and 100 KFSI/900 DME + 5 KPF6 for 1\u00a0M KFSI/DME and 1\u00a0M KFSI/DME + 0.05\u00a0M KPF6 respectively. A 7.5 \u00d7\u00a07.5 \u00d7\u00a07.5\u00a0nm cubic box was created with a total volume of 421.875\u00a0nm for each system. OPLS force field was used for all\u2010atom accurate calculation with verlet integration to accurately calculate trajectories of particles in molecular dynamics simulation as shown in equations.Theoretical studies to calculate HOMO\u2013LUMO energy level and solvation energy Esolv wereMinimization energy was carried out for 1\u00a0ns with the steepest descent minimization. 10\u00a0ns NPT ensemble followed by 10\u00a0ns NVT ensemble were carried out at a constant number of atoms in the system, pressure (NPT), volume (NVT), and temperature with Particle mesh Ewald Coulomb\u2010type for long\u2010range electrostatic calculation and cubic interpolation, V\u2010rescale temperature coupling with modified Berendsen thermostat were applied at temperature 298 K and 1 atm at isotropic periodic box condition (PBC) box vectors. Finally, 20\u00a0ns MD production was carried out to define the molecular interaction and condition during simulation.\u22121 subject to the hardness of the samples. Typically, probes with a radius of 10\u00a0nm were used for both samples. The thickness and Young's modulus of SEIs were estimated based on data collected at the topography image. High\u2010performance X\u2010ray photoelectron spectroscopy  was used to evaluate the components of the SEI layer formed on the surface of the K foil. Raman and FTIR (Spectrum 400) were also used to compare the bonding structure of SPAN before and after cycling. Operando OM was performed using customized visualization cell parts for collecting the electrochemical as well as morphological information simultaneously. Cell assembly was conducted in a glove box filled with Ar gas to prevent degradation to K\u2010metal and the electrolyte. A quartz observation window was installed to allow the transmission of light to the metal surfaces. Operando OM measurements were performed using Ar\u2010filled customized cells by employing a potentiostat , over the voltage range of 5 to \u22125\u00a0V, at a current density of 8\u00a0mA. Ultra\u2010high accuracy OM (VHX\u20137000) was used to acquire videos.The SEI layer formed on the surface of free\u2010standing CNT film after was observed by HR\u2010TEM . The SEI layer on the surface of the CNT film was prepared using a holey carbon grid. TEM samples were loaded under temperature\u2010controlled conditions to prevent electron beam contamination (\u2212110 \u00b0C). The solvation structure of the electrolytes and the bonding structure of SPAN were analyzed using a laser Raman spectrophotometer . The morphology of the deposited K used separators after cycling, and constituents of SPAN was confirmed by field\u2010emission scanning electron microscopy . AFM characterizations were conducted on a high\u2010resolution AFM (HR\u2010AFM) scanning probe microscope (probes), unless otherwise indicated, in an Ar\u2010filled glove box. Non\u2010contact mode images of the surface morphology were obtained using silicon AFM tips coated Al with a typical scanning rate of 0.5\u00a0Hz. Force curves of the samples were obtained by force spectroscopy mode using the silicon probes coated diamond with a spring constant of 7.2 N mThe authors declare no conflict of interest.Supporting InformationClick here for additional data file.Supplemental Movie 1Click here for additional data file.Supplemental Movie 2Click here for additional data file."}
+{"text": "Bacillus amyloliquefaciens bacterial species and tested if we could improve plant growth promotion by assembling consortia of highly clonal but phenotypically dissimilar mutants. While most insertion mutations were harmful, some significantly improved B. amyloliquefaciens plant growth promotion traits relative to the wild-type strain. Eight phenotypically distinct mutants were selected to test if their functioning could be improved by applying them as multifunctional consortia. We found that B. amyloliquefaciens consortium richness correlated positively with plant root colonization and protection from Ralstonia solanacearum phytopathogenic bacterium. Crucially, 8-mutant consortium consisting of phenotypically dissimilar mutants performed better than randomly assembled 8-mutant consortia, suggesting that improvements were likely driven by consortia multifunctionality instead of consortia richness. Together, our results suggest that increasing intra-species phenotypic diversity could be an effective way to improve probiotic consortium functioning and plant growth promotion in agricultural systems.While bacterial diversity is beneficial for the functioning of rhizosphere microbiomes, multi-species bioinoculants often fail to promote plant growth. One potential reason for this is that competition between different species of inoculated consortia members creates conflicts for their survival and functioning. To circumvent this, we used transposon insertion mutagenesis to increase the functional diversity within  Bacterial rhizosphere microbiome diversity has been strongly associated with beneficial effects on plant growth in both natural and agricultural environments . Such beBacillus subtilis bacterium during biofilm matrix production  . In microduction . Such ovoduction , leadingBacillus amyloliquefaciens T-5 bacterium offers a viable strategy to improve bioinoculant consortia multifunctionality. We chose B. amyloliquefaciens T-5 strain as our model species because it originates from the tomato rhizosphere , while swarming motility was positively associated with plant protection at the flowering stage . Similarly, biofilm formation had positive associations with root colonization  and plant protection during vegetative and flowering stages (at 15 and 30 dpi), respectively . Pathogen suppression was positively associated with root colonization and plant protection at 30 dpi , while biomass production was not significantly associated with either root colonization or plant protection at any time points  and plant protection  at the flowering stage (30 dpi). Together, these results suggest that while mutants with high trait values in biofilm formation, swarming motility, and pathogen suppression had positive effects on root colonization and plant protection, their relative importance varied depending on the growth stage of the plant.To test if phenotypic trait variation measured in vitro correlates with beneficial effects on plants in vivo, the rhizosphere colonization and plant protection of 47 phenotypically distinct mutants was quantified after 5, 15, and 30 dpi in a greenhouse experiment. Results showed that  30 dpi, . To esta 30 dpi, . Specifie points . As a reB. amyloliquefaciens T-5 performance could be improved by using mutants as phenotypically diverse consortia. To this end, we chose eight mutants that showed improved performance relative to the wild-type strain regarding one of the plant-beneficial traits measured in vitro  and plant protection , which were also positively correlated with the consortia average performance measured in vitro  exhibited a clear increase in plant protection compared to the wild-type strain  and plant protection  improved along with the increase in the relative performance of consortia. Together, these results suggest that in vitro and in vivo phenotyping could reliably predict the root colonization and plant protection of 8-mutant B. amyloliquefaciens consortia.To test if the positive diversity effect was potentially driven by consortium multifunctionality, we compared the performance of the \u2018optimized\u2019 8-mutant consortium no. 37;  used in B. amyloliquefaciens T-5 bacterium via mutagenesis could offer a viable strategy for improving mutant consortia multifunctionality and plant health  and DeoR  genes, which has previously been linked to antibiotic resistance and bacterial deoxyribonucleoside and deoxyribose utilization (comQ (competence protein) and hutI (imidazolonepropionase) genes and trade-offs with the other three measured traits. ComQ gene controls the production of ComX pheromone  with one mutant, while the other mutant had insertion in YsnB gene, which encodes for a putative metallophosphoesterase. While both insertions were linked to trade-offs with swarming motility and biomass production, they are not commonly associated with biofilm formation in Bacillus (nhaC (sodium-proton antiporter) and dfnG (difficidin polyketide synthesis) genes. The nhaC gene is known to act as repressor for Pho regulon in Bacillus  and R. solanacearum QL-Rs1115 was grown at 30\u00b0C in Nutrient Broth  for 24 hr.We used phytopathogenic L-Rs1115  and B. a strains  as our mzosphere  and by pzosphere . Both baB. amyloliquefaciens, we generated a random transposon insertion mutant library by using a TnYLB-1 transposon derivative, carried in the thermosensitive shuttle plasmid pMarA  was diluted 25-fold with fresh NCM supplemented with 5 mg mL\u20131 of glycine and grown at 30\u00b0C for 3 hr on a rotary shaker (170 rpm). After 1 hr incubation , cells were cooled on ice, harvested by centrifugation (8000\u00d7g for 6 min at 4\u00b0C) and washed four times with ice-cold electrotransformation buffer . Resulting pellets were resuspended in ETM buffer supplemented with 10% PEG 6000 and 1 mM MgCl2, yielding approximately 1010 cells mL\u20131. Cells were then mixed with 500 ng of plasmid DNA in an ice-cold electrotransformation cuvette (2 mm electrode gap), and after 1\u20133 min incubation at room temperature, exposed to a single electrical pulse using a MicroPulser Electroporator (Bio-Rad Laboratories) at field strength of 7.5 kV cm\u20131 for 4.5\u20136 ms. Immediately after the electrical discharge, cells were transferred into 1 mL of LB, incubated with gentle shaking at 30\u00b0C for 3\u20138 hr, and plated on LB agar containing 10 \u03bcg mL\u22121 erythromycin. Transformants were selected after 36\u201348 hr incubation at 30\u00b0C. To generate final transposon library, erythromycin-resistant colonies with plasmids were individually transferred to fresh LB and incubated overnight at 30\u00b0C, after cultures were diluted, spread on LB plates supplemented with 10 \u03bcg mL\u22121 kanamycin, and incubated for 24 hr at 46\u00b0C. As the plasmid cannot replicate at 46\u00b0C, only cells with an integrated transposons grew and could be separated. A total of 1999 transformed colonies were isolated and individually cryopreserved in 30% glycerol at \u201380\u00b0C.To increase the intra-species diversity of id pMarA , which wB. amyloliquefaciens competitiveness in the rhizosphere and their involvement in pathogen suppression . These traits were selected due to their known importance for pression . To prepSwarming motility was measured using a previous method described by Kearns  in 200 \u03bcL of \u2018recomposed exudate\u2019 medium 3, 0.4 mg L\u20131 MnSO4, 1.6 mg L\u20131 CuSO4, 2 g L\u20131 (NH4)2SO4, 0.8 g L\u20131 glucose, 1.3 g L\u20131 fructose, 0.2 g L\u20131 maltose, 0.02 g L\u20131 ribose, 5.6 g L\u20131 citrate, 1.4 g L\u20131 succinate, 0.2 g L\u20131 malate, 0.8 g L\u20131 casamino acids 600 was measured as a proxy for biomass production  on 24-well microtiter plates and incubated without agitation for 24 hr at 30\u00b0C (4)2SO4, 100 mM K2HPO4 [pH 7], 34 mM sodium citrate, and 1 mM MgSO4) for 20 min at room temperature. Plates were then rinsed with demineralized water to remove excess crystal violet, after the remaining crystal violet bound to well wall biofilms were solubilized in 200 \u03bcL of solvent . Bio\ufb01lm formation was defined as the optical density of crystal violet at OD570. Three replicates were used for each mutant.eviously  using 24 at 30\u00b0C . The groPathogen suppression via production of antibiotics was assessed as inhibition of R. solanacearum QL-Rs1115 strain using an agar overlay assay . The pathogen suppression of each mutant was defined as the area of R. solanacearum inhibition halo around the B. amyloliquefaciens colony (in mm2), which is proportional to antibiotic production  using the BLASTX and BLASTN available at the NCBI, and against the complete ancestral B. amyloliquefaciens T-5 genome sequence  were germinated on water agar plates in the dark at 28\u00b0C for 2 days, before sowing to sterile pots containing wet vermiculite . Ten-day-old tomato seedlings (at three-leaves stage) were then transplanted to seedling trays containing natural, non-sterile soil collected from a tomato field in Qilin Town, Nanjing, China  per tray. Each tray was considered as one biological replicate. Tomato plants were grown for 30 dpi with natural temperature (ranging from 25\u00b0C to 35\u00b0C) and lighting variation (around 16 hr of light and 8 hr of dark). Seedling trays were rearranged randomly every second day and regularly watered with sterile water.All selected 47 mutants and the wild-type strain were individually screened for their ability to colonize tomato rhizosphere and protect plants against infection by g, China . Plants g\u20131 soil . The R. B. amyloliquefaciens T-5 mutants was quantified individually as a change in their population densities in the tomato rhizosphere after 5, 15, and 30 days of R. solanacearum pathogen inoculation (\u2018dpi\u2019). At each sampling time point, three independent plants per inoculated mutant were randomly selected and sampled destructively by carefully uprooting the plant and gently removing the soil from the root system by shaking. After determining plant fresh weight, the root system of each plant was thoroughly ground in 5 mL of 10 mM MgSO4\u00b77H2O using a mortar, and serial dilutions of root macerates were plated on a semi-selective Bacillus medium consisting of 326 mL L\u20131 vegetable juice , 33 g L\u20131 NaCl, 0.8 g L\u20131 dextrose, 16 g L\u20131 agar  supplemented with 45 mg L\u20131 cycloheximide and 22.5 mg L\u20131 polymyxin B . The first wilting symptoms appeared 7 dpi and the proportion of diseased plants quantified at 5, 15, and 30 dpi were used in analyses. Plant protection was expressed as the relative reduction in the number of wilted plants compared to the positive control (only R. solanacearum inoculated in the absence of B. amyloliquefaciens T-5 mutants or wild-type).The root colonization and plant protection of 47 ymyxin B . This meB. amyloliquefaciens T-5 mutants could be improved by using consortia of phenotypically dissimilar mutants, a subset of eight best-performing mutants excelling at different phenotypic traits were selected (pare and M124: DeoR), high biomass production (M59: comQ and M109: hutI), high biofilm formation (M54: hutU and M143: YsnB), and slightly improved pathogen suppression (M38: nhaC and M78: dfnG) relative to the wild-type strain (600 of 0.5 (\u223c107 cells mL\u20131) was spotted on the soft agar overlay of the other mutants and direct antagonistic effect was measured as the size of the inhibition halo observed on the soft agar plates , and inhibition calculated as the relative growth of each strain in its own or other strains\u2019 supernatant compared to strains\u2019 growth in the fresh 50% LB (diluted with sterile water). Here, the reduced growth in other strains\u2019 supernatant relative to the growth in the fresh medium was deemed as inhibition between mutants. A following formula was used where OD600 sup and OD600 LB denote for mutants\u2019 growth in other mutants\u2019 supernatant or in 50% fresh LB after 24 hr:To test if the performance of selected . Specifie strain . To testr plates . For the600 of 0.5 . This design has previously been used to investigate biodiversity-ecosystem functioning relationships in plant-associated bacterial communities , washed three times with 0.85% NaCl and adjusted to OD600 of 0.5 (107 cells mL\u20131). Consortia were then assembled following the substitutive design describe earlier . Consortia traits were characterized as described previously and compared with the ancestral B. amyloliquefaciens wild-type strain. The root colonization and plant protection of B. amyloliquefaciens T-5 consortia were quantified in greenhouse experiments following previously described methods. Predicted performances were calculated following the additive model, equaling the sum of different trait values of each member divided by the richness value of the given consortium. To link the performance of single mutant with functioning of consortia, we used the relative performance measure, which included the magnitude and direction of difference relative to the wild-type strain. The difference and direction in magnitude to the wild-type strain were calculated based on the Euclidean distance and average performance using following formula:The performance of each mutant and assembled consortium was assessed in vitro in the lab by measuring traits as mono- and co-cultures following the same methods as described previously . Mutant strains were prepared individually from frozen stocks by growing overnight in liquid LB, pelleted by centrifugation  or Student\u2019s t-test (\u2018t.test\u2019 function) depending on the unequal or equal sample sizes, respectively. The temporal effects of four traits on root colonization and plant protection were assessed separately for different time points using ANOVA (\u2018aov\u2019 function). All statistical analyses were performed using R 3.5.2 . All code used in this study is available on request from corresponding authors.Data were analyzed with a combination of analysis of variance (ANOVA), PCA, linear regression models, unpaired two-sample Wilcoxon tests, and Student\u2019s t-test. Individually measured mutant traits data was normalized between 0 and 1 across the all collection using min-max normalization . In addi The work is significant because it reports that intra-species phenotypic diversity in bacteria could be an effective way to improve probiotic consortia in agriculture. Two solid conclusions emerge from this important work: (1) Communities of near-clonal bacteria can be optimized based on functional traits to promote functional diversity. (2) Consortium multifunctionality \u2013 but not richness \u2013 is key to promoting bacterial colonization in roots and to protection against a plant pathogen. The work has broad practical implications for designing probiotic consortia that promote host health beyond the plant-microbe interaction field. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Decision letter after peer review:[Editors\u2019 note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The following individual involved in the review of your submission has agreed to reveal their identity: Jacob D Palmer (Reviewer #2).Thank you for submitting the paper \"Engineering ecologically complementary rhizosphere probiotics using consortia of specialized bacterial mutants\" for consideration by Comments to the Authors:eLife. Note that while we cannot publish the current study, we remain in principle interested in the work. If you are able to seriously revise the work and respond to the concerns, we would be prepared to review the work again, although we would treat it as a new submission.We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by As you will see, although the reviewers see the work as novel and with the potential to design probiotic consortia, they have also raised a number of issues that will require new experiments, new analyses and important reformatting of the manuscript. After internal discussions with the reviewers, we remain in principle interested in the work but we felt that it is important to give you more time if you wish to thoroughly address the concerns. Particularly, performing pairwise interactions among mutants, testing random sets of 8-member consortia, and reorganizing the manuscript appears to be critical to corroborate the claims and improve clarity, respectively. Furthermore, the reviewers think that the experiments were not designed to test ecological theories regarding ecosystem functioning and stability but rather as a method to design probiotic consortia in agriculture. Many concepts mentioned in the introduction and discussion might not be relevant here and might distract rather than inform.Reviewer #1 (Recommendations for the authors):Overall, the concept/methodology is interesting and the results open novel insights towards the engineering of microbial consortia that promote disease resistance. Furthermore, the statistical analyses seem to be conducted and represented adequately. The text is well written and methods are nicely detailed. Despite the novelty, the manuscript has some, yet important weaknesses that will need to be addressed.Strengths:Multi-species inoculants often fail to promote plant health under natural conditions because microbe-microbe interactions are not often considered when consortia are designed and assembled. Therefore, the idea of promoting intra-species multi-functionality through the assembly of bacterial mutants derived from a single strain is exciting. This is because it could promote functional diversity whilst at the same time minimizing the risk of competition between strains. The research question is therefore interesting and novel, the combination of methods, which include strain engineering (Tn5 mutant library), large-scale phenotypic screening and assembly of synthetic microbial consortia is adequate to test the relevance of functional complementary and multi-functionality between mutant strains.The greenhouse experiment using a natural soil is also relevant to test the effects of the inoculants under semi-natural conditions.The statistical analysis is adequate, the manuscript well written and the figures have been nicely crafted.The conclusions are largely supported by experimental evidence, although it remains difficult to unambiguously conclude that the method actually works.Weaknesses: There are some weaknesses.First, the authors used an initial random pool of 479 mutants for in vitro trait phenotyping. It remains unclear why more mutants have not been tested given the fact that these are high-throughput in vitro screens. The authors did not use a saturated mutant library and might have overlooked many important genes.Second, the structure of the manuscript is confusing. It remains unclear how the three clusters in Figure 1 have been defined and why they were not considered for the rational selection of the consortia shown in Figure 2. The most confusing part comes from the last paragraph and Figure 3 which shows data based on individual strains and not consortia. This is redundant with the data shown in Figure 1 and this part provides very limited information regarding the \"underlying mechanisms between consortia diversity and improved performance\". As it is presented this part distracts rather than informs. I do not think that this is the rights way to test the \"insurance hypothesis\". this hypothesis makes sense if tested in a community context with consortia of different complexities .It remains also unclear whether complementarity between specialized bacterial mutants is really needed for improving plant performance (as stated in the title). The authors showed that the rational selection based on Figure 1 has some limits to predicting community behavior in vitro and in planta. Therefore, a key question is whether microbial consortia composed of random pools of 8 mutants (i.e. not pre-selected based on in vitro phenotypes) would provide similar fitness benefits as the mutant pool selected in Figure 2. In other words, is the first part of the paper really required or could one simply inoculate a pool of Tn5 mutants and observe the same protective effect? Testing the effects of several independent mutant consortia would be needed to draw general conclusions.Finally, the paper is mechanistically weak. That being said, this is not the core of the manuscript and therefore it is not an issue. Although requesting complementation lines for the 8 mutants used for consortia establishment is beyond the scope of the manuscript, it is important to keep in mind that it is difficult to conclude anything regarding the bacteria genetic determinants identified here without proper functional validations.To strengthen the conclusions shown in Figure 2, it would be important to test other independent consortia of 8 mutants and validate directionality in their effects depending on whether they were selected randomly or based on rational criteria. The concern is that part 1 and part 2 of the manuscripts might not be connected and it would be important to validate that the rational selection based on in vitro phenotypes is actually required and important.The results presented in Figure 3  are insufficient to test the insurance effect. One would need to inspect this in the context of the various consortia shown in Figure 2. Here, it would be important to assess 1. total Bacillus load (e.g. using colony counts), 2. disease suppression and 3. \"community structure\" of the bacilli mutants. The latter can likely easily be conducted using PCRs with pairs of Tn5 transposon specific and random primers similar to classical TnSeq approaches. If the insurance hypothesis holds true, one would expect, that throughout the whole growth cycle, the complex community always performs better than the individual mutants (based on colony counts and disease suppressiveness) and also that relative abundances of Bacilli mutants change across the growth cycle. Such experiments could further reinforce the conclusion regarding insurance effects. Alternatively, authors should consider including this section as Figure 2 and tone-down their claim regarding these insurance effects that are not corroborated by experimental evidence.Agar overlay data not shown?Reviewer #2 (Recommendations for the authors):This study provides a novel, potentially high-throughput method for identifying beneficial microbial consortia towards plant growth and health, which may be applicable towards other biotechnological applications. This study has the potential to be of great interest to all those working in host-microbe interactions. However, it is my opinion that there is an overemphasis on microbial ecology and the inherent value of intraspecies diversity towards ecosystem health, where I think the data of this study does not meet their intended aims.Strengths: This study provides a novel and unique approach for studying the impact of intraspecies diversity on microbial consortia and understanding host (plant)-microbe interactions. There is a very good introductory section highlighting the field of microbial ecology. The methods used seem applicable to many different potential environments, as highlighted by the authors, and might be of great interest to those working on both applied and fundamental areas of microbiology and/or host-microbe interactions. The justification of the study, the introduction, and the methods used are all very high quality. The stated expectations by the authors are also well-supported by the theoretical literature and clearly explained. The focus on intraspecies interactions and diversity is also very welcomed and appears to me to be a novel approach.Weaknesses: It is my opinion that the narrative in the results and discussion is overly focused on the impact of intraspecies diversity in microbial ecology, and how this diversity improves ecosystem functioning. I do not think the study provides support for these claims. Instead, the study does provide excellent support for high-performing consortia of mutants, which outperform the WT monoculture across varying metrics, which has both applied and fundamental value regarding agriculture and host-microbe interactions at both the strain and molecular levels. The data provided as apart of this work provides many new avenues of research and I think is an excellent step towards developing beneficial probiotic consortia. Unfortunately, these advances are sometimes overshadowed by claims of ecosystem stability and ecosystem functioning that lack support in the data. In multiple places in the text, it is suggested that intraspecies consortia are not subject to intra-species conflict. I find this to be potentially misleading, as it implies that these genotypes now have neutral (or positive) interactions, which is not appropriately measured nor expected from the data.Line 44-47 \u2013 I am unsure of the support that antagonistic traits often increase invasion success of probiotic bacteria, or what this statement really means. I think it could benefit by being more explicit.The introduction may benefit from a more thorough explanation of biodiversity-ecosystem functioning theory (line 84), to match the excellent introduction of microbial ecology from lines 50-75.Line 95: 'benefits' to 'beneficialLine 96: Expected advances. It does not appear that expectations 2 or 3 are tested. Expectation 3 is also rather unclear. Please consider rewriting this section to better set the reader's expectations for the data and results in the paper.Line 162 \u2013 Please clarify how it is known that OD600 = 0.05 equals ~10^5 cells/mL for B. amyloliquifaciens. Or omit the ~10^5 cells/mL. Additionally, I wonder if OD600 is an appropriate proxy for biomass production in a B. amyloliquifaciens mutant library? Plating and counting CFU/mL would be the much more reliable measurement. Considering the method used for biomass production measurement, did you perform these measurements in a plate reader and have additional time series data beyond the 24hr timepoint? Perhaps maximum growth rate or other factors of the growth curve may also be good indicators of beneficial phenotypes for plant health.General Methods Comments: Given the more applied aims of this study, maintaining a constant inoculum size and measuring the outputs of the consortium is a very reasonable strategy. However, performing experiments in this way ignores the intraspecies competition that likely defines the system. This makes claims of facilitation, exploitation, or cooperation moot, as they are not being appropriately measured. The authors would need to measure monoculture densities of individual mutants, then add mutants at the same inoculum into the consortia experiments , and then measure individual strain abundance and/or total biomass to accurately test for facilitation or cooperation . I am still very impressed and intrigued by this study and the data obtained, but I do think it needs to focus more on the applied aspects: High performing mutant library consortia to improve agricultural yields. The experiments performed, however, don't tell us much about microbial ecology.I am quite confused by the clusters. I don't understand the methods of this PCA plot and how mutants are assigned into the various clusters. Perhaps isolates that did not fall within the bounds, or intersected multiple groups should be excluded. The K-means clustering needs significantly more explanation in the methods. As a key aspect of the data being provided, the written methods section should make it very clear how this clustering is being performed and why it is a valid method.Is there precedent for this type of phenotypic clustering for a transposon library? I think there is tremendous value of having a transposon library of this sort. But I don't really understand the purpose of the clustering.Line 307-315 \u2013 Data are provided for the clusters and compared to the WT. However, statistical tests included in Figures 1E, F measure differences between clusters, rather than each cluster compared to the WT. I see that the WT is provided as the solid black line, but I think adding an additional box plot for the WT would be more appropriate.Line 321 \u2013 I worry that a term like 'specialist mutants' could cause confusion, and perhaps imply that these mutants have niche separation relative to the WT, which hasn't been measured. I think simply 'mutants' would be more appropriate.Line 332 \u2013 It is unclear to me how the predictive performance values were calculated. Please be explicit. When you sum the trait values of monocultures, are you first dividing that trait value according to the reduction in biomass added to the inoculum. ie when you do a 2 species consortium and add each species at 50% of their inoculum as compared to the WT, are you halving the expected trait value? Is there an existing precedent for this?Line 363 \u2013 Stability has a specific definition in ecology that I don't think is intended here. Consider not using this term.Line 366 \u2013 I don't understand the difference between high swarming and swarming motility. These are not differentiated in the methods.Line 356 \u2013 383 \u2013 I'm having a hard time following the data and logic provided here.Discussion:Line 387 \u2013 Did your results show this? Which data/Figure? I think it would be appropriate to remind the reader where to find the evidence for this claim.Line 392 \u2013 The intra-species diversity also introduces conflict. There is likely more inter-genotype competition in the communities assembled for this study as compared to one involved multi-species communities. The competition/conflict just hasn't been measured here.The discussion seems overly focused on the individual mutations identified and their resulting phenotypes. Perhaps this level of depth provided for these mutants is more suited for the Results section.Line 462 \u2013 \"It is thus possible that consortia were together able to overcome the trait trade-offs experienced at the individual mutant level, leading to improved and more stable ecosystem functioning in time.\" This language is too vague and has the potential to mislead readers. What is meant by improved ecosystem functioning? Regarding stability, this study does not measure the ecological interactions between different bacterial genotypes. The levels of intraspecific competition between microbes is likely very high, which may lead to increased stability. It may also lead to extinction of the weaker strain.Line 468 \u2013 Is a transposon library really an example of synthetic biology? This is not how I understand the limits of the field, but I apologise if I'm uninformed.Reviewer #3 (Recommendations for the authors):Line 469 \u2013 I do not agree that this study highlights the importance of intraspecies diversity in ecosystem functioning. Instead, this study does highlight how intraspecies diversity libraries can be an effective mechanism for identifying traits and consortia which can rapidly improve desired measurables within a defined ecosystem. I think an overall refocusing on the applied potential of the study would be appropriate.Yang et al. assembled a set of synthetic consortia using functionally specialized mutants generated from a rhizosphere probiotic, Bacillus amyloliquefaciens, and tested whether the consortia can promote the growth of the plant. Because the mutants are derived from the same strain, they should not antagonize their kins. Accordingly, this design potentially reduces within-community antagonism, overcoming a limitation occurring in the previous multi-species consortia.Although the idea of this paper is of interest to readers in the field of microbiome and plant-microbe interactions, the manuscript is not well-organized. The Introduction section did not adequately discuss the strengths of this design compared to the previous studies. Instead, the author proposed several scientific questions that were not addressed/focused on by this study. In the Results section, several important data are missing, and some claims are not well-supported by the data. The specific comments are listed below.Introduction:The author claims that \"inoculant design should aim to minimize negative interactions within consortia\" (line 46) and the author claimed that three ways (concepts) can be used to achieve this aim: ecological complementarity, division of labor or facilitation between consortia members.Firstly, the discussion on these concepts (lines 50-75) makes me feel that the author thinks they are three totally segregated concepts . However, there are many overlaps among these three concepts. For example, if different species exploit different niches and such diversification benefits all the individuals, it can be also defined as a \"division of labor\" (based on definitions in ref. 26). Moreover, many cases of facilitation can be defined as the division of labor (see this ref: https://doi.org/10.1016/j.jmb.2019.06.023). I would suggest that the author use more specific/distinguishable terms throughout the paper, for example, niche complementarity/ specialization within a single niche/ leaky section. In addition, the direct description of how such engineering works  may be clearer to readers than just giving terms.Secondly, the authors discussed theories but did not state how the design in this study can benefit from these theories to overcome the proposed limitation. This makes it unclear why constructing such mutant-based synthetic consortia can \"minimize negative interactions within consortia\". The author proposed a main scientific question \"whether this should be based on ecological complementarity, division of labor or facilitation between consortia members. (Lines 74-75)\" but this study did not address this question.Thirdly, following the above point, a logical connection is missing between the last two paragraphs of the Introduction. In other words, does increasing intra-species diversity benefit the ecological complementarity, division of labor, or facilitation, so reduce the within-community antagonism? In addition, I would expect the authors to explain more about why increasing the intra-species diversity of a single bacterium could prevent conflicts between the consortia members. I think this is the main novelty of this study different from the previous design constructing consortia using different species. I saw some reasons were listed in lines 101-103 but expect more explanations/discussions.In sum, the author could do a better job linking theory and experimental design.ResultsLine 320-322: I think this \"antagonism\" experiment is very important for the novelty of this study. Because the mutants are derived from the same strain, they should show less competition/antagonism within consortia, which is different from the situation in the previous multi-species consortia. Therefore, (1) the data of the \"agar overlay assays\" should be provided in the main text of the paper; (2) It will be beneficial to add more evidence ; (3) It is also very important to examine if the mutants within a consortium stable coexist during the community assembly. Accordingly, the structure of the consortium during/after the assays  should be measured.Design/analyses of the consortia experiment: in lines 324-326, the authors hypothesized that \"consortia could show improved performance due to ecological complementarity where different mutants 'specialize' respective to different traits, overcoming trade-offs experienced at individual strain level .\" However, the experiments were concluded with \"mutant consortia diversity was positively linked with consortia performance in vivo, which was associated with consortia mean performance and pathogen suppression measured in vitro. (Lines 354-355)\" Obviously, the hypothesis was not well examined using the current design and analyses. For a direct test of the hypothesis, the authors should compare the performance of the consortia with niche specialization  with that of the others.Line 383: I think the conclusion here is less evident. To prove the improvement of the consortia functioning is due to the insurance effects, the performance of the 47-member consortium should be compared to the consortium with fewer members. A more rational design is to build consortia according to the four testing functions. Some consortia contain one mutant specializing in one specific function, while the others contain more mutants for the function . Then compare the root colonization and plant protection ability of the two groups.eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by myself and Detlef Weigel as the Senior Editor.Thank you for submitting your article \"Engineering multifunctional rhizosphere probiotics using consortia of Bacillus amyloliquefaciens transposon insertion mutants\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.eLife.We had substantial internal discussion of the revised manuscript, and we agree that the revisions have been substantial. All referees would \u2013 in principle \u2013 support publication of the work in However, we felt that there is still one important issue that must be carefully considered and addressed. This is regarding the new supernatant experiment, which might not be the best way to infer ecological interactions (please see comments from ref#3) and might lead to misleading interpretations. We agreed that this issue should be clarified before final acceptance of the work. We see two potential options to do so:1) If you wish to firmly conclude that reduced competition among consortia members exists, please include single strain vs. pairwise co-culture experiments followed by colony counts . This might actually require a limited amount of work and would be most appropriate to infer potentially neutral interactions among consortia members.2) Alternatively, you should remove the supernatant data from the manuscript and adopt a more tempered tone for all assertions linked to how \"this study\" enhances our understanding of function by mitigating competition between the consortia members.Reviewer #1 (Recommendations for the authors):The work is significant because it reports that intra-species phenotypic diversity in bacteria could be an effective way to improve probiotic consortia in agriculture. Authors now provide compelling evidence indicating that near-clonal bacteria assembled into consortia based on diverse functional traits perform better than randomly-assembled consortia. Two solid conclusions emerging from this work are that (1) Communities of near-clonal bacteria can be optimized based on functional traits to promote functional diversity and reduce bacterial competition (2) consortium multifunctionality \u2013 but not richness \u2013 is key to promoting bacterial colonization in roots and to protect against a plant pathogen.In my opinion, authors have seriously and thoroughly addressed the previous concerns raised by me and other reviewers. I acknowledge the fact that they have performed additional experiments that have strengthened their conclusions. Particularly, they performed supernatant experiments testing pairwise interactions between the mutants included in their phenotypically-optimized 8-member consortium and performed validation experiments with randomly assembled 8-member consortia. These two novel experiments revealed that:1. Limited negative or positive interactions were observed in supernatant exposure experiments, indicating that bacterial-bacterial interactions are not extensively contributing to the observed phenotypes.2. Importantly, they used random, 8-member mutant consortia, and demonstrate that the phenotypically-optimized consortium indeed performs better than what is expected by chance. This experiment convinced me that the strategy used in the manuscript has relevance for optimizing synthetic communities based on (multi)-functional traits.Reviewer #2 (Recommendations for the authors):They have also reorganized the structure of the manuscript and rewrote the introduction and Discussion sections to focus more on the methodological novelty of the work and less on ecological theories.I only have a small suggestion optional to the authors. It might be intriguing to discuss the microscale-level mechanisms behind why the consortium outperforms a single strain. Could the four plant growth-promotion traits act as public goods? For instance, could biofilm formation specialists aid pathogen suppression specialists in better colonizing plants? It may be interesting to add some discussions to the paragraph in lines 497-516.Reviewer #3 (Recommendations for the authors):Collectively, I am excited to see this manuscript again, as I've been keeping an eye out to see if it had been published in another journal since my first review. It is an intriguing work and I think that many readers in the community will be interested to read it. My primary criticism remains the same as the first review, where ecological interactions are not appropriately measured. I give a detailed explanation of this in Response to R13 (below), along with references that I believe do perform appropriate experiments to measure ecological interactions between strains/genotypes. That said, my other comments appear to be appropriately addressed.Additionally, because much of the narrative of the discussion has been rewritten to avoid direct claims about ecological interactions between the genotypes throughout the text, I no longer believe that an experiment demonstrating ecological interactions is necessary. Figure S5 should be removed, as this is not an appropriate measure of ecological interactions. The data gathered as part of Figure S5 are likely sufficient to still represent these experiments appropriately. If presented appropriately, I strongly suspect that negative interactions will be the predominant interaction type, so it would be up to the authors if they would like to present this data or not.So long as reference to ecological interactions  and Figure S5 are removed from the text , the remainder of this work appears to hold together well, with the text supported by the data.Response to R13:Regarding Figure S5. While supernatant assays are not the preferred method to measure ecological interactions, I appreciate the authors performing an experiment to address this major comment from my first review. However, this is not the appropriate experiment and it does not support the claim that interactions between the different genotypes are neutral.The ideal experiment would be to grow each strain in monoculture and count cfu/mL, then grow each strain in pairwise combination and count cfu/mL of each strain. If it is not possible to selectively plate in order to identify the different genotypes, one could also grow each strain in monoculture and count cfu/mL. Then again repeat growing strains in pairwise co-culture, and count the total cfu/mL. If the interactions are neutral, the prediction is that the total cfu/mL will be the sum of the two strains monoculture cell densities (cfu/mL). One could interpret this as clear niche differentiation, with no interference or exploitative competition. If you are committed to the growth supernatant assay and measuring OD600, you could grow each strain in monoculture, measure final OD600 and then filter the supernatant just as you've done. You can then grow them again in the spend media and measure the final OD600. If the interactions are neutral, then prediction is that growth in monoculture with spent media = growth in monoculture with fresh media. For any strain combination, if growth in monoculture of spent media < growth in monoculture of fresh media, this is a negative interaction.Unfortunately, it is not satisfactory to infer ecological interactions as a measure of growth in supernatant relative to growth in one's own supernatant. There is full niche overlap when a strain grows in its own supernatant. Using this metric, you could have two different strains with identical nutrient requirements, that will compete with each other for these nutrients, and you would likely measure it as a neutral interaction. It is also challenging when measuring ecological interactions in liquid LB and trying to extrapolate this to interactions in vivo where the host is also present. An experiment like this in liquid LB is probably a good proxy for gauging interactions, but an experiment that is close to the environment of interest would be the most desirable. However, I understand that this can present additional challenges. I also understand that a specific aim of this study is to use in vitro phenotyping in order to optimize consortia functioning. So in that regard, an LB experiment is perhaps appropriate.I hope that this criticism is clear. For a more comprehensive description of methods in this regard, I suggest Foster and Bell, 2012. DOI: 10.1016/j.cub.2012.08.005. Additionally, Weiss et al. ISME 2022 DOI: 10.1038/s41396-021-01153-z performs nice experiments in this regard, using both monoculture vs coculture experiments (quantifying strain abundances with qPCR) as well as spent supernatant assays.And yet, after all of this, after reading the revised discussion, I no longer think that this experiment is essential. Because the authors have removed much of the narrative regarding ecological significance and focused more on the applied aspects of this work, I do not think that these ecologically-focussed experiments are completely necessary. So long as the authors avoid claims of the interactions between genotypes (as I would argue these have still not been appropriately measured), then I don't think this experiment is necessary for this manuscript. [Editors\u2019 note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors\u2019 response to the first round of review.]Comments to the Authors:We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife. Note that while we cannot publish the current study, we remain in principle interested in the work. If you are able to seriously revise the work and respond to the concerns, we would be prepared to review the work again, although we would treat it as a new submission.As you will see, although the reviewers see the work as novel and with the potential to design probiotic consortia, they have also raised a number of issues that will require new experiments, new analyses and important reformatting of the manuscript. After internal discussions with the reviewers, we remain in principle interested in the work but we felt that it is important to give you more time if you wish to thoroughly address the concerns. Particularly, performing pairwise interactions among mutants, testing random sets of 8-member consortia, and reorganizing the manuscript appears to be critical to corroborate the claims and improve clarity, respectively. Furthermore, the reviewers think that the experiments were not designed to test ecological theories regarding ecosystem functioning and stability but rather as a method to design probiotic consortia in agriculture. Many concepts mentioned in the introduction and discussion might not be relevant here and might distract rather than inform.We thank the Editor and three anonymous reviewers for highly useful feedback on our manuscript. We have now carefully followed all the suggestions and fully revised our manuscript accordingly. The main changes include:Additional supernatant experiments testing pairwise interactions between the mutants included in \u2018phenotypically optimized\u2019, 8-member consortiumAdditional validation experiments with randomly assembled 8-member consortiaReorganization of the structure of the manuscript following reviewers\u2019 suggestionsRewriting of the introduction and discussion and clarification of the aims of the studyeLife.We hope that these changes have improved our manuscript and that it could now be reconsidered as a new submission to Reviewer #1 (Recommendations for the authors):Overall, the concept/methodology is interesting and the results open novel insights towards the engineering of microbial consortia that promote disease resistance. Furthermore, the statistical analyses seem to be conducted and represented adequately. The text is well written and methods are nicely detailed. Despite the novelty, the manuscript has some, yet important weaknesses that will need to be addressed.Strengths:Multi-species inoculants often fail to promote plant health under natural conditions because microbe-microbe interactions are not often considered when consortia are designed and assembled. Therefore, the idea of promoting intra-species multi-functionality through the assembly of bacterial mutants derived from a single strain is exciting. This is because it could promote functional diversity whilst at the same time minimizing the risk of competition between strains. The research question is therefore interesting and novel, the combination of methods, which include strain engineering (Tn5 mutant library), large-scale phenotypic screening and assembly of synthetic microbial consortia is adequate to test the relevance of functional complementary and multi-functionality between mutant strains.The greenhouse experiment using a natural soil is also relevant to test the effects of the inoculants under semi-natural conditions.The statistical analysis is adequate, the manuscript well written and the figures have been nicely crafted.The conclusions are largely supported by experimental evidence, although it remains difficult to unambiguously conclude that the method actually works.We thank reviewer #1 for positive feedback.Weaknesses: There are some weaknesses.1. First, the authors used an initial random pool of 479 mutants for in vitro trait phenotyping. It remains unclear why more mutants have not been tested given the fact that these are high-throughput in vitro screens. The authors did not use a saturated mutant library and might have overlooked many important genes.We have now included more in vitro phenotyping data to the manuscript. The full dataset now includes phenotypic data for 1999 mutants. Of these, we selected 479 phenotypically representative mutants for more detailed analysis and probiotic bioinoculant design. While we likely missed certain mutants with this method, our analysis similarity suggests that this method captured a representative and phenotypically diverse sample of mutants from the original collection. We have now justified this in the manuscript on lines 149-153.2. Second, the structure of the manuscript is confusing. It remains unclear how the three clusters in Figure 1 have been defined and why they were not considered for the rational selection of the consortia shown in Figure 2. The most confusing part comes from the last paragraph and Figure 3 which shows data based on individual strains and not consortia. This is redundant with the data shown in Figure 1 and this part provides very limited information regarding the \"underlying mechanisms between consortia diversity and improved performance\". As it is presented this part distracts rather than informs. I do not think that this is the rights way to test the \"insurance hypothesis\". this hypothesis makes sense if tested in a community context with consortia of different complexities .We have now restructured and clarified these sections. Specifically, we now present all individual strain-based results before the pairwise and consortia data . Moreover, we have made the selection of subset of strains from the larger mutant collection clearer .3. It remains also unclear whether complementarity between specialized bacterial mutants is really needed for improving plant performance (as stated in the title). The authors showed that the rational selection based on Figure 1 has some limits to predicting community behavior in vitro and in planta. Therefore, a key question is whether microbial consortia composed of random pools of 8 mutants (i.e. not pre-selected based on in vitro phenotypes) would provide similar fitness benefits as the mutant pool selected in Figure 2. In other words, is the first part of the paper really required or could one simply inoculate a pool of Tn5 mutants and observe the same protective effect? Testing the effects of several independent mutant consortia would be needed to draw general conclusions.per se.This is a very important point. As a result, we have conducted additional experiments where we test the plant protection by randomly assembled 8-mutant consortia that vary in their phenotypic dissimilarity and predicted relative performance. These results confirm that randomly constructed mutant consortia perform worse compared to phenotypically \u2018optimized\u2019 consortium, suggesting that improvement was unlikely driven by consortium richness 4. Finally, the paper is mechanistically weak. That being said, this is not the core of the manuscript and therefore it is not an issue. Although requesting complementation lines for the 8 mutants used for consortia establishment is beyond the scope of the manuscript, it is important to keep in mind that it is difficult to conclude anything regarding the bacteria genetic determinants identified here without proper functional validations.We clearly admit these limitations in the discussion and suggest future work to uncover mechanistic aspects of our approach at the genetic level.5. To strengthen the conclusions shown in Figure 2, it would be important to test other independent consortia of 8 mutants and validate directionality in their effects depending on whether they were selected randomly or based on rational criteria. The concern is that part 1 and part 2 of the manuscripts might not be connected and it would be important to validate that the rational selection based on in vitro phenotypes is actually required and important.New data has now been included to strengthen these conclusions; please, also see our response to point 3.6. The results presented in Figure 3  are insufficient to test the insurance effect. One would need to inspect this in the context of the various consortia shown in Figure 2. Here, it would be important to assess 1. total Bacillus load (e.g. using colony counts), 2. disease suppression and 3. \"community structure\" of the bacilli mutants. The latter can likely easily be conducted using PCRs with pairs of Tn5 transposon specific and random primers similar to classical TnSeq approaches. If the insurance hypothesis holds true, one would expect, that throughout the whole growth cycle, the complex community always performs better than the individual mutants (based on colony counts and disease suppressiveness) and also that relative abundances of Bacilli mutants change across the growth cycle. Such experiments could further reinforce the conclusion regarding insurance effects. Alternatively, authors should consider including this section as Figure 2 and tone-down their claim regarding these insurance effects that are not corroborated by experimental evidence.We agree with the reviewer that more detailed measurements and quantification of each mutant frequency would be required to support our conclusions on the insurance hypothesis. As the Tn insertions did not include unique barcodes, quantifying mutant frequencies was not possible (now mentioned in the discussion). We have hence toned down our conclusions on the role of insurance hypothesis and have removed it from the introduction as our hypothesis.7. Agar overlay data not shown?Agar overlay data is now included. We have also added new data on the lack of pairwise inhibitory effects between the strains based on supernatant growth assays (see revised methods on lines 375-378).Reviewer #2 (Recommendations for the authors):This study provides a novel, potentially high-throughput method for identifying beneficial microbial consortia towards plant growth and health, which may be applicable towards other biotechnological applications. This study has the potential to be of great interest to all those working in host-microbe interactions. However, it is my opinion that there is an overemphasis on microbial ecology and the inherent value of intraspecies diversity towards ecosystem health, where I think the data of this study does not meet their intended aims.Strengths: This study provides a novel and unique approach for studying the impact of intraspecies diversity on microbial consortia and understanding host (plant)-microbe interactions. There is a very good introductory section highlighting the field of microbial ecology. The methods used seem applicable to many different potential environments, as highlighted by the authors, and might be of great interest to those working on both applied and fundamental areas of microbiology and/or host-microbe interactions. The justification of the study, the introduction, and the methods used are all very high quality. The stated expectations by the authors are also well-supported by the theoretical literature and clearly explained. The focus on intraspecies interactions and diversity is also very welcomed and appears to me to be a novel approach.We thank reviewer #2 for positive comments.Weaknesses: It is my opinion that the narrative in the results and discussion is overly focused on the impact of intraspecies diversity in microbial ecology, and how this diversity improves ecosystem functioning. I do not think the study provides support for these claims. Instead, the study does provide excellent support for high-performing consortia of mutants, which outperform the WT monoculture across varying metrics, which has both applied and fundamental value regarding agriculture and host-microbe interactions at both the strain and molecular levels. The data provided as apart of this work provides many new avenues of research and I think is an excellent step towards developing beneficial probiotic consortia. Unfortunately, these advances are sometimes overshadowed by claims of ecosystem stability and ecosystem functioning that lack support in the data. In multiple places in the text, it is suggested that intraspecies consortia are not subject to intra-species conflict. I find this to be potentially misleading, as it implies that these genotypes now have neutral (or positive) interactions, which is not appropriately measured nor expected from the data.We have now toned down our conclusions on the effects of intra-species diversity for the ecosystem functioning and stability. To provide more support for the lack of inhibitory effects between mutants, we have included new data based on supernatant growth assays, which demonstrates that most of the pairwise interactions were neutral or mildly positive or negative .Line 44-47 \u2013 I am unsure of the support that antagonistic traits often increase invasion success of probiotic bacteria, or what this statement really means. I think it could benefit by being more explicit.We have now replaced \u2018invasiveness\u2019 with \u2018competitiveness\u2019 and have expanded the example to be more specific.The introduction may benefit from a more thorough explanation of biodiversity-ecosystem functioning theory (line 84), to match the excellent introduction of microbial ecology from lines 50-75.We have now clarified the biodiversity-ecosystem functioning approaches earlier during the introduction to make the key idea clearer (on lines 55-83).Line 95: 'benefits' to 'beneficialRevised as suggested.Line 96: Expected advances. It does not appear that expectations 2 or 3 are tested. Expectation 3 is also rather unclear. Please consider rewriting this section to better set the reader's expectations for the data and results in the paper.This section has now been simplified and completely rewritten.Line 162 \u2013 Please clarify how it is known that OD600 = 0.05 equals ~10^5 cells/mL for B. amyloliquifaciens. Or omit the ~10^5 cells/mL. Additionally, I wonder if OD600 is an appropriate proxy for biomass production in a B. amyloliquifaciens mutant library? Plating and counting CFU/mL would be the much more reliable measurement. Considering the method used for biomass production measurement, did you perform these measurements in a plate reader and have additional time series data beyond the 24hr timepoint? Perhaps maximum growth rate or other factors of the growth curve may also be good indicators of beneficial phenotypes for plant health.The relationship between the OD and cell numbers is based on a calibration curves, which we now present for the wild-type, and low and high biomass producing mutants in Figure S1.General Methods Comments: Given the more applied aims of this study, maintaining a constant inoculum size and measuring the outputs of the consortium is a very reasonable strategy. However, performing experiments in this way ignores the intraspecies competition that likely defines the system. This makes claims of facilitation, exploitation, or cooperation moot, as they are not being appropriately measured. The authors would need to measure monoculture densities of individual mutants, then add mutants at the same inoculum into the consortia experiments , and then measure individual strain abundance and/or total biomass to accurately test for facilitation or cooperation . I am still very impressed and intrigued by this study and the data obtained, but I do think it needs to focus more on the applied aspects: High performing mutant library consortia to improve agricultural yields. The experiments performed, however, don't tell us much about microbial ecology.As we were interested in separating richness and species identity effects in mutant consortia, we employed substitutive experimental design, which assumes that the biomass of the consortia is kept constant . We now acknowledge in the discussion that our method also affected the mutant abundances relative to monoculture controls, which could have affected the observed patterns. We have now included additional data for analyzing interactions between a subset of mutants used in the diversity-ecosystem functioning experiment (see response to point 7). The applied aspect of the study has now been emphasized.I am quite confused by the clusters. I don't understand the methods of this PCA plot and how mutants are assigned into the various clusters. Perhaps isolates that did not fall within the bounds, or intersected multiple groups should be excluded. The K-means clustering needs significantly more explanation in the methods. As a key aspect of the data being provided, the written methods section should make it very clear how this clustering is being performed and why it is a valid method.Is there precedent for this type of phenotypic clustering for a transposon library? I think there is tremendous value of having a transposon library of this sort. But I don't really understand the purpose of the clustering.n observations into k clusters where each observation (in our case mutant) belongs to a cluster with the nearest mean (cluster centers or cluster centroid). PCA analysis was then used to visualize the phenotypic clustering where the bounds of the clusters indicate 95% confidence intervals. Each mutant was hence assigned to one of the clusters even though mutants varied in their distance to cluster centroid means. This method is widely used in ecological studies with microbes and other taxa.We have now clarified the K-means clustering in the methods (lines 186-189). Briefly, K-means clustering assigns Line 307-315 \u2013 Data are provided for the clusters and compared to the WT. However, statistical tests included in Figures 1E, F measure differences between clusters, rather than each cluster compared to the WT. I see that the WT is provided as the solid black line, but I think adding an additional box plot for the WT would be more appropriate.We have now clarified in panels Figure 1E-F and results text that WT was assigned in the cluster 1. As the WT is only one clone, variation between technical replicates is very small. We hence feel that presenting WT performance as solid black line offers better visualization of the WT baseline. We have now included shaded area around WT mean to show variation between technical replicates.Line 321 \u2013 I worry that a term like 'specialist mutants' could cause confusion, and perhaps imply that these mutants have niche separation relative to the WT, which hasn't been measured. I think simply 'mutants' would be more appropriate.We have now simplified the text as suggested and only use the term \u2018Specialist mutant\u2019 when it is related to ecological specialism or generalism. When emphasizing phenotypic differences between mutants, we have now phrased them as \u2018phenotypically distinct\u2019 or \u2018phenotypically dissimilar\u2019 mutants depending on the context.Line 332 \u2013 It is unclear to me how the predictive performance values were calculated. Please be explicit. When you sum the trait values of monocultures, are you first dividing that trait value according to the reduction in biomass added to the inoculum. ie when you do a 2 species consortium and add each species at 50% of their inoculum as compared to the WT, are you halving the expected trait value? Is there an existing precedent for this?This has now been clarified in the methods; predicted value equals to the sum of trait values of each member divided by the richness of given consortium based on additive model. As a result, we are not halving the trait values as the chosen growth-based traits. These potential inoculum abundance effects are now briefly mentioned in the discussion.Line 363 \u2013 Stability has a specific definition in ecology that I don't think is intended here. Consider not using this term.We have removed the references to stability here.Line 366 \u2013 I don't understand the difference between high swarming and swarming motility. These are not differentiated in the methods.Revised to remove ambiguity \u2013 with \u201chigh\u201d we just referred to relatively high swarming motility trait values.Line 356 \u2013 383 \u2013 I'm having a hard time following the data and logic provided here.This section has now been rewritten to improve clarity.Discussion:Line 387 \u2013 Did your results show this? Which data/Figure? I think it would be appropriate to remind the reader where to find the evidence for this claim.Reference to specific results now included as suggested.Line 392 \u2013 The intra-species diversity also introduces conflict. There is likely more inter-genotype competition in the communities assembled for this study as compared to one involved multi-species communities. The competition/conflict just hasn't been measured here.The discussion seems overly focused on the individual mutations identified and their resulting phenotypes. Perhaps this level of depth provided for these mutants is more suited for the Results section.We now discuss potential conflicts of intra-species diversity in the broader context of bioinoculant design beyond this experiment. We feel that discussing individual mutations is still appropriate to provide some potential mechanistic explanations for our results and have kept them in the discussion.Line 462 \u2013 \"It is thus possible that consortia were together able to overcome the trait trade-offs experienced at the individual mutant level, leading to improved and more stable ecosystem functioning in time.\" This language is too vague and has the potential to mislead readers. What is meant by improved ecosystem functioning? Regarding stability, this study does not measure the ecological interactions between different bacterial genotypes. The levels of intraspecific competition between microbes is likely very high, which may lead to increased stability. It may also lead to extinction of the weaker strain.Revised to add clarity; with \u201cecosystem functioning\u201d we refer to \u201cplant protection\u201d in this occasion. With stability we here refer to stability of plant protection \u2013 from the microbial point of view this could be mediated by lack or intense competition, which we have now clarified. We have now revised this section to reduce ambiguity of the terms used.Line 468 \u2013 Is a transposon library really an example of synthetic biology? This is not how I understand the limits of the field, but I apologise if I'm uninformed.Reference to \u2018synthetic biology\u2019 removed.Line 469 \u2013 I do not agree that this study highlights the importance of intraspecies diversity in ecosystem functioning. Instead, this study does highlight how intraspecies diversity libraries can be an effective mechanism for identifying traits and consortia which can rapidly improve desired measurables within a defined ecosystem. I think an overall refocusing on the applied potential of the study would be appropriate.Revised as suggested; we now emphasize our findings in more applied context as suggested and have toned down the significance of intra-species diversity.Reviewer #3 (Recommendations for the authors):Yang et al. assembled a set of synthetic consortia using functionally specialized mutants generated from a rhizosphere probiotic, Bacillus amyloliquefaciens, and tested whether the consortia can promote the growth of the plant. Because the mutants are derived from the same strain, they should not antagonize their kins. Accordingly, this design potentially reduces within-community antagonism, overcoming a limitation occurring in the previous multi-species consortia.Although the idea of this paper is of interest to readers in the field of microbiome and plant-microbe interactions, the manuscript is not well-organized. The Introduction section did not adequately discuss the strengths of this design compared to the previous studies. Instead, the author proposed several scientific questions that were not addressed/focused on by this study. In the Results section, several important data are missing, and some claims are not well-supported by the data. The specific comments are listed below.We thank Reviewer #3 for highly useful comments.Introduction:The author claims that \"inoculant design should aim to minimize negative interactions within consortia\" (line 46) and the author claimed that three ways (concepts) can be used to achieve this aim: ecological complementarity, division of labor or facilitation between consortia members.Firstly, the discussion on these concepts (lines 50-75) makes me feel that the author thinks they are three totally segregated concepts . However, there are many overlaps among these three concepts. For example, if different species exploit different niches and such diversification benefits all the individuals, it can be also defined as a \"division of labor\" (based on definitions in ref. 26). Moreover, many cases of facilitation can be defined as the division of labor (see this ref: https://doi.org/10.1016/j.jmb.2019.06.023). I would suggest that the author use more specific/distinguishable terms throughout the paper, for example, niche complementarity/ specialization within a single niche/ leaky section. In addition, the direct description of how such engineering works  may be clearer to readers than just giving terms.These are very good points, and we have now made it clearer in the introduction that these processes are not mutually exclusive. We have also clarified the terminology and rewritten the whole introduction and reduced the emphasis on division of labor and complementarity, which we did not directly quantify in our experiments.Secondly, the authors discussed theories but did not state how the design in this study can benefit from these theories to overcome the proposed limitation. This makes it unclear why constructing such mutant-based synthetic consortia can \"minimize negative interactions within consortia\". The author proposed a main scientific question \"whether this should be based on ecological complementarity, division of labor or facilitation between consortia members. (Lines 74-75)\" but this study did not address this question.We have now made our research questions clearer at the end of the introduction.Thirdly, following the above point, a logical connection is missing between the last two paragraphs of the Introduction. In other words, does increasing intra-species diversity benefit the ecological complementarity, division of labor, or facilitation, so reduce the within-community antagonism? In addition, I would expect the authors to explain more about why increasing the intra-species diversity of a single bacterium could prevent conflicts between the consortia members. I think this is the main novelty of this study different from the previous design constructing consortia using different species. I saw some reasons were listed in lines 101-103 but expect more explanations/discussions.We have now rewritten this section of the introduction and give a better justification why we would expect more closely related communities to be less competitive based on kin selection theory (with appropriate references).In sum, the author could do a better job linking theory and experimental design.This is a fair point, and we hope that our revised version makes this link more obvious.ResultsLine 320-322: I think this \"antagonism\" experiment is very important for the novelty of this study. Because the mutants are derived from the same strain, they should show less competition/antagonism within consortia, which is different from the situation in the previous multi-species consortia. Therefore, (1) the data of the \"agar overlay assays\" should be provided in the main text of the paper; (2) It will be beneficial to add more evidence ; (3) It is also very important to examine if the mutants within a consortium stable coexist during the community assembly. Accordingly, the structure of the consortium during/after the assays  should be measured.More data has now been included . Unfortunately, we were not able to quantify changes in mutant frequencies during the experiments as transposon insertions did not include barcodes. We have now made this limitation clear in the discussion.Design/analyses of the consortia experiment: in lines 324-326, the authors hypothesized that \"consortia could show improved performance due to ecological complementarity where different mutants 'specialize' respective to different traits, overcoming trade-offs experienced at individual strain level .\" However, the experiments were concluded with \"mutant consortia diversity was positively linked with consortia performance in vivo, which was associated with consortia mean performance and pathogen suppression measured in vitro. (Lines 354-355)\" Obviously, the hypothesis was not well examined using the current design and analyses. For a direct test of the hypothesis, the authors should compare the performance of the consortia with niche specialization  with that of the others.Please, see our response to point 3. Briefly, we have now conducted additional experiments where we test the plant protection by randomly assembled 8-mutant consortia. These results confirm that randomly constructed mutant consortia perform worse compared to phenotypically \u2018optimized\u2019 consortium.Line 383: I think the conclusion here is less evident. To prove the improvement of the consortia functioning is due to the insurance effects, the performance of the 47-member consortium should be compared to the consortium with fewer members. A more rational design is to build consortia according to the four testing functions. Some consortia contain one mutant specializing in one specific function, while the others contain more mutants for the function . Then compare the root colonization and plant protection ability of the two groups.Please, see our response to point 3 and above.The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.We had substantial internal discussion of the revised manuscript, and we agree that the revisions have been substantial.However, we felt that there is still one important issue that must be carefully considered and addressed. This is regarding the new supernatant experiment, which might not be the best way to infer ecological interactions (please see comments from ref#3) and might lead to misleading interpretations. We agreed that this issue should be clarified before final acceptance of the work. We see two potential options to do so:1) If you wish to firmly conclude that reduced competition among consortia members exists, please include single strain vs. pairwise co-culture experiments followed by colony counts . This might actually require a limited amount of work and would be most appropriate to infer potentially neutral interactions among consortia members.2) Alternatively, you should remove the supernatant data from the manuscript and adopt a more tempered tone for all assertions linked to how \"this study\" enhances our understanding of function by mitigating competition between the consortia members.We thank the Editor and three anonymous reviewers for highly useful feedback on our manuscript. We have now carefully followed all the suggestions and fully revised our manuscript accordingly. While we have not been able to collect more data using CFU counts, we have re-analyzed the data using 50% LB media as control baseline as suggested by the reviewer #3.The main changes include:Discussion behind the reasons why consortia outperform single strains.Reanalysis of pairwise mutant interactions using 50% LB media as the baseline control.Toning down our interpretation on the competition between consortia members throughout the manuscript; supernatant data is used to test if mutants inhibit each other\u2019s growth and references to competition have been removed.Reviewer #2 (Recommendations for the authors):I only have a small suggestion optional to the authors. It might be intriguing to discuss the microscale-level mechanisms behind why the consortium outperforms a single strain. Could the four plant growth-promotion traits act as public goods? For instance, could biofilm formation specialists aid pathogen suppression specialists in better colonizing plants? It may be interesting to add some discussions to the paragraph in lines 497-516.We thank reviewer #2 for positive and very helpful comments. The production of public goods could indeed play a role here and we now mention this on lines 524-529.Reviewer #3 (Recommendations for the authors):Collectively, I am excited to see this manuscript again, as I've been keeping an eye out to see if it had been published in another journal since my first review. It is an intriguing work and I think that many readers in the community will be interested to read it. My primary criticism remains the same as the first review, where ecological interactions are not appropriately measured. I give a detailed explanation of this in Response to R13 (below), along with references that I believe do perform appropriate experiments to measure ecological interactions between strains/genotypes. That said, my other comments appear to be appropriately addressed.Additionally, because much of the narrative of the discussion has been rewritten to avoid direct claims about ecological interactions between the genotypes throughout the text, I no longer believe that an experiment demonstrating ecological interactions is necessary. Figure S5 should be removed, as this is not an appropriate measure of ecological interactions. The data gathered as part of Figure S5 are likely sufficient to still represent these experiments appropriately. If presented appropriately, I strongly suspect that negative interactions will be the predominant interaction type, so it would be up to the authors if they would like to present this data or not.We thank reviewer #3 for positive and very helpful comments. We have now replaced the Figure 3 \u2014figure supplement 2 with a revised one, where we use 50% LB as the baseline control to calculate the relative growth as following formula:600 sup and OD600 LB denote for mutants\u2019 growth in other mutants\u2019 supernatant or in 50% LB after 24h of growth (on lines 691-694).ODThe results show that the biomass production of most strains decreased in the supernatant compared to their growth in 50% LB. While most of these effects were negative (up to 12.7% in magnitude), also some positive effects were observed (up to 7.1% in magnitude). This data has been kept in the manuscript to simply test if insertions affected how mutants shape each other\u2019s growth and references to competition have been removed as suggested.So long as reference to ecological interactions  and Figure S5 are removed from the text , the remainder of this work appears to hold together well, with the text supported by the data.Response to R13:Regarding Figure S5. While supernatant assays are not the preferred method to measure ecological interactions, I appreciate the authors performing an experiment to address this major comment from my first review. However, this is not the appropriate experiment and it does not support the claim that interactions between the different genotypes are neutral.The ideal experiment would be to grow each strain in monoculture and count cfu/mL, then grow each strain in pairwise combination and count cfu/mL of each strain. If it is not possible to selectively plate in order to identify the different genotypes, one could also grow each strain in monoculture and count cfu/mL. Then again repeat growing strains in pairwise co-culture, and count the total cfu/mL. If the interactions are neutral, the prediction is that the total cfu/mL will be the sum of the two strains monoculture cell densities (cfu/mL). One could interpret this as clear niche differentiation, with no interference or exploitative competition. If you are committed to the growth supernatant assay and measuring OD600, you could grow each strain in monoculture, measure final OD600 and then filter the supernatant just as you've done. You can then grow them again in the spend media and measure the final OD600. If the interactions are neutral, then prediction is that growth in monoculture with spent media = growth in monoculture with fresh media. For any strain combination, if growth in monoculture of spent media < growth in monoculture of fresh media, this is a negative interaction.We have now used 50% LB as the baseline control to determine how mutants\u2019 supernatants affect each other\u2019s growth in Figure 3 \u2014figure supplement 2.Unfortunately, it is not satisfactory to infer ecological interactions as a measure of growth in supernatant relative to growth in one's own supernatant. There is full niche overlap when a strain grows in its own supernatant. Using this metric, you could have two different strains with identical nutrient requirements, that will compete with each other for these nutrients, and you would likely measure it as a neutral interaction. It is also challenging when measuring ecological interactions in liquid LB and trying to extrapolate this to interactions in vivo where the host is also present. An experiment like this in liquid LB is probably a good proxy for gauging interactions, but an experiment that is close to the environment of interest would be the most desirable. However, I understand that this can present additional challenges. I also understand that a specific aim of this study is to use in vitro phenotyping in order to optimize consortia functioning. So in that regard, an LB experiment is perhaps appropriate.We fully agree with the reviewer that in vivo environment would be the most appropriate way to test the effect of competition between mutants. Hence, we have toned down our interpretation on the competition between consortia members throughout the manuscript.I hope that this criticism is clear. For a more comprehensive description of methods in this regard, I suggest Foster and Bell, 2012. DOI: 10.1016/j.cub.2012.08.005. Additionally, Weiss et al. ISME 2022 DOI: 10.1038/s41396-021-01153-z performs nice experiments in this regard, using both monoculture vs coculture experiments (quantifying strain abundances with qPCR) as well as spent supernatant assays.And yet, after all of this, after reading the revised discussion, I no longer think that this experiment is essential. Because the authors have removed much of the narrative regarding ecological significance and focused more on the applied aspects of this work, I do not think that these ecologically-focussed experiments are completely necessary. So long as the authors avoid claims of the interactions between genotypes (as I would argue these have still not been appropriately measured), then I don't think this experiment is necessary for this manuscript.We hope that our revisions have now resolved this final outstanding issue. We also want to thank the reviewer for raising this important point and taking time to thoroughly revise our manuscript."}
+{"text": "Connexins and pannexins are transmembrane proteins that can form direct (gap junctions) or indirect  intercellular communication channels. By propagating ions, metabolites, sugars, nucleotides, miRNAs, and/or second messengers, they participate in a variety of physiological functions, such as tissue homeostasis and host defense. There is solid evidence supporting a role for intercellular signaling in various pulmonary inflammatory diseases where alteration of connexin/pannexin channel functional expression occurs, thus leading to abnormal intercellular communication pathways and contributing to pathophysiological aspects, such as innate immune defense and remodeling. The integrity of the airway epithelium, which is the first line of defense against invading microbes, is established and maintained by a repair mechanism that involves processes such as proliferation, migration, and differentiation. Here, we briefly summarize current knowledge on the contribution of connexins and pannexins to necessary processes of tissue repair and speculate on their possible involvement in the shaping of the airway epithelium integrity. Establishment of an apicobasal polarity is essential to produce a functional airway epithelium in terms of vectorial ion transport and innate immune defense. The lining of the normal human tracheobronchial tree is classically described as a pseudostratified, ciliated columnar epithelium with all epithelial cells attached to the basal membrane, whereas only basal cells do not reach the apical surface. Basal cells function as pluripotent stem cells capable of renewing the ciliated epithelium ,2. The oGap junctions are made of connexins that assemble to connexons (or hemichannels) in the membranes of contacting cells, which then dock to each other to form intercellular channels ,8. Undoc2+ and pH, membrane potential, and protein\u2013protein interaction, with specificities depending of the connexin or pannexin type expressed [In humans, the connexin genes consist of 21 members, subdivided into subfamilies alpha, beta, gamma, delta and epsilon, respectively, encoding connexins (Cx) identified by their predicted molecular weight . In contxpressed ,11,12. Ixpressed . Thus, c\u00ae inserts, and grown at an air\u2013liquid interface (ALI) for several weeks to trigger full differentiation towards a mucociliated pseudostratified epithelium [The structure and composition of the airway epithelium differs along the respiratory tract, thereby creating different regions with varying functions. The respiratory tract can be divided into two morphologically distinct regions: the conducting and the respiratory airways . The conducting airway includes the nasal cavity, the pharynx, the larynx, the trachea, and the bronchi. Recent progress in high-throughput techniques for single-cell genomic and transcriptomic analysis has further underlined the complexity of the cell composition of the airway epithelium. Mostly constituted of basal, secretory, and multiciliated cells, these cell types can be genetically subdivided into different populations ,15. Submithelium ,24.In a transcriptomic analysis previously performed by our group on well-differentiated primary human airway epithelial cell cultures , variablThese transcriptional gene expression profiles were not always confirmed at the protein level. Older reports using available antibodies confirmed only the expression of some of these connexins in vitro. For instance, Cx26 and Cx31 are present in basal cells while Cx30 is detected in luminal cells (likely club and multiciliated cells), as reported in primary cultures . Modest As a first line of defense, the integrity of the airway epithelium is necessary to eliminate inhaled debris and microbes by several mechanisms, including mucociliary clearance and innate immunity . InterceGap junctions are also components of the innate immunity defense system, mediating the cell-to-cell spread of proinflammatory and proapoptotic signals depending on the activated-pathogen recognition receptors . In airwConnexins and pannexins may also represent targets to restrict the severity of inflammation. Excessive ATP in ASL from patients with asthma is considered as an inflammatory signal. In this context, blocking Panx1 channels did prevent airway hyperreactivity in an asthmatic mouse model . Medina The airway epithelium is usually quiescent during homeostasis, with low rates of turnover, but has a tremendous capacity to regenerate after injuries induced by allergens, toxins, pathogens, and/or mechanical wounding . The regThe gene expression profile was studied at different stages of repair of the human airway epithelium in response to circular wounding of primary cultures polarized at ALI . Upon woATP potassium channel activation [The regulation of basal cell activation and proliferation is critical for their self-renewal and differentiation to secretory and multiciliated cell lineages. Connexins are expressed in adult stem cells, and their self-renewal capacities have been associated with gap junctions or pannexons function . Upon wotivation ,60,61. Ttivation ,63. ThusCx43 and Cx37 were also shown to regulate cell proliferation in other contexts. For example, the overexpression of Cx43 promotes the proliferation of activated human embryonic stem cells through cyclin-dependent kinases . Cx43-meEpithelial cell spreading and migration represent significant steps of wound repair. It relies on active cell volume regulation and well-coordinated cell\u2013cell and cell\u2013extracellular matrix (ECM) interactions. The multifaceted role of connexins supports their potential involvement in all these cellular processes . For exaCell adhesion orientates the front-to-rear polarity in collectively migrating cells . The higThe barrier function of the terminally differentiated airway epithelium relies on stable cell\u2013cell adhesion complexes, controlled cytoskeleton remodeling, and the establishment of an apicobasal polarity. Although data on the airway epithelium are lacking, functional and physical interaction between connexins and several actors important for the establishment of tissue integrity was reported in other cell models. For instance, intracellular calcium mobilization, calcium wave propagation, and oscillation involved hemichannels and GJIC to trigger actomyosin contractility and cytoskeleton remodeling in the endothelium ,88,89,90It has long been described in the air-conducting human and ferret airway epithelia that Cx26, Cx32, and Cx43 are present during development, and then almost disappear from well-differentiated adult airway epithelial cells ,102. Thi2+ entry or Ca2+ release from the intracellular stores [2+ regulation, and cytoskeleton remodeling suggests a potential role of pannexons in several steps of the epithelium regeneration.Functional pannexons are essential for ATP release to the extracellular environment. The local ATP increase will then activate the ionotropic or the metabotropic purinergic receptors responsible for, respectively, Car stores . Of noter stores ,123,124.2+ entry and activates calmodulin kinase II (CaMKII) and cytoskeleton reorganization. The Panx1-dependent activation of P2 receptors was also shown to regulate skeletal muscle development and regeneration [Multiple studies reported that pannexins positively or negatively modulate wound healing in various contexts ,126,127.neration . In thisneration . Anotherneration . Panx1 eneration . Furtherneration . Thus, i2+ propagation and Src and ERK phosphorylation [A transient increase in Panx1 mRNA expression is observed during airway epithelium repair after wound injury B. Recentrylation . The celrylation ,138. Becrylation . Panx1 crylation . In the rylation . Thereforylation  may afferylation .Synchronized cell proliferation, dynamic cell adhesion, collective cell migration, and coordinated interactions of epithelial cells represent fundamental processes for airway epithelium regeneration. Here, we summarized studies in several cell systems, supporting the view that connexins and pannexins may contribute to these fundamental processes. We also outlined knowledge gaps that need to be filled in relation to the airway epithelium. There is still a considerable lack of molecular evidence defining the precise role of intercellular communication to each step of airway epithelium regeneration. Another fundamental question is to discriminate between the channel-dependent or channel-independent role of connexins and pannexins in repairing airway epithelial cells. In this context, a particular focus must be placed on their localization, as connexins and pannexins can be found in intracellular compartments ,144,145."}