diff --git "a/deduped/dedup_0911.jsonl" "b/deduped/dedup_0911.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0911.jsonl"
@@ -0,0 +1,40 @@
+{"text": "After publication of this work , we noteThe author(s) declare that they have no competing interests.AML designed and coordinated the study, YS oversaw mosquito collections, dissections and rearing, CP conceived and conducted PCR assays, data entry and data analysis, ND assisted with fieldwork design and statistical analysis, and SJL conceived of, and worked on the optimization of the PS-PCR assay."}
+{"text": "Do regional boundaries defined by governments respect the more natural ways that people interact across space? This paper proposes a novel, fine-grained approach to regional delineation, based on analyzing networks of billions of individual human transactions. Given a geographical area and some measure of the strength of links between its inhabitants, we show how to partition the area into smaller, non-overlapping regions while minimizing the disruption to each person's links. We tested our method on the largest non-Internet human network, inferred from a large telecommunications database in Great Britain. Our partitioning algorithm yields geographically cohesive regions that correspond remarkably well with administrative regions, while unveiling unexpected spatial structures that had previously only been hypothesized in the literature. We also quantify the effects of partitioning, showing for instance that the effects of a possible secession of Wales from Great Britain would be twice as disruptive for the human network than that of Scotland. Do regional boundaries defined by governments respect the more natural ways that people interact across space? Beyond its fundamental importance in economic geography 6 nodes and 85.8\u00d7106 undirected links. To safeguard personal privacy, individual phone numbers were anonymized by the operator before leaving storage facilities. Also, each caller's geographic location was specified at the level of spatial units based on a geographic agglomeration of sub-regional switching facility groups (covering 49 km2 on average). Thus the geographic agglomeration acts as a kind of mask, preventing us from being able to pinpoint a customer's address, neighbourhood or village.We started with a telephone data set containing 12 billion calls over a one-month period, estimating more than 95% coverage of the Great Britain's residential and business landlines in that quarter. Using these data and the methodology explained in We assumed that the above network is a measure of human interactions at an individual level over all of Great Britain  British regions (11) \u2014with boundaries that approximately coincide with the traditional ones . Many ofThe most obvious difference between the two maps is that Wales, and to a lesser extent Yorkshire, seem to have been incorporated into regions dominated by the major cities of the West and East Midlands regions, respectively. Moreover, we have also \u201cfound\u201d a new region developing to the west of London. The first finding supports hypotheses that have long circulated in the transport and regional studies literature: detailed commuting data from the 2001 census was used to generate regions where 95% of trips are internal to that region, finding that Wales, in spite of its unique cultural and linguistic heritage, is well integrated with its English neighbours to the East There are other metrics for which the partitioning scores better than NUTS. Per our initial hypothesis our regions would produce fewer disturbances to the network of human interaction. This can be seen in The above partitioning of Great Britain using telecommunication data also suggests the extent to which each region is integrated into the country as a whole. To measure this, we calculate the call time ratio, defined as the percentage of time a region talks to itself. By this measure, Scotland is the region least connected to the rest of Great Britain, followed by North Wales, South Wales and Greater London. What is particularly striking about Scotland is that the call time ratio is 76.7%, meaning that just 23.3% of all call time placed or received in Scotland goes to or comes from another part of the country . Scotland appears to be loosely coupled with the rest of Great Britain in a way that Wales emphatically is not. In other terms, if Scotland and Wales were to become independent from the UK, and if the detrimental effect of the secession were considered proportional to the number of external connections, the effect on people would be approximately twice more disruptive on Wales than Scotland.All of the above analysis is based on the pattern of landline calls, but our method could easily be used on other networks in the future: data from mobile phones could be an indicator of more personal (as opposed to household and business-oriented) human interaction Figure S1Defining regions through the spectral modularity optimization. Results of five different modularity optimization algorithms.(5.66 MB TIF)Click here for additional data file.Text S1Inferring the network of human interactions from calling data.(0.05 MB DOC)Click here for additional data file.Text S2Definition of modularity.(0.19 MB DOC)Click here for additional data file.Text S3Comparing different modularity optimization methods.(0.06 MB DOC)Click here for additional data file.Text S4Subsampling the network data.(0.04 MB DOC)Click here for additional data file.Text S5Comparison with null model.(0.04 MB DOC)Click here for additional data file."}
+{"text": "To detect perfusion abnormalities at an early stage of CAD, myocardial perfusion is often assessed by analyzing cardiac MR perfusion (CMRP) images. A combination of rest and stress-induced perfusion allows assessing the ability of the heart to adapt to physical exercise, quantified as the myocardial perfusion reserve index (MPRI).However, especially in stress MR acquisitions, the inability of a patient to breath-hold may lead to misalignments between subsequently acquired frames  from 10 patients with suspected CAD was used to validate the proposed motion correction method. The registration accuracy of the method was assessed based on annotated myocardium contour locations Figures  and clinMean displacements in the non-registered sequences were 2.46 (rest) and 4.85 (stress) pixels (average pixel size: 1.52 mm isotropic). For the proposed method (FT), these decreased to 0.15 and 0.23 pixels, respectively. However, for the ICA based method these were about 1.76 and 5.08 pixels, an motion increase for the stress sequences.Rest and stress upslope parameters of the proposed method (FT) and the ICA method were compared to expert annotations in Bland-Altman plots Figure  and showWith minimal user intervention (ROI selection in 1 frame), sequences of 50 frames can now be registered automatically in 20 seconds compared to approximately 1 minute required by ICA and 10 minutes required for manual annotation, while robustly determining upslope and MPRI.To our knowledge, the minimal user effort, combined with the robustness of the proposed method make it feasible for the first time to process stress sequences in a clinical setting and use parameters such as MPRI in patient care.Agentschap NL, \"Heart in 3D\" project"}
+{"text": "The pyridinium rings are almost planar [maximum deviations = 0.004\u2005(4) and 0.003\u2005(4)\u2005\u00c5]. The ethyl groups are approximately perpendicular to the corresponding pyridinium ring planes [N\u2014C\u2014C\u2014C = 88.8\u2005(4)\u00b0 in each ligand]. The packing of the mol\u00adecules is controlled by \u03c0\u2013\u03c0 inter\u00adactions, with centroid\u2013centroid distances of 3.625\u2005(3) and 3.711\u2005(2)\u2005\u00c5, forming chains approximately parallel to (102). The crystal studied was non-merohedrally twinned .In the bioactive title compound, [ZnBr DOI: 10.1107/S1600536810052190/sj5050Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
+{"text": "Chlamydia infections are notified at much higher rates in Aboriginal and/or Torres Strait Islander people compared to non-Indigenous people. The Australian Collaboration Chlamydia Enhanced Sentinel Surveillance System (ACCESS) was established to complement population-based surveillance.We describe patient demographics, completeness of recording of Aboriginal and/or Torres Strait Islander  status, chlamydia testing rates and positivity rates from the Aboriginal Community Controlled Health Service (ACCHSs), General Practice (GP) clinics and Sexual Health Services (SHSs) networks in ACCESS during 2009. Data were extracted from electronic medical records of each participating health service for consultations with patients aged 16\u201329 years and for chlamydia testing and positivity.Data were included from 16\u201329 year olds attending six ACCHSs ; 22 SHSs  and 25 GP clinics . Aboriginal status was unknown for 79.3% of patients attending GP clinics, 4.5% attending SHSs and 3.8% of patients attending ACCHSs. Chlamydia testing rates among Aboriginal patients were 19.8% (95%CI:18.6%-21.0%) at ACCHSs, 75.5% (95% CI:72.5%-78.4%) at SHSs and 4.3% (95% CI: 2.6%-6.6%) at GP clinics. Positivity rates were highest in Aboriginal patients tested at SHSs at 22.7% (95% CI:19.5%-26.2%), followed by 15.8% (95% CI:3.8%-43.4%) at GP clinics and 8.6% at ACCHSs (95% CI:7.9%-12.4%). This compared with non-Indigenous patients positivity rates at SHSs of 12.7% (95% CI:12.2-13.2%); 8.6% (7.2%-11.3%) at GP clinics and 11.3% at ACCHSs (95% CI:15.4%-24.9%).Higher chlamydia positivity in Aboriginal people across a range of clinical services is reflected in national notification data. Targeted efforts are required to improve testing rates in primary care services; to improve identification of Aboriginal patients in mainstream services such as GP clinics; and to better engage with young Aboriginal Australians. Chlamydia trachomatis is a sexually transmitted infection that is easily diagnosed and treated, but most infections go undetected since up to 80% are asymptomatic ; Western Australian (WA) Aboriginal Health Information and Ethics Committee; and the Human Research Ethics Committee of the NT Department of Health and Families and Menzies School of Health Research (NT). Approval for the GP network was granted by the Royal Australian College of General Practitioners (RACGP). Approval for the SHS network was granted by the Human Research Ethics Committees (HRECs) of St Vincent\u2019s Hospital and the University of New South Wales with further ethical approval granted by the separate HRECs overlooking each of the 22 participating SHSs.Of the six ACCHS one was located in a metropolitan area and the remaining were in regional/remote areas, whereas the majority of the GP clinics  and SHSs  were located in metropolitan areas.Within ACCHSs 4,950 unique patients aged 16\u201329 years attended during 2009. Of these, 60% were female, 33% were aged 16\u201319 years and 37% were aged 20\u201324 years. In the 25 GP clinics, 34,462 unique patients aged 16\u201329 years attended during 2009; 61% were female, 26% were aged 16\u201319 years and 38% aged 20\u201324 years. In the same year, 20,691 16\u201329 year olds attended the 22 SHSs, of these 48.9% were female; 17% were aged 16\u201319 years and 44% were aged 20\u201324 years (Table\u00a0The majority of patients (85%) attending ACCHSs were identified as Aboriginal, 11% as non-Indigenous, and in 4% this status was not recorded. Of all patients attending GP clinics, 1.3% were recorded as being Aboriginal, 31.2% as non-Indigenous, and for 67.5% of patients Aboriginal status was not recorded. Aboriginal patients comprised, 4.1% of the total patients seen at SHSs, with 91.5% recorded as non-Indigenous and for 4.3% Aboriginal status was not recorded  attending ACCHSs; 4.3% (95% CI:2.6-6.6%) at GP clinics, and 75.5% (95% CI:72.5%-78.4%) at SHSs (p\u2009<\u20090.01)  (72 of 833 patients tested), 15.8% (95% CI:3.4%-39.6%) (3/19) at GP clinics, and 22.7% (95% CI:19.5%-26.2%) (145/638) at SHSs (p\u2009<\u20090.01). Among non-Indigenous people, chlamydia positivity at ACCHS was 11.3% (95% CI:4.7%-22.0%) (7/62), 8.2% (95% CI:6.4%-10.1%) (75/920) at GP clinics, and 12.7% (95% CI:12.2%-13.2%) (1887/14851) at SHSs (p\u2009<\u20090.01) , while those tested at ACCHSs had a positivity rate of 9.4% . Among Aboriginal males chlamydia positivity rates within SHSs was 24.5% (95% CI:19.5%-30.0%) and within ACCHSs 8.1%   and one specialised (SHSs). The study is the first comprehensive analyses, and certainly the biggest that compares Aboriginal/non-Aboriginal populations using the same recruitment methods for both populations. Previous comparisons have been based virtually entirely on notification data, which is subject to variabililty due to dependence on testing uptake.Data from three different types of primary care services are represented, covering a period of 12\u00a0months with over 60,100 patients. Elsewhere, we reported the representativeness of participating sites according to Australian population distributions . AccordiAt the participating services, 4.1% of clients at SHSs were identified as Aboriginal, compared to 1.3% at GP clinics and 85% at ACCHSs. Aboriginal attendances in GPs and ACCHSs from this dataset were consistent with those reported in national audits across all ages, and affirm that young Aboriginal people only make up a small proportion of those attending mainstream encounters the patient identified as sexual health services for STI care and management. Of all patients attending GP clinics in 2011\u20132012 1.5% were identified as Aboriginal  while 78The Aboriginal status of patients was better recorded at ACCHSs and SHSs compared with GP clinics where only one third of patients status was recorded. Improving data quality on Aboriginal status within GP clinics is a priority of Australian Governments  with theThis study confirms that the majority of ACCHSs patients are Aboriginal people and that people aged 16\u201329 years attend these services for health care, including for STI screening. This concurs with two previous studies, the first, a cross sectional survey of young people aged 16\u201329 years where 54% reported that they had an STI test in the previous year and did so at an ACCHS , and a sClosing the Gap funding initiatives particularly involving ACCHSs [Further efforts are required to improve STI testing rates in primary care. Testing rates among Aboriginal patients attending ACCHSs and GP clinics were quite different with testing rates within ACCHS almost five times greater than that offered by GPs for both Aboriginal and non-Indigenous patients. As expected, testing rates were high among both Aboriginal and non-Indigenous patients attending SHSs. There are two main reasons to test for Chlamydia- to screen those who are asymptomatic or to diagnose symptomatic infection. Thus, chlamydia testing rates of services may reflect their adherence to screening protocols, as well as the burden of disease affecting their populations. With regards to screening, clinical practice guidelines recommend that all sexually active people up to the age of 29\u00a0years be offered a chlamydia test at least annually ,23. The g ACCHSs  but do nMathematical modelling has suggested that increasing rates of chlamydia testing to 40% in males and females aged less than 25\u00a0years or to 20% in young people aged less than 30\u00a0years could halve the prevalence of chlamydia within ten years; with most of this decline occurring within the first four years . If the A key strength of this study is that the results reflect actual clinical practice in the participating health services. All data were collected retrospectively and thus did not influence the decision to offer a chlamydia test or not. In addition, within each network, study data were collected from services that are geographically dispersed across the country; thus reducing biases introduced when data are reported from one service or region.A limitation of the study was the poor identification of Aboriginal patients at mainstream GP clinics with more than two thirds of patients having an unknown Aboriginal status. The poor completeness of Aboriginal status in GP clinics means we cannot be confident about the true testing and positivity rates in Aboriginal patients. In addition, the study did not record patients who declined to have a test when offered one. Clinical audits would be needed to measure the extent of decline in any of these primary care facilities. Further, we were not able to identify symptomatic patients from asymptomatic patients making interpretation of positivity results difficult to correlate with community prevalence rates. Only first patient visits involving Chlamydia testing were counted, thus excluding subsequent testing and positivity data. Finally, in view of the small sample size of GP clinics and ACCHSs in the ACCESS network, these findings may not be representative of all such health services because of the small sample size of these clinics in Australia.Closing the Gap initiatives that are directed at mainstream general practice [In conclusion, this study provides a snapshot of chlamydia testing and positivity among young people attending three types of primary care health services. Improved completeness of recording of Aboriginal status should be a priority in GP clinics, not only to evaluate chlamydia testing and prevention programs but also for other practice . QualityThe authors declare that they have no competing interests.JW conceptualized the study. JW, JG, HA and AB conducted the analysis. JW drafted the manuscript with assistance from JG, HA, RJG, SC and BD. JW, JMK, MH, RJG and BD are investigators on ACCESS. All authors contributed to the manuscript and read and approved the final version.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/14/285/prepub"}
+{"text": "It has been challenging to find stable blue organic light emitting diodes (OLEDs) that rely on thermally activated delayed fluorescence (TADF). Lack of stable host materials well\u2010fitted to the TADF emitters is one of the critical reasons. The most popular host for blue TADF, bis[2\u2010(diphenylphosphino)phenyl] ether oxide (DPEPO), leads to unrealistically high maximum external quantum efficiency. DPEPO is however an unstable material and has a poor charge transporting ability, which in turn induces an intrinsic short OLED operating lifespan. Here, an alternative host material is introduced which educes the potential efficiency and device lifespan of given TADF emitters with the appropriateness of replacing the most popular host material, DPEPO, in developing blue TADF emitters. It simultaneously provides much longer device lifespan and higher external quantum efficiency at a practical brightness due to its high material stability and electron\u2010transport\u2010type character well\u2010fitted for hole\u2010transport\u2010type TADF emitters. Eg).EST) between the lowest singlet (S1) and triplet (T1) states. 100% internal quantum efficiency (IQE) has already been realizedmax).\u22122) of 52 h using 9,9\u2032,9\u2033,9\u2032\u2032\u2032\u2010bis)tetrakis(9H\u2010carbazole) (DDCzTrz).\u22122 which is much lower than those of traditional fluorescent OLEDs (\u22485%). Cho et al. reported longer LT80 (100 h) by means of replacing only DDCzTrz with 2,3,4,5,6\u2010penta(9H\u2010carbazol\u20109\u2010yl)benzonitrile.max and long device lifetime simultaneously with blue TADF emitters which are sterically shielded to reduce concentration quenching effect.max. In spite of the very short delayed fluorescence lifetimes of the TADF emitters, their efficiency roll\u2010off is severe. It indicates their poor charge balance and it is mainly caused by their mismatched host, mCBP. We thus believe that there has been no report presenting practically long lifespan with blue TADF OLEDs simultaneously exhibiting sufficiently high EQE at a practical brightness yet although lifespan is as important as efficiency for practical success of OLED technology and it is due to lack of host materials well\u2010fitted to given TADF emitters for effective device engineering to achieve improved charge balance.Blue organic light emitting diodes (OLEDs) can play an important role in displays.Here, we introduce an alternative host material to achieve a high\u2010efficiency and long\u2010lifespan blue TADF OLEDs at a relevant brightness as suggesting the appropriateness of replacing DPEPO with alternative host materials in development of blue TADF emitters.S1, \u2010T1 blue TADF emitters yet. In most papers, DPEPO has been employed mostly because it can boost TADF phenomenon resulting in high EQEmax.max OLEDs were achieved only with the DPEPO providing no device lifespan data while the long\u2010lifespan OLEDs were achieved with mCBP providing no efficiency data. Although DPEPO has been reported as an electron transport (ET)\u2010type host,\u22122) using 5,8\u2010bisphenyl)\u20105,8\u2010dihydroindolocarbazole (BDpyInCz)  because mCBP\u2010CN has an ET\u2010type character with deep LUMO, and so the emitting layer composed of mCBP\u2010CN and the highly doped BDpyInCz works like a mixed host system. The electrons are mainly injected into and transported through the ET\u2010type host material while a considerable number of holes are probably injected into TADF emitters and transported through the percolation pathway composed of the emitters having a hole transporting (HT)\u2010type character in our device Figure b. To achFigure\u22122 are quite lower than those of the DPEPO\u2010based ones  of the mCBP\u2010CN\u2010based TADF OLEDs despite their improved charge balance is induced by severe triplet\u2013triplet annihilation and singlet\u2013triplet annihilation caused by the long excited\u2010state lifetime of BDpyInCz (\u03c4TADF = 32 \u00b5s).Vd) indicating charge trapping.TableVd of the hole\u2010only devices (HODs) of mCBP\u2010CN:BDpyInCz and DPEPO:BDpyInCz compared to those of mCBP\u2010CN and DPEPO  of mCBP\u2010CN:BDpyInCz and DPEPO:BDpyInCz are slightly higher than those of mCBP\u2010CN and DPEPO, respectively  materials.TADF than those of BDpyInCz with mCBP\u2010CN, a longer device lifespan could be accomplished with higher EQE at a relevant brightness. The relative PL intensity after 3 h UV laser exposure and \u03c4TADF of BDpyInCz are 0.78 and 32 \u00b5s, respectively.Because excited\u2010state unstability can be another source of OLED degradation,max, it does not show any relevant performance at the practical brightness, nor even noticeable device lifespan except a report of Cui et al.max of blue TADF OLEDs using DPEPO, which is less meaningful in the practical luminance range for display, we found out another weakness of the DPEPO\u2010based blue TADF study.Although DPEPO lets blue TADF emitters exhibit their highest EQEmax of 8.8% with the same DPEPO\u2010based device structure as the BDpyInCz one phenyl)\u20105\u2010phenyl\u20105,12\u2010dihydroindolo carbazole (DpyInCz). DpyInCz exhibits EQEEST and so to increase RISC is to employ a twisted intramolecular charge transfer (TICT) molecule having different dihedral angles between electron donating and accepting moieties leading to spatial separation of HOMO and LUMO phores.While the EL spectra of DpyInCz\u2010based OLEDs show single peaks for both mCBP\u2010CN and DPEPO Figure b, the PLTADF.TICT molecules, the most popular TADF emitters, have a potential risk that some of them possibly work only with DPEPO or DPEPO\u2010like host materials suppressing dual fluorescence. This bias in selecting a host material leaves no room for utilizing device engineering to educe the potential ability of a given TADF emitter. Because of the limitation, we cannot say the newly reported DpyInCz in this work is practically useful though DpyInCz works anyhow in the DPEPO matrix as a blue TADF emitter. We would thus like to suggest that it is better to replace DPEPO with a stable host well\u2010fitted for a given blue TADF emitter to accelerate the advance of TADF technology. The introduced mCBP\u2010CN successfully replaces DPEPO and helps accomplish a remarkably long lifespan in a blue TADF OLED with high efficiency at a practical brightness as educing the potential ability of a given blue TADF emitter despite its relatively long \u03c4SupplementaryClick here for additional data file."}
+{"text": "Both good communication and presentation skills on the part of an academic teacher are crucial when trying to generate students\u2019 interest in the subject of a lecture. More generally, our task is to share knowledge in the most effective way possible. It is also worth teaching students presentation skills, as today\u2019s students are tomorrow\u2019s teachers. An engaging presentation is a powerful tool. There are some rules for presenting which I consider worthy of being discussed and taught at a medical university. Excellent communication and presentation skills are critical when trying to engage students\u2019 interests in the subject of a lecture. Not only should it be important for us to deliver effective lectures, but also we should share our knowledge with students on how to create and deliver effective lectures for today\u2019s students are tomorrow\u2019s teachers. Programs such as Power Point and Keynote have been in use for a long time, and some would argue that everyone knows how to use them and that it is a routine for anyone to prepare an effective presentation and to share their ideas. However, what we often encounter during classes or scientific events are rather boring and ineffective attempts at communication. This can even be seen in the dynamically evolving and thus fascinating field of oncology, where there is always something new to present. Rows of ciphers or dozens of graphs condensed onto one slide together with the monotonous voice of the presenter will tend to discourage even the most attentive listener. Even if the topic of the presentation concerns the milestones of evidence-based medicine, a poor presentation can veil the essentials. What lies at fault is not the color of the presenter\u2019s tie, but more likely the content/format of the slides and the presenter\u2019s delivery. Both of these are easily improved upon thus enhancing the presentation and reception of the lecture.https://www.ted.com/topics/presentation]. I have since received much more positive feedback from my audiences. This statement may seem rather subjective and can be read as an unfounded claim, but I am also able to see progress in the results of my work as an academic teacher. Regardless, there are some rules for presenting which I consider worthy of being discussed and taught at a medical university. While our students make occasional presentations during their classes, this activity is often avoided. Students consider the value of their presentations to be lower than those given by their lecturers. This is because students are not taught how to present. We should start to remedy this situation at the undergraduate level in order to make their future professional communication clear, elegant, and intelligent. Since finding time in the general curriculum to teach these skills is impossible, one must find alternative means. This can be successfully achieved with the very active subgroups of medical students such as those who participate in our Student Scientific Society, a volunteer organization of students who want to broaden their knowledge. One of the tasks pursued by this group is how to make effective presentations. Some details concerning this organization have been previously presented in this journal [I changed my way of presenting 4\u00a0years ago after being inspired by Garr Reynolds  and TED  journal .During regular monthly meetings, students are encouraged to present a chosen topic in a 20-min talk, prepared either individually Fig.\u00a0 or in smThe number of students actively participating in our Society has increased from 38 in 2011 to 47 in 2012 to 82 in 2013 (I have been a tutor of the Society since 1999). I consider the improvement of my presentation skills to be one of the reasons for this increase in participation by students, as there is a visibly growing proportion of third year students with whom I am in contact. Medical studies in Poland comprise six years and the third year the students follow a module in oncology. This is a time when they can discover the field which interests them. I am convinced that a good presentation is one of the most important elements in attracting their attention.One of the goals of the Society is to design and conduct scientific studies. Students present their results first at our group meetings and are next presented at scientific events  and are sometimes published . Not onl"}
+{"text": "The type I is the most common Chiari malformation in children. In this condition, the lower part of the cerebellum, but not the brain stem, extends into the foramen magnum at the base of the skull leading to disturbances in cerebrospinal fluid circulation and to direct compression of nervous tissue.  We describe a 4-year-old Caucasian female child with febrile seizures, headache, parasomnias, and a delay of speech. The child underwent a magnetic resonance imaging to investigate these neurological signs, disclosing a Chiari malformation type 1. The polysomnography showed a mild-moderate sleep-disordered breathing, increased number of central sleep apneas, and generalized spike waves at sleep onset.  Seizures have been seldom described in CM1 patients. The main reasons for performing MRI in this case were frequent seizures, a delay of speech, and headache, leading to an unexpected diagnosis of CM1. Polysomnography detected a discrete SDB. The type I is the most common Chiari malformation CM1) in children with an estimated incidence of 1 : 1000\u20135000  in child. The lowWe describe a child with seizures and parasomnias whose MRI disclosed CM1. We report the night sleep study showing a sleep-disordered breathing (SDB) and discuss the clinical picture taking into count the literature on this topic.A Caucasian female child had a family history of febrile seizures in both maternal and paternal line ; an older sister had a middle-grade cognitive disability and a disorder of the motor abilities. She was born at-term of uneventful delivery. She reached motor milestones in time; at 2.9 years old, she showed a delay in speech development and febrile seizures. Between the age of 3.3 and 3.8 years, she developed 3 episodes of febrile seizures. From the age of 3.5 years, she presented frequent episodes of a headache localized in the occipital-nuchal region of the skull, sometimes with the nocturnal occurrence that caused reawakening, treated with acetaminophen. She showed frequent night awakenings during which the baby sat on the bed with open eyes and unresponsive to the stimuli or got up and walked around the room with open eyes, producing unintelligible words. The neurological examination showed a delay of speech, but normal cognition . The EEG showed good organization of neurological activity and sporadic generalized spikes and wave discharges during drowsiness. To investigate for an occipital headache, at 3.7 years old, she underwent an MRI that disclosed a CM1 with herniation of the cerebellar tonsils beneath the foramen magnum of 17\u2009mm . She was2 of 97%, smallest SatO2 of 85%, snoring of 3% of total sleep time (TST), and periodic limb movement (PLM) index of 2/hour. Sleep stages were REM stage of 20.2%, N1 of 7.2%, N2 of 40%, N3\u20134 of 32.6%, and arousals in REM stage of 5.4 episodes/hour and in the non-REM stage of 6.8 episodes/hour. At 4 years old (body weight 18\u2009kg (81\u00b0 percentile), length 107\u2009cm (91\u00b0 percentile)), the Pediatric Sleep Questionnaire [The otorhinolaryngology surgeon suggested the adenotonsillectomy and programmed the surgery. We recommended oral melatonin and tryptophan for her disorder of sleep and rectal diazepam at the occurrence of seizures. For the CM1, the neurosurgeon suggested both polysomnography and MRI follow-up.We described here a 4-year-old Caucasian female child with febrile seizures, headache, parasomnias, and a delay of speech. To investigate for headache recurrences, she underwent an MRI, disclosing CM1. A night polysomnography showed mild-moderate SDB, increased number of CSAs , 10, genThe prevalence of SDB reported in the literature for CM1 was high. Among children and adolescents, the prevalence of SDB by polysomnography varies between 24 and 49% , 14. SDBAASM reported the role for scoring of CSAs . In addiSeizures are seldom described in children with CM1. In particular, Brill et al. reported 11 children with CM1 who presented with seizures, as a marker for subtle cerebral dysgenesis, and a developmental delay in motor or language ability with or without autistic features . So, it In conclusion, we report a CM1 pediatric case in which parasomnias (somnambulism) and recurrent headache are associated with febrile seizures and SDB. A night sleep study by polysomnography can be a suitable method in CM1 patients to assess for both CSAs and OSAs, paroxysmal activity, and sleep quality and to decide for further clinical workup."}
+{"text": "A School of Nursing supports third-year undergraduate students (mentees) by means of a mentoring programme in which critical-care nursing students (mentors) are involved. However, the programme designers needed to find out what gaps were evident in the programme.The objectives of the study were to explore and describe the learning experiences of the mentees and mentors and to obtain recommendations for improving the programme.An action-research method was used to develop and to refine the student-mentoring programme and to identify student needs. However, for the purposes of this article a descriptive design was selected and data were gathered by means of a nominal-group technique. Fourteen mentees and five mentors participated in the research.The findings indicated that attention should be paid to the allocation and orientation of both mentors and mentees. Amongst the positive experiences was the fact that the mentees were reassured by the mentor's presence and that a relationship of trust developed between them. In consequence, the mentees developed critical thinking skills, were able to apply their knowledge and improved their ability to integrate theory and practice. Not only did the mentees gain respect for the mentors\u2019 knowledge and competence, but they also lauded the mentoring programme as a memorable and vital experience.The findings indicated that several changes would be needed to improve the structure of the mentoring programme before a new group of mentees could be placed in critical-care units. The School of Nursing in the Free State Province of South Africa has a student-mentoring programme (SMP) which addresses the social, academic and clinical needs of undergraduate nursing students through the implementation of different strategies. These strategies include pairing first-year students with third-year students in order to support them during their first placement in the clinical environment, or by using senior nursing students with exceptionally high marks in anatomy, chemistry or microbiology to support students who struggle with these subjects. This article focused on the support rendered by post-basic nursing students enrolled in the critical-care nursing programme to third-year undergraduate nursing students placed in the critical-care units so as to assist them in meeting the module outcomes. In the post-basic critical-care programme, students are required to be involved in the clinical teaching of third-year undergraduate students. Prior to their placement in the different critical-care units, the third-year students (mentees) and critical-care nursing students (mentors) are briefed on their different roles and responsibilities. A structured guideline stating, for example, the outcomes that should be met by both mentors and mentees is also provided. Twelve mentors were available to facilitate 55 mentees and each mentor was scheduled to spend at least 48 hours with each mentee during the month the mentee was placed in the critical-care unit.et al.The utilisation of mentor support in the academic and clinical environments is described in the research literature. Mentor support was seen as being central to a Clinical Practice and Placement Support Unit (CPPSU) developed at the University of Dundee, Scotland. Not only did mentors provide direct support to enhance the development of clinical skills, but they also \u2018engage the student in critical thinking, reflection on practice and an exploration of alternative strategies to care\u2019  and Wilson et al. :154. MenIn 2009, the facilitators of the third-year undergraduate and the post-basic critical-care nursing students decided to link the extensive support that should be rendered to third-year nursing students (mentees) during their placement in the critical-care clinical environment with the module requirements for clinical teaching of the post-basic critical-care nursing students.The decision to provide extensive support to the third-year nursing students was based on research findings that students experienced a \u2018lack of teaching and learning support\u2019 and \u2018poor theory-practice integration\u2019  to explore and describe the learning experiences of third-year undergraduate and post-basic critical-care nursing students who were involved in the School of Nursing's student mentoring programme in 2010; and (2) to make a number of recommendations based on the feedback received.Ontology is referred to as \u2018a theory of being, how we see ourselves\u2019 (McNiff & Whitehead Mentoring is defined by Hawkins and Fontenot (2010) . Through this technique, creative ideas were generated, the results interpreted and the available time used efficiently  and 12 post-basic nursing critical-care students (mentors) registered at a University.et al. et al. et al. The unit of analysis is the type of unit, for example, individuals, organisations, or groups that researchers use when measuring variables  third-year mentees and 5 (5/12) post-basic critical-care nursing mentors who were willing to participate were included in the nominal-group discussions.et al.et al.Because a nominal-group technique (NGT) is a \u2018structured method that encourages contributions from everyone\u2019 Tague :364\u2013365,et al. A four-step process was used to conduct the nominal-group interviews: generating; capturing or sharing of data; discussing and clarification; and voting on categories to establish priorities  were exposed to the mentor was too short for the amount of information that needed to be disseminated. The mentors agreed that for them, \u2018it was better to mentor students for a shift rather than an hour\u2019. From the perspective of mentors working in critical-care units, the number of mentees that was allocated could make it difficult to assist them all.The research findings clearly indicated that mentoring facilitated the participating mentees\u2019 ability to correlate and apply theory in a critical-care environment. The mentors confirmed that the mentees\u2019 demonstrated skills such as critical thinking and the application of knowledge. The mentors were also convinced that they were able to provide the mentees with the opportunity to experience evidence-based practice.t]he mentees were always willing to help to make the flow of the unit easier, for example to address basic needs\u2019. Unfortunately, instances where mentees did not meet the expectations of mentors were also experienced. According to the mentors, some students did not show enough interest and came unprepared to the clinical areas.The mentors valued certain characteristics in their mentees and voiced their appreciation of the mentees\u2019 attitudes toward their clinical responsibilities, stating, \u2018he mentees felt reassured due to the fact that the mentors were there\u2019. However, when the mentors had other responsibilities, such as going on doctors\u2019 rounds, they had to trust the mentees to provide the necessary care.The mentors agreed that the mentees appreciated their presence, stating, \u2018he mentor did not know how important the outcomes were and did not organise support from other critical-care unit staff [referring to permanent staff members] to provide help in order to obtain outcomes\u2019. Despite the mentees\u2019 concerns, being mentored was still described as good experience, despite the fact that little time  was spent with the mentors.The mentees perceived the limited availability of the mentors as being problematic. In some cases, the mentors were available only very late in the year or not available at all. Mentees mentioned that they were placed with the mentors in October for the first time. Furthermore, the mentees stated that the registered nurse in the unit had to explain the work because the mentors had not been there. Achieving the stated outcomes seemed to be an important issue for the mentees and they were concerned about the fact that the mentors seemed to be unaware of how important the outcomes were, stating, \u2018atrons must be made aware that you are in a mentoring programme and allocate you to the mentor\u2019.It was further evident from the research that much more effort had to be made when dealing with the day-to-day critical-care unit staff. The tendency to use mentees and mentors for daily activities did create problems with regard to the outcome of the programme. It was reported that the responsibility of the mentoring programme coordinator is to inform the matrons responsible for training. The mentees felt that, \u2018[i]t will be nice if other disciplines also become involved in mentoring\u2019.Facilitation and coordination of the involvement of a multidisciplinary team in the training of nurses are difficult. However, as suggested by the mentors, the possibility of involving other members of a multidisciplinary team in a SMP should be investigated. According to the mentors, \u2018entoring should be voluntary \u2013 some nurses do not want to be mentors\u2019. The mentees requested that the selection of mentors be done with care.The mentees suggested that more attention be paid to the selection process. The group confirmed that \u2018[Both mentors and mentees mentioned both positive and negative experiences and were more than willing to make recommendations to improve the quality of the existing programme.et al.From the research findings, it is evident that careful consideration should be given to the preparation and orientation, not only of mentors and mentees, but also of unit staff and unit managers. Wilson, Sanner and McAllister :144 haveet al. (The mentees who participated in our study definitely viewed as important the orientation or guidance that critical-care unit mentors received before they were allocated to third-year mentees. Giordana and Wedin :395, Denet al. :333 confet al. .Allocations, specifically with regard to the duration or number of hours that mentees should spend with the mentor, were also addressed by other researchers. Taylor and Neimeyer\u2019s :260, 262The outcomes stated in a mentoring programme are crucial. For example, when it comes to the development of critical thinking and the application of knowledge, the value of mentoring cannot be ignored. Dennison :340 listCareful selection of mentors was requested by mentees in the current study. During the selection process, the characteristics of the mentees, their ability to provide support and to act as role models, should be considered. Naturally, mentors should also be selected based on their competencies or skills.The characteristics and supportive role of mentors, as mentioned by mentees in the current study, were researched extensively. Dennison :340, Feret al. (et al.Wilson et al. :144 have. et al.. Tobin (. et al.:116 writet al.The above views are reflected in several research reports (Byrne & Keefe Mentors also benefit from being involved in a SMP. In addressing the needs of mentees, mentors are also challenged regarding their own knowledge and skills and encouraged to make time to revisit the available resources. The finding that mentors have the need to update their knowledge is confirmed by Dennison :341. Peeet al. (The value of being mentored is also confirmed in other studies. Dennison :340 descet al. :145\u2013147.The disadvantages that were considered were the limited number of topics and issues that can be covered; the limited opportunity for participants to think about the issues; and the lack of anonymity, which may limit participants\u2019 willingness to express their views Jones :23\u201324.Despite the fact that the SMP still requires attention with regard to logistics, both mentees and mentors seemed to have benefitted from being involved in the programme. The insights gained, for example, with regard to the number of mentees allocated to a mentor, the number of hours mentees should spend with mentors, orientation concerning the different roles and the request for a multidisciplinary approach could be used to improve the quality of support rendered to both mentees and mentors. It is hoped that, in future, students\u2019 needs and throughput will also be addressed in the process."}
+{"text": "Background and Objective. Current cardiovascular disease (CVD) risk models are typically based on traditional laboratory-based predictors. The objective of this research was to identify key risk factors that affect the CVD risk prediction and to develop a 10-year CVD risk prediction model using the identified risk factors. Methods. A Cox proportional hazard regression method was applied to generate the proposed risk model. We used the dataset from Framingham Original Cohort of 5079 men and women aged 30-62 years, who had no overt symptoms of CVD at the baseline; among the selected cohort 3189 had a CVD event. Results. A 10-year CVD risk model based on multiple risk factors , hypertension, systolic blood pressure (SBP), cigarettes per day, pulse rate, and diabetes) was developed in which heart rate was identified as one of the novel risk factors. The proposed model achieved a good discrimination and calibration ability with C-index (receiver operating characteristic (ROC)) being 0.71 in the validation dataset. We validated the model via statistical and empirical validation. Conclusion. The proposed CVD risk prediction model is based on standard risk factors, which could help reduce the cost and time required for conducting the clinical/laboratory tests. Healthcare providers, clinicians, and patients can use this tool to see the 10-year risk of CVD for an individual. Heart rate was incorporated as a novel predictor, which extends the predictive ability of the past existing risk equations. Cardiovascular disease (CVD) describes various conditions that affect the functioning of heart/cardiovascular . Due to Majority of cardiovascular-related deaths are premature and preventable and can be improved by effective health management by employing effective diet plans, lifestyle interventions, and drug intervention . To prevIn the past decades, a great deal of research has been done on the CVD risk estimation such as the Framingham risk scores from the Framingham Heart Study (FHS) , 7, the However, challenges and issues regarding the development of CVD risk estimation models still exist. CVD risk models \u201318 are bThe study population selected from the Framingham Original Cohort study dataset , 29. We There are 32 exams in the Framingham Original Cohort study dataset, as shown in  survival analysis, i.e., nonparametric, semiparametric, and parametric [Cox proportional hazard regression analysis  was selerametric . The nonrametric , 32. Botrametric . Howeverrametric . The Coxrametric , but a p Multiple Imputation [ transcan inside the \u201cHmisc\u201d package was used [Statistical analyses were performed in R Studio platform . Missingputation . Continuputation . R functwas used .For candidate predictors listed in In the validation stage, two approaches were undertaken to assess the predictive ability of our fitted model, statistical validation, and empirical validation. The statistical validation was performed with respect to both discrimination and calibration. The empirical validation was defined as an empirical comparison with a general CVD risk prediction model (the Framingham office-based risk equation ) in a hoRisk factors included in the risk model are age, sex, body mass index (BMI), hypertension, systolic blood pressure (SBP), cigarettes per day, pulse rate, the status of diabetes. Characteristics of risk factors were listed in basehaz)) is 0.9027267 at mean values and 0.9981381 at all covariates equal to zero.The regression coefficients, hazard ratios, and their corresponding upper and lower 95% confidence intervals (CI) were estimated, as presented in \u03bb(t) is the hazard function for a subject at time t, determined by a set of m covariates ; \u03b21, \u03b22,\u2026\u03b2k are the regression coefficients that measure the effect size of covariates; exp is the exponential function (exp\u2061(X) = ex); \u03bb0(t) is the baseline hazard rate, an arbitrary (unknown) function, corresponding to the value of the hazard when all Xi equal zero.The Cox model has an exponential form (see Equation ), where So, the Cox model can be written as a survival function:A general formula for computing risk estimates has the following form:\u03b2i is the regression coefficient , where H(t) is the CVD risk estimated for an individual; S0(t) is baseline survival rate at follow-up time t, where t = 10 years see , \u03b2i is tient see , Xi is tved from , using rA nomogram is a two-dimensional diagram to represent a mathematical function involving several predictors . It is aIn The validation of the proposed predictive risk model was performed using traditional statistics. C-index  area)  was used min (lower whisker), 1st quartile (the lower hinge), median, 3rd quartile (the upper hinge), and max (the extreme of the upper whisker) of estimated risks for all samples are depicted in Then, we performed an empirical validation by comparing our risk model with the Framingham Heart Study model in an external dataset horizontally and longitudinally over time. In the horizontal validation process, there were 2786 samples in the external dataset, and 1693 samples have got a CVD event. Risk scores using the FHS model and the proposed risk model were computed separately. Statistics ofIn the longitudinal validation process, we selected four sex-specific subjects with or without CVD at the end of the Framingham Study. A summary of these four subjects is listed in For each sample, data with fixed time intervals (approximately two years) from longitudinal time follow-up are extracted. The data from five exams  are extracted for comparison. Data summary for sample 1, sample 2, sample 3, and sample 4 are listed in It is widely accepted that CVD has become one of the significant public health issue globally , 43 and Motivated by the objective of early detection and risk estimation of CVD, the present study was designed to identify novel CVD risk factors, determine the effect of these factors, and then develop a risk prediction model based on the identified factors. Although risk factors could vary from one specific CVD component to another, there is sufficient evidence that different types of CVD have commonalities of risk factors. We developed and validated a 10-year risk equation for CVD risk using follow-up data rigorously measured by the Framingham Heart Study.This investigation extends the number of risk factors by the previous general CVD risk formulations, incorporating heart rate to estimate absolute CVD risk. The approach used in this research is based on advanced statistical techniques that allow reducing the bias in the assessment of true CVD risk. The whole process of data analysis strictly follows the guideline of regression modelling strategies and survival analysis , 52.We use continuous variables  to generate the model that performs better than other similar models developed using categorical variables. Compared with simpler approaches that try to make inferences of 5-year and 10-year risk models such as the model based on logistic regression analysis  and the The old version Framingham general CVD risk function  is usefuRisk models formulated by using machine learning or data mining techniques have incorporated heart rate as a risk factor but tools that can predict CVD absolute risk are fewer. For example, a prediction tool  focuses Some equations only focused on specific CVD outcomes. The Europe SCORE project equations were developed for the fatal cardiovascular event . These rMoreover, compared with the laboratory-based algorithms, the present research proposed a more straightforward way to estimate 10-year CVD risk based on risk factors. An individual can assess his or her CVD risk during an office visit or his monitoring of the combination of risk factors in the risk model, either manually or use some devices like wearable sensors.The CVD risk prediction model could be implemented at the primary care for population analysis and identifying the high-risk individual. This would be a transformation in healthcare management of CVD at an individual as well as at a population level. However, with a small event size of diabetes, caution must be applied to the practice of this risk model. Even though we have used multiple imputation methods to impute the missing values for diabetes, the original feature of data in-balance, which decides that the imputed data frame for the \u201cdiabetes\u201d might still have a data in-balance there. Advanced imputation methods need to be considered in the future for avoiding unexpected outcome caused by the diabetes data in-balance.Our research aims to provide a CVD prediction model based on key risk factors, so that it can be used at the point-of-care for better and informed decision making. Thus, risk factors based on a clinical test such as total cholesterol, HDL cholesterol were not included, but some of these risk factors have a substantial effect on the development of CVD. We have provided a valid framework for creating a risk model using the Cox regression model; future work should consider risk factors not included in our model at this moment. Thus, expanding more predictors into the risk model is an important issue for future research.The proposed study devised a risk prediction model based on multivariable predictors. A novel risk factor \u201cheart rate\u201d was incorporated into this risk equation by conventional risk factors. A satisfying predictive ability with C-index (AUROC) of 0.71 was obtained, which ensures the accuracy of estimating risk scores. Compared with studies focusing on specific diseases, the proposed algorithm can be applied to measure the 10-year risk of CVD. Health care professionals, public health physicians, practice managers, and individuals can run the proposed model to quantify risk at a population level, during patient consultation and identify high-risk individuals for further preventive health care for the entire practice."}
+{"text": "Identifying people at risk of cardiovascular diseases (CVD) is a cornerstone of preventative cardiology. Risk prediction models currently recommended by clinical guidelines are typically based on a limited number of predictors with sub-optimal performance across all patient groups. Data-driven techniques based on machine learning (ML) might improve the performance of risk predictions by agnostically discovering novel risk predictors and learning the complex interactions between them. We tested (1) whether ML techniques based on a state-of-the-art automated ML framework (AutoPrognosis) could improve CVD risk prediction compared to traditional approaches, and (2) whether considering non-traditional variables could increase the accuracy of CVD risk predictions.AutoPrognosis, an algorithmic tool that automatically selects and tunes ensembles of ML modeling pipelines . We compared our model with a well-established risk prediction algorithm based on conventional CVD risk factors (Framingham score), a Cox proportional hazards (PH) model based on familiar risk factors , and a Cox PH model based on all of the 473 available variables. Predictive performances were assessed using area under the receiver operating characteristic curve (AUC-ROC). Overall, our AutoPrognosis model improved risk prediction  compared to Framingham score , Cox PH model with conventional risk factors , and Cox PH model with all UK Biobank variables . Out of 4,801 CVD cases recorded within 5 years of baseline, AutoPrognosis was able to correctly predict 368 more cases compared to the Framingham score. Our AutoPrognosis model included predictors that are not usually considered in existing risk prediction models, such as the individuals\u2019 usual walking pace and their self-reported overall health rating. Furthermore, our model improved risk prediction in potentially relevant sub-populations, such as in individuals with history of diabetes. We also highlight the relative benefits accrued from including more information into a predictive model (information gain) as compared to the benefits of using more complex models (modeling gain).Using data on 423,604 participants without CVD at baseline in UK Biobank, we developed a ML-based model for predicting CVD risk based on 473 available variables. Our ML-based model was derived using Our AutoPrognosis model improves the accuracy of CVD risk prediction in the UK Biobank population. This approach performs well in traditionally poorly served patient subgroups. Additionally, AutoPrognosis uncovered novel predictors for CVD disease that may now be tested in prospective studies. We found that the \u201cinformation gain\u201d achieved by considering more risk factors in the predictive model was significantly higher than the \u201cmodeling gain\u201d achieved by adopting complex predictive models. Globally, cardiovascular disease (CVD) remains the leading cause of morbidity and mortality . CurrentExisting risk prediction algorithms are typically developed using multivariate regression models that combine information on a limited number of well-established risk factors, and generally assume that all such factors are related to the CVD outcomes in a linear fashion, with limited or no interactions between the different factors. Because of their restrictive modeling assumptions and limited number of predictors, existing algorithms generally exhibit modest predictive performance , especiaHere, we aim to assess the potential value of using ML approaches to derive risk prediction models for CVD. We analyzed data on 423,604 participants without CVD at baseline in UK Biobank, a large prospective cohort study in which participants were recruited from 22 centers throughout the UK. We used a state-of-the-art automated ML method (AutoPrognosis) to develop ML-based risk prediction models and evaluated their predictive performances in the overall population and clinically relevant sub-populations. In this paper, we do not focus on the algorithmic aspects of the ML methods involved and rather focus on their clinical application. Methodological details on our automated ML algorithm can be found in our technical publication in .Participants were enrolled in the UK Biobank from 22 assessment centers across England, Wales, and Scotland, during the period spanning from 2006 to 2010 .The UK Biobank dataset keeps track of a large number of variables for each participant, but most of those variables are missing for most patients. In order to include the maximum possible number of (informative) variables in our analysis, we included all variables that are missing for less than 50% of patients with CVD outcomes. This corresponded to a rate of missingness of 85% for the entire population of participants. Our rationale for assessing the missingness rate among patients with CVD is that missingness itself maybe informative . By excluding all variables that were missing for more than 85% of the participants, a total of 473 variables were included in our analysis. We categorized all variables in the UK Biobank into 9 categories: health and medical history, lifestyle and environment, blood assays, physical activity, family history, physical measures, psychosocial factors, dietary and nutritional information, and sociodemographics . The ca Tables.The primary outcome was the first fatal or non-fatal CVD event. A CVD event was defined as the assignment of any of the ICD-10 diagnosis codes F01 (vascular dementia), I20-I25 (coronary/ischaemic heart diseases), I50 , and I60-I69 (cerebrovascular diseases), or any of the ICD-9 codes 410-414 (ischemic heart disease), 430-434, and 436-438 (cerebrovascular disease). Follow-up data was obtained from the hospital episode statistics , and the equivalent datasets in Scotland and Wales .https://www.framinghamheartstudy.org.)At the time of conducting this study, the UK Biobank had not yet released data on the participants\u2019 total cholesterol, HDL cholesterol and LDL cholesterol, which are used as predictors in various established algorithms, such as Framingham score , ACC/AHAMissForest non-parametric data imputation algorithm [The Framingham score is based on 7 core risk factors: gender, age, systolic blood pressure, treatment for hypertension, smoking status, history of diabetes, and BMI. All of those variables were complete for the participants in the extracted cohort, with the exception of systolic blood pressure (missing for 6.8% of the participants), and BMI (missing for 0.62% of the participants). We used the lgorithm  to recovlgorithm ). The nuWe evaluated the performance of two Cox Proportional Hazards (PH) models derived from the analysis cohort: a model that only uses the traditional 7 risk factors used by the Framingham score, and a model that uses all of the 473 variables in the UK Biobank. To fit the Cox PH models, we imputed the missing data using the MissForest imputation algorithm (with 5 imputations). The Cox PH model that uses the traditional 7 risk factors used by Framingham score can be thought of as a variant of Framingham score calibrated to the UK population . For the Cox PH model that uses all of the 473 predictors, we applied variable selection using the LASSO method . (VariabWe considered 5 standard ML benchmarks that cover different classes of ML modeling approaches. The models under consideration are: linear support vector machines (SVM)   [To train our model, we set AutoPrognosis to conduct 200 iterations of the Bayesian optimization procedure in , where iimators) , and sigpost-hoc approach to rank the contribution of the different variables in the predictions issued by the model. The ranking is obtained by fitting a random forest model with the participants\u2019 variables as the inputs, and the predictions of our model as the outputs, and then assigning variable importance scores to the different variables using the standard permutation method in [In order to identify the relative importance of the 473 variables used to build our model, we use a ethod in . Using tethod in . Other vethod in ) entail To disentangle the \u201cmodeling gain\u201d achieved by utilizing ML-based techniques from the \u201cinformation gain\u201d achieved by just using more variables, we created a simpler version of AutoPrognosis that only uses the same 7 core risk factors  used by the existing prediction algorithms. In addition, we created another version of the AutoPrognosis model that uses only non-laboratory variables in UK Biobank.In order to avoid over-fitting, we evaluated the prediction accuracy of all models under consideration via 10-fold stratified cross-validation using area under the receiver operating characteristic curve (AUC-ROC). In every cross-validation fold, a training sample  was used to derive the Cox PH models, standard ML models, and our model (AutoPrognosis), and then a held-out sample  was used for performance evaluation. We report the mean AUC-ROC and the 95% confidence intervals  for all models. The calibration performance of our model was evaluated via the Brier score.A total of 423,604 participants had sufficient information for inclusion in this analysis. Overall, the mean (SD) age of participants at baseline was 56.4 (8.1) years, and 188,577 participants (44.5%) were male. Over a median follow-up of 7 years , there were 6,703 CVD cases. The mean age of CVD cases was 60.5 years (60.2 years for men and 61.1 years for women). Because the minimum follow-up period for all participants was 5 years, we evaluated the accuracy of the different models in predicting the 5-year risk of CVD. At a 5-year horizon, the total number of CVD cases was 4,801.p < 0.001). The improvement achieved by the Cox PH model that uses the same predictors used by the Framingham score is due in part to the fact that the Cox PH model is directly derived from the analysis cohort, whereas the Framingham score coefficients were derived from a different population.The prediction accuracy of the different models under consideration evaluated at a 5-year horizon is shown in p < 0.001), which suggests that the automated ML system managed to automatically select and tune the \u201cright\u201d ML model.  Compared to the most competitive benchmark , the net re-classification index (NRI) was +12.5% in favor of AutoPrognosis. AutoPrognosis trained only with the 7 conventional risk factors still outperformed the baseline Framingham score (p < 0.001).With the exception of support vector machines, all the standard ML models achieved statistically significant improvements compared to the baseline Framingham score. Furthermore, when compared to the Cox PH model that uses all variables, neural networks, AdaBoost, gradient boosting, and AutoPrognosis all achieved a significantly higher AUC-ROC. AutoPrognosis achieved a higher AUC-ROC compared to all other standard ML models , and is superior to the model that only uses laboratory-based variables.Most of the variables in the UK Biobank are non-laboratory variables collected through an automated touchscreen questionnaire about lifestyle, clinical history and nutritional habits. We evaluated the accuracy of AutoPrognosis once when it is trained with 369 variables corresponding to the participants\u2019 self-reported information (questionnaires) only, and once when it is trained with 104 variables obtained from blood assays, diagnostic tests, and physiological measurements. As we can see in In order to better assess the clinical significance of our results, we compared the AutoPrognosis model with the traditional Framingham score in predicting 7.5% CVD risk (threshold for initiating lipid-lowering therapies recommended by the NICE guidelines ). At thip < 0.001). On the contrary, AutoPrognosis maintained high predictive accuracy for the diabetic population .Among the 423,604 participants included in our cohort, a total of 17,908 participants (4.22%) had a known history of diabetes (either Type 1 or Type 2) at baseline. In The variable ranking for the diabetic sub-population is provided in In order to evaluate the individual predictive ability of the UK Biobank variables, we exhaustively fitted simple versions of our AutoPrognosis model for each of the 473 variables. For each such model, we use one distinct variable as an input and evaluate the resulting AUC-ROC. Because most variables are correlated with age and gender, we use the age variable as a second predictor for all models, and fit separate models for men and women. The AUC-ROC values of the resulting models are depicted in the scatter-plot in As shown in In this large prospective cohort study, we developed a ML model based on the AutoPrognosis framework for predicting CVD events in asymptomatic individuals. The model was built using data for more than 400,000 UK Biobank participants, with over 450 variables for each participant. Our study conveys several key messages. First, AutoPrognosis significantly improved the accuracy of CVD risk prediction compared to well-established scoring systems based on conventional risk factors and currently recommended by primary prevention guidelines (Framingham score). Second, AutoPrognosis was able to agnostically discover new predictors of CVD risk. Among the discovered predictors were non-laboratory variables that can be collected relatively easily via questionnaires, such as the individuals\u2019 self-reported health ratings and usual walking pace. Third, AutoPrognosis uncovered complex interaction effects between different characteristics of an individual, which led to recognition of risk predictors that are specific to certain sub-populations for whom existing guidelines were providing unreliable predictions.The abundance of a large number of informative variables in the UK Biobank (473 variables) guarantees an \u201cinformation gain\u201d that can be achieved by any data-driven model, including the standard Cox PH model, compared to the existing prediction algorithms that use only a limited number of conventional risk factors . The results in While the information gain appeared to be more significant than the modeling gain in our experiments, we note that even when provided with the same 7 core risk factors used by the Framingham score, AutoPrognosis was still able to offer a statistically significant AUC-ROC gain compared to the Framingham score and a Cox PH model that uses the same 7 variables. This shows that the modeling gain is not necessarily limited to settings where many predictors are available and numerical robustness, but is rather achievable whenever a small number of predictors display complex interactions.Because not every ML model would necessarily improve over the Framingham score or the simple Cox PH model, our usage of the AutoPrognosis algorithm was essential for realizing the full benefits of ML modeling. As the results in Individuals in developed countries tend to seek out health information through online resources and web-based risk calculators . In deveOne remarkable finding in Unlike the Framingham score, AutoPrognosis was able to maintain high predictive accuracy for participants diagnosed with diabetes at baseline . This suIt is worth mentioning that the microalbumin in urine measures were available for only 125,406 participants in the overall cohort (29.6%). In a standard prognostic study, such a variable may get omitted from the analysis because of its high missingness rate. AutoPrognosis automatically recognized that this variable is relevant for diabetic patients, and hence did not omit it in its feature processing stage.The main limitation of our study is the absence of the cholesterol biomarkers  from the latest release of the UK Biobank data repository, which hindered direct comparisons with the QRISK2 scores currently recommended by the NICE guidelines. Furthermore, other blood-based biomarkers have been reported to be associated with CVD risk, but were also not yet released in the UK Biobank data repository, such as triglycerides , measureAnother limitation of our study is that the UK Biobank cohort is ethnically homogeneous: 94% of the participants were of white ethnicity. Hence, assessment of the importance of ethnicity as a predictor of CVD events and the recognition of ethnicity-specific risk predictors was not possible in our study.S1 Table(PDF)Click here for additional data file.S2 Table(PDF)Click here for additional data file.S3 Table(PDF)Click here for additional data file.S4 Table(PDF)Click here for additional data file.S5 Table(PDF)Click here for additional data file.S6 Table(PDF)Click here for additional data file.S7 Table(PDF)Click here for additional data file.S8 Table(PDF)Click here for additional data file.S9 Table(PDF)Click here for additional data file.S1 Appendix(PDF)Click here for additional data file.S2 Appendix(PDF)Click here for additional data file."}
+{"text": "The aim of this study was to identify the minimum effective sequence of RH that is still able to inhibit tumor growth and could be used as a peptide-based drug for therapy.  The RH domain of GRK5 is an effective modulator of cancer growth through the inhibition of NF\u03baB signaling and its dependent phenotypes were evaluated by Western blot, TUNEL assay, proliferation assay, and angiogenesis in vitro. In vivo experiments were performed in KAT-4 xenografts in Balb/c nude mice.  Starting from the RH sequence, small peptides were cloned and tested in KAT-4 cells. The effects on NF\u03baB, to increase I\u03baB levels, to induce apoptosis, to inhibit KAT4-cell proliferation, NF\u03baB activation, ROS production, and angiogenesis in vitro. In vivo, the peptide inhibited tumor growth in a dose-dependent manner. We also tested its effects in combination with chemotherapeutic drugs and radiotherapy. RH10 ameliorated the antitumor responses to cisplatin, doxorubicin, and ionizing radiation.  A minimum RH ten amino acids long sequence (RH10) was able to interact with I Our data propose RH10 as a potential peptide-based drug to use for cancer treatment both alone or in combination with anticancer therapies. We have previously identified a new inhibitor of NF\u03baB activity, the RH domain of G protein-coupled receptor kinase 5 (GRK5), that is effective in several cell types, including cancer cells [\u03baB\u03b1, the main inhibitor of NF\u03baB, blocks its degradation in response to stimuli, and keeps NF\u03baB in an inactive state [\u03baB inhibition.Radiotherapy and chemotherapy are the currently available therapeutic treatments for cancer . In the gression , 13. Ind cancers \u201323. More cancers . Targetier cells \u201328. Indeve state . The strve state  and in cve state . However2.Human tumor cells (KAT-4) were a kind gift of Prof. Illario . Bovine aortic endothelial cells (BAEC) were purchased from Sigma-Aldrich. Cells were tested for mycoplasma contamination. Cell lines were cultured in Dulbecco's Minimal Essential Medium (DMEM) supplemented with 10% foetal bovine serum (FBS) at 37\u00b0C in 95% air\u20135% COIn order to synthesize small parts of the RH domain of GRK5, we used pcDNA3.1-GRK5-RH  as a temRH#1 FOR: 5\u2032TAAGCTTGGATGTGCGAAACCAGAA3\u2032RH#1 REV: 3\u2032CCCTCTAGATTGGGTGATGAAAAC5\u2032RH#2 FOR: 5\u2032TAAGCTTGGATGGAAGTTACTCCAG3\u2032RH#2 REV: 5\u2032CCCTCTAGATTCTTTGCAGGGTTT3\u2032RH#3 FOR: 5\u2032TAAGCTTGGATGACCCCAAAGTCC3\u2032RH#3 REV: 5\u2032CCCTCTAGAGTACTCGTGGAAGGGTT3\u2032Amplified sequences were purified by gel extraction kit (Invitrogen) and cloned into pcDNA3.1-Myc/His vector (Invitrogen) by means of T4 DNA ligase (Promega).\u03b1-Fmoc protecting groups were removed by treating the protected peptide resin with a 25% solution of piperidine in DMF  at room temperature. Finally, the peptides were released from the resin with TFA/TIS/H2O (90\u2009:\u20095\u2009:\u20095) for 3\u2009h. The resin was removed by filtration, and the crude peptides were recovered by precipitation with cold anhydrous ethyl ether to give a white powder and then lyophilized. The crude peptide was purified by RP-HPLC, and molecular weights were determined by ESI mass spectrometry.Based on the cloning of RH fragments, we identified a minimal sequence of 10 aa that possibly retains the RH biological effects. We, therefore, designed a 10 aa peptide based on this sequence conjugated to TAT sequence (RH10) and a control peptide based on a flanking inactive sequence conjugated with TAT (CTRL\u2212). Peptides were synthesized using an automated microwave peptide synthesizer from Biotage AB (Initiator\u2009+\u2009Alstra) on a Rink-Amide-ChemMatrix resin . All couplings were achieved for 10\u2009min at 75\u00b0C (2\u00d7) using a coupling reagent HBTU , HOAt , and DIEA  in N-methyl-2-pyrrolidone (NMP). The Nin vitro were all performed as previously described [\u03b2-Actin (C-4) (sc-47778) and I\u03baB antibodies were from Santa Cruz Biotechnology, Inc.; Myc (#2272), p-NF\u03baB (#3033), and cleaved caspase 3 (#9661) were from Cell Signaling Technology. For angiogenesis in vitro, endothelial cells were directly treated with RH10 or CTRL\u2212. For tumor angiogenesis, KAT-4 cells were treated with these peptides, and the cultured medium was collected after 24 hours from starting treatment. This medium was then added to endothelial cells, and tubular formations were evaluated after 12 hours on Matrigel matrix.Cells were treated with 40\u2009ng/ml of RH10 or CTRL\u2212. Western blot, immunoprecipitation, and angiogenesis escribed , 29\u201331. Cells were pretreated with 20\u2009ng/ml of RH10 and CTRL\u2212 and then treated for 24 hours with a single dose of 4 gray (4\u2009Gy) X-radiation at room temperature , 1\u2009nM cisplatin, or 100\u2009nM doxorubicin.Proliferation was evaluated using CyQUANT\u00ae NF Cell Proliferation Assay Kit (Invitrogen), following the manufacturing instructions.To evaluate apoptosis, cancer cells were first treated with RH10 and CTRL\u2212. Then, we performed a TUNEL assay using the \u201cDeadEnd Colorimetric TUNEL System\u201d from Promega, following the manufacturing instructions. Images were acquired at Eclipse E1000 Fluorescence Microscope  using SigmaScan Pro software (Jandel). Results are expressed as mean\u2009\u00b1\u2009SD of apoptotic nuclei.2DCFDA: Sigma-Aldrich), to the fluorescent DCF as described before [4 for each well in 24-well plates. After incubation with the peptide RH10 or the negative control for 24\u2009h, the cells were incubated with 5uMH2DCFDA for 30\u2009min at 37\u00b0C in a humidified atmosphere . After the incubation, cells were washed twice with PBS and fresh medium was added. The fluorescence was immediately measured by a plate reader (Tecan Infinite200Pro) using excitation/emission wavelengths of 492/520\u2009nm.The production of reactive oxygen species (ROS) was determined through the oxidation of a cell-permeable nonfluorescent probe, 2\u2032,7\u2032-dichlorofluorescin diacetate , which had access to food and water ad libitum. All sequence .6 KAT-4 cells in 200\u2009\u03bcl of DMEM was injected subcutaneously in the dorsal side of nude mice. Animals were anesthetized using isoflurane 2%. We used mice that developed a tumor with a diameter\u2009\u2265\u20096\u2009mm within 2 weeks. Mice were divided into four groups (5 mice/group) and treated with intratumor injections of the specific peptide (RH10 and CTRL\u2212) twice a week for 3 weeks. In particular, two groups received RH10 at either low (0.1\u2009mg/kg) or high dosage (3\u2009mg/kg), one group received the higher dose of CTRL\u2212 (3\u2009mg/kg), and another group was treated with DMEM alone. Tumor growth was measured by a caliper twice a week. After three weeks, tumors were collected for Western blot analysis.For tumor formation, a suspension containing 2\u2009\u00d7\u200910p < 0.05 was assumed for all statistical evaluations. Statistics were computed with GraphPad Prism Software .All values are presented as mean\u2009\u00b1\u2009SD. One-way ANOVA with a Bonferroni post hoc test was performed to compare the different parameters among the different groups. A significance level of \u03baB signaling. Given the effectiveness of the full-length RH protein in KAT-4 cells [\u03baB  levels are increased over physiological levels in cancer and are responsible for the oxidative stress that regulates tumor progression . Moreove\u03baB . Thus, w\u03baB-associated phenotypes that are responsible for tumor progression and metastatization. To confirm the effectiveness of RH10 to inhibit NF\u03baB signaling, we first evaluated VEGF gene expression by real-time PCR. VEGF expression was reduced in RH10-treated cells compared with controls  and radiotherapy. A low dose of cisplatin (1\u2009nM) and a lower dose of RH10 (20\u2009ng/ml) alone were both able to reduce cell proliferation (CIS: \u221224\u2009\u00b1\u20094% and RH10 \u221231\u2009\u00b1\u20092% vs. CTRL) . The comin vitro data, we tested the effectiveness of RH10 in an animal model of cancer . In fact, when endothelial cells are exposed to a conditioned medium of KAT-4 cells treated with RH10, their angiogenetic capability is impaired. Among NF\u03baB-dependent phenotypes, oxidative stress via ROS production is one of the main causes of tumor progression [The inhibition of NFc events , 43. NF\u03baelopment \u201346. Sevement [\u03baB , but, sigression . Similargression . For thigression , 50.\u03baB interaction and stabilization.It has been shown that GRK5 is involved in tumor growth and progression even if its effect is quite controversial. Indeed, GRK5 seems to have a double effect on cancer being an inhibitor or inducer of cancer progression depending on its subcellular localization and cancer type . It has \u03baB signaling and its associated phenotypes . Thus, RH10 could be considered a potential specific and effective drug to be tested in clinical trials.In the last decade, cancer targets have been proposed for personalized therapies. The research has a key role in the fight against cancer with the aim to identify novel no toxic drugs that are effective also in advanced stages of the disease and to identify novel biomarkers for prevention and rapid intervention. In this context, our peptide fits well since it is able to inhibit cancer cells progression through its effects on NF"}
+{"text": "This study aims to explore short-term changes following the introduction of alcohol restrictions (most notably 2\u00a0am to 3\u00a0am last drinks). We examined patterns of nightlife attendance, intoxication, and alcohol use among patrons shortly before and after restrictions were introduced in Fortitude Valley, Brisbane: the largest night-time entertainment precinct of Queensland.n\u2009=\u2009497) and July (n\u2009=\u2009562) 2016. A pre-post design was used to assess changes in time spent out drinking/partying prior to the interview, time of arrival in the precinct, pre-drinking, and blood alcohol concentration (BAC).Street-intercept patron interviews were conducted in Fortitude Valley in June . Participants reported going out, on average, one hour earlier after the intervention . There was a decrease  in the proportion of participants who had a high level of intoxication (BAC \u22650.10\u00a0g/dL) post-intervention. No other significant differences were found.Earlier cessation of alcohol sales and stopping the sale of rapid intoxication drinks after midnight was associated with people arriving in Fortitude Valley earlier. Though legislative loopholes allowed some venues to continue trading to 5\u00a0am, the proportion of people in the precinct who were highly intoxicated decreased after the restriction. Further measurement will be required to determine whether the reduction has persisted. Restricting the hours alcohol can be sold is an effective and inexpensive way of reducing alcohol-related assaults and unintentional injury , 2. In 2http://www.webcitation.org/6rXxbYEe8 for full details), the multi-faceted Queensland Tackling Alcohol-Fuelled Violence Policy required the cessation of alcohol service (\u2018last drinks\u2019) by 3\u00a0am within defined entertainment areas (Safe Night Precincts) and by 2\u00a0am in the rest of the state. However, venues could apply for an extended trading permit allowing sales of alcohol until 5\u00a0am; venues could apply for up to 12 single night permits within a 12-month period. A state-wide ban on the service of \u2018rapid intoxication drinks\u2019  after midnight was also introduced.In February 2016, the Queensland state government passed legislation based on the Newcastle model. Coming into effect on 1 July 2016  and four Saturday night/Sunday mornings after the change . Following established protocols , 11, eveParticipants\u2019 gender and age were recorded in the following categories  . ParticiParticipants were asked how many standard drinks they consumed prior to entering a licensed venue (pre-drinking). Participant alcohol status at the time of interview was measured, after confirming that at least 10\u00a0min had elapsed since eating or drinking, using a breathalyser  that converted breath alcohol level into an estimate of blood alcohol concentration (BAC). BAC was examined as both a continuous measure and an ordinal categorical measure in g/dL. The BAC categories used were: \u2018sober\u2019 (0.0); \u2018slightly intoxicated\u2019 (>\u20090.0 to <\u20090.05); \u2018moderately intoxicated\u2019 (\u22650.05 to <\u20090.10); and \u2018highly intoxicated\u2019 (\u22650.10). Our research indicates that observers of licensed venue patrons are able to reliably estimate level of intoxication based on physical signs, with interviewer-rated intoxication moderately correlated with BAC . TherefoEthical approval was obtained from Deakin University 2011\u2013095) and The University of Queensland (20160010121). Five-minute interviews were conducted with patrons in Brunswick Street Mall, the main thoroughfare of Fortitude Valley . Therefore, three multinomial logistic regression models were conducted to explore potential BAC change among those who had a BAC greater than zero; the BAC categories of slight, moderate, and, high intoxication were each used as the reference category. This approach was used to provide insight into how patrons shifted in their levels of intoxication. All analyses were conducted using Stata 14.0.Linear, logistic, and negative binomial regression models examined differences in participant responses by month of interview, with hour of interview as a covariate. For the ordinal BAC variable, ordered logistic regression was planned. However, the assumption of parallelism was not met , with an overall response rate of 84% . For the June sample, participant mean age was 23\u00a0years (standard deviation (SD)\u2009=\u20095.9), and 65% were male. In the July sample, the mean age was 24\u00a0years (SD\u2009=\u20096.6), and 62% were male. There were no significant differences in age and gender distribution by month. Seventy-three participants (7%) refused the breath-test .Research teams approached 1267 people, of whom 1059 completed the interview  was also observed in the post-change period. While it appears the majority of patrons still consume alcohol to moderate intoxication, the finding of a reduction in the number of highly intoxicated patrons is encouraging. This change in patterns of intoxication coincided with a larger proportion of patrons arriving before 10:00\u00a0pm and patrons commencing their evenings out an hour earlier.The finding that people went out earlier after the restriction on last drinks aligns with previous cross-sectional research into the trading hours restrictions implemented in Newcastle . Our finWhile the findings indicate some changes in patterns of drinking and intoxication immediately after the introduction of the alcohol restrictions, the use of extended trading permits allowing venues to continue serving alcohol until 5\u00a0am may have reduced the impact of earlier last drinks , 16. WhiThis preliminary study compared patterns of drinking and intoxication before and after new alcohol restrictions in a major entertainment precinct in Queensland. The inclusion of control sites was impracticable given the short lead-time between funding of the research and the legislation coming into effect. Accordingly, the shortcomings of pre-post designs limit what can be inferred from the observed changes.The primary threat to validity is competing interventions or conditions that exert downward pressure on socialising behaviour and drinking, for instance, changes in economic or climatic conditions. Neither seems likely given the short timeframe of the pre- and post-measurement periods -- a total period of less than two winter months. A secondary limitation is that the university semester ended in late June. This may have resulted in differences between the pre- and post-intervention populations, because fewer students were going out in June because of examinations, or because students from outside of Brisbane returned home during the between-semester break. Our interview did not capture information that would allow us to identify students and adjust for differences in the distributions. However, we found no significant difference in age  or gender  distribution between the June and July samples. As far as we are aware, there were no other legislative or policy changes at the national, state, or local levels that could account for the observed changes in this period.Such considerations will come into play in the evaluation of longer-term changes. We are currently collecting patron interview data in additional precincts of Queensland. This will allow us to examine longer term trends in drinking and intoxication in Safe Night Precincts and other areas, including asking patrons if, and how, they have changed their behaviour on their nights out since the introduction of the policy [see ]. Based Despite the high response rate of 84%, it is possible the participants in this study may not be fully representative of all people who attend night-time entertainment precincts; however, we suggest the findings would generalise to a large proportion of the population exposed to these areas.The restrictions implemented in Queensland were followed by an immediate reduction in the prevalence of highly intoxicated patrons in Fortitude Valley, although average BAC levels did not change. This happened despite the widespread use of extended trading permits, which undermined the objective of the legislation. Further research is necessary to determine how drinking patterns change in the longer term and what occurs in other parts of the state."}
+{"text": "TP53 mutant (mutp53) proteins are involved in the pathogenesis of most human cancers. Mutp53 proteins not only lose wild-typ53 function but, in some circumstances, may acquire novel oncogenic functions, namely gain-of-function (GOF), which lead to aberrant cell proliferation, chemoresistance, disruption of tissue architecture, migration, invasion and metastasis. Decoding the TP53 mutational spectrum and mutp53 interaction with additional transcription factors will therefore help to developing and testing novel and hopefully more efficient combinatorial therapeutic approaches.This commentary wishes to highlight the latest discoveries in the mutant p53 field that have been discussed in the 8th p53 Mutant Workshop 2019, held in Lyon.  TP53 is the most frequently inactivated tumor suppressor gene in tumors, being mutated in over 50% of human cancer types and indirectly inactivated in many others. The loss of TP53 as a signature driver of human cancers is unquestionable. Loss of p53 tumor suppressor functions induces accumulation of genomic alterations culminating in cancer progression, however, other than loosing wild-type (wt) oncosuppressor function, some mutant p53 (mutp53) proteins may acquire new oncogenic functions, namely gain-of-function (GOF), associated with altered p53-dependent transcriptional programs [programs . In addiprograms . The 8thTP53 mutations that profoundly affect the onset of the disease. In the years, the whole-exome and whole-genome testing allowed to sequence germline and somatic DNA leading to the beginning of precision medicine initiatives in LFS [TP53 mutation carriers in children and adults [Important insight into the p53 field come from the Li-Fraumeni syndrome that was first described in 1969 as a highly penetrant cancer-prone syndrome inducing sarcoma, breast cancer, adrenocortical carcinoma, and brain tumors, often with more than one cancer per affected individual. More than 85% of patients with LFS harbour germline d adults .TP53 are associated with the enrichment of a microbial consortia that are highly represented in squamous cell carcinoma (SCC) tumors, providing novel biomarkers for early detection [A new aspect in unveiling unpredicted mutp53 functions is its link with dysbiotic microbiota that is associated, for instance, with lung carcinogenesis, the number one cause of cancer deaths. Recent microbiome studies have demonstrated a contribution of bacteria to carcinogenesis in colon and lung, for instance. Starting from the hypothesis that somatic mutations together with cigarette smoke generate a chronic inflammatory microenvironment and that epidemiological evidence indicates an association between repeated antibiotic exposure and increased lung cancer risk, it has been shown that mutations in etection . The tumetection . In lighGenetic reconstitution of the function of p53 leads to the suppression of established tumours as shown in mouse models . This stAt the end of the Workshop more questions than answers were raised, and it was clear that the successful implementation of p53-based therapies into clinical practice requires a thorough understanding of the mechanisms underlying the p53 response in both cancer cells and normal tissue\u00a0Fig. . Several"}
+{"text": "Vibrio anguillarum and lipopolysaccharide significantly upregulated host lncRNA IRL expression. Results indicate that IRL functions as a competing endogenous RNA for miR-27c-3p to regulate protein abundance of IRAK4; thus, invading microorganisms are eliminated and immune responses are promoted. Our study also demonstrates the regulation mechanism that lncRNA IRL can competitively adsorb miRNA to regulate the miR-27c-3p/IRAK4 axis that is widespread in teleost fish.Growing pieces of evidence show that the long noncoding RNAs (lncRNAs) as new regulators participate in the regulation of various physiological and pathological processes. The study of lncRNA in lower invertebrates is still unclear compared with that in mammals. Here, we identified a novel lncRNA, termed IRAK4-related lncRNA (IRL), as a key regulator for innate immunity in teleost fish. We find that miR-27c-3p inhibits IRAK4 expression and thus weakens the NF-\u03baB-mediated signaling pathway. Furthermore, the Gram-negative bacterium  Innate immunity is the host's first line of defense against the invasion of pathogenic microorganisms. The pattern recognition receptors (PRRs), as crucial receptor molecule in the innate immune signal transmission, play crucial roles in protecting the host from pathogen invasion. Toll-like receptors (TLRs), RIG-like receptors, and nucleotide oligomerization domain-like receptors are the most important types of PRRs, and they play an irreplaceable role in helping the host identify and monitor various invasive microorganisms , 2. TLRset\u00a0al.  is defined as a collection of RNAs that do not have the potential to encode proteins . Long ncArabidopsis by Franco-Zorrilla et\u00a0al  was obtained from Zhoushan Fisheries Research Institute, Zhejiang Province, China. Fish were acclimated in aerated seawater tanks at 25 \u00b0C for 6\u00a0weeks before experiments. The bacterial challenge was performed as described (Vibrio anguillarum (1.5\u00a0\u00d7 108\u00a0cfu/ml) or 0.2\u00a0ml suspension of lipopolysaccharide (LPS) (1\u00a0mg/ml) intraperitoneally. As comparison, 0.2\u00a0ml of physiological saline was used to challenge the individuals. Afterward, fish were respectively sacrificed at different time points and the spleen samples were collected for RNA extraction. All animal experimental procedures were performed in accordance with the National Institutes of Health\u2019s Guide for the Care and Use of Laboratory Animals, and the experimental protocols were approved by the Research Ethics Committee of Shanghai Ocean University (No. SHOU-DW-2018-047).Miiuy croaker, escribed . BrieflyM.\u00a0miiuy intestine cells (MICs) and M.\u00a0miiuy kidney cells were cultured in L-15 medium (HyClone) supplemented with 15% fetal bovine serum (Gibco), 100 U/ml penicillin, and 100\u00a0\u03bcg/ml streptomycin at 26 \u00b0C. Epithelioma papulosum cyprinid (EPC) cells were maintained in medium 199 (Invitrogen) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100\u00a0mg/ml streptomycin at 26 \u00b0C in 5% CO2. For stimulation experiments, MICs were challenged with an LPS concentration of 10\u00a0\u03bcg/ml and harvested at different times for RNA extraction  with stimulating naturally occurring mature miRNAs. The miR-27c-3p mimics sequences were 5\u2019-UUCACAGUGGUUAAGUUCUGC-3\u2019 (sense) and 5\u2019-AGAACUUAACCACUGUGAAUU-3\u2019 (antisense). The negative control RNA sequences were 5\u2019-UUCUCCGAACGUGUCACGUTT-3\u2019 (sense) and 5\u2019-ACGUGACACGUUCGGAGAATT-3\u2019 (antisense). miRNA inhibitors are synthetic single-stranded RNAs (ssRNAs) that sequester intracellular miRNAs and block their activity in the RNA interfering pathway. The miR-27c-3p inhibitor sequence was 5\u2019-GCAGAACUUAACCACUGUGAA-3\u2019. The negative control inhibitor sequence was 5\u2019-CAGUACUUUUGUGUAGUACAA-3\u2019. The RNA interference for IRL are as follows: the si-IRL-1 sequence was 5\u2019-ACGUCAUCACUGUCACAUCTT-3\u2019; the si-IRL-2 sequence was 5\u2019- CGAUCAGGUUAAUCUUCUATT-3; the negative control RNA sequences were 5\u2019-UUCUCCGAACGUGUCACGUTT-3\u2019 (sense) and 5\u2019-ACGUGACACGUUCGGAGAATT-3\u2019 (antisense). The RNA interference for IRAK4 is as follows: the si-IRAK4 sequences were 5\u2019-GCAUCAUGUGAGGAGGUUUTT-3\u2019 (sense) and 5\u2019-AAACCUCCUCACAUGAUGCTT-3\u2019 (antisense). The scrambled control RNA sequences were 5\u2019-UUCUCCGAACGUGUCACGUTT-3\u2019 (sense) and 5\u2019-ACGUGACACGUUCGGAGAATT-3\u2019 (antisense).Both nuclear RNA and cytoplasmic RNA were extracted from MICs using the Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek) according to the manufacturer\u2019s instructions. Total RNA was isolated using TRIzol Reagent (Invitrogen), and cDNA was obtained by reverse transcriptional RNA using FastQuant RT Kit (Tiangen), which includes DNase treatment of RNA to eliminate genomic contamination. The nuclear and cytosolic fractions were separated using the Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek) according to the manufacturer\u2019s instructions. Gene expression was measured by using SYBR Premix Ex TaqTM (Takara). The small RNA was extracted by using miRcute miRNA Isolation Kit (Tiangen), and miRcute miRNA FirstStrand cDNA Synthesis Kit (Tiangen) was applied to reverse transcription of miRNAs. The expression analysis of miR-27c-3p was executed by using the miRcute miRNA qPCR Detection Kit (Tiangen). Quantitative real-time PCR was performed in an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific). GAPDH and 5.8S rRNA were used as negative controls to detect mRNA, lncRNA, and miRNA expression, respectively . Primer The IRL or IRAK4-3\u2019UTR wildtype and the mutant devoid of the miR-27c-3p-binding site were cotransfected with miR-27c-3p mimics into EPC cells. At 24\u00a0h post transfection, reporter luciferase activities were measured using the Dual-Luciferase reporter assay system (Promega). To determine the functional regulation of IRL or IRAK4, MICs were cotransfected with IRAK4 expression plasmid or IRL expression plasmid, together with NF-\u03baB, IL-8, and IL-1\u03b2 luciferase reporter gene plasmids , phRL-TKCells were lysed and collected in 1\u00d7 SDS-PAGE loading buffer. The protein content in the collected cell lysates was measured with the bicinchoninic acid protein detection kit (Vazyme), then subjected to SDS-PAGE (10%) gel and transferred to PVDF (Millipore) membranes by semidry blotting (Bio-Rad Trans Blot Turbo System). The membrane is sealed with 5% bovine serum albumin. Protein was detected with different antibodies. The antibody against IRAK4 was diluted at 1:1000 (Genscript); anti-FLAG, anti-GFP, and anti-Tubulin monoclonal antibodies were diluted at 1: 2000 (Beyotime); and horseradish peroxidase\u2013conjugated anti-rabbit IgG or anti-mouse IgG (Abbkine) were diluted at 1: 5000. The results were representative of three independent experiments. The immunoreactive proteins were detected by using WesternBright ECL (Advansta). The digital imaging was performed with a cold CCD camera.in\u00a0vitro. The two transcripts were biotin labeled with the T7 RNA polymerase and Biotin RNA Labeling Mix (Roche), treated with RNase-free DNase I, and purified with an RNeasy Mini Kit (Qiagen). The whole-cell lysates from MICs (\u223c1.0\u00a0\u00d7 107) were incubated with purified biotinylated transcripts for 1\u00a0h at 25 \u00b0C. The complexes were isolated by streptavidin agarose beads (Invitrogen). RNA was extracted from the remaining beads, and qPCR was used to evaluate the expression levels of miRNAs. The specific protocol of pull-down assay was as described (IRL and IRL-mut with miR-27c-3p-binding sites mutated were transcribed escribed .7) were cotransfection with pcDNA3.1-FLAG, pcDNA3.1-AGO2-FLAG, or miR-27c-3p for RNA immunoprecipitation (RIP) assays. To prove that IRL has the ability to directly bind to miR-217, MICs (\u223c2.0\u00a0\u00d7 107) were cotransfected with pcDNA3.1-MS2, pcDNA3.1-MS2-IRL, pcDNA3.1-MS2-IRL-mut, pcDNA3.1-MS2-IRAK4-3\u2019UTR, or pMS2-GFP for RIP assays. In short, MICs were harvested after 48 h transfection and RIP assays were carried out with Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) and anti-GFP antibody (Abcam) following the manufacturer\u2019s protocol. RNA was extracted from the beads, and the expression level of miRNA was evaluated by qRT-PCR.To explore whether IRL is involved in the ceRNA regulation process, MICs (\u223c2.0\u00a0\u00d7 10Cell viability was measured 48\u00a0h after transfection in LPS-treated MIC with Celltiter-Glo Luminescent Cell Viability assays (Promega) according to the manufacturer\u2019s instructions. At the same time, cell proliferation was measured with BeyoClick EdU cell Proliferation Kit following the manufacturer\u2019s instructions (Beyotime). All the experiments were performed in triplicate.The apoptotic assay was conducted using an Annexin V-FITC Apoptosis Detection Kit (Beyotime) and analyzed with flow cytometry (Beckman). The ratio of early and late apoptotic cells was detected to calculate the apoptotic rate .t test was used to evaluate the data. The relative gene expression data were acquired using the 2 \u0394\u0394CT method, and comparisons between groups were analyzed by one-way analysis of variance (ANOVA) followed by Duncan\u2019s multiple comparison tests . IRL that is one of the significantly different upregulated lncRNAs has attracted our attention. The single-molecule full-length transcript sequencing was used to characterize the complete sequence of IR. The results demonstrate that the length of IRL is 1891 base pairs (bp) and IRL locates on miiuy croaker, N.\u00a0diacanthus, and L.\u00a0crocea chromosome 23, between gene tha1 and gene socs3b, and consists of only one exon (B). Then, we detected the subcellular location of IRL and found that IRL is mainly expressed in the cytoplasm (C). Consistent with IRL being an ncRNA, there was no putative protein conserved in all species, and the CPC  computational algorithm predicts that IRL has a very low coding potential (D).We treated miiuy croaker with omosomes A. IRL thone exon B. Then, ytoplasm C. Consisotential D.Figure\u00a0V.\u00a0anguillarum or LPS stimulation times to verify the results of RNA-Seq. As shown in Figure\u00a02A, we found that the expression of IRL is significantly upregulated after V.\u00a0anguillarum or LPS stimulation. Two small interfering RNAs were designed against IRL (si-IRL-1 and si-IRL-2) and the overexpression plasmid of IRL was constructed to explore the biological functions of IRL. As expected, both siRNAs can inhibit the expression of IRL and si-IRL-1 can induce higher inhibitory efficiency (B). The IRL overexpression plasmid could significantly increase IRL expression levels (D). Inflammatory cytokines play an important role in the antibacterial immune response; we thus focused on investigating the function of IRL in regulating the expression of inflammatory cytokines. As shown in Figure\u00a02C, knockdown of IRL can significantly inhibit the expression levels of TNF-\u03b1, IL-6, IL-8, and IL-1\u03b2 upon LPS stimulation. On the contrary, overexpression of IRL increases these gene expression levels in MICs under LPS treatment (E). Furthermore, cell apoptosis analysis showed that IRL knockdown increased the proportion of apoptotic cells (F). We conducted EdU assays and ATP activity assay to examine cell proliferation and cell viability for further exploring the role of IRL in innate immunity. Furthermore, we tested the effects of si-IRL and IRL-overexpressed plasmid on MIC viability. The results showed that knockdown of IRL decreases the cell viability, whereas it greatly increased when IRL-overexpressed plasmid is transfected (G). As shown in H and I, the results showed that knockdown of IRL considerably decreased the percentage of EdU-positive cells and cell viability, whereas it greatly increased when IRL is overexpressed. These results suggested that IRL can promote the proliferation and viability in miiuy croaker cell lines. Of interest, our results are in perfect agreement with some reports that low concentrations of LPS can stimulate cell proliferation  were predicted to have a high probability of combining to IRL (B). Then, we compared the expression levels of these candidate miRNAs in MICs transfected with si-IRL or negative controls and IRL overexpression plasmid or control vector. Among the five candidate miRNAs, miR-27c-3p is significantly enhanced in response to IRL inhibition and is markedly impaired in response to IRL overexpression (C and D). We constructed the miR-27c-3p sensor to test whether IRL can affect miR-27c-3p activity. The miR-27c-3p sensor was constructed by inserting two copies of perfectly matched miR-27c-3p fragments into psiCHECK vector (E). Then, we transfected it with the miR-27c-3p sensor into cells, along with miR-27c-3p, control vector, or IRL overexpression plasmid; notably, IRL specifically sponges miR-27c-3p, which prevents it from inhibiting luciferase activity (F). Overall, these data suggest that IRL can regulate miR-27c-3p expression and activity, and IRL may function as an miRNA sponge to adsorb and consume the miR-27c-3p.Many cytoplasmic lncRNAs have been reported to act as ceRNAs by competitively binding miRNAs , 35. We Figure\u00a03g to IRL B. Then, pression , C and DK vector E. Then, activity F. OveralA). The luciferase assay showed that miR-27c-3p mimics can significantly inhibit the wildtype IRL luciferase plasmid activity but has no effect on the mutated form (B). In addition, we inserted the wildtype or the mutant type fragment of IRL into the mVenus-C1 vector and cotransfected with miR-27c-3p to confirm whether miR-27c-3p can inhibit the levels of GFP. As shown in Figure\u00a04C, miR-27c-3p can significantly inhibit the levels of GFP but cannot inhibit the level of the mutant type of IRL-GFP. To extend the findings, the Western blotting assay has been conducted to examine the expression level of GFP protein (D). These results indicate that IRL may interact with miR-27c-3p through the predicted miR-27c-3p-binding site.We analyzed the sequence of IRL to investigate whether IRL can directly interact with miR-27c-3p and find a binding site for miR-27c-3p. Then, we constructed the IRL luciferase plasmid and the mutant plasmids with the mutated miR-27c-3p-binding site A. The luted form B. In add protein D. These A). We thus further tested the ability of IRL to bind to miR-27c-3p. To this end, the Ago2 RIP assays were performed in MICs by cotransfecting Ago2-FLAG and miR-27c-3p. The results from qRT-PCR analysis suggested that IRL and miR-27c-3p are efficiently pulled down by Ago2-FLAG (E). For further confirming the direct interaction between IRL and miR-27c-3p, we performed biotin-avidin pull-down experiments to examine whether miR-27c-3p or IRL can be pulled down in MICs that are transfected with biotinylated miR-27c-3p or biotinylated IRL and can then be harvested for pull-down assay. The result showed that IRL could be pulled down by biotinylated wildtype miR-27c-3p (F). The miR-27c-3p can be pulled down by biotinylated wildtype IRL (G). Then we constructed plasmids that recognize lncRNAs by the MS2 protein. We inserted the MS2-12X fragment into the pcDNA3.1, pcDNA3.1-IRL, and the mutated type of IRL plasmids (pcDNA3.1-IRL-mut). We constructed a fusion expression plasmid of GFP and MS2 to produce MS2-GFP fusion protein (pcDNA3.1-MS2-GFP), and the protein can bind to MS2-12X and also GFP antibody. Therefore, if miRNAs can bind to IRL, then miR-27c-3p can be pulled down by the GFP-MS2-12X complex. Analysis of qPCR results showed that the miR-27c-3p enrichment of IRL is significantly higher than that of mutant IRL and empty plasmid (H). In summary, these results indicated that IRL can directly bind to miR-27c-3p and IRL may act as a sponge of miR-27c-3p.We determined through the previous RIP experiment that IRL can directly bind to miRNAs A. We thugo2-FLAG E. For fuR-27c-3p F. The mitype IRL G. Then w plasmid H. In sumV.\u00a0anguillarum. As shown in V.\u00a0anguillarum stimulation. Then, we first searched for predicted miR-27c-3p targets using bioinformatics tools (We first examined the miR-27c-3p expression profiles in miiuy croaker to identify whether miR-27c-3p is involved in the immune response induced by cs tools  to identcs tools .A). Next, we explored the role of miR-27c-3p against the immune response, and miR-27c-3p and miR-27c-3p inhibitors were transfected into MICs and stimulated by LPS, respectively. The results showed that certain inflammatory cytokines, including TNF-\u03b1, IL-6, IL-8, and IL-1\u03b2 are significantly decreased by the introduction of miR-27c-3p mimics upon LPS stimulation. On the contrary, the inhibition of endogenous miR-27c-3p significantly elevated these gene expressions compared with the transfection of control inhibitors (B and C). IRAK4-3\u2019UTR plasmid, miR-27c-3p, and reporter genes were cotransfected into EPC cells to verify that IRAK4 can be regulated by miR-27c-3p. The results showed that miR-27c-3p could inhibit the luciferase activity of inflammatory cytokines by inhibiting IRAK4 (D). We tested the effects of miR-27c-3p and miR-27c-3p-i on MIC proliferation and viability. The results showed that miR-27c-3p considerably decreases the percentages of EdU-positive cells and cell viability, whereas they greatly increased when miR-27c-3p-i is transfected (E and F). In summary, miR-27c-3p plays an important regulatory role in inflammatory responses.We measured the effects of synthetic miR-27c-3p mimics and miR-27c-3p inhibitors on the expression of miR-27c-3p. As expected, miR-27c-3p mimics enhanced miR-27c-3p expression sharply, whereas miR-27c-3p inhibitors decreased miR-27c-3p expression A. Next, hibitors , B and Cng IRAK4 D. We tesnsfected , E and FA). The luciferase assay showed that miR-27c-3p mimics can significantly inhibit the wildtype IRAK4 3\u2019UTR luciferase plasmid activity but they have no effect on the mutated form (B). In addition, we inserted the wildtype or the mutant type fragment of IRAK4 3\u2019UTR into the mVenus-C1 vector and cotransfected with miR-27c-3p to confirm whether miR-27c-3p can inhibit the levels of GFP. As shown in Figure\u00a06C, miR-27c-3p can significantly inhibit the levels of GFP but cannot inhibit the level of the mutant type of IRAK4-3\u2019UTR-GFP. The Western blotting assay has been conducted to examine the expression level of GFP protein for extending the findings (D). These results indicate that the IRAK4 3\u2019UTR may interact with miR-27c-3p through the predicted miR-27c-3p-binding site. We cotransfected miR-27c-3p mimics and IRAK4 expression plasmid with 3\u2019UTR into EPC cells to test whether miR-27c-3p participates in the regulation of IRAK4 expression. The results from Western blotting showed that transfection of miR-27c-3p mimics suppressed the expression levels of IRAK4 (E). We transfected miR-27c-3p mimics and inhibitors into MICs. The results from Western blot assays displayed that transfection of miR-27c-3p mimics suppressed the expression levels of IRAK4, whereas miR-27c-3p inhibitors markedly enhanced the expression levels of IRAK4 (F). We find through qPCR detection that miR-27c-3p mimics suppressed the expression levels of IRAK4 under LPS treatment, whereas miR-27c-3p inhibitors markedly enhanced the expression levels of IRAK4 under LPS treatment (G). We constructed plasmids that recognize IRAK4 3\u2019UTR by MS2 protein. We inserted the MS2-12X fragment into the pcDNA3.1, pcDNA3.1-IRAK4 3\u2019UTR, and the mutated type of IRAK4 3\u2019UTR plasmids (pcDNA3.1-IRAK4-3\u2019UTR-mut). If miRNAs bind to IRAK4, then miR-27c-3p can be pulled down by the GFP-MS2-12X complex. Analysis of qPCR results from the RIP assay showed that the miR-27c-3p enrichment of IRAK4 is significantly higher than that of mutant IRAK4 3\u2019UTR and empty plasmid (H). In summary, these results indicated that miR-27c-3p can directly bind to IRAK4 3\u2019UTR and regulate the expression of IRAK4.We analyzed the sequence of IRAK4 3\u2019UTR to investigate whether IRAK4 3\u2019UTR can directly interact with miR-27c-3p and find a binding site for miR-27c-3p. Then, we constructed the IRAK4 3\u2019UTR luciferase plasmid and the mutant plasmid with the mutated miR-27c-3p-binding site A. The luted form B. In addfindings D. These of IRAK4 E. We traof IRAK4 F. We finreatment G. We con plasmid H. In sumA). Meanwhile, the IRAK4 expression is significantly decreased through knockdown of IRL (B). Then, the MICs were cotransfected with miR-27c-3p and IRL, and the Western blotting assay showed that IRL can reverse the inhibitory effect of miR-27c-3p on IRAK4 protein expression (C). These results indicated that miR-27c-3p can inhibit IRAK4-3\u2019UTR luciferase activity, whereas IRL can reverse the inhibitory effect of miR-27c-3p on IRAK4 (D). The IRAK4 plasmid with full-length 3\u2019UTR, miR-27c-3p, IRL plasmid, and various reporter gene plasmids were cotransfected into EPC cells. The results showed that IRL can reverse the negative effect of miR-27c-3p on the luciferase activities of NF-\u03baB, IL-8, and IL-1\u03b2 report genes (E). Moreover, we attempted to explore the effect of the IRL/miR-27c-3p regulatory loop on cell proliferation. The results indicated that overexpression of IRL can counteract the negative effect of miR-27c-3p on cell proliferation upon LPS stimulation (F). We cotransfected miR-27c-3p-i and si-IRL into MICs to further prove the result that IRL regulates IRAK4 by modulating miR-27c-3p. And the results showed that miR-27c-3p-i can reverse the negative effect of si-IRL on IRAK4 (G). Collectively, these data demonstrated that IRL serves as a ceRNA for miR-27c-3p to regulate IRAK4 expression.Given that IRL interacts with miR-27c-3p and miR-27c-3p targets and regulates IRAK4. Thus, we tested whether IRL can regulate IRAK4. The results from the Western blot and qPCR suggested that IRAK4 protein expression is significantly increased when IRL was overexpressed in MICs, A. Meanwhn of IRL B. Then, pression C. These on IRAK4 D. The IRrt genes E. Moreovmulation F. We coton IRAK4 G. CollecA displays high conservation from mammals to fish. The miR-27c-3p-binding site in IRAK4 3\u2019UTR also displays high conservation from mammals to fish (B). Luciferase report plasmids were generated by cloning the IRL of L.\u00a0crocea and N.\u00a0diacanthus into pmirGLO vector, within the mutant devoid of miR-27c-3p-binding site as a control (C), to obtain the direct evidence that miR-27c-3p could target IRL across fish species. It is striking that miR-27c-3p mimics are sufficient to decrease luciferase activities when respectively cotransfected with the wild types of L.\u00a0crocea and N.\u00a0diacanthus IRAK4-3\u2019UTR, whereas they exhibit no effect on the luciferase activity of cells transfected with their mutant types (D). These results indicate that miR-27c-3p can target the IRAK4 gene in other fish species. This ability verifies that miR-27c-3p is highly conserved among different species and its function is also conserved to some extent.We first examined the sequence alignment of pre-miR-27c from different vertebrate species to address the generality of our findings. Of interest, mature miR-27c-3p as shown in Figure\u00a08 to fish B. Lucife control C, to obtnt types D. These C). Then, we produced luciferase constructs of L.\u00a0crocea and N.\u00a0diacanthus IRL and their mutated forms with mutated miR-27c-3p-binding sites to examine whether IRL in other fish species could also interact with miR-27c-3p. Luciferase assays revealed that miR-27c-3p can suppress the luciferase activity of the wildtype of IRL luciferase plasmid in both fish species but it has no effect on the mutated forms (E). Furthermore, to test whether L.\u00a0crocea and N.\u00a0diacanthus IRL can affect miR-27c-3p activity, we conducted luciferase assays and found that both L.\u00a0crocea and N.\u00a0diacanthus IRL could counteract the inhibitory effect of miR-27c-3p on the miR-27c-3p sensor (F). These results indicate that IRL may act as endogenous sponge RNA to interact with miR-27c-3p among different fish species  is also constantly deepening. Clearly, complex miRNA regulation networks exist in teleost fish in regulating innate immunity. For example, the inducible miR-203 and miR-21 have been reported to represses the inflammatory responses to Gram-negative bacteria by targeting IRAK4 ,\u00a044. miRAccumulating pieces of evidence suggested that some lncRNAs can play as a ceRNA to regulate the expression of coding genes in mammals by competitively sponging the miRNAs. This ceRNA mechanism was first discovered in plants and has since been widely confirmed in mammals, and most lncRNAs with this function are mainly distributed in the cytoplasm , 47. ForIn summary, we find that miR-27c-3p plays a negative role, whereas IRL exhibits a positive regulatory role in the regulation of inflammatory responses. Furthermore, we identified that IRL acts as a regulator of inflammatory responses via acting as a ceRNA for miR-27c-3p to relieve its repressive effects on IRAK4 expression; thus, immune homeostasis and immune balance are maintained. Our findings suggest the critical roles of lncRNAs in operating fish inflammatory response processes, which will benefit for understanding the vertebrate immunology and the evolution of immune systems among vertebrates.All data are contained within the article and the The authors declare that they have no conflict of interest with the contents of this article."}
+{"text": "Proximal Roux-en-Y gastric bypass is commonly used to manage obesity, performed using laparoscopic or robot-assisted minimally invasive surgery. As the prevalence of robotic bariatric surgery increases, further data is required to justify its use.This was a large, retrospective analysis of prospectively recorded data for Roux-en-Y gastric bypass (RYGB) procedures performed using laparoscopic (LRYGB) or robotic  surgery between January 2016 and March 2019. The surgical techniques did not differ apart from different trocar placements. Data collected included patient characteristics before and after RYGB, operative outcomes and complications.In total, 114 RRYGB and 108 LRYGB primary surgeries were performed. There were no significant differences between the groups, apart from a significantly shorter duration of surgery , lower C-reactive protein values at days 1 (31.1 vs. 44.1\u00a0mg/l) and 2 (50.3 vs. 77.8\u00a0mg/l) after the intervention, and overall complication rate  with RRYGB compared with LRYGB. There was a lower hemoglobin value in the postoperative course after RRYGB .In our experience, robotic RYGB has proven to be safe and efficient, with a shorter duration of surgery and lower rate of complications than laparoscopic RYGB. RRYGB is easier to learn and seems safer in less experienced centers. Increasing experience with the robotic system can reduce the duration of surgery over time. Further studies with higher evidence level are necessary to confirm our results.The online version of this article (10.1007/s11695-020-04508-1) contains supplementary material, which is available to authorized users. Proximal Roux-en-Y gastric bypass is the most frequently performed bariatric procedure in Europe , 2 and in\u2009=\u20092282) of all RYGB procedures in 2016 , with comparable complication rates but longer surgery time (138\u00a0min) versus LRYGB (108\u00a0min) [In 1998, a bariatric operation using a surgical robot was performed for the first time for the implantation of a gastric band . Since t108\u00a0min) . DespiteWe present the largest German series of RRYGB procedures using the da Vinci Xi\u00ae system . The aim of our study was to investigate the effectiveness and safety of laparoscopic versus robotic proximal primary RYGB surgery.With the approval of the local ethics committee and provision of written, informed patient consent, all bariatric operations performed at our center have been prospectively recorded since January 2016. The operations were performed by certified bariatric surgeons. At the beginning of 2016, the total experience of the center, among other bariatric and non-bariatric laparoscopic procedures, consisted of 250 LRYGB procedures. Only one surgeon had an experience of over 100 cases. The obesity and metabolic surgery center is certified by the German Society for General and Visceral Surgery (DGAV) since 2015. Furthermore, the department has great expertise in robotic surgery with more than 1000 robot-assisted visceral and thoracic surgical procedures since 2013. The bariatric surgeons performed their first robotic procedures in 2016. Experience with the da Vinci Si\u00ae system  was initially gained in sleeve gastrectomy and RYGB surgery . The da From January 2016 to March 2019, all laparoscopic or robotic (da Vinci Xi) primary proximal RYGB surgeries were retrospectively evaluated. In addition to the inpatient course, standardized follow-up data were collected after 1\u00a0month and 1\u00a0year. A subgroup consisting of 37 primary da Vinci Xi RYGB surgeries was published as single surgeon case series in 2019 .Laparoscopic and robot-assisted operations were performed in French position. The first access was carried out using a 12-mm FIOS First Entry Trocar . Laparoscopically, we used five 12-mm trocars; robotically, we used two 12-mm and four 8-mm trocars. Apart from the different trocar placements, the surgical techniques did not differ. The detailed procedure steps have been published previously . In briet test, categorical parameters by a \u03c72-test. A p value <\u20090.05 was regarded as statistically significant. Values are presented as mean\u2009\u00b1\u2009standard deviation (SD) or n (%), as appropriate.A retrospective analysis of prospectively collected data after laparoscopic and robotic da Vinci Xi gastric bypass surgery was performed to compare the groups with respect to sex, age, weight, body mass index (BMI), Edmonton obesity staging system (EOSS) , preoperIn total, 108 primary LRYGB and 114 primary RRYGB surgeries were performed between 2016 and 2019. Patient demographic data showed no significant differences between the groups, apart from a different distribution with respect to EOSS with a slight increase in comorbidity rates in the robotic group (Table The duration of surgery with RRYGB (116.9\u00a0min) was significantly shorter than with LRYGB 128.9\u00a0min), with an average docking time of 6.4\u00a0min  complications occurred in LRYGB and 5 (4.4%) in RRYGB, according to the Clavien-Dindo classification II-V. After LRYGB, four revision operations were necessary, one with partial omentum necrosis and three with leakage. Following the necessary revision operation, one patient suffered a heart attack and had to be treated in an intensive care unit. The patient was discharged to a rehabilitation facility after 77\u00a0days. The three other patients were all discharged home within 30\u00a0days. In addition, one leak of the gastrojejunostomy was healed using endoscopic vacuum therapy only. Intraabdominal hemorrhage was found parallel to leakage of the gastrojejunostomy during revision surgery. One gastrointestinal bleeding was stopped endoscopically. Two superficial wound infections were confirmed postoperatively. No stenoses occurred with LRYGB. Five more patients received postoperative antibiotic therapy; in one case, a urinary tract infection was diagnosed, but no infection was detected in the other four cases.After RRYGB, two revision operations were performed due to partial omentum necrosis and a leakage of the gastrojejunostomy. The first patient could be discharged 8\u00a0days postoperatively; the second patient initially had to be treated in the intensive care unit and was discharged home after 40\u00a0days. One patient was endoscopied with gastrointestinal bleeding; an active bleeding source was not found, and an endoscopic intervention or transfusion was not necessary. Wound infections and stenoses did not occur with RRYGB. Two more patients received postoperative antibiotic therapy, and a urinary tract infection was diagnosed in one of these cases.The weight loss after 30\u00a0days and 1\u00a0year, measured as percentage excess weight loss and BMI difference, was comparable in both groups Table .An overview of all patients including Clavien-Dindo classification, LOS, weight loss, and laboratory values is available as The learning curves of the da Vinci Xi RYGB procedures for the participating surgeons are shown in Fig.\u00a0In our experience, the use of a robot in primary RYGB surgery is safe and efficient, shortens operative time, and significantly reduces the incidence of overall complications. Considering individual complications such as reoperation, leakage, bleeding, and stenosis, no significant difference could be found due to the low incidence of these events.With regard to complications, our results confirm other original papers , 17, 28 The operation times for RRYGB were significantly shorter than LRYGB, despite inclusion of the first procedures using the da Vinci Xi system. In contrast to our data, most studies report a longer operative time when using the robot \u201323, 29. In our study, there was a significantly lower CRP value on days 1 and 2 after RRYGB. We regard this as a possible consequence of a more atraumatic and precise surgical approach. However, there is no evidence in this respect yet. Consecutively, this would also explain lower general complication rates. On the other hand, we found significantly lowered hemoglobin values on days 1 and 2. After calculating the hemoglobin difference compared to the preoperative value, no significant difference was found. There was no clinical correlation. Accordingly, we do not consider the observed differences to be relevant, but further vigilance is recommended.The duration of the hospital stay after the operation was not significantly influenced by type of surgery. The observed shortening of the inpatient stay by 1.3\u00a0days on average after RRYGB is rather a consequence of the temporal divergence of the two cohorts. Compared to other publications, inpatient stays in our center were longer in both groups, which are primarily explained by the national peculiarities of patient care and billing that generally result in longer inpatient stays for bariatric patients in Germany.Laparoscopically as well as robotically, various anastomotic techniques are applied. We used the linear stapler anastomosis rather than the circular stapler anastomosis or one of a complete \u201chand\u201d-sewn suture. The linear stapler anastomosis is widely used and is considered to be superior to the circular stapler anastomosis with regard to stenosis rates, wound infections, and operative time . No diffCosts are important when evaluating whether the robot has advantages or disadvantages in RYGB. There is no doubt that the use of the robot is initially associated with higher costs. We cannot provide a complete cost calculation but assume additional costs for system maintenance, sterile draping, trocars, and instruments of \u20ac2000 . With ouA possible weakness of the present paper lies in the selection type and in the temporal divergence of the two groups. While laparoscopic procedures were mainly performed between 2016 and 2017, most of the robotic operations took place around 2018. The cohorts are largely comparable. The differences observed in EOSS tended to favor the LRYGB group. The operations were performed by various surgeons, all of whom already had bariatric experience. At the beginning of the study, most of the bariatric surgeons involved were still within the learning curve of an LRYGB as a possible explanation for increased complication rates and operative times. Thus, the conclusions of this paper are valid for bariatric surgeons with limited laparoscopic RYGB experience. The experience with the da Vinci system was limited to bariatric procedures with the Si system before da Vinci Xi was introduced. The entire learning curve with the Xi System can be found in the robotic group. While the latter would benefit the laparoscopic cohort, the overall experience with the procedure gained in laparoscopic RYGB would favor the robotic cohort. The strength of the study lies in the comparable surgical techniques using linear stapler anastomoses. The study provides a detailed picture with a complete 30-day follow-up rate.In our experience, robotic RYGB has proven to be safe and efficient. In case of still limited expertise with laparoscopic RYGB procedures, using a robotic system may result in lower complication rates and shorter operative times than laparoscopic RYGB. Whether the benefits outweigh the additional costs required for RRYGB remains to be evaluated. Further studies with higher evidence level are necessary to confirm our results.ESM 1(PDF 494\u00a0kb)"}
+{"text": "Tuberculosis (TB) is generally considered a disease that principally afflicts the low-income segments of a population. In the Nanshan District of Shenzhen, China, with the economic transformation and a new Headquarters Economy (HE) emerging, there are now more cases in office workers than in manufacturing workers. To illustrate this trend, we describe a small TB outbreak in an office building located in the centre of the rapidly growing HE district. Two active pulmonary tuberculosis cases were found in workers who shared an office, and whole genome sequencing showed that the genetic distance between the strains of the two cases was just one single nucleotide polymorphism, consistent with intra-office transmission. Investigation of 30 other workers in the same or adjacent offices with interviews, interferon-gamma release assays (IGRAs) and chest X-rays, identified one new TB case and latent tuberculosis infection (LTBI) in 40.0% (12/30) of the contacts. The offices were under-ventilated. None of the IGRA positive, asymptomatic contacts agreed to receive treatment for LTBI, presumably due to TB stigma, and over the next 2 years 69.0% (20/29) of the contacts were lost to follow-up. Treatment for LTBI and stigma of TB remain challenges here. Office workers in the HE of rapidly economic developing areas should be targeted with increased vigilance by TB control programmes. Tuberculosis (TB), an airborne infectious disease commonly spread in overcrowded environments, is generally associated with poverty and low social class , 2. ReceThe Nanshan District of Shenzhen is one of the fastest economically developing areas in China, with 2\u00a0000\u00a0000 inhabitants and a reported TB incidence rate of 43.94 new cases per 100\u00a0000 inhabitants . The impIn each year since 2015, the Nanshan Centre for Chronic Diseases Control (Nanshan CCDC), which is responsible for TB treatment and control in the district, has identified one or two outbreaks in office buildings. With the increase in crowded high-rise office buildings using central air-conditioning, TB outbreaks in these settings will likely become more frequent. Although many TB outbreaks have been described in schools, prisons, homeless shelters and long-term care facilities \u201312, therWith an estimated TB incidence of 63 new cases per 100\u00a0000 population in 2017 , China iThe Nanshan CCDC is responsible for TB treatment and control in the district. On a weekly basis, the TB programme routinely checks the information of newly diagnosed cases against that of the previous ones using a web-based TB Information Management System (TBIMS) set up in 2005 by the National Center for TB Control and Prevention (NCTB). An investigation is opened when two or more cases are found in the same workplace. On 9 November 2015, it was noted that two pulmonary tuberculosis (PTB) cases (cases 1 and 2) worked in the same company. A telephone interview with the manager of the company revealed that the two patients worked in the same room, meeting the working definition of an outbreak . The offMycobacterium tuberculosis (MTB) isolates from cases 1 and 2.The principle of graded investigation is that tests and interventions are initiated based on the detected epidemiological links, the characteristics of the index case and evidence of a possible outbreak. Because the two identified cases were both smear and culture positive, and there were 10 other employees working in the same room, six measures were implemented from 10 November 2015 to 16 November 2015: isolation of the patients from the workplace; environmental appraisal for the risk of infection; disinfection and sterilisation of the office; further investigation of the patients; screening of the close contacts and confirmation of transmission through genomic typing of the The exposed and peripheral areas of the office were visually inspected and an air conditioning engineer was consulted to evaluate the risk of a respiratory pathogen spreading through the ventilation system.Close contacts, defined as individuals who shared an enclosed space with the index case \u2a7e4\u00a0h a week , were ofAfter a third active PTB case and seven LTBI coworkers were found among the close contacts, additional measures were adopted between 16 November 2015 and 17 January 2018, including expansion of the investigation, education of coworkers, medical supervision, follow-up tests and the recommendation of treatment for LTBI cases with 9 months of daily self-administered isoniazid.IGRA tests and CXRs were routinely provided free to all contacts who were voluntarily named by the PTB patients when they were diagnosed. However, as is often the case, the PTB patients appeared reluctant to name contacts other than their family members. The investigation was expanded to include casual contacts who visited the office occasionally and workers in other departments on the same floor. It was recommended that all contacts receive medical supervision by a staff member for suspected symptoms, with follow-up CXRs in the 6th, 12th and 24th month after the first screening .CXRs were taken and read by a radiologist. The QFT and T-SPOT.TB assays were performed as recommended by the manufacturer, using positive cut-off values of \u2a7e0.35\u00a0IU/ml and \u2a7e6 spots, respectively.https://github.com/ucdavis-bioinformatics/sickle), reads were mapped to the reference genome H37Rv (GenBank: AL123456) with Bowtie [For whole genome sequencing (WGS), a colony from a L\u00f6wenstein\u2013Jensen culture was inactivated at 121\u00a0\u00b0C for 30\u00a0min. The genomic DNA was extracted using the OMEGA EZNA Bacterial DNA Kit, and a paired end library with an insertion length of approximately 300\u00a0bp was constructed and then sequenced using the Illumina HiSeq X-Ten sequencing platform, with an average depth of 200. After trimming with Sickle ; 66.7% were males and 76.7% were internal migrants from other cities in China.The contacts were screened three times with IGRAs, the first two times in November of 2015 with the T-SPOT.TB test and the third time in March 2016 with the QFT test. In the first IGRA tests, seven close contacts were positive with the T-SPOT.TB assay and in the second round of IGRAs tests, one casual contact was positive. Four additional close contacts were positive with the QFT test administered in the third round of tests in March of 2016 . The eigCXRs were performed five times for the contact screening and follow-up tests. The first two CXRs were taken on the same days that the first two IGRA tests were performed. In the first CXR of contacts performed on 16 November 2015, one more case (case 3) appeared, but this person lived alone and the workmates were already included in the list, so this case didn't contribute more contacts. We attempted to perform a 2-year follow-up of all the contacts, but over this period 69.0% (20/29) of the contacts (not including case 3) left their job and failed to attend follow-up visits. No other abnormal cases were found in the subsequent four CXRs of the contacts who were available for follow-up .WGS showed that the strains isolated from sputum specimens of cases 1 and 2 belonged to the Beijing family of linage 2 and differed by a SNP. Combining epidemiology and genotype results, the outbreak seemingly comprised four cases: the index case (case 1), two direct secondary cases (cases 2 and 3) presumably transmitted in the office and one presumed infection (case 4) transmitted in the household that was apparently controlled without therapy . HoweverAll 12 LTBI contacts were advised to seek treatment in the only two hospitals in Shenzhen offering LTBI treatment, but both resided in other districts of Shenzhen, more than 20\u00a0km from Nanshan and none of the contacts sought preventive therapy. No new cases were reported in the 2-year medical supervision of the contacts, but because 69% were lost over this period, the planned medical supervision was incomplete.Case 1 was characteristic of PTB cases that tend to transmit their infection: they had frequent coughing, a sputum smear that was positive for acid-fast bacilli by microscopy and a long delay before being diagnosed and receiving therapy , 23. TheShenzhen has a greater TB burden than most Western economically developed cities, and the Nanshan CCDC diagnoses more than 600 TB patients each year, making it impractical to implement active contact investigation on each patient, as is the practice in many European and American cities , 23. IGRThe contact investigation we employed used a grading principle that is similar to the concentric circles technique , but incWGS is more precise than older molecular epidemiology techniques for defining genomically linked strains . A diffeIn total, one case of active TB and 12 cases of LTBIs were detected through the contact investigation. Although this appears to be a small number of cases, the incidence of TB (3.3%) and prevalence of LTBI (40.0%) were higher than found through most contact tracing in the United States, 1% and 20\u201330% respectively , so expaThe study has some limitations. Because of the limited number of cases and contacts who had LTBI, it was not possible to analyse factors that might have predisposed the contacts to being infected with TB. Although it seems highly likely that case 3 was infected with the same strain as cases 1 and 2, the sputum culture from case 3 was negative, so the genetic relationship of their infections could not be proven. Four contacts were positive by QFT only with the third IGRA test, a QFT assay that was performed 3 months after two negative T-SPOT.TB tests. Because we have no knowledge that any of these four developed active disease, and no additional tests were performed, it is difficult to be sure which results were correct, or whether the inconsistent results were due to the window period necessary for an IGRA test to become positive. It is also possible, although less likely, that some of these contacts were infected from another source during the interval between the tests. Finally, 69% of the contacts were lost to follow-up before the end of the planned 2 year medical supervision, so it is possible that, unbeknownst to us, some LTBI contacts could have developed active TB.Many of the obstacles to TB control evident in this study could be partially attributed to the stigma associated with TB: a long delay before diagnosis and treatment of the index case; less than full cooperation from the patients and contacts; reluctance of TB cases to name workmates for contact investigation; refusal of LTBI contacts to accept treatment and opposition of the company administration to expanding the investigation to include workers in other, adjacent departments, for fear of provoking panic. Most of the workers in this outbreak setting had university degrees, and although it might be assumed that individuals with higher education would regard TB with less stigma , our exp"}
+{"text": "Acinetobacter baumannii is an opportunistic pathogen ofintensive care unit (ICU) patients. A.baumannii colonizes many parts of the body including thegastrointestinal tract. Endemic and epidemic strains are polyclonal. There is noclarity on the origin of polyclonality of A.baumannii. The objective of the study was to define thegenetic relatedness of serial isolates and the origin of polyclonality. Serialrectal isolates from ICU patients whose rectum was colonized on \u22655 samplingoccasions were selected. From a total of 32 eligible colonized patients,isolates from a subgroup of 13 patients  showingdifferent patterns of colonization as revealed by pulsed-field gelelectrophoresis (PFGE) were studied. The isolates were analyzed by PFGEpulsotypes, sequence types (STs) by multi-locus sequence typing (MLST) andclonal complex (CC) by eBURST analysis. Serial isolates constituted a mixture ofidentical, related and unrelated pulsotypes. Analysis by STs and CCs were lessdiscriminatory. The data suggest a combination of an initial colonizing isolateundergoing mutation as well as colonization by independent isolates. Furtherclarity on the origin of diversity should be better obtained by whole-genomesequencing. Acinetobacter baumannii causes severe nosocomial infections incritically ill patients and is involved in many hospital outbreaks world-wide. Itcolonizes skin and mucous membranes including the gastrointestinal tract Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research withdata that supports the conclusions. Experiments must have been conducted rigorously,with appropriate controls, replication, and sample sizes. The conclusions must bedrawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performedappropriately and rigorously? Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying thefindings in their manuscript fully available?PLOS Data policy requires authors to make alldata underlying the findings described in their manuscript fully available withoutrestriction, with rare exception (please refer to the Data Availability Statement inthe manuscript PDF file). The data should be provided as part of the manuscript orits supporting information, or deposited to a public repository. For example, inaddition to summary statistics, the data points behind means, medians and variancemeasures should be available. If there are restrictions on publicly sharingdata\u2014e.g. participant privacy or use of data from a third party\u2014those must bespecified.The Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligiblefashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submittedarticles must be clear, correct, and unambiguous. Any typographical or grammaticalerrors should be corrected at revision, so please note any specific errorshere.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You mayalso include additional comments for the author, including concerns about dualpublication, research ethics, or publication ethics. Reviewer #1: The manuscript describes the molecular typing analysis of Acinetobacterbaumannii isolates from a Kuwaitian hospital. It is well written in most parts andcould be interesting for the readers of PLOS One. However, due to undeniableweaknesses in methodological procedures and data interpretation, it can not beaccepted for publication in its current form.Major comments:- the introduction is overlong and should be shortened. This can easily done by aless detailed explanation of the different typing methods.- the material and methods part is overlong and could easily be shortened by usingcitations (e.g. description of MLST).- line 50: nowadays, I would not agree that PFGE is still the gold standard. SinceNGS-based typing has become widespread in many countries and as this technique has aat least equivalent or in most cases higher discriminatory power, it should be namedas the gold standard. However, no consensus criteria for e.g. cgMLST exist, what isthe advantage of PFGE (Tenover criteria).- line 52: This is not correct. PFGE has a high discriminatory power, even forisolates from different geographic regions. The real problem is, that PFGE resultsare not comparable from one laboratory to another due to technical variations. Butone single laboratory could easily compare isolates from different regions. This hasto be changed.- the authors did not use the Tenover criteria for outbreak investigation by PFGE. Iof course know that the Tenover criteria should be used only for isolates withindefined time periods, but it would be interesting to know if and how the resultschange when interpreted with these consensus criteria. This must be done.- the band patterns shown in figure 1 are of extremely low quality for some isolatesthat in my oppinion do not allow a reliable data interpretation. e.g. the bandpattern isolate Y5a is completely unuseable due to crooked bands. When looking atthe bands in detail, for me it does not look like this is another pulsotype thanY5b. Additionally, the DNA amounts seem to be very different for different isolates,which complicates the analysis even more.The same is the case for isolates R1, R3a, J11, V2 and others... The authors shouldreperform the PFGE for isolates with poor band patterns.- table 2: prior to publication, the new MLSTs and CCs must be numbered incoordination with the A. baumannii MLST website.Minor comments:- line 44: delete \"typing of the isolates to determine their relatedness\" as thismakes no sense here and seems to be a copy-paste issue- lines 117/118: \"%\" is missing for some numbers- line 121: change it to \"cultures...were typed by PFGE.\"- line 188: \"eBU_R_ST\"Reviewer #2: Al-Hashem et al. present results of a molecular surveillance study onAcinetobacter baumannii on an adult intensive care unit in a tertiary care centre inKuwait. The study was conducted in a setting where A. baumannii is endemic fromMarch 2016 to June 2017.The surveillance was based on rectal colonization. From each specimen isolates withdifferent morphotypes were picked and subsequently genotyped. In a pilot study theauthors analyzed the association of morphotype and genotype in 12 patients. Analyseswere performed with DiversiLab. Based on the pilot study data, the authors concludedthat each morphotype represents one genotype.Rectal colonization with A. baumannii was studied in 493 patients. In 73 out of 493patients A. baumannii was detected after 72 h of admission. 32 out of theses 73patients were positive on more than five occasions . Only patientswith hospital-acquired (> 72 h after admission) and with serial isolates wereincluded. The authors grouped these 32 patients in six groups based on the\u201ccolonization pattern\u201d and picked 13 patients for further genotypic analysis .The key message is the high diversity of hospital-acquired A. baumannii strainswithin one patient.Although the authors did not use whole genome sequencing for genotyping they showwith several other methods  that patients are colonized with severaldifferent strains at single time points and during hospitalization (overtime).The article is well-written and easy to understand. Nevertheless, there are severalaspects that reduce the scientific impact of this manuscript:Major revisions1. The authors do not mention any antibiotic susceptibility data. I recommend addingthis data as it is of interest to the reader if patients are colonized with MDR orsusceptible strains.2. The authors compared isolates from one patient and not between the patients in thegenotyping analysis. From an infections control perspective it is important to knowif there were any transmissions between the patients. Transmissions can be suspectedif two patients hospitalized at the same time on the same ward acquired isolateswith the same pulsotype/MLST-type (person-to-person- transmission).Environment-to-patient transmissions are more difficult to prove, especiallyretrospectively, however A. baumannii is known to colonize the environment. Forexample, PFGE patterns of isolates N3 and Y4 look similar and both patients werehospitalized during the same time period (end of 2016 and beginning of 2017). Pleaseexplain, why you decided not to compare isolates of different patients and mentionit in the text (limitations?).3. The discussion is short. Please mention more aspects .No limitations are mentioned. One limitation is that the sensitivity and specificityof the microbiological sampling method to detect A. baumannii is not known. Patientsmay still be colonized by the first strain overtime even if it is not detected.4. Line 90 \u201cThere was no outbreak during the study period.\u201d Please explain. What kindof outbreak do you mean? Outbreaks with any kind of bacteria or A. baumannii? Isthere any active surveillance system in place to come to this conclusion? Please,mention in the text.5. Isolates were considered as identical (100%), related (99-80%) or unrelated(<80%) in the PFGE analysis (Line 137-140). In my opinion, this is a veryconservative approach. Even if you run the same isolate on one gel in several lanesyou do not necessarily get 100% similarity. I would suggest: 100-97.5% (highlyrelated), 97.5-80% related, <80% unrelated. You also chose a less conservativeapproach in the DiversLab analysis.6. Table 1 is part of the results and not part of the methods. Table 1 shows thedifferent groups based on colonization patterns of the patients overtime . The six groups are complex and difficult tounderstand.For example, Patient N is in group 1 \u201cThe first isolate disappears and is replaced byan identical or related isolate over time\u201d. However, in my opinion, patient Nbelongs to group 3 \u201cthe first isolate disappears and is replaced by related andunrelated isolates\u201d as there is a relatedness of \u201cFI, -> R-> I -> R->U\u201d.A better and more practical subgrouping is proposed in the discussion (line 278-280):\u201ccolonization with identical and related isolates (patient Y), colonization withidentical, related and unrelated isolates , andcolonization with related and unrelated isolates .\u201d.This is the key message of the manuscript. One must consider that patients arecolonized with several geno- and phenotypes over time, which is important to know inoutbreak situations and to important to trace transmissions. In an outbreak you haveto include several isolates from each patient in the genotyping analysis.7. Whole genome sequencing (line 180-185): Please mention how many isolates and whichisolates were analyzed by WGS and why.8. 493 patients were screened over a period of 16 months. Please mention how manypatients were excluded from the study and why (no consent?). I imagine that duringthe period more patients than 493 were admitted on the ICU.9. Why did you exclude patients with A. baumannii present on admission (line 218)?Please explain.Minor revisionsLine 42 \u2013 44: Please rephrase. \u201cThis organism has the propensity for acquiringmultiple resistance genes with phenotypic expression of multidrug-resistant (MDR)characteristics. MDR strains are now endemic in many hospitals around the world,including hospitals in Kuwait  typing of the isolates to determine theirrelatedness.\u201dLine 47 [6] Consider to mention a study where RAPD was used for A. baumannii.Line 68. Please mention recent publications where WGS was used for A. baumannii.There are also several recent publications where a cgMLST scheme was established andused for A. baumannii.Lines 117 \u2013 118: Add %.Line 125 \u201cv/v sarkosyl, pH 7.5),\u201d Remove the bracket.Line 178: Please mention the website.Line 200 \u2013 203: Please shift to methods.Line 245 \u201cThese are shown Table S2\u201d. Please rephraseLine 244 Please mention in the results section that the new MLST types were uploadedto the MLST server and not in the discussion section (lines 288-289).Lines 466-474: How many isolates were included in Figure 2 and Figure 3. Pleasemention in the text.**********what does this mean?). If published, this willinclude your full peer review and any attached files.6. PLOS authors have the option to publish the peerreview history of their article  digital diagnostic tool, AttachmentReview_PlosOne_Ghayda_MS1.docxSubmitted filename: Click here for additional data file. 10 Mar 2020Response to Reviewers11/2/2020Dear Dr. Crivelleri:Re: PONE-D-19-35790 entitled \u201cGenetic relatedness of serial rectal isolates ofAcinetobacter baumannii in an adult intensive care unit of a tertiary hospital inKuwait\u201dThank you for forwarding the reviewers\u2019 comments and your comments. My responses areas below. ACADEMIC EDITOR: \u2022 Dear Authors, I was in doubt for my decision, because there are many criticisms tocorrect. \u2022 There are conflicts between the reviews, actually I think the reviewers areexpressing the same concepts; the weak statistical method doesn't permit thismanuscript to be accepted as it is. It needs a very accurate revision to bepublished. \u2022 Please shorten introduction, materials and methods. Answer to all the criticismmoved by the reviewers in order to make the manuscript ready for publication. Thank you for your decision to invite a revised manuscript in spite of many commentsfrom the reviewers. We have made extraordinary efforts to answer the commentsincluding shortening the Introduction and Materials & Methods.Reviewer #1: The manuscript describes the molecular typing analysis of Acinetobacter baumanniiisolates from a Kuwaitian hospital. It is well written in most parts and could beinteresting for the readers of PLOS One. However, due to undeniable weaknesses inmethodological procedures and data interpretation, it cannot be accepted forpublication in its current form.Major comments:- the introduction is overlong and should be shortened. This can be easily done by aless detailed explanation of the different typing methods.Introduction is much shortened now (L39-L74).- the material and methods part is overlong and could easily be shortened by usingcitations (e.g. description of MLST).Materials and Methods section is much shortened now (L76-L157).- line 50: nowadays, I would not agree that PFGE is still the gold standard. SinceNGS-based typing has become widespread in many countries and as this technique has aat least equivalent or in most cases higher discriminatory power, it should be namedas the gold standard. However, no consensus criteria for e.g. cgMLST exist, what isthe advantage of PFGE (Tenover criteria).This statement is modified now (L50). - line 52: This is not correct. PFGE has a high discriminatory power, even forisolates from different geographic regions. The real problem is, that PFGE resultsare not comparable from one laboratory to another due to technical variations. Butone single laboratory could easily compare isolates from different regions. This hasto be changed.This statement is changed now (L50-L52).- the authors did not use the Tenover criteria for outbreak investigation by PFGE. Iof course know that the Tenover criteria should be used only for isolates withindefined time periods, but it would be interesting to know if and how the resultschange when interpreted with these consensus criteria. This must be done.We did not investigate outbreak in our study. However, we used Tenover criteria, inaddition, to interpret the relatedness of isolates .- the band patterns shown in figure 1 are of extremely low quality for some isolatesthat in my opinion do not allow a reliable data interpretation. e.g. the bandpattern isolate Y5a is completely unusable due to crooked bands. When looking at thebands in detail, for me it does not look like this is another pulsotype than Y5b.Additionally, the DNA amounts seem to be very different for different isolates,which complicates the analysis even more.The same is the case for isolates R1, R3a, J11, V2 and others... The authors shouldreperform the PFGE for isolates with poor band patterns.We have repeated PFGE of these isolates several times to improve the quality of gels.What we have presented are the best patterns we have. I am afraid redoing the gelsis not going to change the quality of gels or conclusions. For Y5a, even though themiddle of the band is a bit drawn up, the pattern is readable. There is amisunderstanding here. We agree that Y5a and Y5b are of the same pulsotype (1c inTable 2). With regard to R1 and R3a, they are clearly different with R3a having anadditional band at the top. In Table 2, these isolates are correctly labelled as 1aand 1b. - table 2: prior to publication, the new MLSTs and CCs must be numbered incoordination with the A. baumannii MLST website.Unfortunately, in spite of repeated reminders, we have not heard from the curator ofthe Oxford MLST scheme. Colleagues in Australia and the UK too have complained of alack of response. Important thing is that we have presented detailed information onthe novel STs. If the manuscript is accepted for publication in PLOS ONE, we willcommunicate the new information to the journal as and when it becomes available. Minor comments:- line 44: delete \"typing of the isolates to determine their relatedness\" as thismakes no sense here and seems to be a copy-paste issueSorry for the mistake. True, it was a copy-paste issue. The sentence is deleted now(L44).- lines 117/118: \"%\" is missing for some numbers- line 121: change it to \"cultures...were typed by PFGE.\"Texts containing these lines are deleted while shortening the Introduction, andMaterials & Methods.- line 188: \"eBU_R_ST\"The spelling mistake is corrected now (L155).Reviewer #2: Al-Hashem et al. present results of a molecular surveillance study onAcinetobacter baumannii on an adult intensive care unit in a tertiary care centre inKuwait. The study was conducted in a setting where A. baumannii is endemic fromMarch 2016 to June 2017.The surveillance was based on rectal colonization. From each specimen isolates withdifferent morphotypes were picked and subsequently genotyped. In a pilot study theauthors analyzed the association of morphotype and genotype in 12 patients. Analyseswere performed with DiversiLab. Based on the pilot study data, the authors concludedthat each morphotype represents one genotype.Rectal colonization with A. baumannii was studied in 493 patients. In 73 out of 493patients A. baumannii was detected after 72 h of admission. 32 out of theses 73patients were positive on more than five occasions . Only patientswith hospital-acquired (> 72 h after admission) and with serial isolates wereincluded. The authors grouped these 32 patients in six groups based on the\u201ccolonization pattern\u201d and picked 13 patients for further genotypic analysis .The key message is the high diversity of hospital-acquired A. baumannii strainswithin one patient.Although the authors did not use whole genome sequencing for genotyping they showwith several other methods  that patients are colonized with severaldifferent strains at single time points and during hospitalization (overtime).The article is well-written and easy to understand. Nevertheless, there are severalaspects that reduce the scientific impact of this manuscript:Major revisions1. The authors do not mention any antibiotic susceptibility data. I recommend addingthis data as it is of interest to the reader if patients are colonized with MDR orsusceptible strains.Susceptibility data are now added .2. The authors compared isolates from one patient and not between the patients in thegenotyping analysis. From an infections control perspective, it is important to knowif there were any transmissions between the patients. Transmissions can be suspectedif two patients hospitalized at the same time on the same ward acquired isolateswith the same pulsotype/MLST-type (person-to-person- transmission).Environment-to-patient transmissions are more difficult to prove, especiallyretrospectively, however A. baumannii is known to colonize the environment. Forexample, PFGE patterns of isolates N3 and Y4 look similar and both patients werehospitalized during the same time period (end of 2016 and beginning of 2017). Pleaseexplain, why you decided not to compare isolates of different patients and mentionit in the text (limitations?).This is addressed (L284-L288).3. The discussion is short. Please mention more aspects .This is now done (L271-L280).No limitations are mentioned. One limitation is that the sensitivity and specificityof the microbiological sampling method to detect A. baumannii is not known. Patientsmay still be colonized by the first strain overtime even if it is not detected.Limitations are mentioned now (L281-L288).4. Line 90 \u201cThere was no outbreak during the study period.\u201d Please explain. What kindof outbreak do you mean? Outbreaks with any kind of bacteria or A. baumannii? Isthere any active surveillance system in place to come to this conclusion? Please,mention in the text.Sorry, this statement was included inadvertently. There is no active surveillance,but if there is a suspicion of outbreak due to any bacteria, then, investigation iscarried out.That way, there was no separate investigation during our study period. 5. Isolates were considered as identical (100%), related (99-80%) or unrelated(<80%) in the PFGE analysis (Line 137-140). In my opinion, this is a veryconservative approach. Even if you run the same isolate on one gel in several lanesyou do not necessarily get 100% similarity. I would suggest: 100-97.5% (highlyrelated), 97.5-80% related, <80% unrelated. You also chose a less conservativeapproach in the DiversLab analysis.Because of the nature of the question asked in the study, it was necessary to adoptconservative criteria for PFGE analysis. It was a different question with regard toDiversiLab analysis. Therefore, I am afraid, the adopted approaches arejustified.6. Table 1 is part of the results and not part of the methods. Table 1 shows thedifferent groups based on colonization patterns of the patients overtime . The six groups are complex and difficult tounderstand.For example, Patient N is in group 1 \u201cThe first isolate disappears and is replaced byan identical or related isolate over time\u201d. However, in my opinion, patient Nbelongs to group 3 \u201cthe first isolate disappears and is replaced by related andunrelated isolates\u201d as there is a relatedness of \u201cFI, -> R-> I -> R->U\u201d.A better and more practical subgrouping is proposed in the discussion (line 278-280):\u201ccolonization with identical and related isolates (patient Y), colonization withidentical, related and unrelated isolates , andcolonization with related and unrelated isolates .\u201d.This is the key message of the manuscript. One must consider that patients arecolonized with several geno- and phenotypes over time, which is important to know inoutbreak situations and to important to trace transmissions. In an outbreak you haveto include several isolates from each patient in the genotyping analysis.We agree with this excellent suggestion and changed the grouping of patients .7. Whole genome sequencing (line 180-185): Please mention how many isolates and whichisolates were analyzed by WGS and why.This is now mentioned (L149-L151).8. 493 patients were screened over a period of 16 months. Please mention how manypatients were excluded from the study and why (no consent?). I imagine that duringthe period more patients than 493 were admitted on the ICU.We included all patients.9. Why did you exclude patients with A. baumannii present on admission (line 218)?Please explain.This is now explained (L180-L182).Minor revisionsLine 42 \u2013 44: Please rephrase. \u201cThis organism has the propensity for acquiringmultiple resistance genes with phenotypic expression of multidrug-resistant (MDR)characteristics. MDR strains are now endemic in many hospitals around the world,including hospitals in Kuwait  typing of the isolates to determine theirrelatedness.\u201dSorry for the mistake. The last line was inadvertently introduced by mistake whilecutting and pasting. It is now deleted (L42).Line 47 [6] Consider to mention a study where RAPD was used for A. baumannii.Reference 6 is now for A. baumannii.Line 68. Please mention recent publications where WGS was used for A. baumannii.There are also several recent publications where a cgMLST scheme was established andused for A. baumannii.Now reference 18 is appropriate (L58).Lines 117 \u2013 118: Add %.Line 125 \u201cv/v sarkosyl, pH 7.5),\u201d Remove the bracket.These are deleted while shortening the Methods section.Line 178: Please mention the website.Now mentioned (L141).Line 200 \u2013 203: Please shift to methods.Done (L104-L106)).Line 245 \u201cThese are shown Table S2\u201d. Please rephraseDone .Line 244 Please mention in the results section that the new MLST types were uploadedto the MLST server and not in the discussion section (lines 288-289).Done (L222-L223).Lines 466-474: How many isolates were included in Figure 2 and Figure 3. Pleasemention in the text.The numbers are not relevant. The figures are constructed based on sequencetypes.I hope that I have answered all comments satisfactorily.With kind regardsYours sincerelyProfessor M. John AlbertDepartment of MicrobiologyFaculty of MedicineKuwait UniversityKuwaitAttachmentGhayda-PLOSONE-ResponseToReviewerComments.docxSubmitted filename: Click here for additional data file. 13 Mar 2020Genetic relatedness of serial rectal isolates of Acinetobacter baumannii in an adultintensive care unit of a tertiary hospital in KuwaitPONE-D-19-35790R1Dear Dr. Albert,We are pleased to inform you that your manuscript has been judged scientificallysuitable for publication and will be formally accepted for publication once itcomplies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendmentsrequired prior to publication. When all required modifications have been addressed,you will receive a formal acceptance letter and your manuscript will proceed to ourproduction department and be scheduled for publication.https://www.editorialmanager.com/pone/, click the \"Update MyInformation\" link at the top of the page, and update your user information. If youhave any billing related questions, please contact our Author Billing departmentdirectly at authorbilling@plos.org.Shortly after the formal acceptance letter is sent, an invoice for payment willfollow. To ensure an efficient production and billing process, please log intoEditorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them aboutyour upcoming paper to enable them to help maximize its impact. If they will bepreparing press materials for this manuscript, you must inform our press team assoon as possible and no later than 48 hours after receiving the formal acceptance.Your manuscript will remain under strict press embargo until 2 pm Eastern Time onthe date of publication. For more information, please contact With kind regards,Martina CrivellariAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 20 Mar 2020PONE-D-19-35790R1 Acinetobacterbaumannii in an adult intensive care unit of a tertiary hospital inKuwait Genetic relatedness of serial rectal isolates of Dear Dr. Albert:I am pleased to inform you that your manuscript has been deemed suitable forpublication in PLOS ONE. Congratulations! Your manuscript is now with our productiondepartment. onepress@plos.org.If your institution or institutions have a press office, please notify them aboutyour upcoming paper at this point, to enable them to help maximize its impact. Ifthey will be preparing press materials for this manuscript, please inform our pressteam within the next 48 hours. Your manuscript will remain under strict pressembargo until 2 pm Eastern Time on the date of publication. For more informationplease contact plosone@plos.org. For any other questions or concerns, please email Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Martina Crivellari Academic EditorPLOS ONE"}
+{"text": "Background: Cases of excessive neutrophil counts in the blood in severe coronavirus disease (COVID-19) patients have drawn significant attention. Neutrophil infiltration was also noted on the pathological findings from autopsies. It is urgent to clarify the pathogenesis of neutrophils leading to severe pneumonia in COVID-19.Methods: A retrospective analysis was performed on 55 COVID-19 patients classified as mild (n = 22), moderate (n = 25), and severe (n = 8) according to the Guidelines released by the National Health Commission of China. Trends relating leukocyte counts and lungs examined by chest CT scan were quantified by Bayesian inference. Transcriptional signatures of host immune cells of four COVID19 patients were analyzed by RNA sequencing of lung specimens and BALF.Results: Neutrophilia occurred in 6 of 8 severe patients at 7\u201319 days after symptom onset, coinciding with lesion progression. Increasing neutrophil counts paralleled lesion CT values (slope: 0.8 and 0.3\u20131.2), reflecting neutrophilia-induced lung injury in severe patients. Transcriptome analysis revealed that neutrophil activation was correlated with 17 neutrophil extracellular trap (NET)-associated genes in COVID-19 patients, which was related to innate immunity and interacted with T/NK/B cells, as supported by a protein\u2013protein interaction network analysis.Conclusion: Excessive neutrophils and associated NETs could explain the pathogenesis of lung injury in COVID-19 pneumonia. As of early May 2020, more than 3 million cases of coronavirus disease 2019 (COVID-19) have been confirmed worldwide, resulting in hundreds of thousands of deaths , myeloperoxidase (MPO)-DNA, and citrullinated histone H3 (Cit-H3) levels were found to be elevated in the serum of COVID-19 patients . This sun = 23) during hospitalization were examined, together with the corresponding lung injury, to clinically define the relationship between lung injury and leukocyte counts. Second, transcriptional signatures of host immune cells from COVID-19 patients (n = 4) were analyzed by RNA sequencing of lung specimens or bronchoalveolar lavage fluids (BALF). Immune cell frequency was analyzed by MCPcouter. We used average expression of genes enriched in neutrophil degranulation and activation to screen highly correlated genes and further identified NET associated genes in the correlated gene list to construct an interactive network from the STRING database.In the present study, first, the dynamics of neutrophil counts in COVID-19 patients . The 55 confirmed COVID-19 patients were enrolled in this retrospective study from January 23 to March 15, 2020. Written informed consent was obtained from all patients from the Fifth People's Hospital, Wuxi, China.2/FiO2 \u2264 300 mm Hg.The clinical handling of COVID-19 patients was performed according to the Guidelines of the Diagnosis and Treatment of New Coronavirus Pneumonia (version 7) published by the National Health Commission of China. Mild, moderate, and severe cases were defined by the following conditions: (1) epidemiological history, (2) fever or other respiratory symptoms, (3) frequency of typical CT image abnormalities of viral pneumonia, and (4) positive RT-PCR result for SARS-CoV-2 RNA. In addition, mild cases were diagnosed if no typical CT image abnormality of viral pneumonia (#3 above) was seen and severe patients also met at least one of the following conditions: (1) shortness of breath, respiratory rate (RR) \u226530 times/min, (2) oxygen saturation (resting state) \u2264 93%, or (3) PaOCRA002390), and corresponding data of three healthy controls were from the NCBI SRA database . Four RNA-seq data from lung specimens of two COVID-19 patients and two healthy controls were acquired from the GEO database .All medical records including epidemiological, demographic, clinical manifestation, laboratory data, radiological characteristics, treatment, and outcome data were reviewed and collected. Laboratory confirmation of SARS-CoV-2 infection was performed by real-time RT-PCR  according to Chinese CDC approval. Five sets of RNA-seq data from BALF of two COVID-19 patients were acquired from BIG Data Center  with patients in supine position. The main scanning parameters were as follows: tube voltage = 120 kV, automatic tube current modulation (about 95 mAs), pitch = 1.2 mm, slice thickness = 7 mm, field of view = 350 mm \u00d7 350 mm. All images were then reconstructed with a slice thickness of 0.6 mm with the same increment.Two professional radiologists (Y.M.Y. and X.M.L.), who were blinded to the laboratory test data, reported chest CT features and assessed the CT features by consensus. The lesion CT values were assessed using the Skyview pacs system. The region-of-interest was selected manually marking the area of highest intensity (most restricted area) of the lesion in CT images.Homo sapiens release 99 transcriptomes (q < 0.1) was used to correct for multiple comparisons.Kallisto was used to pseudoalign the RNA-seq reads and perform bootstrap analysis using an index based on the ENSEMBL GRCh38 riptomes . Gene exriptomes  was usedhttp://metascape.org/)  . Gene sepe.org/) . The genpe.org/) . Gene inpe.org/) .Quantitative parameters are described as the median value followed by the inter-quartile range (IQR) in parentheses. Principal component analysis was performed with R package \u201cFactoMineR\u201d to identify those clinical parameters that contribute most to distinguishing severe, moderate, and mild cases of COVID-19 . FiguresSevere cases were typed as severe and others (moderate and mild cases) as non-severe. The generalized linear model was then used to calculate coefficients  of all parameters for severe. Finally, we used the function of exp [exp(x) = ex] for coefficients. The results were an odd's ratio . Receiver operating characteristic curves (ROC) were calculated by R package \u201cpROC.\u201d The area under the ROC curve (AUC) and cut-off values of selected parameters were used to distinguish mild and severe cases . NumericFifty-five confirmed COVID-19 patients were hospitalized in The Fifth People's Hospital of Wuxi from Jan 23 to Mar 15, 2020. The median age of patients was 45 years (IQR 25\u201361), and 27 (49%) were male. Based on the previously described guidelines, 22 (40%), 25 (45%), and 8 (15%) of the 55 COVID-19 patients were classified as mild, moderate, and severe cases, respectively. There were five patients with diabetes (9%), 13 with hypertension (24%), eight with surgical history (15%), and two with co-infections (4%). The most common symptoms at onset were fever in 28 cases (51%), sputum production in 13 cases (24%), cough in 22 cases (40%), and fatigue in 17 cases (31%) .The clinical handling and relevant time-points of 33 patients including eight severe and 25 moderate cases are shown in The laboratory test of each patient on the day of hospital admission showed that the median neutrophil count in severe COVID-19 patients  was higher than in the moderate  and mild  groups. In contrast, lymphocyte and monocyte counts in severe COVID-19 patients were lower than in the other two groups . By logiPrincipal component analysis was performed to visualize the contribution of all mentioned clinical parameters on disease severity . Nine va9/L) and peaked in six of eight severe COVID-19 patients. In contrast, only one moderate (1/26) COVID-19 patient was found with neutrophilia. Lymphopenia occurred in seven of eight severe patients but only in four mild (4/22) COVID-19 patients. Monopenia (<1 \u00d7 108/L) was found in three moderate (3/25) and four severe (4/8) COVID-19 patients. Overall, monitoring blood cell parameters revealed neutrophilia as a characteristic of severe COVID-19 patients.Next, dynamic changes of neutrophil, lymphocyte, and monocyte counts in the peripheral blood of COVID-19 patients were monitored . DramatiNeutrophilia and lymphopenia obviously occurred in severe COVID-19 patients during hospitalization. Here was a case of severe patient. The CRP level remained low when neutrophilia occurred, and the D-dimer levels increased after neutrophilia. Series of chest CT images exhibited enlarged patches and ground-glass nodules in the sub-pleura area of both lungs during neutrophilia. Interestingly, all observed lesions were reduced or gradually absorbed along with the return of neutrophils to normal levels after neutrophilia . The CT z-values of CT value . Their representation in the RNA-seq data were exhibited using a scaled heatmap by comparing both lung and BALF samples of COVID-19 patients to healthy controls .The results revealed that 112 marker genes represented four immune populations: neutrophils (46 genes), T cells (13 genes), monocytes (10 genes), and B cells (43 genes). For lung tissue, the most up-regulated marker genes were enriched in neutrophils, second in monocytes, and only a small proportion were enriched in B cells. Marker genes of T cells were almost all lowly expressed. For BALF, the most upregulated marker genes were similarly enriched in neutrophils, but more up-regulated genes in monocytes and B cells were observed in COVID-19 patients compared to healthy controls, which is different from the lung samples.q-value were related to neutrophil degranulation and activation . For the BALF samples, the score of neutrophils, cytotoxic lymphocytes, B cells, monocytes, and dendritic cells were found to be higher in one of the COVID-19 patients compared to the three healthy controls  and healthy cases (R2). All DEGs were ranked based on \u0394R (R1-R2). The \u201cR value\u201d of the top 84 genes (R1 > 0) in the two groups are displayed in ape tool ; Table 3ape tool \u201346.To further investigate the role of NETs in COVID-19, we generated a gene set termed \u201cNET-associated genes\u201d based on genes coding for proteins enriched in NETs released from human neutrophils with mass spectrometry . Pre-ranSTAT1 induced Interferon stimulated genes by IL2RG, implying that NETs associated genes may be triggered by IFN signaling. Besides, NETs in turn may activate B cells via TNFSF13B and inhibit the function of T and NK cells via LGAS9 and CEACAM1, which are negative regulators for T and NK cells. LGAS9 is a possible promoter of protein-arginine deiminase type 4 (PAD4). PAD4, a key NETs associated gene, lies downstream of ROS and promotes chromatin decondensation , structural proteins (LCP1), anti-microbial related (TREM1), peroxisomal (SH3BGRL3), and others   . Thus, wIn this study, a set of laboratory test parameters and the corresponding chest CT images of 55 COVID-19 patients were collected during hospitalization. Among these variables, excessive neutrophils were associated with disease severity, as shown by principal component analysis. Bayesian inference across patients quantified that the increased trend of pneumonia lung injury, as represented by CT values, was in accord with the increased trend in neutrophil counts. Transcriptome analysis of lung specimens and BALF from COVID-19 patients also indicated the most up-regulated marker genes were neutrophil related. Importantly, many neutrophil activation genes were categorized as NET-associated genes. These genes were further assessed to interact with T and NK cells via negative regulatory molecules in COVID-19 patients leading to insufficient anti-viral response and lung injury .Our previous study also found an increased neutrophil-to-lymphocyte ratio in the most severe disease cases . RecentlLGALS9, CEACAM1, and TNFSF13B expressions, respectively. We suspect that the progression of lesions in COVID-19 patients may be induced by NETs as well as NETs-T/NK/B cell interactions.NETs, as confirmed contributors to pathological inflammation of pneumonia, can damage tissues by killing epithelial and endothelial cells , 17 of pIn conclusion, the clear trend of lung injury in accord with the trend of increasing neutrophils was quantified by Bayesian inference analysis in COVID-19 patients. The transcriptome signature of immune cells also indicated elevated neutrophil markers in the lung and BALF samples of COVID-19 patients. Importantly, among the excessive neutrophil activated genes, 17 were NETs associated genes and these genes interacted with T cells and NK cells through negative regulation. Therefore, we posit that NETosis in lung tissue leads to an insufficient anti-viral response in COVID-19 patients. We hope that future studies will investigate the predictive power of circulating NETs in well-phenotyped longitudinal cohorts.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/The studies involving human participants were reviewed and approved by the Ethics Committee of the Fifth People's Hospital, Wuxi (No. 2020-006-1). The patients provided their written informed consent to participate in this study.JW, YQ, and QL conceived and designed the experiments. QL, JW, DH, and ML drafted and revised the manuscript. YY, YZ, and XL carried out the data collection. JW, DH, and YC carried out the data analysis and interpretation. DH, YQ, ML, and LH contributed reagents, materials, and analysis tools. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The new Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), which was first detected in Wuhan (China) in December of 2019 is responsible for the current global pandemic. Phylogenetic analysis revealed that it is similar to other betacoronaviruses, such as SARS-CoV and Middle-Eastern Respiratory Syndrome, MERS-CoV. Its genome is\u2009\u223c\u200930\u00a0kb in length and contains two large overlapping polyproteins, ORF1a and ORF1ab that encode for several structural and non-structural proteins. The non-structural protein 1 (nsp1) is arguably the most important pathogenic determinant, and previous studies on SARS-CoV indicate that it is both involved in viral replication and hampering the innate immune system response. Detailed experiments of site-specific mutagenesis and in vitro reconstitution studies determined that the mechanisms of action are mediated by (a) the presence of specific amino acid residues of nsp1 and (b) the interaction between the protein and the host\u2019s small ribosomal unit. In fact, substitution of certain amino acids resulted in reduction of its negative effects.A total of 17,928 genome sequences were obtained from the GISAID database (December 2019 to July 2020) from patients infected by SARS-CoV-2 from different areas around the world. Genomes alignment was performed using MAFFT (REFF) and the nsp1 genomic regions were identified using BioEdit and verified using BLAST. Nsp1 protein of SARS-CoV-2 with and without deletion have been subsequently modelled using I-TASSER.We identified SARS-CoV-2 genome sequences, from several Countries, carrying a previously unknown deletion of 9 nucleotides in position 686-694, corresponding to the AA position 241-243 (KSF). This deletion was found in different geographical areas. Structural prediction modelling suggests an effect on the C-terminal tail structure.Modelling analysis of a newly identified deletion of 3 amino acids (KSF) of SARS-CoV-2 nsp1 suggests that this deletion could affect the structure of the C-terminal region of the protein, important for regulation of viral replication and negative effect on host\u2019s gene expression. In addition, substitution of the two amino acids (KS) from nsp1 of SARS-CoV was previously reported to revert loss of interferon-alpha expression. The deletion that we describe indicates that SARS-CoV-2 is undergoing profound genomic changes. It is important to: (i) confirm the spreading of this particular viral strain, and potentially of strains with other deletions in the nsp1 protein, both in the population of asymptomatic and pauci-symptomatic subjects, and (ii) correlate these changes in nsp1 with potential decreased viral pathogenicity. Riboviria, order Nidovirales, suborder Cornidovirineae, family Coronaviridae, subfamily Orthocoronavirinae, genus Betacoronavirus (lineage B), subgenus Sarbecovirus, and the species Severe acute respiratory syndrome-related coronavirus, and is the virus responsible for the current global pandemic [Severe Acute Respiratory Syndrome Coronavirus-2 (SARS CoV-2) belongs to the realm pandemic \u20133. The gpandemic  is highlpandemic , 6 and tpandemic .Coronavirus Diseases (COVID-19) comprises symptoms reported by patients infected by SARS-CoV-2, ranging from mild to severe, and some cases result in death. Severe acute respiratory illness with fever and respiratory symptoms, such as cough and shortness of breath, are the primary case definition, but recently patients without respiratory symptoms are becoming more recognized, with manifestations such as gastrointestinal, olfactory, cardiovascular, and neurological. Cases resulting in death are primarily middle-aged and elderly patients with obesity and/or pre-existing diseases  \u201311.Given the similarity among the viruses, the data about biological functions, characteristics and effects on the host of the proteins expressed by SARS-CoV-2 are mostly inferred by the previous studies on SARS-CoV and other related human (e.g. MERS-CoV) \u201314 and aAmong these proteins, SARS-CoV, nonstructural protein 1, nsp1 also known as the leader protein, plays a central role in hampering the anti-viral innate immune response, in particular Interferon-alpha expression , and it SARS-CoV nsp1 almost completely blocks host protein translation by binding the 40S ribosome of the host cell, which stops canonical mRNA translation at different steps during the initiation process \u201325. ThisCritical for this mechanism are certain amino acid residues of nsp1. For example, in the case of SARS-CoV several residues have been identified that differentially inhibit host gene expression, like interferon alpha, responsible for antiviral activity . More reHere we describe a deletion identified in the C-terminal region of nsp1 observed in certain genomes from SARS-CoV-2 patients, from different areas of the word. The deletion did result in removal of three amino acid residues (KSF). Two of them (KS) have been shown to be responsible for nsp1 of SARS-CoV partial attenuation of both inhibition of signal transduction and inhibition of gene expression, including Interferon-alpha . Our datWe analyzed 17,928 genomic sequences obtained from the GISAID database (updated on 07/24/2020) derived from patients infected by SARS-CoV-2 from different areas around the world. The genomes were collected from December 2019 to July 2020. SARS-CoV-2 reference genome (RefSeq: NC_045512.2) was obtained from the GenBank database. Genomes alignment was performed using MAFFT .Nsp1 sequence belonging to SARS-CoV-2 were identified using BioEdit and verified by using BLAST . Nsp1 prWe identified genomic sequences, from specific Countries, carrying a deletion of 9 nucleotides in position 686-694, corresponding to AA position 241-243 (KSF) . Though the number of sequences detected was a small fraction of the total analyzed, our data clearly identify a new SARS-CoV-2 viral strain present in subjects from different areas . However, our analysis also indicates that this deletion is not homogeneously present in all the Countries analyzed. For this reason, it would be important to monitor its presence over time, and to determine its penetrance and probability to spread and compete with the current viral strains. Nonetheless, our results suggest the possibility of the evolution of a new viral quasi-specie, but further data are necessary to confirm this hypothesis and explore the possibility of a developing intra-host adaptative process.Our analysis shows the emergence of a deletion in nsp1, one of the most important determinants of pathogenicity of SARS-CoV-2. This is quite surprising, since corona viruses typically experience a moderate rate of mutations, due to the presence of a protein with proofreader activity , calculated in about 26 mutations per year . Substitution of two of these amino acids (KS) reduced the inhibitory effect of innate immune response to SARS-CoV, and by predicted structure analysis we show that these amino acids compromise proper folding of nsp1. Consequently, we hypothesize that viruses harboring this deletion are likely to be less pathogenic than commonly observed viral strains. To this regard, we note that the two common endemic human coronaviruses, HCoV-OC43  and HCoVWe identified the emergence in infected subjects of a new viral strain of SARS-CoV-2 with a deletion of 3 amino acids (KSF) in the C-terminal region of nsp1. I-TASSER structure analysis indicates that this deletion may affects the structure of the C-terminal region, important for regulation of nsp1 activity. Substitution of two of these amino acids (KS) was also previously reported to revert the loss of interferon-alpha expression in cells transfected with mutated nsp1 from SARS-CoV. This deletion in nsp1, together with deletions previously described in other parts of SARS-CoV-2 genome by different groups, indicates that the virus is undergoing profound genomic changes. It should be noted that mutations of the virus are not very common, due to its proofreading mechanism, and that collection of the sequencing data is currently biased toward symptomatic subjects. It would be of interest to monitor over time and confirm the spreading of this particular viral strain, and potentially of strains with other deletions in the nsp1 protein, in the population of asymptomatic and pauci-symptomatic subjects and to correlate these changes in nsp1 with a possible decreased viral pathogenicity."}
+{"text": "The aim of study was to develop and assess the comfortability of garments with elastic straps and pressure applicator (GESPA) and the reliability and user-friendliness of \u201cGVcorrect\u201d app, which aims to catch the elastic straps\u2019 pressure level (mN). Methods: 6 children (5\u20137 y) with intermalleolar distance \u22655 cm wore GESPA daily for 3 months. Anthropometrical and goniometrical measurements were done according to standard technique; tone and biomechanical parameters of skeletal muscles determined with MyotonPRO; feedback about GESPA and \u201cGVcorrect\u201d collected via questionnaire. Results: Based on feedback from children and parents, new, more comfortable and user-friendly GESPA were designed; several updates were made to \u201cGVcorrect\u201d app; new goals were set for the next phase of the study. Conclusions: GESPA and the \u201cGVcorrect\u201d app serve their purpose, but there are still a number of important limitations that need to be removed before the product can be marketed. The study continues with product development until a medical device certificate is obtained.Background: There are non-invasive methods of correcting  Developondition . The preondition  and it iondition  more thaondition  and tibiondition . From fiGV prevalence is higher among overweight and obese children and approximately 70% of children with GV are obese . As partIn cases of mild persistent GV can be successfully treated conservatively . If the genu valgum since 2014. The aim of this study-period (2020) was to develop and assess the comfortability of GESPA and the reliability and user-friendliness of \u201cGVcorrect\u201d app, which aims to catch the GESPA` elastic straps pressure level (mN).There are also non-invasive methods of correcting GV , but until now, there is no method to evaluate mechanotherapeutic intervention that does not restrict the child\u2019s natural movements while the process is on-going so that timely decisions could be made on the effectiveness of the intervention. Scientists in Tartu Health Care College in collaboration with University of Tartu and The Health Clinic have been studied garments with elastic straps and pressure applicator (GESPA) ,20 in chThe study is carried out as an applied research project in collaboration with Tartu Health Care College, University of Tartu and The Health Clinic . There an = 6) whose lower limb alignment has not yet been fixed. The condition for inclusion was that the subjects were not involved in physical therapy and did not use orthoses during the study. Children with any diagnosed orthopedic pathology were excluded from the sample.Children aged 5\u20137 years with intermalleolar distance \u22655 cm were included . The app was developed in collaboration with software and product development partner Mooncascade . The appassessment I, AI) and after  the practical part anthropometric, goniometric parameters and myometric parameters: tone (frequency), biomechanical properties  of m. sartorius, m. tensor fasciae latae, m. semitendinosus, m. tibialis anterior, m. gastrocnemius caput mediale) were measured. Three months after wearing period the final measurement was done to evaluate long term effect of GESPA\u2014assessment III (AIII).At the first measurement ; BMI was evaluated according to National Centre for Health Statistics [All anthropometrical   and goniatistics . To deteatistics .In AII and the follow-up period (AIII), parents in collaboration with children were asked to complete a questionnaire that reflected comfortability of GESPA and reliability and user-friendliness of \u201cGVcorrect\u201d app. The questionnaire consisted of 5 \u201cyes or now\u201d questions. They were asked to explain the answers during the short interview.The researchers evaluated the user-friendliness of monitoring the data in the cloud server. Investigators monitored the appearance of data on the cloud server on a weekly basis and recorded sensor readings. If the data did not appear on the cloud server, the parents were contacted to find out if GESPA had been used. Each non-transfer was recorded.p value of < 0.05 was considered significant.For estimating the skeletal muscle tone (oscillation frequency\u2014Hz) and biomechanical properties (logarithmic decrement and dynamic stiffness N/m) individual analysis was carried out. MultiScan pattern of 20 measurements was used and the mean was considered . The p vn = 6) of the study are presented in m. sartorius in m. tensor fasciae latae in p < 0.05).Main characteristics of subjects (m. sartorius (m. tensor fascia latae (p < 0.05) with wearing GESPA. In AIII, the changes occurred promoted the worsening of GV position. The level of the pressure of elastic traps probably played an important role influencing the muscles\u2019 biomechanical parameters. For example, subject I had low level of the pressure (approximately 550 mN) and the decrease of frequency of m. tensor fascia latae during the GESPA wearing period was low.Biomechanical parameters  in AII showed individual and mostly positive changes as described in previous article . For example, the frequency of artorius  and m. tia latae  increasen = 4); the discomfort above the knee joint (n = 4); the fastening on the midfoot bothered when put on the shoes (n = 4); wearing GESPA caused feeling of warmth (n = 4); garments did not fit in overweight subject due to their apple type body shape (n = 1). However, one third of parents (n = 2) claimed that the child was eager to wear GESPA and nothing bothered them. Positively minded parents added that wearing GESPA has brought their child\u2019s lower limbs closer to normal alignment.According to the parents, the children wore GESPA on average 6 h a day. Most of the children were eager to wear GESPA at the beginning of the study; but the longer the time, the less the children wished to wear GESPA voluntarily. The children claimed that the GESPA was uncomfortable for the following reasons: the GESPA sank and the need to adjust them tightly ; the sensor charging socket broke down and needed repair by a technician (n = 4); the communication between the app and the sensors broke up and the program had to be restarted to restore it (n = 6); the degree of pressure did not stay within the recommended range (6). In addition, the parents did not like the fact that the child was forced to carry a smartphone with them. Because the researchers did not have backup sensors (if they were repaired), the child continued to wear GESPA, but the data was not stored in the cloud server.According to the results of the questionnaire, the parents agreed that \u201cGVcorrect\u201d was fulfilling its purpose and is convenient to use. Nevertheless, some limitations emerged: the sensors did not stay under the straps , press the save button and then the data will be loaded into the mobile application. Otherwise, the sensor program deletes the first recordings from its memory.The charging socket for the sensor battery was weakly attached to the first sensors and new sensor housing was made to repair it. Due to this, some children have pauses of up to two weeks in the cloud server recordings, but the children were instructed to wear their GESPA without sensors.This phase of the project the operation of the equipment in the appropriate environment was checked. The aim was not the number of subjects or corrective parameters, but we focused on the tripartite feedback related to the comfortability of GESPA and reliability and user-friendliness of the \u201cGVcorrect\u201d app. Based on the results, it can be said that GESPA and \u201cGVcorrect\u201d are fulfilling their purpose, but there are still several gaps that need to be improved and developed. Based on the feedback from children and parents, new, more comfortable and user-friendly garments (GESPA) were designed and several updates were made to \u201cGVcorrect\u201d app by the end of the study phase. The new GESPA will be in place in the next phase of research. According to investigators assessment, the use of a cloud server allows control of the adjustment process.The effectiveness of the alignment depends on the pressure force towards the frontal axis of the knee joint generated by the elastic straps remaining within the selected values. The analyzed data showed that the pressure of the elastic straps of the garments lower than 1000 mN does not cause the correction of the biomechanical axis of the lower limb. However, a compressive force greater than 1500 mN may, according to preliminary estimates, cause discomfort to the child. Thus, the optimal reference range is probably 1000 to 1500 mN and it will be tested in the next phase of the study.genu valgum is complicated because its measurement is related to the child\u2019s standing position (can vary greatly from time to time) and thus, the measurement error is large. The authors of the research do not recommend the use of IMD especially in individual analysis or in a small study group to monitor changes over time. However, the use of IMD is justified for the initial assessment of lower limb alignment.In our view, the determination of IMD to assess a change in the position of a genu valgum and direct the lower limb alignment in the right direction, which in turn would avoid the need for surgery. At the moment, this is only an assessment by researchers, which must be checked on a larger study group in the next phase of the study. The trend of changing the tibiofemoral angle is informative in assessing the success of the correction process, but it is suggested, that skeletal maturation is the most significant predictive factor in the severity of GV [In children with normal development TFA reaches 168 degrees and stabilizes at 174\u2013175 degrees by the age of six to seven ; thus, tty of GV , so bonem. sartorius and m. tensor fascia latae increases with the desired level of straps\u2019 pressure, but in general, changes in muscle biomechanical parameters are individual and require also further investigation by a larger study group in the next phase of study.The tone of The next phase of the study project also must: develop comfortable and attractive user-friendly garments (GESPA); to demonstrate the feasibility of the technology in an appropriate simulated environment and to start demonstrating the technology in a working environment. Technical documentation, user, training and maintenance documentation must be prepared. The last task is to apply for a medical device certificate for the device.There are several limitations in our study. Firstly, we cannot make any final conclusions because of quite small number of participants in our study. However, due to the COVID situation (spring 2020), it would not have been possible to work fully with more participants and their parents. Currently, the \u201cGVcorrect\u201d app only works with android phones, but due to the large number of Apple phones, it would definitely be important to find a way to use the app for users of Apple devices as well.The goal of this technology readiness level  was achieved. However, a number of shortcomings need to be addressed before the product can be marketed. Study continues with product development until a medical device certificate is obtained.Vain, A.; Linkberg, R.; Vaher, I.; Tamm, A.-L. Mechanotherapeutic Device and Measurement Method. European patent EP3113729, 2020."}
+{"text": "Early childhood development intervention has gained considerable achievements in eliminating intergenerational transmission of poverty in rural areas. Paying further attention to rural children\u2019s community inclusion can also promote the sustainable development of the village. However, there is a lack of systematic theoretical constructs on the village inclusion of rural children. In this study, an attempt was made to explore the problem mechanism and solution strategy of community inclusion of rural children using a grounded theory approach of in-depth interviews. Seventeen parents of children in a national-level poverty-stricken county in Inner Mongolia of China were investigated, adopting the strategy of intensity sampling. The results revealed that (1) the content of rural children\u2019s activities demonstrates enhanced participation in the virtual environment and weakened participation in the real community environment. That is, the activities are characterized by more virtualization and individualization. (2) Rural parents and community peers are two major channels for children\u2019s community inclusion, while both the community peer environment and parental community participation show a weakening trend. This may be an important reason for the virtualization and individualization of the children\u2019s psychological development environment. (3) Developmental intervention programs for rural children in poverty-stricken areas should focus on the reconstruction of children\u2019s community peer environment, encourage the community participation of parents, and fully mobilize local-based educational resources. Relying solely on economic growth cannot promote equitable and sustainable development in rural and poverty-stricken areas. Only by investing in human development and increasing access to public services can we maximize the revitalization of the countryside and improve social cohesion. Early Childhood Development (ECD) refers to the comprehensive development of early childhood physical, cognitive, emotional, social adaptation, and language . WesternCurrent early development promotion projects for poverty-stricken children in China mainly draw on the practices of Western developed countries in terms of content and models and have achieved certain results . HoweverAt present, with the development of social economy and rural urbanization in China, the labor force of the rural population is gradually moving to cities, which has an impact on the structure and environment of traditional rural communities . The oriRural children are the future successors of rural construction and development. Children\u2019s inclusion into rural communities can enhance their sense of identity and belonging to the village, and deepen the collective memory of the village . The deeHowever, existing research on community inclusion mainly focuses on the living situation and community inclusion work of the floating population , the disTherefore, the aim of this study is to explore the factors and intervention mechanisms of rural children\u2019s community inclusion. With a view to improving the environment for early childhood development, exploring county-level psychological poverty alleviation models, building a rural social- psychological service system, and better promoting the revitalization and development of poverty-stricken areas.\u201cEach place has its own way of supporting its own inhabitants.\u201d This proverb reflects the relationship between individual development and the hometown. Each region has its own unique soil and water environment and social environment. People with natural attributes interact materially with the soil and water environment, while people with social attributes interact spiritually with the social environment through social inclusion. More importantly, social attributes with spiritual interaction are intrinsic attributes of humans, requiring that the individual must integrate into the current social environment to achieve the development of individuals and groups. In other words, based on common emotions, ethics, beliefs, or values, social inclusion as a social bond, links the relationships between individuals and individuals, individuals and groups, and groups and groups with the characteristics of combination or attraction . CommuniBased on the perspective of social equity, social inclusion is the process by which individuals gain mutual access to each other\u2019s memories, emotions, and attitudes by sharing their histories and experiences with other members of the community and ultimately integrating them into a shared cultural life . VillageBased on the perspective of citizenship, foreign scholars chiefly highlight the social inclusion of immigrants, while Chinese scholars focus on the urban inclusion of migrant worker groups and their accompanying children. Existing studies on the social inclusion of immigrants and migrant workers mainly concenter on their economic, social, psychological, or cultural inclusion after leaving their birthplace and entering the city. For instance, in Berry\u2019s psychological-cultural adaptation model, he pointed out that individuals in cross-cultural social inclusion identify with either the original culture or the urban culture, or both, or neither, which corresponds to four cultural adaptation strategies: separation, assimilation, integration, and marginalization . SeparatUrbanization is an important driving force for rural modernization and economic development. However, the in-depth development of urbanization will inevitably bring about a series of social contradictions and problems. At present, with the continuous acceleration of the urbanization process in China, a large number of rural populations, especially young and middle-aged populations, are gradually leaving the countryside, leading to the loss of human resources in rural areas . The livIn this context, some rural children move to cities with their parents and are collectively known as migrant children; some children stay in the country, live with other relatives, and are collectively called left-behind children; and other children, whose parents are both farming in their hometown, are considered rural children in the traditional sense. In terms of children\u2019s community inclusion, part of the current research in China focuses on the inclusion of migrant children in urban communities, while the other part studies the community inclusion of children who still live in rural areas (including left-behind children and non-left-behind children). For example, In traditional agricultural or tribal societies, two age groups generally exist adults and children. Ecological research revealed that the coming-of-age tradition was the dividing line for the transformation of individual child identity into adult identity. The specific developmental mechanism was that the coming-of-age ceremony helped children be liberated from their original family and integrated into the adult group of the village. However, In a community environment, if mobile and digital technologies can be used to develop a virtual community platform that is conducive to the health, education and daily life of community residents, then this virtual environment will help the community to integrate. For example, research shows that virtual community inclusion with using mobile health and digital technologies in mental health was positively associated with positive emotions and significantly predicted recovery . HoweverTherefore, in keeping with grounded theory, this study will explore the problematic mechanisms and possible solution strategy of rural children\u2019s community inclusion. On the one hand, it is necessary to objectively present the ideas and attitudes of rural parents and the reality of rural children\u2019s development. On the other hand, we aim to thoroughly explore educational resources based on local culture, together with rural parents, to enhance the operability of future intervention programs.The village inclusion of rural children is a complex and dynamic process. It is necessary to objectively present the views and micro-interaction behaviors of parents and children, as well as a multidimensional rural children development environment. Qualitative research methods are more feasible to comprehensively study these matters of concern. Therefore, this study utilized in-depth interviews and grounded theory (GT) to collect and analyze the data. Grounded theory is an important qualitative research method that allows for elucidating the overall defined pattern of the complex phenomenon and discovering theoretical frameworks from rigorous data collection and analysis . As a soThe interviewees in this study are mainly from two villages (Village A and Village B) in a poverty-stricken county in Inner Mongolia. The main source of income for farmers in the two villages is animal husbandry in the farming area, with about 10 mu of arable land. The two villages are both Mongolian and Han mixed living patterns, and Mongolian residents can also communicate in Chinese. Village A has a population of 732 people, of which 46% are Mongolians and 13% are migrant workers. The per capita annual income is 12,800. Village B has a population of 271 people. Mongolians account for 55%, and migrant workers account for 16%. The per capita annual income is 14,500. The living spaces of the two villages consist of village houses, cattle and sheep pens, activity squares, villagers\u2019 activity rooms, prairie book houses and vast fields outside the village. In the early stage, our project team utilized the villager activity room and the prairie book house to carry out community construction work. A special children\u2019s activity room has been established to encourage rural parents to jointly optimize the environment for the development of children\u2019s mental health. In this context, this study discussed with the interviewed parents the implementation of parenting mutual support groups to improve the development environment of rural children.Based on the principles of objective sampling and theoretical sampling, this study applied maximum variation sampling and snowball sampling to select typical cases with large information intensity and variation. The selection of the sample size is based on the principle of data saturation. When the interview data reaches a stable consistency between categories, the variation and saturation of theoretical phenomena, and the depth of focus, the interview was stopped . A totalTo collect comprehensive and effective information, we selected face-to-face interviews and semistructured interviews for this research.Before the in-depth interviews, two guardians of rural children were selected as interviewees to conduct the pre-interviews, which provided the basis for the formal interview outline design. The pre-interviews mainly focused on the core theme of the \u201cchild development environment.\u201d In addition, the guardians were invited to answer freely according to their own ideas, reporting on the way their children play, their expectations for the children\u2019s future development, and current problems existing in the children\u2019s development. The preliminary findings showed that (1) all the farmers in the sampling area could communicate in Mandarin, so it was convenient to transfer the interview scripts into the text; (2) rural children\u2019s guardians had their own opinions and thoughts on the topic of the interview, which ensured that the interviews could obtain the needed information; and (3) regarding the core issue \u201cchild development environment,\u201d although the guardians also were involved in the children\u2019s growth process, they were more observers, not direct experiencers. Therefore, there was relatively little experiential information provided when parents discussed the way children play. It was suggested that, in the formal interview, the interviewees needed to offer corresponding memories of their childhood.According to the data organized from the pre-interview, the final outline of the interview is as follows. (1) Recall your childhood games and talk about the effect of these games on children\u2019s development. (2) Have traditional group games disappeared, why? (3) What is your attitude toward the recovery of traditional group games? How can they be recovered? (4) What is your attitude toward parenting mutual support groups? Would you like to participate? Why? (5) What is your expectation of your child\u2019s future career?To encourage the interviewees to better enter into the topic situation, the interview for question (1) and question (2) used picture priming. Question (1) presented the interviewees with a series of pictures of traditional group games  to help them recall childhood games. Question (5) showed three pictures of work scenes: an office work scene, a factory workshop work scene, and a farmland farming scene, facilitating interviewees to think about their career expectations for their children. In view of question (4), this interview utilized the new children\u2019s activity room, built by our project team in their villages, as the priming materials to inquire about their attitudes and views on parenting mutual support groups.The choice of time and place for the formal interview was mainly based on the interviewees\u2019 convenience. When the interviewees had a large amount of free time and were willing to cooperate, the interview was conducted at interviewees\u2019 homes in a quiet and undisturbed environment. When the interview information reached or basically reached saturation, both parties mutually decided to end the interview. In this study, the average duration of 15 interviews was 30.13 min. After the interview, the interviewees were appreciated with gifts. The researchers converted the audio recordings of the interviews into transcripts.The researchers used Atlas. ti 8.0 qualitative analysis software to code and count the imported Chinese interview data. The software can index, search, and theorize these non-numerical and unstructured data. Before coding with the software, researchers must first set aside the existing value judgment criteria and just abstract or conceptualize the text content, ensuring that the minimum meaning unit is a reflection of the interviewees\u2019 views or ideas.As mentioned above, this study mainly used theoretical coding based on grounded theory to analyze the collected data . The anaDuring the data analysis, the researcher had to compare and reflect on the whole process of the study at all times. For example, in analyzing the data, we learned that many rural children had the problem of excessive mobile phone use. If comparing this phenomenon with urban families, we may get a more comprehensive understanding of mobile phone use of rural children. Therefore, in the subsequent sampling, two guardians of urban families were supplied to fill the information gap. The codes, categories, and theories in each step were taken into account in all aspects of the case and data. Before opening the coding, the coders listened carefully to the interview recording two or three times to make sure they had a good grasp of the tone and emotional state behind the text message. In the process of coding, the coders always insisted on combining the interview recording and notes to give meaning to the text.First, we set the corresponding number for each interviewee according to the order of the interview  and ensured that the source of the code and the citation link were correct. Second, we carefully read the contents of every word, sentence, and paragraph in the imported original materials. With \u201cChild Development Environment\u201d as the core, we searched for repeated meaning units from the materials and extracted the login code numbers of text materials that were meaningful to the research problems. Finally, this study established a total of 73 code numbers, involving 235 node samples.Based on the initial coding system, this study further extracted the meaning reflected by the coding system around \u201cchildren\u2019s psychological development environment.\u201d The extraction process was based on a continuous comparison method, in which the original coded material was repeatedly compared and refined and divided into different categories. Subsequently, the authors continued to compare repeatedly in the process of classification to maximize the differences among the different genres. The main comparison methods are homogeneous comparison, heterogeneous comparison, horizontal comparison, and vertical comparison. Finally, 11 secondary codes were extracted, among which five open codes (involving 10 node samples), such as \u201cignorance of white-collar work,\u201d \u201cdemand for children\u2019s self-monitoring ability,\u201d \u201clearning supervision,\u201d \u201cnatural games,\u201d and \u201cdoing what they like,\u201d were not included in the secondary code. The specific open coding and categorization are shown in This study adopted the coding paradigm of \u201ccondition-action-consequence\u201d for selective coding . The matValidity testing is an essential method to assess the quality of qualitative research. In this study, the validity test was mainly conducted by participant tests and expert evaluation methods.To avoid the existence of the researcher\u2019s subjective assumptions in the study findings, the researcher fed back the coding and conclusions to the interviewees after arriving at the preliminary results of the study. These materials were tested in terms of both descriptive validity and explanatory validity. The researcher selected three participants, with different education levels and regions, among the interviewees to give feedback on the coding and results. One participant was a parent from a rural area with high school education, and the other two were parents from a county area with a bachelor\u2019s degree.In addition to the participants in the study, on the one hand, two university lecturers with a Ph.D. in psychology were invited to give feedback on the coding as well as the results, with both testers having rural life experience. On the other hand, one university professor with a Ph.D. in psychology but no rural life experience was invited to conduct the test. Whether the testers had rural life experience was a comparative integration from an inside-outside perspective.The test and evaluation methods included both quantitative scoring and feedback. Specifically, the quantitative evaluation was scored on a 5-point scale, ranging from 1 (very poor) to 5 (very good). The evaluation results are presented in We summarized the feedback from the three experts and addressed it in different ways see . The res(1) Validity risks of samplingDifferent from quantitative research, sampling in qualitative research puts a greater emphasis on the typicality of the research object rather than the representativeness of the population. This study focuses on the environment of children\u2019s psychological development, which requires a certain reference system to analyze. Horizontally, the developmental environment of urban children can be regarded as a reference system; thus, two parents of the county town were included as samples in this study. Longitudinally, the community environment changes over time. Accordingly, the guardians\u2019 own childhood developmental environment can also play an important role in the reference system. Therefore, when including the samples in this study, parents born in the post-80s and post-90s underwent sample matching. In addition, intergenerational parenting is a typical phenomenon that occurs during the influx of rural labor to urban areas. Therefore, this study selected one case of a family with left-behind children in which the respondent was the child\u2019s maternal grandmother. Such a sampling approach ensures that the study maximizes information density and intensity.(2) The validity risk of the researcher\u2019s identity as an \u201coutsider\u201dAlthough the researcher in qualitative research is mostly an outsider, in qualitative research involving sociocultural phenomena, the researchers first need to reflect on their identities to ensure that they produce theoretical knowledge from the perspective of an \u201cinsider\u201d as much as possible. In this case, to better integrate into the primary culture of the interviewees, the interviewers and analysts in this study were all those who had experienced rural life, i.e., their childhood was basically in the country. This not only allows the interview process to follow the research subject\u2019s thinking and achieves in-depth information mining in the interview but also ensures that the collected information is understood from the research subject\u2019s perspective. In addition, to avoid risks to research validity from the researcher\u2019s own childhood experiences, the original words or phrases were retained in open coding as much as possible to prevent personal subjective assumptions.The \u201cchildren group\u201d is an important peer environment for children outside of school, and most parents interviewed expressed positive experiences of playing together in a community peer environment as a child.N4: My childhood was simple, with not so many toys. It was fun to play these things with my friends.N11: We didn\u2019t have these toys at all when we were kids. Because these are all made by ourselves. We made or painted all the playthings when we were kids. We jumped and played together. Now the kids don\u2019t have those games, and they can\u2019t play.N12: It feels like a happy time.C14: I think we used to have a much more interesting life than the kids now.C14: Even though there are squares in this neighborhood, people\u2019s kids didn\u2019t know each other that well. Unlike before, when we lived in the hutongs, the relationship was very familiar and then just played so casually.Traditional group play is an important way to bring children together and an important purpose for children to gather together. Parents interviewed perceived traditional group plays to be physically active, intellectually developing, enhancing a sense of sharing, improving attention, passing time, promoting a sense of community, enhancing positive emotions, and improving imagination. In particular, these descriptions reveal that children\u2019s group play is a significant means of socializing children in a peer environment. However, almost all parents interviewed reported that these peer environments, in which group play was a bond, had disappeared from the community.N4: They rarely play together. My child came back just to find a few children to ride a bike together.N7: It seems that the kids don\u2019t play  now, and my girls don\u2019t play them, either.N9: I wish there were, but it\u2019s likely that no one plays  anymore. When we were in school, maybe kids played a little bit more.N11: Now children do not necessarily play these . My daughter doesn\u2019t know that these things are played, either.C15: Basically, you can\u2019t see them anymore. Sometimes you may see them kicking a shuttlecock, but the other playthings may not be seen.The reasons for the disappearance of group games by the interviewed parents mainly include: (1) the substitution of traditional games by mobile phones, televisions, and new toys; (2) the disappearance of the tradition of older children taking younger children to play; and (3) the weakening of group games and outdoor activities because of many school assignments.N4: Three kids sitting together can play for half a day. They each look at their own phone to play the game [Mobile phone use].N13: Yes, the post-80s, post-90s and my mom their post-70s played . But the post-00s no longer have access to these games. Because the cell phone is developing too fast [Mobile phone use].N7: Now the child is in the third grade, playing less. Because there is usually a lot of homework even on Saturday and Sunday [More homework].C14: The reason may be that one, is that there are more children now, and the other is that our school environment is in buildings [Outdoor activities are reduced].N6: The key is that the older (children) do not like to play with him [The disappearance of the tradition of older children taking younger children to play].The above results suggest that children\u2019s peer environments are moving away from the community and that children are moving away from their peer environments.Neighborhood relationships are an important part of the sense of community. Most parents interviewed manifested fewer visits to neighbors, more mobile phone entertainment, and a declining sense of community trust.N6: I just don\u2019t have time to take him around. I also worried about delaying others\u2019 work if he goes to neighbors\u2019 homes to play. Otherwise, there are children (playing with him) in the east block [Few visits with neighbors].N9: When other children came to visit, they played for a while and went home. Usually, our kids go outside to play, but there are few children outside [Few visits with neighbors].C14: I think it\u2019s still a problem with the living environment. When I used to live in a hutong, I used to run to any families to play in our community. Which family can we go to play in nowadays? We all don\u2019t talk much to each other [Few visits with neighbors].N4: But once grandparents came back, they both watched Kuaishou all day long. When they got older, they each took their phones to watch Kuaishou [Parents have more mobile entertainment].N9: But at that time my parents generally did not care about me. I go out to run and play by myself. Nowadays, families do not let children run to play by themselves. Children are followed by adults behind [Community trust decline].The above results show that parents\u2019 lifestyle is moving away from the community environment.Parents are the first teachers of their children and an important way for children to identify with their original culture. The rural parents interviewed in this survey all showed low professional identity with farmers. Additionally, they did not want their children to be farmers in the future.N1: We are also farmers, what\u2019s the use? Tired and exhausted.N3: That is also very tiring!N4: I think it\u2019s hard to be a farmer. We are farmers too, and we don\u2019t want our children to be like this again.N6: The future of farmers is not yet known.N7: I don\u2019t earn much money, and I\u2019m exhausted.N9: We are farmers. I feel that farmers are quite tired all year round.N10: The income is low and not much help to his future life.N11: Farmers who grow crops are not easy to worry about the amount of rain.N13: This is the least expected. Farmers are very tired to work on the farm.The above results indicate that rural parents have a low sense of professional identity and do not want their children to continue to be farmers.The rural parents interviewed reported that it was common for children to use electronic devices such as mobile phones. Children were also very proficient in how to operate phones. In addition, playing on the phone was an effective way to keep children quiet and not clingy when adults were busy with farming or not able to take care of their children. In terms of content, children mainly watched short videos and cartoons and played some small games.N2: She chooses her own. She knows all the operations of the phone and understands it better than her father.N3: Sometimes he doesn\u2019t want to study when I\u2019m working, so I let him play a little.N7: My son uses his cell phone every day now.N9: When (I\u2019m) busy working, she plays on the phone at home by herself.N11: They all look at the phone at home, which may be harmful to children.N12: She only plays Volcano video. How come she is so proficient with Volcano video? She doesn\u2019t play Tik Tok.N13: Yes, we generally sit together and play on the phone, giving him a phone to play for a while to let him stop horseplay.Although many parents reported that looking at mobile phones is bad for children\u2019s eyes and health, reports from rural parents interviewed indicate that many children spend a lot of time using mobile phones.N5: If you leave him alone, he can play for half a day.N7: My child can watch three or four hours a day.N9: She wants to play, and she can play all day!Regarding parents\u2019 behavior of restricting their children\u2019s mobile phone use, the following types can be classified from the interview data: (1) no restrictions; (2) restrictions but no clear standards and rules; and (3) absolute restrictions. It is noteworthy that two parents from the county town reported absolutely restricting their children\u2019s mobile phone use.N7: They each had a mobile phone to play on, and then I watched TV, thinking that one person had one phone, avoiding fights. [No restrictions].N8: No discipline for him. Basically, he can look at phones if he wants [No restrictions].N6: Rarely let him look at his phone. Unless when I\u2019m working outside on a cold day and he\u2019s on the bed just waking up, I\u2019ll show him cartoons for a while. In this case, I\u2019m not afraid of him getting cold anyway [Having restrictions but no clear standards or rules].N8: She won\u2019t listen to what I say, yet she listens to her dad. If her dad allows her to watch, she does, and if he doesn\u2019t agree, she doesn\u2019t [Having restrictions but no clear standards or rules].N11: He finished all the homework left by the teacher, and then he wanted to play on the phone. I said that he could watch TV. But TV didn\u2019t seem to appeal to him, either [Having restrictions but no clear standards or rules].C14: We don\u2019t let him use those, including the cell phone. We don\u2019t let him use cell phones [Absolute restriction].C15: We basically don\u2019t have children playing on the phones in our family. We don\u2019t let them use mobile phones [absolute restriction].In addition, some parents interviewed reported the phenomenon that parents and children each had a cell phone and used electronic products together. The modeling effect of parents\u2019 mobile phone use habits was regarded as an important trigger for children\u2019s participation in virtual environments.These results indicate that rural children\u2019s participation in virtual environments is common and lacks supervision in participation duration and interactive content.The results suggest that the psychological development promotion program for rural children should focus on strengthening group intervention and education for rural children and parents from the perspective of community culture. In this way, we can rebuild the community peer environment for rural children and further integrate parents and children into the community environment.The parents interviewed were supportive of rebuilding their children\u2019s peer environment but also had some concerns and obstacles.Supportive attitudes were mainly reflected in the possible benefits of building parenting support groups, including exercising social skills, strengthening unity, reducing parenting stress, improving parenting efficiency, increasing understanding, enhancing parental responsibility, strengthening cooperation, and enhancing group play.Concerns and obstacles were mainly reflected in the following areas: worried to trust children to others, fear of strangers for many children, lack of time to take care of children, hard to sustain, fear for others\u2019 children getting hurt, fear of conflicts among children, fear of caregiving responsibilities, and an inability to control multiple children  took the children to play hopscotch once she returned this summer. I saw his aunt with the children drawing like this.N10: That\u2019s okay, too. We took sandbags to school and played with the schoolmates. When we had time after class, we would play turned rope together.N13: I think it will be possible to gather children together to play games.Through further follow-up interviews on the concerns of the parents interviewed, some of them gave many constructive opinions that could be conditions and strategies for rebuilding the peer environment of rural children.The first condition for the construction of parenting support groups is parents\u2019 supportive attitudes. A supportive attitude is an important condition for addressing obstacles, such as lack of time to bring up children, insufficient or wrong awareness of early education, and for children to be able to participate in support groups. Without parental support, children cannot choose to participate in group activities in the community on their own.N4: The main thing I think is to communicate more with the child\u2019s parents. Now from this clock-in activity (reading picture books), parents are not so active. We need to change parents\u2019 thinking. We need to communicate with parents to improve the awareness that the child can\u2019t be only coaxed not to cry. We also need to guide the children to read more books, which is beneficial. Only when the parent\u2019s awareness is raised, and then they can let more children out to the library to read books.Second, mutual trust and setting rules are important conditions to address a range of obstacles, such as worries about trusting children to others, fears that the project will be difficult to sustain, fears of others\u2019 children getting hurt, and fears of caregiving responsibilities. Moreover, other parents interviewed specifically mentioned that it was best not to involve money in this project. This attitude is consistent with the culture of the communities that already exist in rural areas.N12: The thing is that people communicate with each other. Familiar people are the same. It\u2019s okay for us to collide with familiar people.N12: Just have a rule in advance. Otherwise, it is very abrupt. That would never work.N13: People are all like this. If he bumped or upset other kids, their parents will definitely think more badly. The key is our relationship. We definitely don\u2019t think much about it, because the relationship is trust.Finally, several respondents proposed the demand for professional teacher support. This condition is a significant strategy to solve obstacles, such as the inability to control multiple children, fear of conflicts among children, and fear of strangers for many children.N12: The teacher has the authority. We are not teachers. Once there is something (problem), they will certainly hold you accountable.N13: I think parents have no ability to read and talk to them. They can recruit a teacher or somebody to tell them the content.C15: We can ask professional teachers when I have temporary work and no time to come. They can speak to us. I feel that is acceptable.In the final stage of grounded theory research, careful refinement of selective coding can lead or relate to the core category of other categories. This study adopted a bottom-up approach to constructing a theory by iteratively inducting and analyzing original data to gradually generate a theory that can demonstrate a point of view.Generally, the theoretical construction of grounded theory research included the following steps. First, it was essential to find the core theme, reflecting the research problem, on the basis of selective coding. In this study, the core theme of \u201cchildren\u2019s community integration\u201d was developed through the examination and correlation analysis of the established selective coding. Second, the selected core theme was then reverted to the initial material for comparative analysis. Particular attention was given to case materials with opposing or divergent views, which helped to further the theoretical development of the \u201ccondition-action-result\u201d linkage of the core themes. Third, the preliminary relationship framework was devolved to the case data to test the compatibility of the theoretical model with the original data. To achieve the best match between the data and the theory, the theoretical model was constantly revised. Finally, there was an examination of the internal consistency of the theoretical system to establish a holistic theoretical perspective statement through the integration of the previous three steps see . This thAccording to the logical relationship between categories, this study presents a theoretical model for the problem mechanism and solution strategy of rural children\u2019s community inclusion. Specifically, the current rural children\u2019s community inclusion presents the problem of peer environment weakening. The virtual environment is increasingly invading the lives of parents and children. In addition, parents are less involved in community participation. In response to these problems, in the future, community parenting supporting groups can be established to strengthen the construction of community environment, peer environment and parental participation, so as to build a complete community inclusion environment for rural children.This study found that the content of rural children\u2019s activities shows virtualization and individualization. Rural parents may control the use of electronic media for children entering school age, while there are no clear control standards for children\u2019s mobile phone use.In addition, the results revealed that children\u2019s electronics use behavior is associated with the number of electronics in the home, parental accompaniment and regulation of children\u2019s electronics use, and the level of encouragement of outdoor activities. The two parents from the county had strict restrictions on their children\u2019s mobile phone use, and their children were less likely to participate in the virtual environment. In contrast, rural parents often had no explicit restrictions and even played on phones with their children at home. It is noteworthy that they used their phones in parallel, not accompanying their children to pay joint attention to the phone content. This phenomenon may be an important exogenous factor for children\u2019s participation in the virtual environment. In addition, one parent reported that her child has a strong need to play with other children, but it is difficult for her child to get together with other children to play because of the few or short parental visits. Another parent stated that children currently have good material conditions but actually lack companionship. When companionship needs cannot be fulfilled from the real world, children may seek them from the virtual worlds constructed by electronic media, which is an important internal reason for children\u2019s participation in virtual environments.The virtual and personal characteristics of the content and format of rural children\u2019s activities are the evaluation conclusions based on both horizontal and vertical reference systems. This study found that it is widespread for rural children to use electronic devices, meaning that electronic devices are becoming prevalent much faster than researchers\u2019 perceptions of the impact of electronic devices on children. At the individual level, it is difficult to give a definitive conclusion regarding whether children should or are appropriate to use electronic media. However, from the view of the developmental environment, it may be more helpful to understand the impact of electronics on children\u2019s development.First, in a longitudinal comparison, the developmental space for rural children used to consist of the school life environment, the peer group environment, the virtual environment , and the parental companionship environment. In the past, once children became capable of role-playing games, parents were rarely involved in children\u2019s activities. It can be argued that traditional group play has helped children move from home to the community and achieve social inclusion . NeverthSecond, from the cross-sectional comparison, the current developmental space for urban children is composed of a school life environment, an out-of-school quality education environment, a recreational facilities environment , a virtual environment, and a parental companionship environment. In rural communities, there is basically no out-of-school quality education environment, suggesting that urban parents shape the companionship environment better than rural parents .The above longitudinal and cross-sectional comparisons show that the virtual and personalized content of rural children\u2019s activities is the inevitable result of their monotonous developmental environment and their distance from the community environment.In the process of grounded theory construction, this study has experienced a shift from a focus on the developmental status of individual children to an examination of the developmental environment of children. In the selective coding, the theme of rural children community inclusion was gradually established. In recent decades, the dual cultural structure between urban and rural areas has been transformed in the process of urbanization. Because of its relatively backward mode of production and economic development level, rural culture lags behind urban culture in terms of the overall cultural development level. Therefore, rural culture has been in a disadvantaged position in the context of urban-rural integrated development. The parents of the farmers interviewed in this study generally did not want their children to be farmers. They showed a low sense of identification with farmers, which is a reflection of the disadvantaged position of rural culture. In that way, is it still necessary for rural children to include rural communities and identify with rural culture? This study will analyze this issue at the following two levels. First, the connotation of urban-rural culture integrated development has been developed in the background of the modernization of the national governance system and governance capacity . The StrThis study found that parents widely supported rebuilding children\u2019s community peer environment and affirmed the positive significance of traditional group play, which is consistent with the developmental niche theory , 1997. SCurrent rural early childhood development promotion programs are mostly implemented by outsiders with backgrounds in psychology, education, or social work and are mostly conducted through follow-up visits to households, which can lead to decontextualized and individualized interventions.Context minimization error theory argued that psychological theories and research findings have ecological validity flaws and are only true in limited settings . Their rIn rural areas, teachers are a group with relatively high cultural literacy who can not only take up the responsibility of teaching and educating but also drive the local cultural construction. The Strategic Plan for Rural Revitalization of China (2018-2022) specifically emphasized \u201ccarrying out activities such as searching for the most beautiful rural teachers\u201d in the section on the prosperous development of rural culture. In the work of poverty elimination and rural style construction, teachers in certain areas have achieved good results by mobilizing students to urge parents to actively participate in rural construction, which also reflects the vital role of teachers in rural culture construction.Therefore, family school partnerships should not be limited to schools and families working together to supervise children\u2019s learning but rather to establish a large pattern of cooperation among schools, families, and communities. In this survey, we found that rural parents want to have professional teachers to lead parenting support groups. Additionally, the education bureau of the project demonstration area has been vigorously promoting the family school partnerships project, selecting excellent teachers from the teaching system for training, and eventually forming a team that can carry out family education work. Therefore, it is recommended that other poor areas should give full play to the role of teachers in building regional culture, especially training local excellent teachers in psycho-education and social work, so those rural areas can truly embark on a sustainable development path of \u201crelying on education to get rid of poverty.\u201dAlthough this article makes important contributions to systematic theoretical construction on the village inclusion of rural children, it has some potential limitations. First, our interview data were subjective self-reports based on qualitative research. Although this study has achieved good validity, it would be best to take quantitative research in the future to further test and verify the theoretical framework. Second, the interviewees in this study were mainly focused on the child\u2019s mother. That is because female guardians , as the primary caregivers of children in the native culture, have a truer understanding of the development of their children. Nonetheless, we can\u2019t ignore other key stakeholders\u2019 views either. In the future, it may be considered to select children, male guardians, teachers, and village leaders for interviews to receive different perspectives on causes and effects of children\u2019s rural inclusion, especially their attitudes toward socialization online. Third, despite the research sampling has reached theoretical saturation because there were not any new dimensions and key points emerging after the 17th respondent. It would be better to interview additional respondents to ensure that all the codes tended to be stable. Lastly, some interview questions have the guidance of value judgment, e.g., \u201cwhat is your attitude about recovering traditional group games?\u201d It would be better to change it to \u201cwhat do you think of the future development trend of traditional group games?\u201d It is suggested that the design of interview questions need to be more objective and neutral.The content and format of rural children\u2019s activities showed increased participation in the virtual environment and weakened participation in the real community environment. In other words, rural children\u2019s activities became more virtualized and personalized. In addition, rural parents and community peers are important bridges for children\u2019s community inclusion. However, both the rural community peer environment and parental community participation showed a weakening tendency, which indicates that the two major channels for the community inclusion of rural children are blocked. This is also an important reason for the virtualization and individualization of children\u2019s psychological developmental environment. Therefore, developmental intervention programs for rural children in poor areas should focus more on the reconstruction of children\u2019s community peer environment. Furthermore, team managers should make efforts to encourage parents\u2019 community participation to fully mobilize local culture-based educational resources.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by the Ethics Committee for Scientific Research of Institute of Psychology, Chinese Academy of Sciences. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.LW was responsible for the research idea and study design. WY and YC provided efforts on collection of interview data and the first round of coding and analysis. YX and LW wrote the first version of this manuscript. WG, TT, and CF separately revised the manuscript and developed it. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "It is well known that welding dissimilar metals can play the advantages and characteristics of those different metals, but it is easy to encounter some problems. In this paper, the thermomechanical behavior of the weldolet\u2013branch dissimilar steel joints in different welding cases is analyzed by establishing a three-dimensional finite element model, and the predicted thermal cycling and residual stresses are verified using experimental tools. The results show that the high temperature area and the heat affected zone on the side of the branch pipe are larger, and there is a large stress gradient at the fusion line on both sides of the weld. Too high or too low temperature between welding layers will cause large residual stress, thus, 200 \u00b0C is more suitable for the welding of weldolet\u2013branch joints. The residual stresses of path-1, path-2 and path-3 have similar distributions at 0\u00b0 and 180\u00b0 sections, and the circumferential and axial residual stresses on the inner surface are larger than those on the outer surface. The residual stress on the inner and outer surfaces of path-3 is smaller than that of path-1 and path-2 at the 90\u00b0 and 270\u00b0 sections as a whole, and the residual stress at the 90\u00b0 section reaches the minimum. As a new type of reinforcing receiver, the weldolet is widely used in pipeline systems of chemical plants, thermal power plants and nuclear power plants. The weldolet can directly replace the traditionally used branch pipe connections, such as reducer tees and reinforced pipe sections, with higher safety and economy. It is especially used more frequently in high temperature, high pressure and even ultra-high pressure and subcritical pipelines ,2,3,4,5.In the traditional manufacturing field, 12Cr1MoV and 15CrMo are both indispensable engineering materials. Both 12Cr1MoV steel and 15CrMo steel are low-alloy pearlitic heat-resistant steels, which are widely used in high-temperature and high-pressure steam pipes and superheater pipes due to their good oxidation resistance, high strength and plasticity, simple production process and high lasting strength at higher temperatures ,12,13. ISince the advent of the thermal-elastoplastic finite element model, numerical simulation research on welding stress and deformation of the same type of steel and dissimilar steel has been developed rapidly. The welding finite element modeling process mainly includes moving heat sources, temperature-related material thermophysical properties, thermal and mechanical analysis, etc. . The mosIn this study, the hexahedral mesh model was used to simulate and calculate the welding process of the weldolet\u2013branch pipe dissimilar steel annular weld and verify the feasibility of the calculation method by means of experimental analysis. By comparing and analyzing the arc welding process of 12Cr1MoV heat-resistant steel and 15CrMo heat-resistant steel under nine welding process parameters, the effect of process parameters on the thermal cycle and residual stress of dissimilar steel joints was revealed, which is of great significance for the selection and optimization of the process.The experiment object is weldolet\u2013branch pipe dissimilar steel welding. The size of the weldolet is DN80 \u00d7 16 mm, and the material is 12CrMoV steel. The size of the branch pipe is DN80 \u00d7 6 mm, and the material is 15CrMo steel. The selection of welding materials for dissimilar steel welded joints uses low matching, so the filler metal matching with 15CrMo is selected. That is, tungsten inert gas welding (GTAW) using H08CrMoA heat resistant steel argon arc welding wire and electrode arc welding (SMWA) welding using R307 electrode. The sizes of the welded joints, the bevel angles and the distribution of the weld channels are shown in During the welding process, no external constraints are imposed on the components, so the components can move freely in different directions. Before welding, the surrounding points of the butt joint of the weldolet and the branch pipe are fixed by spot welding. The rust, oil and other impurities near the groove are cleaned up before welding. The experimental process was a two-layer, two-pass weld, and the welding sequence was a single-pass straight-through type with GTAW priming and SWAM filler capping. The shielding gas is pure argon, and the welding parameters of the different welding channels are shown in The rapid professional welding software, Simufact Welding 2020, was used to simulate the welding temperature field and residual stress field of the dissimilar steel welded joints. The algorithm of this software is based on the thermo-elastic\u2013plastic finite element model, which can conveniently prepare input data according to welding conditions, welding seam arrangement and welding sequence ,32. The The three-dimensional finite element model of the weldolet, branch pipe and weld channel distribution is shown in In the welding process, the governing equation of heat transfer is as follows:The heat source model plays a crucial role in thermal and mechanical analysis. In this study, the double ellipsoidal heat source model proposed by Goldak et al.  was usedIn the process of numerical simulation of welding, the thermophysical properties of the material parameters have a significant impact on the calculation results. The thermodynamic properties of 12Cr1MoV and 15CrMo change with temperature; the relevant thermophysical property parameters of the two base materials used in the paper were obtained through JMatPro professional software. The thermomechanical properties of the two base materials are shown in h is the heat transfer coefficient  and Stephen\u2013Boltzmann\u2019s law (5).In the mechanical analysis, the results of the thermal analysis are loaded into the elastic\u2013plastic analysis as thermal loads, and the total strain of the material in the finite element model can be described by the following equation:The finite element model in this paper is a multi-layer multi-pass welding, which needs to control the temperature between layers reasonably. Therefore, three groups of interlayer temperatures were set up for numerical simulation, and the interlayer temperatures suitable for this model were analyzed. The welding case of this numerical simulation can be obtained by permutation and combination of the two welding factors, as shown in Obtaining a reasonable temperature field of welded joints is the prerequisite for the analysis of welding residual stress. In order to accurately simulate the shape of the weld pool and ensure the accuracy of the calculation of the weld residual stress, based on the thermal-elastic\u2013plastic finite element model, the heat conduction equations are solved using a multi-threaded parallel technique. Eight threads were called simultaneously during the temperature field calculation. The calculated transient melt pool shape and the macroscopic shape of the experimental joint are shown in In order to verify the prediction accuracy of the developed calculation method, we compared the experimental measurement results of transient temperature and residual stress with the finite element simulation results. The k-type thermocouple is used to measure the transient temperature at different positions on the outer surface of the dissimilar steel welded joint. The position distribution of the thermocouples on the outer surface of the welded component is shown in It can be seen from We measured the residual stresses at selected points on the outer surface of the weldolet and branch pipe, respectively, at 90\u00b0 cross-section. The five measuring points are located at the centerline of the weld and at 9.5 mm and 20 mm from the centerline of the weld on both sides of the weld. The experimental results and finite element simulation results are shown in The thermal field of the weldolet\u2013branch pipe structure is shown in The purpose of this study is to investigate the influence of the interlayer temperature and welding sequence on the residual stress distribution of dissimilar steel joints. In order to study the difference of residual stress distribution under nine cases, we analyzed the residual stress of the defined path-4 shown in . Path-4 From From the From the above conclusions, it can be seen that the number of thermal cycles experienced by the three welding sequences at 0\u00b0 position is the same, and the distribution of residual stresses is very similar, so the following analysis focuses on the distribution of residual stresses at 180\u00b0, 90\u00b0 and 270\u00b0 sections. (1)In this study, the Case 2  model was selected to verify the residual stress and transient temperature. The simulation results are in good agreement with the experimental results, which verifies the reliability of the experimental model.(2)The transient temperature distribution results show that the differences in the thermophysical properties of the materials during welding of dissimilar steels lead to an asymmetric distribution of the transient temperature field about the center of the weld. The high temperature range of the 15CrMo steel side is larger than that of the 12Cr1MoV steel side, and the heat-affected zone is relatively wider.(3)The circumferential and axial residual stress distribution on both sides of the weldolet\u2013branch pipe is not symmetrical, and there are always large fluctuations and stress gradients in the weld and the area near the weld. There is always a peak residual stress at the weld fusion line on both sides of the weld.(4)The interlayer temperature of the weld has little effect on the distribution pattern of the residual stresses, which mainly affect the peak residual stresses. The peak residual stress along the defined path occurs more often at interlayer temperatures of 150 \u00b0C or 300 \u00b0C.(5)The welding sequence is a decisive factor affecting the residual stress. By adjusting the welding sequence, not only can the residual stress distribution area be changed, but also the residual stress in specific areas can be reduced. The post-welded seam largely changes the residual stresses near the first weld, and the high stress areas are mostly concentrated at the post-weld.(6)The number and position distribution of the start/end point of the weld also effect the distribution of residual stress, and the distribution trend of circumferential residual stress and axial residual stress on the outer surface is opposite. The overall residual stress distribution at the 90\u00b0 section is smaller than the other three sections.(7)At the 0\u00b0 and 180\u00b0 sections, the residual stress distribution of path-1, path-2 and path-3 are very similar, and the circumferential and axial residual stresses on the inner surface are larger than those on the outer surface. However, the residual stresses on the inner and outer surfaces of the segmental jump welding method path-3 are smaller than those of path-1 and path-2 in the 90\u00b0 and 270\u00b0 sections as a whole. The residual stresses reach a minimum in the 90\u00b0 section. It can be concluded that path-3 is more suitable for the welding of weldolet\u2013branch pipe dissimilar steel joints.In this study, through numerical simulation and experimental verification, the effect of different interlayer temperatures and welding sequences on the temperature field and stress field of 12Cr1MoV/15CrMo dissimilar metal arc welding joints were studied. The conclusions are summarized as follows:"}
+{"text": "In the process of catalyst preparation, the interaction and electronic effect between metal Ni and support TiO2 were adjusted by changing the calcination temperature, and then the activity and hydrogen production of glycerol steam reforming reaction (GSR) was explored. A series of modern characterizations including XRD, UV-vis DRS, BET, XPS, NH3-TPD, H2-TPR, TG, and Raman have been applied to systematically characterize the catalysts. The characterization results showed that the calcination temperature can contribute to varying degrees of influences on the acidity and basicity of the Ni/TiO2 catalyst, the specific surface area, together with the interaction force between Ni and the support. When the Ni/TiO2 catalyst was calcined at 600 \u00b0C, the Ni species can be produced in the form of granular NiTiO3 spinel. Consequently, due to the moderate metal\u2013support interaction and electronic activity formed between the Ni species and the reducible support TiO2 in the NiO/Ti-600C catalyst, the granular NiTiO3 spinel can be reduced to a smaller Ni0 at a lower temperature, and thus to exhibit the best catalytic performance.Steam reforming of glycerol to produce hydrogen is considered to be the very promising strategy to generate clean and renewable energy. The incipient-wetness impregnation method was used to load Ni on the reducible carrier TiO Howev CO2 gas . Further CO2 gas . It has  CO2 gas ,6,7. The CO2 gas ,9,10. Am CO2 gas ,12,13. W CO2 gas . Therefo CO2 gas . However2O3, ZrO2, CeO2, La2O3, and TiO2 [2O3 was widely used in the hydrogen production reaction of glycerol steam reforming due to its large specific surface area and good hydrothermal stability. However, it is easy to form a strong interaction force between Al2O3 and the active metal Ni, forming an inactive NiAl2O4 spinel, which is difficult to reduce to catalytically active Ni0 species [2O3 by adding rare earth elements, therefore promoting the reduction of Ni species [2O3, and strengthening the low-temperature catalytic activity of methanol steam reforming hydrogen production [2O3 carrier, the reducible support TiO2 was more widely used in the field of water\u2013gas shift reaction, selective hydrogenation and steam reforming reactions due to the electronic effect and strong interaction between it and the active metal [\u03b4-Ov-Ti3+ (Ov denotes oxygen vacancy), which strengthens the activity of the water\u2013gas shift reaction [2O3, which requires the addition of additives to control the electronic effect between it and the active metal, there is an obvious electron transfer effect between Ni and the reducible support TiO2. However, the influence of the electronic effect of Ni-Ti system catalyst on the catalytic performance of alcohol steam reforming hydrogen production is still unclear.Noble metal catalysts  can effectively break the C\u2013C and C\u2013H bonds, lowering the reaction temperature and a considerably better stability, but the high cost limits its large-scale application . Copper-and TiO2 ,28,29,30 species . Extensi species ,32. Lu eoduction . Compareve metal ,34,35,36reaction ,34. Comp2 by changing the calcination temperature, and then study its influence on the steam reforming of glycerol. At the same time, considering that the crude glycerol contains a large amount of methanol, we have also studied in detail the influence of different glycerol/methanol/water ratio feeds on the reaction. To the best of our knowledge, there is no report on the electronic effect of Ni/TiO2 catalyst on its initial catalytic performance, as well as the influence of mixed-alcohol feeds with different volume ratios of glycerol and methanol on the reaction (GMSR).Promoted by the above demands, we tried to tune the electronic effect between Ni and the support TiO2  without further calcination, and nickel nitrate (Ni(NO3)2\u00b76H2O) were obtained from Aladdin Industrial Corporation . During the whole experimental process, deionized water was used, and the chemicals were used without further purification and pretreatment.A commercial TiO3)2\u00b76H2O was dispersed in 2.4 mL distilled water and then 1.8 g TiO2 was added into the above solution using incipient-wetness impregnation method with stirring intensely for 20 min and then ultrasonic treatment for 5 min. After impregnation, the slurry was aged at room temperature and dried at 110 \u00b0C for 12 h, respectively, and finally thermally decomposed in a static air muffle furnace under different set-temperatures with a dwell time of 5 h (5 \u00b0C/min). To explore the effect of calcination temperature on the electronic effect between Ni and reducible oxide supports TiO2, the catalysts were synthesized according to the above processes except for calcination temperature , which were labeled as NiO/Ti-500C, NiO/Ti-600C, NiO/Ti-700C, NiO/Ti-800C, respectively. The NiO/Ti-100C sample represents only after being aged without further calcination. The reduced catalysts were marked as Ni/Ti-500R, Ni/Ti-600R, Ni/Ti-700R, Ni/Ti-800R, respectively.Typically, 1.0 g of Ni(NO2/N2 (50 vol%) with the flow rate of 60 mL/min, then kept for 1 h. Then a glycerol (30 wt. %)/water solution was fed (0.03 mL/min) by a HPLC  pump and then was vaporized at 220 \u00b0C, and the inert N2 (N2/feed = 4/1) was also introduced into the vaporizer at the same time. The corresponding weight hourly space velocity (WHSV) was fixed at 9 h\u22121. The products were first condensed through a cooler, and the incondensable gas species were analyzed online by two gas chromatographs with two thermal conductivity detectors . For activity testing, reaction temperature ranged from 500 \u00b0C to 700 \u00b0C with an interval of 50 \u00b0C, and the corresponding activity data were averaged from three recorded data at each test temperature range. The stability tests of all samples were performed at 600 \u00b0C for 20 h with the same conditions. Considering that in the liquid product obtained by condensation, there are less C2 and C2+ compounds. Therefore, the catalytic performance of the catalyst is presented in terms of the gaseous conversion rate of glycerol and glycerol\u2013methanol mixed alcohol for GSR and GMSR, respectively, the molar yield of H2 and the selectivity of carbon-containing gas products.First, the GSR was used as a probe reaction to study the catalytic performance of the above catalysts, and then GMSR was studied on the best catalyst. Those reactions were performed in a fixed-bed quartz reactor  with an inner diameter of 8 mm under normal pressure. The reactor was equipped with 200 mg of catalyst (40\u201360 mesh) and mixed with 100 mg of quartz particles. Prior to each test, the samples were in situ reduced at 500 \u00b0C (NiO/Ti-500C) or 600 \u00b0C (NiO/Ti-600C), 700 \u00b0C (NiO/Ti-700C), 800 \u00b0C (NiO/Ti-800C) under a flow of gaseous mixture of HThe conversion was calculated byin, methanolin and carbong mean the moles of glycerol fed in, methanol fed in and carbon detected in gaseous products, respectively.The glycerol2 mole yield was calculated byThe H2, CH4) were calculated byThe selectivity of carbonaceous gaseous products . All samples were pretreated at 300 \u00b0C for 3 h. Specific surface area (BET) was obtained from the data of adsorption branch at \u2212196 \u00b0C using the BET method, and pore size distribution was calculated from Barrett\u2013Joyner\u2013Halenda (BJH) method. X-ray powder diffraction (XRD)  patterns were measured by a Rigaku D/max-1200 diffractometer equipped with Cu K\u03b1 radiation (\u03bb = 0.15406 nm), operated at 30 mA and 40 kV. The crystalline size of Ni and NiO were calculated with Scherer equation using the Rietveld refinement of Jade 6.0 software. The UV-vis diffuse reflection spectrum was recorded by the TU-1901 UV-vis spectrophotometer produced by the Persee General Instrument Co., Ltd. and equipped with an integrating sphere. The X-ray photoelectron spectra (XPS) was carried out on an ESCALAB 250 Xi spectrometer  equipped with an Al K\u03b1 (h\u03bd = 1486.6 eV) X-ray source. The charging effect was corrected by adjusting the binding energy of the C 1s peak from carbon pollution to 284.8 eV. Raman spectra were carried out on a micro-Raman system  equipped with a 532 nm laser as the excitation source. A thermogravimetric analyzer  was used to analyze coke deposition on the spent catalysts. NH3-Temperature programmed desorption (NH3-TPD) experiment was performed on a TCD detect  to explore the nature of acidity on catalysts. Before recording the TPD profiles, 100 mg of fresh catalyst was pretreated under 450 \u00b0C for 1 h and cooled down to 100 \u00b0C in the flow of ultra-pure He, then the gas was switched to NH3 flow at 30 mL/min for 1 h. After that, the gas was switched to ultra-pure He flow at 30 mL/min to purge the material for 2 h, finally, the pretreated sample was heated to 800 \u00b0C under the ultra-pure He flow at a heating rate of 10 \u00b0C/min. H2-Temperature programmed reduction (H2-TPR)  experiment was performed to investigate redox properties of catalysts. In short, in a typical test, a sample (50 mg) is first pretreated with a gas mixture (5 vol.% O2 in Ar) at 400 \u00b0C for 1 h to remove moisture and impurities. After cooling down to 100 \u00b0C, the gas was switched to the mixed gas flow with 10% H2/Ar (30 mL/min). The pretreated catalyst was heated to 800 \u00b0C at a rate of 10 \u00b0C/min and the TCD signal was recorded continuously. The H2 chemisorption experiment was used to measure the ratios of H2/Ni for the four catalysts. Prior to hydrogen pulse chemisorption, catalysts were pretreated at the reduction temperature under 10% H2/Ar (30mL/min), and cooled down to 40 \u00b0C in the flow of ultra-pure He. The chemisorption was implemented by pulsing of a mixture of 10% H2/Ar (30 mL/min).Structural properties of the catalysts were carried out by N2+ ions adsorbed on the surface of TiO2, which disappears in the ultraviolet region. Compared with NiO/Ti-100C sample, the peak of the NiO/Ti-500C sample at 720 nm can be attributed the species of NiO [3 phase [8 band of Ni2+ ions into two sub-bands, called Ni2+\u2192Ti4+ charge transfer (CT) bands. It also shows absorbance at 743 nm as indicated by its yellow color [3 and NiO disappear, indicating that NiO and NiTiO3 are completely reduced to Ni0. The above observations clearly indicate that the interaction between Ni species and the support TiO2 gradually increases with the increase of calcination temperature, resulting in the evolution of Ni species from Ni2+ species adsorbed on the surface of the carrier to NiO species, and then to NiTiO3 spinel species.UV\u2212vis diffuse reflection spectrum (UV\u2212vis DRS) was performed to investigate the nature of the Ni species within the material with the change of calcination temperature. The DR spectra of the samples with different calcination temperatures are shown in s of NiO . In cont[3 phase ,38,39. T3 species (JCPDS#33-0960) is apparent in NiO/Ti-600C, NiO/Ti-700C, NiO/Ti-800C. The characterization results are consistent with those of a UV-vis DR spectrum. It has been reported that higher calcination temperature could enhance the immersion of Ni2+ into TiO2 crystal lattices to form NiTiO3 crystals, which, after activation, could allow the existence of Ni crystallites highly dispersed in the support, as also previously reported [0 increases gradually and is approximated to be 18.80 \u00b1 1, 19.77 \u00b1 0.5, 20.83 \u00b1 1, and 23.25 \u00b1 2 nm for Ni/Ti-500R, Ni/Ti-600R, Ni/Ti-700R, Ni/Ti-800R, respectively. The XRD spectrum of Ni/TiO2-500R catalyst after high temperature reaction is shown in 0 increases slightly. However, in the case of TiO2 crystallite size, a monotonic increase in TiO2 crystallite size can be observed with increasing calcination temperature from 500 to 800 \u00b0C. After catalyst reduction, the particle size of TiO2 is almost the same as that after calcination, indicating that the carrier TiO2 is seriously sintered in the process of high-temperature calcination. At the same time, it can be seen from 3 were not detected in the reduced catalyst, indicating that these two substances can be completely reduced to Ni0 specie, and the results were consistent with the UV-vis DRS results.We turned to the XRD to further determine the bulk composition and the average crystallite size of the above catalysts. The XRD patterns for the support and samples before and after reduction are shown in reported ,40. As c2-temperature programmed reduction (H2-TPR) was performed  in NiO/Ti-500C catalyst, the binding energy of Ni2+ in Ni 2p XPS spectrum for NiO/Ti-600C (855.0 eV), NiO/Ti-700C and NiO/Ti-800C (ca. 855.4 eV) catalyst shifts to high binding energy but are 0.3 eV lower than Ni3+. As for the Ti 2p and O 1s XPS spectra, compared with the NiO/Ti-500C catalyst, with the increase of the catalyst calcination temperature, except for the binding energy of O 1s spectrum for NiO/Ti-600C catalyst slightly shifts to higher binding energy, the binding energies of Ti 2p and O 1s XPS spectra for all catalysts shift to low binding energies. This indicates that when the calcination temperature is increased, there is a stronger electronic activity phenomenon between the carrier TiO2 and the active metal Ni species. These changes may also be caused by anatase\u2014rutile phase transition in the carrier [XPS spectra was used to prove the possible existence of electrons interaction between Ti oxide and separated NiO species. The corresponding Ni 2p, Ti 2p, and O 1s XPS spectra of NiO/Ti-500C, NiO/Ti-600C, NiO/Ti-700C, NiO/Ti-800C catalysts, respectively, are given in nd Ni2O3 ,47. The ier TiO2 . As the  carrier .2-TPR and BET characterization results, increasing the calcination temperature, the interaction force and the electronic effect between the active metal Ni and the support gradually increase, and the interaction force between NiTiO3 and the support TiO2 is also enhanced. For NiO/Ti-600C catalyst, the active metal Ni and the support TiO2 form a medium-strength interaction force and electronic effect, which leads to the existence of the Ni species in the catalyst in the form of granular NiTiO3, which is easily reduced to small particles of Ni at relatively lower temperatures. However, under high-temperature calcination, a very strong interaction force and electronic effect are formed between interface NiTiO3 and the support TiO2, or in the form of a Ni-Ti solid solution, which caused the Ni2+ in NiTiO3 to be reduced at a higher temperature. The higher calcination and reduction temperature will cause severe sintering of the active metal and the carrier, therefore affecting the performance of the catalyst.Combined with XRD, UV-vis DRS, H3-Temperature programmed desorption profile was used to study the acid strength characteristics of the Ni-supported TiO2 catalyst as a function of the calcination temperature. The results are shown in 2, there is a bulky and wide desorption peak (Tmax = 220\u2009\u00b0C) caused by Ti\u2013OH of the support surface, indicating that the weak acid and medium strong acid coexist in the support TiO2 and the weak acid is the main one. For the NiO/Ti-500C, the intensity of desorption peak at 350 \u00b0C increases gradually, and new desorption peaks appear at ca. 550 \u00b0C and ca. 650 \u00b0C, indicating that the acidity of the catalyst becomes stronger when the catalyst is calcined at 500 \u00b0C. For the NiO/Ti-600C, NiO/Ti-700C, NiO/Ti-800C, when the calcination temperature is further increased, the intensity of desorption peak below 550 \u00b0C gradually decreases or even disappears, while the desorption peak above 550 \u00b0C shifts to a higher temperature, indicating that the NiO/TiO2 catalyst transforms weak/medium acid into strong acid at higher temperature. As we all know, the strong acidity of the catalyst may cause carbon deposition on the surface of the catalyst, which will lead to a decrease in its catalytic activity [It is well known that the acidity of the catalyst has an important influence on the catalytic performance and anti-coking performance during the reforming reaction . Weak acactivity . The eff2 yield of all catalysts are low, indicating that the Ni particles have a weak ability to break chemical bonds at low temperatures [2 yield of Ni/Ti-500R and Ni/Ti-600R are higher than those of Ni/Ti-700R and Ni/Ti-800R catalysts under the same reaction temperature. At 600 \u00b0C, the conversion rate of glycerol reaches 98.5% for Ni/Ti-600R catalyst, but the conversion rate of other catalysts is much lower than that of Ni/Ti-600R catalyst. When the reaction temperature reached 650 \u00b0C and 700 \u00b0C, the glycerol conversion rate of Ni/Ti-600R catalyst is almost completely achieved, but the glycerol conversion rate of other catalysts was still far lower than Ni/Ti-600R. For all the catalysts, the conversion rate of glycerol and the yield of hydrogen increased gradually with the increase of the reaction temperature. For Ni/Ti-600R catalyst, the conversion rate of glycerol and the yield of hydrogen increased rapidly between 550 \u00b0C and 600 \u00b0C, and then the increase of temperature did not influence much. With the increase of reaction temperature, the selectivity of CO and methane increases first and then decreases, reaching the maximum at 650 \u00b0C. However, the selectivity of CO2 decreased first and then increased, and the selectivity is the lowest at 650 \u00b0C. The above experimental phenomena accord with the reaction thermodynamics. The lower reforming temperature limits the catalytic performance of the catalyst. The feed mainly forms liquid carbon compounds or coke deposits, resulting in a decrease in gaseous products and a decrease in H2 yield [The effects of reaction temperature on the activity of Ni/Ti-500R, Ni/Ti-600R, Ni/Ti-700R and Ni/Ti-800R in GSR were investigated, and the corresponding results are shown in eratures . MoreoveH2 yield .4 selectivity decreases. When the reaction temperature is lower than 650 \u00b0C, although the high temperature will inhibit the methanation reaction, the glycerol conversion rate will increase, and more CO will be produced during the reaction. In the process of increasing the temperature from 500 \u00b0C to 650 \u00b0C, from the perspective of reaction thermodynamics, increasing the reaction temperature will inhibit the methanation reaction of CO (CO + 3H2 = H2O + CH4 \u0394H0 = \u2212206.11 kJ/mol). However, as the reaction temperature increases, the glycerol conversion rate increases, and more CO will be produced, resulting in an increase in the selectivity of methane in the product. When the temperature is higher than 650 \u00b0C, CO selectivity and CH4 selectivity in the product decreases. Comparing the catalytic performance of the above catalysts, increasing the calcination temperature of the catalyst during the preparation process results in the catalytic activity order of Ni/Ti-600R > Ni/Ti-500R > Ni/Ti-700R > Ni/Ti-800R catalysts and the result is consistent with the H2/Ni ratio characterized by H2 chemisorption. Compared with Ni/Ti-600R catalyst, the Ni/Ti-700R and Ni/Ti-800R catalysts have lower glycerol conversion rate and hydrogen production rate, which may be due to their lower specific surface areas and stronger acidity. At the same time, the strong acidity of the catalyst promotes the cracking reaction of glycerol, resulting in a significantly higher CO selectivity in the product than Ni/Ti-500R and Ni/Ti-600R catalysts. Therefore, Ni/Ti-600R and Ni/Ti-500R are used to investigate the stability of the catalyst at the reaction temperature of 600 \u00b0C, and the hydrogen production capacity is shown as the index listed in 22 (0.9973) is larger than R12 (0.9967), and K2 (110.8 \u00b1 1.3) is larger than K1 (82.7 \u00b1 1.1), indicating that the stability of hydrogen production capacity of Ni/Ti-600R catalyst is higher than that of Ni/Ti-500R catalyst.As the temperature increased, the more gas was generated, and the reforming process is more favorable. In addition, as the temperature goes up, the WGS reaction and methanation reaction tends to proceed in the opposite direction, since these two reactions are exothermic reactions . Hence, Considering that the byproduct crude glycerin of biodiesel itself contains about 25% methanol by mass, the adaptability of the Ni/Ti-600R catalyst to reactant systems with different methanol/glycerol/water volume ratios was further investigated. The results are shown in The deactivation of catalysts in the GSR (GMSR) reaction is mainly caused by carbon deposition and sintering of active species Ni, among which many researchers reported that the most important reason is the carbon deposition. Therefore, thermogravimetry and Raman were used to characterize and analyze the amount and type of carbon on the surface area of Ni/Ti-600R catalyst after 20 h reaction in different mixed-alcohol systems.\u03b1) [\u03b2) with different graphitization degree [Thermogravimetric analyzer (TGA) was used to characterize the coking characteristics and coking amount of spent catalyst and the results are shown in \u03b1) . The maj\u03b1) . The feen degree . As list\u22121 is presented in \u22121 and 1590 cm\u22121 in Raman spectra, which are categorized as D-band and G-band of carbon-based materials, respectively. D-band, which is usually caused by the vibration of carbon atoms with dangling bonds in disordered carbon-like substances, and G-band is attributed to the well-ordered, condensed or graphitic aromatic carbon species as the sp2 bonded carbon atoms in a two-dimensional hexagonal lattice [G/ID) has been used to characterize the graphitic degree of coke on catalysts [G/ID of Ni/Ti-600R after 20 h reaction on the feedstock glycerol/methanol/water ratios of 1/2/7, 2/0/7 and 2/1/7 are 0.53, 0.64 and 0.67, respectively. Raman results are consistent with TG characterization, which indicate that the mixed-alcohol feed with a glycerol/methanol/water ratio of 1/2/7 deposits more unstable amorphous (C\u03b1) and filamentous coke (C\u03b2) on the catalyst. These carbons are easy to gasify and decompose in the reaction process at high temperature, so TG characterization shows that the amount of carbon deposition is minimal under this feed condition.The Raman spectrum was applied to further analyze the type of coke deposition on spent catalysts used in different mixed-alcohol feeding systems, and the Raman spectrum in the range 1100\u20132000 cm lattice . In addiatalysts . The rat2 catalyst during the preparation process has a great influence on its physical and chemical properties and the catalytic performance of the corresponding alcohol reforming hydrogen production reaction. During the preparation process of the Ni/TiO2 catalyst, compared to calcination at 500 \u00b0C to form NiO, calcination at 600 \u00b0C forms a granular NiTiO3 species with medium intensity interaction and electronic activity between the metal and support. Due to the moderate metal\u2013support interaction and electronic activity for NiO/Ti-600C catalyst, the granular NiTiO3 spinel can be reduced to a smaller Ni0 at a lower temperature, showing the best glycerol conversion rate and the highest hydrogen yield. However, when the catalyst is calcined at 700 and 800 \u00b0C, the Ni species exists in the form of interface NiTiO3 spinel or Ni-Ti solid solution with strong metal\u2013support interaction force and electronic effect, which requires a higher temperature to reduce to Ni0 species. The higher calcination and reduction temperature will cause severe sintering of the active metal and the carrier, therefore affecting the performance of the catalyst. At the same time, as the calcination temperature increases, the acidity of the catalyst gradually changes from weak acid to strong acid.In our work, we found that the calcination temperature of the Ni/TiOWe have also carried out research on hydrogen production by reforming mixed alcohols with different ratios of glycerol/methanol/water as feedstock on Ni/Ti-600R catalyst. It is found that when the concentration of glycerol is the same, adding a certain amount of methanol will increase the amount of carbon deposit on the catalyst, and the conversion rate of mixed alcohol will decrease, but the hydrogen production will increase. When the methanol concentration in the mixed-alcohol feed is the highest, the carbon deposit is the least, and the hydrogen production will further increase. Therefore, for crude glycerin, a byproduct of biodiesel, a certain amount of methanol will help increase hydrogen production. When the volume ratio of glycerol to methanol is less than 50%, it will not only help reduce carbon deposits, but also increase hydrogen production."}
+{"text": "The turnover frequency (TOF) of C3H8 conversion increases by more than one order of magnitude in the order Ni/TiO2 < Ni/CeO2 < Ni/Al2O3 < Ni/YSZ < Ni/ZrO2, accompanied by a parallel increase of the selectivity toward the intermediate methane produced. In situ FTIR experiments indicate that CHx species produced via the dissociative adsorption of propane are the key reaction intermediates, with their hydrogenation to CH4 and/or conversion to formates and, eventually, to CO, being favored over the most active Ni/ZrO2 catalyst. Long term stability test showed that Ni/ZrO2 exhibits excellent stability for more than 30 h on stream and thus, it can be considered as a suitable catalyst for the production of H2 via propane steam reforming.The catalytic performance of supported Ni catalysts for the propane steam reforming reaction was investigated with respect to the nature of the support. It was found that Ni is much more active when supported on ZrO NickTransmission electron microscopy (TEM) images were obtained with a JEM-2100 system  operated at 200 kV (point resolution 0.23 nm) using an Erlangshen CCD Camera . Samples were dispersed in water and spread onto a carbon-coated copper grid (200 mesh). Details related to the equipment and procedures used for catalyst characterization have been described in detail elsewhere .2O/C = 3.25, and gas hourly space velocity (GHSV) = 55,900 h\u22121. The reactor was loaded with 150 mg of catalyst (particle diameter: 0.15 < dp < 0.25 mm) and placed in an electric furnace, where it was reduced in situ at 300 \u00b0C for 1 h under 50%H2/He flow (60 cm3 min\u22121) to ensure that the Ni exists in its metallic phase prior to catalytic performance tests. Catalyst reduction was followed by heating at 750 \u00b0C under He and subsequent switch of the flow to the feed stream consisted of 4.5%C3H8 + 0.15%Ar + 44%H2O . Argon was used as internal standard in order to account for the volume change. Water was fed through an HPLC pump  into a vaporizer maintained at 180 \u00b0C and mixed with the gas stream coming from mass-flow controllers. A condenser immersed in an ice bath was placed at the exit of the reactor to condensate water prior to introduction of the gas stream to the analysis system. Reaction gases  are supplied from high-pressure gas cylinders  and are of ultrahigh purity. Measurements of reactants\u2019 and products\u2019 concentrations were obtained by stepwise decreasing temperature up to 400 \u00b0C. The effluent from the reactor was analyzed using two gas chromatographs  which were connected in parallel. The procedure used for gas phase analysis was described in our previous study in, [C3H8]out, are the inlet and outlet concentrations (v/v) of C3H8, respectively, Fin and Fout are the total flow rates in the inlet and outlet of the reactor (mols\u22121), respectively, and W is the mass of catalyst (gcat).The intrinsic reaction rates for propane steam reforming reaction were measured for low propane conversions (Ni is the atomic weight of nickel (gNi/molNi), XNi is the nickel loading (gNi/gcat) and DNi is the dispersion of nickel.Turnover frequencies (TOFs) of propane conversion were estimated following Equation (8) taking into account the measurements of both the reaction rates and nickel dispersions:In situ Fourier transform infrared (FTIR) experiments were carried out using an iS20 FTIR spectrometer  equipped with an MCT detector, a KBr beam splitter and a diffuse reflectance (DRIFT) sampling system  accompanied by an environmental chamber suitable for the study of diffusely reflecting solid samples in a controlled atmosphere. A flow system equipped with mass flow controllers, a steam saturator and a set of valves used for controlling the gas stream interacted with the catalyst surface, was directly connected to the gas inlet of the environmental chamber.3H8 +5%H2O (in He). Steam was introduced to the system via an independent He line passing through a saturator containing water maintained at 60 \u00b0C. The resulting gas mixture was fed to the DRIFT cell through stainless steel tubing maintained at 60 \u00b0C by means of heating tapes. A spectrum was collected at 100 \u00b0C after 15 min-on-stream followed by a stepwise increase of temperature up to 500 \u00b0C. During heating, spectra were recorded at selected temperatures after an equilibration for 15 min. In all experiments, the total flow through the DRIFT cell was 30 cm3 min\u22121. Reaction gases  are supplied from high-pressure gas cylinders  and are of ultrahigh purity.In a typical experiment, the catalyst powder was placed in the sampling system and heated at 500 \u00b0C in flowing helium for 10 min and then reduced under hydrogen flow at 300 \u00b0C for 30 min. The flow was then switched to He and the temperature was increased at 500 \u00b0C. After remaining 10 min at this temperature the sample was cooled at 100 \u00b0C. While cooling, the background spectra were recorded at the desired temperatures. Finally, the flow was switched to the reaction mixture, which consisted of 0.5%CxOy catalysts are shown in 2O3 which are attributed to (220), (311), (222), (400) and (440) facets of cubic Al2O3 (JCPDS Card No. 10-425), respectively. The XRD spectra recorded for Ni/CeO2 catalyst consisted of peaks located at 2\u03b8 = 28.79\u00b0, 33.26\u00b0, 47.62\u00b0, 56.34\u00b0, 59.1\u00b0, 69.42\u00b0, 76.66\u00b0, 79.11\u00b0 attributed to (111), (200), (220), (311), (222), (400), (331) and (420) planes of the cubic CeO2 (JCPDS Card No. 2-1306), whereas in the case of Ni/ZrO2 catalyst numerous peaks were detected on the XRD pattern. In particular, the peaks detected at 24.2\u00b0, 24.5\u00b0, 28.5\u00b0, 31.7\u00b0, 34.5\u00b0, 35.5\u00b0, 38.9\u00b0, 41.0\u00b0, 41.5\u00b0, 45.1\u00b0, 45.8\u00b0, 49.5\u00b0, 50.5\u00b0, 54.4\u00b0, 55.7\u00b0, 57.5\u00b0, 60.2\u00b0, 62.1\u00b0, 63.2\u00b0, 66.0\u00b0, 71.6\u00b0, 75.3\u00b0 correspond to (011), (\u2212110), (\u2212111), (111), (002), (200), (021), (\u2212211), (\u2212121), (112), (211), (022), (\u2212221), (202), (013), (212), (\u2212302), (113), (311), (\u2212321), (\u2212104), (\u2212140) planes of monoclinic ZrO2 (JCPDS Card No. 13-307). When Ni was supported on YSZ, the XRD pattern was characterized by reflections at 30.4\u00b0, 35.1\u00b0, 50.4\u00b0, 59.9\u00b0, 62.9\u00b0 and 74.0\u00b0 attributed to (111), (200), (220), (311), (222) and (400) planes of YSZ (JCPDS Card No. 82-1246), respectively. The XRD patterns of Ni/M2 catalyst showed that the sample consisted of TiO2 in both its anatase and rutile form exhibiting peaks at 2\u03b8 = 25.6\u00b0 (101), 37.2\u00b0 (103), 38.2\u00b0 (004), 38.9\u00b0 (112), 48.4\u00b0 (200), 54.3\u00b0 (105), 55.4\u00b0 (211), 63.1\u00b0 (204), 69.3\u00b0 (116), 70.7\u00b0 (220), 75.4\u00b0 (215) and 76.4\u00b0 (301) for anatase (JCPDS Card No. 21-1272), and at 2\u03b8 = 27.6\u00b0 (110), 36.3\u00b0 (101), 41.6\u00b0 (111), 44.3\u00b0 (210), 54.6\u00b0 (211), 56.9\u00b0 (220) and 64.3\u00b0 (310) for rutile (JCPDS Card No. 21-1276).Results obtained from Ni/TiO2 and Ni/YSZ catalysts an additional weak peak located 44.5\u00b0 was appeared corresponding to Ni (111) plane (JCPDS Card No. 04-0850). The absence of peaks corresponding to metallic Ni for the rest catalysts investigated is due to the low Ni loading and/or particle size. The primary crystallite size of the supports was estimated according to Scherrer\u2019s formula at the diffraction angles corresponding to (440) plane for Al2O3, (\u2212111) plane for ZrO2, (111) plane for CeO2, (111) plane for YSZ and (101) plane for TiO2, and it was found to be 6.0 nm for Ni/Al2O3, 10.5 nm for Ni/CeO2, 15.0 nm for Ni/ZrO2, 20.9 nm for Ni/YSZ and 21.8 nm for Ni/TiO2 (In the case of Ni/TiO Ni/TiO2 .xOy) carriers were estimated equal to 39 m2/g for Ni/ZrO2, 11 m2/g for Ni/YSZ, 66 m2/g for Ni/Al2O3, 39 m2/g for Ni/CeO2 and 41 m2/g for Ni/TiO2  and mean particle size (dNi) estimated from CO chemisorption meaurements are summarized in 2 catalyst, whereas Ni/TiO2 exhibited the lowest value of Ni dispersion of 2.8% and the largest particle size of 36.1 nm.Results of Ni dispersion . The appearance of the (101)  and (103)  planes of TiO2, the (111)  and (200)  planes of YSZ, as well as the (111)  and (200)  planes of CeO2 also confirmed the presence of the metal oxides.It should be noted that, based on the results of  support , Table 22, YSZ, TiO2, Al2O3, CeO2). The results obtained are shown in 2 is the most active one, exhibiting measurable C3H8 conversions at temperatures higher than 400 \u00b0C and achieving complete conversion at 750 \u00b0C. Although Ni/YSZ is activated at similar temperatures as Ni/ZrO2, the conversion curve of propane is shifted toward higher temperatures. This is also the case for Ni/Al2O3 and Ni/CeO2 catalysts, which present similar performance. The latter catalysts are less active than Ni/YSZ below 550 \u00b0C, but are able to reach higher XC3H8 at higher temperatures. The titania-supported catalyst becomes active above 500 \u00b0C, with the propane conversion curve being shifted at remarkably higher temperatures. In all examined cases, the carbon balance was satisfactory, with a deviation of <1%.The influence of the nature of the support on catalytic performance for the propane steam reforming reaction has been investigated using Ni catalysts (5 wt.%) supported on five different commercial metal oxide powders  of the propane steam reforming reaction were calculated from the slopes of the fitted lines of a, which takes values between 102 kJ/mol for Ni/CeO2 and 154 kJ/mol for Ni/ZrO2 without presenting any trend with respect to catalytic activity  and CO2 (SCO2) selectivities decrease from 99 to 78% and from 98 to 58%, respectively, with increasing temperature in the range of 390\u2013505 \u00b0C followed by an increase of methane selectivity (SCH4) up to 32.5%, indicating the occurrence of CO2 methanation reactions. Carbon dioxide consumption continues with further increase of temperature above 505 \u00b0C contrary to SH2 which progressively increases reaching 99% at 720 \u00b0C. Consumption of CO2 is followed by production of CO providing evidence that the reverse WGS (RWGS) reaction is enhanced at high temperatures. Moreover, SCH4 decreases above 505 \u00b0C and becomes practically zero at 720 \u00b0C, implying that the reaction of methane steam reforming occurs contributing to the observed increase of both SH2 and SCO. It should be noted that selectivity toward reaction products containing carbon was defined as the concentration of each product containing carbon at reactor effluent over the concentration of all products containing carbon (5), whereas SH2 was defined as the concentration of hydrogen produced divided by the concentration of all products containing hydrogen (6). Therefore, the values of Scn and SH2 cannot be correlated based on the stoichiometry of the reactions taking place under propane steam reforming conditions.catalyst A, both hSH2 and SCO2 at low temperatures and the simultaneous increase of SCH4 are higher for the most active Ni/ZrO2  followed by Ni/CeO2 (21.2 wt.%), Ni/Al2O3 (20.6 wt.%) and Ni/YSZ (19.7 wt.%), whereas Ni/TiO2 exhibits the lowest H2 production (5.2 wt.%).The mass of H3 was more active than Ni/Al2O3, while Ni/CeO2 exhibited intermediate performance. The optimum activity of the former catalyst was attributed to the small Ni nanoparticles dispersed on LaAlO3 surface. Although the effect of the support nature on propane steam reforming activity has not been widely studied over Ni catalysts, certain properties of metal oxide carriers may help explain the results of 2-Al2O3 [2O3 was found to act as an oxygen donor that is transferred to Ni particles leading to rapid decomposition and oxidation of C3H8 and CH4 or C2H4 that may be produced under reaction conditions, resulting in further H2 production and improvement of the catalyst lifetime [2 formation may be favored over metal catalysts supported on \u201creducible\u201d metal oxides through generation of oxygen defects, resulting in improved propane steam reforming activity and resistance to coke formation [2O3 is a hardly reducible metal oxide characterized by low oxygen storage capacity contrary to TiO2 and CeO2, which are strongly reducible metal oxides, or ZrO2 and YSZ, which are characterized by intermediate oxygen mobility [2 should be also active for the title reaction, taking into account that titania support is characterized by high oxygen storage capacity [2 < Ni/CeO2 < Ni/Al2O3 < Ni/YSZ < Ni/ZrO2, which cannot be correlated with the reducibility of the support. Therefore, it is evident that support reducibility is not among the key parameters affecting the catalytic activity of Ni according to the results of the present study. The low activity of Ni/TiO2 catalyst may be related to the fact that Ni/TiO2 has lower Ni dispersion and larger Ni particles, which was previously suggested to suppress both propane steam reforming [2 or CHx) hydrogenation reactions, in excellent agreement with the results of our previous study [2 taking into account that no trend was observed between TOF and Ni particle size for the investigated catalysts.The influence of the nature of the support on the activity of Ni catalysts for propane steam reforming reaction was also investigated by Harshini et al. , who fou 2-Al2O3 . Moreovelifetime . It has ormation ,31. Basemobility . Based ocapacity ,33. Howeeforming ,16, and us study . However2 was the most active catalyst with TOF being one order of magnitude higher compared to that measured for Rh/CeO2 [It should be mentioned that a different activity order was reported in our previous study over supported Rh catalysts, where it was found that Rh/TiO Rh/CeO2 . This im2 catalyst, which exhibited the highest activity, was investigated at 650 \u00b0C using the same experimental conditions as those used in catalytic performance tests. In this experiment, the catalyst was reduced in situ at 300 \u00b0C under 50%H2/He flow followed by heating at 650 \u00b0C. The flow was then switched to the reaction mixture and determination of the conversion of propane and product selectivity started. The system was shut down overnight, while the catalyst was kept at room temperature under a He flow. The next day the catalyst is heated to 650 \u00b0C in the He flow, followed by switching of the flow to the reaction mixture and determination of XC3H8 and the product selectivity as a function of time. Results obtained are shown in XC3H8 and SH2, SCO2, SCO and SCH4 are plotted as functions of time-on-stream. As it can be seen the catalyst presents excellent stability for more than 30 h-on-stream. Propane conversion and hydrogen selectivity were varied in the range of 95\u201399% and 97\u201398%, respectively. The selectivity toward methane was low (3\u20134%) whereas SCO and SCO2 exhibited similar values ranging between 46 and 50%. The carbon balance was found to be satisfactory during the stability test, with a deviation lower than 1\u20132%.The long-term stability of Ni/ZrO3H8 + 5%H2O (in He) and the results obtained are shown in 2 catalyst is characterized by two negative bands at 3787 and 3676 cm\u22121 which can be attributed to losses of \u03bd (OH) intensity of at least two different types of free hydroxyl groups, which are either originally present on TiO2 surface or created via H2O adsorption. Two weak peaks were also detected in the \u03bd (C-H) region, located at 2987 and 2966 cm\u22121 (trace a) due to C-H stretching vibrations in methyl groups  and to symmetric C-H vibrations in methylene groups , respectively [\u22121 are presented. Moreover, a band at 1642 cm\u22121 followed by a shoulder at 1560 cm\u22121 can be discerned, which have been previously assigned to carbonate species associated with TiO2 support [\u22121 can be also discerned in the spectra obtained at 350 \u00b0C (trace f) which is also due to carbonate species. This peak may be also present in the spectra obtained at lower temperatures but couldn\u2019t be clearly observed due to the low signal-to-noise ratio in the region below 1700 cm\u22121. The intensities of bands assigned to carbonate species are progressively decreased above 200 \u00b0C. This decrease is accompanied by the detection of a weak peak at 2021 cm\u22121 [2 in the gas phase. The weak bands in the \u03bd (C-H) region are present on the spectra obtained up to 500 \u00b0C  [x species (2983 and 2966 cm\u22121) [\u22121) related to the consumption of surface OH groups [\u22121 due to bicarbonate species [\u22121, indicating that bicarbonate species are decomposed above 450 \u00b0C. At temperatures higher than 400 \u00b0C (traces h-i) two new broad bands seem to be developed at ca 1540 and 1350 cm\u22121. The broadness of these bands implies that they may contain contributions from more than one species with their corresponding bands being overlapped.A similar experiment was conducted over the most active Ni/ZrOd in \u22121) ,48,49, C66 cm\u22121) ,36,47 asH groups ,36,48. I\u22121. Those detected at 1520 and 1331 cm\u22121 have been previously attributed to bidentate carbonates [\u22121 can be assigned to bidentate formate species [2 surface. The appearance of the latter bands is accompanied by evolution of three peaks in the \u03bd(CO) region due to CO linearly adsorbed on reduced Ni sites (2021 cm\u22121) and bridged bonded CO (1909 and 1858 cm\u22121) [This can be clearly seen in the spectrum obtained at 500 \u00b0C (trace i) where four bands can be clearly discerned located at 1558, 1520, 1370 and 1331 cmrbonates ,50, wher species  adsorbed58 cm\u22121) ,52,53,54x species are eliminated from the spectra obtained above 400 \u00b0C followed by evolution of CH4 in the gas phase, as evidenced by the detection of the 3016 cm\u22121 band (traces h\u2013i). Production of CH4 at the expense of CHx species can be clearly seen in \u22121 are presented.Interestingly, CH2 catalyst proceeds via a dissociative adsorption of propane on metallic Ni leading to the formation of C3Hx species, which are further decomposed toward CHx species and probably carbon oxides due to the presence of H2O adsorbed on the support surface. This may result in the formation of the bicarbonate species  detected at low temperatures on the surface of the support [x species are hydrogenated above 400 \u00b0C, yielding methane in the gas phase (band at 3016 cm\u22121) whereas the rest interact with adsorbed water producing formates (bands at 1558 and 1370 cm\u22121) and, eventually, CO species adsorbed on the Ni surface . Formates may also interact with hydroxyl groups producing H2 and carbonate species (1520 and 1331 cm\u22121), which are further decomposed to CO2 [. It should be noted, however, that, under certain conditions, CHx species may be also dehydrogenated producing C and H2. Surface carbon is either accumulated on the catalyst surface resulting in catalyst deactivation (which is not the case here) or it interacts with the hydroxyl groups or the lattice oxygen of the support yielding CO or CO2 [Based on the above it can be suggested that the reaction of steam reforming of propane over Ni/ZrO support . Part ofx species to be converted to methane and/or formates on the surface of Ni/ZrO2 may imply that CHx species are more weakly adsorbed and/or more reactive on the surface of this catalyst, thus resulting in higher overall activity for the propane steam reforming reaction. This agrees well with results of x species over Ni/ZrO2 is also indirectly confirmed by the significantly higher population of carbonyl species observed over this catalyst. On the other hand, although CHx species were also detected on the surface of Ni/TiO2 catalyst, no band due to gas phase methane or formate species was observed, indicating that CHx species cannot be further converted in the temperature range investigated. The increase of SCH4 in parallel with the increase of catalytic activity (x species is strongly related to the conversion of propane to the desired products. Although detailed mechanistic studies should be conducted to further explore the reaction pathway, it can be suggested that CHx species are key reaction intermediates for the reaction of propane steam reforming.The ability of CHactivity  indicate2 catalyst was found to be more than one order of magnitude higher compared to that measured for Ni/TiO2. The intermediate production of CH4 is strongly influenced by the type of metal oxide used as support following the same trend with that of catalytic activity. DRIFTS studies provided evidences that the most active Ni/ZrO2 catalyst is able to convert the intermediate produced CHx species to CH4 and/or formate species and, subsequently, to carbon oxides and H2. In contrast, CHx species seem to be less reactive when Ni is dispersed on TiO2, thus resulting in a lower reaction rate. In addition to the high activity of Ni/ZrO2 catalyst, it was also found to be stable for more than 30 h on stream and therefore, is a promising candidate for the production of H2 for fuel cell applications.The results of the present study show that the catalytic activity of Ni and the product distribution for the propane steam reforming reaction depend strongly on the nature of the support. The specific reaction rate measured for Ni/ZrO"}
+{"text": "In the paper, we investigate spatial relationship on the labor market of Pozna\u0144 agglomeration (Poland) with unique data on job vacancies. We have developed spatial panel models to assess the search and matching process with a particular focus on spatial spillovers. In general, spatial models may provide different findings than regular panel models regarding returns to scale in matching technology. Moreover, we have identified global spillover effects as well as other factors that impact the job-worker matching. We underline the role of data on job vacancies: the data retrieved from commercial job portals produced much more reliable estimates than underestimated registered data. Labor markets are spatial in their nature. In metropolitan areas, people commute to achieve a better-paid or more satisfactory job. Large cities are surrounded by minor counties the function of which is often to provide shelter and basic services to people who work in the city and spend there most of their daytime. However, these surrounding counties are not homogenous, and may strongly differ in their socio-economic development and functions. They formed more or less self-sufficient enclaves that are somehow dependent on its large metropolitan neighbor.The aim of this paper is to investigate spatial relationships on the urban labor market with two concepts: spatial panel matching function models and in-depth spatial correlation analysis. In the research we employed unique data on job vacancies derived directly from the most substantial Polish internet job portals. We focus on the Pozna\u0144 agglomeration (Poland)\u2014one of the largest metropolitan areas in Poland that consists of 18 counties (LAU level 2). LAU2 (formerly NUTS5) is the smallest administrative unit to divide the territory of the European Union. It includes municipalities, agglomerations or communes (Eurostat).The Pozna\u0144 agglomeration is one of the largest metropolitan areas in Poland and lies in the east\u2013west line in central west Poland. It is also a workhorse of a regional economy with the dominant industries of construction, services, trade, and logistics. The Pozna\u0144 agglomeration is also a highly international place with the Amazon distribution warehouse, Volkswagen Factory, Carlsberg, Bertelsmann, among many others. Pozna\u0144 has a record-breaking low-level of the unemployment rate that dropped to 1.1% in December 2019. As a result, one of the major problems of local employers was worker shortages  within the EU countries. It is worth mentioning that numerous studies investigate the problem of spatial correlation and the matching process on the labor market. However, the first papers focused mainly on NUTS2 and NUTS4 areas within the EU countries. As the repercussion of this research, the general relevance of spatial interaction was confirmed for several countries, e.g. Spain . Such studies are ultimately rare  as well as the third largest http://www.infopraca.pl  according to the Gemius/PBI survey (http://www.jobs.pl (no data on the market share). As we want to compare commercial data with Public Employment Service statistics, we also got API access to the local database of the PES in Pozna\u0144. We started developing the API interface and tests in the late 2017, however it reached its full functionality in 2018. In Fig.\u00a0Three of the largest Polish internet job offering portals agreed to share their databases with us and produced unique Application Programing Interfaces (API) for our purposes. We started collaboration with the largest Polish job offering portal\u2014I survey . AdditioAs an example, we plotted registered vacancies (PES) against those downloaded directly from the databases of job portals. It is easy to notice that the difference is enormous and the number of job offers is on average 20 times larger for commercial job portals. In general, massive fluctuations of vacancies are observed with peaks during spring/summer and drops in autumn/winter. A decrease in the number of vacancies is particularly observed in two periods of the year: the beginning of May (short spring holidays in Poland) and Christmas/New Year time. Peaks are mainly observed during spring (March) and early summer (June). When we look into extracted trends from public and commercial data, one can observe some similar patterns in the inflow of vacancies, i.e., the rise and fall in certain periods of the years. However, in general, drops are more severe and peaks are not so dynamic in public data.The API interface was fully operating in the late 2018, however we managed to extract data starting from the beginning of the year. Then, we disaggregated the data by counties of origin by the field named \u201clocation\u201d that indicates the geolocation of each job offer. As a result, vacancies were sorted according to the data source  and its geographical location. We downloaded data from 01 January 2018 to 31 December 2019 on a daily basis. Every 24\u00a0h the API interface connected to the three selected web services and downloaded the data on job vacancies to the SQL database. In addition, also PES data were downloaded every day, however, the daily dynamics of PES data on the inflow of vacancies at county level was very low. In fact, some days with the NULL inflow appeared. The monthly inflow rate of new vacancies is presented in Fig.\u00a0In turn, the data on unemployment were extracted from the Public Employment Service . The unemployment rate is published by PES monthly for the agglomeration in total. However, we can easily estimate monthly unemployment rateFor further analysis, we aggregated (summed) the daily vacancies inflow data to monthly frequency to match the registered data on unemployment that are reported monthly. Luckily, in Poland unemployment data are much more reliable, because every person that loses a job has to register in the employment office to get free health insurance. Therefore, in practice a vast majority of unemployed persons register in the labor office to get access to medical services.inter alia, a significant rise in wages and a massive inflow of migrants from Eastern Europe.Unemployment rate and job vacancies rate dropped during 2018\u20132019. On average, in January 2018 one can observe higher rates than in December 2019. The last month of the 2019 had a record-low unemployment rate (1.1%) together with 1% vacancies ratio. In turn, in January 2018 the unemployment rate was about 2% accompanied with a similar level of the job vacancy rate. The phenomena led to serious problems related to finding workers and caused, The core metropolitan unit (Pozna\u0144) is in the above-average group in terms of vacancies and below-average in terms of unemployment. In general, counties with higher unemployment are located in the peripheries of the agglomeration and counties with lower unemployment are located in the central part of the area.What is interesting is the case of the Kleszczewo county , characterized by constant and the highest job vacancy rate (above 2.5%) and rather permanent unemployment (1.2%). Kleszczewo is a rural county with the lowest number of employees in the agglomeration (989 people in 2018). The agricultural nature of the commune and the above-average inflow of new vacancies  seem to be the best explanation for the presented indicator level.When we compute the cross-correlation coefficient for the data, we obtain some puzzling results. The inflow of vacancies is positively correlated with the unemployment inflow. It means that if the inflow towards unemployment is higher, employers are more likely to create new jobs and post vacancies. In turn, if the unemployment inflow is lower, employers are less likely to post new vacancies. This can be explained by the greater willingness of employers to hire workers during higher supply of labor. Both inflows of vacancies are highly correlated (0.79) which means that public and commercial data share some common trend also regarding a given spatial unit. If unemployment is higher, people tend to find jobs more often and the inflow to unemployment also rises Table .Table 1CThe summary of the data used in further computations is presented in Table The interaction between spatial units in the labor markets were confirmed in several empirical research . The intensities of spatial relations are defined by some preset rules that are usually based on contiguity or distance .The Queens matrix assumes that workers freely roam the local labor market with no preferences on the localization of job vacancies. In turn, distance-based and graph-based matrices assume that workers prefer jobs which are closer to where they live. The first type of spatial relations may involve higher transactional costs  which however may be compensated by e.g. a higher salary. In turn, the second type has lower costs which may be preferable in the case of having a low-paid job or other obligations .As usual, the matrices were row-standardized in the  range:Standardization ensured that the models with different W could be comparable. Finally, we plotted matrices on maps to highlight the differences between them  that measure the correlation between the same variables in the two neighboring spatial units Anselin . Two mea6The strongly colored regions are therefore those that contribute significantly to a positive global spatial autocorrelation outcome, while paler colors contribute significantly to a negative autocorrelation outcome. This means that pale colors are surrounded by dissimilar values that occur near one another. The north-eastern cluster shows significant clustering for the unemployment rate in the agglomeration. On the other hand, the south-western cluster contributes negatively to the autocorrelation outcome and is surrounded by units of dissimilar values. The Getis-Ord Gi statistic .T can be decomposed into the stock of unemployment U as well as the inflow of newly registered persons u. The model assumptions are that Consequently, the model can be written as a common Cobb-Douglass formula: Further, however a questionable assumption is the one about constant returns to scale of the function. The latter was either falsified or confirmed in several empirical studies  which is the extension of the SLX model and can also be useful in detecting local spillovers. Additionally, the model assumes the spatial pattern in an error term due to omitted factors. The SDEM can overcome both spatial autocorrelation relationships of independent variables and spatial errors between regions. Formally, SDEM is enhanced SLX and contains both spatial exogenous interaction effects as well as a spatial error term. Thus, }\u03b5i,t in  evolves Consequently, the third specification of a spatial model is the spatial autoregressive model (SAR). It includes the spatial lag of a dependent variable and allows detecting global spatial effects. In that case, including endogenous interaction effects means that the number of new matches in a given unit may affect other units in the agglomeration even if the units do not have the common borders. It could be justified economically as unemployed persons seek for a job in the whole agglomeration and may commute throughout several counties. Job search and matching is not limited to neighboring units. Formally speaking the spatial matching function SAR model is:In further computations we used the data described in the previous section. Thus, we had a balanced panel with n\u2009=\u200918, T\u2009=\u200924 and N\u2009=\u2009432. Due to the limitations of the API interface, we were able to retrieve 24\u00a0months\u2019 time-series for each panel unit which could be a little too short  and and5) ansplm R packageplm R packgeSpatial models were estimated with two-step Maximum Likelihood as implemented inComparison of both R-squared and AIC/BIC criteria leads to the conclusion that spatial models estimated with commercial job ads are better fitted with the data (they produced higher R-squared and lower AIC/BIC scores). In turn, spatial models estimated with PES data have not confirmed the existence of the matching function. The inflow of new vacancies is not significant in that case; thus, we focus on the analysis of the output of models estimated with combined data .Therefore, the SAR, SLX, SDEM and panel fixed-effects models identified the spatial matching function which exhibits strictly decreasing returns to scale. In turn, the pooled model indicates the constant return to scale matching function. The result corresponds to the papers that estimate the matching function with disaggregated data  changes in one unit, it somehow affects all units in the agglomeration. The SAR model generates the strong process of global spillovers showing that the effect was observed in the study area. It indicates that if the number of new matches  that consists of 17 small spatial units of the LAU2 class. We proved the existence of spatial autocorrelation and identified the clusters that significantly contribute positively and negatively to the unemployment rate. We therefore extend studies on labor market spatial correlation by adding the analysis of small spatial units which have not been the object of studies so far. We also contribute by the analysis of the spatial panel matching function on the urban labor market with a unique dataset combined with the registered data on unemployment and commercial data on job adds.In the paper, we estimated spatial and non-spatial models with public and commercial data on job vacancies. The results clearly show the drawbacks of PES data on vacancies. Although estimations proved the existence of spatial dependencies, the PES estimations did not identify the matching function and produced worse fit to data. In effect, we were able to produce further conclusions on the basis of the models estimated with the data on job vacancies extracted from commercial job portals. In addition, if we were only to follow the estimates of the pooled models, we would confirm the common finding of the existence of the CRS matching function also at the low level of spatial aggregation (as identified by both pooled models). However, the estimated spatial models exhibit decreasing returns to scale (DRS) and this finding goes along with the hypothesis of exaggerating the role of the CRS matching function . These unidentified factors may be connected with on-the-job search or the exploitation of other channels in the recruitment procedure and bias the elasticities of the matching function ((Fahr and Sunde Another finding (made on the basis of API-gathered data) includes strong positive externalities connected with the matching process among 18 LAU2 units of the urban labor market. The externalities are global in their nature which means the one outflow to employment in one unit affects also others not necessarily the closest ones. The externality may be connected with job commuting\u2014workers may travel through several counties and an increase in the number of new vacancies in one unit attracts job seekers in the whole agglomeration.On the basis of our study, we could provide two main areas of recommendations. Global spillovers indicate strong economic connections between counties and imply policy solutions to be implemented at global rather than local level. From this point of view, further development of the common transportation system should be the primary objective. This kind of solution may reduce matching frictions and transactional costs and increase the overall performance of the local labor. Also, a special point of interest should be solutions for foreign workers, especially from Ukraine or Belarus, who are already present on the local labor market. The immigrants may help to fill the huge gap in labor supply. However, the complicated and time-consuming institutional procedures may discourage them from looking for a job. The institutional weakness is also reflected in the extremely underestimated data on registered vacancies. PES is not fulfilling its function in the job-workers matching process. Thus, the other recommendation would be improving job placement services and increasing the cooperation between employers and PES.The present situation connected with the shock of the COVID-19 pandemic did not hit particularly severe the local labor market\u2014the registered unemployment rate in December 2020 in the Pozna\u0144 agglomeration was still very low and reached merely 2.1%. As a result, the identified issues of the spatial matching process may evolve and should be a point of interest also in the near future."}
+{"text": "Zebrafish has emerged as a powerful model in studies dealing with pigment development and pathobiology of pigment diseases. Due to its conserved pigment pattern with established genetic background, the zebrafish is used for screening of active compounds influencing melanophore, iridophore, and xanthophore development and differentiation. In our study, zebrafish embryos and larvae were used to investigate the influence of third-generation noncompetitive P-glycoprotein inhibitor, tariquidar (TQR), on pigmentation, including phenotype effects and changes in gene expression of chosen chromatophore differentiation markers. Five-day exposure to increasing TQR concentrations  resulted in a dose-dependent augmentation of the area covered with melanophores but a reduction in the area covered by iridophores. The observations were performed in three distinct regions\u2014the eye, dorsal head, and tail. Moreover, TQR enhanced melanophore renewal after depigmentation caused by 0.2 mM 1-phenyl-2-thiourea (PTU) treatment. qPCR analysis performed in 56-h post-fertilization (hpf) embryos demonstrated differential expression patterns of genes related to pigment development and differentiation. The most substantial findings include those indicating that TQR had no significant influence on leukocyte tyrosine kinase, GTP cyclohydrolase 2, tyrosinase-related protein 1, and forkhead box D3, however, markedly upregulated tyrosinase, dopachrome tautomerase and melanocyte inducing transcription factor, and downregulated purine nucleoside phosphorylase 4a. The present study suggests that TQR is an agent with multidirectional properties toward pigment cell formation and distribution in the zebrafish larvae and therefore points to the involvement of P-glycoprotein in this process. TQR is one of the P-glycoprotein  drug pump inhibitors. So far, investigations dealing with TQR have been performed in humans and mice and have revealed its clear noncompetitive inhibitory properties toward P-gp [abcb1/mdr1gene [abcb4 and abcb5, both of which are structurally similar to mammalian abcb1. These authors have also revealed that Abcb4, but not Abcb5, protein possesses functional properties similar to those of mammalian Abcb1. However, the tissue distribution of P-gp in zebrafish is still not fully recognized.During our studies on anti-epileptic properties of tariquidar   solution and euthanized by an overdose of MS-222, respectively.The study was performed on wild-type Tuebingen  embryos and larvae aged from 4 hpf to 120 hpf. Adult fish were maintained in 8l tanks at 28 \u00b0C with a 14 h light: 10 h dark photoperiod and fed three times daily ad libitum with dry food and Artemia sp. nauplii. . The males and females were kept together in tanks. Spawning was made by transferring one male and one female to breeding tanks in the evening. The eggs were collected the next morning and transferred into Petri dishes with embryo solution (E3) containing 5 mM NaCl, 0.17 mM KCl, 0.33 mM CaClTo investigate the mechanism of TQR  influence on pigmentation, three separate experiments were carried out. In all, each experimental group consisted of 15 individuals. The embryos of the control group were incubated in embryo solution (E3) with 0.1% dimethyl sulfoxide DMSO . TQR exposed embryos were assigned into three groups with increasing TQR concentration: 1 uM, 10 uM, and 50 uM. As a solvent for TQR, DMSO was used. At 20 hpf, the embryos were dechorionated with forceps. Replacement of mediums was performed daily. To evaluate how TQR impacts the pigment patterning from the moment of fertilization, the exposure was set in 6-well plates and lasted from 4 hpf until 120 hpf. The second aim was to determine the impact of TQR on pigment cell formation preceded by depigmentation by 0.2 mM PTU . For this purpose, following Choi et al. (2007) , 9-hpf e2) covered by melanophores or iridophores.Observations of pigment patterning during embryogenesis were carried out daily at 30, 48, 72, 96, and 120 hpf, while photo documentation was performed at 30, 72, and 120 hpf. PTU-exposed embryos, depending on the type of the experiment, were evaluated at 35 hpf, 65 hpf, or 120 hpf. The embryos were anesthetized with 0.02% MS-222 solution, mounted in rows of 3% agarose plate, and photographed under the stereomicroscope SteREO Discovery V8  equipped with DLT-Cam PRO 6.3 MP  camera. The effects on the pigmentation were scored using ImageJ software version 1.51j8 . The results were presented as the area (\u00b5mn = 30), frozen, and stored at \u221280 \u00b0C. Total RNA was extracted from pooled frozen embryos using a Total RNA Mini isolation kit . All steps of isolation were assessed according to the respective manufacturer\u2019s protocols. Homogenization required for RNA isolation was made using TissueLyser II . The cDNA samples were synthesized from respective high-quality matrix samples with equal RNA concentration for each sample using Maxima First Strand cDNA Synthesis Kit for RT-qPCR . All steps of reverse transcription were assessed according to the manufacturer\u2019s protocols. qPCR was performed using SYBR Green in accordance with the manufacturer\u2019s protocol  on 7500 Fast Real-Time PCR System instrument . A single PCR reaction included a 1 \u03bcL portion of the reverse transcription product. Oligonucleotide primers were designed to detect genes of chosen chromatophore differentiation markers, such as melanocyte inducing transcription factor (mitf), tyrosinase (tyr), tyrosinase-related protein 1 (tyrp1), GTP cyclohydrolase 2 (gch2), dopachrome tautomerase (dct), leukocyte tyrosine kinase (ltk), forkhead box D3 (foxd3), and purine nucleoside phosphorylase 4a (pnp4a), and two genes of zebrafish ABC transporter family\u2014abcb4 and abcb5. Initial validation of reference genes revealed that for the purpose of the study, elongation factor 1-alpha (ef1-\u03b1) showed the most efficient and equal expression among the samples. The details are listed in Ef1-\u03b1. Each sample was analyzed in triplicate in three separate experiments. The qPCR protocol was used with a 7500 Fast Real-Time PCR System instrument , according to the previously established parameters [Gene expression analysis was performed in a 56 hpf wild-type Tuebingen zebrafish strain. Immediately following the TQR exposures, the embryos of the control and each experimental group were pooled .The statistical analysis was performed using GraphPad Prism, version 5.0 . Data with Gaussian assumption were analyzed using a one-way ANOVA test with Tukey multiple comparisons tests as a post hoc test or student\u2019s t test. Data analyses not assuming Gaussian distribution were based on a Kruskal\u2013Wallis test with Dunn\u2019s multiple comparisons test as a post hoc test. The error bars represent means \u00b1 SEM. The significance level was set at 2 (2 (2) (p < 0.001) (2) (p < 0.001) (2) (p < 0.001) (2) (p < 0.001) (2) (p < 0.001) (2) (p < 0.001) (2 (2 (2) (p < 0.001) (2) (p < 0.001) (2) (p < 0.001) (2) (p < 0.01) (2) (p < 0.001) (2) (p < 0.001)  b\u2019,e and < 0.001) b,e. In 1< 0.001) c\u2019,e and < 0.001) c,e. The < 0.001) d,e and 1< 0.001) d,e compa< 0.001) . In the .001)   b\u2019,e, 2.9< 0.001) c\u2019,e and < 0.001) d\u2019,e fold < 0.01) b,e, 1.5 < 0.001) c,e and 2< 0.001) d,e fold 2 (2 (2 (p < 0.05) (2 (p < 0.05)  e,f and w < 0.05) e\u2019,f.2, within the dorsal head 359.2 \u00b1 86.64 \u00b5m2, and within the tail 2856.7 \u00b1 247.33 \u00b5m2 (2) (p < 0.01) (2) (p < 0.001) (2) (p < 0.01) (2 within the eye (p < 0.001)  (2 within the tail (p < 0.001) (p < 0.001)  b,e, 40-f< 0.001) b\u2019,e, and < 0.01) b\u201d,e. Aft< 0.001) c,e, 3.7 < 0.001) c\u2019,e, and< 0.001) c\u201d,e. In < 0.001) d,d\u2019,d\u201d,e< 0.001) d\u2019,d\u201d.tyrp and gch2 and foxd3 (p > 0.05)   (p < 0.05)   on the mRNA level of various genes encoding chromatophore differentiation markers were determined by RT-qPCR . The ana > 0.05) a,b,h. Ty05\u20130.01) c,d. Mitf > 0.05) e; howeve < 0.05) e. The mR < 0.01) g.abcb4 was not statistically significantly altered after the treatment with all studied TQR concentrations (p > 0.05)   on the mRNA level of genes encoding Abcb4 and Abcb5 were determined by RT-qPCR . The exp > 0.05) a. The an > 0.05) b.The present study provides, for the first time, clear evidence that the P-gp inhibition by TQR leads to distinct pigment pattern alteration in zebrafish. So far, many mammalian models were used to describe pigment regulatory compounds; however, recently zebrafish has emerged as a powerful and reliable model system in studies dealing with pigment development and diseases. As reviewed by Lister (2002) , before abcb5 gene in cells of melanocytic origin, such as melanocytes, RPE, and melanoma cells in human cell cultures. Interestingly, these authors have revealed that Abcb5 transcript level is relatively decreased in melanoma in comparison to normal pigment cells. Although in our study, the expression of abcb5 remained unchanged after TQR exposure, the TQR as ABC efflux pump inhibited the protein function, presumably leading to similar effects, i.e., uncontrolled expansion of melanophores. We are far from concluding that after TQR exposure we obtained melanoma phenotype, but commonly, melanoma cells and melanophores after TQR exposure exhibit uncontrolled enlargement. The analysis of the abcb4 gene in human cell cultures with cells of melanocytic origin showed its unchanged expression between cell types, which was lower than that of the abcb5 gene, suggesting that abcb5 is a pigment cell-specific marker [abcb1 orthologs, abcb4 and abcb5 [abcb5 was found in epidermal cells [As mentioned previously, in mammals, the pigment cell population consists of retinal pigment cells and melanocytes. Lower vertebrates, including fish and amphibians, possess additionally xanthophores and iridophores. In our study, we have focused on two types of zebrafish chromatophores\u2014melanophores and iridophores. Our investigations clearly revealed that TQR exposure led to hypermelanogenesis in the dermis and RPE. The involvement of ABC transporters in melanogenesis has been partially described. Chen et al.  ,32 and Hc marker . Zebrafind abcb5 . It was nd abcb5 . Interesal cells . Therefoal cells . In normal cells .tyr after TQR exposure. The product of the tyr gene is an enzyme called tyrosinase, which is located in melanocytes and is involved in the first step of melanin production. Extensive studies on tyrosinase gene expression in zebrafish embryos described the pattern of its transcription, confirming tyr activity both in RPE and neural crest-derived melanocytes [The majority of melanogenic regulatory compounds studied in zebrafish are defined as tyrosinase stimulators or inhibitors . Since Tanocytes . The preanocytes , suggestmitf gene. Mitf is able to respond to multiple signaling pathways and is responsible for helping the control of various genes involved in melanocyte development, survival, differentiation, and functioning [mitf was shown to play its key role in the direct transcriptional control of tyr, tyrp1, and dct genes, which are associated with the process of melanocyte differentiation [mitf target genes are known, among which there are genes involved in, e.g., cell cycle arrest  and survival  [tyr, tyrp1, and dct. Dct and tyr (described in more detail above) were significantly upregulated after TQR exposure, while tyrp1 expression remained unchanged. However, based on this data it is difficult to establish whether this is a direct effect of TQR exposure or mitf overexpression upshot.TQR exposure (10 and 50 \u00b5M) increased the expression of the ctioning . Initialntiation ,37. Curr, c-met) ,37. In opnp4a, which is considered as a new marker of early iridoblast development and differentiation [Shady (encoding leukocyte tyrosine kinase) mutants lack iridophores both in larvae and in adults, whereas in rose (encoding endothelin receptor b1a) or kar (encoding endothelin-converting enzyme), mutants only the adult pattern is affected [ltk gene expression, because as mentioned, this mutation alters both the larval and adult stage. Ltk remained unchanged after TQR exposure pointing to the involvement of other gene-regulating iridophore fate. In our study, we observed that both pigment cells\u2014iridophores and melanophores\u2014are altered, which suggests that melanophores and iridophores develop from a common precursor. This may also imply that their faith is regulated by one factor or there is some kind of interplay between the core gene regulatory network governing this process. We tested this hypothesis by determining the gene expression profile of foxd3, pnp4a, and the described earlier mitfa. Curran et al. [foxd3, which reappears in approximately half of bi-potent precursors at 24 hpf, resulting in repression of mitfa and activation of pnp4a [mitfa upregulation and pnp4a downregulation may arise from altered foxd3 expression. Surprisingly, foxd3 remained unchanged after TQR exposure, both at 56 hpf and 24 hpf (data not shown), indicating that TQR exposure influences mitfa and pnp4a independently, or other mechanisms are involved. Moreover, taking into consideration well-described interactions between zebrafish chromatophores (mostly studied in adult zebrafish), our data exclude the possibility of the classic influence of one cell type on the other. It has been shown that iridophores promote and sustain melanophores and that mutants lacking iridophores are also characterized by a decreased number of melanophores [Next to the observation of TQR impact on melanophores, we also found its influence on iridophores. In wild-type larvae, we observed the opposite effect after TQR exposure \u2014it stimulated the melanophores and inhibited the iridophores. Since the interaction between pigment cells was revealed to play a key role in pigment pattern formation ,39,40,41ntiation ,12, was ntiation ,42,43. Saffected ,44,45. In et al.  proposedof pnp4a . We hyponophores . Furthernophores . TherefoThe present study has demonstrated, for the first time, the influence of the third generation non-competitive P-gp inhibitor, TQR, on pigment pattern regulation in zebrafish. We have focused on the phenotype effects and supported the findings obtained with some relevant molecular analyses. The final results suggest that pigment pattern regulation by TQR is multidirectional and would imply that those processes are presumably cell lineage dependent. They also suggest that TQR should be considered as a factor playing an important regulatory role in pigment cell development or survival, and it cannot be excluded that this interesting property may have a wider biological context."}
+{"text": "Biodiversity varies in space and time, and often in response to environmental heterogeneity. Indicators in the form of local biodiversity measures\u2013such as species richness or abundance\u2013are common tools to capture this variation. The rise of readily available remote sensing data has enabled the characterization of environmental heterogeneity in a globally robust and replicable manner. Based on the assumption that differences in biodiversity measures are generally related to differences in environmental heterogeneity, these data have enabled projections and extrapolations of biodiversity in space and time. However so far little work has been done on quantitatively evaluating if and how accurately local biodiversity measures can be predicted.Here I combine estimates of biodiversity measures from terrestrial local biodiversity surveys with remotely-sensed data on environmental heterogeneity globally. I then determine through a cross-validation framework how accurately local biodiversity measures can be predicted within (\u201cpredictability\u201d) and across similar (\u201ctransferability\u201d) biodiversity surveys.I found that prediction errors can be substantial, with error magnitudes varying between different biodiversity measures, taxonomic groups, sampling techniques and types of environmental heterogeneity characterizations. And although errors associated with model predictability were in many cases relatively low, these results question\u2013particular for transferability\u2013our capability to accurately predict and project local biodiversity measures based on environmental heterogeneity. I make the case that future predictions should be evaluated based on their accuracy and inherent uncertainty, and ecological theories be tested against whether we are able to make accurate predictions from local biodiversity data. Local biodiversity on land is known to vary with environmental heterogeneity , often qe.g., a model\u2019s ability to accurately predict correlative relationships within the same spatial and/or temporal context by withholding some parts of the data , and transferability, e.g., the capacity to produce accurate predictions for conditions dissimilar to those of the data for which a model was trained by withholding data outside the range used for calibration or making use of independently collected data , rather than the predictability and transferability of this relationships  focussed on effect sizes among studies  tenionships , thus igionships  or have ionships . Quantite.g., spatial scale and sampling duration. To test this, I combine local biodiversity data from globally distributed surveys with remotely-sensed environmental predictors quantifying photosynthetic activity  predictability is generally stronger than transferability, (ii) transferability of species-environment relationships affects some biodiversity measures and taxonomic groups more than others, and that (iii) unexplained variation in the tested relationships is predominantly linked to differences in study design, activity  and specactivity ; predictactivity . The aime.g., sampling extent and date of sampling  database , which csampling . Studiessampling .j and site For each study g effort . In caseg effort . Lastly,g effort , such asg effort .e.g., NDWI  available at adequate spatial resolution, (2) consistently quantified at global extent in comparable units, (3) temporally explicit, often differing between years, (4) correlate with differences in local biodiversity  and landg., NDWI  or energg., NDWI ). A moreimputeTS\u2019 R package  from th package . Wheneve package .Second, I calculated from the remaining time series of spectral observations, as proxy of overall photosynthetic activity, the arithmetic mean of the two-band Enhanced Vegetation Index EVI, . Photosyi of a PREDICTS study j  and training (66%) datasets. For evaluating predictability, I removed one third of sites (33%) at random , but weiy for the excluded \u2018hold-out\u2019 33% sites and then calculated the average sMAPE for each study in the permutation sets.For each respective permutation set, predictability and transferability was then evaluated by using the remaining training data to estimate the regression specified above for each study or group of comparable methodology. I excluded combinations of taxonomic groups, sampling method and sampling unit for which fewer than two studies where available. In total 77.3% of all studies had a matching study of comparable methodology and unit for the same taxonomic group. A table with all recategorized combinations (43) can be found in the Lastly, I explored possible correlates of why sMAPE for some studies is larger than for others for each of the four considered biodiversity measures. I considered a series of variables commonly related to differences in sampling design, species and individual detectability and errors in remotely-sensed environmental predictors. Specifically, I calculated for each study in the permutation sets, the median sampling extent (m) as measure of sample grain, the median sampling duration (days) of the study, the number of sites with a study as measure of effort for the whole study, the average number of samples across sites as effort for area-based sampling effort or the average time sampled (hours) for time-based sampling effort, average accessibility to sites in the study (distance to nearest city in meters) from j  compared to an average R2 of 0.19 (\u00b10.284 SD) in the latter. There was considerable variation of R2 values across studies and biodiversity measures (2 = 0.246 \u00b1 0.311 SD) or spectral variability (R2 = 0.22 \u00b1 0.306 SD). Notably, correlations with species abundance were particularly low, with the R2 being close to 0 (R2 < 0.001) for more than a quarter of all studies  or different (\u2018Transferability\u2019) contexts, the main issue is how accurately such models can predict local biodiversity measures in unknown situations based on the covariates of interest . RegardlThere were also considerable differences in prediction error, as quantified by the sMAPE, among taxonomic groups. Across taxonomic groups and biodiversity measures the sMAPE was larger when predictions were extrapolated to novel contexts compared to predictability, particularly so for reptiles (\u0394sMAPE = 21.3%) and mammals (\u0394sMAPE = 20.8%), with the greatest difference being for reptile species richness (\u0394sMAPE = 33%) and abundance (\u0394sMAPE = 28%). The transferability of fungi (sMAPE = 7.5%), and bird (sMAPE = 9.1%) assemblage evenness was overall the lowest, while predictability was best for evenness and abundance of fungi (sMAPE = 5.11%) and plants (sMAPE = 9.65%). Fungi and Plants had across biodiversity measures the lowest sMAPE in predictability and transferability . OverallI also explored across studies which factors helped explain differences in prediction error, as quantified by the sMAPE . Across e.g., the ability of models to infer local biodiversity measures in known and novel contexts. Particular emphasis is placed on differences among biodiversity measures, taxonomic groups and sampling circumstances. I found that the explanatory power of biodiversity-environment was relatively low for most studies . Scale-dependent effects might only become apparent at spatial scales that go beyond the local scale. A spatial mismatch at the lower end, e.g., that the grain of the used MODIS data is too coarse to be matched to the extent of sampling in PREDICTS studies, could be another explanation, however previous studies that used very-high resolution satellite imagery (<10 m) did not find much more accurate predictions than presented here  could be more important .Click here for additional data file.10.7717/peerj.13872/supp-2Supplemental Information 2Each dot represents the centre coordinates of a study with size and colour indicating the explained variance.Click here for additional data file.10.7717/peerj.13872/supp-3Supplemental Information 3Error bars show the mean and 1 standard deviation of the regression coefficients.Click here for additional data file.10.7717/peerj.13872/supp-4Supplemental Information 4Colours and shapes as in Click here for additional data file.10.7717/peerj.13872/supp-5Supplemental Information 5Click here for additional data file.10.7717/peerj.13872/supp-6Supplemental Information 6Shows the (a) log-transformed number of sites per single study, (b) log-transformed number of samples per site in a study, (c) log-transformed average distance between sites within a study and (d) log-transformed sampling period (start to end) in days.Click here for additional data file.10.7717/peerj.13872/supp-7Supplemental Information 7Taxonomic group indicates the broad taxonomic group used for grouping studies, Sampling method groups together the type of surveying method applied in a study and sampling unit indicates whether effort was measured as number of plots, area covered or time sampled. The concatenation of all columns returns a methodology specific grouping that is used to construct permutations and models.Click here for additional data file."}
+{"text": "However, continued dosing of WTD for 28\u00a0days reversed 13 abnormal metabolites, which may be an important therapeutic mechanism from a metabolomic perspective. Importantly, 12 prototypical components and 16 metabolites from WTD were characterized in RA rat serum. The results of Pearson correlation analysis showed that aconitine, L-ephedrine, L-methylephedrine, quercetin, albiflorin, paeoniflorigenone, astragaline A, astragaloside II, glycyrrhetic acid, glycyrrhizic acid, licurazide, and isoliquiritigenin are the key pharmacological components that regulate the metabolism of RA rats, and they are identified as Q-markers. In sum, utilizing metabolomics and serum pharmacochemistry of traditional Chinese medicine, the metabolic mechanisms and Q-markers of WTD therapy in RA rats were revealed, providing a theoretical basis for the quality control investigation of WTD.Wutou decoction (WTD) is a traditional Chinese medicine prescription for the treatment of rheumatoid arthritis (RA), and this study systematically analyzed the metabolic mechanism and key pharmacodynamic components of WTD in RA rats by combining untargeted metabolomics and serum pharmacochemistry of traditional Chinese medicine to enrich the evidence of WTD quality markers (Q-markers) studies. WTD prevented synovial edema in RA rats and reduced tumor necrosis factor-alpha and interleukin 6 levels in rat serum, according to the results of an enzyme-linked immunosorbent examination and histopathological inspection. In model rats, pattern recognition and multivariate statistical analysis revealed 24 aberrant metabolites that disrupted linoleic acid metabolism, arachidonic acid metabolism, arginine and proline metabolism,  In general, ideal herbal medicines and prescriptions need to have five characteristics: Chinmedomics comprehensively blends metabolomics and serum pharmacochemistry of TCM and serves as a way for the discovery of Q-markers for herbal medicines and formulations . In shorShang Han Lun\u201d of Zhang Zhongjing in the Han Dynasty and consisting of Aconitum carmichaeli Debeaux [Ranunculaceae], Ephedra sinica Stapf [Ephedraceae], Paeonia lactiflora Pall. [Ranunculaceae], Astragalus mongholicus Bunge [Leguminosae], and Glycyrrhiza uralensis Fisch. [Leguminosae] with a mass ratio of 10\u00a0g: 15\u00a0g: 15\u00a0g: 15\u00a0g: 15\u00a0g. Pharmacological studies have shown WTD analgesic and anti-inflammatory effects (Wutou decoction (WTD) is a classic prescription for treatment rheumatology, derived from \u201c effects . Besides effects . To enha effects .HPLC grade methanol and acetonitrile were purchased from Thermo Fisher Scientific , analytical grade formic acid, leucine enkephalin, and Freund\u2019s complete adjuvant were purchased from Sigma-Aldrich , ultrapure water purchased from Watsons , the kit of tumor necrosis factor-alpha (TNF-\u03b1) and interleukin-6 (IL-6) purchased from Jiancheng Biologics , the five botanical drugs that compose WTD were purchased from Tongrentang Pharmacy  and were authenticated by Xijun Wang from the Department of Pharmacognosy of Heilongjiang University of Chinese Medicine.Aconitum carmichaeli Debeaux [Ranunculaceae], Ephedra sinica Stapf [Ephedraceae], Paeonia lactiflora Pall. [Ranunculaceae], Astragalus mongholicus Bunge [Leguminosae], and Glycyrrhiza uralensis Fisch. [Leguminosae] cut into small round pieces according to the mass ratio 2: 3: 3: 3: 3 and were immersed in distilled water (eight-fold volume) for 1\u00a0h and then boiled for 1.5\u00a0h. The extracted solutions were filtered through eight layers of gauze, and the filter residue was boiled with distilled water (eight-fold volume) again for another 1\u00a0h. Finally, the two parts of the filtrates were combined, and the decoction was transformed into powder by freeze-drying. The frozen powder was dissolved with distilled water and kept at 4\u00b0C until use.The crude n = 8): control group (C); model group (M), and WTD treatment group (T). The M and T rats were injected with 0.1\u00a0ml of Freund\u2019s complete adjuvant at a concentration of 2.0\u00a0mg.ml\u22121 at the base of the tail, and the C rats were injected with the same volume of normal saline  under controlled environmental conditions  with unlimited access to food and water. After 7\u00a0days of acclimatization, all animals were randomly divided into the following three groups , serum centrifugation for 15\u00a0min . Urine samples were diluted 10 times with ultrapure water, serum samples were precipitated with four times the volume of methanol and the supernatant was taken. All samples were filtered through a 0.22\u00a0\u03bcm filter before injection into the ultra-performance liquid chromatography quadrupole time of flight coupled with mass spectrometry (UPLC-Q/TOF-MS) instrument. Separately, 100\u00a0\u03bcl of urine and serum were obtained from each animal for the preparation of quality control samples in examining and optimizing the metabolomics analysis parameters.Throughout the experimental period, 12\u00a0h urine from 8 p.m. to 8 a.m. the next day was collected in the metabolic cage, and the blood samples were obtained by the final stage of administration: fresh urine centrifugation for 15\u00a0min . The HSS T3 column  separates urine samples, whereas the BEH C18 column  separates serum samples. The column temperature is 35\u00b0C. The gradient mobile phase consisted of solvent A (0.1% FA-H2O) and solvent B (0.1% FA-ACN). Optimized urine gradient elution status: 0\u20134.5\u00a0min, 1\u201321 A%; 4.5\u20137\u00a0min, 21\u201340% A; 7\u20137.5\u00a0min, 40\u201350% A; 7.5\u20139.5\u00a0min, 50\u201399% A. Optimized serum gradient elution status: 0\u20131.2\u00a0min, 1\u201339% A; 1.2\u20134.3\u00a0min, 39\u201368% A; 4.3\u20134.5\u00a0min, 68\u201371% A; 4.5\u20137.0\u00a0min, 71\u201378% A; 7.0\u20138.2\u00a0min, 78\u201390% A; 8.2\u20139.5\u00a0min, 90\u201399% A. The injection volume is 4\u00a0\u03bcl and the flow rate is 0.5\u00a0ml.min\u22121 in both modes.The metabolomic analysis was performed using an ACQUITY UPLC+) is 3.0\u00a0kV; in the negative ion mode (ESI\u2212), it is 2.7\u00a0kV. The cone voltage is 20\u00a0V, and the gas flow rate is 50\u00a0L.h\u22121. Dry nitrogen is desolventizing at a flow rate of 800\u00a0L.h\u22121 and a temperature of 350\u00b0C. Use the full scan mode of m/z 50\u20131200\u00a0Da to collect MS data. Leucine enkephalin with a concentration of 1\u00a0ng/\u03bcl and a flow rate of 10\u00a0\u03bcl.min\u22121 in ESI+ [M+H]+ = 556.2771 and ESI\u2212 [M-H]\u2212 = 554.2615 was used as a reference compound to obtain an accurate mass.The Waters G2-Si mass spectrometer system (Waters Corp.) is equipped with an electrospray ion source to detect all metabolites, and the ion source temperature is 110\u00b0C. The capillary voltage in the positive ion mode (ESI\u22121), filtered with a 0.22\u00a0\u03bcm filter membrane, and injected into UPLC-MS for analysis chemical profile of WTD. The serum containing components of WTD was added with a quarter volume of 20% phosphoric acid, utilizing an OASIS MCX solid-phase extraction column  to enrich the WTD components in vivo, dissolved in methanol for UPLC-MS data collection. Injection volume is 2\u00a0\u03bcl, the gradient mobile phase consisted of solvent A (0.1% FA-H2O) and solvent B (0.1% FA-ACN), optimized gradient elution conditions: 0\u20133.0\u00a0min, 1\u201310% A; 3.0\u20137.0\u00a0min, 10\u201312% A; 12.0\u201320.0\u00a0min, 20\u201340% A; 20.0\u201322.0\u00a0min, 40\u2013100% A. The MSE data scanning mode of UPLC-Q/TOF-MS was combined with powerful UNIFI software (Waters Corp.) for efficient and accurate characterization of the chemical profile of the WTD and the components absorbed in vivo. The adduct ion is [M+H]+ in ESI+ and [M-H]- in ESI\u2212, respectively. To reduce false positives, select the embedded TCM database and set the tolerance error of components and fragments to 5\u00a0mDa. The study compared the serum between the M and the T and preferred the results of the high response value only in the serum of the T.After lyophilized powder of WTD decoction was dissolved in ultrapure water and was centrifuged 15\u00a0min  and MassBank (http://www.massbank.jp/) databases identifies metabolites, VIP >1, and metabolites normalized abundance with intergroup significance are considered potential biomarkers of RA rats. Comparisons between the two groups of the quantitative data were completed using Graphpad software  independent t-test and presented as mean \u00b1 standard deviation, with p < 0.05 indicating significant differences and p < 0.01 indicating extremely significant differences.The raw data is imported into Progenesis QI software (Waters Corp.) for noise reduction, peak alignment, and normalization to get an information matrix that includes m/z, retention time, and peak relative intensity. The EZinfo software (Waters Corp.) performs a principal component analysis (PCA) and judges differences between groups. Orthogonal partial least squares discriminant analysis (OPLS-DA) calculates variable importance in projection value (VIP), a statistical normalization abundance of different ions. Finally, MS/MS information combined with HMDB (The PCMS (plotting of correlation between marker metabolites and serum components) patented software calculates the correlation coefficient between the components absorbed into the blood of WTD and the potential biomarkers of RA rats to determine which component is most likely to have a therapeutic effect. Normalize the abundance of biomarkers and components, and then use Pearson\u2019s statistical correlation to set the reference standard for the correlation coefficient R. In this study, 0.7 \u2264\u2502R\u2502<0.8 is selected as the highly correlated component; 0.8 \u2264\u2502R\u2502\u2264 1 is regarded as extremely correlated, and extremely correlated components are regarded as Q-markers.Compared with the C rats, 14\u00a0days after the injection of Freund\u2019s complete adjuvant, the rats in the M reached the uttermost state of inflammation. Compared with the M, the T significantly inhibited the levels of IL-6 and TNF-\u03b1 in rats and reduced the swelling of the feet .+ and ESI\u2212 and these are reflected in PCA  = 0.994, Q2(cum) = 0.615 in ESI\u2212) and serum model (R2Y (cum) = 0.858, Q2(cum) = 0.798 in ESI+, and R2Y (cum) = 0.872, Q2(cum) = 0.795 in ESI\u2212) indicated that the statistic model has good quality and predictability.Multivariate statistical analysis was performed on the metabolic fingerprint information collected from serum and urine at the end of the experiment. There are differences in serum total ion chromatograms (TIC) in C, M, and T rats in ESId in PCA . Similard in PCA . The OPLp < 0.05). Secondly, chromatographic peak extraction and elemental composition analysis showed that the tolerance of C20H32O2 was accepted, while m/z 304 and m/z 279 were simultaneously observed in MS extraction at 8.09\u00a0min. Finally, it was identified that m/z 304\u00a0Da is the parent ion of arachidonic acid, and the fragments of 303[M-H]\u2212 and 279[M-COOH]- were generated by high-energy bombardment in ESI\u2212 (Take arachidonic acid as an example to illustrate the identification process of potential biomarkers. First, OPLS-DA calculated that the VIP of 8.09_303.2320m/z was 4.004 and the normalized abundance of this ion in the serum of the C and the M was different ( in ESI\u2212 . Eventua in ESI\u2212 .The above 24 potential biomarkers of serum and urine are mostly engaged in 17 metabolic pathways, which belong to lipid metabolism, carbohydrate metabolism, and amino acid metabolism . Where t+ and ESI\u2212 (E data collected in the continuum mode. Both ion response values between groups and all m/z information at 14.12\u00a0min were obtained, and m/z 646.32\u00a0Da with a high response value in WTD samples was scanned for small molecule ions. After elemental composition and fragment matching, m/z 646.32\u00a0Da was recognized as the hydrogenation ion of aconitine and identified to 586.30\u00a0Da [M+H-C2H4O2]+, 568.29\u00a0Da [M+H-C2H6O3]+, 554.27\u00a0Da [M+H-C3H8O3]+ (The UPLC-Q/TOF-MS collects the TIC of WTD before and after entering the blood in ESIand ESI\u2212 . The UNIC3H8O3]+ . FinallyC3H8O3]+ . ImportaC3H8O3]+ .Aconitum carmichaeli Debeaux [Ranunculaceae], L-ephedrine, L-methylephedrine, quercetin, and kaempferol-3-O-rhamnoside were from Ephedra sinica Stapf [Ephedraceae], albiflorin and paeoniflorigenone were from Paeonia lactiflora Pall. [Ranunculaceae], astragaline A, and astragaloside II were from Astragalus mongholicus Bunge [Leguminosae], glycyrrhetic acid, glycyrrhizic acid, licurazide, and isoliquiritigenin came from Glycyrrhiza uralensis Fisch. [Leguminosae].PCMS software was utilized in this investigation to uncover the important pharmacodynamic components of WTD in the treatment of RA rats, as well as biological activity tracking and literature analysis to identify Q-markers. The findings revealed that 19 of the WTD components were absorbed into the serum. According to correlation analysis, 12 components were confirmed as Q-markers , of whicRA is an autoimmune disease that primarily affects synovial joints and is characterized by chronic synovitis, systemic inflammation, and varying degrees of erosion of bone and cartilage. While the cause of RA is unknown, it involves a combination of genetic and environmental factors, potential mechanisms involving the body\u2019s immune system attacking joints, and researchers have focused on exploring the immune mechanisms and molecular networks of RA . Nonstervia L-palmitoylcarnitine, and high levels of L-palmitoylcarnitine may be detrimental to energy metabolism in mitochondria (via the downstream enzyme 5.3.1.22 (Studies indicate metabolic disorders in biofluids in RA patients or animal models, covering lipid and glucose metabolism, and amino acid metabolism . Untargechondria . Both RAchondria . Accordi5.3.1.22 . UnfortuAconitum carmichaeli Debeaux [Ranunculaceae], has immunomodulatory properties that might be useful in treating autoimmune diseases, such as rheumatoid arthritis and systemic lupus erythematosus (To discover the Q-markers of WTD, this study employed a chinmedomics strategy to analyze the correlation between the components absorbed into the blood of WTD and the potential biomarkers of RA rats, highlighting the importance of certain components in regulating RA metabolism and markers. Finally, 12 key components were determined as Q-markers for the efficacy of WTD in the treatment of RA. Aconitine, the main active component of ematosus . Ephedriematosus . Quercetematosus , and queematosus . Albifloematosus . Astragaematosus . Moreoveematosus . With thTo summarize, this work used chinmedomics to evaluate the therapeutic effect of WTD on adjuvant-induced arthritic rats and to investigate the Q-markers of WTD. WTD helps alleviate disease states and pathological conditions in inflammatory rats, and chinmedomics as a research tool for TCM effectiveness and pharmacology promotes the discovery of WTD Q-markers and contributes to the theoretical evidence for WTD quality control."}
+{"text": "There are several well-known treatments for Restless Legs Syndrome (RLS), including dopamine agonists , anticonvulsants , oral or intravenous iron, opioids and benzodiazepines. However, in clinical practice, treatment is sometimes limited due to incomplete response or side effects and it is necessary to be aware of other treatment options for RLS, which is the purpose of this review.We performed a narrative review detailing all of the lesser known pharmacological treatment literature on RLS. The review purposefully excludes well-established, well-known treatments for RLS which are widely accepted as treatments for RLS in evidence-based reviews. We also have emphasized the pathogenetic implications for RLS of the successful use of these lesser known agents.Alternative pharmacological agents include clonidine which reduces adrenergic transmission, adenosinergic agents such as dipyridamole, glutamate AMPA receptor blocking agents such as perampanel, glutamate NMDA receptor blocking agents such as amantadine and ketamine, various anticonvulsants , anti-inflammatory agents such as steroids, as well as cannabis. Bupropion is also a good choice for the treatment of co-existent depression in RLS because of its pro-dopaminergic properties.Clinicians should first follow evidence-based review recommendations for the treatment of RLS but when the clinical response is either incomplete or side effects are intolerable other options can be considered. We neither recommend nor discourage the use of these options, but leave it up to the clinician to make their own choices based upon the benefit and side effect profiles of each medication. Restless Legs Syndrome (RLS) is a sensorimotor disorder that is most classically described as unpleasant sensations in the lower extremities and a resultant uncomfortable urge to move them, worsened by inactivity and nighttime, while relieved by movement . Despite21234567However, in clinical practice, treatment is sometimes limited due to incomplete response or side effects; accordingly, it is necessary for clinicians and researchers to be aware of other lesser known treatment modalities for RLS. The purpose of this review, therefore, is to synthesize the existing evidence regarding alternative pharmacological treatment for RLS symptom management. Indeed, currently accepted first-line pharmacological treatment modalities for RLS, particularly dopamine agonists, have significant associated side effects and costs , which c10212This is not an evidence-based review as by its very nature it is focusing on determining which alternative treatments exist for RLS patients. In these cases, the evidence for use does not approach the standard for wider endorsement, but does indicate some support from the literature for the use of these agents. Such treatments might be considered for isolated refractory cases when patients have failed multiple lines of standard treatment strategies. We do not aim to evaluate the quality of the publications cited as most systematic reviews do. The vast majority of the medications reviewed here do not have large sample sizes, double blinding, randomization, or other metrics of study rigor and quality. This article is meant, therefore, as a compilation reference for clinicians to consider alternative and adjunct treatment medications for refractory and/or severe cases of RLS. We have indicated which studies are open-label and which studies have double-blind comparison data. Where pathogenetic implications can be drawn from treatment studies, we have included that information as well. To our knowledge, this is the first scoping review of this kind on the treatment of RLS.We reviewed all of the traditional Western treatment literature on RLS but did not include the more well-known treatments for RLS which have been extensively reviewed elsewhere and that are widely accepted as treatments for RLS in evidence-based reviews 2345678. 2345671234567We also did not include non-pharmacologic, herbal preparations, vitamins, or minerals for the treatment of RLS which also have been reviewed elsewhere . Furtherrd, 2023 using the search term phrase, \u201cRestless Legs Syndrome AND treatment.\u201d After we found relevant articles, we then did another search where the name of the medication reported in the relevant articles was substituted in the phrase above as a way of capturing any relevant articles that may have been missed by the first search. We also supplemented our search with articles cited in the reference lists of articles picked up from our original literature search, when these secondary articles had not been picked up by the methodology above.We searched the PubMed online database up to January 23One major caveat to our search is that earlier studies may have employed objective evidence for therapeutic effects such as polysomnography and actigraphy or ad-hoc scales to rate RLS severity. Prior to 2003 studies did not have the advantage of employing a validated rating scale of symptoms such as the International Restless Legs Syndrome Study Group\u2019s Symptom Rating Scale , a 10-question survey graded on a 4-point Likert scale where symptom severity score ranges from 1 (mild RLS) to 40 (very severe RLS) . AnotherUp to 2023, we found 47 studies published fulfilling our inclusion criteria .There were 9 single case reports. There were 11 case series. There was one survey study. There were 14 open-label studies without parallel or crossover groups. There were 8 double-blind cross-over studies of which 6 were randomized. There were 4 double-blind parallel studies of which 3 were randomized.For three studies 1920 we c19The results are summarized in the text and the table. In the We used a variable way of grouping of the medications that we review. In some cases medications are grouped by the neurotransmitter that they affect, particularly when these neurotransmitters play a potential pathogenetic role in RLS. In other cases they are grouped by their general therapeutic effect, e.g., anticonvulsants, when the mechanism of action does not involve a neurotransmitter.th study reporting no benefit [191234568Most of the experimental literature on clonidine for use in RLS was accrued in the late 1980\u2019s up to the mid 1990\u2019s 192123242526.2324252122 19123456827. Clon191234568. The pos191234568 are compThe first double-blind study of clonidine for RLS was in patients with chronic kidney insufficiency . ClonidiBrain iron deficiency is thought to be almost universal in human RLS. The interest in the therapeutic use of dipyridamole developed in concert with basic science animal experiments, which suggested that RLS in the presence of brain iron deficiency is characterized by a hypoadenosinergic state 32. Dipyr3135As aforementioned, based on animal experiments, brain iron deficiency in RLS is thought to cause a hypoadenosinergic state 32. In th3138394041Perampanel is an anticonvulsant the major effect of which is to block AMPA receptors . In a prAmantadine is an NMDA receptor antagonist and was developed first as an antiviral agent and secondarily as an adjunctive treatment for Parkinson\u2019s Disease because of its pro-dopaminergic properties . In an oKetamine is another NMDA receptor antagonist which is used as an adjunct to anesthesia induction . In a ca42A variety of anticonvulsants with a variety of different mechanisms have been found to be useful in RLS management.Carbamazepine and oxcarbazepine are the two medications that are the best studied of the anticonvulsants covered in this review in regard to RLS 454647. O4546In the second double-blind trial of carbamazepine in RLS, 174 patients were entered in a parallel design into the study of which 84 received carbamazepine and 90 received a placebo . CarbamaIn a case report, oxcarbazepine 150 mg bid was found to cause remission in RLS symptoms in a 36-year-old male where the RLS was thought to be induced by paroxetine taken for the obsessive-compulsive disorder . In this48There are 2 reports in the literature on the successful use of lamotrigine in the treatment of RLS 51. In th51Nineteen patients in an open-label study of topiramate showed improvement in RLS symptoms  at a mean dosage of 42.1 mg (p < 0.05) . On the 53Valproic acid was originally investigated as a treatment for PLMS  and subsIn a case-report study of two patients who had experienced augmentation with pramipexole after an initial improvement, treatment with levetiracetam brought patients back to the level of improvement they had experienced in RLS symptoms with pramipexole prior to augmentation  . This imRLS can be triggered de novo by infections and RLS is also characterized by the elevation of inflammatory and hypoxic markers . In addi636465The positive response to cannabinoids in the following two case reports 68 suggesBupropion is often chosen as an antidepressant for RLS patients with concomitant depression as it has pro-dopaminergic properties and does not exacerbate RLS . There i71717274Baclofen is a muscle relaxant that was originally noted to improve PLMS in 5 patients . However78Physostigmine is an anticholinesterase inhibitor. Under the right circumstances, it can be administered intra-operatively or intra-procedurally. Two separate case reports of one RLS patient each demonstrated relief with the injection of 1 mg intravenous (iv) of physostigmine  82. Side 81Orphenadrine citrate is a muscle relaxant. In a study of 32 patients, where there was not a clearly separated mixture of patients with RLS and leg cramps, orphenadrine citrate 100 mg\u2013200 mg/day in 1 or 2 divided doses in the evening was administered to the subjects for from 3 months to 1 year . Twelve An association of RLS to small intestinal bacterial overgrowth (SIBO) has been established 86. SIBO In the second open-label study by the same authors, the IRLS was employed as an endpoint . Twenty-86For Botox and RLS or Botulinum toxin and RLS our search yielded 7 publications. The use of botulinum toxin  in RLS ranged from 25\u2013320 units administered to different sites for the treatment of refractory RLS. . One of In summary, there is no standard protocol for the administration of BTX in patients with RLS. Dosage varies among studies from 50 U to 100 U per leg to 500\u20131000 U per patient. Current studies in a small number of patients have failed to produce robust evidence in favor of the use of BTX in RLS which may be influenced by the limited number of patients, the dose, or the technique used. Furthermore, case reports or studies without controls make it harder to rule out placebo effects. Patients must be observed for temporary excess weakness .Although selegiline increases dopamine levels, it does it by a different mechanism than dopamine receptor agonism. It has not been studied well enough to be considered a mainstay of therapy for RLS or PLMS. Selegiline is a monoamine oxidase (MAO) inhibitor type B and it also interferes with dopamine reuptake at the synapse. In an open-label study of selegiline in 31 patients with PLMS where RLS was excluded, patients were slowly titrated from 5 mg to 10mg to finally 15 mg of selegiline bid in two-week intervals . PLMS weIt is well known that selective serotonin re-uptake inhibitors such as paroxetine which increase the synaptic concentration of serotonin also worsen RLS 4670. Thi46RLS is also worsened by first-generation H1 receptor-blocking antihistamines . In addi102103Eighteen patients with RLS and a matched control group were studied with proton magnetic resonance spectroscopy and actigraphy . Levels There are some limitations to our study. We have performed a scoping review based on one search engine, PubMed. We did not apply any grading of evidence, because those studies with high level of evidence and that are standard care of treatment were not considered for our review per our exclusion criteria. Therefore, the remaining articles which we reviewed are potentially all of a lower level of evidence.We have reviewed medications that are lesser known as treatments for RLS. This is not an evidence-based review because the supportive data for these lesser proven, and thus lesser known treatments is, by definition, low. We would emphasize that clinicians should first turn to more well-proven treatments for RLS including the alpha delta calcium channel anticonvulsants gabapentin and pregabalin, the dopamine agonists pramipexole, ropinirole and rotigotine, the opioids in refractory cases and to oral and intravenous iron 2345678. 234567Among the agents, that we have reviewed are clonidine which causes a reduction in adrenergic transmission, adenosinergic agents such as dipyridamole, glutamate AMPA receptor blocking agents such as perampanel, glutamate NMDA receptor blocking agents such as amantadine and ketamine, various anticonvulsants , anti-inflammatory agents such as steroids, as well as cannabis. Bupropion is a good choice for the treatment of co-existent depression in RLS because of its pro-dopaminergic properties. We would emphasize that we have only reviewed medications and not non-pharmacologic, herbal preparations, vitamins, minerals, compression, electrical stimulation, or vibration devices that have been reviewed elsewhere and may provide additional therapeutic options 16."}
+{"text": "Sorghum bicolor L.) and other cereals, serving as the main energy supplier for both plants and animals, as well as important industrial raw materials of human beings, and was intensively concerned world widely. However, few documents focused on the pathway and transcriptional regulations of starch biosynthesis in sorghum. Here we presented the RNA-sequencing profiles of 20 sorghum tissues at different developmental stages to dissect key genes associated with sorghum starch biosynthesis and potential transcriptional regulations. A total of 1,708 highly expressed genes were detected, namely, 416 in grains, 736 in inflorescence, 73 in the stalk, 215 in the root, and 268 genes in the leaf. Besides, 27 genes encoded key enzymes associated with starch biosynthesis in sorghum were identified, namely, six for ADP-glucose pyrophosphorylase (AGPase), 10 for starch synthases (SSs), four for both starch-branching enzymes (SBE) and starch-debranching enzymes (DBEs), two for starch phosphorylases (SPs), and one for Brittle-1 (BT1). In addition, 65 transcription factors (TFs) that are highly expressed in endosperm were detected to co-express with 16 out of 27 genes, and 90 cis-elements were possessed by all 27 identified genes. Four NAC TFs were cloned, and the further assay results showed that three of them could in vitro bind to the CACGCAA motif within the promoters of SbBt1 and SbGBSSI, two key genes associated with starch biosynthesis in sorghum, functioning in similar ways that reported in other cereals. These results confirmed that sorghum starch biosynthesis might share the same or similar transcriptional regulations documented in other cereals, and provided informative references for further regulatory mechanism dissection of TFs involved in starch biosynthesis in sorghum.Starch presents as the major component of grain endosperm of sorghum ( AGPase granules .bt1 tended to result in the accumulation of ADPG in the cytoplasm, the decrease of starch content, and the limitation of grain development  is responsible for the transmembrane transportation of ADPG , 1998, aelopment . Starch elopment . It was elopment . Besides as well .OsYB1  and gene expression analysis, the root, stem, leaf, leaf vein, leaf sheath, seeds, and endosperm were obtained at seedling, jointing, heading, and maturity stage. All the tissues/samples were immediately frozen in liquid nitrogen and then stored at \u221280\u00b0C. Three biological replicates were taken for each sample.\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae  was used to generate libraries, and purified libraries were sequenced on an Illumina NovaSeq platform . Clean reads were obtained by removing reads containing adapter, reads containing ploy-N and low-quality reads from raw data, and aligned to the reference genome using Hisat2 v2.0.5. FeatureCounts v1.5.0-p3 was used to count the reads numbers mapped to each gene. Fragments Per Kilobase of transcript sequence per Millions (FPKM) were used for estimating gene expression levels. Differential expression analysis of two conditions was performed using the edgeR R package (3.18.1). The P-values were adjusted using the Benjamini and Hochberg method and a corrected P-value of 0.05 and absolute foldchange of 2 were set as the threshold for significantly differential expression.All prepared sorghum tissues were collected and used for RNA isolation with TRIzol regent  according to the manufacturer\u2019s instructions. NEBNextArabidopsis thaliana, and maize (Zea mays L.)  . BLASTP ectively . MEME4 wtigation . The minvia MEGA 5.10, and the neighbor-joining (NJ) method was used with a p-distance model, and the bootstrap replicates were set to 1,000  was used as the internal control. All reactions were performed via the Bio-Rad CFX96 real-time system, and the relative transcription levels were calculated via the method of 2\u2013\u0394\u0394CT based on the expression of SbEif4\u03b1  and first-strand cDNA were synthesized from 1.5 \u03bcg total RNA using the PrimeScript\u2122 RT reagent kit with gDNA Eraser  according to the manufacturer\u2019s instructions. All the primers used for the qRT-PCR analysis are shown in  SbEif4\u03b1 .The co-expression profiling was performed according to via PCR reaction system of 20 \u03bcL with KOD DNA polymerase . The PCR products were purified with Gel Extraction Kit D2500 , and subsequently cloned into the pMD19-T vector  for sequencing. All primers of cloned genes are shown in DNA from leaf samples of BTx623 was isolated by the cetyltrimethylammonium bromide (CTAB) method for promoter cloning. The mixed cDNA of different sorghum tissues was used as the templates for gene cloning. The promoters of starch biosynthesis-related genes and TFs were amplified BamHI and XbaI sites without the termination codon, and the PCR products were then subcloned into pCAMBIA2300-35S-eGFP to form the fusion protein of regulatory factor and enhanced green fluorescent protein (eGFP). All these vectors were constructed via ClonExpress\u00ae MultiS One Step Cloning Kit .Vector of pCAMBIA2300-35S-eGFP was used for the sub-cellular localization analysis. The regulators were amplified with the primers  containi2+ (The pCAMBIA2300-35S-CTF-eGFP was transformed into protoplast through the method of PEG-Ca2+ . The subcis-acting regulatory elements (cis-elements) were predicted among the sequences of putative promoter regions using the PlantCARE  of sorghum starch biosynthesis-related genes was extracted from reference genome sequences through the Gramene database (See text footnote 1). The lantCARE .SbBt1 (1956 bp) and SbGBSSI (1902 bp) was subcloned into the pGreenII0800-LUC vector and drove Luciferase (Luc) expression. The full coding sequence of candidate TFs (CTF) was amplified and integrated into the pBI221 carrier and constructed the vector of TF expression driven by the Ubi promoter. The pUbi-CTF:pGreenII0800-Pro-Luc (1:2) was set as the experimental group, and pUbi-Gus: pGreenII0800-Pro-Luc (1:2) as the control group. All the constructs were transformed into the maize protoplast according to via the dual-luciferase assay kit  and analyzed via GloMax_2020 . LUC/REN ratio was calculated to measure the relationship between experimental and control groups. Four independent experiments were performed and each independent experiment consisted of three replicates. The difference with SbCTF on the promoter activity of starch biosynthesis-related genes was tested by t-test.The pGreenII0800-LUC double-reporter vector and pBI221 were used to detect the relationship between promoter activity and regulatory factors. The promoter of 6 was used for the prokaryotic expression of sorghum NAC-type-His fusion protein. All primers with BamHI and HindIII sites used to insert NAC-type TFs are shown in E. coli strain of BL21 was used as host cells for prokaryotic expression. When the OD600 value of the bacterial cultures reached 0.6, isopropyl \u03b2-D-1-thiogalactopyranoside (IPTG), at a final concentration of 0.5 mmol L\u20131, was added to induce the expression of fusion protein. Cells were broken ultrasonically under 120 W for 20 min after overnight incubation at 16\u00b0C in a shaker at 100 rpm. The Ni-Agarose His label Kit 7 was used to purify the recombinant proteins according to the manufacturer\u2019s instructions.Prokaryotic expression vector of pET32a (YouBio)Arabidopsis NAC TF to bind and respond to stress induction  . For allA total of 37,031 genes containing transcripts were detected across all 20 samples, namely, 34,118 (92.13%) original transcripts, 1,464 (3.95%) newly identified genes, and 1,449 (3.91%) small nuclear RNAs and small cytoplasmic RNAs . Among tArabidopsis , 10 for starch synthase (SS), four for both starch-branching enzyme (SBE) and starch-debranching enzyme (DBE), two for starch phosphorylase (SP), and one for Brittle-1 (BT1) protein . These gbidopsis .All the coding enzymes possessed peptide-chain lengths of 435 aa to 1,684 aa, with the molecular weight ranging from 46.83 kD to 190.02 kD, and pI varied from 5.01 to 9.33 . Conservvia MEME revealed that a total of 10 motifs (motifs 1 to 10) were possessed by the starch biosynthesis enzymes of sorghum (Sb), Arabidopsis (At), and maize (Zm). Each ortholog of AGPase and SP from Sb, At, and Zm presented all the 10 motifs that formed the corresponding conserved domain of NTP_transferase and Phosphorylase, while the other orthologs of these three species covered five to 10 motifs , 2 , and 3 (SbSSIIa)  . Based oSbSSIIa) . The resin vitro .SbBt1 and SbGBSSI could be directly activated by sorghum NAC-type transcription factor. After the confusion of promoters and guiding genes, the assays showed that promoters of SbBt1 and SbGBSSI could drive the expression of Luc and improve the enzyme activity  reporter assay was performed to detect whether the promoters of activity . For SbG2, SbBt1 .Starch is an important storage component in the grains of cereal crops and the main energy source for humans and animals. The biosynthetic pathway of starch in the endosperm is highly conserved in cereals . Functiocis-elements, the discovery of transcriptional regulatory factors, and the dissection of regulatory mechanism  to form starch panicles in both monocot and dicot plants, while another protein, i.e., BT1 then functions as the transporter of ADP-Glc into amyloplast for the catalyzing of GBSSI . In maizto ZmBT1 . Besidesin maize . Additioin wheat , and difis study , implyinAt present, the TFs involved in starch biosynthesis were mainly concentrated in TF families of bZIP, i.e., OsbZIP58/RISBZ1 , Opaque2osnac20/26 double mutant  BioProject, QX, TH, WC, KM, TL, FX, QM, HD, and ML performed the experiments. QX, TH, and ZL drafted the manuscript. QX and TH analyzed the data. QX, XN, and ZL provided ideas, designed the research, and edited the manuscript. All authors contributed to the article and approved the submitted version."}
+{"text": "F1_score has increased by 2.4% and 2.5% on the CoNSeP and PanNuke datasets, respectively. Therefore, the proposed multiattention-based TSHVNet is of great potential in simultaneous nuclear instance segmentation and classification.Accurate nuclear instance segmentation and classification in histopathologic images are the foundation of cancer diagnosis and prognosis. Several challenges are restricting the development of accurate simultaneous nuclear instance segmentation and classification. Firstly, the visual appearances of different category nuclei could be similar, making it difficult to distinguish different types of nuclei. Secondly, it is thorny to separate highly clustering nuclear instances. Thirdly, rare current studies have considered the global dependencies among diverse nuclear instances. In this article, we propose a novel deep learning framework named TSHVNet which integrates multiattention modules  into the state-of-the-art HoVer-Net for the sake of a more accurate nuclear instance segmentation and classification. Specifically, the Transformer attention module is employed on the trunk of the HoVer-Net to model the long-distance relationships of diverse nuclear instances. The SimAM attention modules are deployed on both the trunk and branches to apply the 3D channel and spatial attention to assign neurons with appropriate weights. Finally, we validate the proposed method on two public datasets: PanNuke and CoNSeP. The comparison results have shown the outstanding performance of the proposed TSHVNet network among the state-of-art methods. Particularly, as compared to the original HoVer-Net, the performance of nuclear instance segmentation evaluated by the PQ index has shown 1.4% and 2.8% increases on the CoNSeP and PanNuke datasets, respectively, and the performance of nuclear classification measured by  Precise nuclear instance segmentation and classification are the essential foundation for histopathological image analysis, including nuclear morphology characteristics, counts of specific nuclei, and nuclear distribution, which would significantly impact the predictive results of cancer diagnosis and prognosis . HoweverRegarding nuclear instance segmentation, varied shapes, colors, and sizes of nuclei would make it difficult to segment all the nuclear instances in the same rule . MoreoveIn recent years, due to the availability of big data and the significant improvement of computing power, deep convolutional neural networks have developed rapidly and achieved amazing results in various medical image analysis tasks . RegardiIn this paper, given the long-distance modeling property of Transformer , we propIn the 1990s, energy-based methods, especially the Watershed algorithm based on markers , have beSince the 2010s, deep learning-based image segmentation technologies have been rapidly developed. For instance, the U-Net model , widely Other deep learning approaches take advantage of the information of nuclear edges and centroids to segment nuclei. For example, DCAN  designedSince there are thousands of nuclei in a histopathological image, it will be a challenge to segment a large number of nuclear instances due to the inevitable nuclear adhesion and clustering. Although most deep convolutional neural networks perform well in extracting nuclear features from local regions, few networks take into account the global long-distance dependence of diverse nuclei. The long-distance dependencies provide a broad view to discover features that may improve the accuracy of nuclear segmentation and classification.To facilitate the subsequent analysis of diagnosis and prognosis of diseases, it is necessary to determine the type of each nucleus in histopathologic images. Most existing methods treat nuclear classification as a two-stage task: firstly to conduct a nuclear segmentation or detection process and then to perform the nuclear classification task. Moreover, a series of morphological characteristics of the nuclei could be extracted after carrying out the segmentation operation, which would further benefit nuclei classification. For example, Nguyen et al.  divided In recent years, increasing researchers have tried to combine the attention mechanism with CNN to improve network performance . AttentiThe proposed network TSHVNet is aimed at predicting instance-level nuclear category and the corresponding pixel-level classification simultaneously, to facilitate the accurate analysis of nuclear morphology in histopathological images.TSHVNet is a deep learning neural network for simultaneous nuclear instance segmentation and classification. H\u2217W/P2 to H/P\u2217W/P, where W denotes width, H represents height, and P means the length of each patch P \u00d7 P.To achieve precise segmentation of nuclear regions of interest and accurate distinction among various nuclei, we introduce a Transformer attention module to the trunk of the HoVer-Net  to exploThe three branches decode the features yielded frome DecoderCup module on the trunk of TSHVNet in different ways. The first branch is nuclear pixel (NP) branch, which predicts whether each pixel belongs to the nucleus or background. The second branch is the HoVer (HV) branch, which predicts the horizontal and vertical distances of the nuclear pixels to the centroid of the nucleus. The third branch is the nuclear classification (NC) branch, which predicts the nuclear type of each pixel and determines the category of each nucleus.The parameters and output dimensions of each residual block, Transformer module, and each branch of the proposed TSHVNet network are measured as shown in Given the excellent performance of the 50-layer preactivated residual (Preact-ResNet 50) units on visual tasks and robustness to input disturbances , the truAfter feature extraction by the trunk encoder network, the obtained feature maps are processed, respectively, by three branches of the same structure but with different objectives. The three branches consist of a series of nearest neighbor upsampling and dense connection units  with skiSpecifically, the first and second branches jointly achieve nuclear segmentation through a Marker-controlled thresholding watershed algorithm. The NC branch predicts the type of each nucleus via a majority vote on the predicted pixel-level classification results within the nucleus.The Transformer  performsX\u2009{X \u2208 RH\u00d7W\u00d7C} into a flat 2D patch {Xpi \u2208 RP\u00d7P\u00d7C}. The size of each patch is P \u00d7 P, and the number of patches is N = HW/P2. And then, we use a trainable linear projection to map the vectorized patch XP to the potential D-dimensional embedding space. In addition, to encode the spatial information of the patch, the specific position embedding matrix that will be added to the patch to maintain the position information can be calculated by the following equation:E \u2208 RP \u00d7 P \u00d7 C)\u00d7D and a multilayer perceptron (MLP) module. The output of each layer can be described as follows:Z\u03c3 is the encoded image representation. This encoder structure is represented by (d) in Finally, Later, for maintaining the consistency of the image, we introduce an upsampling module to map the 2D sequence from Transformer back to the 3D space.To assign appropriate weights to neurons, we employed several SimAM modules that integrate 3D channel attention and spatial attention  in both la and lb are the regression losses of HV branch output, lc and ld are the losses of NP branch output, and le and lf are the losses of NC branch output. \u03bba, \u22ef, \u03bbf are the weight scalars for each of the associated loss functions, specifically, making \u03bbb equal to 2 and the others equal to 1.In our proposed network, we use the original loss function defined in the HoVer-Net which employs three different loss functions at each branch output for better overall performance. The loss function can be formulated aspx and py refer to the horizontal and vertical predictions of the output of the HV branch; Hx and Hy denote the horizontal and vertical spatial gradient operations of the Sobel operator, respectively.Since there are significant differences in pixels between individual instances in the output of the HV branch, calculating gradients horizontally and vertically can tell where the difference in pixel intensity between different nuclei is greatest and from where the nuclei should be separated. The process can be described asE:M:\u03c4 is a threshold function that operates on a matrix a and will output \u201c1\u201d for the elements greater than b and output \u201c0\u201d otherwise. Specifically, h and k are set empirically, so that they give the optimal nuclear segmentation results. \u03c3 is a rectifier that sets all negative values to 0, and q is the output of the probability map in the NP branch.Moreover, a labeled watershed algorithm is further employed to segment different nuclei, under the condition of the given energy landscape Finally, to determine the class of a nuclear instance, a majority vote on the classes of the nucleus pixels is conducted in the output of the NC branch. Specifically, the type of a nuclear instance is assigned to the class with the largest number of pixels within the nucleus.The public CoNSeP dataset  is one oAt the same time, we also adopt the public PanNuke dataset  as our eX represents ground truth and Y represents the predicted nucleus. N represents the number of real nuclei, PMi refers to the connected region that generates the nuclear mask, Gi refers to the connected domain that PMi has the largest intersection with the ground truth, U refers to the set of connected regions that have no intersection with the ground truth, and PF denotes the element F inside the set U.In the nuclear segmentation task of medical histopathology, the following two indicators are usually used to evaluate the results of nuclear segmentation: (1) DICE  is used x represents ground truth, and y denotes the predicted segmentation region. IoU is the ratio of the intersection to the union of x and y. The left-hand side of the multiplier indicates the quality of detection. The right-hand side can be interpreted as the distance between each correctly detected instance and the ground truth they match. In this way, we can evaluate the quality of the nuclear instance segmentation and classification objectively and comprehensively.The previous two evaluation indexes assess only the performance of instance segmentation but not the quality of predicted results associated with the true segmentation. To this end, we use the evaluation index PQ originally proposed by Kirillov et al.  in our eF1_score which is the result of a harmonic average between the precision and recall scores. F1_score can comprehensively evaluate the quality of nuclear classification and is calculated as follows:Fd is used to indicate the overall F1_score, Fi is used to indicate the F1_score for inflammatory nuclei, Fc is used to indicate the F1_score for connective cells, Fdead denotes the F1_score for dead cells, Fe represents the F1_score for epithelial, Fn represents the F1_score for neoplastic cells, FS represents the F1_score for spindle, and Fm indicates the F1_score for miscellaneous.To assess the classification performance of nuclei, we adopt the evaluation index We carried out the experiments in this paper by using two NVIDIA 1080Ti graphics processor (GPU) accelerators on the Ubuntu 16.04 operating system and PyTorch 1.0.1, a deep learning framework.In our experiment, we use flip, rotation, Gaussian blur, and median blur data augmentation methods. The network input size of the CoNSeP dataset is 270 \u00d7 270, and that of the PanNuke dataset is\u2009256 \u00d7 256. For the Transformer attention module, we set the size of the patch to 16 and the layer number of MSA and MLP to 12. The TSHVNet model was initialized by the parameters pretrained on the ImageNet dataset.\u22124 and then reduced to 10\u22125 after 25 epochs.The TSHVNet was trained using the following two-stage training strategy where the epoch numbers were set empirically for the best accuracy. Firstly, we trained only the decoder at the first 50 epochs. Secondly, during the next 100 epochs, we fine-tuned the parameters of the entire network. In addition, batch sizes of 8 and 4 are used in the first stage and the second stage, respectively. Adam optimizer was used, and the initial learning rate was set at 10In this part, we visualize the results of simultaneous nuclear instance segmentation and classification obtained by different methods in different datasets, as shown in Figures As can be seen from The superior performance of the proposed TSHVNet model can be attributed to the integration of the Transformer module into the traditional CNN, which enables the network to achieve long-distance modeling and retrieve precise location information. In addition, the SimAM modules with 3D channel attention and space attention inserted into the trunk and branches of the proposed TSHVNet model can also help to better identify the ROI of nuclear instances.To objectively measure the ability of simultaneous nuclear segmentation and classification of our proposed method, we conducted different experiments on the two public datasets, and the results are shown in Tables From Fd, Fe, Fi, Fs, and Fm for the proposed TSHVNet are 2.5%, 4.1%, 5.7%, 3.1%, and 1.0% higher than those of the HoVer-Net, respectively. The increments have become 3.0%, 6.7%, 4.7%, 2.6%, 7.3%, and 3.2% on the PanNuke dataset, respectively.Concerning nuclear classification, it can be seen from The improvement could be attributed to the global dependencies modeling by the Transformer attention module and the simultaneous spatial and channel attention brought by the SimAM modules, which makes the network pay more attention to the nuclear regions of interest and focus more on the distinctive features to classify the nuclei in the histopathology images.In this part, we perform a series of ablation experiments to verify the effect of SimAM at different locations on the entire network. Because there are four residual units in our feature extraction, we abbreviate SimAM behind the four residual units as \u201cRes.\u201d The three branches contain two dense units, and we also indicate the SimAM module behind the two dense units as \u201cDes\u201d for short. The experimental results are shown in Tables It can be inferred from Tables For nuclear segmentation, we combined all the SimAM modules into the TSHVNet model other than using the \u201cRes\u201d SimAM modules or the \u201cDes\u201d SimAM modules alone, which would gain 1.8% and 1.6% promotions in the PQ score on the CoNSeP dataset and 0.4% and 0.8% increments on the PanNuke dataset, respectively.Fd score  on the CoNSeP dataset and 0.5% and 0.4% promotions on the PanNuke dataset, respectively. Therefore, the SimAM modules, which integrates 3D channel attention and spatial attention mechanism according to the energy function of neuroscience, are able to perceive contextual spatial information between diverse nuclear instances and show competitive instance segmentation performance.Regarding the nuclear classification, as compared to the TSHVNet model with only the \u201cRes\u201d SimAM modules or the \u201cDes\u201d SimAM modules, the proposed TSHVNet model integrating all the SimAM modules simultaneously gains 0.6% and 0.4% increments in the In this paper, we proposed a deep network named TSHVNet to simultaneously conduct nuclear segmentation and nuclear classification on medical histopathological images, which integrated Transformer and SimAM modules into the HoVer-Net. The Transformer attention module could automatically learn the global and local dependencies between the image input and network outputs but is insensitive to the location information. We made up for the inaccurate positioning of the Transformer by using a hybrid model design integrating the characteristics of CNN and SimAM attention modules, which enabled the network to pay more attention to the contextual spatial information among diverse nuclear instances for a more accurate simultaneous nuclear segmentation and classification. In addition, we also discussed the effect of the coexistence channel and spatial attention advantages of the SimAM modules in our entire network. The SimAM modules help assign appropriate weights to neurons for distinguishing the nuclear instances with similar interclass but discrepant intraclass appearances. Experiments on the public CoNSeP and PanNuke datasets have proved the superior performance of the proposed TSHVNet model in both tasks of nuclear segmentation and nuclear classification as compared to the state-of-art competing methods."}
+{"text": "COVID-19 continues to pose a dangerous global health threat, as cases grow rapidly and deaths increase day by day. This increasing phenomenon does not only affect economic policy but also international policy around the world. In this paper, Pakistan daily death cases of COVID-19, from February 25, 2020, to March 23, 2022, have been modeled using the long-established autoregressive-integrated moving average (ARIMA) model and the machine learning multilayer perceptron (MLP) model. The most befitting model is selected based on the root mean square error (RMSE), mean square error (MSE), and mean absolute error (MAE). Values of the key performance indicator (KPI) showed that the MLP model outperformed the ARIMA model. The MLP model with 20 hidden layers, which emerged as the overall most apt model, was used to predict future daily COVID-19 deaths in Pakistan to enable policymakers and health professionals to put in place systematic measures to reduce death cases. We encourage the Government of Pakistan to intensify its vaccination campaign and encourage everyone to get vaccinated. From the beginning of this contagious coronavirus disease 2019 (COVID-19), it was acknowledged as a crisis that has negatively impacted almost all aspects of public and economic life. Due to the increasing infectious cases of COVID-19, there is also an increase in the death rate of patients, which creates a chaotic and mental disorder among humans across the globe. Predicting the behavior of contagious diseases is a major headache for both policymakers and health professionals  is a combination of three components; namely, autoregression (AR), gives us information about how the series is dependent on its past lag and denoted by a parameter p, the moving average (MA) part which tells us about the dependency of error terms on past lags and is denoted by q, and the last part is the integrated part which is used when the series is not stationary and denoted by d. This methodology comprises four procedures, namely, model identification, estimation of parameters, diagnostic checking, and forecasting. The series is checked by applying some tests of stationarity, and after that, the model is identified based on the correlogram of the data. It proceeds with the estimation step, and after that, the estimated models are examined based on diagnostic checking; if the candidate model fulfills the criteria, the model is utilized for forecasting. Mathematically, this model can be written asp stands for the autoregressive part and \u04e9q stands for the moving average part, while \u2206dyt denotes the difference in the series. \u03c6P(B) is the seasonal autoregressive polynomial of order P and \u0398Q is the seasonal moving average polynomial of order Q. \u2206d\u2206sDyt is the seasonal difference. The ARIMA model, also known as the Box\u2013Jenkins methodology , is amonun are the bias of the network bn, f is the activation function of the intermediate layers, and fs is the output layer activation function. y is the output signal, wkni is the weight of the intermediate layer, and wk10 is the connection of the output neurons. The multilayer perceptron (MLP) machine learning model \u201339 is acY1,\u2026, YN and Y,\u2026, YT are a partition of the data. The model with the smallest KPI is selected as the most apt for the series and used for forecasting. All analyses were performed in R.We used both models to predict the cumulative death cases in Pakistan and compared the models based on KPIs such as the mean square error (MSE), RMSE, and MAE. Mathematical expressions for KPIs are given as follows:p value of the series was found to be 0.5385, which means we fail to reject Ho, confirming that indeed the series is not stationary. To make the series stationary, we applied difference transformation, thereby finding the order of the candidate model. This was achieved by making a correlogram of the transformed series. The From We then applied the machine learning MLP model to predict the death cases of COVID-19. To achieve this, we set the hidden layers to find the optimum estimates. From The COVID-19 death cases in Pakistan have been analyzed using the classical time series ARIMA model and the machine learning MLP model. Different candidate models of both models were applied and compared using different KPIs. The KPIs used, which have been frequently used in numerous classical and machine learning time series modeling, pointed to the fact that the MLP model with 20 hidden layers outperforms all other competing models for modeling and prediction purposes. It must be noted that increasing the hidden layer should be done with caution as the model may not remain efficient at some point after some fixed number of hidden layers. The MLP model was then used to forecast COVID-19 confirmed deaths in Pakistan. This will, in the long run, help authorities to put in place strategic prevention measures and mechanisms to curtail the death cases in the country. It will also assist authorities to ascertain the intensity of the pandemic in future. Although there is a strong campaign for vaccination, people should be encouraged to take vaccination seriously. It is the responsibility of the Government of Pakistan and the whole society to make the vaccination process successful."}
+{"text": "There was no significant difference in severity, and the majority of adverse events reported were classed as mild to moderate. Tenderness at the injection site was the only reaction that had a statistically higher reported incidence after the mRNA-1273 vaccine than after the BNT162b2 vaccine . In conclusion, a booster dose of the mRNA vaccine, either BNT162b2 or mRNA-1273, in solid cancer patients previously vaccinated with ChAdOx1 and CoronaVac appears safe, and no new safety concerns were observed.Safety data following the COVID-19 booster mRNA vaccine in solid cancer patients are scarce. We prospectively evaluated adverse events after a booster dose of the BNT162b2 vaccine as compared to the mRNA-1273 vaccine in solid malignancy patients who had previously received two doses of ChAdOx1 or heterogenous CoronaVac/ChAdOx1. Data regarding solicited and unsolicited adverse events were collected using questionnaires. The primary endpoint was the difference in incidence and severity of adverse events between BNT162b2 and mRNA-1273 vaccines. A total of 370 subjects were enrolled, including 172 (47%) and 198 (54%) patients receiving booster doses of BNT162b2 and mRNA-1273 vaccines, respectively. The overall incidence of adverse events in the two groups was comparable (BNT162b2 vs. mRNA-1273; 63% vs. 66%,  The coronavirus disease 2019 (COVID-19) pandemic has impacted all health care systems, including cancer care. Patients with malignancies are classified as a high-risk group because they are at increased risk of serious complications and death from COVID-19 infection ,4. Many Safety data for the mRNA vaccine booster dose in malignancy patients are limited to studies of individuals primed with two doses of the mRNA vaccine ,17,18. AHowever, studies of cancer patients who received a primary vaccine with a viral-vectored vaccine (ChAdOx1) or inactivated virus vaccine (CoronaVac) are lacking despite the fact that many countries deployed these vaccines in the early phase of the COVID-19 pandemic. In Thailand, most cancer patients were immunized with the primary series of two doses of the ChAdOx1 vaccine or heterogenous CoronaVac/ChAdOx1 during the early phase of the vaccination program in June 2021 . The mRNAs a result, we aimed to obtain safety data for the mRNA COVID-19 vaccine booster dose in solid cancer patients previously vaccinated with two doses of ChAdOx1 or heterogenous CoronaVac/ChAdOx1. We also planned to compare the differences in adverse events between the two types of mRNA vaccine (BNT162b2 and mRNA-1273).We conducted a multi-center prospective observational cohort study at King Chulalongkorn Memorial Hospital and Phrapokklao Hospital, Thailand. We enrolled solid cancer patients who had previously been vaccinated with a primary series of two doses of the ChAdOx1 vaccine  or heterogenous CoronaVac /ChAdOx1 (the first dose with CoronaVac and the second dose with ChAdOx1). Enrolled patients then received a third dose using an mRNA vaccine, i.e., either BNT162b2  or mRNA-1273 . The interval between the second and third dose of the vaccine was at least 3 months but not more than 6 months. The study excluded patients with a history of SARS-CoV-2 infection or a life expectancy of less than 6 months. Patient demographics, disease characteristics, and data related to cancer treatments were reviewed and recorded. The type of cancer treatment and history of concurrent corticosteroid use were determined within 4 weeks before the third vaccination.After vaccination, the patients were asked to self-report adverse events that did not include previous symptoms experienced due to their cancer or cancer treatments using either a paper-based or electronic online questionnaire  and the Chanthaburi Research Ethics Committee/Region 6 (CTIREC) (No. 044/64).The primary endpoint was the incidence and severity of adverse events following the booster dose with the BNT162b2 as compared to the mRNA-1273 vaccine in solid malignancy patients previously vaccinated with ChAdOx1 or CoronaVac. We also assessed individual risk factors associated with vaccine reactogenicity and their effect on mRNA vaccine type. The secondary endpoints were the onset and duration of adverse events and the frequency with which adverse events interrupted cancer treatment.p-values of less than 0.05 were considered statistically significant.Descriptive statistics including frequencies with percentages and mean with standard deviation were used to describe demographics, disease characteristics, and data on cancer treatments. The difference in baseline characteristics and incidence and severity of adverse events between the BNT162b2 and mRNA-1273 vaccines was analyzed by the Chi-square test. We used the Mann\u2013Whitney U test to compare the distribution of the onset and duration of adverse events between the two types of vaccine. The association between individual risk factors and developing adverse events was evaluated using univariate logistic regression, which was used to calculate the unadjusted odds ratios and corresponding 95% confidence intervals (CIs). The significant factors from the univariate analysis were included in the multivariate analysis to determine significant independent factors, and we used these factors to adjust the impact of mRNA vaccine type. We used SPSS version 28.0  and Stata 15  for the statistical analyses.. The mRNA-1273 group had a higher rate of concurrent steroid use because that group contained more patients who were being treated with chemotherapy, thus more individuals taking steroids for pre-medication purposes. The interval between the second and the third vaccinations was longer among the patients who were vaccinated with BNT162b2.From December 2021 to February 2022, 370 solid malignancy patients previously vaccinated with a primary series of two doses of the ChAdOx1 vaccine or heterogenous CoronaVac/ChAdOx1 were recruited for the study. Each subject then received a third dose of an mRNA vaccine. Of these, 172/370 (46.5%) and 198/370 (53.5%) were vaccinated with BNT162b2 and mRNA-1273, respectively. The BNT162b2 group contained more elderly, female, and metastatic stage cancer individuals, but less comorbidity than the mRNA-1273 group. The distribution of cancer types and treatments was also significantly different between the two groups . The mRNp = 0.57). Although the BNT162b2 group had a higher reported incidence of grade 3 severity adverse events than the mRNA-1273 group, including all adverse events , there was no statistically significant difference and the most common reported severity in both groups was mild to moderate. The most common local reaction was pain at the injection site, while the most common systemic reaction was myalgia in both vaccine types. Tenderness at the injection site was the only reaction that had a statistically higher incidence after the mRNA-1273 than after BNT162b2 vaccination , as shown in A total of 238 out of 370 patients (64.3%) reported adverse events after receiving a booster dose of the mRNA COVID-19 vaccine. The overall incidence of any adverse events associated with BNT162b2 vaccines was comparable to that of the mRNA-1273 vaccines , no serious adverse events or deaths related to the vaccine were reported. Only one patient who received the BNT162b2 vaccine needed to interrupt their cancer treatment (Ribociclib) with a cessation of only 2 days due to a grade 3 fever. There were also no adverse events of interest, including myocarditis, vaccine-induced immune thrombotic thrombocytopenia, or thrombosis, observed. p = 0.38). We also investigated this association in relation to local and systemic reactions, and there was no correlation between the type of booster mRNA vaccine and vaccine reactogenicity  , we founIn cancer patients, studies of adverse events after the COVID-19 vaccine booster dose are limited to individuals primed with two doses of the mRNA vaccine ,17,18. AThere are no previous studies that compare adverse events following immunization for the two types of mRNA vaccines (BNT162b2 and mRNA-1273) used as the booster dose in cancer patients. There is, however, one study, involving healthy volunteers, that reported a similar incidence for any grade of local and systemic reaction among different types of booster vaccines . In our Regarding adverse events of interest, 5 out of 370 patients (1.4%) developed lymphadenopathy after the third vaccination. This occurred after the BNT162b2 vaccine in 4 patients (2.3%) and after the mRNA-1273 vaccine in 1 patient (0.5%). All were affected in the axillary region on the same side as the injection site. Reactive lymphadenopathy, which has been reported in relation to the primary series of the mRNA COVID-19 vaccine ,29,30,31As a result of the non-randomized study design, imbalances in patient demographics and disease characteristics were present between the two booster vaccine groups. Several baseline characteristics that influence vaccine reactogenicity are documented in the literature ,27,33,34There were a few limitations to our study. First, certain adverse events might overlap with side effects from cancer treatment because the study included patients who were receiving cancer treatment (87%). This could lead to overreporting or underreporting of adverse effects. Second, our study was not a randomized control trial, so differences in patient demographics and disease characteristics were present between the two mRNA vaccine groups. We attempted to correct this bias by using logistic regression analysis, as mentioned above.A booster dose with an mRNA COVID-19 vaccine in solid cancer patients previously vaccinated with ChAdOx1 and CoronaVac appears safe, with no new safety concerns being observed in our study. The overall incidence and severity of adverse events for the BNT162b2 and mRNA-1273 vaccines were found to be comparable. The majority of adverse effects were mild to moderate in severity, with hardly any interruption of cancer treatment being reported . Our findings will help health care professionals reduce the vaccine hesitancy associated with booster mRNA COVID-19 vaccines in cancer patients."}
+{"text": "No data regarding the efficacy of a third mRNA vaccine for solid cancer patients previously primed with the heterologous CoronoVac/ChAdOx1 vaccination implemented in Thailand during the shortage of vaccine supply are available. Forty-four cancer patients who previously received the heterologous CoronaVac-ChAdOx1 regimen were boosted with a third mRNA COVID vaccine, either BNT162b2 or mRNA-1273. Anti-RBD IgG was measured immediately before, two weeks after, and four weeks after the third dose. The antibody response was compared to 87 age- and gender-matched cancer patients who were primed with the homologous ChAdOx1/ChAdOx1 regimens. Post-third dose anti-RBD IgG levels significantly increased compared to pre-third dose levels. There was no statistical difference in post-third dose antibody titers or neutralization levels between these two primary series regimens. Treatment with chemotherapy was associated with a lower antibody response compared to endocrine therapy/biologics. Similar antibody levels were observed after a third booster with either BNT162b2 or mRNA-1273 following heterologous CoronaVac/ChAdOx1 vaccination. There was no statistical difference in the immune response following the third-dose vaccination between cancer patients and healthy individuals who received the same heterologous CoronaVac/ChAdOx1 vaccination. In conclusion, a similar degree of enhanced immunogenicity was observed after a third mRNA COVID-19 vaccination in solid cancer patients who previously received the heterologous CoronaVac/ChAdOx1 regimens. Cancer patients are at elevated risk for severe Coronavirus disease 2019 (COVID-19) infection ,4,5,6,7.To combat the limited and unpredictable vaccine supply during the SARS-CoV2 pandemic, heterologous primary schedules of COVID-19 vaccines were implemented in many countries. In Canada, Spain, and Germany, the heterologous ChAdOx1 followed by an mRNA vaccine demonstrated similar high vaccine efficacy compared to the homologous mRNA vaccine ,9,10,11.Due to the emergence of the SARS-CoV-2 Omicron variant of concerns and the waning of vaccine-induced immune response, third dose vaccination with mRNA vaccine is now recommended ,16,17,18This study enrolled solid cancer patients aged \u226518 years who had been previously primed with the heterologous CoronaVac followed by ChAdOx1 vaccines, administered 4 weeks apart for at least 3 months, and had no history of SARS-CoV-2 infection. The recruitment period was between 27 December 2021, and 9 February 2022, at King Chulalongkorn Memorial Hospital, Bangkok, Thailand, and Phrapokklao Hospital, Chanthaburi, Thailand. Participants received a third mRNA COVID-19 vaccine, either BNT162b2  or mRNA-1273  according to vaccine availability. Blood samples were collected immediately before and 2\u20134 weeks after the third COVID-19 vaccination.Demographics, including age, sex, and body mass index (BMI), and clinical data, including cancer type, current disease status, type of anticancer treatment (endocrine therapy without any previous chemotherapy versus chemotherapy treatment given during the COVID-19 immunization), and therapeutic corticosteroid use, defined as >10 mg prednisolone equivalent for more than 7 days, were collected and entered into the REDCap electronic data capture tools hosted at Chulalongkorn University ,21. VaccAll patients provided written, informed consent. The study was approved by the Institutional Review Board of Faculty of Medicine, Chulalongkorn University (No. 486/64) and the Chanthaburi Research Ethics Committee/Region 6 (CTIREC) (No. 044/64) and registered in the Thai Clinical Trials Registry (TCTR20220112004).The primary endpoint was the SARS-CoV2 antibody response after the third mRNA COVID vaccine in comparison with the standard homologous ChAdOx1/ChAdOx1 vaccines administered in solid cancer patients. The secondary end-point was to compare antibody response with healthy individuals who were primed with the same primary series of CoronaVac/ChAdOx1 vaccines. We defined anti-RBD IgG \u2265 300 BAU/mL as adequately protective. This value corresponded to the focus reduction neutralization titers (FRNT50) \u2265 40 against B.1.1.529 (Omicron) variant of concern BA.2 . This anSerum samples were measured for anti-RBD IgG using commercial chemiluminescent immunoassays  according to the manufacturer\u2019s instructions. For anti-RBD IgG, measured units (AU/mL) were transformed into the WHO international standard unit  using the equation: BAU/mL = 0.142x AU/mL. The value \u2265 7.1 BAU/mL  was considered positive.TM SARS-CoV-2 neutralizing assay  [Neutralization to Omicron BA.2 subvariant was performed using the cPassNJ, USA) . ActivitIn the same period, solid cancer patients previously primed with ChAdOx1/ChAdOx1 regimens were administered a third mRNA COVID-19 vaccine. Their immunogenicity data were reported . Since pData from healthy individuals came from a previously published study . One hunAnti-RBD IgG concentrations were reported as geometrical mean titers (GMT) with 95% confidence interval (CI). Pairwise comparisons of antibody concentration between the heterologous and homologous vaccination regimens or between cancer and healthy cohorts were performed with the nonparametric Mann\u2013Whitney test. Comparison within the same patients was performed using the Wilcoxon matched pairs signed rank test. Chi-square or Fisher\u2019s exact test was performed for comparisons of proportions.p-value < 0.05.Statistical analyses were performed using Stata 15  and GraphPad Prism version 9.0 . All tests were two-sided with statistical significance set at Between 27 December 2021, and 9 February 2022, 44 solid cancer patients who previously received the heterologous CoronaVac/ChAdOx1 regimen were recruited for a third mRNA COVID-19 vaccine. In the same period, 87 age- and sex- matched solid cancer patients previously primed with the homologous ChAdOx1/ChAdOx1 regimen were selected as a reference group A. AccordThe median age of patients was 57 years in both groups. Approximately 55% were female. Most patients were diagnosed with breast cancers, colorectal cancers, and cancer of the head and neck. Approximately 45% and 40% of patients had early-stage and recurrent or metastatic disease, respectively. Cancer treatment was categorized into two types including chemotherapy or hormonal therapy/biologics.p < 0.0001 and ChAdOx1/ChAdOx1: GMT 40.6 vs. 2362 BAU/mL, p < 0.0001) (p = 0.1802). Following the third dose mRNA vaccine, levels of anti-RBD IgG in solid cancer patients primed with CoronaVac/ChAdOx1 significantly increased to comparably high titers to those receiving the primary series of ChAdOx1/ChAdOx1 regimen   B. There  = 0.84) B.p < 0.0001). Similar adequate immunity was observed after a third dose booster in solid cancer patients primed with either CoronaVac/ChAdOx1 or ChAdOx1/ChAdOx1 regimen.The proportion of patients with adequate response, defined by level above 300 BAU/mL, was significantly increased from 16% (seven out of 44) to 91% (40 out of 44) and from 10% (nine out of 87) to 90% (78 out of 87) in those who immunized with primary series of CoronaVac/ChAdOx1 and ChAdOx1/ChAdOx1 vaccines, respectively (p = 0.004) (p = 0.34). An age-matched subset analysis between cancer and healthy adults was additionally performed to address the age discrepancy  A. This ccrepancy B. No stacrepancy . One patp = 0.01) (p = 0.54).Treatment with chemotherapy was associated with reduced antibody levels compared to hormonal therapy/biologics  . Similarp = 0.017) and fatigue (19% vs. 38% p = 0.028) occurred in patients vaccinated with CoronaVac/ChAdOx1/mRNA regimen. Lymphadenopathy, however, was more frequently observed in the CoronaVac/ChAdOx1/mRNA group (12% vs. 1% p = 0.014) (Vaccine-related adverse events were assessed in 95% (42 out of 44) of cancer patients who received CoronaVac/ChAdOx1/mRNA and 98% (86 out of 87) of those received ChAdOx1/ChAdOx1/mRNA. No new serious adverse events were reported among patients who received a third dose vaccination following a primary series of the heterologous CoronaVac/ChAdOx1 vaccines at 2\u20134 weeks post-third vaccine. Approximately 48% (20 out of 42) of patients had any vaccine-related reactogenicity. Pain and tenderness were the most common local reactions, occurring in 48% and 36% of patients, respectively. Myalgia and fatigue were the most common systemic reactions, occurring in 26% and 19%, respectively D. Compar= 0.014) .p = 0.289)  .Data regarding the heterologous vaccinations in cancer patients who are at higher risk of suppressed immunity are limited. To the best of our knowledge, this is the first report of immunogenicity in response to a third dose mRNA COVID-19 vaccination following the heterologous primary CoronaVac/ChAdOx1 vaccine schedule in solid cancer patients. This vaccination regimen was well-tolerated and elicited a high SARS-CoV2 binding antibody concentration comparable to the standard homologous ChAdOx1/ChAdOx1 vaccination followed by a third mRNA COVID-19 vaccine. Similar neutralization against the Omicron BA.2 subvariant was also demonstrated.The heterologous mRNA/ vector/mRNA vaccination strategy has been reported to successfully induce an antibody response in a small case series of patients with lymphoma who poorly responded to primary vaccination ,26. HighAlthough reduced immunogenicity after two doses of COVID-19 vaccine has been demonstrated in cancer patients compared to the general population ,6,28,29,Limitations of the study include the lack of cellular immune response and long-term protection. The sample size is small, and this limited additional subset analysis. In Thailand, cancer patients are considered a vulnerable group and most received the standard two doses of ChAdOx1 vaccines. Only a small groups of cancer patients received the alternative CoronaVac/ChAdOx1 primary vaccination in the period of the delta wave due to limited vaccine supply.This study provides evidence for the safety and efficacy of the heterologous mRNA COVID-19 boosting following the heterologous primary vaccination with CoronaVac/ChAdOx1 vaccine schedule in solid cancer patients.A third dose booster is currently recommended to fight against the emerging SARS-CoV-2 Omicron variant of concern and waning of immunity over time. No data exist regarding the efficacy of a third mRNA COVID-19 booster for solid cancer patients who previously received a primary series of the heterologous CoronoVac/ChAdOx1 vaccination. We assessed the safety and humoral immunity in patients with solid malignancy following the CoronoVac/ChAdOx1/mRNA compared to the standard ChAdOx1/ChAdOx1/mRNA vaccination schedules and healthy individuals. The results of our study provide supportive evidence of the safety and efficacy of the CoronoVac/ChAdOx1/mRNA vaccination schedule in solid cancer patients."}
+{"text": "Mild thiamine deficiency aggravates Zn accumulation in cholinergic neurons. It leads to the augmentation of Zn toxicity by its interaction with the enzymes of energy metabolism. Within this study, we tested the effect of Zn on microglial cells cultivated in a thiamine-deficient medium, containing 0.003 mmol/L of thiamine vs. 0.009 mmol/L in a control medium. In such conditions, a subtoxic 0.10 mmol/L Zn concentration caused non-significant alterations in the survival and energy metabolism of N9 microglial cells. Both activities of the tricarboxylic acid cycle and the acetyl-CoA level were not decreased in these culture conditions. Amprolium augmented thiamine pyrophosphate deficits in N9 cells. This led to an increase in the intracellular accumulation of free Zn and partially aggravated its toxicity. There was differential sensitivity of neuronal and glial cells to thiamine-deficiency\u2013Zn-evoked toxicity. The co-culture of neuronal SN56 with microglial N9 cells reduced the thiamine-deficiency\u2013Zn-evoked inhibition of acetyl-CoA metabolism and restored the viability of the former. The differential sensitivity of SN56 and N9 cells to borderline thiamine deficiency combined with marginal Zn excess may result from the strong inhibition of pyruvate dehydrogenase in neuronal cells and no inhibition of this enzyme in the glial ones. Therefore, ThDP supplementation can make any brain cell more resistant to Zn excess. The energy homeostasis of the brain is a very complex process due to the restrictions of substrate transport through the blood\u2013brain barrier against high-energy requirements. It results in the susceptibility of neurons to exogenous metabolic stress, also facing limited glycogen storage in astroglial cells. In fact, the brain uses about 20% of plasma glucose, but it constitutes only 2% of the total body weight . MoreoveTherefore, the loss of PDHC activity and energy hypometabolism are hallmarks of diverse brain encephalopathies. One cause of these conditions is thiamine diphosphate (ThDP) deficit. ThDP is a cofactor of many enzymes that play an important role in key metabolic pathways: the TCA and pentose phosphate pathways. The E1 subunit of the PDHC and OGDHC is activated by ThDP and also the branched-chain alpha-keto acid dehydrogenase complex (BCDHC), 2-oxoadipate dehydrogenase complex (OADHC), transketolase and ThDP-dependent \u03b1-oxidation enzymes . It is cMoreover, TD-evoked energy deficits are linked with the prolonged depolarization of glutamatergic neurons containing Zn in their terminals ,18,19. Z50 equal to 2.34 mmol/L  medium containing 0.003 mmol/L of thiamine according to the manufacturer\u2019s protocol . Its use4 mmol/L a but onl4 mmol/L c.On the other hand, in SN56 cells, 5 mmol/L amprolium in the TD medium caused a small 20% decrease in ThDP content but a relatively high 35% decrease in SN56 cell count and a 12% increase in TB-positive cells a\u2013d. Thes50 values for amprolium against PDHC and aconitase activities in N9, calculated from Dixon\u2019s plots, were equal to 3.8 and 12.5 mmol/L, respectively (50 18.8 mmol/L (p = 0.048) (p = 0.0037) with a profound depletion of acetyl-CoA content. These alterations indicate that cholinergic neuronal cells appeared to be 16 times more sensitive to intracellular ThDP deficits than microglial ones, comparing the slope values of their acetyl-CoA vs. PDHC correlation plots  c. On theon plots c. Citraton plots d.50 value against PDHC activity in SN56 was 17.5 mmol/L, and it was over four times higher than in N9 (3.8 mmol/L)  a. On theicroglia b, which It has been shown that only free Zn cations in the extracellular compartment may display cytotoxic activity ,26. ThesThus, 0.10 mmol/L Zn in the TD medium inhibited the growth rate and viability of SN56 by 56 and 53%, respectively. Despite a moderate 50% increase in intracellular accumulation, Zn inhibited SN56 PDHC, aconitase and ICDH-NADP activities by 56, 67 and 85%, respectively . It causIn the TD medium, in control conditions, the co-culture of SN56 cholinergic cells with N9 microglia seeded on permeable inserts see  resultedHowever, microglial inserts decreased the basal Zn level in SN56 by 45%, below the control value b. The coThe combined addition of 0.10 mmol/L Zn and 5.0 mmol/L amprolium caused an additive inhibition of the PDHC and aconitase in SN56 and N9 cells. Note that PDHC activity was inhibited by 100% in the presence of both inhibitors a. On theFor the assessment of N9 functional viability, lipopolysaccharide 0.1 mmol/L was added in a duplicate validating experiment. This preparation resulted in 70-fold and 825-fold increases in IL-6 and TNF-\u03b1 levels in the N9 culture medium, respectively a.Concentrations of IL-6 released to the medium during the 24 h culture of SN56 alone remained at similar levels irrespective of experimental conditions a. MoreovThere is a number of experimental data that present separate effects of either Zn excess or TD on the energy metabolism and function of brain cells ,26. HoweThe presented data demonstrate that culture in the TD medium resulted in a mild 20\u201325% drop in ThDP in microglial and SN56 cells, which is compatible with clinical data showing no overt TD symptoms in humans and experimental animals with 20% decreases in ThDP levels in their blood or tissues  36]. On. On36]. 50 for amprolium equal to 3.8 and 17.8 mmol/L, respectively , intermediate in SN56 neurons (95 pmol/mg of protein) and the lowest level in C6 astroglial cells (72 pmol/mg of protein)  8]. The. The8]. Thiamine deficiency in the brain is frequently combined with the excitotoxic activation of glutamatergic neurons . Our pasThe strongest, complete inhibition, which was observed for the PDHC in SN56 neurons grown in a medium containing Zn and amprolium, may significantly impair acetyl-CoA provision for mitochondrial energy synthesis and cytoplasmic cholinergic metabolism. Similar conditions could also suppress OGDHC activity, being a rate-limiting step for the second part of the TCA cycle . Such meOur data suggest that the neuroprotection of N9 against the TD-affected Zn excitotoxicity of SN56 cholinergic neurons may be linked with the uptake of the ion excess by N9 cells. They accumulate Zn excess competitively to SN56 resulting in a decrease in the cation concentration in the former both in control and severe ThDP deficiency conditions One should take into account that, except for the mitochondrial mechanisms presented here, there are chronic thiamine-dependent disturbances in citrate metabolism, which, through ATP-citrate lyase, provides acetyl-CoA for cytoplasmic ACh synthesis and microsomal and nuclear acetylations .2. The culture was kept at 37 \u00b0C in an atmosphere of 5% CO2 and 95% air for 48 h. At this time, the growth medium was replaced with fresh one, containing Zn, amprolium or both, as indicated. The culture was continued for the next 24 h. The cellular model of Zn excess in TD was microglial N9 cell line (RRID: CVCL 0452) and cholinergic neuroblastoma SN56.B5G4 cells (RRID: CVCL 4456). To achieve more cholinergic phenotype, the cells were differentiated by combined addition of 1 mmol/L dibutyryl cAMP (cAMP) and 0.001 mmol/L all-trans-retinoic acid (RA) for 48 h . At thisThe control cells were cultured in MEM supplemented with 0.009 mmo/L of thiamine concentration. Cultures were terminated by harvesting the cells in 10 mL of ice-cold 154 mmol/L NaCl containing 5 mmol/L glucose and 10 mmol/L phosphate buffer (pH 7.4). Then, the cells were collected and centrifuged (10 rpm for 7 min), and the cellular pellet was suspended in 0.20 mL of 320 mmol/L sucrose with 0.10 mmol/L EDTA and 10 mmol/L Na-HEPES (pH 7.4). Each sample was aliquoted for trypan blue assay and metabolite and enzyme assays. 5) were seeded on 3 cm diameter inserts with a semipermeable bottom. After 24 h of preconditioning, 3 inserts were placed on each 10 cm plate with SN56 cells. The whole culture was continued for the next 24 h. Then, amprolium, Zn or both were added as indicated, and co-culture was continued for the subsequent 24 h.To determine the combined effect of N9 cells on Zn neurotoxicity, SN56 cells were co-cultured with N9 cells. The microglial N9 cells (3 \u00d7 10w/v) HClO4 for Zn assay  isotonic trypan blue solution. Total cell number and fraction of nonviable, dye-accumulating cells (trypan blue positive cells) were counted after 2 min in Fuchs-Rosenthal haemocytometer under light microscope.Immediately after harvesting the cells, 0.02 mL of cell suspension was mixed with equal volume of 0.4%  100 Tris/HCl buffer pH = 7.4, 0.10 NADH, 0.2 IU malic dehydrogenase and 0.20 mL tested sample. The reaction was started by the addition of 0.1 IU citrate lyase to the tested sample. The activity of the enzyme was presented as nmols of oxidized NADH/min/mg of protein, on the basis of an absorbance coefficient for NADH = 6.22 mol/cm at 340 nm.Before the assay, samples were diluted to desired protein concentration in 0.20% Triton X-100. PDHC activity was assayed by the citrate synthase coupled method . Enzyme 2, 0.10 NADP, 1 IU. isocitrate dehydrogenase and 0.10 mL of tested sample containing 0.10 mg of protein. The reaction was initiated by the addition of 0.01 mL 20 mmol/L of cis-aconitate. The activity of the enzyme was presented as nmols of reduced NADP on the basis of an absorbance coefficient for NADPH = 6.22 mol/cm.Aconitase (EC 4.2.1.3) and IDHC-NADP (EC 1.1.1.42) activities were measured by a direct measurement of NADP reduction ,50. The 2, 0.50 NADP and 0.10 mL of tested sample containing 0.10 mg of protein. The reaction was initiated by the addition of 0.01 mL 10 mmol/L L-isocitrate. The activity of the enzyme was presented as nmols of reduced NADP on the basis of an absorbance coefficient for NADPH = 6.22 mol/cm at 340 nm.The incubation media for ICDH-NADP at the final volume of 0.70 mL consisted of (in mmol/L) 50 Tris/HCl pH = 7.4, 0.60 MgCl4. Deproteinized extracts were put into a solution containing maleic anhydride in ethyl ether to remove CoA-SH for 2 h. The cycling reaction was carried out in 0.10 mL of medium containing (in mmol/L) 1.9 acetyl phosphate, 1.2 oxalo-acetate, 1.0 IU phosphotransacetylase and 0.12 IU citrate synthase for 90 min. The reaction was terminated by putting the samples at 99 \u00b0C for 10 min. Then, the level of produced citrate was determined. The media for citrate measurement at the final volume of 0.70 mL consisted of (in mmol/L) 100 Tris/HCl buffer pH = 7.4, 0.10 NADH, 0.2 IU. malic dehydrogenase and 0.20 mL tested sample. The reaction was started by the addition of 0.1 IU citrate lyase to the tested sample. The activity of the enzyme was presented in mmols of oxidized NADH on the basis of an absorbance ratio for NADH = 6.22 mol/cm at the wavelength = 340 nm. Metabolic parameters of the cells concerning their acetyl-CoA were assessed by their incubation in the depolarizing medium containing the following in a final volume of 1.0 mL: 2.5 mmol/L pyruvate, 2.5 mmol/L malate, 90 mmol/L NaCl, 30 mmol/L KCl, 20 mmol/L NaHEPES (pH 7.4), 1.5 mmol/L Na-phosphate, 0.320 mmol/L sucrose and 0.7\u20131.0 mg of cell protein. These conditions were employed to normalize the metabolic flux in every sample . IncubatThe whole-cell acetyl-CoA level is a marker of energy metabolism integrity in brain cells .For ThDP assay, the cells were homogenized in ice-cold 4% TCA. ThDP was measured in supernatant by reverse-phase HPLC with electrochemical detector.For ThDP assessment, cells were cultured on 3 cm diameter plates and treated as described above. After 72 h, media were withdrawn, and cells that were attached to the plates were gently washed once with ice-cold PBS supplemented with 1 mmol/L EDTA. Then, 1.5 mL of 0.5% trichloroacetic acid was added to the cells and incubated on ice for 1 h. Protein precipitate was removed by centrifugation at 5000 g for 60 s. Supernatant was used for ThDP measurement with use of the reverse-phase HPLC . Protein level was measured using Bradford method (1976) with human immunoglobulin as standard. 4 was added to the plate and incubated on ice for 1\u20132 min. The cells were collected into ice-cold plastic tubes. Protein precipitates were removed by centrifugation for 1 min at 10,000 rpm. The supernatants were neutralized prior to the assay with 3.25 M K2CO3 to pH 6.0. Next, the supernatants were used for Zn assay with modified fluorometric method TSQ with emission and excitation wavelengths equal to 335 and 495 nm, respectively, against a blank reagent that was treated similarly.Zinc level was determined using modified fluorimetric method with N-(6-methoxy-8-quinolyl)-p-toluenesulfonamide (TSQ) as described by Chen and Liao . Culture2 standard solution treated similar to the samples [To quantify analysis, the peak of emission was calculated from calibration curve in range 0.2\u20134.0 nmols/sample of ZnCl samples .p < 0.05 being considered to be statistically significant.The level of cytokines was assayed using commercial Platinum ELISA kits . The two groups were compared by non-parametric Mann-Whitney test, at p < 0.05 being considered to be statistically significant.Statistical analyses were carried out using GraphPad Prism 8.0 . Data are presented as means \u00b1 SEM from 3\u20136 independent cell culture preparations. The assessment of normality of the data were carried out by Shapiro-Wilk normality test. Most data were carried out by Kruskal\u2013Wallis test. The two groups were compared by non-parametric Mann-Whitney test, at The presented data indicate that in the brain, the combination of marginal ThDP deficit and borderline Zn excess may result in overt cytotoxic effects yielding a differential impairment of neuronal, microglial and astroglial cells . The dif"}
+{"text": "Chronic obstructive pulmonary disease (COPD) is a common disease and among the top causes of mortality worldwide but can be prevented and treated. This study aims to estimate the awareness of COPD among the Syrian population. A cross-sectional anonymous self-administered online survey was conducted by using Google Forms on Social Media platforms. The questionnaire included demographic, smoke-related and COPD-related questions. This study included 1607 participants with 930 (57.8%) females, 40% aging 21\u201325\u00a0years old, more than 90% being university students/graduates and 67.8% living\u00a0in cities. Around half were either active smokers or had second-hand smoke exposure. After excluding participants in health-related fields who were 950 participants, only 25.4% of the remaining had ever heard of the term COPD. Knowing about COPD was not associated with reported smoking habits. No significant differences in awareness were seen between city and countryside dwellers, governate groups, genders, or age groups. Being in a health-related field was a major factor of being aware of COPD. COPD awareness in Syria is low, even amongst the well-educated group. Moreover, COPD risk factors of smoking and exposure to indoor and outdoor pollutants are common. Raising awareness is crucial in the Syrian community as COPD is highly prevalence. It manifests as a partially reversible airflow limitation due to chronic inflammation that most commonly occurs due to exposure to particles and gases, mostly from cigarettes. It is often associated with symptoms of shortness of breath, mainly on exertion, chronic cough, and chronic sputum production3. In addition to cigarette smoking, COPD may arise from certain occupational or environmental exposures such as coal mining4. Pulmonary function tests (PFT) are essential to document airflow obstruction and confirm COPD diagnosis. Post bronchodilator airflow obstruction is defined as a ratio of forced expiratory volume in the first second to the forced vital capacity (FEV1/FVC) below 0.74.Chronic obstructive pulmonary disease (COPD) is a common condition that has a high prevalence worldwide but it is preventable and can be managed5. COPD prevalence varies from one country to another1. Unfortunately, Syria is estimated to have one of the highest COPD prevalence among the Middle Eastern countries as it reached 17.2% compared to 14.3% in other countries in the Middle East and North Africa, adjusted by age and gender using symptoms of persistent coughing or breathlessness7  through various social media platforms (WhatsApp and Facebook). It was posted daily and assured confidentiality on all participants. People had access to the link of the survey 24/7 and can access it using any device. The survey\u2019s first page was confidentiality statement, explain the goals of the research and the reasons for the questionnaire.The survey was originally developed following reviewing relevant literature, designed using the Google forms tool, and consists of 24 questions that were completed within 5\u00a0min. The questionnaire was split into several sections which were: demographic characteristics such as age, gender, education level, smoking habits, and basic knowledge about COPD such as its prevalence, definition, symptoms, and diagnostic test.We confirm that all methods were performed in accordance with the relevant guidelines and regulations and in accordance with the Declaration of Helsinki.All variables are presented as frequency and percentages. Chi-square test was used to determine statistical significance between proportions and differences were statistically significant when p values were\u2009\u2264\u20090.05. SPSS version 25 was used to analyse the data.Online informed consent was taken before proceeding with the survey for participating in the research, and for using and publishing the data. We ensure confidentiality was maintained and asked no questions that might reveal any individual\u2019s identity. No subjects were under the age of 18\u00a0years. Our study protocol and ethical aspects were reviewed and approved by Damascus University Faculty of Pharmacy, Damascus, Syria.A total of 1619 Syrian adults started the survey, 1607 of them completed it fully, with 930 (57.8%) being females, and about 40% were in the age range of 21\u201325\u00a0years. In our study, 950 (59.1%) participants were either health-related field university students or graduates. Overall, 703 (43.7%) were university graduates. A total of 657 (40.9%) of respondents were of non-medical background and 67.8% of the total were living\u00a0in Syrian cities. Demographics of the participants are shown in\u00a0(Table\u00a0p\u2009=\u20090.810).Over half of participants (50.4%) had never smoked, whereas about 23% were current smokers. Characteristics of smoking are displayed in . When comparing age and governorates for the entire sample, there were insignificant differences p\u2009=\u20090.261 and p\u2009=\u20090.406 respectively  had heard of COPD. There was no significant difference in participants who knew what COPD was when comparing genders and living in the city or the countryside for both samples,  had ever heard of the term COPD10, Spain where only 17% spontaneously recognised COPD term16, France where 8% of participants were able to identify the COPD acronym17, and India where they had the lowest level of awareness about COPD as only 0.9 had heard the word COPD11. Our result may be explained by our studied group having higher socioeconomical status than the general population.COPD awareness in our study was different from other reported results from Slovenia (50%)13. Furthermore, a previous study in Syria found that 37.9% of participants were tobacco smokers, including smoking shisha, or/and cigarette18. This emphasises on the need to increase public awareness regarding harmful impacts of smoking on health between Syrians.Among people who stated they have heard of the term COPD, smoking was stated by around 80% as the main risk factor for COPD. However, this was not associated with respondents reported smoking habits. A study in Turkey found that around half of the respondents chose tobacco smoking as the main risk factor of COPD10. In our study, respiratory symptoms were the most common reported symptoms. In the Slovenian study, dyspnoea also was the most knowledgeable symptom of COPD followed by cough15.About three quarters of those who had heard about COPD were aware that COPD refers to chronic bronchitis or/and emphysema. One study in Singapore mentioned that only 10% of its participants were aware of what COPD acronym referred toAround three quarters of those who stated that they know about COPD were aware that PFT was necessary to diagnose COPD, and only 50\u201360% stated that COPD could be a lethal disease, which showed the necessity to increase the knowledge about the danger of COPD on health.19, and this was despite the rising beliefs against smoking after COVID-19 pandemic20. Second-hand smoke exposure was also common in our study which is also a risk factor for COPD.In the Syrian community many COPD risk factors are prevalent, mainly high smoking rates found by our study and others which is highly prevalent in Syria and nearby countries21. One study found that around 3 billion people worldwide use biofuel, mainly in developing countries22.Biofuel is very common in Syria as people are forced to use it due to the deteriorating economy.Biofuel was found to be a risk factor of COPD23 and Syria has heavy air pollution, mainly in major cities.Air quality, either indoors or outdoors, is also an important factor in developing COPD as many pollutant can increase the risk of developing COPD6 (Fig.\u00a0Our finding indicated that there is an urgent need for enhancing levels of public awareness related to COPD in the Syrian community, mainly in participants who were not involved in health-related fields. Increasing awareness about COPD in this population is essential for both an early diagnosis of COPD and managing it, especially with the high prevalence rate of COPD in the Syrian population compared to the other regions and was more common amongst females6 Fig.\u00a0. IncreasThis study came with limitations that affect the generalizability of the results, mainly two; using online methods limited the targeted population and having high educational levels and high rates of respondents in health- care related work or education in this study indicate that the estimated awareness of COPD in Syrian population in our study was probably overestimated as the majority were young and university students or graduates. We attempted to minimise the effect by dividing the sample into two groups and basing the results mainly on respondents that were not studying/working in health-related field which were medicine, pharmacy, dentistry and nursery to reduce the effect of medical background on results as possible.Another limitation was regarding using convenient sampling method, we have used this method as gathering samples from the entire community was not possible and we aimed to be as wide as possible in the community to test their knowledge about COPD.Some missing data in some questions, but the response rate for each question exceeded 95%. No accurate indicated of social-economy status could be used due to the cultural barrier that prevented us from asking about monthly income of the family and difficulty to standardise the results with international standards.In conclusion, there is a lack of awareness of COPD in the Syrian population. Increasing awareness is an emergent priority to help COPD diagnosis and management. COPD and its risk factors are very common in Syria, mainly air pollutants exposure from either actively smoking or indoors/outdoors exposure to particles. There was no significant difference of awareness in non-health related participants when comparing different groups such as genders, ages, governorates, living in the city or countryside and smoking habits."}
+{"text": "Patient-tailored management of thyroid nodules requires improved risk of malignancy stratification by accurate preoperative nodule assessment, aiming to personalize decisions concerning diagnostics and treatment. Here, we perform an exploratory pilot study to identify possible patterns on multispectral optoacoustic tomography (MSOT) for thyroid malignancy stratification. For the first time, we directly correlate MSOT images with histopathology data on a detailed level.We use recently enhanced data processing and image reconstruction methods for MSOT to provide next-level image quality by means of improved spatial resolution and spectral contrast. We examine optoacoustic features in thyroid nodules associated with vascular patterns and correlate these directly with reference histopathology.R2-score of 0.9426) with the vessel diameters on histopathology. Subsequently, we identify features of malignancy observable in MSOT, such as intranodular microvascularity and extrathyroidal extension verified by histopathology. Despite these promising features in selected patients, we could not determine statistically relevant differences between benign and malignant thyroid nodules based on mean oxygen saturation in thyroid nodules. Thus, we illustrate general imaging artifacts of the whole field of optoacoustic imaging that reduce image fidelity and distort spectral contrast, which impedes quantification of chromophore presence based on mean concentrations.Our methods show the ability to resolve blood vessels with diameters of 250\u00a0\u03bcm at depths of up to 2\u00a0cm. The vessel diameters derived on MSOT showed an excellent correlation (We recommend examining optoacoustic features in addition to chromophore quantification to rank malignancy risk. We present optoacoustic images of thyroid nodules with the highest spatial resolution and spectral contrast to date, directly correlated to histopathology, pushing the clinical translation of MSOT.The online version contains supplementary material available at 10.1007/s00259-023-06189-1. The incidence of thyroid nodules in clinical practice is high and is still increasing . ThyroidInternational guidelines recommend the performance of a head and neck US for cancer risk stratification \u20139. ThesePatient-tailored management of patients with thyroid nodules suspicious for malignancy would benefit significantly from improved cancer risk stratification by improving the accuracy of nodule assessment. Multispectral optoacoustic tomography (MSOT) is a rapidly growing imaging modality that may accommodate this need by adding molecular contrast to conventional US. MSOT enables non-invasive macroscopic imaging  at depths of several centimeters. By detecting US waves induced by pulsed laser light illumination, referred to as optoacoustic or photoacoustic waves, MSOT has the potential to distinguish and quantify different intrinsic tissue chromophores such as oxy- (HbO2), deoxyhemoglobin (HbR), and lipid and melanin, as well as exogenous contrast agents . The cliThe current study is a non-blinded, single-center, prospective, pilot study. Patients\u2009\u2265\u200918\u00a0years with thyroid nodules who underwent diagnostic US combined with FNA or had an indication for thyroidectomy  were included between September 2020 and April 2021. An index nodule was defined as a nodule for which diagnostic imaging was indicated. Since this was a pilot study, patient inclusion was stopped after including 21 nodules with final histopathology  system . This system uses a Nd:YAG laser  for the emission of 25-mJ light pulses. A two-dimensional handheld concave detector array (256 transducer elements with a center frequency of 3.4\u00a0MHz and bandwidth (\u2212\u20096\u00a0dB) of 60% in receive-transmit mode, 125\u00b0 angular coverage) was used for cross-sectional imaging with a field of view of 40\u2009\u00d7\u200940\u00a0mm and in-plane spatial resolution up to 200\u00a0\u00b5m , 28.The thyroid nodule and contralateral healthy thyroid was imaged transversely with the patient in a supine position with the neck in hyperextension. The US signal was detected for anatomical guidance of the imaging procedure. At the position of interest, in average 20 MSOT images consisting of 14 optical wavelengths ranging from 680 to 1195\u00a0nm  have been acquired (acquisition time of single frame: 0.56\u00a0s). These wavelengths were chosen to enable detection and reliable unmixing of Hb, HbO2, lipids, H2O, and collagen in accordance with previous studies , 30. Sim1-regularization [For further analysis, the MSOT images with slightest motion were selected utilizing the co-registered US images as reference. MSOT acquisitions at wavelength 1195\u00a0nm were discarded for all scans due to a very low signal-to-noise ratio triggered by strong absorption of the probe\u2019s coupling pad. The remaining raw data of the selected frames was additionally pre-processed with a machine learning-based denoising algorithm . This merization , 33. Therization . The sperization , 26. The2-regularization was employed to decrease the effects of high-frequency noise, and L1-regularization ensured the biologically expected sparse contribution of absorbers to pixel intensities [We employed linear spectral unmixing with literature spectra of HbR, HbO2, lipid, melanin, collagen and H2O on the complete MSOT dataset as performed in previous studies , 19, 20.ensities . Both spMS-OPUS scans of the four blind unmixing components with largest biological interpretability similar to HbO2, HbR, lipids, and H2O were used by two reviewers to evaluate all scans independently. This selection was performed by one medical doctor with research experience in nuclear, optical, and optoacoustic imaging of the head-and neck region and one engineer with research experience in optoacoustic imaging. The selected scans were discussed in the research team comprising mathematicians, radiologist, pathologist, and head neck surgeon. Scans which showed clinically relevant indicators of malignancy observable in MSOT were selected and compared with histopathology for the identification of possible malignancy markers.Going beyond the analysis of single patients, we performed a statistical analysis to discriminate malignant from benign thyroid nodules in our complete data set. To reproduce the results of previous studies, we computed the mean coefficients of HbO2 and HbR over the thyroid nodule and the contralateral healthy thyroid utilizing the linear unmixing results. Oxygen saturation (SO2) was computed as ratio of HbO2 over total blood volume for each pixel \u201320. AddiThe mathematical equations for all algorithms applied for data processing, image reconstruction, spectral unmixing and data analysis are provided in the During surgery, the specimen was marked, and during the whole pathological process, the specimen\u2019s orientation was documented. This made it possible to correlate the scans to histopathology and to check the availability of sufficient histopathological data to correlate MS-OPUS scans to histopathology. Because the MS-OPUS transducer\u2019s sensitivity field leads to imaged cross-section of approximately 3-mm thickness, the histopathological slide (0.5\u20133um) with highest similarity to the MS-OPUS image inside this volume was selected. Histopathological data was discussed with a dedicated thyroid pathologist.Immunohistochemical staining was performed at the Department of Pathology of the University Medical Center Groningen to assess microvascularity in malignant thyroid nodules and in normal thyroid tissue. Based on the location during the imaging of the patients, we selected tissue slides of malignant thyroid nodules and healthy thyroid tissue from the same cases. The selected slides were stained with anti-CD31 antibody, a vascular marker of angiogenesis, using a standardized protocol. Hematoxylin and Eosin (H&E) staining was already performed per standard protocol and available for correlation. Additionally, the microvessel density was scored by an expert pathologist as 0 (low) tot 5\u2009+\u2009(very high) and correlated with the H&E slide and all vascular structures on the H&E pathology slides were marked. Vessel diameters were determined as the width of the manually segmented vessels on the H&E slides.In total, we asked 52 patients for consent  of which 29 agreed to participate and met the inclusion criteria after screening. Thus, a total of 29 patients were enrolled, of which two patients were excluded due to technical failure of the MSOT device , totaling 27 included patients in this study Fig.\u00a0. FourteeChromophores of interest for analyzing thyroid nodules were HbO2, HbR, lipids, H2O, and collagen. HbO2, HbR, and H2O were included, because a common feature in thyroid cancer is enhanced angiogenesis and abundance of microvascularity . Lipids In all 12 selected cases, MS-OPUS showed distinctive patterns. However, in 4 of 12 cases, MS-OPUS could not be correlated to histopathology as no histopathology data was available from the plane at which the MS-OPUS scan was performed. In the remaining eight cases, all MS-OPUS scans showed distinctive patterns on MS-OPUS that could be correlated to histopathology. The following sections will showcase five of these cases and correlate them with available histopathology. The remaining cases are displayed in Supplementary Fig.\u00a0We describe four cases (Case 1\u2013Case 4) with distinctive findings in the MS-OPUS images which are substantiated by histopathology and could not be detected with US alone . Thus, a reflection of the MSOT skin signal can be observed inside the nodule in Case 2  and benign lesions should be included to study if our results can be translated to other types of thyroid nodules. Future studies should also focus on diminishing artifacts in MSOT images, since artifacts may lead to wrong interpretation of images, possibly resulting in inadequate diagnosis and treatment in clinical applications. This requires training of clinicians to decrease the number of artifacts resulting from data acquisition. Algorithmic improvements incorporating optical tissue priors and acoustic ultrasound information as well as uncertainty quantification will both mitigate artifacts like acoustic reflections and enhance the data analysis facilitating the interpretation \u201366. AddiSupplementary file1 (DOCX 13.0 MB)Below is the link to the electronic supplementary material."}
+{"text": "Currently, there are few empirical studies that demonstrate the effects of music on specific emotions, especially in the educational context. For this reason, this study was carried out to examine the impact of music to identify affective changes after exposure to three musical stimuli.The participants were 71 university students engaged in a music education course and none of them were musicians. Changes in the affective state of non-musical student teachers were studied after listening to three pieces of music. An inter-subject repeated measures ANOVA test was carried out using the Positive and Negative Affect Schedule (PANAS) to measure their affective state.The results revealed that: (i) the three musical experiences were beneficial in increasing positive affects and reducing negative affects, with significant differences between the interaction of Music Experiences \u00d7 Moment (pre-post); (ii) listening to Mahler\u2019s sad fifth symphony reduced more negative affects than the other experimental conditions; (iii) performing the blues had the highest positive effects.These findings provide applied keys aspects for music education and research, as they show empirical evidence on how music can modify specific affects of personal experience.The online version contains supplementary material available at 10.1186/s40359-023-01110-9. The studies published on the benefits of music have been on the increase in the last two decades \u20133 and haThe publication in 1996 of the famous report \u201cEducation Hides a Treasure\u201d submitted to the UNESCO by the International Commission was an important landmark in the educational field. This report pointed out the four basic pillars of twenty-first century education: learning to know, learning to do, learning to live together, and learning to be . The twoAdagio for Strings, described by the BBC as the world\u2019s saddest piece of classical music, to 20 advanced music students and 20 advanced psychology students with no musical background and subsequently found that the music only had positive affects on both groups.Numerous studies have used the Positive and Negative Affect Schedule (PANAS) to evaluate the emotional impact of music . This scSeveral experimental designs that used sad music on university students noticed that they experienced both sadness and positive affects , 25 and Following on from Fredrickson\u2019s \u2018broaden\u2010and\u2010build\u2019 framework of positive emotions , positivDanz\u00f3n NO 2. Different results were found in an experiment in which the change in participants \u2018affects was assessed after listening the happy \"Eye of the Tiger\" by Survivor and the sad \"Everybody Hurts\" by REM [There is a great deal of controversy as regards the influence of music on negative affects. Blasco and Calatrava  found a \" by REM . They fo\" by REM , who car\" by REM  conducte\" by REM  found th\" by REM  showed t\" by REM  also fou\" by REM .These studies demonstrate that emotional experience can be actively driven by music. Moreover, they synthesize the efforts to find ways in which music can enhance affective emotional experience by increasing positive affects and reducing the negative ones . Although negative emotions have a great value for personal development and are necessary for psychological adjustment, coping with them and self-regulation capacities are issues that have concerned psychology. For example, Emotional Intelligence , which hThus, although empirical evidence of the effects of music on the emotional sphere is still incipient. It seems that they can increase positive effects, but it is not clear their impact on the negative ones, since diverse and contradictory results (no change and reduction of negative affects after listening to music) were found. In addition, the effects of the type of musical piece (e.g. happy or sad music) need further investigation as different effects were found. Moreover, previous studies do not compare between the effects of listening to versus performing music. Such an approach could provide keys to highlight the importance of performing within music education. Therefore, this study aims to contribute to this scientific field, providing experimental evidence on the effects of listening to music as compared to performing music, as well as determining the effects of different types of music on positive and negative affects.To this end, the effects of three different types of music experiences were compared: (1) listening to a sad piece, (2) listening to an epic and solemn piece, and (3) performing of a rhythm and a blues piece, to determine whether positive and negative affects were modified after exposure to these experimental situations. In particular, two hypotheses guided this study: (1) After exposure to each musical experience , all participants will improve their emotional experience, increasing their positive affects and reducing their negative ones; and (2) the music performance will induce a greater change as compared to the listening conditions.A total of 71 students were involved in this study, 6 men and 65 women between the ages of 20 and 40, who were studying a Teaching Grade. These students were enrolled in the \"Music Education\" program as part of their university degree\u2019s syllabus. None of them had special music studies from conservatories, academies or were self-taught; thus, all had similar musical knowledge. None of them had previously listened to music in an instructional context nor had performed music with their fellow students. In addition, none of them had listening before to the musical pieces selected for this experiment.All signed an informed consent form before participating and no payment was given for taking part in the study. As the experiment was carried out in the context of a university course, they were assured that their participation and responses would be anonymous and would have no impact on their qualifications. The research was approved by the ethical committee at the Universidad Cat\u00f3lica de Valencia San Vicente M\u00e1rtir: UCV2017- 18-28 code.To assess emotional states, the Positive and Negative Affective States scales (PANAS), was administered . In partThe PANAS consists of 20 items which describe different dimensions of emotional experience. Participants must answer them regarding to their current affective state. The scale is composed of 20 items; 10 positive affects (PA) and 10 negative affects (NA). Answers are graded in a 5-options , with reversed items, ranging from extremely (1) to very slightly or not at all (5).The musical pieces choice stemmed from the analysis of some of the music elements that most influence the perception of emotions: mode, melody and intervals. Within the melody, range and melodic direction were distinguished. The range or amplitude of the melodic line is commonly divided into wide or narrow, while the melodic direction is often classified as ascending or descending. Chang and Hoffman  associatIn relation to the mode, Tiz\u00f3n  stated tIn this research, the selected pieces  are representative examples of the melodic, intervallic and modal characteristics previously exposed. Mahler's and Vangelis's pieces completely differ in modes and melodic amplitude (sad vs. heroism). Likewise, Mahler's piece is much more chromatic than Vangelis' one, which has a broader melody made up of third, fourth and fifth intervals, often representative of heroism. Those features justify the fact that they have been used as soundtracks in two films belonging to the epic genre  and drama .The musical piece that was performed by the students was chosen in order to be easy to learn in a few sessions, since they were not musicians. So, three musical pieces were used for the experimental conditions, the first two musical pieces were recordings in a CD, while the third one was performed by the subjects.The three chosen pieces are described below:Condition 1 (MML): \u201cAdagietto\u201d from Gustav Mahler\u2019s Fifth Symphony (9:01\u00a0min), performed by the Berlin Philharmonic conducted by Claudio Abbado . This isCondition 2 (VML): \u201cTitans Theme\u201d from Alexander the Great (3:59\u00a0min), directed by Oliver Stone and premiered in 2004, whose music was composed, produced and performed by Vangelis . It has Condition 3 (BP): \u201cRhythm\u2019s Blues\u201d composed and played by Ana Bort (4:00\u00a0min). This is a popular African-American piece of music with an insistent rhythm and harmonically sustained by tonal degrees. This piece was performed by the participants using percussion instruments .1\u2009=\u200936 and N2\u2009=\u200935) that participated separately in all the phases of the study. The first two conditions (MML and VML) were carried out in each group's classroom, while the performance (BP) was developed in the musical instruments room. This room had 52 percussion instruments, including different types of chimes, xylophones and metallophones . It is a large space where there are only chairs and musical instruments and stands. The first group was distributed as follows: 6 chimes , 5 soprano xylophones, 5 alto xylophones, 5 bass xylophones, 5 soprano metallophones, 5 alto metallophones and 5 bass metallophones. The distribution of the second group was similar, but with one less alto metallophone.The sample was divided into two groups . After the two practical lessons, during the next three sessions (leaving two weeks between each session), the experiment was carried out. In each session, an experimental condition was applied and PANAS was on-line administered online beforehand and afterwards (Pre-Post design). All participants were exposed to the three experimental conditions and completed the scale before and after listening to music.In each of these three sessions, a different music condition was applied: MML in the first one, VML in the second one and BP in the third one.As conditions VML and MML were listening to pieces of music, the instructions received by the subjects were: \u201cYou are going to listen to a musical piece, you ought to listen actively, avoiding distractions. You can close your eyes if you feel like to\u201d. For the BP condition, they were said to play the musical sheet all together.The aim of the study was to examine the effect of the music experience variable  in the Positive and Negative Affects subscales from the PANAS scale. The variable Moment was also studied to control biases and to analyze differences between the Pre and Post conditions.The experiment was designed as a two-way repeated measure (RM) ANOVA with two dependent variables: Positive Affects and Negative Affects, one for each PANAS\u2019 subscales.The two repeated measures used in the experiment were the variables Musical Experience (ME), with three levels  and the variable Moment, with two levels (PRE and POST). All participants were exposed to the three experimental conditions.The design did not include a control group, similar to many other studies in the field of music psychology , 30. TheAdditionally, one of the goals of this study was to compare the effects of listening to music compared to performance on affects. For this reason, two music listening experiences (MML and VML) and a musical performance experience (BP) were designed. In order to control potential biases, participants did not know the musical pieces in the experimental conditions and they had a low level of musical performance competence (musicians were excluded).It was used SPSS statistics v.26 for the statistical analyzes.Two ANOVA were performed. The first one, analyzed two dependent variables at the same time: Positive Affects (PA) and Negative Affects (NA).In the second ANOVA, the 20 items of the PANAS scale were taken as dependent variables. The rest of the experimental design was similar to the first one, a two-way RM ANOVA with variables Musical Experience (ME) and Moment as repeated measures.Examination of frequency distributions, histograms, and tests of homogeneity of variance and normality for the criterion measures indicated that the assumptions for the use of parametric statistics were met. Normality was met in all tests except for one, but the ANOVA is robust against this assumption violation. All the analyses presented were performed with the significance level  set at 0.05, two-tailed tests. Means and standard deviations for the 6 experimental conditions for both subscales, Positive Affects and Negative Affects, are presented in Table p\u2009<\u20090.05). The test only was significant for Musical Experience for PA as dependent variable (p\u2009<\u20090.05). The rest of the W\u2019s Mauchly were not significant (p\u2009>\u20090.05), so we assumed sphericity for the non-mentioned variables and worked with the assumed sphericity univariate solution. For the variables which the W\u2019s Mauchly was significant, the univariate solution was also taken, but choosing the corrected Greenhouse\u2013Geisser epsilon approximation due to its conservativeness.Mauchly\u2019s test of sphericity was statistically significant for Musical Experience and Musical Experience*Moment focusing on NA as the dependent variable \u2009=\u200945.291, p\u2009<\u20090.05, \u03b72\u2009=\u20090.393; and the Musical Experience*Moment interaction F\u2009=\u200932.502, p\u2009<\u20090.05, \u03b72\u2009=\u20090.317 were found for PA.A significant principal effect of the Musical Experience variable F\u2009=\u200922.505, p\u2009<\u20090.05, \u03b72\u2009=\u20090.503 and Musical Experience*Moment interaction F\u2009=\u20098.594, p\u2009<\u20090.05, \u03b72\u2009=\u20090.109, but not for Musical Experience F\u2009=\u20092.713, p\u2009<\u20090.05, \u03b72\u2009=\u20090.037, for the other dependent variable, NA.Statistically significance was found for Moment F\u2009=\u200970.729, p\u2009<\u20090.05). It also shows that the musical condition MML is significantly above BP in Positive Affects (p\u2009<\u20090.05).Table p\u2009<\u20090.05) for all the three conditions for both Positive and Negative Affects dependent variables. The Pre-Post difference found in Positive Affects for the VML Musical Experience did not reach the statistical level (p\u2009=\u20090.319).As regards Moment variable Table , all butFocusing on these statistically significant differences, we observe that conditions MML and BP, for PA, decreased from Pre to Post condition, indicating that positive emotions increased significantly between pre and post measures. On the other hand, for NA, all conditions increased from Pre to Post conditions, indicating that negative affects were decreased between pre and post conditions. Once again, one should bear in mind that items were reversed, thus, a higher scores in NA means a decrease in affects.In order to measure the interaction effect, significant differences between simple effects were analysed.The simple effect of Moment (level2-level1) in the first Music Experience condition (MML) in PA was compared with the simple effect of Moment (level2-level1) in the second Musical Experience condition (VML). Music Experience conditions 2\u20133 (VML-BP) and 1\u20133 (MML-BP) were compared in the same way. Thus, taking into account PA and NA variables, a total of 6 comparisons, 3 per dependent variable, were made.p\u2009<\u20090.05) which means that there are statistically significant differences between all the Musical Experience conditions when comparing the Moment (pre/post) simple effects.The results of these comparisons are shown in Table In Table Interested, Excited, Strong, Enthusiastic, Proud, Alert, Inspired, Determined, Attentive, Active, Distressed, Upset, Guilty, Afraid, Hostile, Irritable, Ashamed, Nervous, Jittery, Scared; in each musical condition: MML, VML and BP; and for the PRE and POST measurements, can be found in the Additional file In this second part, the results obtained from the second two-way RM ANOVA with the 20 items as dependent variables are considered. Results of the descriptive analysis of each item: Interested, Alert, Inspired, Active and Irritable. For these items, the highest observed power index among Greenhouse\u2013Geisser, Huynh\u2013Feldt and Lower-bound epsilon corrections was taken for each variable. For the interaction Musical Experience*Moment, sphericity was not assumed for Distressed, Guilty, Hostile and Scared. For these items, the same above-cited criterion was followed.As regards the ANOVA test that compares the three experimental conditions in each mood, Mauchly\u2019s Sphericity Test indicates that sphericity cannot be assumed for the musical experience in most of the variables of the items of effects, except for Nervous, Jittery, Scared, Hostile and Upset) (p\u2009<\u20090.05). For more detail see Table S1 from Additional file Musical experience has a principal effect on all the positive affects, but only has it for 5 negative affects (p\u2009<\u20090.05) for all (positive and negative), but two items: Guilty (p\u2009=\u20090.073) and Hostile (p\u2009=\u20090.123). All the differences between Pre and Post for positive affects are positive, which means that scores in conditions Pre were significantly higher than in condition Post. The other way around occurs for negative affects, all the differences Pre-Post are negative, meaning that the Post condition is significantly higher than the Pre condition. For more detail, see Table S2 from Additional file Guilty (p\u2009=\u20090.073) and Hostile (p\u2009=\u20090.123).The principal effect of Moment is also statistically significant  and 4 negative moods .The effect of interaction, shown in Table S3 from the Additional file Active) which present significant differences between the three musical conditions. Items Concentrated and Decided do not present any significant difference between any musical conditions. The rest of the Positive items show at least one significant difference between conditions VML and BP. All differences are positive when comparing VML-MML, VML-BP MML-BP, except for Alert and Proud. So, in general, scores are higher for the first two conditions in relation to the third one, meaning that third musical condition presents the biggest increase for Positive Affects (remember items where reversed). For more detail see Additional file The pairwise comparisons of Musical Experience\u2019s levels show a wide variety of patterns. Looking at Positive Affects, there is only one item . For Jittery; all three conditions differed significantly from each other (p\u2009<\u20090.05). Conditions MML and BP differed significantly for Hostile (p\u2009<\u20090.05) and conditions VML and BP almost differed significantly for Upset item, but null hypothesis cannot be rejected as p\u2009=\u20090.056. For more detail see Additional file Nervous and Jittery. So, in general, scores are lower for the first and second condition in relation to the third one.As regard pairwise comparisons of Musical Experience\u2019s for negative affects, only the items which had a significant principal effect of the variable Musical Experience are shown here. There is a significant difference between conditions VML and MML in item musical experience x Moment interaction, all the comparisons were significant, with bigger differences in the interpretation of the blues (BP) than in listening to Mahler (MML) and Vangelis (VML). However, the comparison between both experiences, although significant, was smaller. These results indicate that performing music is significantly effective in increasing positive effects. We will explain these results in greater detail below as regards the specific affective states.Positive effects increased significantly during the post phase of all the music experiences, showing that exposure to any of the three music stimuli improved positive affectivity. There were also significant differences between the three experiences in this phase, according to the following order of improvements in positive affectivity: (1) the rhythm and blues performance (BP), (2) listening to Mahler (MML) and (3) listening to Vangelis (VML). As regards the effects of the musical experiencie x Moment showed that all the comparisons were significant, with a larger difference between MML and VML than the one between BP and each of the other experiences. Listening to Mahler (MML) was more effective in reducing negative affects, compared to both listening to Vangelis and interpreting the blues (BP). These results agree with previous studies [As regards Negative Affects, the comparison of the simple effects showed that these decreased after the musical experiences, although in this first analysis the VML musical experience did not differ from the other two. However, the results of the effects of the interaction between  studies , 32, in . For example, there were two items (Guilty and Hostile) that did not obtain significance. These results are consistent with the fact that music has certain limits as regards its impact on people\u2019s affects and does not influence all equally. For example, Guilty has profound psychological implications that cannot be affected by simple exposure to certain musical experiences. This means we should be cautious in inferring that music alone can have therapeutical effects on complex emotional states whose treatment should include empirically validated methods. Also, emotional experiences are widely diverse so that any instrument used to measure them is limited as regards the affective/emotional state under study. These results suggest the importance of reviewing the items that compose the PANAS scale in musical studies to adapt it in order to include affective states more sensitive to musical experiences and eliminate the least relevant items.The analysis of the specific affective states shows that most items that belong to Positive Affect scale are the most sensitive ones to the PRE-POST change, the different musical conditions and the interpretation of both effects. However, some items of the Negative Affect scale did not differ in the different music conditions or in the music experience \u00d7 Moment interactionInspired and Attentive) and reducing 10 negative affects . This shows that this music condition had a greater effect on the negative affects than the other ones. These results agree with previous studies [The analysis of the results in the specific affective states, allows us to delve deeper into each experimental condition. Thus, regarding the results obtained in the complete scale of PANAS, listening to Mahler (MML), causes desirable changes by raising two positive affects  and reduced 8 negative affects . Surprisingly, two positive affects were reduced in this experimental condition (Alert and Attentive). It could be explained due to the characteristic ostinato rhythm of this piece of music. It was found a similar effect in the study by Campbell et al., [Listening to Vangelis (VML) increased 3 positive affects  increased all 10 positive affects, indicating that performing is more effective in increasing positive affects than listening. These results agree with the study by Dunbar et al. , who fouJittery increased after the blues performance. It could be explained by the negative experience that is sometimes associated with music performance. Therefore, it should be taken into account that music performance could increase some negative effects. For example, Dimsdale et al. [Performing the blues (BP) reduced 6 negative affects, although it was more effective in increasing positive affective states. Vigorous rhythmic music was also found to be positively associated with the use of all the forms of regulating emotions, which suggests that this type of music is especially useful for emotion modulation . It was e et al.  found thTo sum up, this study contributes to the scientific field on the following points: (1) all the musical experiences had significant effects on improving emotional states, increasing positive affects and decreasing the negative ones, which shows the importance of musical experiences on improving the affective sphere; (2) the specific affects that increased, decreased or did not change for each musical experience were identified, providing specific and useful keys for the design of future interventions; and (3) the differences between various types of musical experiences were analyzed, finding more improvements in the performing conditions than in the listening ones.The sample, made up of university students with a very homogeneous profile in terms of age and sociodemographic characteristics, could limit the generalization of the results. In addition, the low percentage of men in the sample could also affect the generalizability of the results, although no previous studies have reported gender-based differential effects on the positive and negative affects after musical experiences.Besides, the choice of the pieces of music was based on theoretical criteria and students\u2019 music preferences were not taken into account. This will be included in future research, since the specific choice of the pieces could affect the positive or negative valence of participants\u2019 emotions. However, the goal of using pieces of music not chosen by participants was to elicit new musical experiences for them. Furthermore, no participant was a musician and none of them had previous knowledge of any of the pieces, which may lead to a bias in the results.In relation to this, the huge amount of available pieces of music, all of them influenced by their cultural and historical context, make it difficult to generalize that certain music parameters correlate with specific emotions. It would be necessary a cross-cultural approach to reach that conclusion.It is recommended to introduce the variables of music preferences and music history to control their effect on the results and to be able to compare the different musical parameters of the pieces together with participants\u2019 preferences.Likewise, it would be interesting to identify the affects with a greater or lesser degree of influence by music, to adjust the psychological evaluation instrument to the characteristics of the experiment, including items of emotions that can be modified after exposure to a music experience.Tranquility, Gratitude, Elevation), in order to measure more exactly the effects of music on people\u2019s affective experiences.The PANAS manual  indicateAccordingly, it would be interesting to evaluate participants' affective traits to establish a baseline and control personality variables, helping to delve into the different levels of the hierarchical structure of affectivity and its relationship with the various music parameters.Finally, it is recommended that the psychology of music include objective psychophysiological measurements together with self-report evaluations, so that conclusions arising from the experiments have greater robustness and can increase the impact of the contribution to the scientific community.This study have shown how different music experiences, such as listening and performing, influence the changes in positive and negative affects in student teachers. The results show that the three musical experiences studied are effective in improving the affects by comparing the emotional states before and after the music experiences. It was also showed that there are differences between the effects obtained in each of the music experiences. Besides, improving both types of affects will depend largely on the selected music for the purpose. Although further evidence is required, the results support the importance of music in education, since it provides tools to increase positive affects and to decrease the negative ones, which is important for emotional intelligence development , 54.The three music experiences studied are more effective in reducing negative emotional states than in increasing the positive ones. This finding provides useful clues for music teachers to provide strategies that favor emotional regulation. For instance, in order to reduce hostility, irritability and nervousness, students could be exposed to musical auditions of both sad and solemn pieces, choosing musical pieces with similar characteristics to those described in this study. These auditions will be a resource for stress management in the classroom, as well as a tool that students can adopt and generalize to other contexts. Moreover, it is highly likely that students have not heard this type of music before and this experience could increase their repertoire of musical preferences, enhancing their emotional regulation.The blues performance had a greater impact on participants' positive affects than listening to the other two pieces so, if any teacher wants to increase them , students could be asked to perform simple pieces such as Rhythm's Blues. In this way, musical performance could increase students' resources, contributing to higher levels of motivation, concentration and interest, which promotes learning \u201358. LikeThis study shows that experiencing with various unknown musical pieces can have positive effects on emotions. According to this finding, university professors of Teaching grade in music education should encourage future teachers to experience various musical styles, rhythms and tonalities, avoiding prejudices. Thereby, future music teachers will be able to use a diversity of musical experiences that broaden the emotional effects and fulfill the socio-emotional function of music education. In relation to Fredrickson's 'broaden\u2010and\u2010build' framework of positive emotions , music cAdditional file 1. Results obtained from item analyses."}
+{"text": "Glioblastoma multiforme (GBM) is the most common and aggressive type of malignant primary brain tumor, and it is characterized by a high recurrence incidence and poor prognosis due to the presence of a highly heterogeneous mass of stem cells with self-renewal capacity and stemness maintenance ability. In recent years, the epigenetic landscape of GBM has been explored and many epigenetic alterations have been investigated. Among the investigated epigenetic abnormalities, the bromodomain and extra-terminal domain (BET) chromatin readers have been found to be significantly overexpressed in GBM. In this work, we investigated the effects of BET protein inhibition on GBM cell reprogramming. We found that the pan-BET pharmacological inhibitor JQ1 was able to promote a differentiation program in GBM cells, thus impairing cell proliferation and enhancing the toxicity of the drug Temozolomide (TMZ). Notably, the pro-differentiation capability of JQ1 was prevented in autophagy-defective models, suggesting that autophagy activation is necessary for BET protein activity in regulating glioma cell fate. Given the growing interest in epigenetic therapy, our results further support the possibility of introducing a BET-based approach in GBM clinical management. GBM is the most common and aggressive type of malignant primary brain tumor, and it is characterized by a high recurrence incidence and poor prognosis ,2. DespiFor this reason, the elucidation of the molecular mechanisms controlling GSCs has aroused great interest in obtaining novel therapeutical strategies.Unlike other brain cancers, GBM contains neural precursors endowed with features expected from neural stem cells (NSCs) . There aIntriguingly, the BET member BRD4 has been found to act as a transcriptional repressor of the autophagic process . In detaThe role of autophagy in cancer onset and progression remains controversial as it may promote or hinder tumor progression depending on the tumor type and stage. In GBMs, autophagy has been often associated with chemoresistance mechanisms, although growing evidence has also indicated that autophagy induction can counteract GBM proliferation and invasiveness ,27,28,29It has been demonstrated that autophagy modulates the proliferation and differentiation of normal neuronal stem cells (NSCs), as well as NSC niche maintenance; on the contrary, its failure may contribute to GSC expansion and maintenance ,31.In this work, we investigated the impact of BET protein inhibition on GBM cell reprogramming in both in vitro and in ex vivo models. We found that the pan-BET pharmacological inhibitor JQ1 was able to promote a differentiation program in GBM cells, likely toward a neuronal-like phenotype, thus impairing cell proliferation and sensitizing cells to the drug Temozolomide (TMZ). Notably, the pro-differentiation capability of JQ1 was less evident in autophagy-defective models, suggesting that autophagy activation is necessary for BET protein activity in regulating glioma cell fate.Abnormal BET mRNA and protein expression has been previously observed in glioma in vitro and ex vivo models. Western blotting analysis from GBM patient biopsies highlighted a significant increase in the expression levels of the BRD4 and BRD2 proteins when compared to non-tumoral ones A. We alsIt has been reported that BET protein inhibition by small synthetic molecules is able to inhibit GBM cell proliferation in in vitro and in vivo models. In order to investigate the effect of BET inhibition on GBM tumorigenesis, we took advantage of the pan-BET inhibitor JQ1. Firstly, to test the effect of JQ1 on cell proliferation and viability in our cellular models, we performed cell counts on U87 and GH2 cells grown in the presence of 0.1 and 0.5 \u03bcM of JQ1 for 24, 48, and 72 h. JQ1 significantly affected cell proliferation beginning at 48 h of treatment for both the concentrations employed and in both cell models A,B. Then, we investigated the effect of JQ1 stimulation on cells treated with Temozolomide (TMZ), the first-line chemotherapeutic agent for GBM treatment. As shown in Surprisingly, the JQ1-treated U87 cells showed marked morphological changes when compared to the untreated cells. In detail, an increase in cells bearing cytoplasmic extensions and an elongation of cytoplasmic extensions was observed, beginning at 24 h, and this was more evident at 48 and 72 h A. The saIt has been reported that JQ1 suppresses tumor growth through the regulation of the PI3K/AKT1/mTOR pathway in several cancer models, including GBM. We analyzed the activity of the AKT1 and mTOR kinases by means of specific phospho-antibodies, and we observed a significant dephosphorylation of AKT1 and the mTOR substrate p70S6K in the U87 cells treated with 0.5\u03bcM of JQ1, especially after 48 and 72 h of stimulation A. As Akt/mTOR also regulates autophagy, we also investigated the effect of JQ1 stimulation on the autophagy process in our models. Western blotting analyses indicated that JQ1 modulates the protein expression of some autophagy players in U87 and GH2 cells . In detaIt has been described that functional autophagy is required to promote differentiation and reduce the stemness properties of cancer stem cells ,32. By tNotably, using Western blotting analysis, we found that the increase in \u03b23-tubulin and synaptophysin, observed upon JQ1 treatment in the sh-CTR cells, was significantly less evident in the sh-BECN cells B. ImmunoTo further investigate the impact of autophagy on JQ1-induced cell differentiation, experiments were also performed on GH2 cells in the presence of the autophagy pharmacological inhibitor CQ, which is known to impair autophagosome\u2013lysosome fusion in the last step of autophagy. According to the results obtained for the BECLIN 1-devoid cells, the \u03b23-tubulin up-regulation induced by JQ1 treatment was hampered by CQ co-administration, as was synaptophysin expression D. Taken The BET protein family consists of three members commonly expressed in mammals, which contain two tandem bromine domains that recognize and bind to acetylated lysine residues on histones H3 and H4 and on non-histone proteins ,36. ThroAmong the four members, BRD4 has been found to be overexpressed in GBM cells, and it was inversely correlated to overall survival in patients in the TCGA and CGGA databases ,38. In tAutophagy plays a crucial role during embryonic development and differentiation, ensuring proper cell homeostasis and maintaining the stemness properties of self-renewal cells ,44,45. SGiven the growing interest in epigenetic therapy, which consists of manipulating the deregulated epigenome of cancer cells, our results further support the possibility of introducing a BET-based approach in GBM clinical care.Human GBM U87MG (U87) and GH2 cell lines were kindly provided by Prof. G. Velasco . The GH2 were cells derived from a GBM patient and were obtained from the Spanish National Cancer Center  biobank (GH2). All procedures involving samples of human origin were performed with the approval of the corresponding ethical committees from each institution, as well as that of the ethical committee of Complutense University . Histopathological typing was completed according to the WHO criteria and resulted as grade IV. Briefly, GIC cultures were obtained by using the following procedure: tumour samples were mechanically and enzymatically dissociated with 0.12 mg/mL of the collagenase type Ia from Clostridium histolyticum  for 2 h at 37 \u00b0C and filtered using a 100 \u03bcm nylon filter . Human GBM GL15 cells were kindly provided by Dr. E. Castigli of the University of Perugia, Italy. The GL15 shBECLIN1 and GL15 shCTR cells were prepared by lentiviral infection as previously described . Human b2 humidified atmosphere. Where indicated, the U87 and GH2 cells were cultured in Neurobasal medium in the presence of a B27 supplement. Neurobasal medium was added directly to monolayers or, alternatively, to cell suspensions to allow tumorsphere formation. We added 0.1 \u00b5M and 0.5 \u00b5M of JQ1  to the culture medium for 24, 28, and 72 h, as indicated. Cells treated with the vehicle (DMSO in cell culture media) served as the control. In order to inhibit autophagy and to monitor autophagy flux, 20 \u00b5M of CQ was added to the culture medium for the last 16 h of the JQ1 treatment. For the proliferation and apoptosis assays, 500 \u03bcM of Temozolomide  was employed for the time indicated.Human U87, GL15, and GH2 cells were cultured in DMEM  and supplemented with 10% heat-inactivated FBS  and a 1% penicillin/streptomycin solution . The cells were grown at 37 \u00b0C in a 5% COg for 15 min at 4 \u00b0C. The supernatants were recovered and the protein concentrations were determined using a Lowry protein assay . Laemmli buffer 5X  was added to supernatants and the samples were boiled at 95 \u00b0C for 5 min. The proteins extracts were separated on SDS-PAGE and then electroblotted onto nitrocellulose  using a turbo trans-blot transfer system . After blocking with 5% fat-free milk powder in Tris-buffered saline and 0.1% Tween-20, the membranes were probed overnight at 4 \u00b0C with primary antibodies. Detection was obtained by using horseradish peroxidase-conjugated secondary antibody , the protein antibody immunocomplexes were visualized with ECL plus , and chemiluminescence was recorded using a ChemiDoc MP system . The following primary antibodies were used: anti-BRD4, anti-BRD2, anti-ALDH1L1, anti-Synaptophysin, anti-\u03b2-III-Tubulin, anti-p62, anti-ULK1, anti-BECLIN1, anti-GAPDH, and anti-HSP90 , as well as anti-Akt, anti-p-Akt, anti- P-p70S6K, anti-p70S6K, anti-LC3B, anti-P-ERK1/2 (Thr 202/Tyr 204), anti-ERK1/2, , anti-vinculin, and anti-\u03b2-Actin . Densitometric analysis was performed using Image J software for Windows .The protein extracts were prepared by lysing cells with the appropriate amount of RIPA buffer . After incubation on ice for 20 min, the samples were centrifuged at 160,000\u00d7 The cells were grown on coverslips and fixed with 4% PFA in PBS, followed by permeabilization with 0.1% Triton X-100 in PBS for 5 min at room temperature, which was blocked in Bovine Serum Albumine (BSA) dissolved in 0.1% PBS Triton for 30 min. The \u03b2-III-Tubulin  and LC3  primary antibodies were incubated overnight at 4 \u00b0C and visualized by means of Alexa 488 Fluor secondary antibodies . After nuclear staining with DAPI , the coverslips were mounted with Fluoroshield mounting medium  and examined under a confocal microscope . Leica Application Suite X software equipped with a 40 \u00d7 1.40\u20130.60 NA HCX Plan Apo oil BL objective at RT was used for image acquisition and analysis. The lengths of the cytoplasmic extensions were evaluated at different time intervals and for each experimental group at different fields derived from observation under the light microscope  at 20\u00d7 magnification. Morphological analysis was performed with ImageJ software. The lengths of the cytoplasmic extensions are expressed in arbitrary units.The GBM cells were grown on 12-well plates in the presence of the indicated stimuli or of the vehicle. Cell proliferation was assessed by counting cells in a THOMA chamber at the indicated time points after trypsinization. At least three counts for each condition were performed in each experiment. For apoptosis detection by DAPI staining of the nuclei, the cells were grown on coverslips and fixed with 4% PFA in PBS followed by DAPI staining. The fragmented and condensed nuclei (apoptotic) and the intact nuclei were counted under a confocal microscope as described above. At least 10 fields at 20\u00d7 magnification were counted. FACS analysis by flow cytometry was also performed to detect the subG1 and apoptotic cells. The cells were plated in 35 mm plates in complete medium and treated with JQ1, TMZ, or their combination for 48 h. After treatment, the cells were trypsinised, washed in sample buffer, and fixed in a cold methanol/acetone (4:1) solution. Before analysis, 250 \u03bcM of propidium iodide was added for 30 min. Flow cytometry (FACS) analysis of the cell cycle was performed using an FACSCalibur .t-tests were used. p-values of \u22640.05 were considered significant. All experiments were performed at least three times. GraphPad Prism software  was used for the statistical analysis. All results presented in this study are expressed as means \u00b1 SDs (standard deviations). Statistical significance was determined, as indicated, by using one-way ANOVA followed by a Tukey\u2019s post hoc test or two-way analysis of variance (ANOVA) followed by a Bonferroni\u2019s post hoc test. For immunofluorescence analyses, Student\u2019s"
\ No newline at end of file