diff --git "a/deduped/dedup_0912.jsonl" "b/deduped/dedup_0912.jsonl" new file mode 100644--- /dev/null +++ "b/deduped/dedup_0912.jsonl" @@ -0,0 +1,52 @@ +{"text": "Despite bacteraemia is present in the majority of patients with pneumococcal, little is known about the influence of the systemic infection on the meningeal inflammatory response.6 CFU Streptococcus pneumoniae, type 3, and the 26 rabbits were either provided with ~1 \u00d7 106 CFU S. pneumoniae intravenously at 0 hour , immunized with paraformaldehyde-killed S. pneumoniae for 5 weeks prior to the experiment , or not treated further . WBC and bacterial concentrations were determined in CSF and blood every second hour during a 16 hours study period together with CSF IL-8 and protein levels. We also studied CSF and blood WBC levels in 153 pneumococcal meningitis patients with and without presence of bacteraemia.To explore the role of systemic infection on the meningeal inflammation, experimental meningitis was induced by intracisternal injection of ~1 \u00d7 10P < 0.05), whereas no differences in CSF bacterial levels were observed (P > 0.05). Blood WBC decreased in bacteraemic rabbits between ~10\u201316 hours after the bacterial inoculation in contrast to an increase for both the immunized rabbits and controls (P < 0.05). The CSF pleocytosis was attenuated in bacteraemic rabbits as compared to the two other groups between 12\u201316 hours from time of infection (P < 0.017), despite accelerated CSF IL-8 levels in bacteraemic rabbits.As designed, blood bacterial concentrations were significantly different among three experimental groups during the 16 hours study period , but there was a significant correlation between CSF and blood WBC .In patients with pneumococcal meningitis, no significant difference in CSF WBC was observed between patients with or without bacteraemia at admission vs. n = 50, 1961 cells/\u03bcL (673\u20135182), respectively, Our results suggest that a decrease in peripheral WBC induced by enhanced bacteraemia in pneumococcal meningitis results in an attenuated CSF pleocytosis. Streptococcus pneumoniae meningitis is characterized by an accumulation of leukocytes within the subarachnoidal space. It has been suggested that host inflammatory reactions to the invading pathogen are largely responsible for the poor outcome of pneumococcal meningitis, because pathophysiological alterations leading to death continue to evolve after the bacterial eradication by antibiotic therapy , whereas only sparse information has been generated about the influence of pneumococcal bacteraemia on the recruitment of leukocytes to local infections sites. In contrast to our results, Sato et al. [Several studies have previously documented an altered leukocyte function during endotoxemia declare that they have no competing interests.C\u2205 provided the scientific idea of the study, designed the study, and drafted the manuscript. TOR, CB, NFM, and JDL took part in preparation of the manuscript. All authors approved the final manuscript.The pre-publication history for this paper can be accessed here:"} +{"text": "These results may indicate (a) normalheart function, due to heart sparing, in the IUGR group (b) potential crossing of the placental barrier by cTnI in both groups.Intrauterine growth restriction (IUGR) implies fetal hypoxia, resulting in blood flow redistribution and sparing of vital organs. Serum cardiac Troponin-I (cTnI), a well-established marker of myocardial ischaemia, was measured in 40 mothersprior to delivery, the doubly clamped umbilical cords , and their 20 IUGR and 20 appropriate-forgestational-age (AGA) neonates on day 1 and 4 postpartum. At all time points, no differences in cTnI levels were observed betweenthe AGA and IUGR groups. Strong positive correlations were documented between maternal and fetal/neonatal values ( Cardiac troponin (cTn), an inhibitory protein complex located on theactin filament in all striated muscles, consists of three subunits T, I, and C and coorIntrauterine growth restriction (IUGR) caused by the chronic malnutrition and hypoxia , 9 full-term infants. Therefore, we aimed todetermine circulating cTnI levels in IUGR and AGA pregnancies at time-pointscharacteristic for intra-and extrauterine life, and correlate determinedlevels with gestational age, gender, and mode of delivery.The Ethics Committee of our teaching hospital approved thestudy protocol. All included mothers provided signed informed consent beforerecruitment. Forty parturients giving consecutively birth either to 20 AGA or20 asymmetric IUGR full-term singleton infants with a birth weight below the 3rdcustomized centile were included in the study. The Gestation Related OptimalWeight computer-generated program , 14was Doppler studies were performed in the IUGR group every10\u201315 days, starting from the 32nd gestational week. During each Dopplervelocimetry evaluation, three consecutive measurements of the pulsatility index(PI) of the studied vessel were done and the mean value was recorded.Concerning uterine and umbilical arteries , 15, meaIn contrast, in the AGA group, mothers were healthy andwere either nonsmokers or had abstained from smoking during pregnancy.Moreover, placentas were normal in appearance and weight.All neonates had no symptoms of intrauterine infection or stigmata ofgenetic syndromes. One- and five-minute Apgar scores were \u22658 and umbilicalcord pH values were \u22657.25 in all IUGR cases and AGA controls. The demographic data of participating infantsand their mothers are shown in Blood was collected at specific time points as follows: (1) from themother (MS) during the first stage of labour, or before receiving anaesthesiain cases of elective caesarean section, (2) from the doubly clamped umbilicalcord (UC), reflecting the fetal state, and (3) from the neonates on postpartumdays 1 (N1) and 4 (N4), which are characteristic for transition andstabilization to extrauterine life, respectively. Blood was collected inpyrogen-free tubes and was immediately centrifuged after clotting. Thesupernatant serum was stored at \u221280\u00b0C until assay. cTnI was determined by a commercially available enzyme immunoassay kit . All specimens were run in duplicate. The detection limit was 0.1 ng/mL. Theintra- and interassay coefficients of variation were 2.8% and 6.7%,respectively. The antibodies used in this assay were highly specific for cTnIand there was no cross-reactivity with cTnT or skeletal troponin-T. t test with Bonferroni correction for multiple comparisons, and Spearman's or Pearson's correlation coefficient were used as appropriate. P < .05 was considered statistically significant. cTnI was normally distributed; thus, Anova for repeated measures, paired samples Mean (SD) circulating cTnI levels in AGA andIUGR groups at all time points are shown in r = .536, P = .018, r = .498, P = .025 and r = .730, P < .001, resp.). Additionally, N4 cTnI levels positivelycorrelated with UC and N1 levels . As expected, birth weight positively correlated withgestational age . In the AGA group, no statisticallysignificant differences in cTnI levels were observed between MS, UC, N1, andN4. MS cTnI levels positively correlatedwith respective levels in UC, N1, and N4 (P < .012) and N4 (P = .026). Additionally, MS cTnI levels positively correlated with respective levels in UC, N1, and N4 . N1 cTnI levels positively correlated with N4ones . Finally, gestational age positively correlated with birth weight . In the IUGR group, MS cTnI levels were significantly lower compared to respective levels in N1 , P = .04]. Lastly, gestational age and mode of delivery did not affect cTnI levels in both groups. The effect of gender on cTnI levelswas found to be significant in the IUGR group see . Thus, cAlthough cTnI has been extensively investigated as a diagnostic andprognostic marker of myocardial damage and outcome in paediatric and adultpopulation \u201319, dataAlthough some investigators claim that cTnI levels are undetectable inhealthy adults and healthy pregnant women ,24, othOn the other hand, it has been reported that healthy term newborns werepresented with higher upper reference limits of circulating cTnI than adults,26,28.Araujo et al. publisheAccording to our results, cTnI seems to cross the placental barrier,since positive correlations between maternal and fetal/neonatal cTnI levelswere documented for both IUGR and AGA groups. No relevant reports for cTnI existin the literature; however, for cTnT experimental evidence suggestsnontransplacental passage . Our finding that maternal and neonatal cTnI levels are lower when theIUGR offspring is a male has not been previously reported. Relatively, Baum etal. have demIn conclusion, circulating cTnIlevels do not differ between IUGR cases and AGA controls, possibly due to thesparing of vital organs, like the heart. Furthermore, cTnI possibly crosses theplacenta, as strong correlations between maternal and fetal/neonatal values aredocumented. Lastly, maternal and neonatal cTnI levels are lower when the IUGRoffspring is of male gender."} +{"text": "Contrast echocardiography is a precise tool for the non-invasive assessment of myocardial function and perfusion. Side effects of contrast echocardiography resulting from contrast-agent induced myocardial micro-lesions have been found in animals. The goal of this study is to measure markers of myocardial necrosis, inflammation and oxidative stress in humans to evaluate potential side-effects of contrast echocardiography.20 patients who underwent contrast echocardiography with Optison as the contrast medium were investigated. To evaluate myocardial micro-necrosis, inflammation and oxidative stress, cardiac troponin I (cTnI), tumor necrosis factor-\u03b1 (TNF-\u03b1), interleukin (IL)-6, -8 and thiobarbituric acid reactive substances (TBARS) were measured at baseline and at 2, 4, 8 and 24 hours after contrast echocardiography.At baseline, 50% of the patients had cTnI and TBARS values outside the reference range. TNF-\u03b1, IL-6, IL-8 levels were within the reference range. Patients with cTnI above the RR clustered to significantly higher levels of TNF-\u03b1 and IL-6. After contrast echocardiography, no statistically significant increase of cTnI, cytokines and TBARS was found. However, for nearly 50% of the patients, the intra-individual cTnI kinetics crossed the critical difference which indicates a marker increase. This was neither predicted by the baseline levels of the cytokines nor the markers of oxidative stress.There are no clinically relevant increases in serum markers for micro-necrosis, inflammation and oxidative stress in humans after contrast echocardiography. Future studies have to address whether cTnI increase in some patients represent a subset with increased risk for side effects after contrast echocardiography. Contrast echocardiography is a precise and study-proven tool for the non-invasive assessment of left ventricular systolic function, myocardial perfusion, endocardial border detection and coronary flow reserve ,2.in vitro and in vivo studies [Myocardial trauma, e.g. occlusion of a coronary artery during angioplasty, can potentially stimulate inflammatory processes with subsequent activation and infiltration of inflammatory cells in the myocardium. This can induce the release of cytokines and reactive oxygen species . Microbu studies -7. ThereThese markers are not specific for myocardial damage but the degree of oxidative stress is correlated to the extent and progression of myocardial damage. -11. It hcut-offs generally accepted to indicate myocardial necrosis [cut-off values deducted from ROC-curves which were used at that time were too high for the detection of micro-lesions after contrast echocardiography. Based on strongly improved assay performance, it is now generally agreed that the elevation of cTnI without crossing the former cut-off is indicative of myocardial micro-necrosis [In a former study, we analyzed markers for myocardial necrosis in patients undergoing contrast echocardiography. None of the markers crossed the necrosis . Possiblnecrosis . Consequnecrosis -17.Furthermore, there is increasing evidence that a low level troponin increases are pathologically relevant. Specifically, cTnI values below the ROC cut-off are clearly associated with mild and subclinical myocardial damage .In this study, we performed additional measurements on the serum samples of the former study. cTnI concentrations were measured at baseline and at 2, 4, 8 and 24 hours after contrast echocardiography. Furthermore, we measured the markers of inflammation and oxidative stress .20 consecutive patients with a clinical indication for contrast echocardiography were included in this study. The indications for contrast echocardiography are listed in table within-run variation. There is general agreement that two values measured within-run are significantly different (p < 0.05) if the difference between the values is greater than the three-fold of the within-run variation of the method.The critical difference indicating a marker increase after echocardiography was calculated based on the data for the Contrast echocardiography was performed with the Vivid Five System . Optison was used as the contrast medium. 20 ml of contrast microbubble solution were infused manually over three minutes into a peripheral vein followed by a saline flush. Contrast echo was performed 5 minutes after the beginning of the application of the contrast solution.Cardiac troponin I was measured with the heterogeneous immunoassay module cardiac troponin-I flex\u2122 reagent cartridge for Dimension . For this assay, the lowest limit of detection (LoD) is 0.04 \u03bcg/l. The 99%-percentile of the reference group is 0.07 \u03bcg/l. In the range below the ROC cut off (0.6 \u03bcg/l), the analytical variation is 10% at a cTnI level of 0.24 \u03bcg/l and nearly 20 % at the 99 % percentile .For TNF-\u03b1, IL-6 and IL-8, IMMULITE immunoassays obtained from DPC Biermann GmbH were used. According to the manufacturer information, reference ranges (95% percentile) and their analytical variation for TNF-\u03b1, IL-6 and IL-8 are 12% at 8.1 ng/l, 7% at 9.7 ng/l and 3.5% at 62 ng/l respectively. The LoD and the analytical variation at this level are 18% at 4 ng/l; 10% at 2 ng/l and 6% at 5 ng/l.in vitro oxidation and to guarantee high precision in the analytical procedures, adequate conditions for sampling, storage and measurement were ascertained in pre-study experiments [within-run variation was 3.8 %. There is no standardized test for TBARS, so that measurements have to be compared with the laboratory specific reference range. Based on former investigations, the reference group of 20 age-matched healthy controls had a mean value of 3.82 \u00b1 0.51 \u03bcmol/l (min 2.62 \u2013 max 5.06 \u03bcmol/l). The 95%-percentile of the reference group is 4.79 \u03bcmol/l.TBARS was measured according to TAKEDA et al. . To avoieriments . TherefoData are expressed as mean \u00b1 SD. Statistical analysis was performed with the SPSS 12 software package . Using bootstrapping simulation, the U-test of Mann-Whitney for group comparison and the Wilcoxon test for comparison of paired values were used. In the figures, the measurements below the LoD are displayed by the values that correspond to half of the LoD.cut-off of 0.6 \u03bcg/l and 2 patients with values which were even above the ROC cut-off. (see table 7 of the 20 patients had baseline cTnI levels below the LoD (0.04 ug/l). 3 patients had a cTnI level between the LoD and the 99%-percentile of the reference population (\u2264 0.07\u03bcg/l). Altogether, 10 patients were within the reference range. The other 10 patients had baseline cTnI levels above the reference range: 8 patients with values between the 99%-percentile and the ROC For TNF-\u03b1 (reference range \u2264 8.1 ng/l), 3 of the 16 patients had baseline values above the reference range. Two patients belonged to the group with cTnI in the reference range, one to the group with cTnI above the reference range.However, comparing all baseline TNF-\u03b1 levels to the cTnI levels (inside or outside the reference range), TNF-\u03b1 was significantly lower in the patient group with cTnI in the reference range than the patients with cTnI above the reference range. The correlation of cTn-I and TNF-\u03b1 is also documented by the regression analysis .For IL-6 (reference range of \u2264 9.7 ng/l), two patients both from the cTnI group outside of the reference range had IL-6 values outside of the reference range. In analogy to the TNF-\u03b1 levels, there was a significantly higher IL-6 level in the patient group outside of the cTnI reference range compared with that inside . The linear regression of baseline IL-6 and cTnI was r = 0.68 (p = 0.01). A significant correlation of baseline TNF-\u03b1 and IL-6 could be calculated .For IL-8, the baseline values of all patients were all within the reference range. There was no significant difference in IL-8 values between the patient groups inside and outside of the cTnI reference interval (13.8 \u00b1 22.6 vs. 10.0 \u00b1 7.2 ng/l).Based on the calculated reference range (95%-percentile) the TBARS level of 6 of the patients was inside the reference range, while in 14 patients it was outside of the reference range at baseline. TBARS levels were significantly higher in the patient group compared to the healthy controls: mean 5.82 \u00b1 1.30 \u03bcmol/l . However, no significantly different TBARS levels (5.98 \u00b1 1.65 vs 5.61+0.81 \u03bcmol/l) were found in the cTnI groups inside or outside the reference range. There was no significant correlation of baseline TBARS to cTnI, TNF-\u03b1 and IL-6, however, the TBARS correlated significantly to the baseline IL-8 .Overall, if patients were classified based on their underlying heart disease in \"ischemic\" (n = 6) and \"non-ischemic\" (n = 14), no significantly different pre-study levels for all parameters are present.As shown in figure There was no predictive power of baseline cTnI levels for an increase after contrast echocardiography. In the group with baseline cTnI within the reference range, we found an increase based on our definition in 5 of the 10 patients. In the group with baseline cTnI above the reference range, the increase was seen in 4 of the 10 patients.Neither the etiology of the heart disease (ischemic and non-ischemic) nor the baseline cTnI level predicted an increase in cTnI.In the case of TNF-\u03b1 and cytokines, the critical difference was crossed 24 hours after contrast echocardiography for TNF-\u03b1 in 3, for IL-6 in 6 and for IL-8 in 7 of the analyzed patients. The marker increase was neither related to the baseline cTnI nor to the ischemic or non-ischemic background. The correlation of cytokine and cTnI increase was not statistically significant.The oxidative stress marker TBARS exceeded the critical difference after contrast echocardiography in 7 patients. The increase of TBARS was neither related to the baseline cTnI nor to the ischemic or non-ischemic background of the underlying myocardial pathology of the patient.This study was designed to investigate safety of contrast echocardiography in humans. By determination of serum markers for myocardial necrosis, inflammation and oxidative stress, no statistically significant side-effects could be detected. In the most of the patients, the baseline marker levels were within or near to the reference range and there were no sustained increases 24 hours after contrast echocardiography.As marker for myocardial necrosis, cTnI was chosen because the analytical sensitivity of the test has improved and it is now accepted as an indicator of myocardial micro-necrosis. Furthermore, there is increasing evidence that cTnI can indicate myocardial damage that is not associated with necrosis -24.To examine inflammatory activation after contrast echocardiography, TNF-\u03b1 and IL-6 and IL-8 were analyzed. These markers are not specific for a myocardial inflammatory response, but a marker increase with temporal association to contrast echocardiography more likely results from the proposed effects of the contrast agent on the heart than from systemic inflammation by other causes .TBARS, a metabolite and end product of lipid peroxidation, is a more static and global parameter. TBARS is, despite the lack in standardization, currently the most frequently used marker to quantify oxidative stress in clinical studies. It was measured in several studies in patients with heart diseases and increased oxidative stress ,26. The Our results after contrast echocardiograph in humans are be in agreement with a recently published study. A new second-generation myocardial contrast agent (LK565) has been evaluated in healthy individuals undergoing contrast echocardiography. Neither an increase in TNF-\u03b1 secretion, nor antibody development and activation of leukocyte surface markers was induced by the procedure . HoweverConsequently and in critical view of our study results, we hesitate to negate a potential myocardial damage after contrast echocardiography. An intra-individual increase of cTnI above the pre-determined limit was seen in nearly half of the patients. Furthermore, IL-6 and IL-8 increased after contrast echocardiography based on the pre-defined limit in nearly half of the patients analysed for cytokines. The increases of cTnI, IL-6 and IL-8 were not correlated to a particular group of patients. Further larger studies have to clarify whether subgroups of patients are prone to myocardial damage after contrast echocardiography. In present study, we cannot exclude that the findings in some of our patients resulted from such a subset enrolled in our patient cohort. Due to the sample size we were not able to clearly define subgroups. In our view, patients with cTnI or TBARS above the reference range at baseline could form such a subgroup more susceptible to side- effects.Possibly, the one patient suffering from dilated cardiomyopathy and ventricular arrhythmia who had the highest baseline and largest increase in cTnI levels after contrast echocardiography could belong to such a subgroup. High troponin levels are found in patients with stable heart failure without an indication for myocardial ischemia -22,28. FWe have found a significant correlation of the baseline levels of cTnI, TNF-\u03b1 and IL6. This is in accordance with the findings of , who fouLimitations of this study include the low number of patients, the lack of a control group and the use of just one contrast agent. Increasing the number of patients studied would facilitate the identification of patients who are more sensitive to the side-effects of contrast echocardiography. Controls in future studies would have to receive contrast agent only without echocardiography. We cannot draw comparisons between the effects of different contrast agents because only Optison was used in this study.In summary, there is no conclusive evidence for the induction of myocardial micro-necrosis, inflammation and oxidative stress by contrast echocardiography. The baseline cTnI levels do not correlate to the oxidative stress and inflammation markers within 24 hours after contrast echocardiography. In some of the patients however, cTnI levels increase slightly after contrast echocardiography. These patients may belong to a subgroup more prone to side effects of contrast echocardiography than others. Hence, this study \u2013 although limited in size \u2013 suggests that contrast echocardiography does not induce oxidative stress and inflammation.TNF-\u03b1 Tumor necrosis factor alphaTBARS thiobarbituric acid reactive substancesIL InterleukinROC Reviever operating characteristic curvecTnI cardiac Troponin ILoD lowest limit of detectionMI myocardial infarctionFK, IS and ACB have designed and performed the study and have written the manuscript. IS, FK, RZ and ACB have performed the laboratory measurements. TW, SE, SS and GB have participated in the study design and coordination. All authors read and approved the final manuscript."} +{"text": "Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI) is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS) and to evaluate whether other clinical or laboratory parameters were associated with cTnI increase.Preoperative plasma levels of cTnI were investigated in 58 female dogs with pyometra and 9 controls. The value of physical examination findings, haematological, serum biochemical and pro-inflammatory (CRP and TNF-\u03b1) parameters as possible predictors of increased cTnI levels was also evaluated.-1 and in the control dog the level was 0.3 \u03bcg l-1. The cTnI levels did not differ significantly between the two groups. No cardiac abnormalities were evident on preoperative physical examinations. Four of the pyometra patients died within two weeks of surgery, of which two were examined post mortem. In one of these cases the cTnI levels increased from 0.9 \u03bcg l-1 preoperatively to 180 \u03bcg l-1 the following day when also heart arrhythmia was also detected. The other patient had cTnI levels of 0.7 \u03bcg l-1 with no detectable heart pathology post mortem. CTnI increase was not associated with presence of SIRS. There was a trend for the association of cTnI increase with increased mortality. No preoperative physical examination findings and few but unspecific laboratory parameters were associated with increased cTnI levels.Seven dogs with pyometra (12%) and one control dog (11%) had increased levels of cTnI. In the pyometra group, the levels ranged between 0.3\u20130.9 \u03bcg lIncreased cTnI levels were observed in 12% of the dogs with pyometra. The proportions of dogs with cTnI increase did not differ significantly in the pyometra group compared with the control group. CTnI increase was not associated with presence of SIRS. A trend for association of cTnI increase and mortality was observed. Preoperative physical examination findings and included laboratory parameters were poor predictors of increased cTnI levels. Pyometra is a common reproductive disorder which affects nearly one fourth of all female dogs before they reach ten years of age . The disCardiac troponin I (cTnI) analysis is a highly sensitive and specific method for the detection of myocyte injury which has been used to diagnose myocardial damage in many mammalian species including humans, dogs and cats -8. TropoIn canine pyometra, the role of inflammatory mediators in myocardial disease remains to be evaluated. Analysis of c-reactive protein (CRP) was reported to reliably predict myocardial damage, dysfunctions and outcome in human patients when combined with analysis of cTnI ,12,17. T2\u03b1, as measured in plasma by its main metabolite 15-keto-13,14-dihydro-PGF2\u03b1 (PG-metabolite) was demonstrated to be increased in female dogs with pyometra and to be associated with outcome as measured by the length of hospitalisation [It seems logical that dogs with pyometra and more severely affected general condition would also be at higher risk of developing myocardial injury. In a previous study conducted by our laboratory group the inflammatory mediator prostaglandin Flisation . In thatlisation . Analysilisation . The posThe aim of the present study was to evaluate presence of myocardial injury by cTnI measurement in female dogs with pyometra. Furthermore we aimed to explore whether myocardial injury is more common in the patients with systemic inflammatory response syndrome (SIRS) and investigate the association of cTnI increase with other parameters . Detailed information on some of these variables in pyometra, although not all the same cases, is previously published in other studies ,20,22.The study was approved by the Uppsala County Ethical Board, Tierp, Sweden, prior to onset of the clinical investigations.In total 58 privately-owned bitches with the presumptive diagnosis of pyometra were included in the present study. The pyometra group consisted of 35 different breeds. All bitches were treated by ovariohysterectomy at the Department of Small Animal Clinical Sciences, Swedish University of Agricultural Studies, Uppsala, Sweden. The diagnosis was based on case history, physical examination and diagnostic imaging using ultrasonography and/or radiography to demonstrate an enlarged, fluid-filled uterus. The diagnosis was verified visually during the ovariohysterectomy and confirmed by histopathological examination at the Department of Pathology, National Veterinary Institute, Uppsala, Sweden. The admitting clinician filled out a form specifying rectal temperature, heart rate, respiratory rate, mucus membrane colour, capillary refill time, location for pain response at abdominal palpation, hydration status and general attitude at the time of admission. Postoperatively the heart rate, rectal temperature and respiratory rate were noted daily on a special form for as long as the patient was hospitalised. The heart was monitored by auscultation each day post surgery and if any signs of abnormalities were detected, additional electrocardiographic examinations and blood samplings for cTnI analysis were performed. Further information on treatment, complication to treatment and mortality were obtained from the medical records. None of the dogs had previously been medically treated for pyometra.Healthy adult intact staff-owned female dogs (n = 9) were included in the control group which consisted of 6 different breeds. A history questionnaire was filled out, ensuring that the owner considered the bitch healthy for at least eight weeks prior to the examination. Complete physical examination, including heart and lung auscultation, was performed and documented by two of the authors who also filled out the form specifying rectal temperature, heart rate, respiratory rate, mucus membrane colour, capillary refill time, location for any pain response at abdominal palpation, hydration status and general attitude. None of the control bitches had previously been medically treated for pyometra, nor had suffered from any uterine disease at least one year after the study was finished.2\u03b1 in duplicates [-1. Where necessary, dilution of the samples was performed to allow for accurate readings on the standard curve. Cardiac troponin I was analysed using a commercially available immunometrical method previously used in dogs for this purpose [-1, according to the manufacturer or even lower (0.1 \u03bcg l-1) according to a recent study [-1, which is 1/60 of the levels achieved after sub-lethal doses of endotoxin [Blood samples for biochemical, haematological and PG-metabolite analysis were obtained immediately before surgery in EDTA, sodium-heparinised and non-additive vacutainer tubes . Biochemical and haematological analyses were performed using routine methods, at the Department of Biomedicine and Veterinary Public Health, Swedish University of Agricultural Sciences, Uppsala, Sweden. Analysed haematology parameters included packed cell volume (PCV), haemoglobin (Hb), white blood cell count (WBC), differential count of WBC including total count (BN) and percentage band neutrophils (PBN), nucleated erythrocytes, erythrocyte morphology, red blood cell mean corpuscular volume (MCV), red blood cell mean corpuscular haemoglobin concentration (MCHC) and platelet count (PC). Analysed serum biochemical parameters included alanine aminotransferase (ALAT), albumin, alkaline phosphatase (AP), blood urea nitrogen (BUN), cholesterol, glucose, total protein and the electrolytes sodium (Na), potassium (K), chloride (Cl) and calcium (Ca). For analysis of PG-metabolite, sodium heparinised plasma was assayed at the Department of Clinical Sciences, Swedish University of Agricultural Sciences, Uppsala, Sweden. A radioimmuno assay (RIA) was used to analyse 15-ketodihydro-PGFplicates . The praCA, USA) ,14. The nt study . Immediandotoxin . This ELndotoxin .Blood samples from the control dogs were collected through the same procedure as for the diseased group after the physical examination.The diagnosis of pyometra, according to the previously proposed definition was confirmed by gross and histopathological examination of hematoxylin-eosin stained sections of formaldehyde-fixated uteri and ovaries at the Department of Pathology, National Veterinary Institute (SVA), Uppsala, Sweden . Samples-1; heart rate > 120 beats min-1; WBC < 6 or > 16 (\u00d7 109 l-1) or percentage band neutrophils (PBN)> 3%; temperature < 38.1 or > 39.2 [A patient was regarded as SIRS-positive if two or more of the following criteria were met: respiratory rate > 20 minr > 39.2 . The selr > 39.2 . The riss) was used to test for associations between interval-scale variables. Values below the detection limit, which in the data set occurred for cTnI, PG-metabolite, BN, segmented neutrophils, eosinophils, and basophils, were set to zero in the calculations. Mann-Whitney U-tests were used to test for differences in haematological and blood chemistry parameters between the control and pyometra group, and Fisher's exact test was used to test for association between detectable cTnI levels in dogs with SIRS or without SIRS, as tested in the pyometra group. Fisher's exact test was also used to test for association between detectable cTnI levels and survival as tested in the pyometra group. Significance was accepted at P < 0.05 for all statistical tests used in this study.Statistical analyses were performed with the programme Statistica . Spearman rank correlation coefficient (r-1 (Table -1), another blood sample was obtained for cTnI analysis the following day, which demonstrated levels of 180 \u03bcg l-1 of the 58 pyometra female dogs. The cTnI levels ranged between 0.3\u20130.9 \u03bcg l2% of the-1.The levels of cTnI were low or undetectable by means of the chosen method, in eight of the nine control female dogs. The remaining control dog (11%) had cTnI levels of 0.3 \u03bcg lThere was a trend for increased mortality in the pyometra patients with detectable cTnI levels .The cTnI concentrations did not differ significantly in the pyometra dogs with and without SIRS (Two-sample t-tests). Detectable cTnI levels were not associated with presence of SIRS (Fisher's exact test).The pyometra and control groups differed significantly (P < 0.05) regarding the PG-metabolite, TNF-\u03b1, and CRP levels, Hb, PCV, EPC, WBC, BN, PBN, neutrophils, lymphocytes, monocytes, PC, AP, albumin, cholesterol, potassium, body temperature, heart rate and age Table .s = 0.295), body temperature (rs = 0.424), respiratory rate (rs = -0.315), age (rs = 0.302), TNF-\u03b1 (rs = 0.345), PG (rs = 0.453), BN (rs = 0.413), PBN (rs = 0.397), segmented neutrophils (rs = 0.337), albumin (rs = -0.500), AP (rs = 0.451), cholesterol (rs = 0.353), monocytes (rs = 0.383), MCV (rs = -0.392), WBC (rs = 0.331), Hb (rs = -0.291), and PC (rs = -0.266).Hospitalisation length was not correlated with cTnI levels but with the following parameters: duration of illness before admission (rs = 0.320), AP (rs = 0.282), ALAT (rs = 0.266) and lymphocytes (rs = -0.246).Cardiac troponin I levels were significantly (P < 0.05) correlated with BUN prevHeart muscle injury occurs in female dogs with pyometra for several reasons. Bacteraemia, septicaemia and disseminated bacterial infection with possible subsequent myocarditis are not uncommon complications of the disease . PyometrCardiac troponin levels did not correlate with any of the inflammatory markers examined in the present study. Measurement of these parameters was thus not useful to predict or identify dogs with increased cTnI levels despite previous reports of an association of TNF-\u03b1 with cardiac troponin and the predictive value of CRP for cardiovascular events ,36. Both-1), indicative of severe myocardial injury. That dog died later during the day and the increased level of cTnI was probably caused by the extensive myocarditis and disseminated bacterial infection demonstrated on subsequent post mortem gross and histopathological examination. The preoperative cTnI levels of 0.9 \u03bcg l-1indicate that additional myocardial injury developed after the first sample was obtained. No other concurrent cardiac disease was identified, which could otherwise account for the cTnI increase especially in elderly female dogs with pyometra. In cases with arrhythmia or thoracic radiograph abnormalities, it is valuable to rule in or out cardiac muscle injury in order to optimize the treatment. The cTnI analysis may also be functional in managing treatment response and healing since the plasma levels previously have been shown to be correlated with the severity of myocardial injury and survival [In the case where cardiac arrhythmia was discovered by auscultation on the first day post surgery, the cTnI levels were very high at that point in time . In two previously published studies 51% and 19 % of the tested healthy control dogs had detectable levels of cTnI, as analysed by the same method. Since cTnI is intracellular it should generally not be present at all in the peripheral circulation unless some myocardial injury has occurred [-1 might be due to minor damage of cardiac myocytes which did not affect the clinical appearance, haematological or biochemistry parameters. Since that dog was clinically healthy and not further examined, the exact cause for the cTnI increase remains unknown.Only one of the control dogs in the present study had detectable cTnI levels . Of the remaining two fatalities one occurred two weeks after surgery, and the other one day after surgery, shortly after departure from the veterinary clinic. Whether these deaths were associated with complications of the pyometra or related to heart dysfunction is unclear since no autopsies were performed. In both these female dogs cTnI was not detected in the plasma preoperatively. The four pyometra patients that died ranged between 8.1\u201313.6 years of age. Two of the seven pyometra dogs with detectable cTnI levels died (28%) in comparison with two of the fifty-one pyometra dogs without cTnI increase (4%). A trend for the association of detectable cTnI levels with increased mortality was apparent when evaluated in the pyometra group (P = 0.067).Potential life-threatening consequences of pyometra include endotoxaemia, bacteraemia, septicaemia, SIRS, DIC, multiple organ dysfunctions and disseminated bacterial infection of vital organs ,21,29. TAs for prognostic value, the cTnI levels were not correlated with the outcome as measured in this study by length of the hospitalisation. Pyometra cases overiohysterectomised at our clinic are generally dismissed 1\u20132 days after surgery. Additional complications lead to longer hospitalisation. Although a relatively crude measurement, length of hospitalisation has previously been used for this purpose in studies of human diseases and in dMinor myocardial injury was present in 12% of the female dogs with pyometra. The proportions of cases with increased cTnI levels did not differ significantly in the pyometra patient group when compared with healthy control dogs. Presence of SIRS was not associated with increased cTnI values. A trend for the association of detectable cTnI levels with increased mortality was apparent, as evaluated in the pyometra group. Findings at physical examination, haematological, biochemical and inflammatory parameters evaluated preoperatively in the present study, were all poor predictors of myocardial cell injury as determined by cTnI analysis.The author(s) declare that they have no competing interests.RH, ASL, BAF and AB were involved in the study design and collection of the samples. RH, AB and BAF were responsible for data acquisition. RH was responsible for data analysis and manuscript preparation. JH, ASL participated in the study design, and and revision of the manuscript. All authors read and approved the final manuscript."} +{"text": "Anti-IL-21R antibodies are potential therapeutics for the treatment of autoimmune diseases. This study evaluated correlations between the pharmacodynamic (PD) activity, pharmacokinetics, and anti-product antibody responses of human anti-IL-21R antibodies Ab-01 and Ab-02 following IV administration to cynomolgus monkeys.ex vivo. Monkeys screened for responsiveness to rhuIL-21 stimulation using the PD assay, were given a single 10 mg/kg IV dosage of Ab-01, Ab-02, or a control antibody (3/group), and blood samples were evaluated for PD activity (inhibition of IL-2RA expression) for up to 148 days. Anti-IL-21R antibody concentrations and anti-product antibody responses were measured in serum using immunoassays and flow cytometry.The PD assay was based on the ability of recombinant human IL-21 (rhuIL-21) to induce expression of the IL-2RA gene in cynomolgus monkey whole blood samples 1/2) was ~10.6 and 2.3 days for Ab-01 and Ab-02, respectively. PD activity was lost at ~5-13 weeks for Ab-01 and at ~2 weeks for Ab-02, when serum concentrations were relatively low. The estimated minimum concentrations needed to maintain PD activity were ~4-6 nM for Ab-01 and ~2.5 nM for Ab-02, and were consistent with the respective KD values for binding to human IL-21R. For Ab-01, there was noticeable inter-animal variability in t1/2 values (~6-14 days) and the resulting PD profiles, which correlated with the onset of anti-product antibody formation. While all three Ab-01-dosed animals were positive for anti-Ab-01 antibodies, only one monkey (with the shortest t1/2 and the earliest loss of PD activity) had evidence of neutralizing anti-Ab-01 antibodies. All three Ab-02-dosed monkeys developed neutralizing anti-Ab-02 antibodies.Following IV administration of Ab-01 and Ab-02 to cynomolgus monkeys, PD activity was observed as early as 5 minutes (first time point sampled). This PD activity had good correlation with the serum concentrations and anti-product antibody responses throughout the study. The mean terminal half-life (tFor anti-IL-21R antibodies Ab-01 and Ab-02, there was good correlation between PD activity and PK profiles following IV administration to cynomolgus monkeys. Compared with Ab-01, Ab-02 was eliminated markedly faster from the circulation, which correlated with a shorter duration of PD activity. Interleukin 21 (IL-21) is a type I cytokine that is produced by activated CD4+ T cells and natural killer (NK) T cells . The comD values for the human IL-21R (i.e. \u0394\u0394Ct) values were tested in the Shapiro-Wilk and D'Agostino & Pearson normality tests but not for the log [RQ] distribution (p = 0.16 for the Shapiro Wilk test and p = 0.48 for the D'Agostino & Pearson test). The log-transformed RQ values were fitted into normal distribution was used for all statistical analyses.6-tagged rhuIL-21 receptor. The bound anti-IL-21R antibody was detected with a mouse monoclonal antibody to human IgG conjugated to horseradish peroxidase.The test articles in serum samples (in duplicate) were captured onto a microtiter plate that was coated with HisThe enzyme substrate, 3, 3', 5, 5'-tetramethylbenzidine (TMB), was used to produce a colored end-product to visualize the bound anti-IL-21R antibody. Optical densities (OD) were measured at 450 nm. Sample concentrations were determined by interpolation from a calibration curve that was fit using a 4 parameter logistic equation . The lower limit of quantitation (LLOQ) was 30.0 ng/mL.1/2). The apparent t1/2 was determined for each individual animal using a non-compartmental analysis module (Model 202) of the pharmacokinetic software package WinNonlin, ver. 5.1 . The slope of the apparent terminal phase was estimated by log-linear regression using at least 3 data points and the terminal rate constant (\u03bb) was derived from the slope. The apparent elimination half-life (t1/2) was calculated as 0.693/\u03bb.Because of the relatively large sample volume required for the PD assay and limitations on blood volumes that could be collected from each individual cynomolgus monkey, extensive serum sampling required for determination of a complete set of PK parameters could not be performed. The only PK parameter that could be calculated under the sampling scheme employed in this study was the elimination half-life (tSerum samples (in duplicate) were co-incubated with biotinylated-Ab-01 and ruthenylated- Ab-01 overnight. After incubation with streptavidin-coated paramagnetic beads, the mixture and the plate were placed in the BioVeris M Series 384 Analyzer 2004 , a magnet was applied, and unbound reactants were washed away. The emitted light was measured by photo detectors with the read out in response units (RU). Positive and negative control serum samples were included on each plate to monitor assay performance. The negative control serum samples were also used to determine the cutpoint RU, which was defined as twice the mean RU of the negative control. Samples were initially tested in a screening format at dilutions of 1:25 and 1:75. Samples generating an RU greater than or equal to the cutpoint RU were considered positive. Positive samples were reanalyzed in a full dilution series to determine the titer . For positive samples, the log of the titer was reported. The minimum required dilution was 1:25 and the limit of detection was 1.40 (the log of 25). Therefore, negative samples were designated as <1.40. This assay detects both neutralizing and non-neutralizing anti-Ab-01 antibodies.6 cells/mL, and incubated at 37\u00b0C for 2 hours. The cells were then washed in cold PBS/0.5%BSA, re-suspended in ice-cold PBS buffer, and kept on ice until staining. To determine the EC50 for Ab-02-biotin binding to TF-1/huIL-21R cells, both the parental TF-1 and the TF-1/huIL-21R cells (105 cells per test) were incubated with either Ab-02-biotin, or IgG-biotin control using serial 3-fold dilutions (range = 16-0.0002 \u03bcg/mL) on ice for 30 minutes, washed in PBS/0.5%BSA, and then incubated with streptavidin-allophycocyanin . Geometric mean fluorescent intensities (\"GMFI\") of the APC channel peaks was collected on an LSRII flow cytometer and analyzed using Flowjo 8.3.3 software . Linear regression analysis of the plots was performed using Prism 4 for Macintosh v4.0b .TF-1 and TF-1/huIL-21R were grown in RPMI media containing 25 ng/ml huGMCSF . Confluent cell cultures were centrifuged at 300 g for 10 min, resuspended in OptiMEM serum free medium at 1050 concentration), washed in PBS/0.5%BSA, stained with streptavidin-APC, and analyzed for GMFI as described above. Each serum sample was run in duplicate in two individual experiments, and the average GMFI value for the 4 replicates was obtained for each dilution point. The relative GMFI value for each serum sample for each dilution point was calculated using the formula [100%* average GMFI/average GMFI pre-dose]. A sample was considered positive if the relative GMFI value was less than or equal to 80% at the MRD. For positive samples, the log titer was calculated as the log [reciprocal dilution that would generate relative GMFI >80%]. Based on the MRD, log titers for negative samples were reported as <0.78 (log 6).The minimum required dilution (MRD) for testing serum samples in this assay was determined to be 1:6 in PBS/0.5%BSA. To test for inhibition of Ab-02-biotin to TF-1/huIL-21R cells , TF-1/huIL-21R cells were pre-incubated with sera from anti-IL-21R-dosed monkeys (using a 3 fold dilution series starting at the MRD), stained with an anti-IL-21R-biotin in blood samples of untreated cynomolgus monkeys was examined. Gene expression changes (relative to vehicle control) for IL-2RA, IL-21R, PRF1, GZMB, and/or IL-6 following ex vivo stimulation of whole blood samples with rhuIL-21 for thirteen monkeys are shown in Table Prior to conducting the ex vivo addition of Ab-02 antibody simultaneously with rhuIL-21, completely inhibited (p < 0.001) rhuIL-21-induced gene expression changes in the whole blood assay . As expected, ex vivo assay, blood samples were collected from 24 additional female cynomolgus monkeys, stimulated ex vivo with rhuIL-21, and analyzed for IL-2RA gene expression (in RQ units) using quantitative RT-PCR . There were no noticeable differences in IL-2RA RQ distribution between male and female monkeys , and subsequent analysis of IL-21RA RQ distribution was performed using a combined data set (n = 37). All cynomolgus monkeys tested had IL-2RA RQ values greater or equal to1.5 following ex vivo stimulation with rhuIL-21. The median IL-2RA RQ value (n = 37) was 3.2 with a range of 1.5 to 8.1. The distribution of the IL-2RA RQ values and log transformation (log2) of the RQ values obtained in the ex vivo assay are shown in Figure To obtain a larger number of samples for characterization of the distribution of the IL-2RA response to rhuIL-21 in the ex vivo PD assay required for the inclusion into the in vivo PD study of Ab-01 and Ab-02 in cynomolgus monkeys (RQcutoff) was defined as 2.3 using the formula: log [RQcutoff] = mean of the log-transformed RQ values - standard deviation of the log-transformed RQ values. Approximately 81% of monkeys tested (30 of 37) had RQ values greater than 2.3 and were considered to be good responders in the ex vivo PD assay.The minimum RQ value for IL-2RA gene expression in the ex vivo PD assay, were administered a single 10 mg/kg IV dosage of Ab-01, Ab-02, or a control antibody (3/group), and monitored for PD activity, serum concentration, and anti-product antibody responses at the time points shown in Table Nine male monkeys that were determined to be good responders in the 1/2) was calculated based on the terminal phases of serum concentration-time profiles.Initial PK studies in cynomolgus monkeys demonstrated that following single IV administration, Ab-02 was cleared markedly faster compared to Ab-01 . In the 1/2) of ~10.6 \u00b1 3.92 days compared to that for animals 1 and 3 .Following a single 10 mg/kg IV dose, Ab-01 was eliminated slowly from cynomolgus monkeys, with a mean apparent terminal half-life t1/ of ~10.61/2 values . The third aliquot was treated with rhuIL-21 and an anti-IL-21R antibody (30 nM), and the fourth aliquot was treated with rhuIL-21 and an IgG control antibody (negative control for the anti-IL-21R antibody). The third and fourth aliquots were used to assess whether inhibition of rhuIL-21-induced IL-2RA gene expression by circulating test article in a given post-dose sample was complete (for time points at which PD activity was observed), to assess whether the return of rhuIL-21-induced gene expression was mediated through the IL-21R (for time points at which PD activity was lost), and to monitor for the presence of neutralizing anti-product antibodies.For all nine monkeys enrolled into this study, each pre-dose and post-dose blood sample was divided into four 1.5 mL aliquots. The first and second aliquots were treated with either rhuIL-21 or vehicle , and were used to assess whether circulating test article affected Ex vivo rhuIL-21-induced IL-2RA expression returned to pre-dose values (i.e. PD activity was lost) at day 92 for animals 1 and 3, coincident with the time points at which serum concentrations of the test articles were 50% increase) was seen significantly less with the use of CO2. Quality of images is better with iodinated contrast.Contrast-induced nephropathy is well-known sequelae of iodinated contrast (diatrizoate meglumine). Carbon dioxide (CO Comparisons of the parameters during baseline and at the end of 48 hours were done using paired 2. The levels of the urinary enzymes were determined by following the method previously reported by us.[et al,[Safety of the procedure was assessed by the arterial blood gas analysis (Roche omni-C) to check for the accumulation of pCOed by us. Ten mills.[et al, whereas s.[et al, and Jungs.[et al, respecti2 and 17 iodinated contrast (diatrizoate meglumine) according to the computer generated randomization. There was no difference in the baseline S.Cr. between the contrast and CO2 [2 from baseline 48 hours after the aortography. There was increase in the PaCO2 after CO2 aortography compared to the preaortography level, but it was not statistically significant (P = 0.06). The baseline tubular enzymes, namely: GGT (P = 0.39), NAG (P = 0.09), and AAP (P = 0.21), were similar between the contrast and CO2. There was significant increase in the enzymuria 48 hours after the aortogram both in the iodinated contrast , and the CO2 as shown in 2, GGT: P = 0.002; NAG: P = 0.0001; and AAP: P = 0.0001.Out of 29 dogs that underwent angiography, 12 received CO and CO2 . There w2 images are negative images, arterial tree seen as white. Images obtained with iodinated contrast agents [2 [2. Although the quality of image with CO2 is not as good as that of iodinated contrast, it still gives adequate delineation of the major vascular anatomy.Images obtained with iodinated contrast are positive images, arterial tree is seen as black, and COt agents were supgents [2 . Main, d2 as an alternative angiographic contrast agent used in combination with DSA. They showed minimal renal toxicity following CO2 due to a \u2018vapor lock\u2019 phenomenon.[2. Even though there was no change in the S.Cr, there was significant increase in the tubular enzymes after iodinated contrast and also CO2. The degree of increase in the enzymuria was significantly more with the iodinated contrast. This shows that even with CO2 there is tubular injury in normal healthy subjects, but significantly less than iodinated contrast.Hawkins and coworkers explored the use of COenomenon. Our stud2 instead of conventional iodinated contrast media. Rapid clearance of CO2 in lungs prevents recirculation and the renal metabolism is likely to be minimally affected.[2 is that, there is no risk of allergic reactions.[2 is the lower contrast properties that the gas provides compared with iodinated contrast agents. Another undesirable effect is that some patients experience nausea after CO2 injection.[There are several advantages of the use of COaffected. Iodinateaffected. Another eactions.16 Howevenjection.2 angiographies does not affect renal function.[It has been reported in several studies that COfunction.7 These s2 is lower than after injection of iodinated contrast medium alone. CO2 alone was not sufficient to visualize the small and narrow vessel. PTRA and stent placement could be performed safely with the addition of small dose of iodinated contrast to the CO2 without significant deterioration in renal function. Drawback of this study was that it was not possible to totally exclude the use of iodinated contrast medium. Hawkins et al, showed that there was a mean decrease in renal blood flow of 11.86% immediately after the CO2 injection which returned to baseline after 24 hours in canine model.[2 toxicity, but the intensity is much less than iodinated contrast. The incidence of CIN depends on the renal function,[et al, showed that, in patients without diabetes, whose S.Cr. concentrations were higher than 1.5 mg per deciliter, the incidence of nephropathy was reduced from 27.0 to 12.2% by the use of low-osmolar agent (iohexol) as compared to high-osmolar agent (diatrizoate). Experimental studies in dogs, in which the use of iso-osmolar contrast medium showed no advantage,[In a recent study, Liss and coworkers found thfunction, diabetesfunction, osmolalifunction, of the cdvantage, but in hdvantage,2 accumulation. The drawbacks of this study are: one, the study was done in canine model and not in humans. Two, we did not study the effect of CO2 with different dosages or multiple boluses. Three, all the dogs were having normal renal functions. Hence, it is difficult to quantify the renal injury with reduced GFR.This study has the following strengths. One, prospective randomized study in canine model, showing the nephrotoxicity and quality of the image. Two, this study measured not only S.Cr. but also the tubular enzymes which are one of the sensitive markers of tubular injury. Arterial blood gas was done to show no significant COIn vitro conditions were created in which bubbles adhered to the tubing of the circuit, creating functional stenosis, or coalesced into larger bubbles that became trapped, thereby reducing flow and augmenting potential embologenic effects of subsequent injections. In canine models the CO2 injections showed potential for ischemic damage owing to vapor lock or transient obstruction to the blood flow in the vessels. The initial lack of blood in the renal cortex after CO2 injection can also explain the decrease in GFR. It is highly likely that the filtration of plasma over the glomerular membrane was momentarily stopped when the gas substituted all the blood.The exact mechanism that accounts for the increased risk of CIN has not been determined, but it has been suggested that medullary hypoxia is a crucial factor for the onset of CIN2. In vitr2 cause significant increase in enzymuria. More severe renal injury measured by changes in the tubular enzymes is seen with the iodinated contrast than CO2. Quality of images is better with iodinated contrast than CO2, but CO2 is able to delineate the aorta and main renal artery.Both iodinated contrast and CO"} +{"text": "Three-dimensional image formation in microscopy is greatly enhanced by the use of computed imaging techniques. In particular, Interferometric Synthetic Aperture Microscopy (ISAM) allows the removal of out-of-focus blur in broadband, coherent microscopy. Earlier methods, such as optical coherence tomography (OCT), utilize interferometric ranging, but do not apply computed imaging methods and therefore must scan the focal depth to acquire extended volumetric images. ISAM removes the need to scan the focus by allowing volumetric image reconstruction from data collected at a single focal depth. ISAM signal processing techniques are similar to the Fourier migration methods of seismology and the Fourier reconstruction methods of Synthetic Aperture Radar (SAR). In this article ISAM is described and the close ties between ISAM and SAR are explored. ISAM and a simple strip-map SAR system are placed in a common mathematical framework and compared to OCT and radar respectively. This article is intended to serve as a review of ISAM, and will be especially useful to readers with a background in SAR. In addition to the broad commonality ISAM has with other computed imaging techniques, it has strong physical and mathematical connections to a family of instruments including SAR, synthetic aperture sonar \u201332, seisIn the following section, OCT, the forerunner of ISAM, is described. In Sec. 3 a general framework for ISAM, OCT, SAR and radar is developed. The distinctions between the ISAM/SAR and OCT/radar models are discussed within this framework in Sec. 4. In Sec. 5 it is shown how the models used lead to a simple Fourier-domain resampling scheme to reconstruct the imaged object from the collected data. Simulated and experimental results are shown in Sec. 6, while alternative ISAM instrument geometries are briefly discussed in Sec. 7. Conclusions and references appear at the end of this article.2.An obvious distinction between ISAM and SAR is the spectrum of the electromagnetic field used to probe the sample\u2014ISAM operates in the near infrared (IR), while most SAR systems operate in the radio spectrum. Probing in the near-IR allows the formation of an image with resolution on the order of microns. Additionally, in many biological tissues the near-IR spectral band is primarily scattered rather than absorbed , allowincL, determined by the statistical coherence length of the source is proportional to the square of the minimum width \u03c90 of the beam. As illustratted in \u03c90 and b implies that the resolution, which improves with decreasing \u03c90, and the depth of focus are competing constraints in OCT. When the coherence gate is set to image planes outside of the depth of focus, the transverse resolution suffers as the beam becomes wider.As described above, depth discrimination in OCT is achieved via coherence gating, while transverse resolution is achieved using focusing optics. Ideal focusing optics would produce a thin collimated beam in the sample, described as a pencil beam in ISAM uses computational imaging to overcome the trade-off between depth of focus and resolution. By accurately modeling the scattering processes and the data collection system, including the defocusing ignored in OCT image formation, the scattering properties of the object can be quantitatively estimated from the collected data. As in SAR, diffraction-limited resolution is achieved throughout the final image. for both ISAM and SAR the key to this capability is the coherent collection of a complex data set.Interferometric microscopes , such as3.In both SAR and ISAM an electromagnetic wave is used to probe the object, the detection apparatus is scanned in space, and a time-of-flight measurement is used to image an additional spatial dimension. Thus, in a fundamental sense, the connection between the data and the object is determined by the same physical laws in either case. This analogy can also be extended to other wave-based techniques such as ultrasound and seismic migration imaging. In this section a general model for radar, SAR, OCT and ISAM techniques is presented. While there are significant differences in system scale and operation, see \u03c1, while the vector r describes the position in the imaged object. In the SAR case, a linear-track strip-map system is considered so that the detector is moved along points \u03c1 = T (superscript T indicates a transpose) and the object may be imaged at points in a plane r = T. In OCT and ISAM the data are collected as a function of two spatial variables in order to image a three-dimensional volume, so that the detector ranges over \u03c1 = T and the object may be imaged for r = T. Throughout this work a vector will be denoted by bold type, while the corresponding scalar magnitude is given in plain type, e.g., r is the magnitude of the vector r. The Fourier transform kernel is exp(i\u03c9t) for time domain signals and exp(\u2212ik \u00b7 r) for spatial domain signals, so that the complex plane wave exp [i(k0 \u00b7r \u2212 \u03c90t)] is a delta function centered on in the Fourier domain.As shown in 3.1.\u03c1, the object consists of a point scatterer at the position r, and an ideal temporal impulse response is used as input to the aperture. This returned scattered field will be denoted by \u0125, where the dependence on r \u2212 \u03c1 is indicative of the transverse spatial invariance of the system. Under the assumption linearity and temporal invariance, the response to an arbitrary transmitted waveform r\u00ca(t) is then,r\u00ca(t) is the transmitted radar pulse for SAR systems and the temporal dependence of the optical plane wave incident on the objective lens in ISAM. The object is described by the reflectivity function \u03b7(r) which, in terms of Maxwell's equations, can be identified as the susceptibility is not a function of \u03c9 in It is often convenient to represent the temporal convolution seen in 3.2.R\u00ce represents the processed radar data. In r\u00ca (t). Note that, following standard practice, a complex analytic representation of the signals has been employed .The backscattered field incident on the detecting aperture is represented in yed is possible at the frequencies used in radar, there exist no detectors capable of directly measuring the amplitude and phase of an optical field. However, the phase is indirectly captured through the use of the interferometer. Accurate control of the amplitude and phase of the probing optical signal presents a further complication. These obstacles are surmounted by using a broadband stochastic source and by relying on the coherence-gating effect to measure the time of flight. As shown below, broadband interferometry in OCT and ISAM essentially produces the same effects as coherent detection and pulse compression in radar.While coherent detection of \u03c4 is the temporal delay on the reference arm, T\u00ce does not depend on t is ensured by the assumption of stationarity.The response times of optical detectors are generally of such a scale that the measured data can be considered a long-time average over optical time scales. Assuming that the fields in the system are statistically stationary and ergodic and \u0393ss do not depend on \u03c4 in T\u00ce depend only on the real part of \u0393sr, but by taking multiple measurements that include a phase shift in the reference arm it is possible to recover the full complex function \u0393sr \u22121/2 decay so that, for the SAR system, The angular spectrum of G and sG seen in z = 0, resulting in the function G being directly related to the lens aperture. For high numerical aperture lenses the function G is broad and the beam width at the focus narrow. Aberrations on the lens can be included in the phase of the angular spectrum. A simple model for g is a Gaussian beam \u22121.The angular spectrum representations seen in As a first step towards the solution of the inverse problem, it is useful to recognize that the transverse part of the integral appearing in 5.2.z = 0 plane. In As illustrated in DH describes the bandwidth of the data (see [k(\u03c9)z]\u22121 appearing above describes the signal decay away from focus. In SAR, the method of stationary phase in one dimension is applied to a kernel based on the angular spectrum of k(\u03c9)z]\u22123/2.Applying the method of stationary phase in two dimensions gives the ISAM result,ata to obtain an elegant inversion 3/2 in the SAR case) for z in the diverging region. The transition point between these two regimes is discussed in [The approximated models described above can be substituted into the data model of ussed in .A(\u03c9) H act as linear filters on the data. The effects of these filters can be compensated by standard means, such as the Wiener filter [H is slowly varying, as is A(\u03c9), meaning that it may be acceptable to neglect the effects of A(\u03c9)H in many situations.In r filter . For sys\u03b7\u034c\u2032 is the three-dimensional Fourier transform of \u03b7(r)/R(z), the object with an attenuation away from focus, and\u03c9\u2212k algorithm or the wavenumber algorithm. This work shows the utility of the Stolt mapping in the field of interferometric broadband microscopy.In either case, the remaining integral in The equivalent Fourier mapping for OCT, found from the kernel of S. This procedure can be summarized asS, collected as described in Sec. 3, take the transverse spatial Fourier transform to get S\u0303.Starting with the complex data S\u0303 , to compensate for the bandpass shape given by A(\u03c9) H in Implement a linear filtering, i.e., a Fourier-domain multiplication of a transfer function with S\u0303 so as to account for the Stolt mapping illustrated in Warp the coordinate space of \u03b7(r)/R(z), the object with an attenuation away from focus.Take the inverse three-dimensional Fourier transform to get an estimate of R(z) to compensate for decay of the signal away from focus.If required, multiply the resulting estimate by The relation given in The operations described above are computationally inexpensive and allow a fast implementation of ISAM processing .6.In this section ISAM images are compared to those obtained using standard OCT methods. The high quality of the results obtained validates the calculations made above, while also showing that the approximations made to the forward model in Sec. 5, do not introduce significant error in the solution to the inverse problem.6.1.z axis.Numerical simulations of the ISAM system are useful for providing a theoretical corroboration of the proposed methods in a tightly controlled and well understood environment. In The data were produced using the focused vector beam formulation given in . The elexq\u2013yq plane.The magnitude of the spatial-domain OCT data gives a broadly spread and low-amplitude response. Ideally the image would be point-like, corresponding to the point scatterer. The blurring observed is due to the scatterer being in the out-of-focus region. When the OCT image is examined in the Fourier domain, curved phase fronts can be seen. For the offset point scatterer imaged, the Fourier spectrum should have flat phase fronts parallel to the The Fourier resampling of ISAM can be seen to take the curved OCT phase fronts to the expected straight lines. When the ISAM image is represented in the spatial domain, the desired high-amplitude, point-like image is seen. These simulations lend strong support to ISAM, as the detailed, vectorial forward model is inverted accurately by a simple Fourier-domain resampling only.6.2.\u03bcm, in silicone. This phantom was imaged with a spectral-domain ISAM system employing an objective lens with a numerical aperture of 0.05. A femtosecond laser was used as a source, to give a central wavelength of 800nm and a bandwidth of 100nm. The resulting focused pattern g can be approximated as a Gaussian beam with a spot size of 5.6\u03bcm and a depth of focus of approximately 240\u03bcm. Further details of the ISAM instrument and the phantom can be found in [Beyond simulations, the next step in ISAM validation is to image an engineered object (i.e. a phantom) with known structure. Here the phantom was constructed by embedding titanium dioxide scatterers, with a mean diameter of 1found in .ISAM processing, including dispersion compensation , was appx\u2013y details of Out of focus blurring is clearly visible in the collected data. This blurring limits the depth of field in OCT. The ISAM reconstruction can be seen to bring the out-of-focus regions back into focus, as evidenced by the point-like features in the image, which correspond to individual titanium dioxide scatterers. It should be noted that the point-like reconstructions observed are produced by the physics-based computational imaging, not by the use of any assumed prior knowledge of the sample, e.g., . The x\u2013yTo further illustrate the SAR-ISAM analogy, ISAM and SAR images are compared below. Strip-map radar and SAR images from a linear rail SAR imaging system ,80 are s6.3.OCT and ISAM are primarily biological imaging methods. As such, the most important capability of ISAM is the imaging of tissue. As described in , human bThe improvement observed in the ISAM reconstructions has significant consequences in terms of the diagnostic utility of the images. In the out-of-focus OCT images, the cellular structure is almost entirely lost, while in the ISAM reconstructions, significant features can be seen on the micrometer scale. For example, cell membranes can be recognized, and the boundary between the adipose and fibrous tissue can be clearly seen. There is also a strong correspondence to the histological sections, although embedding, sectioning and staining of the tissue disrupt the sample to some extent. ISAM, unlike OCT, can be seen to allow diffraction-limited imaging at all planes within the sample, rather than just at the physical focus. As a result, significantly more information regarding the tissue can be extracted without increasing the measurement duration or scanning the focal plane. In contrast to the histological images, the structure visible in the ISAM images is observed without destruction of the sample. This suggests ISAM may be particularly useful in applications where in vivo imaging over a large tissue volume is preferable to biopsy.7.ISAM is a microscopic imaging technique and is implemented on a bench-top scale. This provides significant flexibility in the design of alternative ISAM modalities. In this section some alternative ISAM instruments are briefly discussed.7.1.To achieve a maximum-resolution image it is necessary to use the highest possible numerical aperture objective lens . For su\u03b7 (r), but a rank-two tensor function of position \u03b7\u0304 (r). The illumination and detection patterns, g and f , are vectorial, which results in six independent ISAM kernels\u2014one for each possible pair of field directions in illumination and detection. That is,g is an element of the field g, and \u03b1 takes on values of x, y and z. The scalar kernel of In the vectorial system, scattering from the object is recognized as being dependent on the polarization state of the relevant fields. As a result, the object is not a scalar function \u03b7\u0304 is an element of the tensor \u03b7\u0304(r). The scalar case of It can be shown that the data then depend on the scattering tensor as ,(30)S = h. Symmetry arguments [\u03b7\u0304 = \u03b7\u0304, for the scattering tensor. The effect of each independent element of the scattering potential on the data is therefore described by a distinct kernel.It can be seen from rguments , can be 7.2.x\u2013y images sequentially, one frequency \u03c9, or delay \u03c4, at a time. A similar system has been analyzed for ISAM [z-propagating plane wave, so that the illumination pattern isf is of the same form as g in Full-field OCT systems -93 involfor ISAM . In thisThe spatial-domain kernel of Confocal ISAM is analogous to SAR, and both techniques share the Stolt mapping. The full-field ISAM mapping of 7.3.Rotationally-scanned ISAM is a senS, is sampled at points given by the displacement p along the y axis and the azimuthal coordinate \u03b8, as well the usual frequency \u03c9. Taking the Fourier transform with respect to both p (argument \u03be) and \u03b8 (argument \u03b8\u03b7) results in the data S\u0303. After some calculation an approximate expression is obtained for the transformed data:K describes the bandpass function of the rotationally-scanned ISAM system. The function \u03ba\u034c is a Fourier transform of a resampled version of the Fourier transform of the object being sought. That is,x\u0302, \u0177, \u1e91 are unit vectors and\u03b7(r), with P(r) a function of the radial distance to focus [The complex analytic signal, to focus . It is t7.4.g and f . Varying the source coherence length allows considerable control of g and also results in a changing resampling scheme in the inverse problem. The multiple scattering artifacts that can be problematic in full-field ISAM can be effectively mitigated using partially-coherent ISAM.In a recent analysis , it has 8.ISAM is a computed imaging technique that quantitatively estimates a three-dimensional scattering object in broadband coherent microscopy. The solution of the inverse problem allows the reconstruction of areas typically regarded as out of focus. The result obviates the perceived trade-off between resolution and depth of focus in OCT.ISAM, like OCT, is a tomographic method, i.e., the images produced are truly three-dimensional. While ISAM addresses an inherent weakness in OCT, namely the need to scan the focus axially to obtain images outside of the original focal plane, ISAM is not merely a method to refocus the field computationally. Refocusing may be achieved from a single interferometric image at a fixed frequency, but the resulting image is still inherently two-dimensional, failing to unambiguously distinguish contributions to the image from various depths. As in other ranging technologies, the broadband nature of ISAM allows a true three-dimensional reconstruction.ISAM and SAR are closely related technologies, to the point where they can be cast in the same mathematical framework. Both techniques employ a Fourier domain resampling, based on the Stolt mapping, in the inverse processing. While the mathematics of the two systems are closely related, each uses a significantly different region of the electromagnetic spectrum and images objects of com-mensurately different scales. In SAR, translation of the aperture and computational imaging allow the synthesis of a virtual aperture of dimension dependent on the along track path length, rather than the physical aperture size. This larger synthetic aperture produces an image of higher resolution than would otherwise be achievable. In OCT the limitations on the size of the physical aperture are not the limiting factor, rather the image acquisition time becomes prohibitively long if the focal plane must be scanned through an object of extended depth. The computational imaging in ISAM gives diffraction-limited resolution in all planes, not just at the physical focus, and hence eliminates the need for focal-plane scanning.ISAM and SAR are examples in the broad class of modalities known as computed imaging. Like almost all computed imaging modalities in common practice today, they are based on the solution of linear inverse problems. Linear inversion problems offer advantages such as the option to pre-compute and store the elements of an inversion kernel for rapid computation of images from data. Moreover, error and stability may be well understood and there exist a wealth of well-studied methods for regularization (stabilization) of the inversion algorithms. ISAM and SAR are also members of the more restrictive class of problems that may be cast as data resampling. To arrive at the resampling view of these problems, the data must be Fourier transformed and the resampled data Fourier transformed again. Thus the methods take advantage (are even reliant on) one of the greatest advances in applied mathematics in the last half-century, the fast Fourier transform . They ma"} +{"text": "Equivalence: Do observers' judgments agree with their actual performance? Do they correctly trade off eccentricity and contrast and select the more discriminable target in each pair? Transitivity: Are observers' choices self-consistent? Dominance: Do observers understand that increased contrast improves performance? Decreased eccentricity? All observers exhibited patterned failures of equivalence, and seven out of eight observers failed transitivity. There were significant but small failures of dominance. All these failures together reduced their winnings by 10%\u201318%.Recent work in motor control demonstrates that humans take their own motor uncertainty into account, adjusting the timing and goals of movement so as to maximize expected gain. Visual sensitivity varies dramatically with retinal location and target, and models of optimal visual search typically assume that the visual system takes retinal inhomogeneity into account in planning eye movements. Such models can then use the entire retina rather than just the fovea to speed search. Using a simple decision task, we evaluated human ability to compensate for retinal inhomogeneity. We first measured observers' sensitivity for targets, varying contrast and eccentricity. Observers then repeatedly chose between targets differing in eccentricity and contrast, selecting the one they would prefer to attempt: e.g., a low contrast target at 2\u00b0 versus a high contrast target at 10\u00b0. Observers knew they would later attempt some of their chosen targets and receive rewards for correct classifications. We evaluated performance in three ways. Human ability to discriminate drops dramatically with increasing distance from the center of vision. If you fixate a word on a page, you likely can not read words a short distance away. Because of this retinal inhomogeneity, we need to move our eyes to search a scene. The efficiency of search depends on how well the visual system compensates for inhomogeneity in planning eye movements. We used a simple decision task to find out what the observer \u201cknows\u201d about his or her own retina. We first measured observers' sensitivity for targets, varying contrast and eccentricity. Observers then repeatedly chose between targets differing in eccentricity and contrast, selecting the one they would prefer to attempt: e.g., a low contrast target at 2\u00b0 versus a high contrast target at 10\u00b0. Could observers correctly trade off contrast and eccentricity and pick the more discriminable of the two targets? We found that observers exhibited large, patterned errors in their choices, making choices that were not even self-consistent. Targets were placed along a horizontal line passing through the fovea and each target could be thought of as an ordered pair We examined whether human observers have access to this information in a simple decision task. In the first part of the experiment (decision), the observers were asked to judge which of two configural targets, differing in contrast and in retinal eccentricity, In the main part of the experiment of New York University and informed consent was given by the observer prior to the experiment.Stimuli were displayed on a 19-in. Sony Trinitron Multiscan G500 monitor controlled by a Dell Pentium D Optiplex 745 computer. The monitor was run at a frame rate of 100 Hz with 1280\u00d71024 resolution in pixels. A forehead bar and chinrest were used to help the observer maintain a viewing distance of 57 cm. At that distance, the full display subtended 40.4\u00b0\u00d730.3\u00b0. The observer viewed the display binocularly.Observers were required to fixate a fixation cross and all stimuli were presented relative to this fixation cross. We used an Eyelink II eye tracker to verify that observers did not make eye movements away from the fixation cross. At the beginning of each trial drift correction was made at the fixation cross. The criterion of eye movement was set to be a speed over 10 deg/s or an offset over 1 deg from the fixation cross. A trial would be cancelled if the fixation constraint were violated during the trial. The eye tracker was calibrated initially, drift corrected for each trail and re-calibrated after every 100 trials or when drift exceeded 5 deg.2) background. The fixation cross was black, spanning 2) square with an even lighter gray dot of 2, i.e., a contrast of eccentricity-contrast pairStimuli were presented against a uniform gray between targets that differed in contrast, we used one-up, one-down adaptive staircase procedures. In a staircase, one target of one contrast was fixed in eccentricity and the target of the other contrast varied in eccentricity. The fixed contrast in each staircase had an eccentricity corresponding to a probability correct of 0.6, 0.7, 0.8, or 0.9 separately estimated for each observer based on their calibration data. We estimated the eccentricity that the observer considered to be equally discriminable for the variable contrast. Each staircase consisted of 70 trials. There were 12 staircases (3 contrasts\u00d74 probabilities), randomly interleaved. That is, 12 staircases\u00d770 trials\u200a=\u200a840 staircase trials. Based on these staircase trials, we tested equivalence and transitivity.equi-contrast trials), or different contrasts but the same eccentricity . The possible contrasts were low, medium, and high. The possible eccentricities were the eccentricities corresponding to a probability correct of 0.75 for each of the three contrasts, computed with the functions estimated in the calibration task for the particular observer. The number of equi-contrast trials was 3 contrasts\u00d73 eccentricity combinations\u00d710 repetitions\u200a=\u200a90. The number of equi-eccentricity trials was 3 eccentricities\u00d73 contrast combinations\u00d710 repetitions\u200a=\u200a90 as well.To test dominance, we included trials in which the two targets had different eccentricities but the same contrast and examined whether they significantly deviated from zero. We used a bootstrap method We noticed that observers' errors were not random in direction. In t-tests, all observers' mean probability difference was significantly different from zero (p<.05). Among the eight observers, three overestimated the visual sensitivity difference and the other five underestimated it.To verify this claim we computed probability difference of the lower contrast target minus the higher contrast target averaged across the 12 subjective indifference pairs for each observer. According to two-tailed Student's We also measured observers' errors in eccentricity. The correct eccentricity of the variable target in a staircase was defined as the eccentricity where the variable target had the same probability correct as the fixed target. Eccentricity error of a subjective indifference pair was the actual eccentricity of the variable target minus the correct eccentricity. The absolute error averaged across the 12 pairs was 1.6, 5.8, 1.9, 7.5, 2.2, 7.7, 6.4, and 5.0 degrees respectively for S1\u2013S8. Their median was 5.4 degrees. Therefore, observers' errors in the decision task were unlikely to be a byproduct of lack of ability to discriminate eccentricity.In the equivalence test, we tested whether observers made judgments consistent with their actual ability to classify stimuli differing in contrast and eccentricity. They did not do so. Next we examined whether observers' judgments, even though in error, were self-consistent by testing transitivity (one of the necessary conditions for a conjoint measurement representation) as follows. An observer's judgments are transitive if and only if, for all choices of eccentricities equivalence transformation.Suppose the function From the decision task, we can estimate the equivalence transformations of low-to-medium, medium-to-high, and high-to-low contrasts, respectively denoted as In our transitivity test, we assume that the subjective probability correct for a particular contrast, like the true probability correct, is a function of eccentricity in the form of Equation 1. An equivalence transformation from one contrast to another contrast would then be linear on a log scale passed the transitivity test. The remaining seven observers' mean Observers failed the equivalence test and, with one exception, the transitivity test. The dominance test is, in conjoint measurement terms, a test that observer's preferences form a weak order satisfying single cancellation We employed a simple decision task with a conjoint measurement design to investigate what people know about their own visual uncertainty across the retina. In this task, observers were asked to judge which of two eccentricity-contrast pairs Observers may err in judging equally-discriminable pairs, but be self-consistent in their erroneous judgments. We tested whether observers' judgments were transitive. An observer's judgments are transitive if and only if, for all choices of eccentricities The last test, dominance, assessed whether the observer would choose the eccentricity-contrast pair with smaller eccentricity if contrasts were the same or the eccentricity-contrast pair with larger contrast if eccentricities were equated. An observer need only have a crude sense that higher contrast leads to better performance and that performance is better at smaller eccentricities, at least for our choice of stimuli. In particular, an observer can \u201cpass\u201d dominance without any ability to trade off the consequences of differences in contrast with differences in eccentricity. We found significant failures of dominance but the rate of failure was small and observers were far from the chance level that would indicate a complete failure of dominance.The observer maximizes his expected gain by always choosing the contrast-sensitivity pair that is more readily detectible. If the probability of detection of one pair is Previous work amply demonstrates that memory for the location of targets decays significantly over time In conclusion, we find little evidence that observers can accurately assess their visual sensitivity or even order eccentricity-contrast pairs consistently. Their consistent patterns of transitivity violation suggest that contrast and eccentricity are treated as two dimensions that constitute a lexicographic semiorder We emphasize that the decision task inducing these failures in judgment was remarkably simple. Since rewards never varied, failures to judge probability correctly could not be due to assignment of subjective utilities to rewards. Moreover, any invertible distortion of probability of the sort commonly found in the decision making literature Previous work in cue combination and in motor planning suggest that the human visuo-motor system has access to estimates of its own visuo-motor uncertainty in various tasks We consider a very similar task but in a different domain: judgments of retinal sensitivity as a function of contrast and eccentricity. In contrast to performance in these visual and motor tasks, however, our observers not only had markedly distorted representations of their retinal scaling functions for targets differing in contrast but also made choices that violated transitivity.The observed failure to correctly judge visual sensitivity across retinal positions agrees well with reports in other areas. Patients suffering from scotomas are typically unaware of the scotoma even when testing reveals near total loss of visual sensitivity outside the fovea Our results suggest that people might have difficulty in integrating the uncertain visual information from across different retinal eccentricities to speed search. In fact, people are reported to be suboptimal at choosing where to saccade One possibility is that observers have inaccurate estimates of retinal eccentricity Our results are in apparent conflict with the results of Najemnik & Geisler But a second possibility is that human visual search is actually based on simple heuristics plus a qualitative understanding of one's visual sensitivity map. Such a heuristic-based approach may approximate ideal performance in some tasks while failing utterly in others. The experimenter who considers performance in a limited range of scenes may record behavior that approximates optimal but is in fact no more than a lucky coincidence of a heuristic rule and experimental conditions. Such \u201capparent optimality\u201d is not rare in behavioral studies of animals only succeed if it has access to estimates of visual sensitivity for the range of contrasts and eccentricities we considered.The task used by Najemnik & Geisler Dominance was the only test where subjects predominantly succeeded and their success could be due to a preference for higher contrast We conjecture that this preference for short saccades could be an oculo-motor heuristic serving to integrate the visual sensitivity map into saccade selection. A key prediction of Najemnik & Geisler's model If human saccade decisions are based on such heuristics rather than on a computation that requires knowledge of visual sensitivity maps, we would expect a failure of adjustment when one's visual sensitivity map is changed. In fact, when observers' foveae were artificially shifted with gaze-contingent techniques, their performances in visual search were significantly worse than predicted by the ideal-observer model There is evidence that saccade selection and explicit perceptual decision in visual search pick the same location Text S1Proof for Equation 3.(0.06 MB DOC)Click here for additional data file."} +{"text": "The in vitro and in vivo stability and anti-tumour efficacy of the anti-EGFR/anti-CD3 bispecific monoclonal antibody (biMAb), M26.1, were analysed. The interaction of the intact biMAb with Fc receptor I (Fc gamma RI) present on human leucocytes was not observed when the antibody was used as an F(ab')2 fragment. A CD8+ T-cell clone coated with M26.1 F(ab')2 was as effective as the intact biMAb in inducing IGROV1 target cell lysis when tested in a 51Cr-release assay. Variable levels of reduction of F(ab')2 to monovalent F(ab') were observed upon incubation with human ovarian cancer ascitic fluid (OCAF) or with human glioblastoma cavity fluid (GCF), but not with mouse or human sera. Activated lymphocytes coated with F(ab')2 and incubated in vitro with GCF or OCAF for 24 and 48 h respectively maintained their targeting. Thus, the F(ab')2, when present as a soluble molecule, but not when bound to T cells, might lose some functional activity as a consequence of partial reduction to F(ab'). In normal mice, M26.1 F(ab')2 retained full cytotoxic activity in the circulation, and clearance values were similar to those obtained with parental and other MAb F(ab')2. Treatment of IGROV1 tumour-bearing mice with activated human lymphocytes coated with the M26.1 F(ab')2 significantly prolonged survival of the animals compared with tumour-bearing untreated and control mice treated with lymphocytes or F(ab')2 alone. Together, these results suggest the clinical usefulness of bispecific M26.1 F(ab')2 as a targeting agent for local treatment of tumours such as glioma and ovarian cancers that express variable levels of epidermal growth factor receptor (EGFR)."} +{"text": "Contrast Induced Nephropathy (CIN) is a feared complication of numerous radiological procedures that expose patients to contrast media. The most notorious of these procedures is percutaneous coronary intervention (PCI). Not only is this a leading cause of morbidity and mortality, but it also adds to increased costs in high risk patients undergoing PCI. It is thought to result from direct cytotoxicity and hemodynamic challenge to renal tissue. CIN is defined as an increase in serum creatinine by either \u22650.5\u2009mg/dL or by \u226525% from baseline within the first 2-3 days after contrast administration, after other causes of renal impairment have been excluded. The incidence is considerably higher in diabetics, elderly and patients with pre-existing renal disease when compared to the general population. The nephrotoxic potential of various contrast agents must be evaluated completely, with prevention as the mainstay of focus as no effective treatment exists. The purpose of this article is to examine the pathophysiology, risk factors, and clinical course of CIN, as well as the most recent studies dealing with its prevention and potential therapeutic interventions, especially during PCI. The role of gadolinium as an alternative to iodinated contrast is also discussed. There is a high prevalence of Chronic Kidney Disease (CKD) in Patients with Coronary Artery Disease (CAD), ranging from 23%\u201346% in different studies \u20133. PatieThe incidence of renal insufficiency in this high-risk group of population undergoing coronary intervention is on the rise due to the use of radiographic contrast in increasingly complex cardiac interventional procedures . This haThis paper covers the latest update on contrast-induced nephropathy among patients undergoing PCI.Contrast-induced nephropathy (CIN) after PCI has multiple definitions in the medical literature , 13. DueBased on these definitions, the overall incidence of CIN in the general population has been estimated to lie between 1%\u20136% . The figAlthough the pathogenesis of CIN is not well understood, there is increasing evidence that it occurs as a combination of direct toxicity to the renal tubular epithelium, oxidative stress, ischemic injury, and renal tubular obstruction \u201320. AlsoSignificant urine volume is needed to clear the high osmotic load of the contrast medium. Exposure to this high osmotic load results in characteristic histopathological changes of osmotic nephrosis, a morphological pattern with vacuolization and swelling of the renal proximal tubular cells . In a stThe risk factors of CIN have been extensively studied in the past and can be classified into modifiable and nonmodifiable risk factors. These have also been subdivided into \u201cpatient related\u201d and procedure related and are tabulated in The elderly remain at a higher risk of CIN after PCI, although the reason has not been elucidated yet. It is believed to be multifactorial, including age-related reduction in glomerular filtration rate (GFR), tubular function, as well as more difficult vascular access requiring greater amount of contrast, presence of multivessel disease, and comorbids. A few studies have found age older than 70 years to be an independent predictor of CIN in multivariate analysis \u201326.Baseline elevated serum creatinine was found to be an independent predictor of CIN in numerous studies. Increase in baseline Cr level to 1.2\u2009mg/dL or higher resulted in an exponential increase in the risk of nephrotoxicity . Risk ofMany studies have found Diabetes Mellitus (DM) as an independent risk factor for CIN in studies , 26, 29.Congestive Heart Failure, Anterior MI, Cardiogenic Shock, and Use of Intra-aortic Balloon Pump have all been associated with increased risk of CIN after PCI, mainly because they all lead to Reduced Renal Perfusion , 34, 35.Volume of contrast remains the primary modifiable risk factor. Increasing complexity of coronary intervention invariably has led to higher volumes used per procedure and this overall augments the risk of CIN. Many studies have documented a clear correlation between volume of contrast and risk of CIN , 36\u201338. However, whether incidence of CIN is dose related or not has also been studied. In their study of 118 patients with Cr >1.3 and pre existent renal disease, Mekan et al. found that the contrast-induced reduction in renal function was not significantly higher with a higher volume of contrast (>100\u2009mL) . On the Another important factor contributing to risk of CIN is the type of contrast used, with osmolality playing the key role. Other differences in contrast media including ionicity and viscosity may also be involved. Properties of contrast media are listed in A meta analysis of 31 trials looking at CIN and osmolarity of contrast used revealed that the incidence of CIN was significantly higher with high osmolar contrast use in patients with pre existing renal insufficiency. In patients without renal disease it was not significantly different . This waThe advent of iso-osmolar contrast was further promising. In a randomized, double-blind, prospective, multicenter study, Aspelin et al. compared the nephrotoxic effects of an iso-osmolar, dimeric, nonionic contrast medium, iodixanol, with those of a low-osmolar, nonionic, monomeric contrast medium, iohexol in a group of 129 diabetic patients with serum creatinine concentrations of 1.5 to 3.5\u2009mg per decilitre, and showed that nephropathy induced by contrast medium may be less likely to develop in high-risk patients when iodixanol is used rather than a low-osmolar, nonionic contrast medium . AnotherTwo recent trials looked at the incidence of CIN in CKD patients with use of iso-osmolar and low-osmolar contrast agents . In the In the most recent multicenter, double-blind, randomized, parallel-group ACTIVE trials, 148 patients with moderate-to-severe chronic kidney disease, undergoing contrast-enhanced multidetector computed tomography of the liver, were randomized to either the low-osmolar agent iomeprol-400 or iodixanol-320. The incidence of CIN as well as mean rise in serum creatinine was significantly higher in the patient group receiving iodixanol . Generally the use of iso-osmolar contrast agents is safer and leads to lower rates of CIN in patients at high risk of developing acute kidney damage. However, it may not be needed in all patients. An expert consensus on this issue is lacking. Furthermore, the iso-osmolar media generally have higher viscosity than their low-osmolar monomeric counterparts. Hence, these media should be prewarmed before infusion, which markedly lowers the viscosity .Patients usually have a combination of risk factors predisposing them to CIN after PCI. All scoring systems, therefore, attempt to encompass these risk factors. Bartholomew et al. worked on developing a time insensitive scoring system . IndepenMehran et al., similarly, found eight variables and assigned a weighted integer to each variable to make up a score cumulatively so as to divide low risk (\u22655) and high risk (\u226516) scores . The oveP < .0001). One-year and 5-year estimated mortality rates were also significantly higher in patients with ARF .\u201382.77\u201382Researchers then investigated whether increasing the standard dose of acetylcysteine resulted in better renoprotection. Hence, Briguori et al., in their single center study, found that double dose of NAC resulted in better prevention of CIN, especially with high volumes (140\u2009mL) of nonionic, low-osmolality contrast agent . EfficacP = .08), a nonsignificant trend towards benefit in patients treated with acetylcysteine [A meta-analysis of twenty trials involving 2195 patients showed summary risk ratio for contrast-related nephropathy to be 0.73 and had better postprocedural creatinine clearance . Benefit of statin before treatment was observed in all subgroups, except in patients with a preexisting creatinine clearance <40\u2009mL/min [Statins have also been studied as potential agents to prevent CIN in patients undergoing PCI, primarily by means of their beneficial effects on endothelial function and oxidative stress. This is very promising as most patients undergoing PCI are already on this class of drugs. Patti et al. showed that Statin-treated patients had a significantly lower incidence of CIN (3% versus 27%, 0\u2009mL/min . Similar0\u2009mL/min , 90. How0\u2009mL/min . However0\u2009mL/min . OverallNumerous other interventions have been studied to assess their efficacy in preventing CIN. Overall, results have either been ambiguous or unsatisfactory. A list of these potential management strategies and the existing data is summarized in Gadolinium is often used as an alternative to iodinated contrast in patients at increased risk of CIN. Overall, the trials show conflicting results about whether gadolinium is better than iodinated contrast in its risk of CIN . The safCIN is an iatrogenic disorder with high morbidity and mortality and a high incidence in elderly, diabetics, and patients with pre existing renal failure. Despite uncertainty regarding the degree of nephrotoxicity produced by various contrast agents, nonionic low-osmolar or iso-osmolar contrast media remains the preferred choice. Limiting the volume of contrast as much as possible is recommended. Best way to prevent CIN is to identify patients at high risk and provide adequate volume administration. However, use of sodium bicarbonate or N-Acetylcysteine in its prevention remains inconclusive in light of available evidence. Although the role of various drugs in prevention remains controversial, nephrotoxic drugs should be avoided before and after the procedure. Also, there still is no conclusive evidence to recommend gadolinium as a better alternative to iodinated contrast media in order to prevent CIN.The authors declare that they have no conflict of interests."} +{"text": "Phosphoprotein phosphatase 2A (PP2A), a major serine-threonine protein phosphatase in eukaryotes, is an oligomeric protein comprised of structural (A) and catalytic (C) subunits to which a variable regulatory subunit (B) can associate. The C subunit contains a methyl ester post-translational modification on its C-terminal leucine residue, which is removed by a specific methylesterase (PME-1). Methylesterification is thought to control the binding of different B subunits to AC dimers, but little is known about its physiological significance in vivo.PME-1 gene causes perinatal lethality in mice, a phenotype that correlates with a virtually complete loss of the demethylated form of PP2A in the nervous system and peripheral tissues. Interestingly, PP2A catalytic activity over a peptide substrate was dramatically reduced in PME-1(\u2212/\u2212) tissues, which also displayed alterations in phosphoproteome content.Here, we show that targeted disruption of the in vivo.These findings suggest a role for the demethylated form of PP2A in maintenance of enzyme function and phosphorylation networks Reversible protein phosphorylation regulated by the coordinated action of protein kinases and phosphatases is an essential signaling mechanism for most cellular processes. Post-translational phosphorylation is predicted to occur on more than 30% of all eukaryotic proteins Despite the central role that PP2A plays in cell signaling, the biochemical mechanisms that regulate PP2A activity in vivo are poorly understood. This is in part due to the complex composition and post-translational modification of PP2A. Structurally, it is a heterotrimeric complex typically consisting of a catalytic subunit (C), a scaffolding subunit (A or PR65) and one of an array of different regulatory subunits. In mammalian cells, the A and C subunits each have two isoforms (\u03b1 and \u03b2), which share high sequence similarity. However, the most variable component of the holoenzyme is the regulatory subunit, which can belong to one of four different families termed B (or PR55), B\u2032 (or B56 or PR61), B\u2033 (or PR72) and B\u2019\u2019\u2019 (or PR93/PR110). Each one of these gene families encodes multiple isoforms and splice variants. The different families of B subunits bind to overlapping regions on the AC dimer so their association to the core enzyme is mutually exclusive. Combinatorially, this variety of B subunits could generate as many as 70 different holoenzyme assemblies in vivoThe current model for regulation of PP2A suggests that heterotrimers containing different regulatory subunits have distinct functions 307, as well as on a threonine residue 309) 309 (referred to hereafter as \u201cmethylation\u201d) is catalysed by a specific S-adenosylmethionine dependent methyltransferase, termed leucine carboxylmethyltransferase (LCMT) 309 and PP2A activity has remained contentious with different groups observing opposed effects in vitro, suggesting instead that this modification indirectly regulates PP2A activity by modulating the binding of different regulatory B subunits to AC dimers in vivo, methylation is predicted to alter the targeting of PP2A to certain substrates and, as a consequence, potentially impact a wide range of signalling pathways PME-1 gene did not result in an observable cellular phenotype, even though PP2A methylation levels were enhanced A further level of PP2A regulation is provided by post-translational modification of the catalytic subunit, which can be phosphorylated on Tyrin vivo.To more clearly understand the impact of methylation on PP2A function in mammalian biology, we have created mice that lack PME-1 by targeted gene disruption (PME-1(\u2013/\u2013) mice). Deletion of PME-1 resulted in post-natal lethality, a phenotype that correlated with a nearly complete loss of demethylated PP2A in most mammalian tissues. PP2A activity and brain phosphoproteome were also altered in PME-1(\u2013/\u2013) mice. These data indicate that dynamic methylation is required for proper PP2A function PME-1 gene was obtained as part of a commercial BAC clone (Invitrogen). The gene disruption construct was generated using PCR-amplified 5\u2032 and 3\u2032 homologous recombination fragments surrounding exon 7, which codes for amino acids 134\u2013185 of the PME-1 gene. The 5\u2032 and 3\u2032 homologous recombination fragments were subcloned into the NotI and BamHI sites (5\u2032) and XhoI and internal HindIII sites (3\u2032) of the pKO scrambler NTKV-1901 vector. Primers for 5\u2032 homologous end: 5\u2032-GC GCGGCCGC CAC TGG CAG ACA CTC TCT CGC-3\u2032 and 5\u2032-GC GGATCC CTC ACA GCT ATC TCC TTT ACC-3\u2032 . Primers for the 3\u2032 homologous end: 5\u2032-GC CTCGAG GAG ACT CAT ATT GGA AGC TGG-3\u2032 and 5\u2032-CAA CAG GGC TGC TAA CAC AGG-3\u2032 (reverse). Homologous recombinant 129SvJ embryonic stem cell clones were identified by Southern blot analysis, and two such clones were used to generate chimeric mice on a C57BL/6 background. Chimeras from one of the two clones gave germline transmission of the mutated gene. All mice used in this study were first or second generation offspring from intercrosses of 129SvJ-C57BL/6 PME(+/\u2212). All work performed in mice was done in accordance with the guidelines of the Institutional Animal Care and Use Committee of The Scripps Research Institute.The HindIII and separated on a 1% agarose gel. Fragments were transferred to nylon membrane and probed with 5\u2032 external probe. An external \u223c330 bp probe was generated by PCR using the PME-1 genomic BAC clone as template and the following primers: 5\u2032-CAG TTA GCT AGG ATG TGC-3\u2032 (forward primer 3\u2032), 5\u2032-CCA GAG GAA GTA AAC AGG-3\u2032 (reverse primer 3\u2032), 5\u2032-TCT GGT GGG CTT ATA CCG-3\u2032 (forward primer 5\u2032) and 5\u2032-TTC TTT TCT GGT CTT GCT TCC-3\u2032 (reverse primer 5\u2032). 32P-labeled probe was hybridised overnight at 65\u00b0C.For Southern blotting, genomic DNA was digested with PME-1(+/+) primer set: 5\u2032-G GTG TCT TCC TCC AGC ACT C-3\u2032 and 5\u2032-CCA TAC CAG GGG ACC TCC TAC-3\u2032; PME-1(\u2212/\u2212) primer set: 5\u2032-GTC ACA GGG GCA AAA CTG TC-3\u2032 and 5\u2032-GCT CCC GAT TCG CAG CGC ATC-3\u2032 that gave PCR products of 259 and 360 bp, respectively. After initial denaturation at 94\u00b0C for 4 min, PCR amplification was performed at a denaturing temperature of 94\u00b0C for 30 sec and followed by annealing at 60\u00b0C for 30 sec and extension at 72\u00b0C for 30 sec (35 cycles).PCR genotyping was performed using the following primers: g for 45 min at 4\u00b0C degrees to generate membrane and soluble fractions. Soluble fraction from each tissue was analysed by standard SDS-PAGE and western blotting procedures (incubation with the primary antibodies was carried out overnight at 4\u00b0C and with the secondary antibodies for 1 hour at room temperature). Polyclonal anti-PME-1 was generated in rabbit against a PME-1-GST fusion protein. Anti-PP2A structural (A), regulatory (B and B\u2032) and catalytic subunit antibodies were from Upstate. An anti-phosphotyrosyl phosphatase activator protein (PTPA) antibody was obtained from Upstate and an anti phospho-PP2A (Tyr307) antibody was obtained from Santa Cruz. Immunoblots incubated with anti-tubulin (Sigma) were carried out as appropriate for loading control (not shown in the figures for the sake of clarity) and taking into account for band quantification as detailed in the corresponding legends.Tissue homogenates were centrifuged at 100,000Phosphopeptide substrate assay. Phosphatase activity of E18 tissue homogenates was determined using the phosphopeptide KRpTIRR as a substrate with a PP2A immunoprecipitation phosphatase assay kit (Upstate) following the manufacture\u0155s recommendations. Free PO42\u2212 generated was quantified by measurement of the absorbance at 595 nm after addition of malachite green-molibdate reagent. A standard curve with free phosphate was used to determine the amount of phosphate generated. ppNPP) assay.-Nitrophenylphosphate ( Phosphatase activity was determined following similar protocols to those previously described 2 and 0.10 mg/mL BSA) and incubated in presence of 10 mM pNPP at 37\u00b0C for 20 min. The reaction was terminated by addition of an equal volume of Na2CO3 1.0 M and absorbance was measured at 405 nm.4HCO3, reduced with 10 mM dithiothreitol by incubation for 45 min at 60\u00b0C and alkylated with 20 mM iodoacetamide for 45 min in the dark. Proteomes were diluted with 100 mM NH4HCO3 to a final Gu\u00b7HCl concentration of 1 M and digested with trypsin overnight at 37\u00b0C. As an internal standard, the peptide FLApTGDGAR was added to each extract. Peptides were desalted using SPE columns , spiked with a second standard peptide (LIEDAEpYTAK), and concentrated by vacuum centrifugation to a volume of 50 \u00b5L. Reductive amination was performed as described E18 brains from either PME-1(+/+) or (\u2212/\u2212) mice were homogenized in Trizol (Invitrogen) and proteins isolated following the manufacture\u0155s directions. The protein pellet was reconstituted in 75 \u00b5L of 6M guanidine\u00b7HCl (Gu\u00b7HCl) with phosphatase inhibitors (Sigma) and solubilized at 60\u00b0C for 30 min. Debris was pelleted by centrifugation and protein concentration was measured in the supernatant using a Bradford-based protein assay (Biorad). One milligram of total protein was brought to pH 8 by addition of 100 mM NH154HSMG158 motif that contains the catalytic serine nucleophile, was deleted by homologous recombination (To generate mice lacking PME-1 [PME-1(\u2212/\u2212) mice], the exon that encodes amino acids 134\u2013185, including the conserved Gbination . Two hombination and usedbination and was bination .At the moment of birth, PME(\u2212/\u2212) mice showed no obvious abnormalities. However, these animals did not commence normal breathing or suckling behaviour and invariably died during first day of birth (in vitro data using either reconstituted systems in vivo verification of this hypothesis has remained lacking. We compared the levels of methylated and demethylated PP2A in tissues from PME-1(+/+) and (\u2212/\u2212) mice using methylation-specific antibodies. Brain extracts from PME-1(\u2212/\u2212) mice contained essentially no demethylated form of PP2A or at Thr304, the importance of which has been recently suggested PME-1 has been described as the enzyme that specifically demethylates the catalytic subunit of mammalian PP2A based on of PP2A . The los of PP2A . The per of PP2A . One surPeripheral tissues from PME-1(\u2013/\u2013) mice, such as heart and liver, also showed a dramatic decrease in the levels of demethylated PP2A; however, some residual signals for this form of the enzyme could be detected in the absence of PME-1 . In periDrosophilaAblation of the catalytic (C) subunit of PP2A causes disappearance of all structural and regulatory PP2A subunits in 307, which has been found to inactivate PP2A 307 is not a major steady-state modification on PP2A in brain tissue of PME-1(+/+) and (\u2212/\u2212) mice.We next investigated the influence of the methylation state of PP2A on catalytic activity using a phosphopeptide substrate (KRpTIRR). Immunoprecipitated PP2A from PME-1(\u2212/\u2212) tissues showed significant reductions in phosphatase activity, which were most dramatic in brain tissue (\u223c4-fold reduction) . More thAnother mode of regulation of PP2A occurs through binding to the PP2A phosphatase activator (PTPA) protein. PTPA is highly conserved from yeast to human and was initially named based on its ability to stimulate the basal level of phosphotyrosyl phosphatase activity of PP2A p-nitrophenylphosphate (pNPP). Interestingly, no significant differences were observed in pNPPase activity in brain tissue from PME-1(+/+) and (\u2212/\u2212) mice (pNPPase activity was taken into account (pNPPase activity in brain tissue from PME-1(+/+) and (\u2212/\u2212) mice These data suggest that the methylation state of PP2A selectively impacts the productive binding/recognition of phospho-peptide substrates rather than causing inherent defects in catalytic activity. A possibility that cannot be excluded from the present results is that the decrease in activity can be due to differential composition of the immunoprecipitates between the PME-1-(+/+) and (\u2212/\u2212) samples. Although statistically significant variations in the levels of the immunoprecipitated C subunit were not detected by western blot (data not shown), their different composition cannot be ruled out, especially since this phenomenon has been widely described to influence PP2A activity Taken together, these data suggest that the decreased phosphopeptide phosphatase activity observed in PME-1(\u2212/\u2212) mice may be directly related to the absence of demethylated forms of the PP2A catalytic subunit. In order to establish whether the defective activity of PP2A was observed with other classes of substrates, we tested the activity of immunoprecipitated PP2A towards the small-molecule substrate /\u2212) mice . Similar account , inset, m/z units per modified primary amine group in the peptide. Phosphopeptides that are unique to one or the other proteome appear as singlets. After phosphopeptide identification using SEQUEST 0- and d3- labelled independent proteomes. The proteins identified as up- or down-regulated in at least two of three independent experiments with a difference between PME-1(+/+) and (\u2212/\u2212) samples of at least two fold were considered significant hits and were manually validated and (\u2212/\u2212) samples. The majority of the identified proteins are known phosphoproteins (with the exception of phosphacan). Interestingly, in addition to detecting some known PP2A interacting proteins and/or substrates [e.g., MAP1B A closer examination of the list of putative direct substrates of PP2A brain tissue) suggests some molecular and cellular hypotheses potentially related to the pre-mature death observed in PME-1(\u2212/\u2212) mice. Gab1 plays an essential role in several steps of mammalian development. For example, in Gab1(\u2212/\u2212) mice, migration of myogenic precursor cells is impaired and muscles in the diaphragm are missing in vitro biochemical studies Ppe1) were without apparent phenotypic defect The post-translational carboxylmethylation of the catalytic subunit of PP2A appears to exist in all eukaryotic organisms from yeast to human and, therefore, likely represents a key mechanism for regulating PP2A activity. Methylation has been hypothesized to influence the association of the PP2A heterodimer with different B regulatory subunits, which in turn control PP2A intracellular location and recognition of substrates. This model has been supported by various PME-1 gene by deleting it from mice. PME-1 gene deletion resulted in perinatal lethality, a phenotype that correlated with essentially complete loss of the demethylated form of PP2A in brain tissue. Further studies revealed that PME-1(\u2212/\u2212) brain tissue also possessed significantly reduced PP2A activity with phosphopeptide substrates and diminished quantities of PP2A holoenzyme complexes. To begin to assess the net biochemical and cellular effects of these changes in PP2A activity and complex assembly, we performed a comparative phosphoproteomic analysis of brain tissue from PME-1(+/+) and (\u2212/\u2212) mice. Several phosphoproteins were identified that exhibited either elevated or reduced signals in PME-1(\u2212/\u2212) brains, suggesting that the absence of demethylated PP2A invokes widespread alterations in phosphorylation networks. Collectively, we interpret these results to indicate that demethylated PP2A plays essential non-redundant functions that cannot be undertaken by the methylated pool of this protein. This statement implicitly assumes that methylated PP2A is the main, if not the unique, PME-1 substrate. However, the data available about the absolute substrate specificity of PME-1 are far for being conclusive. Therefore, the possibility of the existence of alternative substrates that could potentially play a role in the lethality and/or differential PP2A activity can not be unequivocally ruled out. Having said this, and even in the presence of other potential PME-1 substrates, it is clear that no other enzyme can undertake the role of PME-1 in PP2A demethylation, since non-methylated PP2A is virtually absent from PME-1(\u2212/\u2212) tissues. Considering the importance that has been attributed to the methylation state of PP2A, it seems logic to hypothesize that at least part of the effects are due to the disruption of the PP2A methylation state. Precisely how the absence of demethylated PP2A leads to reductions in enzyme activity or differential recognition of substrates remains unclear. Possible explanations could be that proper functioning and stability of PP2A complexes requires the dynamic ability to switch between methylated and demethylated forms during the substrate binding/catalytic cycle. In the absence of PME-1, this cycling would be blocked, resulting in an imbalanced accumulation of methylated forms of PP2A. Another explanation is that PME-1 is, itself, a key component of PP2A complexes in vivo. Potentially consistent with this latter idea, PME-1 has been shown to regulate active PP2A C subunit generation and holoenzyme assembly 156-to-Ala) forms of the PME-1 enzyme. Such next-generation studies should further refine our understanding of the evidently critical role that post-translational methylation plays in regulating PP2A activity in vivo.Here we have investigated the function of mammalian Figure S1Expression of PP2A structural and regulatory subunits in PME-1(+/+) and (\u2212/\u2212) tissues. Tissues were harvested from E18 embryos.(0.29 MB PDF)Click here for additional data file."} +{"text": "Studies in rodents and carnivores have shown that orientation tuning width of single neurons does not change when stimulus contrast is modified. However, in these studies, stimuli were presented for a relatively long duration , making it possible that contrast adaptation contributed to contrast-invariance of orientation tuning. Our first purpose was to determine, in marmoset area V1, whether orientation tuning is still contrast-invariant with the stimulation duration is comparable to that of a visual fixation.We performed extracellular recordings and examined orientation tuning of single-units using static sine-wave gratings that were flashed for 200 msec. Sixteen orientations and three contrast levels, representing low, medium and high values in the range of effective contrasts for each neuron, were randomly intermixed. Contrast adaptation being a slow phenomenon, cells did not have enough time to adapt to each contrast individually. With this stimulation protocol, we found that the tuning width obtained at intermediate contrast was reduced to 89% (median), and that at low contrast to 76%, of that obtained at high contrast. Therefore, when probed with briefly flashed stimuli, orientation tuning is not contrast-invariant in marmoset V1. Our second purpose was to determine whether contrast adaptation contributes to contrast-invariance of orientation tuning. Stationary gratings were presented, as previously, for 200 msec with randomly varying orientations, but the contrast was kept constant within stimulation blocks lasting >20 sec, allowing for adaptation to the single contrast in use. In these conditions, tuning widths obtained at low contrast were still significantly less than at high contrast (median 85%). However, tuning widths obtained with medium and high contrast stimuli no longer differed significantly.Orientation tuning does not appear to be contrast-invariant when briefly flashed stimuli vary in both contrast and orientation, but contrast adaptation partially restores contrast-invariance of orientation tuning. For most neurons in area V1, response amplitude depends on stimulus orientation However, the above studies demonstrating contrast-invariance of orientation tuning have all been performed in carnivores (cat or ferret) or rodents (squirrel). Whether orientation tuning is also contrast-invariant in primate V1 is not firmly established. One study examined orientation selectivity at different contrasts in the primate Furthermore, data demonstrating contrast-invariance of orientation tuning were generally obtained with relatively lengthy presentation of drifting sine-wave gratings \u2013 for four seconds usually. Contrast adaptation mechanisms could be activated during this time. At the neuronal level, contrast adaptation corresponds to the slow adjustment of firing rates that is observed during the lengthy presentation of a stimulus of constant contrast. For example, contrast adaptation appears as a progressive decline of response amplitude during the presentation of a constant high contrast stimulus It has been shown that, for many V1 cells, the time constant of contrast adaptation is less than 4 seconds both contrast and orientation when they are presented for a short duration (0.2 sec), corresponding to that of a fixation. We performed recordings in area V1 of a new world monkey, the common marmoset. The proportion of orientation selective neurons and tuning bandwidths of single-units in marmoset area V1 appear similar to those found in macaque V1 The first purpose of our study was to determine whether orientation selectivity is contrast-invariant with stimuli varying in Callithrix jacchus, n\u200a=\u200a6) weighting 350\u2013450 g. One half hour before anesthesia induction, animals were tranquilized with diazepam . At the same time, atropine (0.05 mg/kg) was injected subcutaneously to reduce secretions and to prevent bradycardia. Anesthesia was induced with Alphadalone/Alphaxalone acetate injected intramuscularly. Synthetic corticoids Dexamethasone (Merck) or Solumedrol (Pfizer) were given at the same time to prevent brain edema (1 mg/kg). Once anesthetized, animal's body temperature was maintained at 38\u00b0C using a heating pad controlled by a rectal thermistor . EKG recording was performed through metallic pliers. All incision sites were infiltrated with the local anesthetic lidoca\u00efn (Xylocaine\u00ae). A venous catheter was placed in the femoral vein to allow for intravenous infusion of solutions. Anesthesia was maintained during the remainder of the surgery by i. v. Saffan injection (0.17 ml/kg every 10\u201315 minutes). A tracheotomy was performed and a tracheal tube was inserted to allow artificial ventilation. The marmoset was then set in a stereotaxic frame. A homemade support for eyes and mouth bars has been built (following the design in All procedures were conducted in accordance with the guidelines from the French Ministry of Agriculture (d\u00e9cret 87/848) and from the European Community (directive 86/609) and was approved by the local ethical committee . The protocol used for marmoset preparation has been adapted from other published protocols 2O/O2 (50%/50%) using a ventilator whose volume and rate were initially set at 12 ml and 30 strokes/min respectively, and adjusted so as to keep end-tidal CO2 level, measured with a Capstar-100 Capnometer , between 4 and 5%. Anesthesia and analgesia were supplemented by a continuous infusion of sufentanil citrate after a loading dose of 1 \u00b5g/kg. The infusion vehicle was made of the mixture of 2 ml glucose 30%, 15 ml of amino-acid perfusion solution and included synthetic corticoids (0.4 mg/kg/hr); NaCl was added to a final volume of 50 ml. We waited for 1\u20132 hours of infusion with this solution to ensure adequate depth of anesthesia. The animal was then paralyzed by adding pancuronium bromide to the solution described above.Following surgery, the animal was artificially ventilated with NMydriasis and cycloplegia were induced with ophthalmic atropine sulfate . Gas permeable contact lenses were used to protect the eyes. Lenses were cleaned every day and neomycin sulphate eye drops applied to prevent infection. Optic disks were located using a reversible ophthalmoscope. RF eccentricity was determined relative to the position of the optic disk and, using histological sections, relative to published correlation between recording sites and RF position Visual stimuli were presented onto a computer monitor placed at 114 cm from the animal's eyes. For improving the focusing of the eyes, we examined responses to high spatial frequency sine-wave gratings and optimized the response by placing corrective lenses in front of the eyes.2 concentration were monitored throughout the experiment and maintained at 250\u2013350 bpm, 37\u201338\u00b0C and 3\u20135%, respectively. The EEG and the absence of reaction to noxious stimuli were regularly checked.The heart rate, rectal temperature and expiratory COAction potentials were recorded extracellularly through tungsten in glass microelectrodes SB color monitor in the last experiments. Gamma corrections were regularly made to produce accurate stimulus contrast, using VSG's \u201cOptiCAL\u201d photometer and associated automated correction. Contrast corresponds to Michelson's contrast, defined relative to maximal and minimal luminance of the gratings as The location of the RFs was determined with a hand-held projector. Eye preference was then determined and all subsequent visual stimuli were delivered through the dominant eye. Computer controlled stimuli were generated with a VSG2/2F board in the initial experiments, and with a VSG Visage system in the last experiments. Scripts for visual stimuli generation and presentation were written in the Matlab environment. Visual stimuli were presented on a Daewoo CMC-2100 ME, 21 inches color monitor in the initial experiments and on a 22 inches, Mitsubishi Diamond Pro 2070Cell selectivities and optimal stimuli were evaluated from PSTHs calculated on-line from the multi-unit recording. The preferred orientation of the cell or cells cluster was determined using drifting square-wave gratings presented at eight orientations, each presented in two motion directions . The grating was presented within a circular patch, 2\u20136 degrees diameter, centered on the RF. The remaining of the screen was a gray background with a luminance equal to the mean grating luminance. The drift temporal frequency was between 0.5 and 2 cycles/sec. It was qualitatively chosen as the one optimizing the response, as judged by listening to the cell's response on the audio-monitor. To avoid transient responses, the contrast was incremented from 0 to 40% in a 1 sec duration ramp, maintained at 40% for 3 or 4 sec, then decreased back to 0% in a 1 sec duration ramp, then maintained at 0% contrast for 1 sec. The measurement of mean firing rates was restricted to the 3\u20134 sec plateau period.Once the preferred orientation was characterized, the preferred spatial frequency was determined using sinusoidal drifting gratings (40% contrast). Drift speed, window size and timing of stimulus presentation were the same as for the orientation tuning protocol. Spatial frequencies varied either between 0.125 cy/deg and 2.83 cy/deg, or between 0.5 and 16 cy/deg in logarithmic steps , one causing 20\u201325% of the maximal response (\u201clow contrast\u201d), and one causing approximately 50% of the maximal response (\u201cmedium contrast\u201d).Our first aim was to determine whether orientation tuning is contrast-invariant with briefly flashed stimuli. Our second aim was to determine the consequences of contrast adaptation on orientation selectivity. The stimulation protocol we used to fulfill these aims is depicted on mismatch between the contrast presented at one particular moment and the contrast to which the cell was adapted.In the first block of stimulus presentation , and it match in this condition. Stimulus presentation time and interstimulus interval were the same as for the first block.In the second, third and fourth stimulus presentation blocks, orientation still varied randomly (blockwise randomization), but the contrast within each block was fixed: in the second block to low contrast only, in the third block to medium contrast only, and in the fourth block to high contrast only was less than the lower 95% confidence limit. We also considered the possibility that neurons may be \u201caccelerating\u201d, that is, that the spike count in the fourth bin was larger than the upper 95% limit \u2013 but this occurred in only a small number of cases (n\u200a=\u200a2/69 cells with low contrast and n\u200a=\u200a2/105 cells with medium contrast).In cells that showed significant adaptation, we next evaluated the time constant of adaptation. For this purpose, PSTHs were calculated for each contrast with a bin width of 0.8\u20131.2 sec (this corresponds to twice the grating presentation period). The data (firing rate vs. time) were then fit with a single exponential . Time coThe time constant of adaptation was used to delineate a period corresponding to the adapted state for the analysis of orientation selectivity with constant contrast conditions: adaptation was considered to have reached a steady state at a time corresponding to three times the time constant of adaptation. In cells with accelerating responses, the first 5 sec of the response were excluded from orientation tuning calculation. We also excluded the first 5 sec of the blocks in cells that showed a significant adaptation but for which we could not fit the data satisfactorily. The first 5\u201310 sec of the mixed contrasts block were also excluded from orientation tuning calculation.Single-unit spike trains were transformed into spike density functions: each spike was replaced with a raised cosine waveform . The sampling interval for the spike density was 5 msec. Averages of the spike density function, collapsing all spatial phases, were calculated for each orientation and for each of the 6 stimulus conditions separately. This resulted in 6 sets of orientation tuning curves: for low, medium and high contrast in the mixed contrasts condition, for low, medium and high contrast in the constant contrast condition, restricted to the adapted response only.Mean spontaneous activity was delineated between stimulus onset (time 0) and 200 msec prior to stimulus onset (adjustments down to 100 msec were required if the neuron showed an appreciable \u2018off\u2019 response). Significance of the responses was determined relative to the distribution of spontaneous activity bins amplitude (bin width 5 msec). Responses were considered \u2018significant\u2019 if their amplitudes were larger than 1.5 times the highest bin in the spontaneous activity period in two consecutive bins. This approach allowed us to dismiss false positives regardless of the statistics underlying spontaneous activity amplitude distribution. This arbitrary criterion is a very conservative one: if the noise was distributed in a Gaussian manner, then the p value associated with our criterion would be extremely low (p\u226a0.01).Mean firing rate for each orientation was calculated between response onset (40\u2013100 msec) and response offset. Since latency tends to increase when contrast decreases Quantification of orientation tuning was achieved by fitting either a Gaussian or Von Mises formula \u03b8 is the orientation (in rad). 0y corresponds to the component of the response that lacks orientation selectivity (it does not correspond to spontaneous activity that was removed prior to fitting). A corresponds to the amplitude of the orientation selective response at the preferred orientation, c\u03b8. k is a width factor from which the half-width at half-height of the tuning function can be calculated as:In broadly tuned cells, we found that the Von Mises fit often failed to stabilize. In these cases, the fits were made using a Gaussian curve of the form:HWHH was calculated as The 0y value to the mean of the two lowest experimental values. We always used the same fitting equation for the different conditions in each cell. That is, if a Gaussian was used for one of the contrast/adaptation conditions, a Gaussian was also used for the other 5 conditions.Fits that did not stabilize even with the Gaussian function were constrained by fixing the 2 of fit was >0.67. Median r2 were 0.935, 0.946 and 0,945 for tuning curves obtained at high, medium and low contrasts, respectively, in the mixed contrasts condition. Median r2 were 0.944, 0.951 and 0.949 for tuning curves obtained at high, medium and low contrasts in the constant contrast condition.Data have been considered for further analysis only when the rThe main conclusion of this study, which is that tuning width depends on contrast, did not depend on the fit function that was used. We compared changes in half-width at half-height vs. tuning function for each pair of contrasts comparison and found that changes in tuning width did not depend on the fit function used for 5 of the 6 contrast/adaptation conditions. The condition that showed a significant difference (p\u200a=\u200a0.02) between fit functions corresponds to the medium vs. high contrast in the adapted situation, which was the only condition in which contrast initially had no significant effect on tuning width see . For thiWe relied on the response evoked by drifting sine-wave gratings, used for characterizing spatial frequency tuning of the cells, for classifying cells as simple or complex. PSTHs (16 bins) were computed over one cycle of the drifting grating for each spatial frequency. After subtracting the mean spontaneous activity, each histogram was Fourier-analyzed and the F0 (average firing rate) and F1 components extracted. The F1/F0 ratio, or \u201crelative modulation\u201d maxR corresponding to the maximal response, 50C representing the contrast at with 50% of the maximal response is obtained, and the exponent n determining the steepness of the CRF. For cells that showed supersaturation (n\u200a=\u200a13/81), we removed the data points that were below the maximal response for contrasts larger than the one evoking the maximal response and the fit was made on this reduced data set. For cells that did not show saturation (n\u200a=\u200a34/81), that is, cells for which the fit provided Rmax that would be attained at contrast >100% , Rmax was instead ascribed to the firing rate extrapolated to 100% contrast and the C50 was then determined from this corrected Rmax value. These adjustments were made in order to provide a phenomenological description of the CRFs in marmoset monkey.This analysis has been performed on 81 single-units that showed significant responses in this protocol. PSTHs (16 bins) were computed over one cycle of the drifting grating for each contrast. After removal of spontaneous activity, each histogram was Fourier-analyzed and the F0 and F1 components extracted. Data were fit using the hyperbolic ratio equation After completion of an electrode track, several electrolytic lesions were made at different depths through the recording microelectrode. At the end of the experiment, the animals were sacrificed with a lethal i. v. injection of sodium pentobarbitone and perfused transcardially with 0.9% saline with heparin, followed by 4% paraformaldehyde in phosphate buffer. The posterior part of the brain was removed and cryoprotection was insured by overnight immersion in 30% sucrose solution. Parasagittal sections, 40 \u00b5m thick, were cut on a freezing microtome. Sections were stained with Cresyl violet to reveal cortical layers. Recording sites positions were determined relative to electrolytic lesions positions.t value comparing a parameter value (\u201cV\u201d) in two different conditions (\u201cC1\u201d and \u201cC2\u201d) could be calculated as:t value<\u22122.064 indicates a significant decrease of VC1 compared to VC2, and a t value>2.064 a significant (p<0.05) increase of VC1 compared to VC2.We determined the significance of the effects of contrast and contrast adaptation for each cell individually. Since a standard error (\u201cSE\u201d) value was provided with each parameter of the fit, a At the population level \u2013 except when mentioned \u2013 statistical significance of differences between paired groups has been determined using the non-parametric Wilcoxon rank test. Correlations were tested using the non-parametric Spearman rank correlation test. Confidence intervals for rho were constructed using Fisher's z transformation.The stimulation protocol is illustrated in mismatch between the contrast presented at a particular time, and the average contrast to which the neuron was adapted. This mismatch allowed us to probe the effect of contrast proper on orientation tuning, independently of the effect of contrast adaptation. We will refer to this condition as \u201cmixed contrasts\u201d. Orientation tuning curves obtained for each of the three contrasts in this mixed contrasts block are illustrated for the same cell in During the first block of stimulation, that lasted 40\u201360 sec, both orientation and contrast varied randomly from one stimulus presentation to the next. This corresponds to the \u201cmixed contrasts\u201d block , left. Imatched with the one used to stimulate the cell. This allowed us to examine the effect of contrast on orientation selectivity, including the effect of contrast adaptation. This condition is referred to as \u201cconstant contrast\u201d condition.In the second, third and fourth stimulation blocks, orientation still varied randomly from one stimulus presentation to the next, but the contrast was fixed to one value at a time for each block: either low, medium or high . Each blThe present study is based on extracellular recordings that have been performed in area V1 of 6 marmoset monkeys. The sample consists of 114 cells that responded to at least 1 of the 6 orientation vs. contrast conditions. Eighty-seven of these cells (76%) were orientation selective, a proportion very similar to that reported in previous studies of marmoset V1 To determine the number of cells that showed significant contrast adaptation, we compared for each single cell the number of spikes, averaged across all orientations, in the first 5 sec of the response to constant contrast presentation with the number of spikes counted between 15 and 20 sec see . When coTime constant of contrast adaptation was estimated using exponential fits made to PSTHs with bin width of 0.8\u20131.2 sec . AdaptatA first example illustrating the effects of contrast on orientation tuning when the contrast presented at a particular time, and the average contrast to which the neuron was adapted, did not correspond (mixed contrasts) is depicted in Additional examples are presented in For the cell of The example in We next examined, at the population level, how the orientation tuning parameters were modified by contrast and contrast adaptation.A\u201d in the fitting equations, which represents the amplitude of the orientation-tuned component in the neuronal responses . We first examined changes in response amplitude resulting from changes in stimulus contrast. Response amplitude refers here to parameter \u201cIn the mixed contrasts condition, tuned response amplitude varied with contrast, and, not unexpectedly, firing rates were lower at low contrast compared to higher contrasts in the vast majority of the cells . We examThe amplitude of the tuned response component decreased with decreases in contrast in the adapted situation as well , but difhigher for low contrast after adaptation to low contrast than after adaptation to mixed contrasts. Finally, given that, by experimental design, medium contrast should have yielded a response close to the mean obtained with the mean of the three contrasts in use, response amplitude after adaptation to medium contrast was expected not to differ much from response amplitude after mixed contrasts adaptation.During the mixed contrasts block, neurons adapted to a contrast representing the mean of the three contrasts used, whereas they adapted to the only contrast in use during the constant contrast blocks. It was therefore expected that response should be lower for high contrast after adaptation to high contrast than after adaptation to the mixed contrasts. Conversely, it was expected that responses should be Acst/Amix. The results obtained were close to this expectation. Changes in response amplitude were calculated as the ratio of the response amplitude, for a given contrast, after adaptation to that contrast in the constant (cst) contrast block, to the response amplitude to the same contrast in the mixed (mix) contrasts block: 100\u00d7higher after adaptation to low contrast than in mixed contrasts blocks (median 132.9%); in this later case, responses to low contrast stimuli were relatively depressed due to adaptation to the mean of the three contrasts in use in the mixed contrasts blocks, and recovered from this depression when given time to adapt to the low contrast only.At the population level, response amplitude with high contrast stimuli was significantly (p<0.0001) lower after adaptation to high contrast compared to adaptation to mixed contrasts (median percent change: 91.3%). Response amplitude with medium contrast was significantly (p\u200a=\u200a0.006) larger after adaptation to medium contrast than in mixed contrasts blocks but the median (102.6%) indicates relatively small changes in this case. Finally, response amplitude with low contrast stimuli was significantly (p\u200a=\u200a0.0004) c\u03b8) by calculating the difference between the value obtained with one contrast (C1) from the one obtained with a higher contrast (C2), cC1\u03b8\u2212cC2\u03b8. Distributions of differences in preferred orientation are shown in We next examined whether changing contrast modified neurons preferred orientation, as has been reported in a cat study In the mixed contrasts condition, a significant change in preferred orientation occurred in 37.1%, 53.3% and 56.7% of the cells for high vs. medium, high vs. low and medium vs. low contrasts, respectively . With adHowever, the differences in preferred orientation appear to be small in most cases. At the population level, the absolute values of preferred orientation differences were <8 deg for 80% of the cells in the mixed contrasts condition, and <6 deg in 80% of the cases in the constant contrast condition. Furthermore, as shown in We found that, in the mixed contrasts condition, contrast had a strong and highly significant effect on the HWHH of orientation tuning curves, with HWHHs being on average larger with higher contrast. Cumulative distributions of HWHHs for each contrast group are shown in Distributions of percent change in HWHH are presented in Given that the sample size varied for the different contrasts, we used paired comparisons to compare data at the population level. We found that HWHH at medium contrast was significantly less than at high contrast , with the HWHH at medium contrast representing 88.9% (median) of the HWHHs at high contrast. Similarly, HWHH at low contrast was significantly less than at high contrast , with the HWHH at low contrast representing 73.9% of the value obtained at high contrast. Finally, HWHH at low contrast was significantly less than at medium contrast , and the median value of percent change indicate that the HWHH at low contrast represented 76.4% of that obtained at medium contrast .In contrast to what was observed in the mixed contrasts condition, the cumulative distributions show thaOn the other hand, HWHHs at low contrast were still significantly less than at high contrast and still significantly less than at medium contrast . HWHH at low contrast represented 84.5% of the value obtained at high contrast and 89.5% of that obtained at medium contrast . HoweverDecreasing contrast reduced both tuning width and response strength. We next examined interactions between these two parameters. Indeed, a simple \u201ciceberg\u201d effect predicts that orientation tuning becomes broader when response becomes stronger. This, however, was not found to be the case. The scatter plots in 2\u200a=\u200a0.156 with a linear relationship). It is, furthermore, a negative correlation, suggesting increases in tuning width at medium contrast, provided response amplitude is less than at high contrast.No significant correlation was obtained between changes in tuning width and changes in response strength for low vs. high contrast and for low vs. medium contrast in the constant contrast condition as well , therefore inducing comparable amount of adaptation. However, cumulative distributions do not overlap , circlesThe conclusion up to this point is that orientation-tuning width appears to be adjusted by contrast adaptation. Adapting to a high contrast stimulus slightly reduced the HWHH compared to a situation in which stimuli had a lower (on average) contrast. An opposite and quite stronger effect occurred with low contrast stimuli: when adapted to a higher (on average) contrast, responses to low contrast stimuli were depressed and tuning widths were thinner. Conversely, adapting to low contrast allowed for recovery from adaptation to a higher (on average) contrast, and this resulted in both an increase in response amplitude and an increase in tuning width, though these effects were not correlated on a cell by cell basis. Thus, the way matched adaptation reduced the effects of contrast on tuning width was mostly by increasing tuning width with low contrast stimuli, and to some extent with medium contrast stimuli.0y, which reflects the untuned component in the response of the cells. This term does not correspond to spontaneous activity that was removed prior to the fit. Since response strength varies greatly among cells, we examined, not the 0y itself, but its amplitude relative to the full response height. This measure has previously been named \u201crelative untuned response amplitude\u201d (RURA) Fits made to orientation tuning data included a parameter, 0y+A). Note that RURA and HWHH represent different facets of orientation selectivity. Depending on contrast, correlation between HWHH and RURA were either weak, or not significant (not illustrated). For high contrast, the correlation (linear) was significant (p<0.0001) but with a low correlation coefficient (r2\u200a=\u200a0.135). For medium contrast, the correlation was not significant (p\u200a=\u200a0.16). For low contrast, the correlation was significant (p\u200a=\u200a0.003) but showed an inverse relationship between the two variables . Cells with broad HWHH may show RURA values close to zero while cells with thin HWHH may show RURA values larger than zero. We also checked for the possibility that the RURA is not cleanly separated from orientation bandwidth, as would occur if orientation tuning is not truly Gaussian, by examining the residuals in a dozen cases. We have not found any systematic structure that would indicate \u201cfatter tails\u201d compared to the Gaussian. Thus, while we cannot exclude that departure from Gaussian may be present in some cases, this does not appear to be a systematic trend.This is complementary to the \u2018orientation index\u2019 used in other studies: OI\u200a=\u200aA/, and the distributions of this difference are shown in In most cells, the RURA represented only a small percentage of the total response amplitude , Table 1more than expected given increase in tuned response amplitude. In this case, changes in RURA corroborated changes in HWHH, implying further decrease in orientation selectivity with increase in contrast. On the other hand, RURA did not change significantly when comparing high and low contrast or medium and low contrast .Contrast did change the RURA, when comparing medium and high contrast (p\u200a=\u200a0.0035) in the mixed contrasts condition. The median increase in RURA with high contrast was +1.22% (mean +2.32%). This means that, with an increase in contrast, response to non-optimal orientations did increase proportionately When considering constant contrast conditions, RURA did not differ significantly between low and medium contrast (p\u200a=\u200a0.38): cumulative distributions superimpose almost completely , Table 1In contrast to HWHH, the RURA showed almost no difference between matched and unmatched adaptation. RURA for low and medium contrasts were not significantly modified by adaptation (not illustrated). For high contrast, there was a moderate but significant decrease in RURA with adaptation to high contrast compared to adaptation to mixed contrasts (not illustrated). Thus, the relative proportion of unselective response appears to be slightly reduced after adaptation to high contrast.Spread in the distributions of changes in HWHH or RURA with changes in contrast indicates important heterogeneity in the behavior of individual neurons , 9, 12. We next examined whether heterogeneity between cells with respect to the effect of contrast on orientation tuning could be related to differences in their contrast sensitivities and to the actual contrast values that were used.50C) was 27.7% . There was no significant correlation between 50C and changes in HWHH or changes in RURA induced by changes in contrast. The exponent of the CRF (n) was 3.1 . There was also no significant relationship between changes in tuning width and the exponent of the CRFs. Changes in orientation tuning with contrast therefore are not related to the contrast sensitivity of the cells.CRFs were quantified using the hyperbolic ratio equation in 81 cells and 54 in the calcarine . Studies showing contrast-invariance of orientation selectivity were usually based on recordings obtained parafovealy. It was therefore possible that our discrepant result could be due to a different behavior for neurons with RFs located at larger eccentricity.2 test). Orientation selective cells represented 44/54 cells (81.5%) in the calcarine and 43/60 cells (71.7%) in the operculum.Whether recordings were obtained in the calcarine or in the operculum did not affect the proportion of orientation selective and non-selective cells . However, HWHH obtained in constant contrast block did show a near significant difference between opercular and calcarine recordings . Median HWHH for opercular recordings were 25.9 (n\u200a=\u200a40), 23.9 (n\u200a=\u200a27) and 20.6 (n\u200a=\u200a19) deg for high, medium and low contrasts respectively. For calcarine recordings, median values were 19.9 (n\u200a=\u200a40), 18.4 (n\u200a=\u200a36) and 13.2 (n\u200a=\u200a27) deg, respectively. Confirming this trend will require a larger sample.When considering HWHH of orientation tuning curves obtained in the Nevertheless, decreases in orientation tuning width with decreases in contrast were not related to the recording sites (not illustrated). In mixed contrasts blocks, percent changes in HWHH were not significantly different between the calcarine and the operculum . Percent changes in HWHH also did not differ significantly in the case of constant contrast blocks . This indicates that the lack of contrast invariance observed with briefly flashed stimuli is not the consequence of some peculiar behavior for neurons with RFs located at relatively large eccentricity.We also examined orientation selectivity and the effects of contrast on orientation tuning with respect to the layers in which recordings were obtained .We first compared orientation tuning width and RURA obtained for cells recorded in supragranular layers (n\u200a=\u200a22 cells), layer 4B and 4C\u03b1 , and infragranular layers (n\u200a=\u200a36) . We did not find significant differences, whatever the contrast and stimulation condition (not illustrated). This agrees with quantitative studies that also failed to reveal profound differences in orientation selectivity between layers in macaque V1 We next examined whether the effects of contrast on orientation tuning width and RURA differed between layers. We found that contrast affected tuning width and RURA in a similar fashion when comparing layers 4C\u03b1 and 4B with infragranular and supragranular layers (not illustrated). Lack of contrast-invariance of orientation tuning cannot therefore be attributed to a difference between neurons relaying magnocellular inputs (layers 4C\u03b1 and 4B) and neurons possibly receiving convergent magnocellular and parvocellular inputs (supragranular and infragranular layers).The two main results of this study are: 1) Orientation tuning does not appear to be contrast-invariant when stimuli vary in both contrast and orientation at a high rate. 2) Orientation tuning is less affected by contrast when neurons are given enough time to adapt to one particular contrast, suggesting that contrast adaptation plays a role in contrast-invariance of orientation tuning.Contrast-invariance of orientation tuning has been demonstrated in a large number of studies in cats Contrast adaptation manifests itself as a slow adjustment of neural firing rate during the prolonged presentation of a stimulus of constant contrast. During prolonged presentation of a high contrast stimulus, firing rate progressively decreases with a time course of seconds Contrast adaptation could therefore play a significant role during the 4-second stimulus presentation that was typically used in studies of contrast invariance. This has led us to examine whether contrast-invariance of orientation tuning still holds with briefly flashed stimuli. We thus had two purposes in mind: determining whether contrast-invariance of orientation tuning still occurs when the stimulus presentation time is commensurate with the fixation duration observed in natural viewing conditions (200\u2013300 msec) Our results show that orientation tuning is not contrast-invariant with briefly flashed stimuli, when the contrasts do not match the contrast to which the cells are adapted. We also found that contrast-invariance of orientation tuning was partially restored when stimuli had a contrast corresponding to the contrast to which the cells have been adapted. However, this restoration was not complete and orientation-tuning curves obtained with the lowest contrast still appeared to be slightly thinner, on average, than those obtained with the highest contrast.Mechanisms responsible for contrast adaptation have been examined in several studies. Thalamic neurons do not present strong contrast adaptation when stimulated with sine-wave gratings drifting with a low temporal frequency (<3 cy/sec) in vivo results in a membrane potential hyperpolarization that mimics the one obtained with high contrast visual stimuli, and which is able to reduce responses to visual stimuli In vitro studies showed that this long-lasting hyperpolarization depends largely on the activation of a sodium-dependent potassium current In intracellularly recorded cortical neurons, it is observed that, in contrast to the F1 component, the F0 component shows significant changes with adaptation: high contrast stimulation in cortical neurons is associated with a progressive membrane potential hyperpolarization Nevertheless, an intrinsic adaptation mechanism cannot explain the fact that adaptation shows some stimulus specificity In the temporal domain, the stimuli we used in the present study correspond to square pulses, whose Fourier spectrum necessarily includes high frequencies. Recent studies showed that contrast adaptation could actually occur for fast temporal frequencies in thalamic magnocellular neurons We may now examine how the mechanisms involved in contrast adaptation may influence orientation tuning and its contrast-invariance. Experimental and theoretical studies have identified several possible mechanisms that could contribute to contrast-invariance of orientation tuning. Among these, 3 at least could be modified by contrast adaptation.in vitroThe first of these possible mechanisms is inhibition in vitro, in the absence of synaptic noise, the input-output relation of cortical neurons is well approximated by a linear relationship (R\u200a=\u200a\u03b2.V) Inhibition may be important in setting up contrast-invariance of orientation tuning at the membrane potential level. However, it might not be sufficient to explain contrast-invariant orientation tuning for the spiking response ) e. g., . In a fe) e. g., . HoweverThe third mechanism involved in contrast-invariance of orientation selectivity, which may be modified by adaptation, is the input-output power law itself. Even if the amplitude of membrane potential fluctuations remains constant, it is expected that the slow membrane potential changes induced by adaptation will result in the modification of one or the other power law parameters (slope or exponent). This dynamic adjustment might also be involved in the generation of contrast-invariant tuning. The effects of contrast adaptation on membrane potential noise and on input-output relationship in single cortical neurons are currently under examination.Although contrast adaptation did reduce contrast-dependent differences in orientation tuning, it did not completely suppress them. There was still a significant difference in tuning width between the lowest and highest contrast, such that, despite adaptation, orientation tuning was still not completely contrast-invariant. It is possible that this reflects a difference between flashing and drifting stimuli, involving distinct networks, or different interaction dynamics within these networks.does vary with contrast in the primate Alternatively, it could represent a species difference Whatever the reason for the presence of an effect of contrast on orientation tuning, our results are not simply explained by an iceberg effect. Changes in orientation tuning with contrast, in both constant and mixed contrasts conditions, were never proportional to changes in response strength . This laContrast-invariant orientation tuning, as initially reported in the cat, provided a neuronal correlate to the observation that, behaviorally, orientation discrimination appeared to be contrast-invariant Models suggest that orientation discrimination depends on the differential activity of orientation detectors At the behavioral level, contrast adaptation leads to a variety of effects: thresholds are elevated for detecting stimuli similar to the adapting stimulus The functional role of contrast adaptation has remained somehow elusive. At one extreme, it may be proposed that contrast adaptation does not have much of a functional role in vision; contrast adaptation may simply be the by-product of the presence of sodium-dependent potassium channels, whose main functions may be to provide a \u201cmetabolic gate-keeper\u201d and to protect cells against ischemic stress discrimination around the adapting contrast. However, behavioral testing failed to show such a beneficial effect Neurophysiological studies have suggested that contrast adaptation results in an adjustment of the (limited) dynamic range of the neurons around the adapting contrast Benefits of contrast adaptation have therefore been sought with respect to other stimulus dimensions. With respect to spatial frequency for example, a psychophysical study constant orientation does improve orientation discrimination when test and adapting orientation differ by 10\u201320 deg Finally, psychophysical studies have shown that adapting to a high contrast stimulus of Our results suggest that, when stimuli are presented for a duration comparable to that of a visual fixation, and without prior adaptation to the contrast of these stimuli, contrast-invariance of orientation selectivity breaks down. This indicates that contrast-invariance of orientation tuning is not instantaneous and rather requires some time of adaptation to the prevailing contrast to be expressed. In fact, there appear to be a number of response properties that do not show contrast-invariance. One is spatial frequency tuning in primate"} +{"text": "CHI3L1 (YKL-40) is up-regulated in a variety of inflammatory conditions and cancers. We have previously reported elevated CHI3L1 concentration in the cerebrospinal fluid (CSF) of human and non-human primates with lentiviral encephalitis and using immunohistochemistry showed that CHI3L1 was associated with astrocytes.In the current study CHI3L1 transcription and expression were evaluated in a variety of acute and chronic human neurological diseases.In situ hybridization (ISH) showed CHI3L1 transcription mostly associated with reactive astrocytes, that was more pronounced in inflammatory conditions like lentiviral encephalitis and MS. Comparison of CHI3L1 expression in different stages of brain infarction showed that YKL40 was abundantly expressed in astrocytes during acute phases and diminished to low levels in chronic infarcts.ELISA revealed significant elevation of CHI3L1 in the CSF of multiple sclerosis (MS) patients as well as mild elevation with aging. Taken together, these findings demonstrate that CHI3L1 is induced in astrocytes in a variety of neurological diseases but that it is most abundantly associated with astrocytes in regions of inflammatory cells. CHI3L1 , YKL-40, gp38k, chondrex, breast regression protein 39 (BRP-39)) is up-regulated in inflamed tissues in ulcerative colitis, Crohn's disease, rheumatoid arthritis, osteoarthritis, asthma, chronic obstructive pulmonary disease (COPD) and liver cirrhosis, as well as in solid cancers . RecentlPrevious studies have reported altered expression of CHI3L1 in CNS disorders. Brain tissue homogenate studies have found increased CHI3L1 mRNA in schizophrenia, autism and Alzheimer's disease -15. CSF The current study was carried out to identify the spectrum of CHI3L1 expression in a variety of neurodegenerative and neurological diseases, the cellular origin of CNS CHI3L1, and in the case of brain infarction a comparison between acute and chronic expression. We show that CHI3L1 is elevated in CSF from patients with MS and to a lesser extent with aging. CHI3L1 transcription is induced in reactive astrocytes and is associated with local neuroinflammation in acute and chronic diseases.Ten de-identified CSF samples from each of AD, MS, ALS, stroke and normal control patients were obtained from the Human Brain and Spinal Fluid Resource Center and the Center for ALS Research at the University of Pittsburgh. Cortical tissue samples from three cases of AD and schizophrenia, two cases of infarct and Pick's disease and one case of MS and ALS were obtained from the Human Brain and Spinal Fluid Resource Center and used for ISH and immunohistochemical analyses. All human studies were approved by the corresponding institutional review boards.Macaca nemestrina) infected with SIVDeltaB670 viral swarm (SIVdB670) that developed encephalitis and three macaques that did not develop encephalitis were used for in situ hybridization (ISH) and immunohistochemistry.Previously banked brains from four pigtailed macaques . After removal of paraffin, cortical tissue sections from patients with MS, AD, Pick's disease, ALS, stroke and schizophrenia and SIV-infected pigtailed macaques were processed for in situ hybridization (ISH) and then for immunohistochemistry. For ISH, tissue sections were microwave oven treated and then incubated in hybridization buffer containing radiolabeled CHI3L1 probe in 50\u00b0C over night. The following day the tissue sections were washed and processed for immunofluorescence. Tissue sections were exposed to emulsion for 10 days in 4\u00b0C and then ISH signal was visualized using D19 and then fixed in Rapid fix .Sense and antisense CHI3L1 DNA templates containing the T7 promoter were generated by PCR from the pUC57 vector containing the full length YKL40 cDNA (NCBI Reference Sequence: NM_001276.2). 2O2 for 20 minutes. Antigen unmasking was performed using antigen retrieval Citra\u00ae solution . Tissue sections were blocked with protein blocking agent for 20 minutes. GFAP staining was performed using polyclonal rabbit anti-human GFAP . Iba1 staining was performed using rabbit anti-human Iba1 and CHI3L1 staining was performed using goat anti-human chitinase 3-like 1 . These staining were followed by goat anti-rabbit Dylight 488 antibody or mouse anti-goat biotin-conjugated antibody .Formalin-fixed, paraffin-embedded, 6-micrometer thick tissue sections were deparaffinized in Histoclear and rehydrated for 3 minutes in 100%, 95%, and 70% alcohol followed by PBS. Endogenous peroxidase activity was inactivated by immersing the section in 3% HFive fields from each case were captured by confocal microscopy and analyzed for the number of ISH-positive cells or ISH/IHC pixels per field . Illumination was provided by Argon , HeNe lasers. Digital images were captured with LSM 510 version 4.2 (Zeiss).Infarct presence or absence was established by a neuropathologist (RLH), then infarct age was charachterized as acute, subacute, or chronic based upon neuropathological features seen on hematoxylin staining as previously described . Due to CHI3L1 levels were determined, in duplicate, for all of the CSF samples using the MicroVue CHI3L1 ELISA kit from Quidel Corporation according to the manufacturer's protocol. Absorbance was measured using a microplate reader .Average \u00b1 standard error (SEM) of CSF CHI3L1 concentrations from MS, AD, ALS, stroke patients and healthy young and aged controls were graphed. The Mann-Whitney test was used to computes the statistical difference between disease groups and control patients. CHI3L1 ISH and GFAP imuunohistochemistry pixels were captured by confocal microscopy from 5 random fields of each of the SIVE, SIV, infarct, MS, AD, Pick's disease and schizophrenia cases. Average pixels per filed were calculated and a linear regression was used to determine a correlation between CHI3L1 pixel count and GFAP pixel count.p = 0.0007) which implies that there is a modest but significant increase of CSF CHI3L1 with aging Figure , Table 1g Figure , Table 1in vitro studies demonstrated that YKL40 was present in the supernatant of macrophages and not astrocyte or neuronal cultures, we were surprised to observe YKL40 staining localized with astrocytes in regions of microglial nodules and occasional activated macrophages/microglia in SIVE and HIVE. To elucidate the cellular source of CHI3L1 in SIVE encephalitis we performed ISH combined with immunohistochemistry. In order to validate the presence of CHI3L1 protein with its transcript we performed combined CHI3L1 ISH with immunohistochemistry for CHI3L1 on brain tissue from pigtailed macaques that developed SIVE. This confirmed that the antibody against CHI3L1 stained the cells that expressed the CHI3L1 transcript indicative of a correlation between CHI3L1 transcription and reactive gliosis is not associated with YKL40 expression (data not shown). This further emphasizes the use of CHI3L1 as a potential marker for CNS inflammatory conditions with its concentration reflecting a process of reactive gliosis. CSF samples from these diseases show increased CHI3L1 CSF levels compared to healthy young adults. Perhaps not surprisingly, older healthy adults have a very modest but significant elevation in CHI3L1 levels consistent with the hypothesis that low-grade inflammatory processes are induced in the aging brain.Recent studies showed increased CHI3L1 mRNA in the hippocampus and prefrontal cortex of schizophrenic patients ,18. MoreComparison of CHI3L1 transcription in acute, subacute and chronic infarcts showed that there is focal and temporal expression of CHI3L1 in astrocytes at the site of injury. Maximal CHI3L1 induction starts at the acute stages , continues at the subacute stages and then diminished at the chronic stages . These differences in YKL-40 transcription in different stages of pathology implies that acute inflammation induces CHI3L1 expression in astrocytes proximal to the lesion and as inflammation resolves CHI3L1 expression is diminished.\u03bd\u03b23 and induce focal adhesion kinase phosphorylation [In summary, while the biological functions of CHI3L1 are unclear, its expression is related to inflammation in a variety of diseases, and in this study we show this is true also in the brain. Paradoxically in the brain CHI3L1 synthesis appears to be more astrocytic than macrophage based. The role of CHI3L1 in reactive astrogliosis is still obscure, but from our previous study, it could potentially be involved in growth factor mobilization from the extracellular matrix and attenuation of their biological activities. Alternatively, a recent study by Shao et al showed that CHI3L1 can directly induce cell signaling through syndecan 1 and integrin \u03b1rylation . The BRPThe authors declare that they have no competing interests.DBB conceived the study and participated in the design and coordination of the experiments and drafted the manuscript. GW carried the ISH and immunohistochemistry. AS participated in assessing CSF YKL-40 levels and ISH. RLH assessed the neuropathology of the infarct cases and CAW participated in the design and coordination of the study and helped drafting the manuscript. All authors read and approved the final manuscript."} +{"text": "The potential of contrast-enhanced cardiovascular magnetic resonance (CMR) for a quantitative assessment of myocardial perfusion has been explored for more than a decade now, with encouraging results from comparisons with accepted \"gold standards\", such as microspheres used in the physiology laboratory. This has generated an increasing interest in the requirements and methodological approaches for the non-invasive quantification of myocardial blood flow by CMR. This review provides a synopsis of the current status of the field, and introduces the reader to the technical aspects of perfusion quantification by CMR. The field has reached a stage, where quantification of myocardial perfusion is no longer a claim exclusive to nuclear imaging techniques. CMR may in fact offer important advantages like the absence of ionizing radiation, high spatial resolution, and an unmatched versatility to combine the interrogation of the perfusion status with a comprehensive tissue characterization. Further progress will depend on successful dissemination of the techniques for perfusion quantification among the CMR community. The title of this review, \"perfusion quantification\" refers to the approaches used with cardiovascular magnetic resonance (CMR) to assess or measure myocardial blood flow from the contrast enhancement observed during the first pass of a contrast agent bolus. This technique is often referred to by the name of \"first pass\" imaging, because the first pass of a contrast agent represents the phase of contrast enhancement most sensitive to changes in blood flow, be it from disease, pharmacological intervention, or exercise. Another approach, not requiring exogenous contrast, and referred to as arterial spin labeling, can also be employed to assess myocardial blood flow. AlthougThe quest to quantify myocardial perfusion has been largely motivated by the desire to obtain quantitative, observer-independent, and reproducible measures of the myocardial perfusion status. Whether a quantitative approach improves the accuracy of myocardial perfusion imaging, such as for the detection of coronary artery disease, remains controversial, with circumstantial evidence pointing to the benefits of a quantitative analysis, versus a qualitative interpretation in cases of multi-vessel disease. But in the research realm, there is by now a long line of evidence proving that the measurement of myocardial perfusion leads to new insights in coronary physiology and the etiology of cardiac diseases.In the context of perfusion quantification, there are two aspects of myocardial perfusion studies that warrant some discussion about the methods for dynamic image acquisition. First of all, one assumes that the observed contrast enhancement is proportional to the change of contrast concentration in the tissue. For example, if one were to use a pulse sequence giving mixed T1/T2* contrast, with T1 effects prevailing at lower contrast concentrations, and T2* effects dominating at higher concentrations, then this would give rise to signal increases at lower concentrations, which would be confounded by signal loss at higher concentrations. It is preferable to have a sequence technique that makes one contrast mechanism (e.g. T1) prevail. T1-weighted imaging is predominantly used for myocardial perfusions studies, not the least because the vascular volume and also the distribution volume of Gd-chelates is sufficiently large to yield appreciable signal intensity changes in myocardial tissue. The short echo times inherent in weighting the signal towards T1 are advantageous for minimizing the effects of myocardial motion and flow, as one would otherwise have increasing signal attenuation due to motion and flow when the echo time (TE) becomes longer.A second aspect relates to the nature of contrast enhancement in the blood pool of the ventricular cavity or the proximal aorta. Intuitively, it is obvious that myocardial contrast enhancement is driven by arterial enhancement. In fact, we will see that the myocardial contrast enhancement can be considered as a linear response to the arterial contrast enhancement, which implies that myocardial contrast enhancement can never proceed at a rate faster than for the arterial contrast enhancement. For this reason it is important to measure the contrast enhancement in the blood pool as reference for the analysis of the myocardial contrast enhancement. Ideally, the arterial contrast enhancement would be measured as close as possible to the myocardial region under consideration, but in practice one can only expect to measure enhancement in the blood pool at a location in the left ventricle, or in the proximal aorta. Either way, the pulse sequence should not be overly sensitive to blood flow in the great vessels or the ventricular cavities, nor should it suppress the signal from flowing blood. For example, pulse sequences with long echo-trains after each radio-frequency excitation would suppress signal from blood flow in the ventricular cavities and should be avoided for quantitative perfusion studies.The contrast enhancement in the blood pool has a non-linear or sub-linear dependence on contrast concentration, with the nonlinearity, or contrast-enhancement saturation, becoming more pronounced as contrast concentration increases ,8. EventPossible solutions to avoid arterial signal saturation are: a) the use of lower contrast dosages, which avoid the saturation effect, albeit at the price of reduced contrast-to-noise in the myocardium; b) employing dual contrast sequences,9; c) usThe dual bolus approach involves giving a low dosage contrast bolus to characterize the arterial input of contrast, followed by a higher dosage bolus to image the myocardial contrast enhancement. The two bolus dosages are in a pre-determined ratio (e.g. 1:10) that is then used to scale the arterial input function (AIF) from the low-dosage bolus to analyze the myocardial contrast enhancement with the rescaled and time-shifted AIF.A further important aspect is the administration of contrast: If the contrast is injected slowly, then the observed myocardial contrast enhancement is bottlenecked by the slow arterial enhancement, and myocardial enhancement becomes relatively insensitive to blood flow. To achieve good sensitivity to myocardial blood flow, the contrast agent should be injected as a bolus, at a rate somewhere between 3-5 ml/s, in part1 inhomogeneity effects, e.g. due to dielectric effects, in particular at magnetic field strengths of 3 Tesla or higher. Body RF coils, used almost exclusively for RF excitation, are designed to achieve excellent B1 homogeneity, albeit under assumed ideal conditions. B1 inhomogeneity over a region with the dimensions of the heart can be brought about by two conditions: a) the electromagnetic wavelength of the RF excitation can approach the field of view dimensions at higher field strengths, and in tissue the wavelength can be even shorter, because tissue has a comparatively high relative dielectric constant or permittivity (e.g. \u03b5r~70 at 100 MHz for muscle tissue); and b) the dielectric properties within the anatomical region being imaged can be highly heterogeneous, thereby giving rise to dielectric resonances, a form of constructive B1 interference effects that can be set up in a dielectric \"cavity\". B1 inhomogeneity can contribute to signal intensity variation over the heart, but equally important, it also causes unintended changes for the magnetization preparation. For the latter, it is useful to realize that a magnetization preparation with a nominal inversion pulse that deviates from the ideal 180\u00b0 flip angle can be confounded with a more rapid relaxation recovery, and similar observations apply to saturation pulses. In other words, in the presence of B1 inhomogeneity, the signal intensity variations can mimic perfusion defects. Currently, the most common solution for myocardial perfusion imaging at \u2265 3T, is the use of adiabatic, i.e. B1-insensitive, RF inversion or saturation pulses, or composite pulses. Adiabatic pulses increase the SAR burden, because the B1 amplitude intrinsically has to be considerably higher than normal (to meet the adiabaticity condition), and the pulses also have 5 to 10-fold longer durations, both of which increase the deposited RF energy . Composite pulses represent a practical compromise with lower SAR burden than adiabatic pulses, but they still compensate for B1 inhomogeneity or flip-angle variation, the concentration of Gd contrast in the voxel. The relaxivity of most Gd-chelate agents is unchanged as it transitions from blood into tissue, with albumin-binding agents being one notable exception.where RAny pulse sequence yields a finite dynamic range for signal changes when contrast is introduced, with a theoretical upper bound set by the proton density. We give here a specific example for a spoiled gradient echo sequence, with saturation recovery magnetization preparation, and linear ordering of the phase-encodings. After N/2 phase-encoding steps the signal intensity is given by:0 Sis the equilibrium signal, TR the repetition time per phase encoding, R1 the T1 relaxation rate (R1 = 1/T1), TD, the delay between magnetization preparation and start of FLASH read-out, E = exp(-R1\u00b7TR), and a = E\u00b7cos(\u03b1), with \u03b1 denoting the flip angle. The signal intensity of the central-k-space echoes determines the overall contrast characteristics of an image, although contrast enhancement in smaller structures, is also weighted by the T1-weighting of higher-frequency k-space echoes. The effects of the modulation of the phase-encoding amplitudes by an inversion, or saturation recovery have not been systematically investigated, but could impact negatively on the quantification of blood flow, e.g. in thinned LV walls.where The expression in , plottedrelative to the arterial contrast enhancement, and myocardial perfusion is overestimated. The overestimate of blood flow can be almost proportional to the peak saturation effect, i.e. a 30% reduction of the peak signal intensity of the arterial input due to saturation can cause an overestimate of myocardial blood flow of similar relative magnitude.With pre-contrast T1 measurements, knowledge of the sequence parameters, and numerical simulation, it is possible to correct the signal saturation, by generating calibration curves to replace the measured signal intensity, or percent contrast enhancement, by their corresponding values in the absence of signal saturation,12. AlteAlthough it may go without saying that signal intensity curves for myocardial regions of interest should represent only the underlying tissue properties, this may be difficult to achieve for the endocardial layer, because the regional signal intensity average may include an admixture from the ventricular blood pool. Several factors can contribute to this, all too often, subtle artifact: the endocardial border definition may be poor, which can lead to the inadvertent inclusion of some blood pool region, or some voxels may only partially be filled by myocardial tissue over the full slice thickness, which generally exceeds by a factor of 4-5 the in-plane voxel dimensions . These partial-volume effects are also referred to as \"spillover\" from the blood pool, a term particularly prevalent in nuclear medicine. In nuclear medicine spillover correction was incorporated by adding to any model for the myocardial contrast enhancement, a \"spillover\" term, which essentially amounts to a scaled (and time-shifted) arterial input function, with the scaling factor (and time shift) as variable parameter(s). Such anA persistently vexing problem in myocardial perfusion studies has been the appearance of dark rim artifacts at the endocardial border, when a contrast bolus first enters the ventricular cavity,28. Sevesame linear scale, irrespective of whether that scale has absolute or arbitrary units. The time points for signal intensity readings need to be recorded in absolute units, for example seconds, relative to a common reference for all images, such as the start of the image acquisition. One can then quantify the contrast enhancement as fraction of the arterial contrast enhancement , and per unit of time. While the arterial contrast enhancement is typically measured per unit volume of blood, tissue blood flow is quoted in mL of arterial input per gram of tissue, which requires that the unit volume of myocardial tissue be converted into its mass equivalent, using the specific gravity of myocardial tissue, which averages 1.05 g per ml of tissue. Units of ml/min per g of tissue follow naturally from the procedures for microsphere tissue blood flow measurements, where the deposition of tracer is measured per g of tissue sample. The use of microspheres as reference standard made the units of ml/min per g of tissue also a natural choice for estimates of myocardial blood flow with external detection by an imaging device .Measurements of arterial and myocardial contrast enhancement do not require any calibration in terms of absolute units for contrast enhancement. It is sufficient that they are measured on the Before discussing approaches for quantifying myocardial blood flow from CMR perfusion studies, brief mention should be made of semi-quantitative perfusion measures, which form the basis of perfusion reserve indices. One such parameter is the so-called \"up-slope\", which rOne advantage of such a perfusion index is the relative simplicity of its estimation from the signal intensity curves. For each perfusion parameter, and with some form of adjustment for hemodynamic conditions, one can in principle define a perfusion reserve index. While these perfusion reserve indices may be proportional to the coronary flow reserve over some limited range of CFR, or the perfusion reserve obtained from flows measured by the microsphere method, they generally each have specific thresholds to distinguish a hemodynamic significant stenosis from a coronary artery without flow-limiting lesions. The semi-quantitative perfusion indices cannot be compared in magnitude directly to the coronary flow reserve ratio measured in the catheterization laboratory. A further drawback of any ratio is the potentially confounding effect of the quantity in the denominator, which purportedly serves the role of \"normalization\". An examth to 1/20th of the peak contrast-enhancement observed with a 0.03-0.04 mmol/kg bolus of Gd-DTPA, and therefore amounts to approximately 5-10%, or less, of the peak contrast enhancement observed during a second injection, an arguably acceptable level for the background signal increase in the blood pool. In the myocardium, the signal intensity level at 10 minutes after contrast injection is only ~10-20% higher than before contrast injection, which is a small fraction of the peak myocardial contrast enhancement during a first pass. After 10 minutes or longer, the background signal is therefore unlikely to make a significant contribution to signal saturation effects, which is arguably the primary concern related to the contrast residue from a previous injection. Higher contrast dosages may require longer delays before a repeat injection.The approaches which can be used for quantifying myocardial blood flow from the observed contrast enhancement can be broadly divided into two categories, which we label here as model-based, and model-independent. For model-based approaches one specifies the functional spaces in myocardial tissue, how tracer moves through these spaces, and how it traverses permeable barriers between spaces. A considerable degree of simplification is necessary to arrive at models that can be used for numerical calculations and simulations. As commonly used MR contrast agents, such as Gd-DTPA, are excluded from the intracellular space one can consider a simplified model comprising only the vascular and interstitial spaces. Such a \"two-compartment\" or \"two-space\" model can be ut, that describes the variation of contrast concentration with time. The compartmental model without spatial variable(s) only considers the change of contrast concentration as a function of time, and is termed a lumped compartment model. A prototypical example of a lumped two-compartment model is shown in Figure An important question is whether one wants to treat the vascular space as spatially lumped compartment (\"well-stirred tank\") with a uniform concentration of contrast, or whether one accounts for the fact that a vascular element has a spatial extent and the concentration of tracer can be higher at the arterial inlet(s) than further downstream. The latter approach results in a spatially dependent concentration of tracer or contrast. Mathematically this translates into the introduction of (a) spatial variable(s) into the set of equations that describe the tissue model, in addition to the time variable PS). Note, that it is not only the permeability of the capillary barrier that counts, but also the total area of this barrier, as a larger capillary surface area per unit tissue volume will result with constant permeability in a higher rate of contrast traversal from the vascular to the interstitial side. This means that capillary recruitment during vasodilation results in an increase of both blood flow and PS [PS rate constant is the same for either direction of transit. If the primary goal of the analysis is the quantification of blood flow, the other model parameters may appear as a nuisance. The focus on blood flow often captures only a very limited view of pathological changes, and effects like limited capillary recruitment, and a blunted vasodilator capacity can have a significant effect on PS and vascular volumes. Unfortunately, it is challenging to quantifying the permeability surface area product from first pass studies. A reliable estimate of PS may only be feasible with two contrast injections, using intravascular and extracellular contrast agents respectively.For an extracellular contrast agent an important contribution to the total observed or measured tissue contrast concentration comes from the fraction of contrast that has traversed the capillary barrier and leaked into the interstitial space. On signw and PS . For an Identifiability of a model parameter refers to the ability to measure or detect changes of the model parameter. For example, it turns out that with an extracellular contrast agent, the signal intensity curves measured with a CMR perfusion scan are relatively insensitive to the changes in vascular volume, because of the leakage of contrast into the interstitial space - the detected contrast enhancement corresponds to the effect of contrast in both the vascular and interstitial spaces. This means that signal intensity after the first pass primarily reflects the sum of the vascular and interstitial volume fractions, rather than just the vascular volume fraction. In the context of a \"first pass\" perfusion study, blood flow is a parameter that has a readily identifiable effect on the signal intensity curves, and this explains in part the reasons why \"first pass\" perfusion imaging, independent of modality, has mostly focused on the quantification of blood flow. For a model-based analysis of myocardial perfusion with an extracellular contrast agent this means that the vascular and interstitial volume parameters generally have to be kept at fixed assumed values, possibly with the constraint that their sum matches the effective distribution volume.F\u00b7(cout - cin) = dq(t)/dt, where cin, out denote the concentrations at inlet and (venous) outlet, respectively, q(t) is the mass of tracer in the region, and dq(t)/dt its rate of change with time (t). Fick's principle is simply a statement of mass balance: tracer that has entered the region and not yet exited remains in the region of interest.Model-independent analysis means that one foregoes specifying a functional model of the tissue structure. Model-independent analysis is based on the central volume principle introduced by Kenneth L Zierler in the the 1960's. A 2002 q(t), to its arterial input, in the form of a convolution integral, which according to Fick's principle , also has to equal the amount of tracer that has entered the region, minus the amount that exited:Starting from Fick's mass balance equation, one can arrive at an expression that relates the tracer amount in the region, F(t) Rrepresents the q(t) response if an impulse input of tracer is applied at the region input - this follows from the integral equation 3, if one replaces in cwith a \"Dirac-delta\" input function. We also note, that with such an impulse input (in c(t) = \u03b4(t)) at time t = 0, there can be no tracer at the output (out c(t = 0) = 0), as this would otherwise require that the tracer or contrast to traverse region instantaneously, i.e. F \u2192 \u221e. It can be shown then, that F(t = 0) = FR, meaning the initial amplitude of the impulse response is equal to the blood flow through the region. This statement can be generalized to any type of arterial input and it represents the essence of the Central Volume Principle.The function q(t) response in a tissue region to a general from of arterial input in(t)c, which can include a recirculating component of the arterial input. The meaning of the convolution integral is illustrated in Figure q(t) and in(t) ccan be measured. The process of extracting F(t) Rfrom the measurements of the ROI tracer concentration and arterial input concentration reverses the convolution operation, and is referred to as deconvolution, a mathematically substantially more challenging operation, than convolution.The convolution integral in equation 3 allows one to calculate the F(t) Ris normalized for this purpose by its value F(t = 0)R[F(t)/RF(t = 0)R(t) = R, gives for any time t the probability that a tracer molecule still remains in the region of interest at that time, assuming that it entered at t = 0. In other words, the normalized impulse response gives the probability that the tracer residence time is greater than t. The complement of this statement is that F(t)1-R, is the probability that the transit time of the tracer is 0. The difference is to be expected for a lumped compartment model, because, by definition, the contrast agent or tracer is well mixed at any moment within each compartment. The Fermi function represents a good approximation to the shape of impulse responses of intravascular tracers obtained by simulations from spatially distributed models. The limitation of the Fermi-function is the fact that it basically decays like a single exponential, while the most commonly used (extracellular) CMR contrast agent also permeates the interstitial space. For extracellular contrast agents the impulse response shows an initial fast decay, related to the vascular transit of contrast, followed by a slower, long-tailed decay that can be described as the delayed wash-out of contrast that has crossed the capillary barrier into the interstitial space. Examples of impulse responses for intravascular and extracellular contrast agents are shown in Figure It is noteworthy that the Fermi function can initially have approximately constant amplitude before decaying at an approximately exponential rate. This early plateau phase means that no, or a negligible amount of tracer has left the region of interest up to the end of the plateau duration, and such a plateau is more likely to be observed for low flows. This can be contrasted with the shape of an impulse response from a lumped two compartment model, which consists of a sum of two exponentials that begin to decay immediately for The representation of the impulse response shape can be generalized to properly reproduce also the features of the impulse response related to the delayed wash-out of contrast that has crossed the capillary barrier into the interstitial space. To that end, one can for example use a representation of the impulse response as a sum of B-spline components. NeverthIt lies in the nature of the deconvolution problem that there is no unique solution for the impulse response, which is partially why it is considered an \"ill-posed\" problem. In fact, the brute force approach of calculating the impulse response from the Fourier transforms, or other naive forms of numerical inversion of the deconvolution operation yield mathematically admissible solutions of the convolution equation, which nevertheless have to be dismissed as unstable, and physiologically unrealistic. Under most circumstances we are not much concerned about the exact details of the impulse response, but are primarily interested in estimating the initial impulse response amplitude, which, by virtue of Zierler's central volume theorem, provides an estimate of the blood flow. But there are some requirements one can impose on the impulse response, e.g. that it has to be a monotonically decaying function - contrast can only leave the region of interest after the initial arterial impulse input and is not replenished. Furthermore one can impose some smoothness constraints, as impulse responses don't have any sudden jumps in the decay from their initial amplitude. Such requirements can help to stabilize the deconvolution operation.The fact that with the deconvolution analysis one does not need to specify the internal structure of the blood tissue exchange unit also identifies its main limitation. At least with an extracellular contrast agent, one can with the deconvolution analysis determine only the blood flow, but not other perfusion parameters such as the vascular volume or the capillary permeability surface area product. For the latter one has to have some model to identify these parameters, both in the sense of giving them a functional meaning within a model of the blood tissue exchange unit, and also in the sense of being able to determine stable values from measurements of myocardial contrast enhancement.1-Hct) where Hct represents the blood hematocrit. This follows from considering the effective T1 of blood in the fast exchange limit, which is given by the volume-weighted average of the 1 Tof water in the blood plasma, The signal intensity observed during a study of myocardial contrast enhancement originates from the proton magnetization, and it often suffices to assume that the T1 or R1 changes are proportional to the concentration of contrast agent. This model can become inadequate when contrast agent is confined to subspaces in the tissue, while water can move between the tissue spaces. In this latter case the T1 of water protons changes not only in the subspaces where contrast is introduced through injection into the blood stream, but also in spaces that can exchange proton magnetization with these contrast-permeated subspaces. If the water exchange is slow in comparison to the difference of the native relaxation rates (relaxation rates in the absence of exchange), then one can neglect the effects of water exchange (\"no exchange limit\"). At the other extreme water exchange is so rapid that it can sample the relaxation environments in the two spaces multiple times during the relaxation recovery (\"fast exchange limit\"). In this latter case the effective relaxation rate corresponds to a weighted average of the intrinsic relaxation rates, with weights determined by the volume fractions of the two spaces. An example of fast water exchange is the relaxation of water in blood, which can rapidly move between blood plasma and red blood cells, because the dwell time of water in the red blood cells is relatively short (1-10 ms). In practice this means that the relaxation rate of water in blood is well described by a single exponential recovery at a rate that corresponds to the plasma concentration of contrast, reduced by a factor of factor.Within myocardial tissue spaces water exchange often occurs at a rate that falls neither into the fast or slow exchange regimes, and this makes the analysis more tedious, and a description of the formalism is beyond the scope of this review. SufficeThe conditions of fast or slow exchange are also determined by effective relaxation rate, which is a function of the pulse sequence applied during read-out of the signal. Assuming that a spoiled gradient echo sequence is used for read-out with higher flip angle radio-frequency pulses, then the effect of water exchange is less noticeable because the radio-frequency pulses, if applied with short repetition times (TR), rapidly erase any \"memory\" of water exchange. A more formal proof and experimental validation of this can be found in the work of Donahue et al.. More reTo counterbalance the partially abstract presentation in the earlier sections of this review, it may be useful to include a summary of practical experiences, and possible recommendations for quantification of myocardial blood flow. Tools for quantifying perfusion are on the verge of appearing in cardiac analysis software packages, but they will for several reasons retain the flavor of a research tool, that requires technical expertise for its use. Offering these tools in cardiac image analysis software packages remains a challenge because of the close link between acquisition protocols, and post-processing algorithms. As an example: The work-flow in the software programs may be built on the assumption that signal intensity in the ventricular cavity or the proximal aorta can be used to represent the arterial input of contrast. To what degree that is true, remains under the control of the user. Furthermore, methods to correct for signal saturation may require exact knowledge of the protocol parameters, not all of which may be encoded in the headers of the DICOM images. The user needs to be acutely aware of the limitation and built-in assumptions of the quantification algorithms to be used. At this point one can at least formulate a set of minimal requirements and recommendations that should be met if a user wishes to pursue absolute quantification of myocardial blood flow:a) The pulse sequence needs to be chosen such that it allows the recovery of an arterial input function. For example, any technique where the signal in the blood pool is suppressed or attenuated by intraventricular flow (echo-planar technique with spin-echo) would not be suited for the goal of blood flow quantification. Another example is the interleaved notched saturation preparation, which ib) The contrast dosage should be sufficiently low to allow recovery of contrast concentration, either by using a special acquisition technique, such as the dual-echo technique, or through post-processing, using calibration curves. For the standard gadopentetate dimeglumine agent, this generally means a contrast dosage well below 0.1 mmol/kg. If the non-linearity of contrast-enhancement versus contrast concentration in the blood pool should not exceed more than 10-15%, then the contrast dosage may need to be < 0.03 mmol or less at 1.5 and 3T.c) For temporal resolution a repetition time corresponding to 1-2 R-to-R intervals at rest, and 1 R-to-R interval during stress is strongly recommended. Poor temporal resolution will lead to unacceptably low accuracy for MBF quantification. Spatiald) New acceleration techniques, such as k-t BLAST and k-t SENSE,48, alloe) CMR at 3 Tesla is steadily gaining ground. For myocardial perfusion imaging with gradient echo techniques (without steady-state free precession) one can make an unreserved recommendation for the higher field strength, because of the concomitant increase of signal-to-noise compared to 1.5 Tesla. Although SSFP techniques yield excellent signal-to-noise ratio at 1.5 Tesla,18, therArguably one of the most serious limitations of quantitative perfusion analysis is the inability to measure the arterial input accurately and relatively closer to the myocardial region of interest. This has a direct impact on the accuracy of blood flow estimates. Instead the enhancement from the contrast bolus is typically measured in the LV blood pool or the proximal aorta, but transit through the epicardial vessels is bound to cause some dispersion of the contrast bolus, which may be exacerbated by an epicardial stenosis. One is Cardiac magnetic resonance can be used to quantify absolute myocardial blood flow with high spatial resolution, thereby avoiding spill-over of signal from the LV cavity, and providing an assessment of the transmural perfusion gradient. The quantification of blood flow is not significantly more time consuming that a semi-quantitative analysis, in particular if a deconvolution method is used for the analysis, requiring minimal user input. Instead the most time-demanding step continues to be the segmentation of the images along endo and epicardial borders. Standardization of the quantitative analysis still appears to be some time off, as this remains a field of active investigation, where further optimization and innovations are still forthcoming at a rate that precludes a broad consensus and standardization. Despite its evolving status, quantitative CMR perfusion imaging has achieved recognized role in studies of coronary physiology and cardiac diseases. Whether it will be adopted for the clinical workflow remains uncertain at this time.1 and interstitial volume V2, their respective concentrations, C1 and C2, and an exchange coefficient PS, which stands for the permeabilty-surface area product. The equations describing this model are:We consider as an example a spatially-lumped, two compartment model with flow, F, capillary volume V1(t) cand 2(t)c, with weights corresponding to the volume fractions of the two compartments:Note that the exchange is passive, as it depends only on the difference in concentrations between the compartments. The tracer concentration in a tissue region described by this two-compartment model is given by weighted sum of http://www.wolfram.com.It can be shown that the solution of the equations 1) and (2) to an impulse input is given by the sum of two exponential functions with coefficients that are proportional to the volumetric flow rate per unit volume. Obtaining the solution to this set of equations involves some tedious algebra which we spare the reader. Instead we included a Mathemetica notebook This two-compartment model is used to illustrate the effects of changes in flow, PS, and compartmental volumes on the impulse response, and on the tissue residue curves. The tissue residue curves correspond to the signal intensity curves that are measured for myocardial regions of interest in a CMR perfusion study. We also verify that the amplitude of the impulse response for this lumped two-compartment model corresponds to the tissue blood flow, as predicted by Zierler's central volume theorem.The author declares that they have no competing interests.Two compartment model for analysis of myocardial perfusion. The solution of the equations (1) and (2) to an impulse input is given by the sum of two exponential functions with coefficients that are proportional to the volumetric flow rate per unit volume. The additional file contains the algebra in a Mathemetica notebook used to obtain the solution to this set of equations. It can be opened with the Mathematica software package, or with the free Mathematica player software, which can be downloaded from http://www.wolfram.com.Click here for file"} +{"text": "Genes in the CCCH family encode zinc finger proteins containing the motif with three cysteines and one histidine residues. They have been known to play important roles in RNA processing as RNA-binding proteins in animals. To date, few plant CCCH proteins have been studied functionally.In this study, a comprehensive computational analysis identified 68 and 67 CCCH family genes in Arabidopsis and rice, respectively. A complete overview of this gene family in Arabidopsis was presented, including the gene structures, phylogeny, protein motifs, and chromosome locations. In addition, a comparative analysis between these genes in Arabidopsis and rice was performed. These results revealed that the CCCH families in Arabidopsis and rice were divided into 11 and 8 subfamilies, respectively. The gene duplication contributed to the expansion of the CCCH gene family in Arabidopsis genome. Expression studies indicated that CCCH proteins exhibit a variety of expression patterns, suggesting diverse functions. Finally, evolutionary analysis showed that one subfamily is higher plant specific. The expression profile indicated that most members of this subfamily are regulated by abiotic or biotic stresses, suggesting that they could have an effective role in stress tolerance.Our comparative genomics analysis of CCCH genes and encoded proteins in two model plant species provides the first step towards the functional dissection of this emerging family of potential RNA-binding proteins. Transcription factors are important regulators of cellular processes, and the complexity of living organisms necessitates a large number of transcription factors. The zinc finger motifs, which are classified based on the arrangement of the zinc-binding amino acids, are present in many transcription factors and play critical roles in interactions with other molecules ,2. A larCaenorhabditis elegans germ cell fate that segregates with the germ lineage by inhibition of transcription or activation of protein expression from maternal RNAs .,59.58,598-C-X5-C-X3-H motif, with its sister gene AtC3H68, we found that they share different expression profiles with relatively low level . In addition, we examined the expression of other CCCH duplicated gene pairs of both Arabidopsis and rice, and only 20 of 31 pairs (18 duplicated gene pairs in Arabidopsis and 13 in rice) share the same expression pattern. These results are consistent with the previous research by Blanc and Wolfe, that the expression profiles of the two paralogs have diverged in concert, forming two parallel networks, and the expression of each gene is strongly correlated with the other nonhomologous genes in its network but poorly correlated with its paralog in the other network, suggesting functional diversification of the surviving duplicated genes is a major feature of the long-term evolution of polyploids -x-[LIVFM]-x-L-x-[LIMTKD]Click here for fileTable S4. The gene locus containing WWWT(ATTTA)TTTW pattern in 3'-UTR of Arabidopsis genome.Click here for fileTable S5: Primers for RT-PCRs.Click here for file"} +{"text": "To investigate how patterns of cell differentiation are related to underlying intra- and inter-cellular signalling pathways, we use a stochastic individual-based model to simulate pattern formation when stem cells and their progeny are cultured as a monolayer. We assume that the fate of an individual cell is regulated by the signals it receives from neighbouring cells via either diffusive or juxtacrine signalling. We analyse simulated patterns using two different spatial statistical measures that are suited to planar multicellular systems: pair correlation functions (PCFs) and quadrat histograms (QHs).With a diffusive signalling mechanism, pattern size is determined by both morphogen decay rate and a sensitivity parameter that determines the degree to which morphogen biases differentiation; high sensitivity and slow decay give rise to large-scale patterns. In contrast, with juxtacrine signalling, high sensitivity produces well-defined patterns over shorter lengthscales. QHs are simpler to compute than PCFs and allow us to distinguish between random differentiation at low sensitivities and patterned states generated at higher sensitivities.PCFs and QHs together provide an effective means of characterising emergent patterns of differentiation in planar multicellular aggregates. Whilst small molecules \u00d7 at time t, where h = L/Ms. Equation (3a) becomesThe morphogen equations (3) are approximated numerically using a cell-centred finite-volume approach to discretise spatial derivatives. We denote by j, k \u2264 Ms, and similarly for (3b).for 1 \u2264 h or less) dependent on h. The discrete equations are stepped forward in time using the Douglas alternating-direction implicit method ((r) is the indicator function on can be obtained by using a smoothing kernel in place of the indicator function.) Whilst the above estimate is piecewise constant, in order to show the distribution more clearly, we plot the values calculated as above at the centres of each interval ((rk+1 + rk)/2) (this is linearly interpolated to give a continuous line).For each cell XY gare calculated in a similar manner, but the sums for m and n in (10) run only over cells of types X and Y respectively, and the normalization constant is NX and NY are the numbers of cells of type X and Y. As the simulations are initially symmetrical in the two cell fates, we will combine RRg(r) and GGg(r) to give the cross PCF for pairs of cells of the same type, Sg(r), defined byThe cross PCFs Sg(r)/g(r) is then the conditional probability that two randomly selected cells are of the same type, given that they are separated by a distance r, divided by the probability that any two randomly selected cells are of the same type Msim realisations with the same parameter values in order to better estimate them.We choose to weight the two cross PCFs in proportion to the number of pairs of cells of that type, as L] \u00d7 into Mq \u00d7 Mq squares (or quadrats) with side length L/Mq. We calculate the proportion pR of cells of type R (those for which fn > 0) in each quadrat, ignoring empty quadrats; we combine the results of Msim simulations with the same parameter values to generate a histogram of the distribution of pR over all quadrats and for all simulations.To calculate this statistic, we partition the domain [0, The authors declare that they have no competing interests.JAF developed the mathematical model in collaboration with HMB, OEJ and JRK. JAF also performed the numerical simulations and the statistical analyses of the resulting data. GRK generated the experimental results presented in Figure Simulation source code. Source code for simulations of pattern generation in populations of stem cells.Click here for file"} +{"text": "The drug development process is widely hampered by the lack of human models that recapitulate liver functionality and efficiently predict toxicity of new chemical compounds. Moreover, liver failure is a global medical problem, with transplantation being the only effective treatment currently available. The bipotent liver progenitor cell line HepaRG can be differentiated into cholangiocyte and hepatocyte-like cells that express major functions of mature hepatocytes, representing a valuable tool to model hepatic function . Current2. Spinner vessels with ball impeller (Wheaton) were inoculated with inoculums ranging from 5 to 8 \u00d7 105 cell/mL and an agitation ranging from 35 to 45 rpm to attain the desired aggregation conditions. Aggregate size was determined by measuring Ferret's diameter using the Image J software (NIH). After 3 days of aggregation, spheroids were encapsulated in 1.1% and 2% (w/v) of Ultra Pure MVG alginate in NaCl 0.9% (w/v) solution. Encapsulation was performed in an electrostatically driven microencapsulation unit VarV1 (Nisco) and cultures were maintained for 14 days in stirred culture conditions. Viability was determined by the double stain viability test - alginate beads were collected from stirred cultures, incubated with fluorescein diacetate (10 \u03bcg/mL) and TO-PRO3 \u00ae (1 \u03bcM) and observed on a fluorescence microscope (Leica DMI6000) - and by the Trypan blue exclusion method - alginate beads were dissociated with a solution of Sodium citrate 50 mM, Sodium chloride 104 mM and spheroids were dissociated by incubation with Trypsin 0.05%-EDTA (Gibco) and counted trypan blue exclusion dye. For characterization of the cultures, encapsulated spheroids were fixed as previously described [HepaRG cells were routinely propagated in static conditions as previously described . BrieflyIn 2D cultures, HepaRG cells proliferate until confluence is reached and the cell-cell interactions established associated with the spatial constriction are postulated to trigger the differentiation program and maintain the differentiated state ,4. MoreoIn both culture conditions, the viability was maintained above 85%, showing that the alginate concentration does not affect diffusion of nutrients or oxygen to supply effectively the cell spheroids Figure . MoreoveThe structural organization of the cell spheroids in both stiffness environments was characterized by the arrangement of actin filaments, which is associated to the tight junctions in highly polarized epithelial cells. As shown in Figure In the current work, the encapsulation of liver spheroids with different stiffness conditions was evaluated as a strategy to culture HepaRG cells. It was observed that the encapsulation with different alginate concentrations is compatible with maintenance of highly viable cultures of liver spheroids, with growth arrest and cell polarization promoted by spatial constriction and the enhanced cell-cell interactions in 3D."} +{"text": "Primary umbilical endometriosis is a rare disorder and is defined as the presence of ectopic endometrial tissue within the umbilicus. A patient with painful mass in the umbilicus during menstrual period is studied in this paper. The possibility of subcutaneous endometriosis should be considered when an umbilical mass is detected despite the absence of previous surgery. In this case, urachal cancer, urachal remnant, umbilical endometriosis, and its malignant transformation were among the diseases considered in the differential diagnosis. Complete excision and histology are necessary to obtain a definitive diagnosis and optimal treatment for umbilical subcutaneous endometriosis. Endometriosis is defined by the presence of endometrial tissue outside the uterus. The precise rate of prevalence of umbilical endometriosis is not known, but primary umbilical endometriosis is a rare disorder. The incidence of this disease is estimated to be about 0.5% to 1% of all cases of extragenital endometriosis [Cyclical pains are coincidental with a tumor, and palpable masses are the most common symptoms of primary umbilical endometriosis. Although the pathogenesis of this disease is not fully understood, possibilities include the migration of endometrial cells to the umbilicus through the abdominal cavity or the lymphatic system or embryonic remnants in the umbilical fold such as the urachus and the umbilical vessels , 2. In cThe patient considered here has a rare primary umbilical endometriosis and had been diagnosed with urachal cancer. In this case, complete surgery and histopathological examination were essential as the appropriate treatment.Our subject was provided with written informed consent with guarantees of confidentiality. She was a 45-year-old multiparous patient with a painful umbilical mass concomitant with menstruation. She had no past history of any surgery and her medical histories were unremarkable. She has been complaining of progressive dysmenorrhea 3 years ago, and it was diagnosed as endometriosis based on her clinical symptoms by a gynecologist in another hospital. At that time, the patient did not show a pigmented area in the umbilical nodule. Initially, she took Dienogest (DNG), a progestin, for 14 months. Subsequently, while on treatment with oral contraceptives (OC) for 18 months, she felt a gradual increase in size of the subcutaneous induration and more tenderness around her umbilicus.A physician in another clinic performed ultrasonography (USG) and fine needle aspiration biopsy (FNB). At that time, USG and MRI (magnetic resonance imaging) revealed about 1.0 \u00d7 1.5\u2009cm solitary nodule in her caudal umbilicus , and adeThe patient was subsequently introduced to the department of surgery in our hospital and was diagnosed with suspicious urachal cancer. She then visited our department as an outpatient. This nodule was a nonbleeding rigid mass and discolored, which could not be reduced by digital pressure. Using transvaginal USG, a myoma (4\u2009cm in diameter) at the fundus of the uterus was found. At that time, abdominal MRI did not reveal a lesion of pelvic endometriosis. Serum CA125 and SCC values were within normal ranges. There was no sign of infection and bleeding in the umbilical lesion.Based on the diagnosis of urachal cancer, urachal remnant, umbilical endometriosis, or its malignant transformation, we excised surgically the rigid lesion together with umbilicus and its surrounding tissues consisting of skin, fat, and fascia under general anesthesia . HistopaAmong all diagnosed endometrioses, 1% to 12% of patients have them at extragenital sites, such as the lungs, diaphragm, or umbilicus , 5. PrimPrimary umbilical endometriosis is typically manifested by a firm, pigmented, or bluish nodule with pain and tenderness associated with cyclic bleeding or discharge during menstruation. In this subcutaneous nodule, the patient did not show any skin symptoms, pigmentation, or bleeding in the umbilicus. It was impossible to establish a definitive diagnosis of umbilical endometriosis by only the USG or MRI findings. Zhai also stated that the FNB is a useful additional tool for diagnosing cutaneous endometriosis . AlthougHormonal therapy, such as DNG or OC, was effective preoperatively in ameliorating the symptoms of this disease but could not completely control the pain of the umbilicus lesion. Surgical excision is most frequently used as a safe and definitive treatment of umbilical endometriosis , 11. WheThe risk of malignant transformation from umbilical endometriosis is very low. Only two cases of umbilical endometrioma with malignant transformation have been reported thus far. Lauslahti first reported a case of adenocarcinoma of umbilical endometriosis in 1972 . Obata eThe urachus is the main excretory organ of the fetus located in a region from umbilicus to upper bladder and is present in all children at birth and then gradually degenerates into a single fibrous band connecting the umbilicus to the dome of bladder after birth. Although we considered urachal cancer as a different diagnosis, it is a rare form of cancer that can sometimes involve the bladder. Urachal cancer stems from malignant transformation of the remaining enteric epithelium in the urachus. Currently, there is no consensus on the diagnostic criteria for urachal cancer, and it is considered to have no specific symptoms. Urachal cancer is generally aggressive, appears at an advanced stage, and has poor prognosis. Surgery, including partial cystectomy and radical resection , is the In summary, primary umbilical endometriosis is a rare and underrecognized phenomenon. Nevertheless, this disease must be considered in the differential diagnosis upon examining any umbilical lesions. Complete excision with successive histology is recommended for obtaining a definitive diagnosis and optimal treatment."} +{"text": "Endometriosis is defined as the presence of endometrial glands and stroma outside the uterus. It affects 3 to 10 percent of women of reproductive age. Umbilical endometriosis is rare, with an estimated incidence of 0.5\u20131.0% among all cases of endometriosis, and is usually secondary to prior laparoscopic surgery involving the umbilicus. In this report, we described a case of umbilical endometriosis treated with surgical resection and highlight the great importance of medical history compared to complementary diagnostic tests that can be sometimes inconclusive. Endometriosis is a common benign disease, which is defined by the presence of endometrial tissue outside the uterus . The firTo treat umbilical endometriosis, wide resection with 2\u2009mm margins is generally recommended and therThe authors report a case of a patient with umbilical endometriosis associated with a previous laparoscopic intervention and treated by surgical excision.A forty-two-year-old healthy female, with menarche at the age of 13, was referred to the gynecology department by general surgery, with a livid coloured nodule in the umbilicus which gradually increased in size over the past 3 years. She also presented with dysmenorrhoea : 10), dyspareunia (NRS: 10), dyschezia (NRS: 7), and tenesmus. She was medicated with an oral contraceptive with ethinylestradiol and gestodene. The nodule was painless and the patient mentioned cyclical umbilical bleeding synchronized with menstruation , during Abdominal examination was otherwise normal with no clinical signs of hernia. The first ultrasonography of the umbilical nodule revealed an image suggestive of dermoid cyst. Pelvic computed tomography (CT) scan revealed two contiguous cystic images with peripheral contrast enhancement in the left adnexal area that were included in the differential diagnosis of endometrioma, tubo-ovarian abscess, and serous cystadenoma. A second ultrasound scan of the lesion revealed two superficial cysts measuring 2\u2009mm and another deeper cyst measuring 4\u2009mm, with nonspecific aspect, though compatible with sebaceous or dermal inclusion cysts. Magnetic resonance imaging (MRI) showed uterus measuring 92 \u00d7 40 \u00d7 58\u2009mm, with multiple small nodules showing signal hypointensity on T2-weighted imaging regarded as intramural leiomyomas and the presence of some endometrial glands suggesting adenomyosis, endometrium with 6\u2009mm . MRI alsThe patient underwent excision of the nodule under general anesthesia. The nodule was supra-aponeurotic with central extension to the abdominal peritoneum . DiagnosThe patient was observed at 1, 3, 6, and 12 months after surgery and there was no evidence of clinical recurrence 13 months after that. The hormonal medication was then changed to dienogest plus ethinylestradiol and the patient remained asymptomatic. Histology of the lesion showed the presence of endometrial glands and stroma; therefore a diagnosis of umbilical endometriosis was made. The clinical evaluation for follow-up will be done annually.Endometriosis is a common disorder, defined as the extrauterine presence of endometrial glands and stroma. It is a common, estrogen-dependent inflammatory disease, affecting 3\u201310% of women in the reproductive age , 25. EndThe most common locations of endometriosis are the ovaries , followed by the appendix, intestine, cervix, omentum, and skin . In 70% direct transplantation theory which says that this type of endometriosis is caused by iatrogenic dissemination of endometrial cells, for example, a laparoscopic operation [The pathogenesis of primary umbilical endometriosis is still unclear. Possible explanations for this disorder could be the migration of endometrial cells to the umbilicus through the abdominal cavity, the lymphatic system, or through the embryonic remnants in the umbilical fold such as the urachus and the umbilical vessels , 18, genperation . Spontanperation , 20.Extragenital or extrapelvic endometriosis is even more difficult to diagnose due to the extreme variability in presentation . UmbilicNumerous studies have reported a long delay in the diagnosis of endometriosis . There a de novo cells. Identifying risk factors for recurrence may permit the recognition of subgroups at risk for disease control [The treatment of choice for umbilical endometriosis is the excision en-bloc of the lesions with wide margins with a subsequent course of medication effective in inducing endometrial atrophy , 43. The control . Several control . Ghezzi control . Maligna control , 12, 20. control . There a control ; nonetheOur case describes a woman in her reproductive age with secondary umbilical endometriosis, with cyclical pain and umbilical blood discharge during menstruation, with previous diagnosis of endometriosis in the appendix and a concomitant endometrioma in the right ovary. Initially, before the patient has been referred to the gynecology department, umbilical endometriosis was misdiagnosed and was considered a dermoid cyst. After laparoscopy, our patient was followed up with a standard gynaecological examination, the assessment of painful symptoms, and a TV-US scan that were performed at 1, 3, 6, and 12 months, and this will be repeated subsequently on a yearly basis. The differential diagnosis of an umbilical nodule includes inflammatory disorders , other benign lesions , umbilical hernia, and malignant tumors , 30.This case highlights the importance of medical history compared to those of complementary diagnostic tests which are sometimes inconclusive. Surgeons should always consider umbilical endometriosis in their diagnostic approach when confronted with umbilical nodules. The evidence of the results of diagnosis and the different options to treat extragenital endometriosis is limited. Clinicians may consider surgical removal of symptomatic extragenital endometriosis, and when this is not possible, medical treatment should be considered to relieve symptoms. More studies are necessary to conclude about the best method of diagnosis of umbilical endometriosis and the most appropriate recommendations to treatment and follow-up which include the best medication to prevent the recurrence of the disease."} +{"text": "Acquired epilepsies can arise as a consequence of brain injury and result in unprovoked seizures that emerge after a latent period of epileptogenesis. These epilepsies pose a major challenge to clinicians as they are present in the majority of patients seen in a common outpatient epilepsy clinic and are prone to pharmacoresistance, highlighting an unmet need for new treatment strategies. Metabolic and homeostatic changes are closely linked to seizures and epilepsy, although, surprisingly, no potential treatment targets to date have been translated into clinical practice. We summarize here the current knowledge about metabolic and homeostatic changes in seizures and acquired epilepsy, maintaining a particular focus on mitochondria, calcium dynamics, reactive oxygen species and key regulators of cellular metabolism such as the Nrf2 pathway. Finally, we highlight research gaps that will need to be addressed in the future which may help to translate these findings into clinical practice. Epilepsy, a devastating disease, affects over 50 million people worldwide and is d2+ entry [N-methyl-d-aspartate (NMDA) receptors play a pivotal role in intracellular Ca2+ accumulation during seizure activity. This is supported by robust evidence showing that blocking of NMDA receptor activity abolishes cell death both in vitro and in vivo [2+ are potent triggers of the mitochondrial permeability transition pore opening, which is a key event and point of no return leading to mitochondrial swelling and cytochrome c release from mitochondria, subsequently triggering the cell death cascade [There are clinical hints pointing to a strong involvement of mitochondria and bioenergetics in epileptogenesis, seizures and epilepsy. For example, patients with mitochondrial mutations often present with epilepsy as a phenotypic manifestation of the disease , highlig2+ entry . There i in vivo ,11,12. N in vivo ,14. Exce cascade ,16,17.2+ dynamics, ROS and key regulators of cellular metabolism such as the nuclear factor erythroid 2\u2013related factor 2 (Nrf2)pathway. It is not in the scope of this review to cover the extensive literature on genetic syndromes with mutations in genes coding for mitochondrial proteins or key enzymes of metabolism, which has been the subject of a number of other extensive reviews . Ins. Ins2+ ds and \u201cepilepsy\u201d or \u201cseizures\u201d from 1950 until July 2017. In addition, manuscripts were also identified through searches of the authors\u2019 own files and from reference lists of the articles pointed out by the PubMed searches. Due to space restrictions, the final reference list was compiled from a selection of the articles identified which were prioritized according to their originality and their ability to fit into the narrative style of the current review.Mitochondria, initially coined bioblasts, were first described by Richard Altmann in 1890 and were recognized to function as elementary organisms within the cell . A furth2+ homeostasis through buffering of intracellular Ca2+, and thus have been referred to as the \u201chub of Ca2+ signaling\u201d [The mitochondria are organelles that are amongst others essential in three different homeostatic mechanisms. Firstly, their most prominent and obvious function is ATP production. Secondly, they are involved in Cagnaling\u201d . Lastly,gnaling\u201d . Links tEarly pioneering experimental studies showed that glucose, ATP and other energetic substrates decrease during seizure activity, particularly if this is prolonged ,30,31. T2+. Excess Ca2+ entry into neurons has been observed in rats that underwent status epilepticus induced by bicuculline and l-allylglycine [2+ overload has been shown to lead to cell death and was particularly pronounced in CA1 and CA3 regions, which are areas of the central nervous system (CNS) that are very susceptible to seizure induced cell death [2+ accumulation during prolonged seizures.Besides ATP production, the most important function of mitochondria is the buffering of excess Calglycine . In thesll death ,40. It i2+ buffering have been described in the literature. The mitochondrial uniporter (MCU), whose structure has been unraveled only recently [2+ entry into the mitochondria and is thus instrumental in Ca2+ buffering during excess Ca2+ overload. The uptake and extrusion of Ca2+ in mitochondria is coupled to H+ and Na+ cycling that is maintained by the electron transport chain, which creates a potential gradient across the mitochondrial membrane [2+ precipitates to insoluble Ca2+ phosphate complexes, a process which is dependent on the availability of phosphate. This in turn is also dependent on the proton gradient and thus more phosphate enters the mitochondria if the gradient is higher, i.e., when the mitochondria are hyperpolarized. Ca2+ homeostasis through the MCU has been shown to play a role during seizure activity. Inhibition of the MCU significantly attenuated neuronal death after pilocarpine-induced status epilepticus and reduced levels of intracellular ROS [Different pathways for mitochondrial Carecently , is the membrane ,42 opening is another route for Camembrane . The MPT, releasproteins ,54,55,56proteins .2+ accumulation, which is one of the leading causes for seizure induced sequelae, is an event that is not only governed by the interplay of Ca2+ entry through the plasma membrane, but also by intracellular Ca2+ stores. An intracellular site of Ca2+ accumulation resides, as mentioned above, within the mitochondria. However, the endoplasmic reticulum (ER) has a larger capability to store intracellular Ca2+ and thus is pivotal in Ca2+ homeostasis.Excess intracellular Ca2+ release for muscle contraction [2+ homeostasis in cells other than muscle cells [2+ release have been shown to play a role in many neurological diseases [The ER, which was first identified as the site for intracellular Catraction ,59, was le cells . Inositodiseases .2+ stores. Preincubation of neuronal hippocampal cultures with thapsigargin, a drug that depletes intracellular ER Ca2+ stores, resulted in a decrease in the amount of neuronal excitation produced by bicuculline [2+ stores as they were blocked by thapsigargin or dantrolene, which both affect ER-Ca2+ stores [2+ release from the ER, provides protection against cell death produced by kainate-induced status epilepticus [2+ stores in mediating seizure-induced cell death.With regards to epilepsy, surprisingly very few studies have examined the role of ER Cauculline . Ictal d+ stores . A recenlepticus . This st2+ release from intracellular stores, extracellular Ca2+ entry has been identified as the most important route of Ca2+ entry during seizure activity, which is supported by a plethora of studies [In contrast to Ca studies ,12.+ and Ca2+ ions. Depolarization of the cell opens the channel by dislodging Mg2+ and Zn2+ ions from the pore [2+ ions entering the cell upon NMDA receptor stimulation have been shown to be responsible for subsequent cell death promoted by NMDA receptor activation, since omission of Ca2+ ions from the extracellular solution mitigated the harmful NMDA receptor mediated effects [The NMDA receptor (NMDA-R) forms a heterotetramer comprising two GluN1 and two GluN2 subunits and is mainly permeable by Nathe pore . The NMDthe pore ,12 and ithe pore ,67. The the pore ,69. Ca2+ effects .However, clinical evidence points to a more complicated role of NMDA receptors in epilepsy. Antibodies against the extracellular N-terminal domain of the GluN1 subunit have been identified to be responsible for NMDA receptor encephalitis ,71, an aNR1neo/neo mouse model of NMDA receptor hypofunction showed a dramatic sensitivity to kainate induced seizures [Interestingly, mutations in subunits of the NMDA receptor, e.g., GRIN1 and GRIN2B, have recently been identified as a cause of epileptic encephalopathy presenting with seizures ,76. In aseizures , highligseizures .2+ permeable AMPA receptors have been shown to play a role in status epilepticus [2+ mediated injury in seizures remains to be determined.Besides NMDA receptors, Calepticus . How sub2+ channels (VGCC) channels is beyond the scope of this review. It should just be mentioned though that T-type and P/Q-type channels contribute to epileptogenesis, modulation of network activity, and genetic seizure susceptibility [V3.1 and CaV3.2 T-type channel isoforms of VGCC are essential in the pathogenesis of absence epilepsy [A review of the role of voltage gated Catibility . These cepilepsy . In addiepilepsy ,83.2+ permeable AMPA receptors and voltage gated Ca2+ channels mediate the influx of Ca2+ into the cell, the plasma membrane ATPase (PMCA) together with the sodium Ca2+ exchanger (NCX) removes Ca2+ from the cell against its concentration gradient (2+-ATPase activities was found in pentylentetrazole treated rats [2+ extrusion proteins (PMCA and NCX) has been studied in a rat model of kainate-induced status epilepticus [2+ homeostasis in these regions during epileptogenesis, however, was not assessed in these studies.While NMDA receptors, Cagradient . A decreted rats . The explepticus . This stlepticus . The net2O2) molecules that are by-products of many biological reactions [2+-ATPase pump inhibition and inhibition of plasma membrane Ca2+ channels, ROS increase intracellular Ca2+ levels, which together with ROS, then trigger mitochondrial permeability transition [ROS contribute to neuronal damage in a wide range of neurological diseases ,88,89, ieactions . ROS in eactions . It is ieactions . Whetheransition Figure O2 molecuansition . The braThere is overwhelming evidence supporting a role for ROS in epilepsy . Early sTraditionally, mitochondria have been assumed to be the main site of ROS production during seizure activity. Some of this has been initially concluded by the coincidence of mitochondrial membrane depolarization, cellular ROS increases and cellular damage . ComplexA more recent study analyzed hippocampal and parahippocampal tissue samples from 74 patients with drug-refractory temporal lobe epilepsy and found that neuropathological signs of inflammation in patients suffering from hippocampal sclerosis correlated with mitochondrial DNA (mtDNA) mutations . This fiNADPH oxidase was discovered by studying the respiratory burst in phagocytes and granulocytes . SubsequNOX2 has been highlighted to play a role in seizures and epilepsy. This is not surprising since NMDA receptor activation, which has a leading role in epilepsy, has been found to trigger NOX2 assembly and activity ,111. We 2O2 [With regards to the other NADPH oxidase isoforms, besides NOX2, NOX4 has been highlighted as a major source of ROS in acute brain diseases such as stroke . NOX4 is2O2 . We have2O2 , yet NOX2O2 . In this2O2 ,120.Other sources of ROS have been described in seizures and epilepsy, including xanthine oxidase, cyclooxygenase and lipoxygenase ,121,122.One strategy to decrease the ROS burden during seizure activity is to reduce ROS production by blocking key enzymes; another strategy is to boost ROS scavengers. With regards to the latter, the Nrf2 pathway represents an ideal target.https://clinicaltrials.gov). Moreover, dimethyl fumarate, a drug licensed for use in multiple sclerosis, is an Nrf2 inducer [S-transferases (GSTs), NAD(P)H:quinone oxidoreductase 1 (NQO1) as well as enzymes involved in glutathione biosynthesis and regeneration [Nrf2 is a transcription factor that has been shown to regulate both antioxidant defense and intermediary metabolism and thus combines some of the mechanisms outlined above ,125,126. inducer , and thuneration ,136. Intneration . In addineration . More reneration . All theN-acetylcysteine treatment with the rationale that these mechanisms are complementary in increasing glutathione levels, as glutathione is one of the main intracellular antioxidants and thus one of the most potent ROS scavengers within the brain. Sulforaphane at high doses (>100 mg/kg) was shown to lead to sedation, hypothermia, impairment of motor coordination, decrease in skeletal muscle strength, and deaths in addition to offsite effects such as leucopenia [Nrf2 has been highlighted as a target in the treatment of seizures and epilepsy ,139. Oneucopenia . It shouucopenia .2+ excess is another key candidate for these changes, but the involvement of intracellular calcium stores and particularly the ER in Ca2+ excess during seizures and epilepsy remains understudied. Moreover, mitochondrial and ER-Ca2+ stores are intimately linked with each other. How this interconnection is in seizures and epilepsy remains an open question. It is known that Ca2+ together with ROS induce cell death during seizure activity. We have outlined some ideas about the sources of ROS involved in this process. However, the precise sources of ROS involved remain a matter of debate. It is likely that different sources are active at different time points during seizures and epilepsy, such as has been shown in other diseases, e.g., stroke [We have highlighted some exciting activity in the field of metabolic and homeostatic changes during seizure activity and in epilepsy. These studies show that mitochondria are both the source and target of metabolic and homeostatic dysfunction during seizures and epilepsy. Ca, stroke . With re, stroke . As outl, stroke to comba"} +{"text": "Making decisions based on choice-outcome history is a crucial, adaptive ability in life. However, the neural circuit mechanisms underlying history-dependent decision-making are poorly understood. In particular, history-related signals have been found in many brain areas during various decision-making tasks, but the causal involvement of these signals in guiding behavior is unclear. Here we addressed this issue utilizing behavioral modeling, two-photon calcium imaging, and optogenetic inactivation in mice. We report that a subset of neurons in the posterior parietal cortex (PPC) closely reflect the choice-outcome history and history-dependent decision biases, and PPC inactivation diminishes the history dependency of choice. Specifically, many PPC neurons show history- and bias-tuning during the inter-trial intervals (ITI), and history dependency of choice is affected by PPC inactivation during ITI and not during trial. These results indicate that PPC is a critical region mediating the subjective use of history in biasing action selection. Past outcomes modulate activity in a diverse set of brain regions however their precise influence on decisions is not known. Here the authors show that posterior parietal cortex neurons encode history-related signals between trials and optogenetic inactivation during this epoch disrupts the history dependence of choice. History-dependent biases are not limited to explicitly adaptive contexts such as dynamic foraging tasks. Instead human and animal subjects show diverse idiosyncratic history-dependent biases even when the optimal choice is a strict function of environmental stimuli independent of the subject\u2019s history, if they are unaware of such a rule or the stimuli are difficult to decipher10. The prevalent history-dependency of decisions suggests that tracking choice-outcome history to form subjective bias is a fundamental aspect of decision-making, yet the neural circuits mediating this process are largely unknown.Imagine you are deciding on a meal to order at your favorite restaurant. If you enjoyed the dish you ordered the last time you dined there, you may be more inclined to order it again. Such a decision bias shaped by the choice-outcome history can allow one to infer the rules of the environment and generate adaptive behavioral strategies12. Such variability is often treated as random noise15. However, for future decisions to be biased by history, it is necessary that neural responses are modulated by history, accounting for some of the observed neural variability. Indeed, choice-outcome history has been shown to modulate the activity in a variety of brain areas, including parietal, prefrontal and premotor cortex, and subcortical structures20. For example, neurons in the lateral intraparietal area of the monkey posterior parietal cortex (PPC) that has been implicated for the accumulation of sensory evidence are modulated by the choice and outcome information of recent trials22. However, history affects action selection biases in flexible and complex ways that vary over time and across individuals19, and it is unclear how the history signals in the brain may account for such a flexible relationship between history and decision bias. Furthermore, these brain areas often contain intermingled neurons with diverse temporal activity profiles24, and the roles of specific temporal windows of history-related activity cannot be accessed with traditional lesion or pharmacological inactivation approaches.Responses of neurons in the sensorimotor pathway including areas implicated for decision-making show degrees of variability even for identical sensory inputs and motor outputs7. These idiosyncratic biases are highly correlated with the pre-stimulus activity of a subset of neurons in PPC. Temporally precise inactivation reveals a causal role of the pre-stimulus activity of PPC, but not the subsequent activity following stimulus onset, in action biases. Therefore, we conclude that PPC is involved in subjective uses of history in biasing action selection.Here we combine behavioral modeling, two-photon calcium imaging, and temporally precise inactivation to explore the mechanisms of the subjective, history-dependent decision bias in mice performing a visually instructed action selection task. Similar to previous findings in difficult decision-making tasks, our behavioral model identifies diverse, idiosyncratic relationships between choice-outcome history and action selection biasWe developed a task in which head-fixed mice moved a joystick with their left forelimb in one of two directions in response to visual cues Fig.\u00a0. In eachAfter 2\u20134 months of incremental training trial, and equalizing choice frequencies, were both adaptive and helped mice perform better than chance. In contrast, a strong constant preference of one choice was an example of maladaptive strategies, as it results in repetition of the same error for multiple trials. The varying degrees of \u2018adaptiveness\u2019 of models in different sessions were quantified by assessing the success rate of the internal bias model (excluding the stimulus term in the full model) of each session in simulation in which the stimulus was selected according to the same rules. We found that 53% of sessions showed significantly adaptive strategies, while 24% were significantly maladaptive in every trial. Thus, the two common strategies described above, biasing choice based on the outcome history of the immediately preceding showed significant task-related activity and were included in the analysis.To explore the neural basis of these subjective, history-based internal biases, we applied two-photon calcium imaging to record the neural ensemble activity in PPC while mice performed the task Fig.\u00a0. We chos29, many PPC neurons exhibited choice-selective activity such that the activity in forward-pressing and downward-pressing trials was significantly different. Choice-selective neurons presented varying timing of choice selectivity, and largely distinct populations of neurons showed choice selectivity during the stimulus, memory, and movement periods trial, respectively , we performed additional experiments in which the joystick was unfixed in the ITI of a subset of trials. Choice-selectivity of PPC neurons during the ITI in the trials when mice did not apply force on the unfixed joystick remained the same as in the joystick-fixed condition, suggesting that the ITI choice-selectivity does not arise from partial execution of movements and N choice independently, by focusing on trials in which 2 of the 3 variables were identical. For example, neuron 1 shown in Fig.\u00a0N\u22121 outcome, exhibiting different levels of activity after rewarded and error trials. This modulation by N\u22121 outcome was clearly present even when we considered only the trials in which N\u22121 choice and N choice were fixed, indicating that the N\u22121 outcome modulation of this neuron was not a secondary effect of correlation between N\u22121 outcome and N\u22121 choice or N choice. In addition, this neuron was also modulated by both N\u22121 choice and N choice, independent from its modulation by N\u22121 outcome. Overall, large fractions of ITI choice-selective neurons exhibited independent tuning for N\u22121 outcome, N\u22121 choice, and N choice were tuned to both ice Fig.\u00a0, indicatN\u22121 outcome in all imaged sessions during the ITI. However, the strength of its N\u22121 outcome tuning varied across sessions, tracking the strength of the influence of previous outcome on the subsequent choice as estimated by the accuracy of the partial model using the previous outcome information only. That is, the neuron showed more pronounced N\u22121 outcome tuning in sessions in which the previous outcome influenced the upcoming choice more strongly. Such flexible modulation of N\u22121 outcome tuning was consistent across PPC neurons . For example, the neuron in Fig.\u00a0ons Fig.\u00a0. Similaring Fig.\u00a0. The fleIn line with this notion that PPC represents the subjective bias, the weighted sum of ITI activity of neurons simultaneously recorded from PPC was able to fit very closely the internal biases estimated by our behavioral model Fig.\u00a0. The excN\u22121 trial, we found that the population activity encoded both bias and N\u22121 outcome independently. That is, even for the same value of internal bias, population activity was still separable depending on the N\u22121 outcome . Once their performance reached a plateau, we started inactivation sessions in which blue light was applied bilaterally to inactivate PPC during the ITI of a small subset (~15%) of trials in PV-Cre mice to express ChR2 in parvalbumin-positive inhibitory neurons in PPC and these mice were trained with the task . To our surprise, the history-choice relationship was not altered when we inactivated PPC during the trial period , the effect was variable across animals . These changes in behavioral performance provide additional evidence that PPC ITI activity is essential for the history-dependent biases, and the bidirectional effects suggest that PPC is responsible for the range of variable and idiosyncratic strategies to utilize the history information.Given that some sessions showed adaptive and maladaptive strategies Fig.\u00a0, we hypo33. However, in contrast to the current study, these previous studies did not systematically relate the pre-stimulus activity to decision variables such as history-dependent internal bias and could not distinguish it from stochastic neural noise such as ongoing fluctuations of baseline. Moreover, the causal relationship between pre-stimulus activity and future choice has not been tested. To our knowledge, our current study is the first to demonstrate that the PPC pre-stimulus activity is essential for the influence of biases on subsequent actions.The pre-stimulus activity of PPC during the ITI closely reflected the subjective, internal bias estimated by our behavioral model and accordingly predicted the future choice. Choice-predicting pre-stimulus activity has been reported in various brain areas including the visual, parietal, premotor, and prefrontal cortex34, and identifying these downstream areas that are responsible for the bias execution is an important topic of future research. We also note that our result does not imply that the post-stimulus choice-selective activity in PPC has no functions. In fact, several studies reported altered behavioral performance in perceptual discrimination tasks following PPC perturbation35. PPC also contributes to movement planning and execution, and inactivation in monkeys can affect movement end point control36. Such a role in fine motor control or sensory evidence accumulation is distinct from the bias coding that we describe here and was not tested in this study.Our temporally precise optogenetic inactivation revealed that the effect of PPC inactivation was specific to ITI, and perturbation after stimulus onset did not cause a measurable effect on behavior. This result implies that bias information encoded in PPC during ITI is unloaded to some other areas after the ITI and maintained in a PPC-independent manner. PPC neurons have projections to various brain areasWe found that the PPC ITI activity contains both history and bias information mixed at the level of individual neurons. This observation clearly excludes two extreme possibilities; (1) PPC only contains history information and is upstream of bias computation, and (2) PPC only contains bias information and is downstream of bias computation. While the precise circuit mechanisms underlying the transformation of history information into bias are extremely difficult to uncover, based on the mixed representation of history and bias in PPC, we favor the view that PPC participates in the computation of subjective bias from history information. It is important to note that these PPC neurons that encode history and bias information are intermingled with other neurons that are selectively active during visual stimulation, delay, and movement periods. PPC thus likely contains multiplexed, parallel pathways dedicated to the processing of distinct forms of information.38. Especially, two recent findings in rodent PPC resonate with our current study: (1) PPC population activity exhibits slow dynamics that integrate recent events22, and (2) PPC perturbation affects internally guided decisions39. Our finding that PPC neurons encode a mixture of history and bias to influence action selection demonstrates an important functional consequence of the former observation. The representation of history-dependent internal bias in PPC presents a mechanism for PPC to affect internally guided decisions. Furthermore, our finding that intermingled but distinct sets of neurons represent specific sets of information lays foundation for investigating functional diversity in PPC microcircuits, likely linked with projection target areas.The functional homology between primate and rodent PPC is not fully established, but several rodent PPC studies have found neural response properties analogous to primate PPC and started to provide further insights into PPC circuits and functionsGad2-IRES-Cre [JAX 010802]40 and Rosa26-CAG-LSL-tdTomato [JAX 007914]41 or Rosa26-CAG-LSL-tdTomato or cross between Camk2a-tTA [JAX 003010] and tetO-GCaMP6s [JAX 024742]; optogenetic perturbation: PV-Cre [JAX 008069]42\u00a0or cross between PV-Cre and Ai32 [JAX024109]) were housed in a room with a reversed light cycle (12\u201312\u2009h). Experiments were performed during the dark period.All procedures were in accordance with protocols approved by the UCSD Institutional Animal Care and Use Committee and guidelines of the National Institute of Health. Mice were implanted with a custom head-fixation plate on the skull. Following a minimum 3 days of recovery, daily water consumption was limited to a controlled amount . Behavioral training began following 3\u201310 days of water restriction.http://brodywiki.princeton.edu/bcontrol/). The presentation of visual stimuli was implemented using Psychtoolbox .A custom-built behavioral apparatus housed in a box (40\u2009\u00d7\u200940\u2009\u00d7\u200940\u2009cm) included a joystick , a 17 inch computer monitor , and a water port with photodiodes to sense licking Fig.\u00a0. The stoIn the two-alternative forced-choice task Fig.\u00a0, one of Mice were trained under head-fixation in the behavioral apparatus, ~1\u2009h per day over a period of 2\u20134 months. The task was shaped to reach the final version through 8 training steps and reached the correct target. Trials in which mice responded before the go cue were considered errors and immediately aborted, resulting in a white noise error sound. Step 3 training continued until mice achieved withholding performance above 80%:In step 4, mice were trained to discriminate between the two distinct visual stimuli (forward and downward drifting gratings) and reach the correct target after the go cue. In this step, trials were considered errors and immediately aborted if mice reached the incorrect target, or moved before the go cue (as in step 3). step 4 continued until they achieved both withholding and discrimination performance above 80%:Discrimination performance was computed for all trials that reached a target regardless of whether or not the trials were successfully withheld. Once this performance criterion was achieved, the ITI length was gradually increased to 4 or 8\u2009s (step 5). In step 6, we turned off the visual stimulus during the response period . In step 7, the stimulus period was shortened to 1.8\u2009s and a 0.2\u2009s memory period was introduced. In the final step, the visual stimulus period was gradually decreased to 1\u2009s and the memory period was gradually increased to 2\u2009s. With the 2-s memory period, the discrimination performance rarely improved above 60% (even after prolonged training). Thus, we trained each mouse until their discrimination performance in the 2-s memory task reached 60% on average.A subset of mice performed sessions containing randomly interleaved non-memory and memory trials during training. In those sessions, the discrimination accuracy was consistently lower in memory than non-memory trials, indicating that the memory load, rather than the sensory discriminability, impaired performance in the memory task Fig.\u00a0.The visual stimulus was randomly selected between forward or downward drifting gratings with the following constraints: (1) after three consecutive rewarded trials in one direction, the stimulus always switched to the other direction, and (2) after error trials, the same stimulus was repeated. These constraints were implemented to discourage the mice from choosing only one direction and settling at 50% discrimination accuracy. Despite the deterministic stimulus after an error or a third consecutive reward in one direction, the mice performed only slightly better in those trials than random trials , and selected the time constants and weights that produced the highest model accuracy as the best-fit regression parameters. For given time constants, we found best weights using logistic regression on a training set Eq.\u00a0. The twoIn partial models, we used a subset of variables and performed the same regression procedure. For instance, when estimating the effect of inactivation on trial-history dependency of choice, we used a partial model without the stimulus term and compared the partial model accuracy between light-on and light-off trials.p\u2009<\u20090.05 as a significance threshold.To assess the statistical significance of history information in predicting future choices, we applied a likelihood-ratio test between the full model and a partial model that contains only stimulus and constant terms. We used To determine whether the specific history-dependent strategy of a given session was adaptive or not Fig.\u00a0, we geneAfter mice reached the discrimination threshold of 60% in the 2-s memory task, we paused training and allowed unlimited water access at least for 2 days prior to craniotomy and virus injections. The craniotomy spanned both the PPC and the forelimb region of the primary motor cortex in the right hemisphere. Viruses were injected at 5 sites (~20\u2009nL per site) in PPC and M1 at a depth of ~250\u2009\u00b5m beneath the dura, in layer 2\u20133. After the injections, the craniotomy (~2\u2009mm\u2009\u00d7\u20093.5\u2009mm) was covered with an optical window fixed in place with dental cement. Two of the three mice in the free-joystick task condition , we imaged cortical activity in layer 2\u20133 at the depth of ~200\u2009\u00b5m with excitation at 925\u2009nm from a Ti\u2013Sa laser (Spectra-physics) using a two-photon microscope . Each imaging field was 512\u2009\u00d7\u2009512 pixels covering 472\u2009\u00d7\u2009508\u2009\u00b5m and imaging was performed at ~28.4\u2009Hz. The duration of each behavior-imaging session limited to 1.5\u2009h, ended when the mouse was disengaged from the task, or completed 170 rewarded trials. Mice completed ~135 (range: 88\u2013172) rewarded trials in each imaging session.N\u2009=\u20094), the same fields were imaged repeatedly over 4\u20137 sessions. Of the repeatedly imaged fields, except for the analysis tracking selectivity for immediately preceding trial outcome and choice across sessions . For some mice were implanted with a head-fixation bar and bilaterally injected with virus carrying ChR2 through a thinned skull over PPC. Approximately 100\u2009nL of virus was injected in one location at each of two depths, 200\u2009\u00b5m and 600\u2009\u00b5m from the dura. After the surgery, following the same training protocol as the head-plate implanted mice described above, we trained them to perform the task over a period of 2\u20134 months.Mice for PPC inactivation experiments were placed ~2\u2009mm above the head-fixation bar, away from the cortical region expressing Channelrhodopsin, and lights were turned on during the ITI of randomly selected 15% of trials. Most mice recovered their previous task performance within 1\u20132 days.Each inactivation experiment was performed across 14\u201316 daily sessions. Control and inactivation sessions alternated day-by-day for all but 5 mice. The 5 mice performed control and perturbation sessions sequentially in 7-day blocks. In control sessions, the LED lights were directed above the head-fixation bar, whereas in inactivation sessions they were placed directly above PPC on both hemispheres. Except for this difference, all procedures were identical between control and inactivation sessions.In both control and inactivation sessions, light-on trials were pseudo-randomly selected with a constraint that there be at least 5 light-off trials between any two adjacent light-on trials to avoid potential behavioral adaptation to cortical perturbation due to consecutive and/or frequent exposures. Under this restriction, light stimulation was applied to ~15% of trials.The procedures were identical to the PPC inactivation experiment described above except for the following difference. In three of the seven mice, ChR2 was expressed in PV positive neurons by crossing PV-Cre mice with Ai32 mice containing lox-stop-lox-ChR2 in the ROSA locus, and an optical window was placed over M1. We did not observe behavioral differences during the inactivation experiment between these three mice and the rest.In behavioral model analyses, choice was predicted only for trials in which mice reached any of the two targets after the stimulus onset, ~248 trials per session. In neural data analyses, we included trials in which mice reached any target within 1\u2009s after the go cue. Error trials in which mice moved the joystick before the go cue were excluded due to the possibility that neural activity during stimulus and memory period in those trials might be contaminated with immediate movement planning and execution. Slow trials were also excluded to reduce neural variability associated with highly dissimilar movement kinematics within the same categorical choice. By these criteria, ~185 trials per session (range: 92\u2013293) were analyzed. The early and late trials excluded from the neural analysis showed similar choice tuning to the regular trials 23. For GCaMP6s signals recorded to compare ITI tuning between free-joystick and fixed-joystick conditions, dF/F was further transformed into an estimate of spike rates using the spike-triggered mixture model (https://github.com/lucastheis/c2s)44.Using custom Matlab program, fluorescence images were aligned frame by frame to compensate for lateral motions. Regions of interest (ROIs) were manually drawn on the motion-corrected fluorescence images, by circumscribing the cell bodies based on their GCaMP fluorescence intensity distinguishable from the background. Pixels inside each ROI were considered as a single cell, whereas pixels extending radially outward from the cell boundary by 2\u20136 pixels were considered background. In case the background included other cells\u2019 ROIs, those pixels were excluded. To estimate the activity of a single cell, 70% of the average pixel intensity in its background was subtracted from the average pixel intensity inside the cellTo detect calcium transients, we used a zero-mean dF/F trace in which the mean dF/F was subtracted from the original dF/F. Using Matlab function findpeaks, we first identified tentative transient peaks. If the amplitude of a detected peak was at least 0.5 and >3.3 times the standard deviation of dF/F velocity per frame, the peak was counted as a calcium transient. To focus our analysis on stable and reliable cells, we only included the cells that showed calcium transients at a rate >1 transient/minute in both the first and second half of a session and the average peak amplitude of all transients is greater than five times the standard deviation of dF/F. By these criteria, the average number of analyzed cells in a single PPC field was 73 (range: 22\u2013140).Of the active cells, we identified task-related cells that showed significant activity modulation during the task as following. The mean activity trace of each neuron was calculated by aligning dF/F traces to behavioral events and averaging across all correct trials. Three different behavioral events were used to align dF/F traces: stimulus onset (\u22126 to 3\u2009s), movement onset (\u22122 to 7\u2009s), and reward onset (\u22124 to 5\u2009s). A cell was considered to be task-related if its mean activity fell outside the 99.9th percentile of its dF/F distribution in three consecutive frames in any of the three alignments. For this criterion, the false positive rate estimated on temporally-shifted dF/F traces, by a random amount for each trial, was 4.4%.p\u2009<\u20090.01 with Bonferroni correction for multiple comparisons) estimated by choice label shuffling per cell and epoch, 1000 times. The preferred directions of choice-selective neurons were nearly equally distributed was computed in the same way as choice selectivity, but with those binary variables as the label or score trial outcome, (N\u22121) choice, and N choice, we computed the classifying accuracy of a linear classifier . Thus to avoid overfitting, only the features that significantly contributed to the regression were selected using Matlab function stepwisefit using all trials before applying the classification analysis.To compute the prediction power of the neural activity on binary behavioral variables such as . Then, to compute the outcome information independent of the internal bias, we subtracted the accuracy of the second classifier from the first trial outcome and choice information had predictable power for the upcoming trial choice, we inspected whether the ITI activity remains choice selective even for the trials that followed the same outcome and choice conditions in the N\u22121 trial. Thus, the ITI choice selectivity was examined in each of the four possible conditions of the N\u22121 trial: (1) post-reward and post-downward, (2) post-reward and post-forward, (3) post-error and post-downward, and (4) post-error and post-forward . In each of these conditions, choice selectivity of each cell was assessed using ROC analysis. The fraction of conditions in which the cells are choice selective was compared to the null distribution estimated by shuffling choice labels in each condition.Because the immediately preceding .Movement onset was defined as the first time at which the joystick velocity exceeded 22.2\u00b0/sec (~20\u2009mm/s) continuously for 20\u2009msec and the joystick moved at least 1.3\u00b0 (~1.1\u2009mm) from the origin. The reaction time was measured as the time from the go cue and movement onset, and the movement duration was measured as the time from movement onset to the time when the joystick entered any target region than the median of the other set acquired from the same subjects, we used Wilcoxon one-sided signed rank test. For two sets of samples acquired from different subjects, we used Wilcoxon one-sided rank-sum test for testing specific hypotheses. For statistical tests for means, we used bootstrapping.N different inactivation sessions is significantly different from zero, we randomly drew N values from the original N observations allowing repetitions, computed the mean of N random samples, and constructed the probability distribution of the mean through 1000 repetitions. When the 95% confidence interval of the distribution did not include zero, we deemed the mean significantly different from zero.To examine whether the mean change in a parameter across The data that support the findings of this study are available from the corresponding authors upon reasonable request.Supplementary InformationPeer Review File"} +{"text": "This study showed that the majority of the pediatricians still prescribe vitamin D prophylaxis late, recommend high doses of vitamin D in cases of delayed tooth eruption, and think that low serum 25-hydroxy vitamin D level regardless of alkaline or phosphatase parathyroid hormone measurement is an indication for high-dose vitamin D (stoss) therapy. These results suggest a need for new training programs focusing on vitamin D supplementation.To determine the adherence of pediatricians to the nationwide \u2018Vitamin D Prophylaxis Program\u2019 and to evaluate their attitudes about vitamin D intake. The study was conducted using the Turkish National Pediatrics Association network. The pediatricians were asked to respond to an online questionnaire that included five questions on \u2018What dose of vitamin D they recommend for supplementation?\u2019, \u2018At what age they start vitamin D supplementation?\u2019, \u2018Supplementation method\u2019, \u2018Clich\u00e9s and truths about vitamin D\u2019, and \u2018High-dose vitamin D therapy indications\u2019. Responses of 167 pediatricians were evaluated in this study. 75.5% of pediatricians indicated that they recommended vitamin D supplementation in a daily dose of 400 IU. 47.1% started vitamin D supplementation by the end of the 2 While there is an increased awareness on the critical role of vitamin D on health, vitamin D deficiency is still an important health problem due to the influence of social, cultural, and geographic factors . SymptomA nationwide vitamin D prophylaxis program that included free distribution of vitamin D drops to all newborns and infants (0-12 months) attending primary health centers throughout the country was initiated in 2005 in Turkey . HoweverThis study aimed to determine the adherence of pediatricians to the guidelines of the program and to evaluate their fundamental attitudes about vitamin D deficiency and vitamin D supplementation.The study was conducted making use of the Turkish National Pediatrics Association Network. The questionnaire was sent to 1800 pediatricians. The pediatricians filled out an online questionnaire regarding their policy on vitamin D supplementation.The questionnaire consisted of 5 questions. The first part three questions were on vitamin D supplementation practices:What daily dose of vitamin D supplementation do you recommend? 1200 IU, 400 IU, 600 IU, 800 IU.At what age do you recommend to start vitamin supplementation? Soon after birth, at the end of the 1st week, at the end of the 2nd week, at the end of the 3rd week, after age one month.Which method do you prefer for vitamin D supplementation? Three drops orally once daily (400 IU/day), eight drops orally once daily (1000 IU/day), one vial (300.000 IU) orally once a month, one vial (300.000 IU) orally every two months, one vial (300.000 IU) intramuscularly every two months.We also asked whether their practices were influenced by some common non-scientific beliefs.Clich\u00e9s and truths about vitamin D intake .The last question queried whether they followed the under-mentioned indications for high-dose vitamin D therapy (stoss therapy) in their clinical practice.High-dose vitamin D therapy indications for all newborns and infants consist of a 25-hydroxy vitamin D [25(OH)D] level <15 ng/mL, an elevated serum alkaline phosphatase levels in addition to a serum 25(OH)D level of <15 ng/mL, and presence of craniotabes in addition to a serum 25(OH)D level <15 ng/mL.A total of 167 pediatricians completed the questionnaire. 75.5% of them indicated that they routinely recommended daily vitamin D prophylaxis in a dose as 400 IU. 10.2% of respondents recommended vitamin D prophylaxis in a daily dose of 800 IU. The remainder of the responders stated they recommended daily doses of 1200 IU and 600 IU. 28.7 % of respondents recommended beginning vitamin D prophylaxis soon after birth and 47.3% recommended beginning by the end of the 2nd week. 86.2% of respondents recommended daily 3 drops for vitamin D prophylaxis, while 11.38 % recommended daily 8 drops and 1.2% administration of oral 300.000 IU every 2 months.7.8% of respondents suggested doubling the daily dose of vitamin D prophylaxis in infants with delayed tooth eruption, 19.9% suggested immediate cessation of vitamin D in infants with small anterior fontanelle, while 2.4% suggested giving 300.000 IU of vitamin D every two months to infants with delayed walking and 16.9% suggested giving 300.000 IU of vitamin D to infants with leg bowing .The nationwide vitamin D prophylaxis program of the Turkish Ministry of Health successfully reduced the prevalence of rickets in Turkey from 6% in 1998 to 0.1% in 2008 in children under 3 years of age ,8. In a While this was encouraging, more than half of the pediatricians who responded to our questionnaire recommend to start supplementation later than the age recommended by the Ministry of Health. We believe this finding is mostly due to the misconception among pediatricians that the maternal transfer of vitamin D in utero would protect the infants against vitamin D deficiency in the first 3 weeks of life . HoweverThe results of our study reveal that non-scientific beliefs may influence clinical practice. 20% of the physicians thought that vitamin D supplementation should be stopped in babies with small anterior fontanels. We suppose that this belief is because of a misconception that if vitamin D deficiency can delay anterior fontanel closure, an early closure of fontanel should indicate vitamin D excess. Another stereotyped approach is erroneously considering bowing in infants automatically as a sign of vitamin D deficiency and prescribing high doses of vitamin D without additional findings though it may be due to other causes . Similarly, 10% of pediatricians have stated that high-dose vitamin D treatment will accelerate tooth eruption and walking. This is consistent with a common belief among the parents.Another interesting finding is that most pediatricians routinely analyze serum 25(OH)D and prescribe high doses of vitamin D (stoss therapy) without assessing the clinical symptoms and/or other biochemical and radiological parameters. We believe this attitude is due to the widely publicized extraskeletal effects of vitamin D . HoweverIn conclusion, despite significant progress in the prevention and treatment of vitamin D deficiency in Turkey, some pediatricians still have incorrect attitudes such as starting vitamin D supplementation late, using high doses of vitamin D without a real indication, and accepting low serum 25(OH)D levels sufficient to begin high-dose vitamin D therapy. We believe there is a need for a new reinforcing education program among the pediatricians.Peer-review: Externally peer-reviewed."} +{"text": "The aim of this study was to investigate the effects of orally administered FPP\u00ae in either the prevention or treatment of a murine model of melanoma. The tumor growth was analyzed together with the blood levels of both oxidants (ROS) and anti-oxidants (SOD-1 and GSH). The results showed that FPP\u00ae controlled tumor growth, reducing the tumor mass of about three to seven times vs. untreated mice. The most significant effect was obtained with sublingual administration of FPP\u00ae close to the inoculation of melanoma. At the time of the sacrifice none of mice treated with FPP\u00ae had metastases and the subcutaneous tumors were significantly smaller and amelanotic, compared to untreated mice. Moreover, the FPP\u00ae anti-tumor effect was consistent with the decrease of total ROS levels and the increase in the blood levels of GSH and SOD-1. This study shows that a potent anti-oxidant treatment through FPP\u00ae may contribute to both preventing and inhibiting tumors growth.Prolonged oxidative stress may play a key role in tumor development. Antioxidant molecules are contained in many foods and seem to have a potential role in future anti-tumor strategies. Among the natural antioxidants the beneficial effect of Fermented Papaya (FPP Tumors are in fact a multifactorial pathology in which, in addition to environmental factors, some phenotypes common to all malignant tumors have been shown to have a role in tumor development and growth. These include inflammation, oxidative stress, hypoxia and microenvironmental acidity ,9,10,11.Our research group has helped to demonstrate that the tumor microenvironment is typically acidic ,16,17,18However, our study focused on the possibility of interfering with the initial accumulation of oxidative molecules and on the possibility of verifying the effect of oxidative molecules on tumor growth. In fact, the rapid turn-over of tumor cells leads to the accumulation of a large amount of ROS resulting in oxidative stress ,21,22. O\u00ae) (Immun\u2019\u00c2ge\u00ae) is known [The reduction of oxidative stress and therefore of the redox balance alteration are necessary conditions for the restoration of normal cellular functions. However, most of the current strategies in the treatment of tumors based mainly on surgery, chemotherapy and radiation therapy are unable or insufficient to achieve this goal because they result in numerous side effects, paradoxically due above all to the induction of oxidative stress and consequent cell damage . Cancer is known ,35,36,37Carica papaya Linn, native to Central America (southern Mexico) and South America and nowadays grown in most tropical countries. Traditionally used as a medicinal fruit, Carica papaya Linn is rich in polyphenols and has antioxidant [Papaya is the fruit of the ioxidant ,39, immuioxidant ,40 anti-ioxidant propertiioxidant ,43,44.\u00ae), a natural functional food able to support the natural antioxidant systems of the organism, produced with a technologically advanced and patented process, registered by the Japanese Patent Office on September 14th 2018 as ATP production promoter, mitochondrial activity promoter, and immunostimulant (Patent Number: 6401792) [\u00ae sublingually allows to achieve better results than the fresh fruit with a lower dose; in fact this route of administration proves to be faster and more effective, not going through the digestive system and the hepatic metabolism.The presence of beneficial compounds with anticancer properties known as \u03b1-tocopherol , flavono6401792) . This pr6401792) . In addi\u00ae), a natural functional food able to support the natural antioxidant systems of the organism, produced with a technologically advanced and patented process, registered by the Japanese Patent Office on September 14th 2018 as ATP production promoter, mitochondrial activity promoter, and immunostimulant (Patent Number: 6401792) [\u00ae sublingually allows to achieve better results than the fresh fruit with a lower dose; in fact this route of administration proves to be faster and more effective, not going through the digestive system and the hepatic metabolism.The presence of beneficial compounds with anticancer properties known as \u03b1-tocopherol , flavono6401792) . This pr6401792) . In addi\u00ae has proved to be an excellent antioxidant and an excellent nutraceutical adjuvant in combined therapies against several diseases, including tumors [\u00ae is not simply a free radical neutralizer, but a free radical regulator [\u00ae interferes with the production and accumulation of free radicals even if there is much more to be verified [According to recent studies, FPPg tumors ,51,52,53egulator and an iegulator ,55,56,57verified ,59.\u00ae can have an anti-aging effect [Clinical studies and studies on experimental animals have shown that FPPg effect but alsog effect ,54,61,62\u00ae in the prevention and treatment of melanoma were investigated, using an immunocompetent mouse model (C57/BL) inoculated with B16 melanoma cells. We have identified the optimal treatment conditions with FPP\u00ae with the final goal of evaluating its ability to keep tumor size under control and to study how oxidative stress directly affects tumor growth. So we measured the levels of oxidants and antioxidants (GSH and SOD-1) in mice\u2019s blood in relation to the size of the tumor in order to provide the proof of concept that FPP\u00ae may counteract tumor growth through inhibition of oxidative molecules production and accumulation, thus contributing to restore a redox balance in the whole body.In the present study the effects of orally administered FPP\u00ae and to evaluate specific effects, C57/BL mice were inoculated with an increasing number of B16F10 cells, starting from 100,000 cells up to 500,000 cells. \u00ae antitumor effect (tumor mass reaching a size of 197 \u00b1 104 mm3 and up to 2101 \u00b1 250 mm3 after 17 days). We thus used the model of 300,000 cells inoculation for the dose-response studies and the either 200,000 or 100,000 cells inoculations for studies on the therapeutic and the preventive effect of FPP\u00ae . , while the concentration of FPP\u00ae of 400 mg/Kg/mouse (group B3) resulted in a tumor reduction of approximately 2-fold (\u00ae administration by gavage was induced the most significant effect with the dose of 200 mg/Kg/mouse administered 7 days after the melanoma cells s.c. inoculation.To obtain the dose-response curve of FPPKg/mouse A or 400 Kg/mouse B. Moreov0.0001). B. Figure 0.0001) C. All in\u00ae administration in terms of effectiveness on melanoma growth. To this purpose the mice were treated one week after the s.c. inoculation of B16F10 cells with FPP\u00ae at a concentration of 200 mg/kg/mouse, every day without interruption until the mice sacrifice by either oral gavage and sublingual administration. Using oral gavage, FPP\u00ae was released directly into the stomach of mice through a gastric probe, while the sublingual route was the typical way of taking FPP\u00ae.On the basis of the above results we wanted to compare different route of FPP\u00ae by oral gavage and the mice in group B were treated with sublingual FPP\u00ae.Mice were thus divided into three treatment groups , 6 mice for each group. The control mice were treated exclusively with sterile water, the mice of group A were treated with FPP\u00ae was clearly detectable as early as 13 days after the s.c. inoculation of the cells (p < 0.0001). At that time the tumor of the treatment groups were five and seven times smaller , as compared to the control group (283 \u00b1 43 mm3) (The results in 43 mm3) A,C. \u00ae-treated animals were both significantly lower than the control group (751 \u00b1 151 mm3): 304 \u00b1 84 in group A (p < 0.04) and 256 \u00b1 84 mm3 in group B (p < 0.02) respectively was 2.2 times than that of group A and two times than that of group B C. To not\u00ae administered by both gavage and sublingual induced a highly significant reduction of tumor growth, slowing down the progression and suggesting therapeutic properties of FPP\u00ae. Treatment with sublingual FPP\u00ae was an ideal, simpler and less stressful route of administration for mice. Our results suggest that the administration of FPP\u00ae by \u201coral gavage\u201d may be stressful for mice, resulting in common complications and usually related to animal resistance to the procedure such as involuntary tracheal administration. Therefore sublingual administration could represent a less aggressive and more suitable alternative.This set of experiments showed that the daily treatment of mice with FPP\u00ae on tumor growth, we started the animal treatment by sublingual administration either 21 days before (group A) or 14 days before (group B) or 3 days before (group C) the s.c. melanoma cells inoculation. Briefly, 100000 B16F10 melanoma cells/mouse were inoculated, and the mice were treated with FPP\u00ae at the concentration of 200 mg/Kg/mouse each day sublingually without interruption until sacrifice. Group A was treated with FPP\u00ae for 44 consecutive days, groups B for 37 days and group C for 26 days respectively.In order to evaluate the combined preventive and therapeutic effects of FPP3). At 15 days after melanoma s.c. inoculation the tumors of the controls reached a size of 267 \u00b1 55 mm3: 4-fold greater than those of group A (64 \u00b1 26 mm3), 12-fold greater than group B and 165-fold greater of group C (3) was 2.5, 5 and 29 times higher as compared to groups A , B and C respectively (\u00ae administration was in group C (FPP\u00ae started 3 days before inoculation), with a tumor of size 250 \u00b1 78 mm3 (p < 0.0001), 6 times lower than the control (1462 \u00b1 213 mm3) and B were about two and three times lower than the control A,C. Eighectively B,C. At t213 mm3) C. The tu control C.\u00ae started before the B16F10 cell inoculation had very powerful preventive and therapeutic effects, significantly reducing the growth of melanoma in C57/BL mice (p < 0.0001). The greatest effect was achieved when treatment with FPP\u00ae started 3 days before the inoculation of B16F10 cells . In fact, a prolonged sublingual treatment (groups A and B) was more stressful for mice compared to a treatment for a shorter time (group C). At the time of sacrifice none of the mice had either metastasis or micro-metastases. In addition, the tumor removal at mice sacrifice revealed that the melanomas of mice belonging to groups B and C were completely pigment-free (amelanotic) D, that i\u00ae we analyzed the redox balance in treated vs. untreated mice, To this purpose we measured the total ROS levels in the blood of untreated (control) mice and those treated daily with FPP\u00ae starting at either 21 or 14 or 3 days before the inoculation, up to the sacrifice . The analysis of the total ROS was done with a colorimetric assay on the red blood cells of the mice taken before the sacrifice.In order to evaluate the in vivo mechanism of action of FPP\u00ae induced a highly significant decrease (p < 0.0001) in the blood ROS levels, directly related to the size of the tumor , higher levels of ROS (8992 \u00b1 1225 a.u.) were measured: the values proven to be either 1.9-, 2.7- or 4.7-fold higher as compared to groups A , B and C respectively. The lowest total ROS levels were therefore observed in mice in group C, where tumor growth was the lowest actually and the enzyme superoxide dismutase-1 (SOD-1). This set of experiments was aimed at establishing the relationship between blood levels of GSH and SOD-1 as compared to the tumor size at the end of FPP treatment.It is known that antioxidant substances, including FPP\u00ae started 3 days before the inoculation of B16F10 and continued for 26 consecutive days, with an average value of 19.5 \u00b1 1.1 \u03bcM (p < 0.0001), higher than 12.1 times compared to the control group (1.6 \u00b1 0.1 \u03bcM), 6 and 5.1 times higher as compared to A (3.3 \u00b1 0.8 \u03bcM) and B (3.8 \u00b1 0.6 \u03bcM) groups, respectively , group A (0.9 \u00b1 0.1 U/mL) and group B B. Notabl\u00ae anti-tumor effect was consistent with both the decrease of hydroxyl radicals levels and the increases of superoxide-dismutase (SOD-1) and glutathione (GSH) antioxidants blood levels. Strongly suggesting that the FPP\u00ae antitumor effect passed through a triggering of the natural anti-oxidant mechanisms.Therefore FPP\u00ae antitumor effect was obtained with a shorter treatment, indeed sadly the positive effect of FPP\u00ae for a longer time was overcome by the stressing daily administration to the mice, inasmuch as also the sublingual administration in experimental animals passed through a non-voluntary procedure being the animals obliged to open the mouth.Again the experiments were stopped at the 23th day for ethical reasons having the tumors of control mice reached limit sizes. In conclusion, the best FPPA growing body of evidence is demonstrating that tumor growth and progression highly depend on tumor micro-environment that makes hard for either normal or more differentiated cells to survive. In short, the malignant tumor forms and spreads thanks to a progressive selection of cells, already present in our body, which are the most suitable to live in an environment lacking oxygen and nutrients, and last but not least with acidic pH conditions that do not allow the survival of normal cells.\u00ae) was already well known [\u00ae was very low or limited to in vitro investigations. In previous studies we have shown that a promising antitumor approach is the use of antacid substances, such as proton pump inhibitors (PPI) ,5,19,20 ll known ,35,36,37ll known ,54,55,61ll known ,63. Befo\u00ae in either the prevention or treatment of melanoma. We first showed that optimal effect of FPP\u00ae treatment on tumor growth was at a dose of 200 mg/Kg per day, treatment starting at 7 days after subcutaneous inoculation of B16F10 melanoma cells. With this experimental approach we obtained a significant reduction of the tumor mass as compared to untreated mice (p < 0.0001). As often has been shown in experimental oncology we did not obtain any increase in the antitumor effect of the FPP\u00ae treatment while doubling the dose (400 mg/kg/day), comparably to a previous study we performed with a potent buffer [For this purpose, in this study we used a model of immunocompetent C57/BL mice, inoculated with melanoma B16, to demonstrate the effects of FPP\u00ae administered through both gavage and sublingual routes always induced a significant reduction of the tumor growth (p < 0.03). The antitumor effect of FPP\u00ae was evident up to 13 days after melanoma cell inoculation, with only 6 consecutive days of mice treatment. In this case the tumor of the mice treated with FPP\u00ae grew up to seven times less than the control (p < 0.0001). However, the FPP\u00ae anti-tumor effect was clearly dependent on the duration of the treatment being the shortest treatment always the most effective. This result might be explained by the invasive and non-voluntary procedure of forcing the mice to have FPP\u00ae orally each day.The treatment of mice with FPP\u00ae represented the best route of administration, simpler and less stressful for mice as compared to the oral \"gavage\" treatment, thus supporting previous studies [Therefore, it is important to consider the methods of administration, as invasive procedures may induce a series of important complications and reactions to the animal that often compromise the effectiveness of the therapy, as it has been clearly shown for the oral gavage route of administration ,65. This studies .\u00ae is able to significantly reduce tumor growth. The most significant combined preventive and therapeutic effects were obtained sublingually when FPP\u00ae treatment started 3 days before the melanoma B16 inoculation . Further experiments have shown that FPP\u00ae had metastases and the subcutaneous tumors were significantly smaller than untreated mice and were amelanotic. These results suggest that FPP\u00ae not only drastically reduced melanoma growth, but also controlled tumor progression by inhibiting metastatic development and inducing the growth of amelanotic tumors. Notably, the amelanotic turning is considered from a clinical point of view the first response of a melanoma to a pharmacological treatment, further supporting a direct effect of FPP\u00ae on the progression of a melanoma as aggressive as B16F10.Moreover, at the time of the sacrifice none of the mice treated with FPP\u00ae and to assess the ability to interfere with the accumulation of oxidizing substances, we measured blood levels of total ROS, an example of oxidant molecule and of GSH and SOD-1, examples of natural anti-oxidant molecules, in untreated mice and mice treated with FPP\u00ae.In order to better understand the mechanism/s underlying the antitumor effect of FPP\u00ae: in fact, treating mice every day with FPP\u00ae at the concentration of 200 mg/Kg/mouse, the total ROS levels in the blood decreased (p < 0.0001) in a directly proportional way to the size of the tumor, while the levels of plasma GSH and SOD-1 increased (p < 0.0001) inversely to the size of the tumor. Our results suggest that the ROS scavenging action of FPP\u00ae also passes through the stimulation of the body\u2019s anti-oxidant systems. The accumulation of toxic radicals during the tumor growth may markedly inhibit the immune reaction against tumor or even entirely blocks it. We provide in vivo evidence that an anti-oxidant effect of FPP\u00ae may underlay an indirect immune stimulation. So the FPP\u00ae immune stimulation may well be mediated by the antioxidant effect [The results showed that the mechanism of action of FPP\u00ae was strictly related to the decrease of total ROS levels in the blood and to the increase in the plasma levels of antioxidants, such as free GSH and SOD-1. Small amounts of ROS are tolerated and are inactivated by enzymatic systems such as glutathione and other antioxidants, while an excess of ROS production by the tumor cells induces a pathological condition known as \u201coxidative stress\u201d. In this condition the enzymatic systems and the intracellular antioxidants are no longer able to counteract the overproduction of free radicals, with consequent cellular damage that can irreversibly compromise cell function, contributing to tumor progression ,11,23,24t effect . An indit effect ,67. A co\u00ae may well be considered a new element to introduce in an integrative approach in this sense. The other hypothesis is really fascinating and it was proposed from two different angles: one is the microevolutionary development of cancers due to the hostile microenvironment [\u00ae may thus represent a new and effective approach to reduce the \u201chostility\u201d of the tumor microenvironment in possibly tuning a re-differentiation of cancer cells. The results of this study give support to important new view points and hypothesis on cancer. One interesting hypothesis is that of a the implementation of a buffer therapy and a buffer diet in cancer patients , and FPPironment ; the othironment . The pro2. Tumor cells were negative for mycoplasma contamination as routinely tested by PCR . Metastatic melanoma B16F10 cell line was purchased from ATCC . The cells were maintained in RPMI culture medium with 10% of FCS and antibiotics, at 37 \u00b0C in humidified 5% CO\u00ae (Immun\u2019\u00c2ge\u00ae) used in our experiments was registered with patent number 6401792 from the Osato Research Institute . Depending on the experiment FPP\u00ae was administered by oral gavage or sublingually dissolved in sterile water at concentration of 200 or 400 mg/kg/mouse every day without interruption. Treatment of mice with FPP\u00ae was started before or after the B16F10 melanoma cells inoculation and continued until sacrifice of the mice.FPPAll the studies were approved by the ethical committee of the Italian National Institute of Health (Rome) and were conducted in accordance with the current Italian Law (Law 26/2014), authorization n\u00b0 792/2017-PR, that regulates experiments in laboratory animals. CB57/BL female mice between 16 and 20 g (4 weeks of age) were purchased from Charles River Laboratories Italia s.r.l., , and housed in the animal facility of the Italian National Institute of Health. Mice had 10 and 14 h periods of light and darkness respectively, were housed in a different number of animal cages, depending on the experiment, with ad libitum mice chow I) and water provided through a bottle.3 accordingly to the guidelines for a correct laboratory practice and signs of poor quality of life.Depending on the experiment between 100,000 and 300,000 B16F10 melanoma cells were subcutaneously injected in the right flank. Tumors were calipered twice a week and mice were weighted once a week. Mice were checked twice a week by a veterinarian responsible for animal welfare monitoring for signs of sufferance such as weight loss, decreased water and food consumption, poor hair coat, decreased activity levels and tumor ulcerations. Endpoints were maximum tumor volume of 2400 mmIn the first experiment mice were divided into four groups inoculated with an increasing number of B16F10 cells, starting from 100,000 cells up to 500,000 cells to monitor the growth of melanoma over time. Each group consisted of 5 animals for statistical significance. Mice inoculated with 500,000 B16F10 cells were sacrificed after 17 days from inoculation because the tumor had reached too large a size, while the other mice were sacrificed after 21 days from the inoculation of the cells.\u00ae at the concentration of 200 mg/Kg/mouse and 400 mg/Kg/mouse , respectively 1 day before the inoculation of the cells (groups A1 and B1), 3 (groups A2 and B2) and 7 (groups A3 and B3) days after the inoculation of the cells. FPP\u00ae treatment was performed every day without interruption until animal sacrifice after 21 days from the inoculation of the cells, and the experimental scheme is shown in the In the second experiment mice were divided into seven groups of five animals inoculated with 300,000 B16F10 cells and treated by oral gavage with FPP\u00ae at the concentration of 200 mg/Kg/mouse by oral gavage (group A) and sublingual (group B). FPP\u00ae was performed until animal sacrifice after 20 days from the inoculation of the cells, and the experimental scheme is shown in the In the third experiment mice were divided into three groups of six animals inoculated with 200,000 B16F10 cells and treated starting 7 days after cell inoculation every day without interruption with FPP\u00ae at the concentration of 200 mg/Kg/mouse every day without interruption until the sacrifice of the animals. Treatment with FPP\u00ae started 21 days before (group A), 14 days before (group B) and 3 days before (group C) cell inoculation. The experimental scheme is shown in the In the fourth experiment mice were divided into four groups of 10 animals inoculated with 100000 B16F10 cells and treated only sublingually with FPPAnalysis of the total ROS levels was performed in preparations of the mice red blood cells obtained before the sacrifice. To this purpose a Total Reactive Oxygen Species (ROS) Assay Kit 520 nm was exploited. The cells were resuspended with 100 \u03bcL of 1\u00d7 ROS Assay Stain and incubated for 60 min in a 37\u00b0C incubator with 5% CO2. The cells were treated with the desired reagents to induce production of ROS and analyzed on a microplate reader off the 488 nm (blue laser) in the FITC channel. g for 20 min, plasma was collected and immediately analyzed. The samples were incubated for 20 min at room temperature after the addition of the sample and substrate and chromogenic detection reagent. The optical densities were recorded at 450 nm.Detection and quantification of superoxide dismutase activity was performed in preparations of the mice plasma obtained before the sacrifice. To this purpose a colorimetric activity assay, The Superoxide Dismutase Activity kit (ThermoFisher). In order to obtain plasma samples, EDTA-treated blood from C57/BL mice injected with murine melanoma were centrifuged at 400g for 20 min, plasma was collected and immediately analyzed. The samples were incubated for 20 min at room temperature after the addition of the detection reagent and reaction mixture. The optical densities were recorded at 405 nm. Detection and quantification of glutathione activity was performed in preparations of the mice plasma before the sacrifice. To this purpose a colorimetric activity assay, Glutathione Colorimetric Detection Kit (Thermo Fisher). In order to obtain plasma samples, EDTA-treated blood from C57/BL mice injected with murine melanoma were centrifuged at 400p < 0.05.Results in the text are expressed as means \u00b1 standard error (SE), calculated using the GraphPad Prism software San Diego, CA, USA. The statistical analysis was done with one-way ANOVA Bonferroni. Statistical significance was set at \u00ae in new anticancer strategies, in particular in the treatment of melanoma both in neoadjuvant regimen and after surgical treatment. FPP\u00ae may well implement current anti-tumor strategies but it may also be tested in combination with antacid therapies based on anti-acidic or alkaline substances [Early diagnosis and secondary prevention are today the most effective therapeutic strategies in the treatment of melanoma, since the existing therapies are not very effective in favoring appreciable survival rates . The resbstances ,5,19,20.\u00ae may be very promising in both preventing tumors and in implementing current anti-cancer strategies, most of all in combination with chemotherapy that is known to increase the levels of oxidants production and release by our body.This study represents a milestone pre-clinical evidence showing that a potent anti-oxidant treatment through FPP"} +{"text": "Serologic detection of Zika virus (ZIKV) infections is challenging because of antigenic similarities among flaviviruses.To evaluate the sensitivity and specificity of commercial ZIKV IgM and IgG enzyme-linked immunoassay (ELISA) kits.We used sera from febrile patients with RT-PCR-confirmed ZIKV infection to determine sensitivity and sera from RT-PCR-confirmed dengue cases and blood donors, both of which were collected before ZIKV epidemics in Brazil to determine specificity.The ZIKV IgM-ELISA positivity among RT-PCR ZIKV confirmed cases was 0.0% (0/14) and 12.5% (1/8) for acute- and convalescent-phase sera, respectively, while its specificity was 100.0% (58/58) and 98.3% (58/59) for acute- and convalescent-phase sera of dengue patients, and 100.0% (23/23) for blood donors. The ZIKV IgG-ELISA sensitivity was 100.0% (6/6) on convalescent-phase sera from RT-PCR confirmed ZIKV patients, while its specificity was 27.3% (15/55) on convalescent-phase sera from dengue patients and 45.0% (9/20) on blood donors\u2019 sera. The ZIKV IgG-ELISA specificity among dengue confirmed cases was much greater among patients with primary dengue , compared to secondary dengue .In a setting of endemic dengue transmission, the ZIKV IgM-ELISA had high specificity, but poor sensitivity. In contrast, the ZIKV IgG-ELISA showed low specificity, particularly for patients previously exposed to dengue infections. This suggests that this ZIKV IgM-ELISA is not useful in confirming a diagnosis of ZIKV infection in suspected patients, whereas the IgG-ELISA is more suitable for ZIKV diagnosis among travelers, who reside in areas free of flavivirus transmission, rather than for serosurveys in dengue-endemic areas. Zika virus (ZIKV) is an emerging mosquito-borne flavivirus. Majority of human infections evolve asymptomatically or cause mild and self-limited clinical manifestations. Non-specific signs and symptoms may include exanthema, low-grade fever, conjunctivitis, and arthralgia \u20133. HowevDue to the similarity in the initial clinical presentation between ZIKV infections and other infectious diseases, especially with other arboviral diseases that usually co-occur in tropical and sub-tropical regions, such as dengue (DENV) and chikungunya (CHIKV), clinical diagnosis is challenging, and often depends on laboratory confirmation. However, ZIKV laboratory diagnosis is difficult because viremia tends to be low . In addiA correct differential diagnosis between ZIKV and other arboviral infections is critical to alert patients and clinicians for potentially evolving complications, as well as to guide appropriate supportive care (i.e. fluid replacement for severe dengue patients). In addition, an accurate ZIKV laboratory diagnosis can inform surveillance activities, which include detection and monitoring of virus circulation, estimation of disease burden, guiding preventive and control actions to interrupt virus transmission, and informing pregnant women on the risk of a gestational infection.In this study, we evaluated the diagnostic sensitivity of commercial enzyme-linked immunoassays (ELISAs) for detection of ZIKV IgM and IgG antibodies in sera of febrile patients with ZIKV infections. We also assessed the specificity of these kits in sera of both dengue-confirmed patients and blood donors.This study was conducted and reported according to the STARD (Standards for Reporting of Diagnostic Accuracy) guideline . The perMost of the serum samples used for our diagnostic test evaluation were obtained from an acute febrile illness (AFI) enhanced surveillance study that we conducted in a public emergency health unit of Salvador, between January 2009 and August 2016. Details were previously described . BrieflyWe collected blood samples from participants at study enrollment (acute-phase sample) and\u2009\u2265\u200915\u00a0days post-enrollment . Sera were stored in aliquots at \u2212\u200920\u00a0\u00b0C and\u2009\u2212\u200970\u00a0\u00b0C for serologic and molecular testing, respectively. Acute-phase samples were tested for DENV by NS1- and IgM-ELISA and convalescent-phase samples by IgM-ELISA . Between 2009 and 2014, acute-phase samples that yielded a positive result in either ELISA underwent RNA extraction and RT-PCR for dengue typing and CHIKAdditionally, we obtained sera from presumably health volunteer blood donors at the State Blood Donation Center located in Salvador during December 2013. Collection of blood was performed after the regular screening process . Blood donors\u2019 sera were stored in \u2212\u200920\u00b0 and subsequently tested for DENV with the same NS1-, IgM- and IgG-ELISA kits.To determine the sensitivity of the ZIKV IgM- and IgG-ELISA , we tested the available sera for the 14 patients enrolled during the surveillance study who had a ZIKV infection confirmed by RT-PCR . To determine the specificity of the ZIKV IgM- and IgG-ELISA in a group of confirmed dengue patients, we selected from RT-PCR-positive dengue cases detected during the AFI surveillance study the first 20 cases positive for each DENV serotype. We selected the first 20 confirmed cases of each DENV type to ensure that there was no recognized ZIKV transmission in Salvador at the time, such that there was limited chance of a prior ZIKV infection. The selected DENV1-confirmed patients were detected from April 2009 to May 2011; the DENV2 from February 2009 to February 2010; and DENV4 from October 2010 to April 2011. DENV-3 patients were not selected for testing because we confirmed only a very small number of such cases during the study period. To augment the confidence that these DENV patients did not have a concomitant ZIKV infection, we also performed ZIKV RT-PCR on their acute-phase serum samples. We also determined the specificity of the ZIKV IgM- and IgG-ELISA in randomly selected sera from 23 blood donors. The initially planned number of samples from DENV-confirmed patients and blood donors was defined to provide 95% confidence for an estimated specificity of 95% and a precision of ~\u20093.5%.The ZIKV IgM-ELISA (El 2668\u20139601\u00a0M) and ZIKV IgG-ELISA (El 2668\u20139601\u00a0G) by Euroimmun were performed according to the manufacturer\u2019s instructions for semiquantitative interpretations. Although assay performers were not blinded to group identification of tested samples , reading was performed by automated microplate reader . Positive and negative controls were provided by the test\u2019s manufacturer.The AFI patients with a RT-PCR-based diagnosis of ZIKV or DENV were characterized according to demographic characteristics (sex and age) and clinical manifestations. We calculated the accuracy of ZIKV IgM- and IgG-ELISA tests, with respective 95% confidence intervals, using the samples from RT-PCR-confirmed cases of ZIKV infection as the reference group of positives for sensitivity estimation, and the samples from RT-PCR-confirmed dengue cases, as well as blood donors as reference groups of negatives for specificity estimation. We also calculated the specificity among dengue-confirmed cases stratified by the infecting DENV type and by the type of infection (primary versus secondary). Samples with equivocal ELISA results were excluded from the accuracy analysis.The 14 RT-PCR-confirmed Zika cases had a median age of 22.5\u00a0years and 42.9% were male. The most frequent clinical manifestations were headache (92.9%), myalgia (85.7%), retro-orbital pain (71.4%), rash (71.4%), and pruritus (71.4%) were positive, 4 (30.8%) negative, and 3 (23.1%) equivocal (Table\u00a0P\u2009=\u20090.04).Overall, the specificity of the ZIKV IgG-ELISA for the 75 samples with valid results was 32.0%. The specificity for convalescent-phase samples of dengue patients was 27.3%, ranging for 5.9% in DENV-4 infections to 45.0% in DENV-1 infections . As the time elapsed between Zika symptoms onset and acute-phase serum collection was short (median 2.5\u00a0days), a low IgM detection in the acute-phase sample was expected. However, even for the convalescent-phase serum samples, collected on average 3\u20136\u00a0weeks after disease onset, the ZIKV IgM-ELISA yielded a low sensitivity. This low performance was also reported for RT-PCR-confirmed Zika samples from residents from other ZIKV- and DENV-endemic areas , where Euroimmun Zika IgM-ELISA detected 6 of the 19 evaluated samples collected \u22651\u00a0days post onset of symptoms (dpos) and 5 of 12 samples collected \u22656 dpos, yielding sensitivities of 31.6 and 41.7%, respectively [Although recent studies suggest a high specificity of this Zika IgG-ELISA against dengue infections in returning travelers \u201322, we hThe main limitation of our study was the small number of ZIKV-confirmed cases. Technical difficulties in ZIKV diagnosis, especially due to the low viremia during infection and the cross-reactions with other circulating arboviruses in tropical and subtropical regions, has hampered composing large subsets of Zika cases\u2019 samples to be used in diagnostic test accuracy studies. As another limitation, we did not perform ZIKV RT-PCR on the acute-phase samples of all dengue cases to ensure the absence of co-infection. Even though, sufficient serum was available to perform RT-PCR in 47 of the 60 dengue cases, and none of them yielded a positive result. Considering that our dengue case selection specifically included patients with infections that occurred prior to 2012, it is unlikely that they had a dengue and Zika co-infection or a prior ZIKV infection, because ZIKV introduction into Brazil was estimated to have occurred between late 2012 and early 2013 \u201325. In aStrengths of our study included the use of RT-PCR as a confirmation criterion for both Zika and dengue cases because as ZIKV and DENV transmission are endemic in our setting, a molecular diagnosis ensures a more accurate distinction between these flaviviruses compared to serologic diagnosis. In addition, the availability of paired sera provided a unique opportunity to evaluate the performance of commercial ZIKV IgM- and IgG-ELISAs in detection of antibodies in acute- and convalescent-phase samples.In conclusion, our study revealed a high specificity but low sensitivity of the Euroimmun ZIKV IgM-ELISA in an endemic region for both dengue and Zika, as well as a high specificity of the Euroimmun ZIKV IgG-ELISA in DENV primary infections contrasting with low specificity in DENV secondary infections. This suggests that this IgG-ELISA may be more suitable for Zika diagnosis in travelers returning from non-endemic areas than for serosurveys in endemic areas. Further studies with larger well-characterized samples are needed to assess the diagnostic accuracy not only of this test, but also of several others serological ZIKV assays."} +{"text": "Finally, applications of the W-CDs in fabricating single-component-based W-LEDs using commercially available UV chips were attempted and shown to exhibit satisfactory performances including high white light-emitting purity, high color rendering index (CRI), and tunable correlated color temperature (CCT), thus rendering great promise for W-CDs in the field of white lighting.Large-scale applications of conventional rare-earth phosphors in white light-emitting diodes (W-LEDs) are restricted by the non-renewable raw material sources and high energy consumption during the production process. Recently, carbon dots (CDs) have been proposed as promising alternatives to rare-earth phosphors and present bright prospects in white lighting. However, the use of CDs in W-LEDs still has two major obstacles, i.e., solid-state quenching and lack of single-component white emissive products. In this work, a facile, rapid, and scalable method for the preparation of solid-state white emissive CDs (W-CDs) is reported via microwave-irradiation heating of L-aspartic acid (AA) in the presence of ammonia. The W-CDs exhibit blue photoluminescence (PL) in dilute aqueous dispersion and their emission spectra gradually broaden (emerging new emissions at orange-yellow regions) with concentration increases. Interestingly, the W-CDs powder displays a very broad PL spectrum covering nearly the whole visible-light region under ultraviolet (UV) excitation, which is responsible for the observed white emission. Further studies revealed that the self-quenching-resistance feature of the W-CDs is probably due to a covering of polymer-like structures on their surface, thus avoiding the close contact of nanoparticles with each other. PL emission of the W-CDs is reasonably ascribed to a cross-linked enhanced effect (CEE) of the sub-fluorophores contained in the material (e.g., \u2013NH The ever-growing interest and significant progress of carbon-based nanomaterials have witnessed broad prospects in the fields of sensing, catalysis, biomedicine, and optoelectronic devices ,2,3. As 2 and C=O) containing small molecules as carbon sources via polymerization and carbonization processes .,53.\u22122, ld W-LEDs e. OveralIn summary, a facile, rapid, and scalable method for the synthesis of solid-state white emissive CDs is reported in this study. The as-prepared W-CDs exhibit blue PL in dilute aqueous dispersion but unique white light emission in the solid state under UV excitation. Furthermore, the possible chemical structure, the formation process, and the PL mechanism of the W-CDs in dispersion and solid state were discussed. Thanks to the unique optical properties, W-CDs were employed to fabricate single-component-based W-LEDs by using commercially available UV chips which exhibited satisfactory performances, including high white light-emitting purity, high CRI, and tunable CCT, rendering great promise for the W-CDs in the field of white lighting. Finally, it is necessary to point out that the PL QY of the W-CDs powder is still relatively low in comparison to the traditional rare-earth phosphors. The following work should be focused on improving PL QYs of white solid-state emissive CDs and such work is now in progress in our laboratory."} +{"text": "Despite women with criminal justice involvement reporting routine Papanicolaou (Pap) testing, significant disparities in cervical cancer outcomes exist when compared to women without criminal justice involvement. A possible reason for the discrepancy is that this group of women may be misreporting Pap testing. The objective of this study was to validate self-reported cervical cancer screening among women leaving jails.We used three methods to validate self-reported cervical cancer screening for women recently released from jail: 1) Medical record review; 2) Semi-structured interview; 3) Pap test knowledge survey. After validating women\u2019s self-reported Pap tests with a review of their medical records, we scored interviews for Pap test recall, and used Pap test knowledge survey scores to compare scores between women who accurately reported Pap tests vs. those who did not.Sixty-one percent (N = 14/23) self-reported cervical cancer screenings were accurate per medical record review. Comparing participants who did and did not accurately self-report a Pap test, we found a significant difference in Pap test recall scores and Pap test knowledge scores .Self-report of cervical cancer screening was more likely to be accurate if a woman\u2019s Pap test knowledge was high. Clinicians might take extra care in describing screening and distinguishing between Pap tests and pelvic exams to support the cervical health of women with lower knowledge. Cervical cancer was once a leading cause of death among women of childbearing age. Over the last 40 years, interventions such as the Papanicolaou (Pap) test for cervical screening, human papillomavirus (HPV) vaccine, and access to health care services through increased insurance coverage have led to the decline of cervical cancer . These iRecall bias can challenge the validity of a participant\u2019s self-reported Pap test. Such recall may present other challenges, as well. A pelvic exam is performed by a healthcare professional to examine reproductive organs. While often including a Pap test, a pelvic exam may be performed for many reasons unrelated to cervical cancer screening. Limited cervical health literacy may lead women to mistakenly report a pelvic exam as a Pap test . CervicaSelf-reports of medical services are often inadequate and downward adjustment is suggested to correct for overestimation \u201320. Whilfour sources of data were compared, to include not only patient self-report and medical record review, but also assessments of patient recall and knowledge. The first source was the self-report of a last Pap test from participants\u2019 post-intervention follow-up surveys at one, two, and three years post-intervention. The second source was the medical records of participants who both self-reported a Pap test post-intervention and gave consent for the release of their medical records to the study team. To understand more about how and why self-reporting does not always match medical records, a tertiary source was collected: semi-structured interviews asking about a participants\u2019 last Pap test. The fourth data source was a participant\u2019s Pap test knowledge score, a composite score from 15 true or false questions on the same annual survey that a participant self-reported a Pap test.We used a validation study research model, which is most commonly a comparison of patient self-report with medical record review for a given procedure, with most studies suggesting that there are limitations to self-report alone, based on patient recall and knowledge. Thus, in order to complete this validation study, There were 182 SHE intervention completers in the parent study . This toTherefore, participants were selected from 185 SHE invention completers who reported a Pap test post-intervention in the one, two, or three-year follow-up surveys. Of the 96 participants that met these criteria, 23 participants signed a release of medical information and 16 participated in a semi-structured interview Did you have a Pap test in the last year? and 2) When was your last Pap test? The second question allowed participants to identify how many years ago their last Pap test was, so was an approximation and not an exact date. If the answer to the first question was \u201cYes\u201d or if the answer to the second question was within the last three years, the participant was considered to have an up-to-date Pap test.medical records to check for accuracy of self-report, participants who self-reported an up-to-date Pap test were contacted at their last known contact number to see if they would sign a release of medical information. Signed releases were faxed to the medical institution identified by participants as the place they got their last Pap test. Participants\u2019 self-reporting of having a Pap test was compared to medical records. Notations of \u201cPap\u201d or \u201cCytology\u2014Pap\u201d in the medical records, within two years of the self-reported Pap test, were considered to have had a Pap test. This two year buffer was used to account for difficulties in recalling the exact year the Pap test took place.To obtain Semi-structured interviews for Pap test recall were conducted to distinguish whether participants had a pelvic exam rather than a Pap test .p<0.05) and more likely to have completed a high school education or more (p<0.05) compared to the rest of the parent study participants.Participants in the parent SHE study and those in the validation study were compared based on sociodemographic characteristics. At baseline, participants in the validation study (N = 23) were similar with no statistically significant differences on employment prior to incarceration, homelessness, insurance status, having a primary care doctor, having a medical home, or having an up-to-date self-reported Pap test, compared to the rest of the participants in the parent study (N = 162). Participants in the validation study were more likely to be Black confirmed Pap tests. Nine (39.1%) records either had no mention of Pap tests or had Pap tests that were significantly older than those self-reported. The results of the medical record retrieval and the interviews are presented in p<0.01). The average Pap test knowledge score was 13.50 for a participant who accurately self-reported a Pap test and 12.22 for a participant who did not accurately self-report a Pap test .Semi-structured interviews were completed with the 16 of the participants that could be reached and consented to an interview. The interviews took an average of five minutes. Comparisons of Pap test knowledge and interview scores between each group (those that accurately self-reported a Pap test and those that did not accurately self-report a Pap test) are presented in While many participants scored high on their semi-structured interview, recalling a Pap test was challenging for the four that did not accurately self-report one. These four all received a score of 0 for their interview content analysis. One belief that led to the incorrect self-report by each of these participants was the idea that if a speculum was used, they had received a Pap test. The medical records from three incorrect self-report participants\u2014two who were interviewed and one who was not\u2014showed that they did have various pelvic-related care: two had an STI screening and one had urology care. These participants did not understand the difference between a Pap test and other types of gynecological medical care or screenings.These findings show that the accuracy of a cervical cancer screening self-report is related to knowledge of the procedure. Overall, 60.9% of the 23 medical records confirmed accurate self-report of Pap tests. This is lower than the 85.6% validation found between self-report and administrative records of adults recently released from prison in another study . HoweverThose who inaccurately self-reported a Pap test equated pelvic exams with receipt of a Pap test. The findings of this study are consistent with another study of incarcerated women in the Kansas City area that found Pap tests were often thought of as an all-inclusive screening for gynecological and pelvic health issues. Pelvic exam findings such as abnormal bleeding, STIs, bacterial vaginosis, yeast infections, and ovarian cysts were considered \u201cabnormal Pap test results\u201d by many of the women in interviews .Pap test knowledge was associated with accurate Pap test self-report. Even with adequate overall health literacy, cervical health knowledge can vary. Although one study reported that 91.1% of incarcerated women had an adequate health literacy score, many were not able to accurately describe the purpose of the Pap test when probed qualitatively [The primary limitation of our validation study was the small sample size. Signing a release of medical information was not required to be part of the study. Had these releases been routinely collected as participants completed the intervention, more robust data on the accuracy of self-reports would have been possible. Women leaving jails often have inconsistent contact information, which can make follow-up and further data collection difficult. This reality may have resulted in a low response rate when medical record releases and interviews were requested. Another limitation is that medical records were only collected from the institution that a participant identified as the place she got her last Pap test. If a participant received an up-to-date Pap test at a location she did not identify, this could not be validated.This study supports interventions that aim to increase cervical health knowledge in vulnerable populations as a method to increase cancer screenings. If Pap test knowledge can be increased, the likelihood of correctly self-reporting a Pap test is higher. Increased recall of a Pap test may in turn result in better adherence to recommended life-long screening, reducing the disparity of cervical cancer in incarcerated women and other vulnerable populations.In conclusion, the self-reporting of cervical cancer screening is more likely to be accurate in justice-involved women if a person\u2019s knowledge of a Pap tests and Pap test procedures are high. Pelvic exams and STI tests are often mistaken for Pap tests when knowledge of a Pap test is low. Clinicians may work harder to provide accurate information and assess knowledge of procedures during gynecological exams, in order to support the cervical health of vulnerable women.S1 Fig(DOCX)Click here for additional data file.S1 Text(DOCX)Click here for additional data file.S2 Text(DOCX)Click here for additional data file."} +{"text": "Autophagy is an essential physiological process that maintains cellular homeostasis by eliminating harmful protein aggregates, damaged organelles and certain pathogens through lysosomal degradation. During autophagy specialized structures, known as autophagosomes are formed that recruit the cargo through autophagy receptors, and deliver it to lysosomes. Optineurin (Optn) is an autophagy receptor that mediates cargo selective autophagy. Recently, we have identified a novel function of Optn that promotes autophagosome formation during non-selective autophagy. Optn-deficient cells show reduced formation of autophagosomal protein LC3-II and lower number of autophagosomes as well as autolysosomes. Interestingly, formation of phagophores is increased in Optn-deficient cells. This suggests that Optn promotes autophagosome formation by potentiating LC3-II production and phagophore maturation. Phosphorylation of Optn at Ser-177 is required for promoting autophagosome formation. Here, we discuss various aspects of the role of Optn in the formation of autophagosomes and Atg16L1-positive vesicles. We also discuss the potential role of Rab1a-Optn interaction. Autophagy is a cellular waste disposal process that removes damaged organelles, aggregated and damaged proteins and invading pathogens, by delivering them to lysosomes where degradation takes place ,2. An opOptn-deficient mouse embryonic fibroblasts (MEFs) showed reduced formation of LC3-II and lower number of autophagosomes under basal condition and also upon induction of autophagy by starvation. However, the number of phagophores was not reduced but increased in Optn-deficient cells . This clSalmonella [TBK1 mediated phosphorylation of OPTN at Ser-177 residue has been shown to enhance its LC3-II binding and promote autophagy-mediated clearance of cytosolic lmonella . Previoulmonella . Thus, wOptn has a role in various membrane vesicle trafficking pathways, in addition to its role in autophagy . TherefoRecently Rab1a has been shown to interact with Optn and this interaction is suggested to be required for autophagosome formation . HoweverReduced number and size of Atg16L1-positive vesicles in Optn-deficient cells was not due to lower level of Atg16L1 protein. In fact the level of Atg16L1 in Optn-deficient cells was significantly higher during starvation-induced autophagy . This suCertain mutations in OPTN are associated with glaucoma, an eye disease that causes irreversible blindness, and amyotrophic lateral sclerosis (ALS), a motor neuron disease ,18. An AOverall, our studies have identified a new function of the autophagy receptor Optn in autophagosome formation that is required for efficient LC3-II production and phagophore maturation during basal and starvation-induced autophagy; this may have implications for ALS pathogenesis. This work has also revealed an unexpected role of Optn in the formation of Atg16L1-positive vesicles."} +{"text": "Bone Research 10.1038/boneres.2017.44, published online 26 September 2017Correction to: During a reread of our article previously published in Bone Research, we regrettably found that the second lane of originally published Fig."} +{"text": "Dietary patterns (DPs) are known to be tied to lifestyle behaviors. Understanding DPs and their relationships with lifestyle factors can help to prevent children from engaging in unhealthy dietary practices. We aimed to describe DPs in Spanish children aged 1 to <10 years and to examine their associations with sociodemographic and lifestyle variables. The consumption of toddler and young children milk formulas, enriched and fortified milk within the Spanish pediatric population is increasing, and there is a lack of evidence whether the consumption of this type of milk is causing an impact on nutrient intakes and if they are helping to reach the nutrient recommendations. Within the Nutritional Study in the Spanish Pediatric Population (EsNuPI), we considered two study cohorts and three different age groups in three year-intervals in each of them. The study cohort included 740 children in a representative sample of the urban non-vegan Spanish population and 772 children in a convenience cohort of adapted milk consumers (AMS) who provided information about sociodemographics, lifestyle, and dietary habits; a food frequency questionnaire was used for the latter. Principal component analysis was performed to identify DPs from 18 food groups. Food groups and sociodemographic/lifestyle variables were combined through a hierarchical cluster algorithm. Three DPs predominated in every age group and study sample: a palatable energy-dense food dietary pattern, and two Mediterranean-like DPs. However, children from the AMS showed a predominant dietary pattern markedly related to the Mediterranean diet, with high consumption of cereals, fruits and vegetables, as well as milk and dairy products. The age of children and certain lifestyle factors, namely level of physical activity, parental education, and household income, correlated closely with the dietary clusters. Thus, the findings provide insight into designing lifestyle interventions that could reverse the appearance of unhealthy DPs in the Spanish child population. Infancy is a stage characterized by high nutrient requirements and rapid conversion from a primarily milk-based diet (breast milk or infant formula) to a diverse diet with the ingestion of numerous food groups. The first two years of life are critical in individual growth and can disturb long-term health . Later, Most dietary guidelines in many countries promote the consumption of milk and other dairy foods, e.g., fermented milk and cheese, as they provide high-quality protein, calcium, and a wide range of micronutrients ,10,11. EA balanced diet in children covers the needs for all the nutrients. However, in developed countries, i.e., Spain, some nutrients are commonly consumed in excess , or a percentage of children ingest insufficient amounts of others, primarily iron, calcium, vitamin D, and docosahexaenoic acid (DHA) ,18. The Food consumption studies traditionally focused on food ingredients and nutrients. However, since diet is multidimensional and complex, other approaches have been developed in recent years, and research has shifted toward approaches focusing on dietary patterns (DPs) ,23. HumaPrincipal component analysis (PCA), exploratory factor analysis, or cluster analysis have been employed to empirically derive DPs . These dSeveral studies used the methods mentioned above to gain insight into the relationships between diet, physical activity, sedentary behavior, and country-specific DPs among children and adolescents ,30,31,32In Spain, the ANIBES study focused on DPs, physical activity behaviors, sedentary behaviors, and sleep time on weekdays in 207 Spanish children aged 9\u201312 years and 208 adolescents aged 13\u201317 years, clustered into two different groups . Leis etGiven this background, we aimed to (1) determine the DPs in a representative cohort of the Spanish non-vegan pediatric population, living in urban areas (SRS) in three different age groups (group 1 (Gp 1), 1 to <3 years old; group 2 (Gp 2), 3 to <6 years old, and group 3 (Gp 3), 6 to <10 years old) as well as in a convenience cohort of adapted milk consumers of the same age groups , and (2) examine how sociodemographic and lifestyle factors are clustered within the DPs and among the three age groups.The data used in this manuscript were obtained as part of the EsNuPI study, which was a prospective, cross-sectional, observational study, conducted from October 2018 to January 2019. The complete design, protocol, and methodology of the EsNuPI study were described in detail elsewhere . BrieflyTwo subsamples were selected, one SRS and one AMS both from 1 to <10 years old. The AMS regularly consumed follow-on formula, toddler\u2019s milk, fortified or enriched milk depending of the specific children age. All these formulas are usually formulated with a partial replacement of saturated fatty acids (SFAs) from milk fat with unsaturated fatty acids (FAs), from vegetable oils and added with selected nutrients, namely calcium, iron, vitamin D, and docosahexaenoic acid (from marine oil) depending on the specific age of the child. The reasons for choosing the AMS and SRS cohorts are described elsewhere .A total of 1514 children agreed to participate in the study and completed the face-to-face interview. The EsNuPI study was conducted following the Declaration of Helsinki and was approved by the University of Granada ethical committee (No. 659/CEIH/2018) and registered in ClinicalTrials.gov (Unique Protocol ID: FF01/2019).For our study, a food frequency questionnaire (FFQ) was used that was previously modified, adapted, and validated with the portion sizes and food groups usually consumed by the Spanish child population . This FFThe physical activity and sedentary behaviors questionnaire used for this study was a modification of a questionnaire previously validated in children aged <10 years from Colombia based on a seven-day recall . Some moThe questionnaire provided information on the physical activity and sedentary behaviors in children under 10 years of age. Furthermore, we adjusted the questionnaire to the Spanish most common terms of different activities. The detailed protocol has been reported elsewhere . In brieFinally, the calculations of energy cost were based on the metabolic equivalents (METy) value from the Youth Compendium, a measured or computed basal metabolic rate (BMR), and the duration of each specific activity, as follows:Energy cost = METy \u00d7 BMR \u00d7 duration (minutes), where the BMR for boys and girls was predicted using specific Schofield equations ,44,45. PWeight and size data were reported by parents or caregivers based on the latest child\u2019s health card. The weight and height of the children were evaluated using the World Health Organization (WHO) international growth patterns based on the analysis of the body mass index (BMI)-for-age indicators. For each child, the z-score index was estimated using WHO Anthro and WHO Anthro PLUS software .The education levels of parents participating children were established following the Spanish educational system. After a preliminary analysis of the distribution of the variable, categories were collapsed and recoded into a 3-point scale as follows: (1) low , (2) medium , and (3) high .Household income (HI) was classified based on occupation (12 categories) according to the National Association of Opinion and Market Research (ANEIMO) criteria, which were adapted to the Spanish context using the World Association for Market, Social and Opinion Research (ESOMAR) criteria. After a preliminary analysis of the distribution of the variable for this analysis, the categories were collapsed and recoded into a 3-point scale as follows: (1) low, (2) mid-low, and (3) high HI levels .p-values were obtained from H Kruskal\u2013Wallis tests corrected by the Bonferroni post hoc test when age groups were compared for each sample. The chi-squared test was used to compare percentage differences for parental education and household income variables.Statistical tests were performed using IBM SPSS Statistics for Windows, Version 25.0 , and R version 3.6.1 . Descriptive statistics were computed for each variable. All results are expressed as the mean \u00b1 standard deviation unless otherwise indicated. PCA was performed to identify underlying dietary patterns using the average weight consumed (g/day) by each individual from 18 food groups as input variables . MulticoFactors were retained based on the following criteria: factor eigenvalue >1.2, identification of a breakpoint in the scree plot, the proportion of variance explained, and factor interpretability .The strength and direction of the associations between patterns and food groups were described through a rotated factor loading matrix. Food groups with factor loadings >0.20 and communality >0.20 were retained in the patterns identified. The factor score for each pattern was constructed by summing observed intakes of the component food items weighted by the factor loading. A high factor score for a given pattern indicated a high consumption of the foods constituting that food factor, and a low score indicated a low intake of those foods. Radar charts were used to display multivariate data in the form of a two-dimensional chart of 18 food groups (input variables) represented on axes starting from the same point.A two-step cluster analysis procedure was used as an exploratory tool to reveal natural clusters within the dataset that would otherwise not be apparent and automatically determine the \u201cbest\u201d number of clusters using SPSS v.25 . Thereafter, using R v.3.6.3 package, unsupervised hierarchical clustering analysis was applied on the FFQ and lifestyle variables , to build clusters of subjects with similar characteristics (R package pheatmap). The distance matrix was defined by Euclidean distances, and Ward\u2019s method was used as linkage criteria to group the clusters. More specifically, based on the distance matrix, the clustering algorithm identified the closest observations and iteratively merged them within the same cluster until all clusters were merged together. This clustering algorithm was applied separately within each age group. Three clusters were retained among subjects and lifestyle/dietary variables, which were assumed to be the optimum number of clusters (2 to 5 clusters were tested) based on the silhouette method (R package Nbclust). The agglomerative coefficient, calculated by the Agnes function in R package cluster, was always higher than 0.85.A total of 1512 children of the EsNuPI study sample whose parents or caregivers agreed to participate and completed the FFQ (49.9% girls and 50.1% boys) were analyzed. The total SRS represented 48.9%, and the AMS 51.1%. The characteristics of both study samples are provided in The food consumption divided according to the 18 food groups considered in the present study is shown in Comparing the total cohorts (SRS vs. AMS), we found that consumption of meat and meat products, bakery and pastry, other dairy products, sugars and sweets, ready to cook, eggs, fish and shellfish, beverages, appetizers, and nuts group foods was significantly higher in SRS, whereas milk and dairy products, vegetables, cereal-based baby foods, and sauces and condiment consumption was significantly higher in AMS .Between-group ages, we found that children aged 1 to <3 years consumed more milk and dairy products and cereal-based baby foods in AMS than in SRS. In contrast, sugar and sweet consumption was significantly higher in SRS than in AMS. Children aged 3 to <6 years consumed more beverages in SRS than in AMS. In children aged 6 to <10 years, we observed a higher consumption of oils and fats, appetizers, and sauces and condiments in AMS than in SRS .DPs were computed using the PCA statistical approach. Bartlett\u2019s tests of sphericity and KMO supported the appropriateness of factor analysis in both the SRS and AMS populations for the three different age groups. All Bartlett\u2019s tests of sphericity were significant, and the KMO value was >0.626 in all analyses. Three major factors were extracted through PCA using the 18 food groups, as mentioned above, which explained from 37.56% to 51.26% of the variance in the six studied models . Figure For the SRS, in children from 1 to <3 years, we observed three major factors or components: The first component had high positive loadings on sweetened dairy products, sugars and sweets, bakery and pastry, ready to cook, appetizers, beverages, sauces and condiments, and oils and fats, and negative loading on cereal-based baby foods. The second component was characterized by high positive loadings on cereals, vegetables, milk and dairy products, cereal-based baby foods, fruit, meat and meat products, and oils and fats. This pattern is close to the traditional Mediterranean diet pattern but with relatively high consumption of dairy and meat products. The third component (Mediterranean-like diet) had high positive loadings on nuts, fruits, legumes, cereals, fish and shellfish, and meat and meat products, and negative loading on milk and dairy products. Regarding children aged 3 to <6 years, we observed three major components: The first component was similar to children 1 to <3 years and was therefore defined as the palatable energy-dense foods component. The second component was described as the Mediterranean-like diet, and the third component had high positive loadings on cereals, cereal-based baby foods, fruit, vegetables, appetizers, and oils and fats. Likewise, in children aged 6 to <10 years there were three major components; again, the first component was characterized as palatable energy-dense foods. The second component was defined as Mediterranean-like diet and the third component was defined by beverages, milk and dairy products, fruits, other dairy products, bakery and pastry, meat and meat products, and cereal-based baby foods with high positive loadings .Concerning the AMS, in children aged 1 to <3 years, we observed three major factors. The first component was characterized as Mediterranean-like diet. The second component was defined by high positive loading on other dairy products, bakery and pastry, meat and meat products, ready to cook, eggs, fish and shellfish, beverages and sauces and condiments. The third component was characterized as palatable energy-dense foods. Children aged 3 to <6 years had three major components: the first component was defined by Mediterranean-like diet, the second component was defined as palatable energy-dense foods, and the third component was composed of fruits, cereals, vegetables, milk and dairy products and cereal-based baby foods with high positive loadings. Finally, children aged 6 to <10 years had three major components: the first component was defined by palatable energy-dense foods, the second component was characterized as a Mediterranean-like diet, and the third component was defined by high positive loadings on sauces and condiments, meat and meat products, appetizers, ready to cook, sugars and sweets, fish and shellfish, and nuts .In SRS, moderate\u2013vigorous physical activity increased with age, whereas PAL and BMI z-score did not differ across the age groups. In AMS, children had a similar result in age and moderate\u2013vigorous physical variables to SRS. However, PAL and BMI z-score were significantly different in the different age groups: PAL was significantly higher in children aged 6 to <10 years, and BMI z-score was significantly higher in children aged 1 to <3 years. Parental education and HI variables did not show any statistical differences in both samples across ages . AccordiClusters of subjects within each study sample, classified based on their dietary and lifestyle characteristics, are shown in In the youngest age group in the SRS cohort A, we fouWithin AMS A, we obsIn the three to six years age group, we observed similar dietary clusters in both study samples B. The maThe children aged six to nine years were similar to the above-described clusters and in the two study samples C, with mDifferences between the clusters with regard to dietary and lifestyle variables, to complement the description of the above clusters, are shown in The main goals of this study were to determine the DPs in a representative SRS in three different age groups of Spanish children (one to nine years old) and in a convenience cohort of AMS of the same age groups, and to examine how several sociodemographic and lifestyle factors are clustered within the DPs and among the three age groups. For SRS, we observed three components in the different age groups. The first component was \u201cpalatable energy-dense foods\u201d in all group ages; here, the consumption of sweetened dairy products, sugars and sweets, bakery and pastry, ready to cook, appetizers, beverages, sauces and condiments, and oils and fats products predominated. The second and third components were a mix of Mediterranean-like diet and diverse plant and animal foods. Regarding AMS children, component one was a Mediterranean-like diet in children aged 1 to <3 years old, and 3 to <6 years old, whereas children aged 6 to <10 years were similar to SRS with palatable energy-dense foods. Similar to SRS, components two and three were a mix of palatable energy-dense foods and the Mediterranean-like diet, respectively.Regarding the dietary and lifestyle clusters, we observed dietary clusters that were, to some extent, similar to the DPs observed in the PCA. In brief, in the youngest SRS children (aged 1 to <3 years), we observed a clustering of the more energy-dense foods (cluster 1) that resembled the palatable processed food cluster derived with PCA, a more Mediterranean-like group of foods (cluster 2), and a dairy milk products cluster including cereal-based baby foods (cluster 3), both of which tended to represent the Mediterranean-diet-like PCAs. The children\u00b4s age and their lifestyle characteristics were found to be correlated with these dietary clusters. While the Mediterranean diet clusters were always present, some variations were observed in the older age groups, likely due to dietary adaptations to children\u00b4s growth. As such, there were not only slightly different dietary clusters defined in these other age groups, but also groups of children who were high- or low-level consumers of all foods. Within AMS, we observed somewhat similar dietary clusters to those seen in SRS, although some foods clustered differently, and the Mediterranean diet-like dietary pattern tended to be ranked first. It is important to mention that age was one of the main variables in our study and the differences were analyzed within the groups of the same ages to avoid comparisons determined with the stage of life . We also took special consideration of the fact that food groups, such as cereal-based baby foods, were more likely consumed by children aged less than 3 years.The importance of adequate nutrition in early childhood development has been recognized for many decades. Epidemiological analyses and animal studies showed that nutritional effects early in life can encourage the responsiveness of the body to have a better nutritional status in the adult life . Infantsn = 552) and 24-month-old (n = 493) children. Two patterns were identified in these two studies: one was characterized by fruits, grains, vegetables, cheese, and nuts, and the second by white bread, spreads, sweetened beverages, snacks, chocolate, and processed meat. Lower maternal age and early breastfeeding termination were connected with the second component, and patterns were not related to BMI z-score [Knowing dietary habits and their determinants is essential for evaluating the adequacy of nutrient intake as well as its impact on health in children. Overweight and obesity among children are a major health issue, and the diets of many children exceed dietary guidelines for fat, cholesterol, added sugar, saturated fatty acids, and sodium, and are low in fiber . Changes z-score . A syste z-score . A recenThe term \u201cMediterranean diet\u201d has been extensively used to explain the traditional dietary habits of people living around the Mediterranean Sea. This diet is defined by the predominant consumption of fruits, vegetables, whole grain cereals, legumes, nuts and seeds, and fish, with olive oil as the main source of added fat. Other important features of the Mediterranean diet are a relatively low intake of dairy products, mainly as fermented milk, i.e., yogurt and cheese, and low to moderate intake of fish and poultry meat, low consumption of red meat, and modest wine drinking in adults ,57. EvidA total of 9301 European children aged two to nine years participated at baseline and two-year follow-up examinations of the \u201cIdentification and prevention of dietary- and lifestyle-induced health effects in children and infants\u201d (IDEFICS) study. For the Spanish population, three DPs were recognized at baseline and follow-up by applying clustering methods. These DPs were based on a higher frequency of consumption of snacks and fast food (processed), sweet foods and drinks (sweet), and fruits and vegetables . In SpaiBacteroides population [Several studies showed that the ingestion of dairy foods has a neutral or inverse association with adverse cardiometabolic health outcomes ,13. Cerepulation . A studypulation . This heThe results of our cluster analysis combining lifestyle and dietary factors were consistent with those reported by other studies. These studies reported a healthy energy-balance-related behavior pattern characterized by a healthier diet with high levels of physical activity and low levels of sedentary behavior between children in different countries. Other studies conducted in different countries also reported the clustering of a combination of sedentary lifestyle with healthy diet ,31,32,65The major strength of this study was the opportunity to investigate a large sample of Spanish children representative of Spanish children aged 1 to <10 years living in urban areas, and the possibility of comparing the results in a convenience sample of children (AMS) of the same age group. Two different methodological approaches were applied to identify the DPs and to validate our findings: PCA and cluster analyses . We relied upon dietary information collected via the FFQ and 24 h dietary recalls, but we considered the FFQ dietary data in the present study because a higher variance was explained and uses almost the total EsNuPI sample (1512/1514).The limitations of the present study were the cross-sectional design, which provides evidence for the relationship between lifestyle and dietary factors but does not allow for causal inference. Residual confounding by unobserved and unmeasured factors is probable, and information on dietary intake, physical activity, weight, and other variables is prone to measurement error since the data were self-reported by the participants. However, a careful multistep quality control procedure was implemented to derive dietary intake to minimize this bias. For instance, the interviewers were coached by knowledgeable dieticians/nutritionists, and these professionals were responsible for inspection of the food consumption records during the study process and from the coding process to verify the survey data.Subjective decisions have been constantly reported as a limitation in studies deriving a posteriori DPs with PCA or cluster analysis . HoweverIt is unlikely that energy intake influenced our results according to earlier studies comparing DPs derived with and without energy adjustment . AnotherThe current study is the first exploring dietary clusters in Spanish children aged under nine years to the highest extent possible. The three identified dietary clusters demonstrated the existence of an unhealthy dietary pattern, with palatable and processed foods being consumed in all age groups and in the two study samples. Two Mediterranean-like DPs were also identified. Children from AMS showed a dietary pattern related to the Mediterranean diet as the main component, with high consumption of cereals, fruits, and vegetables, as well as milk and dairy products. Certain lifestyle and sociodemographic factors, i.e., PAL, parental education, and HI, were found to be significantly correlated with the dietary clusters, suggesting that physical activity and socioeconomic status may be to some extent determinants of these DPs. Thus, the findings provide guidance for designing lifestyle interventions based on age group or based on parent education that could reverse the appearance of unhealthy DPs in the child population. Our findings represent a wake-up call for regulatory bodies and professional organizations to try to reduce the consumption of energy-dense foods. Further research is warranted to evaluate how these variables or others influence the health status of children and to assess the whole picture of the relationships between consumption of nutrients and lifestyle factors in properly designed longitudinal studies including the whole population . Intervention studies considering dietary patterns such as the Mediterranean diet and promotion of physical activity might be necessary to establish the role of dietary and lifestyle factors on health determinants of the Spanish pediatric population."} +{"text": "Acer saccharum is one ecologically and economically important tree species cultivated widely across the world. In this study we generated the complete chloroplast (cp) genome of A. saccharum via genome-skimming method. The assembled genome is 155,684 base-pairs (bp) in size, with one large single copy region of 85,393\u2009bp and one small single copy region of 18,033\u2009bp separated by two inverted repeats of 26,129\u2009bp. The genome contains a total of 133 genes, including 85 protein-coding genes, 8 rRNAs and 40 tRNAs. Furthermore, phylogenomic estimation strongly supported A. saccharum as a distinct lineage within the monophyletic Acer. Acer saccharum Marshall, usually called sugar maple, is arguably one of the most ecologically and economically important tree species in the Northern Hemisphere , for total genomic DNA extraction. The voucher specimen was preserved at the Tree Herbarium of Zhongkai University of Agriculture and Engineering (accession number ZXZ18018). Illumina paired-end (PE) library was constructed and sequenced by Beijing Genomics Institute (BGI) in Shenzhen, China. We assembled the cp genome using CLC Genomics Workbench v7.5 , as stated previously is 155,684 base-pairs (bp) in size with high coverage (mean 380\u00d7), displaying a typical quadripartite organization: one large single copy region (LSC) of 85,393\u2009bp and one small single copy region (SSC) of 18,033\u2009bp separated by two inverted repeats (IRs) of 26,129\u2009bp. The cp genome contains a total of 133 genes, with 85 protein-coding genes, 8 ribosomal RNA (rRNA) genes and 40 transfer RNA (tRNA) genes. Six protein-coding genes occur as duplicated genes in IRs and 12 ones are intron-containing genes . The overall GC content of this cp genome is 37.9%. In short, the A. saccharum cp genome is structurally similar to previously published ones . But it is worth noting that this relationship was just lowly supported (Acer, consistent with previous studies (Zhao et\u00a0al. Phylogenetic placement of rt value . A. saccupported . In all,"} +{"text": "While the management of Rockwood type III injuries is still a topic of debate, high-grade Rockwood type V injuries are mostly treated surgically, to anatomically reduce the acromioclavicular (AC) joint and to restore functionality. In this case report, we present a method for non-operative reduction and stabilization of a high-grade AC joint injury.A 31-year-old male orthopaedic resident sustained a Rockwood type V injury during a snowboarding accident. His AC joint was reduced and stabilized with an AC joint brace for six\u00a0weeks. The brace provided active clavicle depression and humeral elevation. After removal of the brace the AC joint showed a nearly anatomic reduction. Six-month follow-up weighted\u00a0X-ray\u00a0views showed an AC joint which had healed in a Rockwood type II position and the patient returned to full pre-injury function with a satisfying cosmetic appearance.Non-operative reduction and stabilization of high-grade AC joint separations seems to be a valuable treatment option. A \u201cclosed reduction\u00a0and external fixation\u201d approach with the aid of a dedicated AC joint brace can reduce the AC joint and keep it in place until ligamentous consolidation occurs, thus improving AC joint stability and cosmetic appearance without surgical intervention. AC joint separations account for 4\u201312% of all shoulder injuries and mainly affect male athletes that sustain a direct impact trauma to the shoulder , 4.Usually, Rockwood type I and II injuries, where the coracoclavicular (CC) ligaments are still intact, are treated conservatively with a shoulder sling for a few days, ice, analgesia and early pain-adapted physiotherapy . While iRockwood type IV\u2013VI injuries are usually treated surgically with a variety of techniques aiming at anatomical reduction and realignment of clavicle and acromion . ReportsThe literature describes various conservative methods to treat AC joint separations, ranging from the original spica cast method described by Tossy et al. in 1963 to the\u00a0nThe main advantage of restoring the AC joint\u2019s anatomic integrity lays in the possibility for the capsule to heal through scaring. If the AC joint is not reduced, scaring around the injured tissue may still occur, but the capsule cannot heal. The position that the clavicle is immobilized in will therefore determine the position in which the injury will heal. Neglected reduction in conservatively treated high-grade AC joint separations often leads to an elevated and prominent distal clavicle under the skin. Many patients are bothered by the cosmetic outcome and function might be impaired in some patients due to a remaining instability after conservative treatment .All slings and braces, currently used in AC joint separation therapy, can provide temporary immobilization but do not address the separation of the joint itself. There are no reports of devices that provide a permanent clavicle depression and humeral elevation to reduce and realign the AC joint.In this case report, we present a method for non-operative reduction and stabilization of a high-grade AC joint injury, using an AC joint brace for six\u00a0weeks in combination with a restrictive physiotherapy program.We report the case of a 31-year-old male orthopaedic resident, who presented to our emergency department after a snowboarding accident. On the same morning the patient fell off a rail obstacle in a snowboard park onto his left shoulder. After the direct blast to the shoulder, the patient felt a sudden separation of the AC joint.Upon admission, the patient underwent clinical examination revealing a moderate piano key sign Fig.\u00a0a. The paDue to the patient\u2019s wishes, the injury was treated conservatively using an AC joint brace , that provides a strap system, allowing depression of the clavicle with a broad shoulder pad, while simultaneously elevating the humerus towards the AC joint Fig.\u00a0b. The ACThe AC joint brace reduced the AC joint as made evident by radiographic imaging taken one week after the injury Fig.\u00a0c.The brace was worn day and night and only taken off for showering and physiotherapy sessions of 40\u00a0min/day. Physiotherapy began one\u00a0week after the injury and was undertaken once or twice a week following a restrictive physiotherapy protocol Table .Table 1IDuring the first week after the injury, the patient reported reoccurring subluxations of the clavicle and a feeling of instability, whenever he took off the brace to shower. These subluxations gradually became less frequent and a more stable feeling of the AC joint was reported. From the second week after the injury onwards, no subluxations reoccurred and the patient reported a return of stability similar to the one before the injury.The patient was able to return to work two\u00a0weeks after the injury, still constantly wearing the AC joint brace and mainly performing one-handed computer tasks.After six weeks of conservative treatment, the AC joint brace was taken off and bilateral AP X-ray views of the clavicles were obtained another three days later. The radiographs showed an aligned AC joint Fig.\u00a0d with anThe patient reported of muscle soreness of the deltoid muscle and myofascial trigger points in the upper trapezius muscle after taking off the brace. Both symptoms subsided over the coming weeks. The active range of motion one\u00a0week after removing the brace was 80\u00b0 of abduction, 80\u00b0 of flexion, 45\u00b0 of external rotation and internal rotation to the T12 vertebra level. Within the third week after brace removal, the patient returned to the full pre-injury range of motion with an active abduction of 180\u00b0, flexion of 180\u00b0, external rotation of 90\u00b0, and internal rotation to the T7 vertebra level.The patient was able to return to sports , four\u00a0weeks after the AC joint brace was taken off but was instructed not to lift heavy weights with the left upper extremity for another four\u00a0weeks. Further, the cosmetic result was satisfying and showed no contour changes compared to the contralateral side. Fig.\u00a0c.At the six-month follow-up, weighted X-ray\u00a0views (10\u00a0kg) showed an AC joint that had healed in a Rockwood type II position with a slightly elevated clavicle compared to the uninjured contralateral side Fig.\u00a0e. The paThe Subjective Shoulder Value at the six-month follow-up was 90 (range\u00a00\u2013100) , the TafUntil today there are no reports of devices that achieve clavicle depression and humeral elevation to realign the AC joint after high-grade AC joint separations. Cloth slings or shoulder immobilizers protect the shoulder from rotation and give support against gravity yet\u00a0theyWe report for the first time a case of a successfully treated Rockwood type V injury with the aid of an AC joint brace that was able to achieve anatomic reduction of the AC joint without the risks of surgery. Reduction, cosmetic and functional outcomes were comparable to results that could previously only be achieved surgically , 19\u201321. Initially the patient\u2019s AC joint separation was classified as a Rockwood type III injury, following the evaluation of the unweighted bilateral AP X-ray view Fig.\u00a0a. WeightAs the recovery time with the AC joint brace was comparable to that of an abduction sling worn post-operatively after a surgical AC joint reconstruction, the restrictions of shoulder immobilization on everyday life are equal in both treatments . The proThe literature reports costs for arthroscopic subacromial decompressions to be at $7246 per patient and for Although the patient was diagnosed with a Rockwood type V injury, non-operative reduction and stabilization were attempted using a dedicated AC joint brace. The radiographic follow-up of this \u201cclosed reduction and external fixation\u201d approach was convincing with excellent functional, cosmetic and pain outcomes. Non-operative treatment of high-grade AC joint separations with a reduction brace might therefore be a treatment alternative in selected cases."} +{"text": "Individuals encounter problems daily wherein varying numbers of constraints require delimitation of memory to target goal-satisfying information. Multiply-constrained problems, such as the compound remote associates, are commonly used to study this type of problem solving. Since their development, multiply-constrained problems have been theoretically and empirically related to creative thinking, analytical problem solving, insight problem solving, and a multitude of other cognitive abilities. In the present study, we empirically evaluated the range of cognitive abilities previously associated with multiply-constrained problem solving to assess common versus unique predictive variance . Additionally, we sought to determine whether problem-solving ability and self-reported strategy adoption were task specific or task general through the use of novel multiply-constrained problem-solving tasks (TriBond and Location Bond). Performance across these tasks was shown to be domain general, solutions derived through insightful strategies were more often correct than those derived through analytical strategies, and crystallized intelligence was the sole cognitive ability that provided unique predictive value after accounting for all other abilities. Jeopardy! where contestants are provided with an answer and their goal is to find the specific question that generated that answer. To the naive viewer, this may seem like a nearly impossible problem to solve. However, contestants can use certain cues to delimit their search of memory. Specifically, the answers all come from a common category which narrows the search to a specific domain. Additionally, contestants\u2019 responses are almost exclusively limited to \u201cWho is/are\u201d or \u201cWhat is/are,\u201d which means that dates are more often clues than answers. Lastly, the answer itself provides the final narrowing. Jeopardy! questions, such as the one above, can alternatively be classified as a multiply-constrained problem. More importantly, individuals engage in multiply-constrained problem solving every day, not just when an answer to a trivia questions needs to be retrieved. Specifically, when a doctor is treating a patient with an unknown ailment, the doctor will identify different symptoms, such as cough, runny nose, and elevated temperature, to eliminate unlikely or incorrect diagnoses and to eventually arrive at a correct diagnosis . Similarly, choosing a restaurant with a group of friends can be a multiply-constrained problem. The constraints in this situation are dietary limitations, location, and budget.Humans possess an incredible ability to target remote information stored in semantic memory even when provided with only minimal cues to guide their search. For example, consider participating on the game show Jeopardy! example highlights a type of convergent or multiply-constrained problem. While Jeopardy! questions have certainly been used in the classroom are conceptualized it is theoretically possible that different cognitive abilities will better support different strategies. Specifically, given the need to maintain the cues and retrieved responses during problem solving, working memory and attention control may better account for performance related to analytically retrieved responses. Specific to working memory there are inconsistent findings with regards to its role in problem solving. Some have found working memory to be correlated with problem solving , but othAttentional focus has been theorized as one key source of variation in problem solving performance . InitialGiven the relation between WMC and attention control , it is pRecent work by In many CRA experiments, the participant is only allowed to enter a single response for each problem, but others have allowed for multiple responses. For example, Recently, there have been calls for more research focused on fundamental processes and abilities related to creativity and multiply-constrained problem solving . CurrentParticipants completed multiple measures of multiply-constrained problem solving, WMC, attention control, long-term memory (episodic and semantic), and intelligence . To better understand the role of these cognitive abilities in multiply-constrained problem solving, we adopted two additional remote associate tasks, TriBond and Location Bond (LocBond). The addition of these two tasks will allow us to better understand whether multiply-constrained problem solving is a general cognitive ability and whether the process by which individuals arrive at solutions to these problems is task specific or domain general. With these data, we sought to answer four key research questions, (1) do answers derived from analytical processes differ from those found through insight processes at the within-subject level? (2) Do different multiply-constrained problem-solving abilities represent individual task performance or a domain-general ability? (3) Are analytical and insight processes in multiply-constrained problem solving domain general or task specific? (4) Which, if any, of the cognitive abilities uniquely predict multiply-constrained problem-solving ability? Given the importance of accessibility and availability of information in memory, we analyzed conditionalized accuracy. Moreover, models were generated using response time for correct responses not conditionalized by strategy reported.Previous individual difference research on multiply-constrained problem solving had a sample size of 413 participDemographics. Participants were asked to provide general demographic information, such as age, whether they were a native English speaker or not, and if they are not a native English speaker, at what age they learned English. The Demographics also included the 10-item personality inventory which measured an individual\u2019s openness, conscientiousness, emotional stability, agreeableness, and extraversion. Additionally, we evaluated an individual\u2019s self-discipline, internal motivation, and external motivation.Reading Span. Participants were required to read sentences while trying to remember a set of unrelated letters . For this task, participants read a sentence and determined whether the sentence made sense or not . Half of the sentences made sense while the other half did not. Nonsense sentences were made by simply changing one word from an otherwise normal sentence. Participants were required to read the sentence and to indicate whether it made sense or not. After participants gave their response, they were presented with a letter for 1 s. At recall, letters from the current set were recalled in the correct order by clicking on the appropriate letters. There were three trials of each list length with list length ranging from 3\u20137. The dependent measure was the number of correct items in the correct position.Operation Span. Participants were required to solve a series of math operations while trying to remember the same set of unrelated letters as in the Reading Span. Participants were required to solve a math operation, and after solving the operation they were presented with a letter for 1 s. Immediately after the letter was presented the next operation was presented. Three trials of each list length (3\u20137) were presented, with the order of list length varying randomly. At recall, letters from the current set were recalled in the correct order by clicking on the appropriate letters presented in one of three different font colors . All words were presented in Courier New with an 18-point font. The participants\u2019 task was to indicate the font color via key press . Participants were told to press the corresponding key as quickly and accurately as possible. Participants received 75 trials in total. Of these trials, 67% were congruent such that the word and font color matched , and the other 33% were incongruent . Congruent and incongruent trials were mixed throughout the task. The dependent measure was average incongruent trial reaction time for correct trialsAntisaccade. In this task at random intervals. The participant\u2019s goal is to stop the counter once it begins counting by pressing a key on the keyboard. Therefore, one can measure the amount of time it takes from the onset of the counter until the time that participants stop the counter as the dependent measure. The Psychomotor Vigilance task is a simple RT task ( RT task . PreviouCompound Remote Associate Test. The 30 compound remote associate (CRA) items were selected from the TriBond. TriBond\u2122 is a board game developed by Mattel, Inc. and functions similarly to the CRA. In the game, individuals are given three seemingly unrelated cues and tasked with finding the category, name, event or specific association between them (Solution: \u201crecyclables\u201d). Four independent raters evaluated a list of potential problems from 0 (easy) to 9 (difficult). Using averaged difficulty ratings, we selected 30 items of moderate difficulty (between 1.5 and 8.5). The flow of each problem solving trial was identical to the compound remote associates task. After attempting all 30 problems the participant completed a short post-experimental questionnaire, which included questions about strategies used. A participant\u2019s score is the proportion of items correctly solved.Location Bond (LocBond). LocBond operates similarly to CRA and Tribond. A LocBond problem consists of three clues and requires finding the target location the clues identify (Solution: Paris). We generated 30 problems where the target is a location on or in the immediate vicinity of the Arizona State University campus. The flow of each problem solving trial was identical to the compound remote associates and TriBond tasks. After attempting all 30 problems the participant completed a short post-experimental questionnaire, which included questions about strategies used. A participant\u2019s score is the proportion of items correctly solved.CRA, TriBond, and LocBond Strategy. After every CRA, TriBond, and LocBond problem the participant identified the strategy process that happened prior to submitting a solution in one of four different quadrants on screen for 1 s. Participants were explicitly instructed to pay attention to both the picture (item) and the quadrant it was located in (source). At test, participants were presented with 30 old and 30 new pictures in the center of the screen. Participants were required to indicate whether the picture was new or old and, if old, in what quadrant it had been presented, via keypress. Participants had 5 sec to press the appropriate key to enter their responses. A participant\u2019s score was the proportion of correct responses.Cued Recall. Participants were given three lists of 10 word pairs each. All words were common nouns, and the word pairs were presented vertically for 2 s each. Participants were told that the cue would always be the word on top and that the target would be on bottom. After the presentation of the last word, participants saw the cue word and ??? in place of the target word. Participants were instructed to type in the target word from the current list that matched the cue. Cues were randomly mixed so that the corresponding target words were not recalled in the same order as that in which they had been presented. Participants had 5 s to type in the corresponding word. A participant\u2019s score was the proportion of items recalled correctly.Delayed Free Recall. Items were presented alone for 1 s each. After a 10-item list presentation, participants engaged in a 16 s distractor task before recall: participants saw 8 three-digit numbers appear for 2 s each, and were required to type the digits in descending order . The participants were informed that they could retrieve the exemplars in any order that they wished; they were required to type in each response, and then press Enter to record the response. We instructed the participants that they needed to keep trying to retrieve exemplars for that category throughout the entire 3 min retrieval period.General Knowledge. In this task, participants complete three separate short general knowledge tests. In the first test, participants were given 10 vocabulary words and were required to select the synonym (out of five possible choices) that best matched the target vocabulary word .All experimental procedures (E-Prime), experimenter/participant notes, data files, and analysis scripts (SPSS and R) will be made available through Open Science Framework = 384.333, p < .001, CFI = .917, RMSEA = .048 [.041\u2013.055]. We found significant correlations between all latent factors, but importantly a perfect (~1) correlation between the crystallized intelligence and multiply-constrained problem solving factors indicates isomorphism between these factors (see \u03c72 (193) = 396.056, p < .001, CFI = .914, RMSEA = .048 [.041\u2013.055], \u0394\u03c72 (6) = 11.723, p = .068). Thus, in general, multiply-constrained problem solving relies heavily on crystallized intelligence. Because of that finding, we wanted to assess whether there was any unique variance shared among the multiply-constrained problem-solving measures, after accounting for the variance shared among all the multiply-constrained problem-solving and crystallized intelligence measures, and whether that unique variance correlated with the other cognitive factors.Model 1 specifies separate factors for each of the seven cognitive abilities measures in the present study and the three crystallized intelligence measures were loaded onto one factor, and the three multiply-constrained problem-solving tasks were loaded onto a residual factor (MCPSr). The correlation between these factors was set to zero. Thus, the MCPSr factor represents any shared variance among the multiply-constrained problem-solving measures after accounting for the large pool of variance shared across the multiply-constrained problem-solving and crystallized factors. This factor correlated with the working memory, attention control, episodic memory, semantic memory, and fluid intelligence factors . Thus, tThese models represent overall performance, but a major goal of the present study was to determine whether there were task-general individual differences in the usage of analytical vs. insight solution strategies in multiply-constrained problem-solving tasks. Thus, our next set of models conditionalized accurate responses on strategy reported\u2014that is, the number of times someone reported either an analytical solution vs. an insight solution when they correctly solved the problem. We specified factors for analytical and insight multiply-constrained problem solving separately to determine whether we could form such factors from the data, and to determine whether these factors would correlate with cognitive abilities in meaningful ways.M = .376, SD = .282) strategies and conditionalized proportion correct for insight strategies to a paired samples t-test. Results indicated that when participants reported using an insight strategy, they were more often correct than when they reported using an analytics approach, t (434) = \u221214.628, p < .001, d = .701. The same paired samples t-test compared analytical and insight strategies for both TriBond, t (427) = \u221213.624, p < .001, d = .658, and LocBond, t (426) = \u221217.976, p < .001, d = .869. For TriBond, insight solutions were more often correct than analytical solutions . Further, for LocBond, insight solutions were also found to be more often correct than analytical solutions . Thus, for all three multiply-constrained problem-solving measures, insight responses were more often correct than analytical responses. Additionally, performance on the multiply-constrained problem-solving measures correlated with one another = .546, p < .001, CRA and LocBond were correlated, r (420) = .354, p < .001, and TriBond and LocBond were correlated, r (424) = .547, p < .001. The moderate-to-large positive correlations indicated that participants used strategies consistently between the three tasks. Lastly, a structural equation model was generated to determine whether a strategy usage latent factor predicted a problem solving latent factor, which consisted of the proportion of items correctly answered for the three multiply-constrained problem-solving tasks. Model fit was acceptable, \u03c72 (8) = 37.310, p < .001, CFI = .950, RMSEA = .091 [.063\u2013.122], and strategy usage, defined as a difference score of solutions derived through analytical processes versus insight processes, was found to significantly predict problem solving performance, \u03b2 = \u2212.270, p < .001, accounting for 7.3% of the variance. This indicated that participants who reported using insight more often solved more multiply-constrained problemsThe results of the strategy analyses indicated that when an insightful strategy is used, the response was more often correct, but the possibility existed that participants varied in the number of analytical and insight solutions reported see . Specifi\u03c72 (253) = 530.719, p < .001, CFI = .879, RMSEA = .049 [.043\u2013.055], and Model 3, \u03c72 (246) = 436.983, p < .001, CFI = .917, RMSEA = .041 [.035\u2013.047], both had acceptable fits. The chi-square test indicated that the models were significantly different, \u0394\u03c72 (7) = 93.736, p < .001, and thus the more parameterized model (Model 3) was chosen . Model 2, osen see . For Modosen see . Importa\u03c72 (250) = 463.260, p < .001, CFI = .907, RMSEA = .043 [.037\u2013.049]. However, this model fit the data significantly worse than Model 2, \u0394\u03c72 (4) = 26.277, p < .001, and Model 3 was retained.The general trend that emerged among the latent correlations was that crystallized intelligence had the strongest correlations with multiply-constrained problem solving. Given the strength of the correlations an additional model (Model 4) was evaluated with the crystallized intelligence manifests loading onto the multiply-constrained problem solving factors and the overall model fit was acceptable, Model 3 was then used to conduct a structural equation analysis to determine the predictive nature of the cognitive abilities on multiply-constrained problem solving accuracy see . Althoug\u03c72 (187) = 377.464, p < .001, CFI = .901, RMSEA = .047 [.040\u2013.054] had an acceptable fitLastly, we examined which, if any, cognitive abilities predicted the speed at which correct responses were retrieved from memory Model 4; . Model 4The present study sought to provide the most complete picture of the underlying cognitive processes related to multiply-constrained problem solving. Before we examined each of the hypotheses related to strategy, we found that crystallized intelligence and multiply-constrained problem solving were found to be isomorphic. Our follow-up analysis examined residual variance in multiply-constrained problem solving, independent of variance accounted for by crystallized intelligence, which likely represent processes related to the problem solving process removed from having the necessary information in memory. The remaining cognitive ability latent factors were correlated with the MCPS Residual latent factor, but none were found to account for unique variance.Our first research question asked, do answers derived from analytical processes differ from those found through insight processes at the experimental level? When a participant arrived at a solution from insight strategies, that answer was more often correct than when it was derived from analytical processes. Second, we asked, do multiply-constrained problem-solving abilities represent individual task performance or domain-general ability? Results indicated that there exists a domain general multiply-constrained problem-solving ability. Next, we asked, are analytical and insight processes in multiply-constrained problem solving domain general or task specific? The best-fitting model contained latent factors for each of the cognitive abilities measured and two multiply-constrained problem solving latent factors . The structural equation analysis accounted for 48% of the variance in analytical multiply-constrained problem solving and 54% of the variance in insightful multiply-constrained problem solving. Lastly, which, if any, of the cognitive abilities uniquely predicts multiply-constrained problem solving? The structural model indicated that each of the underlying cognitive abilities was correlated with the problem solving latent factors, only crystallized intelligence was found to have unique predictive value. Relatedly, when cognitive abilities were used to predict multiply-constrained problem solving correct response times only, semantic memory contributed unique predictive value. This pair of findings indicate that different, but related, cognitive abilities account are necessary for multiply-constrained problem solving.Across all three tasks, our data demonstrate that answers retrieved through insight processes are more often correct than analytical strategies. Of primary importance is that the sets of strategy solutions between multiply-constrained problem-solving tasks load onto unique factors, which indicates that strategy processes are domain general rather than task specific. While there is a debate to be had whether this is evidence for the special-processes view of insight see for a thr = .23 analytical and r = .24 insight), and no relation with the Stroop task . However, the fact that the three tasks loaded well onto factors gives us confidence that these tasks tapped into a common cognitive ability.Additionally, the use of a self-report measure for strategy usage could represent a proxy of item difficulty. Specifically, when an item is more difficult, and the solution is not being retrieved with ease, the participant may be more likely to report using an analytical approach. Specifically, one way to conceptualize these responses is as a type of metacognitive assessment of the emergence of the solution into mind. That assessment, like all metacognitive assessments, is governed by multiple inputs including features of the problem , features of the problem solver , and features of the problem solving context . Therefore, these judgements are almost certainly not process (strategy) pure. They likely reflect some combination of a retrospective evaluation of strategy usage plus other inputs which may or may not actually be related to the problem solving approach . Future In the future, an evaluation of whether these multiply-constrained problem-solving tasks share any cognitive underpinnings with other measures of creativity should be conducted as since its conception the (compound) remote associates task has been linked to both creativity and insight. Previous work has shown for the CRA how and when insight responses are submitted is not always the same . Others real world? The answer is Jeopardy! In 2014, their \u201cBattle of the Decades\u201d aired and, late into the tournament, the category \u201cCommon Bonds\u201d appeared. The first clue in the category read \u201ccupid, dancer, prancer\u201d and within moments, the correct response \u201creindeer\u201d was produced, and thus science and life intersected. The contestant who responded correctly could not have done so had they not known any of those names or that they shared a connection with reindeer. More specifically, despite the demands on effective goal maintenance, attention control, memory search efficiency, and problem solving skill, one cannot retrieve an answer from memory if the answer does not already reside there.As with any experimental or laboratory task, the question must be asked, how do the current results map onto behavior in the"} +{"text": "In patients with facial trauma, multidetector computed tomography is the first-choice imaging test because it can detect and characterize even small fractures and their associated complications quickly and accurately. It has helped clinical management and surgical planning, so radiologists must communicate their findings to surgeons effectively. In Le Fort fractures, there is a breach between the pterygoid plates and the posterior maxilla. These fractures are classified in three basic patterns that can be combined and associated with various complications. Conceptualized when low-speed trauma was predominant, the Le Fort classification system has become less relevant giving more importance on maxillary occlusion-bearing segments. The classification of naso-orbito-ethmoid depends on the extent of injury to the attachment of the medial canthal tendon, with possible complications like nasofrontal duct disruption. Displaced fractures of the zygomaticomaxillary complex often widen the angle of the lateral orbital wall, resulting in increased orbital volume and sometimes in enophthalmos. Severe comminution or angulation can lead to wide surgical exposure. In orbital fractures, entrapment of the inferior rectus muscles can lead to diplopia, so it is important to assess its positioning and morphology. Orbital fractures can also result in injuries to the globe or infraorbital nerve. Frontal sinus fractures that extend through the posterior sinus wall can create a communication with the anterior cranial fossa resulting in leakage of cerebrospinal fluid, intracranial bleeding. It is essential to categorize fracture patterns and highlight features that may affect fracture management in radiology reports of facial trauma. Radiologists should know anatomical classifications expressed as struts/buttresses and thirds as is the nomenclature used by many surgeons.Merely listing fractured bones in the report is useless for surgeons.Reports should focus on critical structures affected because of possible complications.Displacement and comminution determine the need for surgery, bone grafting, etc.Many patients seen in emergency departments have facial trauma. In these patients, major findings may go undetected due to multiple trauma, clinicians\u2019 inability to perform a thorough physical examination, patients\u2019 inability to cooperate, and pronounced facial swelling; thus, facial injuries can be challenging for trauma surgeons .Most patients with facial trauma are male 56.8\u201392.8%) [.8% [2\u20138]Although some authors affirm that appropriate physical examination of the face reliably rules out fractures in some patients (as low impact trauma ones) and some clinical variables are associated with facial fractures , physicaIt is essential to know the typical patterns and classifications of facial fractures, including those of the zygomaticomaxillary complex and naso-orbito-ethmoidal complex, because each pattern is often associated with particular functional and esthetic complications . There aThanks to its widespread availability, computed tomography (CT) is the reference standard for facial imaging . In patiMoreover, even in trauma traditionally diagnosed with plain-film radiography, such as mandibular fractures, CT is more sensitive . SurgeonBetween the emerging advances in CT imaging, it stands out the growing use of cone-beam CT: it can make diagnosis of low-energy mandible fractures in walk in clinics, is also used intraoperatively, and has excellent spatial resolution and low radiation dose. As limitations of the technique, the patient must be upright for most units and contrast is not used, so it is not useful in patients with polytrauma .Some techniques are being used in whole-body computed tomography algorithm to decrease the radiation dosis as the Adaptive Statistical Iterative Reconstruction V (ASiR-V). In a recient study by Elmokadem et al., it was proved that biphasic computed tomography protocol reduced radiation dose with maintenance of diagnostic accuracy and image quality after implementing ASiR-V algorithm .As the advantages of CT are so evident in facial trauma classically, there has been a scarce role for MR imaging even advanced techniques like diffusion-weighted imaging (DWI) have not added new utilties for facial trauma. In case of orbit, nasal, paranasal, and skull base lesions, MR evaluation with DWI and ADC levels in is a non-invasive imaging parameter that can help mainly to discriminate between benign and malignant causes \u201329.Five paired and four facial unpaired bones fit together to form the facial skeleton, so it can be cumbersome to characterize facial fractures according to the bones involved. Thus, it is more useful for radiologists to describe how facial fractures relate to structures like orbits or sinuses.It is useful to simplify the skeletal structure into four pairs of horizontal and four pairs of vertical struts or buttresses, because this conceptual view emphasizes the functional relations between the different bones in the facial anatomy Fig. . BecauseFurthermore, otolaryngologists normally use a different classification scheme, which divides the facial skeleton into upper, middle, and lower thirds Fig. , and thiIt is essential to report the involvement of critical structures or landmarks, where different patterns of fracture could determine major complications Table .Table 1Facial fractures often involve risks to intraorbital contents. The inferior rectus muscle can herniate through a fracture, or it can be torn, avulsed from the globe, or entrapped, leading to ophthalmoplegia and diplopia. Rupture of the globe may result in blindness; on CT, a ruptured globe is seen as the \u201cflat tire\u201d sign (deformity of the globe) or an optic nerve lesion Fig. a 31]. T. T31]. TFractures extending to foramina or to the canals which nerves pass through can damage nerves. When the orbital apex is involved, the optic nerve (CN II) can be damaged, resulting in unilateral blindness. When the superior orbital fissure Fig. b is invoWhen the infraorbital canal is involved, CN V2, a terminal branch of the maxillary division of the trigeminal nerve Fig. a and b tIf the temporalis muscle is injured or becomes impinged in the infratemporal fossa, patients can develop trismus.Alveolar bone fractures can result in dental complications such as fracture, avulsion, devitalization, and/or malocclusion of teeth; furthermore, germs from the mouth can invade damaged soft tissues adjoining the fracture, leading to infection Fig. a, b.FigPredominantly medial fractures can damage drainage canals and should be surgically repaired. When the frontal recess Fig. a, sphenoFractures extending superiorly to the cribriform plate can cause a tear in the underlying dura, allowing cerebrospinal fluid to leak into the paranasal sinuses and nasal cavity Fig. a. Those Subcondylar fractures and some patterns of facial fracture , especially in association with skull base fractures, confer increased risk of blunt carotid artery injury . In addiTo ensure effective communications with surgeons, it is extremely important for radiologists to describe patterns , 30.The AO group has proposed a system for classifying craniomaxillofacial fractures in adults (AOCMF) in which anatomic modules are arranged into a hierarchy with three levels of precision to describe these injuries in terms of complexity and details. Level 1 is the most basic; it conveys only whether fractures are present in four anatomical units: the mandible, midface, skull base, and cranial vault. Level 2 describes the location of the fractures in detail within specific regions of the mandible, central and lateral midface, internal orbit, endocranial and exocranial skull base, and cranial vault. Level 3 reports even greater detail about the location of the injury, focusing on morphology within specific subregions . The AO Multidetector CT\u2019s exquisite depiction of bone has enabled the development of new subunit-specific principles for the management of midfacial fracture that are supplanting the older, more general Le Fort classification system, which does not adequately reflect the complexity of the individual components of the midfacial region . NeverthThe following discussion of fracture patterns first focuses on those involving more buttresses and then focuses on those that involve fewer buttresses . It is important to keep in mind that various patterns often coexist in the same patient Table .Table 2In midface fractures involving multiple buttresses and damage to the pterygoid plates, the three subtypes of Le Fort fractures should be considered. Determining whether the fracture predominantly affects the lateral or medial portion of the midface will help show whether the pattern corresponds to a fracture of the zygomaticomaxillary complex or naso-orbito-ethmoidal complex.Le Fort fractures are complex facial fractures with varying degrees of craniofacial dissociation affecting various facial buttresses. In 1901, a French surgeon, Ren\u00e9 Le Fort, published the results of his experiments in which he applied blunt force to the midface of cadavers, finding three common patterns, all including a fracture through the pterygoid plates Fig. 21].Fi.Fi21].Although pterygoid plate fractures are often described in relation to Le Fort fractures, 37.3% of the patients with pterygoid plate fractures have craniofacial fracture patterns unrelated to Le Fort fractures , 5352, 5It is important to examine this area carefully. A recent study found that a significant percentage of fractures of the anterior skull base, cribriform plate, or sella turcica were missed in reports done during calls .Alveolar process fractures are the most commonly observed pattern of maxillary fracture. Caused by direct force on the alveolar process or by indirect force from an impact on the teeth below through the base of the dental crown, these fractures must be treated with surgical debridement and prophylactic antibiotics to avoid bacterial infection from the oral cavity . AlveolaThe superficial location of the nose and the relative thinness of the nasal bones mean that nasal bone fractures are the most common injuries to the facial skeleton . The twoNasal bone fractures are classified according to the anatomic plane involved. Type 1 fractures affect only the region below the plane that extends from the caudal tip of the nose to the anterior nasal spine; the nasal septum is unaffected in these fractures. By contrast, in type 2 fractures, both the septum and the anterior nasal spine are involved Fig. . FinallyIn low-force impacts, trauma often causes isolated fracture of the nasal bones. However, because the nasal bones are located close to the ethmoid sinuses and the medial orbital walls, high-force impacts can also cause injury to the underlying ethmoid sinuses and orbit. The close physical and functional relationships among the bony structures in this area have led some authors to recommend that the nasal-orbital-ethmoid region be considered a single unit in cases of high-impact trauma . Other aIt is essential to use shared terminology to refer to the pattern of facial fractures in radiology reports. Descriptors such as naso-orbito-ethmoidal complex, zygomaticomaxillary complex, and orbital \u201cblowout\u201d can be extremely useful for surgeons, so they should be used when possible. Surgeons require information about the anatomic landmarks and features of the fracture such as the degree of displacement and comminution so they can plan treatment and predict possible complications."} +{"text": "Stroke is a common complication in children with tuberculous meningitis (TBM). Host proteins may give us insight into the mechanisms of stroke in TBM and serve as biomarkers for detection of stroke, however, they have not been widely explored. In this study, we compared the concentrations of cerebrospinal fluid (CSF) and serum proteins between children who had TBM-related stroke and children with TBM without stroke.We collected CSF and serum from 47 children consecutively admitted to the Tygerberg Academic Hospital in Cape Town, South Africa between November 2016, and November 2017, on suspicion of having TBM. A multiplex platform was used to measure the concentrations of 69 host proteins in CSF and serum from all study participants.After classification of study participants, 23 (48.9%) out of the 47 study participants were diagnosed with TBM, of which 14 (60.9%) demonstrated radiological arterial ischemic infarction. The levels of lipocalin-2, sRAGE, IP-10/ CXCL10, sVCAM-1, MMP-1, and PDGF-AA in CSF samples and the levels of D-dimer, ADAMTS13, SAA, ferritin, MCP-1/ CCL2, GDF-15 and IL-13 in serum samples were statistically different between children who had TBM-related stroke and children with TBM without stroke. After correcting for multiple testing, only the levels of sVCAM-1, MMP-1, sRAGE, and IP-10/ CXCL10 in CSF were statistically different between the two groups. CSF and serum protein biosignatures indicated stroke in children diagnosed with TBM with up to 100% sensitivity and 88.9% specificity.Serum and CSF proteins may serve as biomarkers for identifying individuals with stroke amongst children diagnosed with TBM at admission and may guide us to understand the biology of stroke in TBM. This was a pilot study, and thus further investigations in larger studies are needed. Tuberculous meningitis (TBM) is the most common form of central nervous system (CNS) tuberculosis, mainly affecting younger children and immunocompromised individuals, including those living with human immunodeficiency virus (HIV) . The truThe occurrence of stroke has been reported in up to 57% of TBM patients, with mortality about three times higher in those with stroke compared to those without . Higher Several studies have demonstrated the roles of inflammatory mediators in the pathogenesis of TBM. Upregulation of inflammatory mediators including tumour necrosis factor (TNF)-\u03b1, interferon (IFN)-\u03b3, interleukin (IL)-1\u03b2, IL-6, IL-8 and IL-10 in the cerebrospinal fluid (CSF) of patients with TBM have been described , when coInflammatory proteins may provide insight into infarction in TBM patients. Given that neuroimaging is not available in many low resource settings, where most patients develop TBM, a blood- or CSF-based test that could indicate stroke could allow targeted therapeutics. In addition, if a host protein biosignature could be developed that could predict future stroke, therapy could be targeted to those individuals. Finally, a better understanding of the biology of arterial ischemic stroke could contribute to the development of new therapeutic and preventive strategies . In thisWe used existing CSF and serum host protein concentration data from children diagnosed with TBM or \u201cnot-TBM\u201d, from previous studies , 17. BriThe study participants were classified as TBM cases (\u2018definite\u2019 TBM and \u2018probable\u2019 TBM) and \u2018not TBM\u2019 group, based on a published research case definition, which combines clinical, radiological and laboratory characteristics . The \u2018noAs previously described , 17, we Concentrations of 69 host proteins in serum and CSF samples from study participants with TBM (with or without infarction) and \u2018not TBM\u2019 were determined in our previous studies , 17. We All Luminex experiments were performed on the Bio Plex platform in an ISO15189 accredited laboratory using the reagent kits purchased from Merck Millipore and R&D Systems Inc. , 17. DatData for this study were analysed using Statistica and Graphpad Prism version 8 . Differential expression of host markers between the three groups were evaluated using one-way analysis of variance (ANOVA), with Fisher\u2019s Least Significant Difference (LSD) post hoc testing to determine the differences between TBM-related stroke and TBM without stroke. Games-Howell post hoc test was used for analysis of host markers in which Levene\u2019s test of homogeneity revealed unequal variance between the groups. P-values <0.05 were considered significant. Correction for multiple testing was done using Benjamini-Hochberg with a false discovery rate of 20%. Receiver operating characteristic (ROC) curve analysis was used to investigate the abilities of biomarkers to indicate stroke amongst children with TBM. Maximum values of Youden\u2019s index were used to select the optimal cut-off values yielding highest sensitivities and specificities for each marker . The abiWe included 47 children on suspicion of meningitis; 23 were finally diagnosed with TBM (3 definite TBM and 20 probable TBM) , 17. TheOf the 69 host proteins investigated in CSF samples, the levels of lipocalin-2, soluble receptor for advanced glycation end products (sRAGE), and interferon-gamma inducible protein (IP) -10 (CXCL10) were significantly higher in children who had TBM-related stroke compared to TBM without stroke, while the levels of soluble vascular cell adhesion molecule (sVCAM)-1, metalloproteinase matrix (MMP)-1, and platelet derived growth factor (PDGF)-AA were increased in children with TBM without stroke compared to TBM with stroke. In addition, we observed trends in increased levels of granulocyte-macrophage colony-stimulating factor (GM-CSF), D-dimer and Brain-derived neurotrophic factor (BDNF), and lower levels of ferritin and apolipoprotein CIII were observed in children who had TBM-related stroke compared to TBM without stroke. After correction for multiple testing using Benjamini-Hochberg procedure, significant differences were only observed for the concentrations of sVCAM-1, sRAGE, MMP-1, and CXCL10 , Fig 2. Using ROC curve to assesses the abilities of individual CSF biomarkers to indicate stroke among children with TBM at baseline, we obtained the area under the ROC curve (AUC) above 0.70 for lipocalin-2, sP-selectin, glial cell-derived neurotrophic factor (GDNF), sVCAM-1, sRAGE, apolipoprotein CIII, MMP-1, MMP-7, d-dimer, myoglobin, BNDF, complement factor H, PDGF-AB/BB, CXCL10, MIP-1\u03b1, ADAMTS13, SAA, PEDF, A1AT, MIP-1\u03b2, sICAM-1, apolipoprotein AI, PDGF-AA, and GM-CSF . The AUCData for all the CSF host proteins in children with TBM were analysed with GDA, regardless of HIV status, for investigation of combinations of proteins with optimal performance for indication of stroke. The most optimal model was obtained with a combination of four proteins, namely vascular endothelial growth factor (VEGF)-A, complement C5a, Complement factor 1, and BDNF. This four-protein biosignature indicated stroke among children with TBM with AUC of 0.98 , associated to sensitivity of 92.9% (13/14) and specificity of 88.9% (8/9). The positive predictive value (PPV) and negative predictive value (NPV) of the biosignature were 92.9% and 88.9% (54.4%-98.2%), respectively. Both the sensitivity and specificity of the four-protein biosignature remained the same after leave-one-out cross-validation .Of the 69 host proteins measured in serum samples, the levels of D-dimer, ADAMTS13, serum amyloid A (SAA), ferritin, monocyte chemoattractant protein (MCP-1)/CCL2 and growth differentiation factor (GDF)-15 were higher in children who had TBM-related stroke compared to the TBM without stroke group, whereas the concentrations of IL-13 were increased in children with TBM without-stroke compared to TBM with stroke. In addition, we observed trends in increased levels of GDNF, interleukin (IL)-7, MMP-9, lipocalin-2, IL-4, sP-selectin, and myoglobin, and lower levels of CC5a, in children with TBM-related stroke compared to TBM without stroke. After correction for multiple testing using Benjamini-Hochberg procedure, there was no statistical difference in the concentrations of the host proteins between children who had TBM-related stroke and TBM without stroke , Fig 5. Assessment of the abilities of the individual biomarkers to indicate stroke using ROC curve analysis showed that 23 of the 69 proteins, namely GDF-15, D-dimer, ADAMTS13, MCP-`1, IL-4, CC4b, IL-7, ferritin, IL-10, SAA, I-309, CC5a, lipocalin-2, myoglobin, CC2, IL-13, RANTES, IL-1\u03b2, GDNF, serum amyloid P, MIP-1\u03b1, CC3, and PDGF-AB/BB indicated stroke in children with TBM with AUC \u22650.70 . Of noteThe most accurate serum protein biosignature by GDA comprised IL-1\u03b2, IL-4 and alpha-1-Antitrypsin (A1AT), and indicated stroke amongst children with TBM with an AUC of 1.00 , associated to sensitivity of 100.0% (14/14) and specificity of 88.9% (8/9). The PPV and NPV of the biosignature were 93.3% and 100.0% , respectively. Following leave-one-out cross-validation, the performance of the three-protein biosignature remained the same .This study demonstrated that baseline CSF and serum host proteins are differentially expressed between children diagnosed with TBM, with stroke and no-stroke. Although only a few proteins showed statistical difference following correction for multiple testing, it is possible that other proteins which were statistically different prior to correction also have biological relevance as some have been associated with stroke in other studies. Individual CSF and serum host biomarkers, as well as combinations of proteins (biosignatures), demonstrated potential for indicating stroke amongst children diagnosed with TBM. The host biomarkers may be beneficial for early identification of stroke in TBM and timely clinical intervention to prevent poor clinical outcome or further deterioration. Given that neuroimaging is not available in many low resource settings, where most patients develop TBM, a blood- or CSF test based on host protein biomarkers will be beneficial. Such a test can be used to rapidly detect the presence of stroke in patients who are diagnosed with TBM, and thus initiate early appropriate therapy to prevent bad outcome.The differentially expressed serum and CSF proteins described in this study may also help us to better understand the mechanisms of stroke in TBM for development of preventive and therapeutic strategies. Most of TBM pathology is attributed to the host inflammatory response \u201313. A dyA recent trial suggested that aspirin may reduce the incidence and promote resolution of TBM-associated stroke and inflammation, thus improving outcome . AspirinOur study has some important limitations. The main concern is the small sample size, particularly of TBM patients with and without stroke. A further limitation is that we only evaluated the host proteins at one time point (baseline). Thus, changes in the expression of the proteins over the course of the disease or during treatment remains unknown. In addition, the association of host proteins with the severity, volume of infarcts or outcome remains to be investigated. It would also be necessary to assess the correlation of the host biomarkers described in this study with imaging (CT/MRI) findings and clinical characteristics such as age, gender, disease severity (TBM stage), and HIV status. We acknowledge that the lack of MRI imaging, which provides much more detailed neuroimaging than CT, is a limitation . HoweverIn summary, in addition to identifying candidate biomarkers and biosignatures which may be valuable as baseline detectors of stroke in patients diagnosed with TBM, and hence inform patient management practices, findings on the biomarkers evaluated in the current study may provide insight into biomarkers that are important in understanding the biology of stroke in TBM. Identification of patients with stroke at admission as shown in this study and/or early prediction of stroke if shown in future studies, may lead to timely appropriate treatment or the implementation of preventative or therapeutic strategies. Although findings of our study are potentially important, our study was preliminary, and the candidate biomarkers identified warrant further investigations in larger studies.S1 File(XLSX)Click here for additional data file.S1 Table(PDF)Click here for additional data file.S2 TableThe least square (LS) means of all host markers and accuracies in indicating stroke amongst children with TBM are shown. #reported in ng/ml, all other markers are reported in pg/ml.(PDF)Click here for additional data file.S3 TableThe least square (LS) means of all host markers and accuracies in indicating of stroke amongst children with TBM are shown. #reported in ng/ml, all other markers are reported in pg/ml.(PDF)Click here for additional data file. 12 Mar 2021PONE-D-21-04815Serum and cerebrospinal fluid host proteins predict stroke in children with tuberculous meningitisPLOS ONEDear Dr. Solomons,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised by the reviewers, during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Apr 24 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Katalin Andrea Wilkinson, PhDAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. In your Methods section, please provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as:a) a description of any inclusion/exclusion criteria that were applied to participant selection,b) a statement as to whether your sample can be considered representative of a larger population, andc) a brief description of how participants were recruited in the original study.3. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail and who has imposed them . Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see We will update your Data Availability statement on your behalf to reflect the information you provide.http://journals.plos.org/plosone/s/competing-interests by including the following statement: \"This does not alter our adherence to\u00a0 PLOS ONE policies on sharing data and materials.\u201d If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.4.We note that you have a patent relating to material pertinent to this article. Please provide an amended statement of Competing Interests to declare this patent (with details including name and number), along with any other relevant declarations relating to employment, consultancy, patents, products in development or modified products etc. Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, as detailed online in our guide for authors This information should be included in your cover letter; we will change the online submission form on your behalf.http://journals.plos.org/plosone/s/competing-interestsPlease know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: 5.We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:https://scholar.sun.ac.za/handle/10019.1/106647In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Many thanks for asking me to review this paper. The manuscript describes analysis undertaken following your larger studies which have investigated a wider spectrum of protein changes in patients with TBM and those without. I agree with the authors that analysis of proteins related to stroke, an often disabling or life threatening sequelae in TBM, warranted further analysis. Knowledge gained here will contribute to our understanding of the mechanisms which underpin stroke pathogenesis within TBM. However, I have a few comments to be addressed:1. Major: One of the conclusions of the proteins identified have the potential to contribute to management by 'predicting' stroke and therefore identifying those who may benefit from preventative therapy such as anti-platelet therapy. Given the design of this study where proteins were identified in blood and CSF samples of patients at baseline who either had or had not already developed stroke (ie imaging was performed at the same timepoint as blood/CSF samples taken), I think this conclusion cannot be drawn from this study. These proteins may rather be describing protein level mechanisms occurring during or more likely following infarct, and may differ in their nature to protein abnormalities which may be present prior to stroke. This needs to be clear in the discussion. As it stands this is a major conclusion of the study which I think is misleading. This is important as future research may (as the authors elude to) concentrate on developing biomarker tests (including those to be used as point of care tests) to understand risk of stroke sequelae and inform clinical management.2. Minor: I agree with the authors that more detailed analysis of the nature of stroke would contribute to the paper and therefore its absence is a limitation of the study. In the least would it be possible for more detailed information on the time of onset of the stroke in order to ensure the findings here differentiated stroke which occurred as part of the TBM presentation, and those which may have occurred as part of a separate illness? It states in the manuscript that those with radiological evidence of infarct were assigned to the TBM with stroke group, however there is no indication that more rigorous analysis of the clinical/radiological data included within this group were only those with stroke occurring as part of this episode of TBM.3. Minor: Baseline demographics are relatively sparse. Were there other noticeable differences between the TBM-stroke and TBM-no stroke group in terms of clinical presentation ie proportion of definite vs probable cases, severity of presentation/BMRC grade, other radiological features ?Reviewer #2:\u00a0This is a pilot study examining potential biomarkers of stroke in patients with tuberculous meningitis (TBM). Stroke is a key factor contributing to poor outcomes in TBM yet is currently under-studied and poorly understood. Therefore, this is a worthwhile study in starting to address some of the unanswered questions about TBM-associated stroke, including the need for diagnostic and predictive tools that can guide patient management. The pilot data generated are certainly interesting and could serve as valuable preliminary data to inform future studies that aim to address the question of biomarkers on a larger scale. Some of the key limitations to the study have been addressed, including the small sample size, absence of infarct classification, and lack of serial sampling. However, I think there are other important limitations that also require attention, including the combination of CT and MRI images and the lack of serial imaging to examine infarct evolution. These factors could significantly change the stroke and non-stroke groups and can therefore not be overlooked. I have also raised some questions about the choice of control group and the lack of a reported association between the controls and cases (unless I missed this??).Methods\u2022 What was the definition of stroke on imaging? Ie: were small lacunar infarcts considered equally with large vascular territory infarcts? Similarly, were only established infarcts considered, or also evolving/acute infracts as would be seen on DWI?\u2022 The control group is quite heterogenous in their pathology and it seems like some had neurological disease while others did not \u2013 were CSF samples collected from all these controls? What was the eligibility criteria for the control group?Results\u2022 On page 15, line 180 the authors refer to the AUC of 24 of the 69 markers, which 24 markers are these and how were they selected?\u2022 What was the difference in biomarker concentrations between the TBM and control cohorts in CSF and blood? A possible caution for the analysis would be the heterogeneity of the control group with some having CNS pathology while others do not \u2013 this may factor into the selection of controls for comparison or the interpretation of findings\u2026\u2022 Also, from Figure 2 (and 3) it looks like the biomarker concentrations between the TBM with stroke and not-TBM cohorts are very similar \u2013 was a statistical comparison done between these groups? If so, what were the results? I think this is an important comparison to make so that the specificity of these biomarkers for TBM stroke can be established.Discussion\u2022 The authors acknowledge the key limitations of this study, ie: small sample size, single time point testing and the grouping of heterogenous imaging data into a homogenous group. Further limitations the authors should address include 1) that they used a combination of CT and MRI when we know from previous work done by this group that MRI has better sensitivity in showing location, number and temporal resolution of infarcts , 2) that they did not look at the evolution of infarcts over time \u2013 TBM patients can show signs of infarction over the first weeks of treatment that are not present on admission , this would have been a key analysis to establishing the predictive power of their biomarker signatures for stroke\u2022 I found it interesting that the multi-marker signatures with high predictive value in CSF and blood largely comprise biomarkers that did not come up as significant on the stroke vs non-stroke comparison; why do the authors think this may be the case?Tables and figuresTable 2 and 3\u2022 These tables are a bit too full, I would suggest editing the column headings to make them shorter**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article digital diagnostic tool,\u00a0 14 Apr 2021Point by Point Responses to reviewersJournal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.Responses: We have made changes to the reference list to include a reference suggested by reviewer 1. The following reference was included:[34] Pienaar M, Andronikou S, van Toorn R. MRI to demonstrate diagnostic features and complications of TBM not seen with CT. Childs Nerv Syst. 2009;25: 941\u2013947. doi:10.1007/s00381-008-0785-3When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfResponse: We have ensured that our manuscript meets PLOS ONE\u2019s style requirements, including for file naming.2. In your Methods section, please provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as:a) a description of any inclusion/exclusion criteria that were applied to participant selection,Response: The study setting section under methods of the manuscript was revised to clearly state the inclusion/exclusion criteria. Lines 86-92.b) a statement as to whether your sample can be considered representative of a larger population, andResponse: We have indicated in the methods section that our sample is a representative of the typical patients from our study community (Lines 85-86)c) a brief description of how participants were recruited in the original study.Response: We have revised the study setting section to describe how the participants were recruited in the original study lines 81-87 \u201cBriefly, in these studies the participants were enrolled at Tygerberg Academic Hospital, Cape Town, South Africa between November 2016 and November 2017. Children with suspected TBM are referred from primary care day hospitals, district and secondary level hospitals to our institution to establish the diagnosis of TBM and to treat the complications associated with advanced disease . We enrolled 47 children presenting with signs and symptoms suggestive of meningitis and requiring routine diagnostic assessment including lumbar puncture for CSF investigations\u201dhttp://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.3. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail and who has imposed them . Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see We will update your Data Availability statement on your behalf to reflect the information you provide.Response: We have uploaded the minimal anonymized data set necessary to replicate our study findings as a supporting information file during re-submission (S1 File)http://journals.plos.org/plosone/s/competing-interests by including the following statement: \"This does not alter our adherence to PLOS ONE policies on sharing data and materials.\u201d If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.4.We note that you have a patent relating to material pertinent to this article. Please provide an amended statement of Competing Interests to declare this patent (with details including name and number), along with any other relevant declarations relating to employment, consultancy, patents, products in development or modified products etc. Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, as detailed online in our guide for authors This information should be included in your cover letter; we will change the online submission form on your behalf.http://journals.plos.org/plosone/s/competing-interestsPlease know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: Response: We have amended statement of Competing Interests to declare the patent and confirmed that this does not alter our adherence to all PLOS ONE policies on sharing data and materials. Our amended statement is as follows: NC, CM, GW and RS are listed as inventors on an International Patent Application entitled \u201cCerebrospinal fluid and blood-based biomarkers for the diagnosis of tuberculosis meningitis\u201d (PCT/IB2019/054259), filing date: 23 May 2019. NC and GW are listed as inventors on another patent application entitled \u201cMethod for diagnosing tuberculous meningitis\u201d (PCT/IB2015/052751), filing date: 15 April 2015. These applications do not generate any royalties for the inventors. These does not alter our adherence to PLOS ONE policies on sharing data and materials. 5.We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:https://scholar.sun.ac.za/handle/10019.1/106647In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.https://scholar.sun.ac.za/handle/10019.1/106647 on the sections that were adapted from this publication.Response: We have rephrased the duplicated texts outside the methods section and have referenced the original publication that appears in Original reference: 17. Manyelo CM, Solomons RS, Snyders CI, Manngo PM, Mutavhatsindi H, Kriel B, et al. Application of Cerebrospinal Fluid Host Protein Biosignatures in the Diagnosis of Tuberculous Meningitis in Children from a High Burden Setting. Giovarelli M, editor. Mediators of Inflammation. 2019;2019: 7582948. doi:10.1155/2019/7582948Reviewer's Responses to QuestionsComments to the Author1. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: Many thanks for asking me to review this paper. The manuscript describes analysis undertaken following your larger studies which have investigated a wider spectrum of protein changes in patients with TBM and those without. I agree with the authors that analysis of proteins related to stroke, an often disabling or life threatening sequelae in TBM, warranted further analysis. Knowledge gained here will contribute to our understanding of the mechanisms which underpin stroke pathogenesis within TBM. However, I have a few comments to be addressed:1. Major: One of the conclusions of the proteins identified have the potential to contribute to management by 'predicting' stroke and therefore identifying those who may benefit from preventative therapy such as anti-platelet therapy. Given the design of this study where proteins were identified in blood and CSF samples of patients at baseline who either had or had not already developed stroke (ie imaging was performed at the same timepoint as blood/CSF samples taken), I think this conclusion cannot be drawn from this study. These proteins may rather be describing protein level mechanisms occurring during or more likely following infarct, and may differ in their nature to protein abnormalities which may be present prior to stroke. This needs to be clear in the discussion. As it stands this is a major conclusion of the study which I think is misleading. This is important as future research may (as the authors elude to) concentrate on developing biomarker tests (including those to be used as point of care tests) to understand risk of stroke sequelae and inform clinical management.Response: We thank the reviewer for this comment and the suggestions. Indeed the proteins identified in this study may describe protein level mechanisms occurring during or more likely following already established infarcts and may differ from the levels that may be seen prior to stroke. The major conclusion of our initially submitted version may be misleading, and we have considered the reviewer\u2019s suggestion and revised our conclusion. The protein biomarkers identified in this study may be useful for detection or indication of stroke in patients diagnosed with TBM at admission. This may especially be beneficial in settings where neuroimaging is not available. The future research could then concentrate on evaluating the abilities of these proteins and other proteins for prediction of future stroke, by following TBM patients over time, and observe if those predicted to have stroke will develop stroke over a period of time.2. Minor: I agree with the authors that more detailed analysis of the nature of stroke would contribute to the paper and therefore its absence is a limitation of the study. In the least would it be possible for more detailed information on the time of onset of the stroke in order to ensure the findings here differentiated stroke which occurred as part of the TBM presentation, and those which may have occurred as part of a separate illness? It states in the manuscript that those with radiological evidence of infarct were assigned to the TBM with stroke group, however there is no indication that more rigorous analysis of the clinical/radiological data included within this group were only those with stroke occurring as part of this episode of TBM.Response: In the 14 children with TBM and stroke, 3 children presented 2-14 days prior to admission which was considered compatible with the prolonged symptom duration seen in TBM, and in 6 children hemiplegia was the reason for admission. In the 5 children without hemiplegia, acute radiological infarction was detected on admission CT brain (within 24-48 hours).3. Minor: Baseline demographics are relatively sparse. Were there other noticeable differences between the TBM-stroke and TBM-no stroke group in terms of clinical presentation ie proportion of definite vs probable cases, severity of presentation/BMRC grade, other radiological features ?Response: We thank the reviewer for this comment. We have revised the baseline demographics in Table 1 and have now included other patient characteristics/features including as \u2018Admission characteristics\u2019 and \u2018other radiological features\u2019.Reviewer #2: This is a pilot study examining potential biomarkers of stroke in patients 1with tuberculous meningitis (TBM). Stroke is a key factor contributing to poor outcomes in TBM yet is currently under-studied and poorly understood. Therefore, this is a worthwhile study in starting to address some of the unanswered questions about TBM-associated stroke, including the need for diagnostic and predictive tools that can guide patient management. The pilot data generated are certainly interesting and could serve as valuable preliminary data to inform future studies that aim to address the question of biomarkers on a larger scale. Some of the key limitations to the study have been addressed, including the small sample size, absence of infarct classification, and lack of serial sampling. However, I think there are other important limitations that also require attention, including the combination of CT and MRI images and the lack of serial imaging to examine infarct evolution. These factors could significantly change the stroke and non-stroke groups and can therefore not be overlooked. I have also raised some questions about the choice of control group and the lack of a reported association between the controls and cases (unless I missed this??).Response: We thank the reviewer for reviewing our work and for all the suggestions. Indeed our work is a pilot study examining the differences in biomarker concentration between TBM patients with stroke and those without stroke, and to further look at potential biomarkers of stroke in patients with TBM. We have considered all the comments and suggestions raised by the reviewer and have responded to all the points below.Methods\u2022 What was the definition of stroke on imaging? Ie: were small lacunar infarcts considered equally with large vascular territory infarcts? Similarly, were only established infarcts considered, or also evolving/acute infracts as would be seen on DWI?Response: Radiological arterial ischemic infarction was defined as neuroimaging evidence of infarction, i.e. interruption of blood flow eventually resulting in focal encephalomalacia. Mostly small areas of arterial ischemic infarction in the territory of the middle cerebral artery perforators i.e basal ganglia and internal capsule, were observed. When CT was performed established arterial ischemic infarcts were considered, and when MRI was performed both established and evolving arterial ischemic infarction were considered (Line 103-107 in the revised version)\u2022 The control group is quite heterogenous in their pathology and it seems like some had neurological disease while others did not \u2013 were CSF samples collected from all these controls? What was the eligibility criteria for the control group?Response: All the study participants were eligible for inclusion into this study if they presented with signs and symptoms suggestive of meningitis, and requiring assessment to establish TBM diagnosis or an alternative diagnosis. The CSF samples were collected for the purpose of routine diagnostic assessment, and additional CSF samples were collected from each patient for the purpose of this study. So, the CSF collection (lumbar puncture) was not done specifically for this study. Written informed consent for inclusion in this study was obtained from the caregivers.Results\u2022 On page 15, line 180 the authors refer to the AUC of 24 of the 69 markers, which 24 markers are these and how were they selected?Response: We thank the reviewer for this comment. The 24 of the 69 markers referred to here are listed in S2 Table in the initial submission. To make this section more clear, the 24 of the 69 markers were listed in the revised manuscript (Lines 193-197). The 24 markers were selected on the basis of area under the curve, whereby the markers were arranged (sorted) according to the highest AUC, and those with AUC of at least 0.70 were considered. As similar issue would apply to line 236 (of previous version), we also corrected this section by listing the 23 of the 69 serum markers on the revised manuscript (Line 251-255).\u2022 What was the difference in biomarker concentrations between the TBM and control cohorts in CSF and blood? A possible caution for the analysis would be the heterogeneity of the control group with some having CNS pathology while others do not \u2013 this may factor into the selection of controls for comparison or the interpretation of findings\u2026Response: The difference in biomarker concentrations between the TBM and control cohorts in CSF and blood were not reported in the current manuscript. We previously reported on the differences in biomarker concentrations between TBM and control cohorts from the same study participants in CSF and blood In the current manuscript we focused specifically on the differences in biomarker concentrations between TBM patients with stroke and TBM patients without stroke, and further included the no-TBM controls, which were all part of the previous cohort.We agree with the reviewer that the heterogeneity of the control group may be a possible caution, however we were including children who were presenting with signs and symptoms suggestive of TBM, as in a practical clinical setting all these children may be assessed to establish a TBM diagnosis or to rule out TBM. We then measured biomarker concentrations in all the study participants prior to final diagnosis of TBM. Upon final diagnosis, all the children with alternative diagnosis were classified as no-TBM. It may be good in future to include control cohort with CNS pathology such as viral meningitis, bacterial meningitis, and fungal meningitis.\u2022 Also, from Figure 2 (and 3) it looks like the biomarker concentrations between the TBM with stroke and not-TBM cohorts are very similar \u2013 was a statistical comparison done between these groups? If so, what were the results? I think this is an important comparison to make so that the specificity of these biomarkers for TBM stroke can be established.Response: Thank you for this comment. The statistical comparison for TBM with stroke and not-TBM were done, however as the main aim was to compare the differences in biomarker concentration between TBM patients with stroke and without stroke, we did not report the statistical comparison for TBM with stroke and not-TBM in the submitted version. However, we have considered the reviewers suggestion and have now included the statistical comparison of CSF and serum biomarker concentrations between TBM with stroke and not-TBM in S2 and S3 tables (Revised S2 and S3 Tables were resubmitted), in the revised version. Furthermore, texts were inserted in lines 190-191, and lines 249-250 to mention how many CSF and serum proteins were statistically different between TBM-related stroke and not-TBM, respectively. As the aim was to mainly identify biomarkers that are different between TBM with stroke compared to TBM without stroke, and can be used to detect stroke or guide therapy in patients who are finally diagnosed with TBM, we then put focus of our results on TBM with stroke compared to TBM without stroke. Thus, the specificity of these biomarkers may only be important between TBM patients with stroke and TBM without stroke.Discussion\u2022 The authors acknowledge the key limitations of this study, ie: small sample size, single time point testing and the grouping of heterogenous imaging data into a homogenous group. Further limitations the authors should address include 1) that they used a combination of CT and MRI when we know from previous work done by this group that MRI has better sensitivity in showing location, number and temporal resolution of infarcts , 2) that they did not look at the evolution of infarcts over time \u2013 TBM patients can show signs of infarction over the first weeks of treatment that are not present on admission , this would have been a key analysis to establishing the predictive power of their biomarker signatures for strokeResponses:1) The authors acknowledge that the lack of MRI imaging, which provides much more detailed neuroimaging than CT, is a limitation. However, in TB endemic settings, the cost of MRI is often prohibitive. We definitely aim, with careful planning, to use MRI as the primary imaging modality in prospective studies. (Lines 347-351 in the revised version)2) We thank the reviewer for this comment, and we have revised the discussion to include this as one of the limitations of our study (Line 351-355). We acknowledge that it would be good in the future study to follow-up patients and look at the evolution of infarcts over time. As the reviewer has suggested, this will allow to establish the predictive power of the biomarker signatures over time. The patient were recruited into this study as part of our previous studies in which we collected CSF and blood samples, and neuroimaging data only at baseline. This work will guide future work in which we could follow-up patients and look at evolution of infarcts and biomarker signature predictive abilities over time. \u2022 I found it interesting that the multi-marker signatures with high predictive value in CSF and blood largely comprise biomarkers that did not come up as significant on the stroke vs non-stroke comparison; why do the authors think this may be the case?Response: We thank the reviewer for raising this and we have acknowledged this as a possible limitation in the revised version (line 358-363). Indeed the multi-marker signatures comprised largely of biomarkers that were not significantly different between TBM-related stroke and no stroke. This may be due to the smaller sample size, and hence it will be good to further investigate this biosignatures in a larger cohort, to determine if accuracies of the multi-marker signature were true results. However, we put more focus in the individual biomarkers that were significantly different between stroke and no-stroke and can contribute to the understanding of biology of stroke, as well as indication of stroke at baseline. However, all our findings require further research in a larger study.Tables and figuresTable 2 and 3\u2022 These tables are a bit too full, I would suggest editing the column headings to make them shorterResponse: We thank the reviewer for this suggestion. We have edited the column headings on the tables to make them shorter.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 19 Apr 2021Serum and cerebrospinal fluid host proteins indicate stroke in children with tuberculous meningitisPONE-D-21-04815R1Dear Dr. Solomons,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Katalin Andrea Wilkinson, PhDAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 22 Apr 2021PONE-D-21-04815R1 Serum and cerebrospinal fluid host proteins indicate stroke in children with tuberculous meningitis Dear Dr. Solomons:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofAssociate Professor Katalin Andrea Wilkinson Academic EditorPLOS ONE"} +{"text": "Secondly, we aimed to explore the fit of an equation previously used in cyclists and runners in a cohort of well-trained, competitive cross-country skiers for calculation of LTv. Thirdly, we aimed to investigate if a new LTv could still be calculated after a period of regular training only by providing a new MAS.To investigate the relationships between maximal aerobic speed (MAS), lactate threshold in per cent of peak oxygen uptake (LT) and velocity at LT (LT2max), peak oxygen uptake in double poling (DP-VO2peak), oxygen cost of double poling (CDP), LT, and LTv. Thirty-five skiers volunteered to be tested 3\u2009months later to evaluate potential changes in LT and LTv.Ninety-five competitive cross-country skiers were tested for maximal oxygen uptake . LT did not show a significant impact on LTv. The product of MAS\u00b7LT precisely predicted LTv at baseline , and by only measuring MAS, a new LTv could be accurately calculated 3\u2009months later in a sub-set of the initial 95 skiers (n\u2009=\u200935).Velocity at LT was mainly determined by MAS (v in DP tested in a laboratory. LTv seemed to be predominantly determined by MAS, and we suggest to put more focus on MAS and less on LT and LTv in regular testing to evaluate aerobic performance capacity in DP.The results suggest that LT has minor impact on LT Maximal2max . As MLSS2max . Only modified to running velocity, the same equation showed similar results in a large cohort of recreational to elite runners in v or power at LT are often displayed together with improvements of either VO2max or C, or both were recruited and included for the baseline analyzes in the present study. Thirty-five of the participants volunteered to perform post-tests 3\u2009months later. All tests were performed in the first half of the preparation period, i.e., April to September. The recruited skiers ranged in performance from mid-junior level to top national senior level. Subject and physiological characteristics are presented in The study was conducted in accordance with the Declaration of Helsinki, and the regional ethical committee (REC) and the ethical board at the University of Southeastern Norway approved the study. All participants gave their written informed consent after being provided oral and written information about the study protocol.2maxtest in running (RUN-VO2max). The second test day consisted of a sub-maximal DP-test on a treadmill to measure LT, LTv, and oxygen cost of DP (CDP), and an incremental peak oxygen uptake in DP (DP-VO2peak) test. All preparation procedures prior to testing are described previously , controlled for speed and incline. The starting intensity was set to 7\u20138 and 9\u201310\u2009km\u00b7h\u22121 for females and males, respectively, and 6% inclination. Within the first minute of the test, inclination increased to 8%, while only speed was increased by 0.5\u2009km\u00b7h\u22121 every 30\u2009s after that. The test terminated at voluntary fatigue, and VO2max was calculated by the three highest consecutive VO2measurements. In addition to voluntary fatigue and flattening of the VO2 curve, heart rate at \u226598% of HRmax, RER\u2009\u2265\u20091.05, and rate of perceived exertion \u226517 was used to evaluate if VO2max was achieved. All VO2 measurements were performed with a MetaLyzer Cortex II , with measurements every 10\u2009s. Prior to all tests, flow sensors were calibrated with a 3-L calibration syringe, and O2 analyzers were calibrated with certified calibration gases (16% O2/4% CO2) and ambient air. All HR measurements were performed with Polar s610 monitors or the participants individual HR monitor.The first day of testing started with a self-conducted warm-up procedure of 10\u2009min, before the incremental RUN-VOv, and CDP assessments, all participants were familiarized to the rollerskiing treadmill with a 30-min workout on different skiing velocities. After termination of the treadmill familiarization, measurements of [La\u2212]b, heart rate (HR), and oxygen consumption (VO2) were measured in 4-min work periods while double poling at different sub-maximal intensities to evaluate LT, LTv, and CDP. The first work period started with an intensity assumed to be approximately 60% of DP-VO2peak. This corresponded to 4% inclination and 10\u201311.5\u2009km\u00b7h\u22121 for males and 6\u20138\u2009km\u00b7h\u22121 for females. After the first work period, the velocity was increased by 1\u20133\u2009km\u00b7h\u22121 for subsequent work periods until [La\u2212]b values exceeded the LT values. The individual LT value was calculated by the individual warm-up lactate value +2.3\u2009mmol\u00b7L\u22121. This protocol is presented and evaluated in 2 during the last minute of every work period was used to calculate CDP and LT. A Lactate Scout+ was used to measure whole blood lactate values.Prior to the LT, LT2peaktest was performed 5\u2009min after the LT and CDP assessments. For 47 participants, the protocol presented in \u22121 for females and males, respectively. Every 30\u2009s, the speed was increased by 1\u2009km\u00b7h\u22121 until 10 and 18\u2009km\u00b7h\u22121 was reached for females and males, respectively. Increments of 0.5\u2009km\u00b7h\u22121 every 30\u2009s were then provided until exhaustion. For the remaining participants (n\u2009=\u200948), the protocol presented in \u22121 and 6% inclination. While inclination was held constant, the speed increased by 1\u2009km\u00b7h\u22121 every minute until exhaustion for both genders. In both protocols, voluntary exhaustion was defined as the time where the participants no longer were able to maintain their position at the treadmill. The test terminated when the subjects reached a pre-defined mark 1\u2009m behind the starting position on the treadmill. By both protocols, the DP-VO2peak was defined as the mean of the two highest consecutive VO2measurements. MAS was calculated as the product of DP-VO2peak divided by CDP at 80% of DP-VO2peak for all participants. To calculate LTv, an equation based on A DP-VOv is the velocity at LT, LT is LT in percent of DP-VO2peak, and CDP is the oxygen cost of DP.where LT2peak, CDP, and LT. Thus, parametric statistics were used. Mean\u2009\u00b1\u2009SD and inter-individual variability expressed as coefficient of variance (CV) were used as descriptive statistics for all variables. Independent sample t-tests and paired sample t-tests were used to evaluate differences between genders at baseline and physiological differences from pre to post (n\u2009=\u200935), respectively. To evaluate possible relationships between variables at baseline and changes in variables over time (delta correlations), correlation coefficients r was used from Pearson\u2019s bivariate tests. Since the data material consisted of both males and females, partial correlations corrected for gender were also performed. Standard error of the estimate (SEE) was calculated by linear regression analyses.The data material was found to be normally distributed by use of quantile\u2013 quantile (QQ) plots and normality tests for DP-VOp\u2009<\u20090.05. The statistical package for social science, version 26 was used for all statistical analyses.In all two-tailed tests, the level of significance was set to a value of DP compared to females while no difference was observed in LT independent of genders, while LT did not show any correlation at all and CDP correlated significantly with LTv.Baseline correlations are presented in v and was n at all . Both DPpost\u00b7LTpre). LTv could be calculated at post-test within a range of 1.0\u2009km\u00b7h\u22121 . In line with the baseline correlations, no significant delta correlation was apparent between \u0394LTv and \u0394LT (r\u2009=\u20090.11). However, \u0394MAS correlated moderately negatively with \u0394LT , which means that an improved MAS resulted in a lower LT and a reduced MAS provided higher LTvalues.By the use of the previously measured LT and a new MAS that MAS showed a major impact on LTv both at baseline and over time, (3) that LT was not associated with LTv, and (4) that only by measuring MAS, a subsequent LTv could be strongly predicted after 3\u2009months of regular training.The main findings of the present study were (1) that the same equation as in v was precisely calculated within a range of 0.4\u2009km\u00b7h\u22121 . In contrast, LT did not show a significant impact on LTv. These results support previous findings in large cohorts of competitive cyclists , and a VO2max/VO2peak test are needed to calculate LTv. This protocol may not last for more than 20\u201325\u2009min. Consequently, competitive cross-country skiers could reduce time for physiological testing of aerobic variables by approximately 50%.By only testing for VOresearch suggest v on aerobic endurance performance has been reported to be high in several studies in running should be performed to confirm the present findings. In addition, evaluation of these relationships and the direct impact on performance in longer cross-country skiing events (10\u201390\u2009km) and in other classical and skating techniques are warranted.The large number of participants in the present study makes the results statistically strong. However, controlled training interventions aimed to impose significant adaptations in either VOv were minorly influenced by LT and merely a product of MAS. In addition, only by providing new MAS, a subsequent LTv could be strongly predicted after 3\u2009months of training.Both baseline and adaptations in LTThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Regional Ethics Committee of Southeastern Norway and the Institutional Research Board at the University of Southeastern Norway. Written informed consent to participate in this study was provided by the participants. For all participants under the age of 18, written informed consent was provided from their legal guardian/next of kin.All authors contributed significantly to the design and planning of the study. \u00d8S and J-MJ led the interpretation of data, while J-MJ led the writing of the manuscript. J-MJ, \u00d8S, and AS took part in the data collection. All authors contributed to the different data analyzes and edited, reviewed, and approved the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."} +{"text": "Patients with signs of post-neurosurgical meningitis (n = 30) had lower median values of glucose and higher values of cell count, neutrophils, lactate, protein, 3-(4-hydroxyphenyl)lactic acid (p-HPhLA), and interleukin-6 (IL-6) than patients without signs of post-neurosurgical meningitis (n = 52). ROC analysis for IL-6 and p-HPhLA resulted in 0.785 and 0.734 values of the area under the ROC curve, with sensitivity 96.30 and 66.67%; specificity 54.17 and 82.69%, respectively. IL-6 should be considered as a non-specific biomarker, in contrast to the microbial metabolite p-HPhLA. If the concentration of p-HPhLA was more or equal to 0.9 \u00b5mol/L, the risk of bacterial complications was 9.6 times higher. p-HPhLA is a promising marker for the prognosis of post-neurosurgical meningitis, and its determination on a larger group of post-neurosurgical patients can subsequently prove its diagnostic significance for the verification of CNS infections.The search for new potential biomarkers for the diagnostics of post-neurosurgical bacterial meningitis is required because of the difficulties in its early verification using results of the routine laboratory and biochemical analyses of the cerebrospinal fluid (CSF). The goal of the study was to determine the contents of the aromatic metabolites and biomarkers in the CSF samples of the post-neurosurgical patients ( The diagnostics of bacterial complications in patients of neurosurgical units is an important issue as these patients could be compromised by hospital-acquired or commensal bacteria, and they could have non-infectious complications that have similar symptoms, such as fever or decreased consciousness. Bacterial meningitis develops in post-neurosurgical patients after craniectomy, craniotomy , raised CSF protein, and hypoglycorrhachia, which are non-specific criteria and may indicate non-infectious diseases\u2014for example, tumors ,3,4,5. CMetabolomics is actively used in searching for new biomarkers of bacterial meningitis. In a recent study, the authors compared concentrations of about 200 metabolites in CSF samples using liquid chromatography coupled to tandem mass spectrometry (HPLC-MS/MS) from patients with bacterial or viral meningitis and non-inflamed controls. The CSF levels of phosphatidylcholines (\u00b5mol/L levels) were significantly higher in patients with bacterial meningitis than in controls, while its serum concentrations remained relatively unchanged and had higher sensitivity and negative predictive values than the CSF lactate or cell count . Phosphap-HPhLA) acids are tyrosine and phenylalanine metabolites of microbial origin [Some aromatic metabolites of tyrosine and phenylalanine were revealed to increase in the serum of patients with severe infectious diseases such as sepsis and septl origin , and thel origin and HPLCl origin in the CThus, the goal of the study was to determine the contents of the aromatic metabolites and biomarkers in the CSF samples of the post-neurosurgical patients and their potential diagnostical significance for the evaluation of the risk of post-neurosurgical meningitis.n = 82) were collected and frozen at \u221230 \u00b0C in the Federal Research and Clinical Center of Intensive Care Medicine and Rehabilitology as it was previously described [p-HPhLA) were measured using GC-MS obtained from Thermo Scientific [The residues of CSF samples after routine laboratory analyses from post-neurosurgical patients . Biomarkn = 42), malignant tumor (n = 18), stroke (n = 8), intracranial injury (n = 5), cyst (n = 4), hydrocephalus (n = 3), bacterial meningitis (n = 2) were divided into two groups. The first group included patients with signs of post-neurosurgical meningitis. The patients of the second group did not have sufficient signs of bacterial meningitis. The criteria of post-neurosurgical meningitis are listed below.Information about the main disease and complications, clinical signs of infection, results of the CT scan, antimicrobial treatment, and laboratory analyses of the serum and CSF\u2014including examination for cell count, protein, lactate, glucose levels, and microbiological culture from post-neurosurgical patients\u2014was obtained from medical documentation retrospectively. Patients with a benign tumor :-Hyperthermia/hypothermia;-The presence of the draining devices.Other non-specific criteria:If there were no major criteria, the patient was classified in the group with signs of post-neurosurgical meningitis when there were 3 or more signs of minor criteria. In total, there were 30 from 82 patients with signs of post-neurosurgical meningitis .https://medstatistic.ru/calculators/calchi.html (accessed on 9 December 2021)).One CSF sample from each patient was used for statistical analysis. The accumulation of data and the primary analysis were carried out in Microsoft Office Excel 2019. Statistical data analysis was carried out using the IBM SPSS Statistics 25.0 application package and online calculators ; for multiple pairwise comparisons, the Bonferroni correction was used. Correlation analysis was carried out using Spearman\u2019s nonparametric correlation coefficient. Values are reported as medians and interquartile ranges. The significance level was chosen equal to 0.05 . To assess the quality of various quantitative indicators, ROC analysis with the area under the ROC curve was used.Additionally, the following parameters were evaluated: precision or positive predictive value, negative predictive value, accuracy, and odds ratio:The main criteria for the success of the predictor are a high area under the ROC curve and the lower bound of the confident interval being not less than 50% for the odds ratio, sensitivity, specificity, positive and negative predictive values, and accuracy.n = 12) of the group of patients with signs of post-neurosurgical meningitis (n = 30) was the patients (n = 8) or had positive bacterial CSF culture (n = 6). To classify the majority of patients in this group (n = 18), non-specific criteria for post-neurosurgical meningitis were used, which should be considered as potentially false results, as they could be caused by the main diagnoses of these patients (2/3 of the patients had tumors as the main diagnosis). This situation is the limitation of our study\u2014although, this is a well-known problem of the post-neurosurgical meningitis diagnostics described in different studies were analyzed using GC-MS for a number of aromatic metabolites [p-HPhLA. Most of these acids could not be statistically evaluated as their concentrations were less than the limit of the quantitation in most samples. The concentrations of BA, HVA, and p-HPhLA together with biomarkers are demonstrated in The results of laboratory tests of the CSF for two groups of patients were obtained from medical records and are accumulated in abolites . They arp-HPhLA and without (n = 25) signs of systemic inflammation, and there was a group of patients without information about both the total leukocyte count and C-reactive protein in the serum samples collected on the same day of the CSF analysis (n = 26). The ROC analysis results for the p-HPhLA and systemic inflammation are demonstrated in patients , and we p-HPhLA is known to correlate with the serum lactate, and we revealed a moderately positive statistically significant correlation between the CSF levels of p-HPhLA and lactate [r > 0.5, p = 0.01). Other correlation coefficients are demonstrated in In addition, = 0.01) . IL-6 coIn this study, we determined the contents of aromatic metabolites and biomarkers in the CSF samples of post-neurosurgical patients to reveal their potential diagnostical significance for the evaluation of the risk of post-neurosurgical meningitis. Post-neurosurgical meningitis may develop in post-neurosurgical patients regardless of the main disease . This fact is the reason for the heterogeneity of the patients\u2019 cohort included in the study, and it is diagnostically important to identify a marker of post-neurosurgical meningitis, which will not depend on the main disease but will indicate an infectious process.Several biomarkers were studied in our research, and only one of them (IL-6) demonstrated potential diagnostic significance for the prognosis of post-neurosurgical meningitis. Serum IL-6 is used as a diagnostic and prognostic biomarker for inflammation, autoimmune disorders, cancer ,23, cardIL-6 is one of the most important cytokines involved in the inflammatory response in the CNS, where it is produced by endothelial cells, astrocytes and glial cells as a response to various injuries and is also involved in neurogenesis. It induces the synthesis of acute-phase proteins and contributes to blood\u2013brain barrier damage . Severaln = 75) with an external ventricular drainage, which had been inserted predominantly because of poor-grade subarachnoid hemorrhage, the intrathecal IL-6 concentrations correlated with the clinical course and ventriculostomy-related infection incidence. The predictive value of CSF IL-6 in patients with an external ventricular drainage for the diagnosis of CNS infection prior to clinically manifesting meningitis was 2700 pg/mL. In another study [n = 40) and external ventricular drain-associated ventriculitis showed that the CSF IL-6 levels higher than the threshold of 4064 pg/mL were significantly associated with the probability of ventriculitis. In another prospective study [n = 106) [In our study, the IL-6 cut-off value (270 pg/mL) was lower compared with other studies. In a prospective study of the Cer study , the lever study from patve study , all patn = 106) , IL-6 wan = 106) ,31,32,34Patients with signs of post-neurosurgical meningitis manifested statistically significant higher median values of IL-6 manifested 3 times higher median values of p-HPhLA (n = 52). The CSF levels of p-HPhLA in patients with signs of post-neurosurgical meningitis (n = 30) were higher than the cut-off value (0.9 \u00b5mol/L) in 20 cases without sufficient signs of meningitis . Seven of them had at least signs of systemic inflammation in serum (C-reactive protein more than 7 mg/L and leukocyte count more than 1 \u00d7 1010/L); for two patients, there was no information about the serum levels of C-reactive protein and leukocyte count in the serum samples collected on the same day of the CSF analysis.Special attention should be paid to the patients (ningitis b who hadp-HPhLA accumulation in CSF (p-HPhLA) enter the bloodstream from the gut at constant low concentrations, as demonstrated in serum samples of healthy controls [p-HPhLA in the serum by analogy with the critically ill patients as in previous studies and by the similar results of the ROC analysis of the CSF level of p-HPhLA and inflammation in CSF and serum , the main limitation is the value of the lower bound of the confident interval for sensitivity (less than 50%), which may be explained by the insufficient sample size. Further studies on a larger group of patients may improve the statistical results. Additionally, the analysis of p-HPhLA in serum and CSF samples taken simultaneously is needed and will reveal its pathophysiological and diagnostic significance for the verification of CNS infections.The diagnostics of post-neurosurgical meningitis as an inflammation complication in post-neurosurgical patients is an important and difficult problem. The absence of positive CSF Gram staining or microbiological culture in most cases of post-neurosurgical meningitis forces the use of non-specific criteria, such as cell count, neutrophils, lactate, protein, and glucose levels, of which values could be different from the norm because of the main disease or other non-infectious reasons. Thus, the search for new and specific criteria of nosocomial meningitis is an actual issue. In our study, we evaluated the concentrations of different biomarkers and some aromatic metabolites, including those of microbial origin, in patients with and without signs of post-neurosurgical meningitis. The results of our retrospective study demonstrated that IL-6 is a non-specific biomarker and its elevated concentrations in patients with signs of post-neurosurgical meningitis could be due to both meningitis and main disease. At the same time,"} +{"text": "Decades of efforts have attempted to differentiate the pluripotent stem cells (PSCs) into truly functional hematopoietic stem cells (HSCs), yet the problems of low differentiation efficiency in vitro and poor hematopoiesis reconstitution in vivo still exist, mainly attributing to the lack of solid, reproduced, or pursued differentiation system.+ cells derived from the mouse PSCs was evaluated via m-NSG transplantation assay. Flow cytometry analysis, RNA-seq, and cell cycle analysis were used to detect the in vitro hematopoietic ability of endothelial protein C receptor cells generated in our induction system.In this study, we established an in vitro differentiation system yielding in vivo hematopoietic reconstitution hematopoietic cells from mouse PSCs through a 3D induction system followed by coculture with OP9 stromal cells. The in vivo hematopoietic reconstitution potential of c-kit+ cells from 3D self-assembling peptide induction system followed by the OP9 coculture system possessed apparently superiority in terms of in vivo repopulating activity than that of 3D induction system followed by the 0.1% gelatin culture. We interestingly found that our 3D+OP9 system enriched a higher percentage of CD201+c-kit+cells that showed more similar HSC-like features such as transcriptome level and CFU formation ability than CD201-c-kit+cells, which have not been reported in the field of mouse PSCs hematopoietic differentiation. Moreover, CD201+ hematopoietic cells remained in a relatively slow cycling state, consistent with high expression levels of P57 and Ccng2. Further, we innovatively demonstrated that notch signaling pathway is responsible for in vitro CD201+ hematopoietic cell induction from mouse PSCs.The c-kitAltogether, our findings lay a foundation for improving the efficiency of hematopoietic differentiation and generating in vivo functional HSC-like cells from mouse PSCs for clinical application.The online version contains supplementary material available at 10.1186/s13287-021-02434-2. Currently, allogeneic HSC transplantation has been widely used in a clinical setting, yet allogeneic transplantation often leads to graft versus host disease (GVHD) . AlthougOP9 stromal cells have been reported to augment the survival of hematopoietic precursors and progenitors derived from human embryonic stem cells (ESCs) ; moreove+ cluster of hematopoietic cells was highly prevalent and showed similar characteristics to the mouse embryonic and adult CD201+ HSC with LTR capacity. Interestingly, the CD201+ cell populations derived from mouse PSCs are superior in terms of hematopoietic TF, markers, colony-forming unit (CFU) colonies, and hematopoietic related regulation signaling pathways. More importantly, we innovatively demonstrated that notch signaling pathway participated in the CD201+ hematopoietic cell generation from mouse PSCs. In sum, for the first time, we established a novel approach for generating functional hematopoietic cells, which technically creates a link between the unlimited PSCs source and HSC-based immunotherapy for translational purposes.Recent studies claimed that the endothelial protein C receptor gene, a novel marker, can enrich mouse HSCs within AGM regions and the fetal liver and can even enrich human HSCs within cord blood and the fetal liver \u201313. In oMouse ESCs derived from 129/ola and C57BL/6 mice (Shanghai Institute of Biochemistry and Cell Biology) were maintained on inactivated mouse embryonic fibroblasts (MEFs) in mESC medium containing DMEM/F12 (Invitrogen) supplemented with 15% fetal bovine serum , 1% nonessential amino acids (Invitrogen), 1% GlutaMAX (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), 1000 U/mL leukemia inhibitor factor (Biolead), and penicillin/streptomycin (Solarbio\u00ae LIFE SCIENCES). OP9 and OP9-DL1 stromal cells were cultured with \u03b1-MEM (Gibco) supplemented with 20% FBS (Gibco).5 OP9 stromal cells were plated in 0.1% gelatin-coated 12-well plate and were treated with mitomycin C after 24-h culture. Then, 20 6\u20138-day hematopoietic-like colonies derived from EBs in the 3D induction system were picked and reseeded on OP9 stromal cells for further hematopoietic differentiation. The medium for the OP9 coculture system was composed of a-MEM (Gibco), 10% FBS (Gibco), and cytokines (100 ng/mL stem cell factor (SCF), 100 ng/mL IL-3, and 100 ng/mL Flt3 ligand, all from PeproTech) [For stage I, the 3D induction protocol involved EBs hematopoietic differentiation as previously described [proTech) .For experiments involving dual antiplatelet therapy , DAPT was added to day 0 OP9 coculture system medium , while cCells derived from in vitro mouse PSC hematopoietic differentiation and the in vivo PB and BM of m-NSG mice were harvested and suspended in PBS with 2% FBS. Before antibody incubation, the cells were blocked with an anti-CD16/32 antibody (eBioscience). The following antibodies were used for analysis: Alexa Fluor 700 (AF700)-conjugated anti-Flk1 (eBioscience), allophycocyanin (APC)-conjugated anti-TIE2 (eBioscience), APC-Cy7-conjugated anti-c-kit (eBioscience), AF700-conjugated anti-Lineage (eBioscience), APC-conjugated anti-Sca-1 (eBioscience), peridinin-chlorophyll protein (PerCP)-eFluor\u00ae 710-conjugated anti-CD201 (eBioscience), APC-Cy7-conjugated anti-TER119 (eBioscience), PerCP-Cy5.5-conjugated anti-CD45.1 (eBioscience), and PE-Cy7-conjugated anti-CD45.2 (eBioscience). The following antibodies were used for sorting: APC-Cy7-conjugated anti-c-kit (eBioscience), eFluor450-conjugated anti-Lineage (eBioscience), and phycoerythrin (PE)-conjugated anti-CD201 (eBioscience). Samples were measured by BD Fortessa, and cells were sorted by BD Aria II. The data were analyzed using FlowJo Version 10 software.4 cells into MethoCult\u2122 GF M3434 medium in a 35-mm culture dish for 12 days. The colonies were counted based on standard morphological criteria. BFU-E (burst-forming unit-erythroid), CFU-GM (colony-forming unit-granulocyte/macrophage), and CFU-GEMM (colony-forming unit-granulocyte/erythroid/macrophage/megakaryocyte) were classified and enumerated based on morphological recognition. In addition, colonies were picked, fixed on glass slides, and stained with Giemsa solution (Sigma).CFU assays were performed by plating 2\u2009\u00d7\u200910TM Fixation/Permeabilization Concentrate (Invitrogen) at room temperature (RT) for 20 min in the dark. After washing with PBS containing 2% FBS, cells were incubated with PE-Cy7-conjugated anti-Ki-67 antibody (eBioscience) at RT for 30 min in the dark. Later, washed cells were incubated with 4\u2032,6-diamidino-2-phenylindole (DAPI) (Biogems) at RT for 30\u201340 min, followed by flow cytometry analysis with BD Fortessa. The data were analyzed using FlowJo Version 10 software.Cells were harvested and suspended in PBS with 2% FBS. Then, the cells were stained with HSC-related antibodies as described above. Cells were fixed and permeabilized with eBioscience+ cells were intrafemorally injected into each irradiated (2.25\u00a0Gy) m-NSG mouse. The mice were fed water containing Baytril (Bayer) for 2 weeks to prevent infection. All animal work was supported by The Institutional Animal Care and Use Committee of Zhejiang University.Female m-NSG mice aged at 6\u20138 weeks were purchased from Shanghai Model Organisms Center, Inc., maintained in the standard SPF animal house and used in all studies . Mouse P\u2212\u0394\u0394Ct. PCR primers used for reverse transcription PCR are referenced to Table Quantitative polymerase chain reaction (qPCR) was performed as follows: day 5 mouse PSC-derived total cells in 3D+OP9 coculture system in the presence of DMSO or DAPT were collected. Total RNA was extracted from using Trizol reagent (Invitrogen) and 1 \u03bcg RNA was reverse-transcribed into complementary DNA (cDNA) using PrimeScript RT reagent Kit (Takara) according to the manufacturer\u2019s instructions. qPCR was completed in a Light Cycler system (Roche) Q5 using SYBR Premix Ex Taq (Takara). Each sample was performed in triplicate and all results were normalized to the expression of Actin. Fold expression relative to the reference gene was calculated using the comparative method 2https://david.ncifcrf.gov/) and -log10 were plotted to show term significance.Total RNA was extracted from sorted cell samples using TRIzol Reagent (Life Technologies) following the manufacturer\u2019s instructions. cDNA libraries were constructed using the VAHTS mRNA-seq v2 Library Prep Kit for Illumina (Vazyme) according to the manufacturer\u2019s protocol. Library sequencing was performed on an Illumina HiSeq X Ten platform (Illumina) to generate 150-bp paired-end reads. The paired-end reads were processed and aligned to the reference genome (GRCm38) using HISAT2 (v.2.0.5). Mapped reads for each sample were assembled into transcriptome data using StringTie (v.1.3.3) with a reference-based approach. The normalized expression value was represented by fragments per kilobase of transcript per million mapped reads (FPKMs). Cuffdiff (v1.3.0) was used to calculate the differential expression genes for each sample. Only comparisons with q-values < 0.05 and absolute log2 (fold change) values \u22651 were considered as significantly differentially expressed genes. Functional enrichment analysis of DEGs was performed with DAVID (The RNA-seq data are available at Gene Expression Omnibus (GEO) (accession number: GSE175563).P value < 0.05 and were denoted as NS, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001. The statistical analysis data were assessed using GraphPad Prism 8.The number of biological replicates is indicated by the n value. All graphs depict mean \u00b1 SD. Statistical analysis was performed using a two-tailed un-paired Student\u2019s test. The results were considered statistically significant at + mesoderm cells and TIE2+c-kit+ hemogenic endothelial cells maintained an increasing tendency from day 2 to day 7 in our induction system. Flow cytometry analysis data suggested that the 3D+OP9 coculture obtained a higher percentage of Flk1+ and TIE2+c-kit+ cells than 3D+0.1% gelatin coculture and lymphoid hematopoietic lineages in surviving mice. The phenotypic analysis indicates that c-kit+ hematopoietic progenitors from the 3D+OP9 and 3D+0.1% gelatin groups all reconstituted myeloid and B lymphoid lineages and T cells, with the c-kit+ hematopoietic progenitors from 3D+OP9 inducible system possessing the stronger hematopoiesis superiority -, CFU macrophage (CFU-M)-, CFU granulocyte macrophage (CFU-GM)-, and CFU granulocyte erythrocyte monocyte macrophage (CFU-GEMM)-derived colonies, whereas Lin\u2212c-kit+CD201\u2212 cells resulted in few CFU-G, CFU-M, CFU-GM, and CFU-GEMM colonies , bone marrow-derived LSKCD201+ (BM-LSKCD201+) from C57BL/6 mice aged at 6\u20138 weeks, and fetal liver-derived LSKCD201+ (FL-LSKCD201+) cells from C57BL/6 mice on embryonic day 12.5 (E12.5). Compared with D5-LSKCD201\u2212 cells, D5-LSKCD201+ cells showed a genome transcriptome more similar to that of BM-LSKCD201+ and FL-LSKCD201+ cells than to mouse PSCs inhibitors, such as p57, were abundantly expressed in LSKCD201+ cells, yet various cell cycle regulators of G1, G1/S, and G2/M phase progression, such as Ccnd1, Ccnd2, Cdk6, and Aurka were expressed at significantly higher levels in LSKCD201\u2212 cells than in LSKCD201+ cells . The relative molecular mechanism of Hoxb cluster and Hoxa cluster genes for CD201+ cell populations derived from PSCs remains elusive. From in vitro long-term culture observations, such as colony-forming unit assays, LSKCD201+ cells obtained from our induction system have a higher proliferative potential than LSKCD201\u2212 cells, maybe attributing to the higher expression of Hox genes and EHT genes, which need our further research in the future.Regarding the hematopoietic potential of LSKCD201ntiation . In our + cells from mouse PSCs than the control system followed by coculture with 0.1% gelatin. Our data demonstrated that these LSKCD201+ cells were more likely to be in a slow cycling state than LSKCD201\u2212 cells under the regulation of CDK inhibitors, such as p57. Whereas various regulators of G1, G1/S, and G2/M cell cycle phase progression, Ccnd1, Ccnd2, Cdk6, and Aurka, were expressed at significantly higher levels in LSKCD201\u2212 cells than in LSKCD201+ cells. These characteristics were confirmed in CD201+ cells isolated from mouse fetal liver and adult BM. The OP9 stromal cell-mediated ECM-rich microenvironment may serve as a niche for LSKCD201+ cells that are in a relatively slow cycling state. Our RNA-seq data showed that genes upregulated in 3D+OP9 coculture system were enriched in extracellular matrix organization signaling pathway. However, the detailed regulatory mechanism will be addressed in future studies.In our study, our findings showed that using a 3D self-assembling peptide-mediated hematopoietic induction system followed by coculture with OP9 stromal cells could produce many more LSKCD201+ hematopoietic cells. Most importantly, our transplantation data analysis confirmed that PSC-derived hematopoietic cells exhibited a hematopoiesis reconstitution potential for up to 4 weeks in both the PB and BM of sublethally irradiated (2.0 Gy) m-NSG mice injected intrafemorally with c-kit+ cells. Because the mice were in such a poor state, only a limited number survived. Here, we only could provide representative data that showed donor-derived cells in peripheral blood of m-NSG in 3D+OP9 induction system after 6 weeks\u2019 transplantation Flow cytometry analysis of the percentage of CD201+ on day2, day5 and day7 respectively. (B) Statistical analysis of the percentage of CD201+ in 3D+OP9 hematopoietic induction system. Data are represented as mean \u00b1 SD (n = 3).Additional file 2: Figure S2 is the hematopoietic related gene expression in between CD201+ cells and CD201- cells. (A) The expression level of hematopoietic markers in CD201+ cells compared with that in CD201- cells is shown as FPKM values, Data are represented as mean \u00b1 SD (n = 3). (B) The expression level of HOX family genes in CD201+ cells compared with that in CD201- cells is shown as FPKM values, Data are represented as mean \u00b1 SD (n = 3).Additional file 3: Figure S3 demonstrates representative flow cytometric plots for CD45.1 and CD45.2 expression in the PB from m-NSG recipient mice (CD45.1) after 6 weeks transplantation, meanwhile representative flow cytometric plots for expression of CD11b, CD19 and thy1.2 in gated CD45.2+ cells."} +{"text": "In which, flavumolines A\u2009\u2212\u2009D (1\u2009\u2212\u20094) were four new ones, and flavumoline E (5) was reported as natural compound for the first time. Their chemical structures were elucidated by the analysis of extensive spectroscopic data. The inhibitory activities of these isolates on Cav3.1 low voltage-gated Ca2+ channel, NO production in LPS-activated RAW264.7cells, five human tumor cell lines, as well as acetylcholinesterase (AChE) were tested.Sixteen diterpenoid alkaloids (DAs), including six aconitine-type alkaloids (The online version contains supplementary material available at 10.1007/s13659-021-00302-3. Aconitum species represent a large genus in the Ranunclaceae family . Me. MeAconireported .Aconitum flavum Hand.-Mazz, known as a perennial herb, is mainly distributed in Qinghai, Gansu, and other northwest places in China + . The presence of hydroxyl (3431\u00a0cm\u22121) and carbonyl (1672\u00a0cm\u22121) units was deduced from the IR spectrum. The 13C NMR and DEPT spectra displayed 29 carbons signals, which were divided into five methylenes, nine methines, and five quaternary carbons as well as the signals for a benzoyl and three methoxy groups. Detailly, the characterized signals for a franchetine-type C19-DA core could be distinguished as follows: one representative 6,17-epoxy unit , two quaternary carbons at \u03b4C 48.9 (C-4) and 51.0 (C-11), and three methines at \u03b4C 46.5 (C-5), 44.3 (C-9), and 47.1 (C-10), together with the typical C-7/C-8 trisubstituted double bond + in the HRESIMS , which indicated 10 degrees of unsaturation. The 13C NMR and DEPT data showed six methylenes, nine methines, four quaternary carbons, as well as the signals for a benzoyl group, three methoxy groups, and a typical N-ethyl group. Side by side, comparison of its NMR data with those of 6, a known franchetine-type DA isolated previously, indicated that the structure of 4 was similar with that of 6 + , in combination with NMR spectroscopic data. The IR spectrum of 5 showed absorptions due to the hydroxyl (3487\u00a0cm\u22121) and carbonyl (1676\u00a0cm\u22121) functionalities. The 13C NMR and DEPT spectra of 5 displayed 33 carbon resonances including five quaternary carbons , eleven methines, three methylenes, and 14 other signals attributable to a benzoyl, a typical N-ethyl group, an acetoxyl, and three methoxy groups. By carefully analyzing the characteristic resonances of a N-ethyl group at \u03b4C 49.2, t (C-21) and \u03b4C 13.2, q (C-22), a nitrogen-bearing methine and methylene at \u03b4C 60.8, d (C-17) and \u03b4C 51.0, t (C-19), an \u03b1,\u03b2-unsaturated ketone moiety at \u03b4H 6.27, 6.46 together with the C-atom signals at \u03b4C 132.3, 147.3, and 200.5 were clearly observed. The 1H NMR spectrum also verified resonances assignable to a nitrogen-bearing methine and methylene at \u03b4H 2.76 , \u03b4H 2.62 and 2.38 , as well as a representative N-ethyl group at \u03b4H 2.39, 2.69 and \u03b4H 1.00 . These evidences suggested that 5 should be a typical aconitine-type C19-DA . Silica gel , and MCI gel were used for column chromatography. Fractions were monitored by TLC , and spots were visualized under a UV lamp at 254\u00a0nm or by spraying the Dragendorff\u2019 reagent and heating silica gel plates sprayed with 10% H2SO4 in EtOH.Optical rotations were measured on a Jasco P-1020 polarimeter. UV spectra were detected on a Shmadzu UV-2401PC spectrometer. IR spectra were determined on a Bruker FT-IR Tensor-27 infrared spectrophotometer with KBr disks. All 1D and 2D NMR spectra were recorded on Bruker DRX-600 spectrometers using TMS as an internal standard. Unless otherwise specified, chemical shifts was deposited in the Kunming Institute of Botany.The plants of A. flavum (45\u00a0kg) was extracted three times (3\u2009\u00d7\u2009150 L) with MeOH at room temperature and then concentrated to 3.88\u00a0kg under reduce pressure. The crude extract was suspended in 1% HCl followed by basification with 10% aqueous NH4OH (pH 9\u2009\u2212\u200910) and subsequently, extracted with ethyl acetate to afford crude alkaloids (808\u00a0g). The total alkaloids fraction was separated on a silica gel column to yield eight fractions (Fr. 1\u2009\u2212\u20098). Then Fr. 1 (35\u00a0g) was separated on a silica gel column to yield six sub-fractions (Fr. 1a\u2009\u2212\u20091f). Fr. 1a (2.3\u00a0g) was separated on a silica gel column and then semi-preparative HPLC using MeOH/H2O as the mobile phase afforded 6 (57\u00a0mg), 7 (10\u00a0mg) and 8 (23\u00a0mg). Fr. 1b (2.7\u00a0g) was separated on a silica gel column followed by preparative HPLC using MeOH/H2O to yield 4 (128\u00a0mg), 14 (15\u00a0mg), 15 (9.7\u00a0mg) and 16 (6\u00a0mg). Fr. 1c (3\u00a0g) was separated on a silica gel column , followed by semi-preparative HPLC using MeOH/H2O as the mobile phase to afford 10 (8\u00a0mg), 11 (3\u00a0mg) and then yield 9 (230\u00a0mg) by recrystallizaiton. Fr. 1d (7\u00a0g) was separated on a silica gel column yielded 12 (50\u00a0mg) and then on semi-preparative HPLC using MeOH/H2O as the mobile phase to afford 13 (10\u00a0mg). Fr. 1e (5.5\u00a0g) yielded 2 (7.3\u00a0mg) and 3 (20.1\u00a0mg) by preparative HPLC using MeOH/H2O as mobile phase, subsequently, afforded 5 (4.7\u00a0mg) and 1 (2\u00a0mg) isolated by Sephadex II column using acetone.Air-dried and powdered plant material of \u03b1]D19 \u22124.9 ; IR (KBr) \u03bdmax: 3431, 2975, 2933, 2828, 1718, 1672, 1282, 1099\u00a0cm\u22121; For 13C NMR data .White powder; [\u03b1]D18 \u221212.5 ; IR (KBr) \u03bdmax: 3447, 2938, 2882, 2828, 1717, 1670, 1280, 1099\u00a0cm\u22121; For 13C NMR data .White powder; [\u03b1]D18 \u22129.7 ; IR (KBr) \u03bdmax: 3534, 3402, 2974, 2824, 1717, 1280, 1103\u00a0cm\u22121; For 13C NMR data .White powder; [\u03b1]D1919 \u22123.9 ; IR (KBr) \u03bdmax: 3437, 2973, 2932, 2826, 1719, 1279, 1101\u00a0cm\u22121; For 13C NMR data .Colorless oily liquid; [\u03b1]D18\u2009+\u20094.4 ; IR (KBr) \u03bdmax: 3487, 2973, 2936, 1721, 1676, 1280\u00a0cm\u22121; For 13C NMR data .White powder; [4.4 c 0.12, MeOH; 2, 2 CaCl2, 10 Glucose and 10 HEPES (pH 7.4 adjusted with CsOH). The intracellular solutions contained (in mM) 127 Cs-methanesulphonate, 2MgCl2, 2Na2ATP, 10 HEPES and 11 EGTA (pH 7.4 adjusted with CsOH). The tested compounds (30\u00a0\u03bcM) were added.All experiments were performed at room temperature (~\u200922\u00a0\u00b0C). Pipettes were fabricated from borosilicate glass (World Precision Instru-ments) using a micropipette puller , and were fire-polished to resistances of 2\u2009~\u20094\u00a0M for whole-cell recording. Whole-cell currents were elicited by 150\u00a0ms depolarization to\u2009\u2212\u200940\u00a0mV at 4\u00a0s intervals from a holding potential (HP) of\u2009\u2212\u2009100\u00a0mV. Currents were amplified by Axopatch 200B and digitized by Digidata 1440A (Molecular Devices). Currents were low-pass filtered at 2\u00a0kHz and sampled at 10\u00a0kHz. pCLAMP 10 software (Molecular Devices) was used for data acquisition and analysis. The extracellular solutions contained (in mM) 142 CsCl, 1 MgCl5 cells/well) and treated with serial dilutions of the compounds with a maximum concentration of 50\u00a0\u03bcM in triplicate, followed by stimulation with 1\u00a0\u03bcg/mL LPS (Sigma) for 18\u00a0h. NO production in the supernatant was assessed by Griess reagents (Sigma). The absorbance at 570\u00a0nm was measured with a microplate reader . NG-Methyl-L-arginine acetate salt was used as a positive control [The murine macrophage cell line RAW264.7 was obtained from Cell Bank of Chinese Academy of Sciences. RAW264.7 cells were seeded in 96-well cell culture plates -5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay [50 value of each compound was calculated with Reed and Muench\u2019s method [The human tumor cell lines HL-60, SMMC-7721, A-549, MCF-7, and SW-480 were obtained from ATCC . Cells were cultured in RMPI-1640 or DMEM medium supplemented with 10% fetal bovine serum at 37\u00a0\u00b0C in a humidified atmosphere with 5% COA) assay . Brieflys method .S-Acetylthiocholine iodide, S-butyrylthiocholine iodide, 5,5\u2032-dithio-bis-(2-nitrobenzoic) acid , acetylcholinesterase derived from human erythrocytes were purchased from Sigma Chemical. Compounds were dissolved in DMSO. The reaction mixture containing phosphate buffer (pH 8.0), test compound (50\u00a0\u03bcM), and acetyl cholinesterase (0.02U/mL), was incubated for 20\u00a0min (37\u00a0\u00b0C). Then, the reaction was initiated by the addition of 40 \u03bcL of solution containing DTNB (0.625\u00a0mM) and acetylthiocholine iodide (0.625\u00a0mM) for AChE inhibitory activity assay, respectively. The hydrolysis of acetylthiocholine was monitored at 405\u00a0nm every 30\u00a0s for one hour. Tacrine was used as positive control with final concentration of 0.333\u00a0\u03bcM. All the reactions were performed in triplicate. The percentage inhibition was calculated as follows: (%) inhibition\u2009=\u2009(E\u2014S)/E\u2009\u00d7\u2009100 (E is the activity of the enzyme without test compound and S is the activity of enzyme with test compound).Acetylcholinesterase (AChE) inhibitory activity of the compounds isolated was assayed by the spectrophotometric method developed by Ellman et al. with sliSupplementary file1 (doc 9284 kb)Below is the link to the electronic supplementary material."} +{"text": "Arrhythmogenic right ventricular dysplasia (ARVD) is a rare genetic condition of the myocardium, with a significantly high risk of sudden death. Recent genetic research and improved understanding of the pathophysiology tend to change the ARVD definition towards a larger spectrum of myocardial involvement, which includes, in various proportions, both the right (RV) and left ventricle (LV), currently referred to as ACM (arrhythmogenic cardiomyopathy). Its pathological substrate is defined by the replacement of the ventricular myocardium with fibrous adipose tissue that further leads to inadequate electrical impulses and translates into varies degrees of malignant ventricular arrythmias and dyskinetic myocardium movements. Particularly, the cardio-cutaneous syndromes of Carvajal/Naxos represent rare causes of ACM that might be suspected from early childhood. The diagnostic is sometimes challenging, even with well-established rTFC or Padua criteria, especially for pediatric patients or ACM with LV involvement. Cardiac MRI gain more and more importance in ACM diagnostic especially in non-classical forms. Furthermore, MRI is useful in highlighting myocardial fibrosis, fatty replacement or wall movement with high accuracy, thus guiding not only the depiction, but also the patient\u2019s stratification and management. Arrhythmogenic right ventricular dysplasia (ARVD) is a genetic condition of the myocardium, clinically characterized through syncope, malignant ventricular arrhythmias and sudden death. The pathological substrate of the disease is represented by the replacement of the ventricular myocardium with fibrous adipose tissue. ARVD is a rare condition, with a prevalence of 1:2000\u20131:5000 ,4,5 the Particularly, the cardio-cutaneous syndromes of Carvajal/Naxos represent rare causes of ACM that might be suspected from early childhood.The diagnostic is sometimes challenging, even with well-established rTFC or Padua criteria, especially for pediatric patients or ACM with LV involvement. Therefore, the Padua system was developed to assess the involvement of LV based on new criteria, including MRI features. Cardiac MRI (CMRI) gain more and more importance in ACM dg especially in non-classical forms. Furthermore, MRI is useful in highlighting myocardial fibrosis, fatty replacement or wall movement with high accuracy, thus guiding not only the depiction, but also the patient\u2019s stratification and management.According to the database of the anatomical variants of the ARVC (The ARVC Genetic Variants Database), in the last two decades more than 1400 variants of the 12 genes involved in ACM have been discovered, as follows: plakophilin (PKP2), desmoplakin (DSP), desmochollin (DSC2), desmoglein (DSG2), plakoglobin (JUP), transforming growth factor TGFG3), transmembrane protein 43 (TMEM43), A/C lamina (LMNA), desmin (DES), titin (TTN), phospholamban (PLN), catenin alpha-3 (CTNNA3). Out of these variants, approximately 411 mutations are considered pathogenetic for ARVC spectrum [, transmeMutation screening in desmosome genes is performed as a gold standard to identify point mutation in ACM. Up to 50% of the patients have a proven genetic substrate, and only 50\u201360% of them are in desmosome genes PKP2, JUP, DSP, DSC2, DSG2 . DesmosoACM is transmitted in an autosomal dominant manner in half of the cases, with a variable expressivity and penetrance depending on the age . The forAdditionally, it was observed that compound/digenic heterozygosity may express a more severe form of the disease, with an earlier onset, higher chances to develop sustained ventricular tachycardia/fibrillation and a five times higher risk of developing LV dysfunction and cardiac failure, compared with those who only have one mutation (monogenic) ,8,9. Furdesmosomes, recent data suggests a more complex mechanism of connexome to be affected [Classical features of ACM pathophysiology include cardiomyocyte loss and fibro-fatty replacement, inflammation and arrhythmogenesis. Even if half of individuals with genetically proven mutations concern the affected ,11. The affected .In terms of determining a precise morphology and kinetics, volume, mass and thicknesses of the cardiac cavities, MRI represents the gold standard. A revised diagnosis criteria have been established (revised Task Force Criteria 2010\u2014rTFC 2010) which include the following: morphological and functional data (echocardiography and/or angiography and/or cardiac MRI), endomyocardial biopsy, electrocardiogram (EKG), arrhythmias, family history and genetic profile. The rTFC 2010 allowed an improved diagnosis of ACM with predominant RV or biventricular involvement, with a less sensitive diagnosis of the LV predominant form involvement. The latter was diagnosed due to the increased use of cardiac MRI in the last decade [For a confident diagnosis, two major and one minor criterion have to be met or one major and two minor or four minor criteria. If one major and one minor or three minor criteria are met then there is a \u201cborderline\u201d ARVC diagnosis, The rTFC 2010 are also valid for the pediatric population, with the specification that inverted T wave in precordial derivations are often normal in children under 12 years old. The ACM diagnosis is rare under the age of 10 mainly due to the genetic penetrance that is age dependent ,14,15 shIn order to improve the diagnosis of ARVC with predominant LV or biventricular form, Corrado et al. proposedThe MRI differential diagnosis includes anatomical variants and pathological conditions. As a general rule, the diagnosis sensitivity is improved by correlating more diagnosis parameters, such as echocardiography, EKG, endomyocardial biopsy, cardiac electrical mapping, family history) . The claAnother anatomical variant is found in patients with pectus excavatum. Due to the rotation and displacement of the heart to the left, the sternum comes into close relationship with the right atrium and the base of the compressed RV looking like a small hypokinetic base, while the midmyocardial and apex areas have a pseudo-dilated appearance, mimicking dyskinesia. In this particular situation, the key to a correct interpretation is recognizing the pectus excavatum .Tethered RV may be responsible for the third normal variant. It represents a relatively small area of systolic-diastolic dilatation of the lateral RV wall, secondary to the presence of a pericardial connective tissue membranes that tether the RV to the posterior side of the sternum . The diaVarious pathological conditions may mimic ACM, such as RV infarction, DCM, sarcoidosis, myocarditis, idiopathic ventricular tachycardia of the RVOT, Brugada syndrome or athlete\u2019s heart.RV infarction implies a vascular territory and focal hypokinesia and dyskinesia are not characteristic. Additionally, LGE starts subendocardial unlike ARVC which is subepicardial/midmyocardial.Patients with ACM-LV involvement require a differentiation from DCM . Most patients with DCM do not show LGE. In those who do present LGE, the uptake is midmyocardial or subepicardial in the non-ischemic type, similar to ACM-LV. Furthermore, DCM cases do not present involvement of the RV, while ACM-LV is associated with ventricular malignant arrhythmias more often and at a much earlier stage than DCM ,7.Sarcoidosis affecting the heart may mimic the aspect of ACM. The personal history, and the presence of mediastinal and/or lung hilum adenopathy with lung infiltrates in different stages of the disease are criteria for differentiation. Patients with isolated cardiac sarcoidosis involvement are rare , and theMyocarditis has a highly variable clinical presentation but often is similar to that of heart failure. Occasionally it may show clinical features similar to ARVC. The differential diagnosis based on the LGE is inconclusive as they are very much alike. The STIR sequence may reveal focal/diffuse intramyocardial edema in acute/subacute myocarditis, but there are cases of ACM that also show intramyocardial edema, the aspects being difficult to differentiate . That isIdiopathic ventricular tachycardia of RVOT is a typically benign condition . An accuBrugada syndrome is an arrhythmogenic cardiac manifestation first described in 1992, which is responsible for ventricular tachycardia and sudden death. The Shanghai Criteria has been proposed for the diagnosis of Brugada syndrome, usually in the presence of a type 1 ECG . There iA particular case that requires a differential diagnosis is the heart of the athletes. Intense training leads to physiologic cardiac adaptation such as moderate dilatation of the RV and LV (with RV/LV index kept under 0.9), EKG anomalies and arrhythmias, but without regional or global systolic dysfunction. After training, ventricular volume usually decreases. Furthermore, an athlete\u2019s heart does not present fibrotic changes on MRI. The imaging aspects that favor the ARVC diagnosis are the global systolic dysfunction and/or focal dyskinesia (systolic +/\u2212 diastolic bulging) and LGE (presence of fibrosis) ,22.First patient: H.C-D, 21 years old, presents into the emergency room for a syncope that occurred while standing, palpitations and moderate effort dyspnea. The family history revealed that the patient had a sister who suffered sudden death at the age of 21 (minor criteria for ACM). The clinical examination showed woolly hair and hyperkeratotic lesions. The EKG showed flattened T waves in the limb leads and negative in V5 and V6, ventricular extrasystoles with left bundle branch block (LBBB) and right bundle branch block (RBBB) .Echocardiography (ECG) described RV dilatation (57/49 mm), hyperechoic interventricular septum (IVS) and a severely reduced EF (LVEF = 29%). Microaneurysms were present in the IVS. The lateral wall of the RV revealed noncompaction of the myocardium. RV presented hypokinetic areas at the apex, the inferior wall and the RV outflow tract and a small dyskinetic area at the apex (major ARVC criteria). The systolic function of the RV was very reduced (RVEF = 29%). The delayed ventricular potentials monitored through SAECG detected 3 positive parameters (filtered QRS duration = 137 ms (>114 ms); root-mean-square of the last 40 ms of QRS = 4\u03bcV (<20 \u03bcV), low-amplitude signal duration of QRS terminal = 53 ms (\u226538 ms), which represents a minor criterion for ARVC, 2)\u2014major MRI criteria for the diagnosis of ARVC.The CMRI highlighted the following: biventricular dilatation , global hypokinesia of the LV and RV, with small akinetic area in the IVS D, focal As a result of the clinical and laboratory evaluation, the diagnosis of ARVC, as part of a cardio-cutaneous syndrome, was established with certainty (two major and three minor criteria rTFC 2010). Genetic testing revealed the presence of three heterozygotic mutations of the DSP gene \u2014the patient is compound heterozygote. The parents were carriers with one and two mutations of the DSP gene, respectively, and they were clinically and paraclinically healthy; it must be mentioned that both the mother, as well as the deceased sister, had woolly hair. The final diagnosis was that of ARVC in the context of a Carvajal/Naxos-like syndrome.The second patient, F.D.S., 10 years old, is brought to the outpatient for effort dyspnea. Woolly hair and palmoplantar keratoderma were observed with the latter affirmative present since the patient was one year old , diffuse hypokinesia of the LV and very low EF (LVEF = 25%); low amplitude mitral and pulmonary regurgitation, patent foramen ovale. The EKG showed delta wave and a short PS interval compatible with Wolf\u2013Parkinson\u2013White pre-excitation syndrome. A 4 h Holter EKG was performed (insufficient), detecting 244 ventricular extrasystoles.2).A cardiac MRI showed the following: dilated LV (51/60 mm), non-dilated RV (41 mm short axis) A, globalThe rTFC 2010 criteria were not met in this case. However, the Padua Criteria for ACM-LV \u201cborderline\u201d were met (one major and one minor). Considering the association between the cardiac involvement and the cutaneous changes in such a young patient, a cardio-cutaneous syndrome could not be excluded. Genetic testing found two heterozygotic mutations of the DSP gene \u2014therefore, the patient is a compound heterozygote. The parents did not manifest the symptoms of the patient, each being a carrier of a heterozygotic mutation of the gene. The final presumable diagnosis is ACM in the context of the Carvajal cardio-cutaneous syndrome.The third patient, L.S.-P., 27 years old, presented to the outpatient clinic for daily, low intensity arrhythmias for the last 10 years, with normal tolerance to effort. A cardiac examination showed the following: 100 bpm, normal rhythm cardiac murmurs, no pathological cardiac murmurs associated. An EKG revealed the following pathological alterations: sinus arrhythmia, corrected QT interval = 451 ms , quadrigeminal VES. Echocardiography showed hypokinesia of the infero-lateral and antero-lateral walls of the LV in the mid-apical segments, base and mid of the IVS and hypokinesia of the RV inferior wall and RVOT . The 24 h Holter examination detected 10,002 bigeminal and trigeminal VES (minor criteria for ACM).Cardiac MRI detected enlarged right cavities and dilatation of the LV . There is also concentric LV hypokinesia beginning from the mid segments towards the distal apex and mild global RV hypokinesia associated with a few small, focal dyskinetic areas (systolic bulging) within the RVOT A and thePatients 1 and 2 are the first two cases of ACM as part of the Carvajal syndrome transmitted in a recessive manner from Romania. Patient 3 manifests a classic, non-syndromic form of ACM. The patients were chosen for this presentation to underline the fact that ACM is not an RV exclusively disease as it was considered in the past, but a specter of conditions with various degrees of ventricular myocardial involvement as follows: predominately RV involvement (patient 3), predominately LV involvement (patients 2), biventricular involvement (patient 1) as part of a syndromic inheritance or not. Furthermore, the role of CMR is vital, especially in patient 2, where only Padua criteria were met for a final diagnosis.The cardiac involvement in the context of Carvajal syndrome in patients 1 and 2 consists of an ACM phenotype with a pattern of midmyocardial fibrotic changes (similar to idiopathic DCM) , the aspPatient 1 has two out of three DSP gene mutations (c.88G>A and c.273+5G>A) which are included in the database of the genetic variants of ARVC (last checked on 20.12.2021). According to Bauce et al. , these mThe second patient\u2019s DSP gene mutations are not included in the database of the genetic variants of ACM. The case has been reported initially by Pigors et al. ; at thatWe included patient 3\u2019s RV apex contractility pattern under dyskinetic changes. Although Te Riele et al. pointed Patients with Carvajal syndrome present with symptoms from a young age, as the cardiac involvement can be severe before 20; the mean age of death is 14, most patients dying as a result of severe cardiac failure or sudden death due to malignant ventricular arrhythmias. Our first two patients demonstrated severe left cardiac involvement at the ages of 21 and 10.The patients were diagnosed according to rTFC 2010. As previously mentioned, these criteria are insufficient for diagnosis because of the following two major reasons: they do not address the patients with LV involvement and there is no diagnosis variant for the pediatric population. It is a well-known fact that children under 12 years old can physiologically manifest inverted T waves in the precordial leads, which is why the major criteria for repolarization cannot be taken into account. The multitude of cases with predominant left side involvement is due to the more frequent use of cardiac MRI in the last 10 years. Where rTFC 2010 were not met, we took in consideration the Padua Criteria 2020 proposed by Corrado et al., with new criteria assessing the LV involvement, and observed an improved diagnostic, highlighting the central role CMR has in this rare cause of ACM.We did not mention the fatty changes within the myocardium due to the fact that up until now, no consensus has been established regarding the imaging differential diagnosis between physiologic myocardial lipogenesis and the one developing in the context of ACM. Its appearance at a young age does not represent a solid differentiation criterion. Cannavale et al. proposedThe differential diagnosis with myocarditis is difficult in children and teenagers. ACM may manifest in these age groups in a so-called \u201cwarm phase\u201d, before the onset of fibrosis, when the progression of the disease becomes accelerated, with biventricular morphological and functional alterations. Intramyocardial edema detected on the STIR sequence may overlap with the aspect of myocarditis ,29. A poAn interesting aspect was the association of ACM with the CMR findings of ventricular noncompaction in the situation of patient number 1 and number 3. Arbustini et al. illustraEven though noncompaction is often described as a condition with intrauterine onset and a predominantly non-desmosomal genetic substrate, in particular cases when ACM has a desmosomal substrate, the possibility of common pathogenesis mechanism can be raised; under the intracavitary mechanical pressure and the alteration of the intercellular signaling , the myoACM represents a myocardial condition that involves both the RV as well as the LV in various degrees. The patients are usually young, and the prognosis is poor in undiagnosed cases, with death occurring due to malignant ventricular arrhythmias. The CMR examination brings a significant contribution to the diagnosis of ACM, especially in cases with predominately LV involvement, where the delayed post contrast PSIR sequence is essential. Furthermore, CMR may help distinguishing ACM from normal or pathologic variants."} +{"text": "Arrhythmogenic Cardiomyopathy (ACM) is a heredo-familial cardiac disease characterized by fibro-fatty myocardial replacement and increased risk of sudden cardiac death. The diagnosis of ACM can be challenging due to the lack of a single gold-standard test: for this reason, it is required to satisfy a combination of multiple criteria from different categories including ventricular morpho-functional abnormalities, repolarization and depolarization ECG changes, ventricular arrhythmias, tissue characterization findings and positive family history/molecular genetics. The first diagnostic criteria were published by an International Task Force (ITF) of experts in 1994 and revised in 2010 with the aim to increase sensitivity for early diagnosis. Limitations of the 2010 ITF criteria include the absence of specific criteria for left ventricle (LV) involvement and the limited role of cardiac magnetic resonance (CMR) as the use of the late gadolinium enhancement technique for tissue characterization was not considered. In 2020, new diagnostic criteria (\u201cthe Padua criteria\u201d) were proposed. The traditional organization in six categories of major/minor criteria was maintained. The criteria for identifying the right ventricular involvement were modified and a specific set of criteria for identifying LV involvement was created. Depending on the combination of criteria for right and LV involvement, a diagnosis of classic (right dominant) ACM, biventricular ACM or left-dominant ACM is then made. The article reviews the rationale of the Padua criteria, summarizes the main modifications compared to the previous 2010 ITF criteria and provides three examples of the application of the Padua criteria in clinical practice. Arrhythmogenic cardiomyopathy (ACM) is an inherited heart muscle disease characterized by progressive fibro-fatty replacement and malignant ventricular arrhythmias that may lead to sudden cardiac death, especially in young people and athletes ,2. The dThe diagnosis of ACM is challenging due to the lack of a single sensitive and specific test. In 1994 an International Task Force (ITF) of experts in cardiomyopathies proposed the first diagnostic criteria based on a multiparametric approach. These criteria relied on the identification of different clinical abnormalities typical of the disease: dilation/dysfunction of the RV; ECG changes; ventricular arrhythmias; histopathological abnormalities and positive family history . Each caIn 2019 an international experts\u2019 report provided an extensive critical appraisal of the 2010 ITF criteria, identifying potential areas of improvement . The Padua criteria are organized in two different sets of criteria to identify, respectively, clinical signs of RV and LV involvement. In both sets of criteria, the traditional organization in six diagnostic categories is maintained, including morpho-functional changes, tissue characterization, repolarization and depolarization ECG abnormalities, ventricular arrhythmias and family history/genetic testing. Similar to the 2010 ITF criteria, the diagnostic criteria are divided into \u201cmajor\u201d and \u201cminor\u201d and the diagnosis is considered possible, borderline or definite according to the number of criteria that are fulfilled. However, to reach the diagnosis of ACM, at least one morpho-functional or structural criteria (either major or minor) needs to be satisfied. .The use of the 2020 International criteria is a two-step process: the first step is the application of the multiparametric approach to verify how many major/minor criteria for both RV and LV involvement are satisfied. It is noteworthy than only one major or minor criterion for each category can be considered. The second is to classify the ACM phenotype in one of three different variants according to the combination of criteria .1. Morpho-functional abnormalitiesThe morpho-functional abnormalities can be detected with echocardiography, CMR or angiography. At variance with the 2010 ITF criteria, the presence of RV wall motion abnormalities without associated global RV dilation/dysfunction is now classified as a minor criterion. Despite its high specificity for ARVC , isolateThe LV morpho-functional criteria include the presence of global systolic dysfunction with or without LV dilatation, or the documentation of regional hypokinesia or akinesia. They are both considered minor criteria because of the low specificity for ACM. The use of current reference values for cardiac chamber size and function ,16, and 2. Structural myocardial abnormalitiesThe structural myocardial abnormalities are detected through CMR or endomyocardial biopsy (EMB). The major CMR criteria are the presence of transmural LGE in at least 1 RV region, and the presence of a stria of LGE with a non-ischemic distribution affecting at least 1 LV Bull\u2019s Eye segment . In both cases, the LGE/fibrosis must be confirmed in two orthogonal plans. The \u201cring pattern\u201d is a circumferential distribution of subepicardial LGE in the LV free wall and septum, seen in short axis view: it is highly specific for ALVC . Right ventricular LGE has a high diagnostic specificity but low sensitivity due to the thin RV wall and the suboptimal resolution obtained with CMR. The combination of LGE and wall motion abnormalities results in the highest accuracy . The fatty tissue replacement can be detected with dedicated sequences by CMR, and it is often observed in the same regions of LGE: however, it is not considered a diagnostic criterion when found in isolation because of its lack of specificity. The histological tissue characterization through EMB is indicated in patients with non-familial ACM and negative genotyping to exclude phenocopies . The dem3. ECG repolarization abnormalitiesAmong the repolarization abnormalities, T wave inversion (TWI) in right precordial leads (V1\u2013V3) or beyond is a major criterion for RV involvement. Instead, the presence of TWI only in V1\u2013V2 is a minor criterion. The criteria are valid in the absence of complete right bundle branch block (RBBB) and in patients who have already achieved complete pubertal development. In case RBBB is present, TWI extension through V1\u2013V4 is a minor criterion, as long as pubertal development is completed. TWI extending from V1 to V5 or V6 is the expression of a more severe RV dilatation, caused by its displacement to lateral leads, rather than of concomitant LV disease .Only the presence of TWI in left precordial leads (V4\u2013V6) in the absence of LBBB is a minor criterion for LV involvement.4. ECG depolarization abnormalitiesThere are no major criteria among the depolarization abnormalities. The 2020 Padua criteria downgraded the epsilon wave in right precordial leads to minor criteria because it is largely influenced by ECG sampling rate and filtering, with a high interobserver variability . In righThe fibro-fatty replacement involving the LV could be responsible for low QRS voltages in limb leads , which is a minor criterion in the absence of other potential causes . Inappropriate setting (<100 Hz) of low band-pass filters can cause spurious QRS voltage attenuation.5. Ventricular arrhythmiasVentricular arrhythmias are typical of ACM and arise from or around the fibro-fatty tissue. Premature ventricular beats (PVBs) are considered in terms of absolute number (>500 PVBs per 24 h), complexity and morphology on 12-ECG leads (exercise test or 24 h Holter monitoring). PVBs or VT with LBBB/superior axis morphology are more specific for ACM as they originate from the RV free wall or interventricular septum (major criterion). Instead, ventricular arrhythmias with an LBBB/inferior axis morphology are less specific (minor criterion), given that they originate from the RV outflow tract and are often idiopathic. PVBs or VT with an RBBB morphology, excluding the fascicular pattern (QRS < 130 ms), origin from the LV and are a minor LV criterion. The most common PVBs morphology in patients with an LV scar involving the lateral wall or infero-lateral wall, as typically observed in patients with biventricular ACM or ALVC, is RBBB/wide QRS/superior axis.6. Family history and molecular genetics.This category is shared by RV and LV criteria because it is not useful for phenotype characterization: in fact, the manifestation of the disease and the predominant involvement of one or the other ventricle may vary among members of the same family and in individuals with the same gene mutation.The history of a first-degree relative with ACM confirmed pathologically at autopsy or surgery, or who received a diagnosis of definite ACM, is a major criterion. A minor criterion is met if the disease is confirmed in a second-degree relative, it is suspected but not confirmed in a first-degree relative or it is suspected in a first-degree relative who died suddenly at young age (<35 years old). Furthermore, the Padua criteria recommend genotyping in probands who satisfy the diagnosis of ARVC or biventricular ACM, to detect genetically affected family members at a preclinical phase of the disease. Genotyping may also be considered in borderline phenotypic patients to achieve the diagnosis (taking into account the current limitations of molecular genetic testing), and it is necessary to reach a diagnosis of purely LV ACM to exclude phenocopies such as ventricular scars from previous myocarditis .After a careful evaluation of the six diagnostic categories, the second step is to define the specific phenotypic variants and the likelihood of the disease . First, If morpho-functional and/or structural criteria are met for both ventricles, either major or minor, the patient is diagnosed with biventricular ACM that can be considered definite, borderline or possible according to the number of additional criteria that are satisfied from both the LV and RV categories.If morpho-functional and/or structural criteria are met only for the RV, the patient may be diagnosed with classic ARVC if a sufficient number of additional RV criteria are satisfied. In this case, the \u201celectrical\u201d LV criteria (ECG changes and ventricular arrhythmias with RBBB morphology) are not considered.Finally, if no morpho-functional and/or structural RV criteria is satisfied, the diagnosis of ALVC requires the combination of the structural LV criterion and a positive molecular genetic testing for ACM mutation.Three examples of practical application of Padua criteria follow.2/m2), with hypokinesis of the free RV wall and lower normal limit (FAC 33%) RV function. CMR revealed a mild RV dilatation, a moderate systolic function reduction , a wide peri-tricuspid aneurysm, with an extreme thinning of the wall and apical hypertrabeculation with normal function and subtricuspidal hypokinesis. The troponin peak was 177.600 ng/L (n.v. 0\u201334 ng/L). CMR was consistent with acute biventricular myocarditis. LV function was mildly reduced (EF 51%) with focal hypokinesis of the mid-lateral wall. There was also a mild reduction of the RV function (EF 42%) with subtricuspidal hypokinesis, right ventricle outflow tract (RVOT) and costophrenic angle bulging. Myocardial edema and LGE was present in both the LV, with a subepicardial distribution (non-ischemic pattern), and the RV. A more detailed collection of anamnestic data revealed that his maternal aunt suddenly died at the age of 50, and that some time before the patient had undergone a 24 h ECG Holter monitoring because of palpitations, which revealed infrequent isolated PVBs with RBBB/superior axis morphology. Therefore, he underwent an EMB that showed fibro-fatty replacement associated with acute inflammation consistent with \u201chot phase\u201d ACM [A 39-year-old man came to the emergency room complaining about oppressive chest pain. When he was 14, he had tuberculosis; he was an ex-smoker and he had hyperhomocysteinemia. The physical examination was normal. The ECG revealed low-voltage of QRS complex in the limb leads, ST-segment elevation in lateral leads and ST-segment depression in inferior leads. As an ST elevation myocardial infarction (STEMI) was suspected, he underwent emergent coronary angiography that demonstrated normal coronary arteries. The echocardiography revealed mild RV dilatation gene, and the S596L mutation in Junction plakoglobin (JUP) gene. Physical examination was unremarkable. The ECG a showed The echocardiography was normal. CMR revealed normal chamber size and function, subepicardial/midmyocardial LGE of the LV, with a \u201cring-like\u201d pattern, without any sign of RV involvement c\u2013f. She In conclusion, we provided an overview of the 2020 Padua criteria for ACM diagnosis and examples of their practical application. These criteria aim to improve the diagnosis of ACM, particularly by identifying LV involvement. The main element of novelty compared to the 2010 ITF criteria is the central role of CMR, which has become mandatory to characterize the ACM phenotype and to exclude other diagnoses. We believe that the application of the Padua criteria in clinical practice will be crucial for their validation, correlation with therapeutic outcomes and future refinement."} +{"text": "Pain is the most common factor that drives hospital and healthcare facility visits by patients \u20133. It haWith such limits and ambiguity in the understanding of the physiopathology and defining neuropathic pain and headache, the management of the diseases becomes difficult. In addition, as the two pathologies are resistant to the existing drugs, new strategies and alternatives are necessary to overcome the therapeutic difficulties , 15. ThuThe aim of this Research Topic was to gather information on neuropathic pain and headache, which both lead to chronic pain. It was also envisaged that manuscripts published under this Research Topic would shed light on new insights into the physiopathology and on novel treatments for both types of pain.Lin et al. showed that the tension of the cervical extensor muscle contributes to the cervicogenic headache. This is supported by the fact that stiffness in the superficial extensor muscles was significantly higher on the side of the headache than on the contralateral side. More, there was a significantly higher tension in the unaffected side of the patients than in the control subjects. The stiffness of semispinalis cervicis was positively correlated with VAS scores in cervicogenic headache patients. Li et al. shed light on the probable mechanisms underlying chronic pain due to Postherpetic Neuralgia (PHN), which arises as a complication of herpes zoster. The experimental study in mice showed that the injection of Varicella-Zooster Virus (VZV) to the footpads of mice led to upregulation of T-Type calcium channel Cav 3.2 expression in the dorsal root ganglia and spinal dorsal horn of these mice. The injection of Cav.3.2 channel blocker (2R/S)-6-prenylnaringenin relieved the pain associated with VZV injection. The findings showed that Cav. 3.2 channel could be a putative therapeutic channel for the treatment of PHN.Concerning the physiopathology, Yang et al., provided insight into the identification of possible blood biomarkers for all types of migraine and the critical role that oxidative stress might be playing in the pathogenesis of the disease. The findings from their study highlighted the potential role of serum levels of Uric Acid (UA), Total bilirubin (TBil), Albumin (ALB), and Creatinine (CRE) in migraine. Specifically, ALB, TBil, and UA were independently related to migraine. They concluded that oxidative stress is a factor to be considered in the etiology and pathogenesis of migraine.Anand et al. exhibited the beneficial effects of capsaicin 8% patch for the treatment of Non-Freezing Cold Injury. Their findings showed that capsaicin 8% patch reduced spontaneously evoked pain. This interesting therapeutic approach not only alleviates neuropathic pain but is able to induce nerve regeneration and restoration. Malfitano et al. reported a case study involving a patient with thalamic stroke presenting with acute onset pain and paresthesia. The observations showed that the patient responded well to repetitive transcranial magnetic stimulation (rTMS) applied to the hand area of the primary motor cortex. The significantly ameliorated pain was also accompanied by a decreased motor cortex excitability. The findings represent the first report on the use of rTMS for the treatment of acute central post-stroke pain.Some of the papers published in this special topic highlight new therapeutic and alternative approaches. In fact, In conclusion, this Research Topic has collated both basic and clinical research. The findings of the published articles are of good translational value but call upon additional works on both the physiopathology pathways and therapeutical approaches to neuropathic pain and headache.BO produced the first draft. RT, TN, and DA revised the draft. All authors approved the submission.BO is supported by Tertiary Education Trust Fund (TETFund) of the Federal Government of Nigeria under Grant No. TETFUND/DESS/NRF/STI/11/Vol.1. DA is supported by a Novo Nordisk Grant (NNF21OC0072828).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."} +{"text": "The auditory brainstem implant (ABI) can provide hearing sensation to individuals where the auditory nerve is damaged. However, patient outcomes with the ABI are typically much poorer than those for cochlear implant recipients. A major limitation to ABI outcomes is the number of implanted electrodes that can produce auditory responses to electric stimulation. One of the greatest challenges in ABI surgery is the intraoperative positioning of the electrode paddle, which must fit snugly within the cochlear nucleus complex. While there presently is no optimal procedure for intraoperative electrode positioning, intraoperative assessments may provide useful information regarding viable electrodes that may be included in patients\u2019 clinical speech processors. Currently, there is limited knowledge regarding the relationship between intraoperative data and post-operative outcomes. Furthermore, the relationship between initial ABI stimulation with and long-term perceptual outcomes is unknown. In this retrospective study, we reviewed intraoperative electrophysiological data from 24 ABI patients (16 adults and 8 children) obtained with two stimulation approaches that differed in terms of neural recruitment. The interoperative electrophysiological recordings were used to estimate the number of viable electrodes and were compared to the number of activated electrodes at initial clinical fitting. Regardless of the stimulation approach, the intraoperative estimate of viable electrodes greatly overestimated the number of active electrodes in the clinical map. The number of active electrodes was associated with long-term perceptual outcomes. Among patients with 10-year follow-up, at least 11/21 active electrodes were needed to support good word detection and closed-set recognition and 14/21 electrodes to support good open-set word and sentence recognition. Perceptual outcomes were better for children than for adults, despite a lower number of active electrodes. The multichannel auditory brainstem implant (ABI) is a surgically implanted neuro-prosthetic device developed to electrically stimulate auditory neurons of the cochlear nucleus complex (CNC) bypassing the auditory nerve. It is used to restore hearing sensation in patients for whom a cochlear implant (CI) is not effective and/or applicable. Initially, it was indicated for patients affected by neurofibromatosis type 2, who were totally deaf after acoustic neuroma removal . Over tiWhile the ABI can provide hearing to patients in whom auditory nerve function is impaired, perceptual outcomes are often poorer than those for cochlear implant recipients, in whom the auditory nerve remains functional , 9. For One factor that affects ABI outcomes is the coupling of the electrode paddle with the CNC during surgery. Indeed, effective electrode placement is essential to provide patients with auditory sensation while avoiding stimulation of surrounding non-auditory anatomical structures . While eIn the present study, we evaluated interoperative electrophysiology and 10-year follow-up data from adult and pediatric ABI patients to investigate whether: 1) the morphology of intraoperative electrophysiology used to guide electrode paddle positioning differs between two stimulation protocols, 2) intraoperative electrophysiology might be used to predict the number of electrodes activated after surgery and, 3) the number of electrodes at initial activation is associated with auditory outcomes over the long term.Surgical and electrophysiological procedures were approved by the Ethics Committee of Verona Hospital. Written informed consent was obtained from the adult patients and or from the parents/caregiver of pediatric patients. This study was carried out in accordance with the Declaration of Helsinki. Note that all data presented in this study were collected as standard of care for the ABI recipients.A retrospective case series analysis was performed to review data from 24 patients who received Cochlear Nucleus ABIs at the ENT Department in Verona between June 2004 and September 2007. Sixteen patients were adults and 8 were children . At the time of surgery, adult patients were aged 21 to 59 years (mean = 37.69 \u00b1 13.65) and children were aged 1.42 to 10.25 years (mean = 4.09 \u00b1 2.84).Inclusion criteria were 10 years of follow-up, the ability to communicate orally in Italian for adults, and the ability of family members to report on communication for children unable to speak. Exclusion criteria were the presence of motor deficits or body malformations that prevented perceptual testing. Note that children with mental delay were not excluded from the study because their diagnosis was made later in years based on other learning delays.A retrosigmoid approach was used for ABI implantation \u201320. AfteWhen an appropriate positioning of the electrode paddle over the CNC was obtained, the implant was stabilized with suturing before surgery conclusion , 17. DurFor EABR recordings, the Amplaid MK12 electrodiagnostic system was used. Recording settings and parameters are detailed in Veronese et al. . PatientEABR waveforms were analyzed according to Waring , 27\u201330 iABIs were activated 4\u20136 weeks after surgery, based on patient recovery. Adult activation took place in intensive care units with cardiac and respiratory monitoring, in direct collaboration with patients who were asked to report any auditory and non-auditory sensations or any psycho-physical alterations. Threshold and comfort levels of each electrode were defined with a down-up-down procedure. Current levels, quantized by Cochlear as current units (CUs), were progressively increased until the patient reported an auditory response, defined as threshold. To identify the comfort level, CUs were further increased until the patient reported a discomfortable perception . After these initial estimates of threshold and comfort levels, current levels were reduced in 1-CU steps. If non-auditory sensations were reported, the electrode was excluded from the initial speech processor map.In the pediatric population, postoperative EABRs were recorded before activation to guide the initial speech processor map. Recordings were performed under sedation with cardiac and respiratory monitoring.The same intraoperative equipment and electrode montages were used for EABR recordings. EABRs were evoked using common ground stimulation mode, in which current is delivered to the target electrode and all the other electrodes are used as the ground/return electrodes. The pulse phase duration was 150 \u03bcs, the stimulation rate was 25 pulses per second (pps), and current was decreased from 190 CUs to the hearing threshold level in 10-CU steps. Test and retest recordings were performed to identify auditory responses.EABRs were interpreted as follows. Electrodes presenting non-auditory components (peak latency > 4\u20134.5 ms) or unclear/poorly defined responses were excluded from the activation map. After EABR recording and while the children were waking up in a separate room, initial maps were created based on the identified thresholds. Before activation, the initial stimulation levels were decreased to be below the EABR thresholds and then gradually increased in 5-CU steps while observing the child\u2019s behavioral responses.Ten years after the activation of the implant, perceptual abilities were assessed . TestingLevel 0: no sound awareness of sounds and words presented at 65 dBA. Here, participants needed only to indicate that they heard a sound.Level 1: \u226560% correct detection of sounds and words presented at 65 dBA. Here also, participants needed only to indicate that they heard a sound.n-alternative forced choice was used . Disyllable words were used because, unlike English language, there are few monosyllabic words in Italian language. Participants were presented with a test word , and had to choose among the response choices . The response choices were shown on a sheet of paper . Ten test runs words for the 3AFC, 5AFC, and 10AFC tasks, resulting in a total of 30, 50 or 100 words tested for each participant.Level 2: \u226560% closed-set disyllabic word identification. An Level 3: \u226560% open-set word and sentence recognition. Disyllable words (different from those used in the previous tests) and simple everyday sentences were used. During testing, the examiner presented the stimulus (word or sentence), and the participant repeated as accurately as possible. The examiner scored the number of words and words in sentences correctly identifiedAll tests were administered with appropriate levels of difficulty according to age at testing and cognitive level.For the EABRs, Pearson\u2019s chi-squared test was used to compare the distribution of peaks recorded with the two stimulation protocols. Student\u2019s t-test was used to compare differences in peak characteristics across the protocols. Through analysis of intraoperative EABRs, the number of active electrodes was hypothesized for both protocols and compared to the number of active electrodes included in patients\u2019 clinical maps.The number of patients that obtained the different perceptual levels at 10-year follow-up was expressed in terms of percentage. The mean and range for the number of active electrodes was calculated across patients for Level 1 (sounds and words detection), Level 2 (closed-set word recognition), and Level 3 (open-set word and sentence recognition). The number of active electrodes and perceptual results were compared using a Probit model . The median and 95% confidence interval (percentile) of the perceptual results, correlated with the number of active electrodes, were calculated.EABRs were recorded in 13 patients with the CP, 4 with the MP, and 7 with both protocols. Thus, EABRs were recorded in 20 patients with the CP and 11 with the MP. Overall, 896 waveforms were recorded .2Reviewers' comments:Reviewer's Responses to Questions Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0This is a retrospective cohort study aimed at assessing whether intraoperative electrophysiological data from 24 ABI patients correlated with postoperative perceptual outcomes.The abstract is adequate, and has listed rationale and setting details, alongside the most important findings.The introduction section is too long, and several paragraphs discussing details regarding hearing outcomes should be transferred to the discussion section.The objectives of the study are presented clearly and the introduction section communicates the need for investigating the electrophysiological variables impacting perceptual outcomes of ABI surgery. I would also recommend using a STROBE flowchart and checklist. Inclusion and exclusion criteria need to be clearly stated. I would consider including children with mental delay a significant confounding factor, but due to the small number of patients, exclusion is not neccessary, but rather an ancillary statistical analysis with mental delay as a separate binary variable to control sampling bias.However, since the methodology included a small number of patients, evaluated through tests assesing correlation, but not causality. I would suggest using an ancillary multivariate multinomial logistic regression model if a causal connection is to be evaluated between the three groups of perceptual outcomes (level 0-3) and number of electrodes.The tables and figures are adequate and support data interpretation. I have no concerns regarding internal or external manuscript validity. The discussion is fine, addressing all of the objectives of the manuscript, alongside other published relevant studies.A honest limitations and shortcomings paragraph is needed.Reviewer #2:\u00a0I enjoyed reading this article. It presents innovative and new data to the research community regarding ABI. As this is a rare surgery, performed in a few centers worldwide, it is of great interest to publish long term results for ABI patients. The retrospective study is well designed; very well written article and interesting findings. Good figures and tables.Only two little minor details and can be published:page 7: The evoked potentials were selected because more adequate than other potentials in terms of... missing a wordpage 10: eliminate the period before Level 3 (line 189)********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1:\u00a0NoReviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 25 Jan 2023To the editor:We thank the editor and the reviewers for their helpful comments. We have incorporated nearly all suggestions into the revised MS. Below we respond to specific comments. Please let us know if you need further information.Sincerely,Sheila Veronese1. Is the manuscript technically sound, and do the data support the conclusions?Reviewer #1: YesReviewer #2: Yes________________________________________2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: NoReviewer #2: Yes________________________________________3. Have the authors made all data underlying the findings in their manuscript fully available?Reviewer #1: YesReviewer #2: Yes________________________________________4. Is the manuscript presented in an intelligible fashion and written in standard English?Reviewer #1: YesReviewer #2: Yes________________________________________5. Review Comments to the AuthorReviewer #1: This is a retrospective cohort study aimed at assessing whether intraoperative electrophysiological data from 24 ABI patients correlated with postoperative perceptual outcomes.The abstract is adequate, and has listed rationale and setting details, alongside the most important findings.>>Thank you.The introduction section is too long, and several paragraphs discussing details regarding hearing outcomes should be transferred to the discussion section.>>We have moved some of the Introduction to the Discussion. For the inclusion criteria, we now state: \u201cInclusion criteria were 10 years of follow-up, the ability to communicate orally in Italian for adults, and the ability of family members to report on communication for children unable to speak. Exclusion criteria were the presence of motor deficits or body malformations that prevented perceptual testing. Note that children with mental delay were not excluded from the study because their diagnosis was made later in years based on other learning delays.\u201dThe objectives of the study are presented clearly and the introduction section communicates the need for investigating the electrophysiological variables impacting perceptual outcomes of ABI surgery. I would also recommend using a STROBE flowchart and checklist. >> We have added a new figure which presents a STROBE flow diagram of the patient selection process. Inclusion and exclusion criteria need to be clearly stated.>>In the original MS (and unchanged here), we explicitly stated the inclusion and exclusion criteria. I would consider including children with mental delay a significant confounding factor, but due to the small number of patients, exclusion is not necessary, but rather an ancillary statistical analysis with mental delay as a separate binary variable to control sampling bias.However, since the methodology included a small number of patients, evaluated through tests assessing correlation, but not causality. I would suggest using an ancillary multivariate multinomial logistic regression model if a causal connection is to be evaluated between the three groups of perceptual outcomes (level 0-3) and number of electrodes.>> Two multivariate logistic regression models were evaluated, one with 15 subjects (excluding the single subject with score 0) and one with 13 subjects - file attached as Supplemental Informations. Although neither model detected a significant relationship between the number of active electrodes and 10 yr outcome data, there was a positive trend, consistent with the results previously reported in the MS. Accordingly, we prefer to retain the previous analysis. If the reviewer and editor think it\u2019s worthwhile, we could present the multivariate logistic regression models as supplementary data.The tables and figures are adequate and support data interpretation. I have no concerns regarding internal or external manuscript validity. The discussion is fine, addressing all of the objectives of the manuscript, alongside other published relevant studies.>>Thank you.An honest limitations and shortcomings paragraph is needed.>>We have added to the end of the Discussion: \u201cOne limitation to the present study is that the perceptual outcome categories were somewhat broad, enough so that they could be used to characterize both pediatric and adult perception. The categories represented increasing levels of difficulty, similar to the principles of the speech recognition hierarchy introduced by Geers (1994) and developed for the pediatric population [45]. As deafness in the adult ABI patients was due to tumors, neuropathy, head trauma, etc. (but not presbycusis), we felt that the present categories could be applicable to adults and children. While developmental differences between adults and children were not considered, children generally outperformed adults, possibly due to a better neural substrate [33], or greater neural plasticity [34]. Greater standardization of perceptual outcomes appropriate for adults and children would allow for better characterization of ABI outcomes.\u201dReviewer #2: I enjoyed reading this article. It presents innovative and new data to the research community regarding ABI. As this is a rare surgery, performed in a few centers worldwide, it is of great interest to publish long term results for ABI patients. The retrospective study is well designed; very well written article and interesting findings. Good figures and tables.>>Thank you.Only two little minor details and can be published:page 7: The evoked potentials were selected because more adequate than other potentials in terms of... missing a word>>Revised as: \u201cThe evoked potentials were selected because they were more appropriate than other cortical potentials in terms of the presence and stability of responses [21], and because they were indifferent to anesthesia .page 10: eliminate the period before Level 3 (line 189)>>Corrected.AttachmentVeronese - Response to Reviewers.docxSubmitted filename: Click here for additional data file. 13 Feb 2023Ten-year follow-up of auditory brainstem implants: From intra-operative electrical auditory brainstem responses to perceptual resultsPONE-D-22-23874R1Dear Dr. Veronese,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Paul Hinckley Delano, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 22 Feb 2023PONE-D-22-23874R1 Ten-year follow-up of auditory brainstem implants: From intra-operative electrical auditory brainstem responses to perceptual results Dear Dr. Veronese:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Paul Hinckley Delano Academic EditorPLOS ONE"} +{"text": "As demonstrated by the COVID-19 pandemic, endemic diseases or epidemic outbreaks represent a significant financial risk to society. In veterinary medicine, risks also include the loss of animals and the reduction of productivity and market access. Antimicrobials contribute to the treatment and prevention of infectious diseases in both animals and humans while improving farm animals' productivity and welfare. However, antimicrobial resistance (AMR) is becoming an important and growing economic and social problem associated with annual costs estimated at US$1 trillion to US$3.4 trillion worldwide , and is https://www.canada.ca/en/health-canada/services/publications/drugs-health-products/tackling-antimicrobial-resistance-use-pan-canadian-framework-action.html. This responsible use in animal production is intended to preserve the effectiveness of antibiotics and minimize the development and spread of AMR.It is well known that antimicrobial resistant bacteria are selected mainly by antibiotics/antimicrobials use (AMU). In conventional production, antibiotics have been used to prevent infectious diseases. However, this practice has been discontinued in more and more countries due to restrictions on antibiotic use. Antibiotics as feed additives to promote growth and eventually prevent diseases in healthy production animals were banned by the European Union in 2006. In 2018, the European Parliament approved new restrictions on the use of antimicrobials in healthy livestock. The Government of Canada has developed a Federal Framework and Federal Action Plan on AMR to initiate and take action in the areas of surveillance, stewardship, and innovation Lagarde et al. evaluated the impact of regulation by comparing the AMR situation in dairy cattle in Qu\u00e9bec before and after the introduction of the new regulation. They found that AMR was significantly decreased in generic Escherichia coli from dairy cattle, and this started 2 years after the initiation of the AMU regulation. Despite this positive effect on AMR, decreasing AMU should also be evaluated for other aspects, including health and productivity. Another study on the reduction of antimicrobial use by Khine et al. showed a decline in pathogenic mcr-positive E. coli following the withdrawal of colistin in pigs. The study by Furuya et al. reported significantly higher resistance rates in E. coli and Enterococcus spp. isolates from sick pet animals than in those from healthy ones and concluded that the use of antimicrobials could select resistant E. coli and Enterococcus spp. The optimization of therapeutic doses by better understanding of pharmacokinetics and pharmacodynamics (PKs and PDs) could reduce the burden of the therapeutic use of antimicrobials on AMR. This concept has been presented for danofloxacin in pigs by Zhou et al..In this Research Topic, The microbiota play critical roles in the gut and establish general health in the animal by maintaining/improving organ integrity and function and the provision and absorption of nutrients, as well as protecting against pathogens, including promoting immunity. A well-established microbiota plays a particularly important role in young animals. Feed additives, including alternatives to antibiotics, received attentions after the ban or restriction of in-feed antibiotics as growth promoters. Few studies have investigated the effects of antimicrobials on the metabolism, physiology, and immunity of animals. By contrast, several studies have reported their effects on microbiota and microbiomes. However, many other factors, such as genetics (line), physiological status, sex , health , and housing/husbandry, influence the microbiota. Microbes respond to antimicrobials by developing and acquiring resistance mechanisms and changing gene expression patterns, which alter their metabolism and nutrient uptake and transport . The eliKong et al.). A comparison of the fecal microbiomes and antibiotic resistance genes (ARGs) in free-ranging and zoo-captive rhesus macaques by Jia et al., revealed that semi-captive wildlife might harbor a higher diversity of ARGs. Anemoside from Pulsatillae Radix has been found to potentially alleviate calf diarrhea, protect the integrity of the intestinal mucosa, and change the structure of intestinal microbiota . Baicalin, another plant compound, this time from Scutellaria baicalensis , has been shown to potentially reverse azithromycin resistance in Staphylococcus saprophyticus .In this Research Topic, the analysis of fecal microbiota in healthy, diarrheal, and treated weaned piglets showed differences between these three animal groups , which could be related to temperature . TherefoG\u00fcnther et al. investigated environmental factors associated with the prevalence of extended-spectrum beta-lactamase (ESBL) and AmpC-producing E. coli in wild boar. The findings from this study improved our understanding of the distribution of AMR in humans and animals using \u201cOne Health\u201d approaches. The plasmid pE165, a mobile genetic element (MGE) involved in the horizontal transfer of erm(T) in Enterococcus faecalis, and its intraspecies and interspecies transmission ability, was determined by Li X-Y et al.. Different types of multidrug-resistant Klebsiella pneumoniae harboring virulence and resistance genes on MGEs, including IncFIB-, IncFII-, IncR-, and IncX3-type plasmids, were shown to be present in diseased dogs and cats in China . Furthermore, Li A et al. showed the simultaneous occurrence of tet(X4), blaNDM \u2212 1, and blaOXA \u2212 58 in a porcine Acinetobacter towneri isolate. The tet(X4) and the florfenicol floR resistance genes were flanked by IS91-like elements, emphasizing the importance of AMR surveillance in animals.\u201cOne Health\u201d approaches, using \u201comics\u201d and well-structured government-controlled surveillance, are needed. Additionally, it is imperative to understand the impacts of environmental factors on the evolution of bacteria and the development of AMR. In this context, Antimicrobial resistance is a \u201cOne Health\u201d issue because AMR genes can be spread across humans, animals, and the environment. Surveillance, whole-genome sequencing, microbiota/microbiome, and antibiotic stewardship research are needed to determine important AMR drivers. The identification of hot spots and the ability to predict phenotype and transmission pathways, along with the adoption of best AMU practices, will help mitigate AMR. New knowledge contributing to the improvement of animal health and production, as well as studies providing science-based evidence about AMR transmission through the food chain and the environment, are needed. Owing to the high load of ARGs in animal manure and their potential spread to the environment when manures are used as soil fertilizers, the effects of different treatments of raw manures, such as composting (thermophilic composting and vermicomposting) and anaerobic digestion, should be investigated.All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication."} +{"text": "The Annual Conference and International Conference of the Chinese Association of Micro-NanoTechnology is a comprehensive, cross-disciplinary, high-level academic conference that has been held annually since 1994 and has become an important academic event in the field of micro- and nanotechnology. The conference includes an opening ceremony, reports related to the main and sub-venues, education and training, a call for papers, and technical exhibits. Moreover, it provides a platform for domestic and foreign micro- and nanotechnology workers to exchange ideas, technology, and scientific research pertaining to micro- and nanotechnology and related fields.This Special Issue contains sixteen papers and one review from the 23rd Annual Conference and 12th International Conference of the Chinese Society of Micro-Nano Technology (CSMNT 2021), which was held in Harbin, China (24\u201327 September 2021). The papers highlight new findings and technologies related to micro/nanoenergy, micro-electromechanical systems, nanosystems, and nanomaterials, as well as emerging related fields.This issue includes a proposal for a novel spiral-wound optic-fibre sensor to monitor the corrosion of steel bars by some authors; the feasibility of the spiral distributed sensors was verified experimentally. This method can be used to evaluate the initial and final cracking behaviours of concrete structures, as well as steel bar corrosion . Due to Light-emitting diodes (LEDs) are widely used in medicine, navigation, and landscape lighting. The development of high-power LEDs requires the dissipation of LED heat. The authors reviewed the packaging technology and structure in terms of the thermal performance of LED packaging and introduced related technologies that promote heat dissipation in LED packaging . Some auAnother group of authors used microelectromechanical systems (MEMS) combining electrical, optical, and mechanical components at the micro-scale for miniaturizing mechanical micro devices . The autAnother group of authors designed and fabricated a laser-controlled intelligent initiation system with inherent safety and a laser-controlled explosion-initiating device (LCEID) using integrated safe-and-arm, electromagnetic pulse-resistant, and fast-acting technologies. A modular design and integrated circuit fabrication techniques were also used . Some auWe would like to thank all of the authors for contributing their original manuscripts to this Special Issue, and the reviewers for their participation in the peer-review process, which helped to improve the quality of the papers."} +{"text": "To construct an in vitro inflammation model, HDPSCs were exposed to LPS. The MTT test and migration assay were used to investigate the effect of HM-Exos on cell proliferation and migration, and the quantitative polymerase chain reaction (qPCR) was used to assess the expression of inflammatory genes in HDPSCs. Data were analyzed using a one-way analysis of variance (ANOVA) with Tukey's post-test.DLS measurement revealed that HM-Exos were 116.8\u2009\u00b1\u20093.6\u00a0nm in diameter. The SEM and TEM images revealed spherical shapes with diameters of 97.2\u2009\u00b1\u200934.6\u00a0nm. According to the results of the cell viability assay, the nontoxic concentration of HM-Exos (200\u00a0\u00b5g/ml) was chosen for the subsequent investigations. The migration assay results showed that HM-Exos improved the potential of LPS-exposed HDPSCs to migrate. The qPCR results indicated that HM-Exos significantly reduced the expression of inflammatory cytokines such as TNF-\u03b1, IL-1\u03b2, and IL-6 in HDPSCs after LPS stimulation.HM-Exos increased LPS-exposed HDPSCs migration and proliferation and reduced gene expression of inflammatory cytokines. They may be a viable candidate for pulpitis therapy.The online version contains supplementary material available at 10.1186/s12903-023-02796-4. HM-Exos were successfully isolated using the exosome extraction kit.The size and shape of HM-Exos were analyzed using DLS, SEM, and TEM.HM-Exos improved the migration potential of LPS-exposed HDPSCs.HM-Exos reduced the expression of inflammatory cytokines such as TNF-\u03b1, IL-1\u03b2, and IL-6 in LPS-exposed HDPSCs.The online version contains supplementary material available at 10.1186/s12903-023-02796-4. Tooth decay, dental trauma, tooth erosion, and other dental problems can all stimulate inflammation in the dental pulp tissue, leading to pulp necrosis and even periapical periodontitis . One of When the pulp is damaged, it requires vital pulp therapy to keep it alive and functional. A suitable pulp capping substance should protect the pulp from infection and create a favorable biological environment for the regeneration of dental pulp tissue . DependiExosomes are extracellular vesicles released by various cell types and have a diameter of 30\u2013150\u00a0nm. They contain various types of components obtained from source cells, such as proteins, miRNAs, RNA, and DNA, which conduct a significant role in cell-to-cell interaction . They arBreast milk includes a wide range of components, including immune competent cells, milk fat globules (MFG), soluble proteins such as IgA, cytokines, and antimicrobial peptides . ExosomeMesenchymal stem cells (MSCs) are multipotent stem cells found in a variety of adult tissues, including bone marrow, adipose tissue, and tooth pulp. These cells are distinguished by their ability to self-renew and multi-differentiate \u201318. MSCsAs a result, we constructed a model of LPS-induced inflammation in human dental pulp stem cells (HDPSCs), and the effects of human milk exosomes (HM-Exos) on the proliferation, migration, and inflammatory response of LPS-induced HDPSCs were investigated.Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) and fetal bovine serum (FBS) were supplied by Gibco, Grand Island. Penicillin plus streptomycin solution, Escherichia coli LPS powder, and 3--2,5-diphenyltetrazolium bromide (MTT) were obtained from Sigma-Aldrich . Exosome extraction kit (Exocib) was supplied by Cibbiotech Co . Dimethyl sulfoxide (DMSO) provided from Merck Chemical Co.g for 1\u00a0h at 4\u00a0\u00b0C to further remove deposited cells and then at 12,000\u00a0g for 1\u00a0h, and 14,000\u00a0g for 2\u00a0h at 4\u00a0\u00b0C to pellet the vesicles /d2 which SD\u2009=\u20095.2, d\u2009=\u20090.504, and \u03b1\u2009=\u20090.1. According to this assessment, 294 participants were needed; therefore, owing to the availability of data and to account for every possible exclusion, 350 participants were added. Birjand University of Medical Sciences Ethics Committee approved the study. Before recruitment, subjects provided written informed consent. All participants had infants aged 1\u20136\u00a0months, with no history of chronic diseases or medication use in the previous six months. At the start of the day, each mother was asked to provide two samples of breast milk in 20\u00a0ml volumes expressed from primary breastfeeding. Breast milk is centrifuged after collection to remove fat and debris. The upper-fat layer is removed by centrifuging milk at 300\u00a0g for 45\u00a0min at 4\u00a0\u00b0C. The supernatants were centrifuged at 2000vesicles , 23. TheDLS (NanoBrook 90Plus) was used to evaluate the size of Exos, and to further analyze the size and morphology of Exos, SEM (FEI Quanta 200) and TEM (Philips EM 208S) were employed.The HDPSCs were isolated using a technique reported in our prior publication . In brie4 cells per well and incubated in culture media containing various concentrations of LPS for 24\u00a0h. These LPS-induced HDPSCs were called inflammatory human dental pulp stem cells (iHDPSCs). Then 20\u00a0\u00b5l of MTT solution (2\u00a0mg/ml in PBS) was added to each well, and the plate underwent incubation for 4\u00a0h at 37\u00a0\u00b0C incubator in the dark. Afterward, the supernatant was eliminated, 100\u00a0\u00b5l DMSO was added to each well, and the optical absorption of the samples was measured at 570 and 630\u00a0nm using a spectrophotometer .According to published methods , 24, Esc4 cells per well. After 24\u00a0h of LPS induction (1\u00a0\u00b5g/ml), the medium was changed to complete culture medium supplemented with different doses of HM-Exo for 24\u00a0h at 37\u00a0\u00b0C. Then 20\u00a0\u00b5l of MTT solution was added to each well, and the plate underwent incubation for 4\u00a0h at 37\u00a0\u00b0C in the dark. Afterward, the supernatant was eliminated, 100\u00a0\u00b5l DMSO was added to each well, and the optical absorption of the samples was measured at 570 and 630\u00a0nm using a spectrophotometer.For the cell viability test, HDPSCs were planted in a 96-well plate at a density of 1.5 A scratch test was used to evaluate the migration potential of iHDPSCs. HDPSCs were planted into six\u2010well plates. After 24\u00a0h of LPS induction (1\u00a0\u00b5g/ml), the medium was changed to complete culture medium, and a straight scratch was formed with a 200\u00a0\u03bcl tip. Microscopy was used to observe cell migration at 0, and 24\u00a0h after treatment with 200\u00a0\u00b5g/ml of HM-Exos. The lesion's boundary areas were evaluated and photographed using an inverted microscope . Cellular migration was evaluated by measuring the ratio between the reduced open space after 24\u00a0h and the open space at 0\u00a0h.5 cells. After 24\u00a0h of LPS induction (1\u00a0\u00b5g/ml), the mRNA expression levels of TNF-\u03b1, IL-1\u03b2, and IL-6 were evaluated using the quantitative real-time polymerase chain reaction and the GAPDH gene was used as an endogenous control. Isolation of RNA and cDNA synthesis were performed using the Pars Tous kit according to the manufacturer\u2019s instructions, and real-time was done using the SYBR Green assay. The expression levels of target genes were calculated using the 2\u2212\u0394\u0394Ct method. The sequences of primers used are shown in Table HDPSCs were planted into the plates at a density of 3 mentclass2pt{minimp\u2009<\u20090.05 as the statistical significance value. Mean and standard deviation (SD) were determined . A one-way analysis of variance (ANOVA) with Tukey's posthoc multiple comparison test was employed to assess statistical significance for noticing significant differences between study groups, with According to DLS findings, HM-Exos were 116.8\u2009\u00b1\u20093.6\u00a0nm in diameter Fig.\u00a0 and 3.Fip\u2009>\u20090.05). 1\u00a0\u00b5g/ml of HM-Exos was chosen for the following investigations.The effect of LPS powder (0.5\u20138\u00a0\u00b5g/ml) on the cell viability of HDPSCs is shown in Fig.\u00a0p\u2009<\u20090.01) and 50\u00a0\u00b5g/ml (p\u2009<\u20090.05). In comparison to the control group, no statistically significant difference in cell toxicity or proliferation was seen at 5 and 100\u2013400\u00a0\u00b5g/ml doses (p\u2009>\u20090.05). Furthermore, at 800\u00a0\u00b5g/ml, cell viability was reduced (p\u2009<\u20090.01). Based on the findings of the cell viability assay, the concentration of 200\u00a0\u00b5g/ml was chosen for the following investigations.The effect of LPS powder (1\u00a0\u00b5g/ml) and different doses of HM-Exos on the cell viability of iHDPSCs is shown in Fig.\u00a0P\u2009<\u20090.001).To investigate the effect of HM-Exos on the migration capacities of iHDPSCs, the scratch test was done Fig.\u00a0. The resp\u2009<\u20090.01, p\u2009<\u20090.01, p\u2009<\u20090.05) respectively compared to the HDPSC group. HM-Exos significantly reduced LPS-induced expression of IL1-\u03b2, IL-6 (P\u2009<\u20090.01), and TNF\u03b1 (P\u2009<\u20090.05) compared to the iHDPSC group.To investigate the inhibitory impact of HM-Exos on mRNA expression of inflammatory cytokines in iHDPSCs, q-PCR was used Fig.\u00a0. LPS sigThe expression of inflammatory cytokines can be stimulated in DPSCs by LPS, a significant component of the bacterial outer membrane . ImmunosIn this investigation, LPS induced an inflammatory condition in DPSCs by increasing the expression of TNF-\u03b1, IL-1\u03b2, and IL-6. In addition, we indicated that the level of inflammatory cytokines reduced after treatment with HM-Exos.Pulpitis is a common inflammation of tooth pulp tissue, and oral microbes are implicated in this opportunistic infection. According to research, various parameters associated with host reaction play an important role in pulpitis. Among these components are immune system inflammatory mediators such as cytokines and chemokines, which contribute to pulpal defense mechanisms In this regard, the results of a reversible pulpitis model showed that IL-1\u03b2, IL- 6, and TNF-\u03b1 gene expressions were elevated in LPS-exposed inflamed pulp tissues . Recent Exosome therapy is emerging as a viable treatment option for a variety of disorders, particularly inflammatory ones. The use of exosomes in clinical applications and disease therapy is attended by limitations such as the difficulty in identifying an effective separation and purification approach, the inadequate standardization of large-scale production processes, and target cell uptake capacity .In conclusion, the results showed that HM-Exos therapy could not only increase iHDPSC migration and proliferation but also reduce inflammatory cytokine gene expression. Although these findings are promising, more in vitro and in vivo studies must be conducted in the future to demonstrate the efficacy of HM-Exos in pulpitis therapy.Additional file 1. Fig. 1. HDPSC isolation and differentiation to osteogenic and adipogenic lineages. Fig. 2. Immunophenotypic characterization of DPSCs. Table 1. Mean and standard deviation (SD) values of cell viability in MTT assay. Table 2. Mean and standard deviation (SD) values of cell viability in MTT assay. Table 3. Mean and standard deviation (SD) values of relative gene expression in q-PCR assessment."} +{"text": "Targeting glutamine metabolism has an impact on T cell activation and differentiation. However, the effect of glutamine metabolism blocking upon AIH remains unknown. We use glutaminase antagonist 6-diazo-5-oxo-L-norleucine (DON) for in vitro T cell activation and differentiation were measured using separated splenocytes stimulated with ConA with or without DON. The activation and differentiation of T cells were tested using flow cytometry, qRT-PCR and ELISA. Phosphorylation level of mammalian target of rapamycin (mTOR) and 70 kDa ribosomal protein S6 kinase (P70S6K) were examined by western blotting.AIH mice were treated with JHU083 or vehicle before concanavalin A (ConA) administration, and disease severity was examined. Then activation and differentiation [including Th1/Th17 cells and cytotoxic T lymphocytes (CTL)] of T cells from Vehicle-WT, JHU083-AIH and Vehicle-AIH mice were tested. Furthermore, in vivo and in vitro. Besides, we demonstrated that glutamine metabolism blocking inhibited T cells activation and differentiation through decreasing the mRNA expression of amino acid transporter solute carrier family 7 member 5 (SLC7A5) and mitigating the activation of mTOR signaling.JHU083 and DON significantly suppressed the activation of T cells and inhibited the differentiation of Th1/Th17 cells and CTL We proved that targeting glutamine metabolism represents a potential new treatment strategy for patients with AIH and other T cell-mediated disease. Mechanistically, we demonstrated that glutamine metabolism blocking inhibits T cells activation and suppresses the differentiation of Th1/Th17 cells and CTL. Autoimmune hepatitis (AIH) is a self-perpetuating inflammatory liver disease, and the misdiagnosis or delayed treatment of AIH can lead to liver cirrhosis, liver cancer, liver transplantation and even rapid death \u20133. AIH oThe precise etiology and pathophysiology of AIH remains largely unknown, and lacking valid animal models for AIH research makes this situation a vicious circle. Thus, related basic research in this field is relatively limited compared with other types of hepatitis. However, some animal models can partially represent the pathogenesis of AIH, among which, intravenous injection of concanavalin A (ConA) is widely used in AIH research and this model shows the specific participation of T cells in promoting liver injury . ConA prin vivo assays.Glutamine is a conditionally essential amino acid in rapidly proliferating cells and glutaminolysis is a very important source of energy for effector T cells . GlutamiBecause the mTOR signaling cascade plays a central role in the regulation of T cell activation and differentiation \u201327, blocC57/BL6 mice were purchased from Shanghai SLAC Laboratory Animal Co . All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Shanghai Institute of Materia Medica (SIMM), Chinese Academy of Sciences and approved by the Institutional Animal Care and Use Committee of SIMM.via intravenous injection. The Vehicle-AIH group received administration of 5% MC by oral 24h and 1h before ConA injection, while mice in JUH083-AIH group were treated with JHU083 dissolved in 5% MC via gavage 24h and 1h before ConA treatment. Blood and liver tissues were collected from mice that were sacrificed 6h after ConA treatment. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) and alkaline phosphatase (ALP) were analyzed using an automatic biochemical analyzer to assess liver injury. For survival analysis, concentration of ConA was adjusted to a lethal dose (20mg/kg) and mice were under observation until 48h after ConA injection.Mice were randomly divided into three groups: wild-type (WT) group , vehicle group and JHU083-treated group . Induction of AIH was based on the treatment of mice with ConA (8mg/kg body weight (BW), C2010, Sigma-Aldrich, USA). Mice in Vehicle-WT group were treated with 5% methyl cellulose (MC) dissolved in saline by oral gavage 24h and 1h before administration of saline The tissues were fixed in 4% paraformaldehyde and embedded in paraffin. Tissue sections were prepared and stained with hematoxylin-eosin (H&E). Terminal Deoxynucleotidyl Transferase (TdT)-mediated dUTP Nick-End Labeling (TUNEL) staining was performed in paraffin-embedded liver sections using the TUNEL Kit . Finally, the slides were scanned using a fluorescence microscope .Spleens were dissected from C57BL/6 mice and cell suspensions were prepared as following steps. Spleens were milled and centrifuged at 400g for 5 minutes. Red blood cells were lysed and splenocytes were washed with 10ml phosphate buffer solution (PBS). Cells were resuspended with complete medium -1-piperazineethanesulfonic acid (HEPES), 1mM glutamine, 50\u03bcM \u03b2-mercaptoethanol and 1mM sodium pyruvate) for further culture or for cytometric assays.in vivo T cells activation and differentiation tests, splenocytes were separated from mice in WT-Vehicle, Vehicle-AIH and JHU083-AIH group and stained with above antibodies for flow cytometry analysis. The antibodies used in the flow cytometry were as follows: CD4 , CD8a , CD25 , CD69 , IL4 , IL17A were purchased from Elabscience Biotechnology , antibodies IFN\u03b3 was purchased from BD Biosciences (UK), and Granzyme B was purchased from Biolegend . SLC7A5 antagonist LAT1-IN1 (HY-108540) was purchased from MedChemExpress .Isolated splenocytes were activated with ConA (1.5\u03bcg/ml) with or without 2.5\u03bcM DON . After 24h, the expression of CD69 and CD25 were analyzed by flow cytometry to evaluate the activation of CD4(+) and CD8(+) T cells. For T cell differentiation analysis, splenocytes were stimulated using ConA (1.5\u03bcg/ml) with or without DON (2.5\u03bcM). GlogiPlug was added 18h after for the next 24\u2009h of incubation. The cells were first stained with monoclonal antibodies CD4 and CD8 for 20\u2009min at room temperature, then fixed using a Fixation/Permeabilization Solution Kit , and finally stained with IFN-\u03b3, IL4, IL17 and Granzyme B antibodies. Flow cytometry analysis was conducted by flowJo_V10 software . For The IFN-\u03b3 Mouse Uncoated ELISA Kit and IL17 Mouse Uncoated ELISA Kit were used to measure the levels of IFN-\u03b3 and IL17 in the serums of mice in Vehicle-WT, Vehicle-AIH and JHU083-AIH group and the supernatants of unstimulated splenocytes or splenocytes that were stimulated with ConA in the presence of vehicle or DON. Briefly, the serums and supernatants were collected and added to the well of corresponding microplates for 2h. After the samples were washed with wash solution, 100\u03bcL of mouse IFN-\u03b3 or IL17 conjugate was added to each well for 2h. The washing process was repeated, and 200\u03bcL of Substrate Solution was added and incubated for 30\u2009min. Then, 50\u03bcL of Stop Solution was added to each well, and the optical density was determined within 30\u2009min using a microplate reader set to 450nm.Protein samples were homogenized with SDS loading buffer and boiled to denature the proteins. Samples with different sizes were separated by 10% SDS-polyacrylamide gel electrophoresis, and transferred to NC membranes. After blocking with 5% non-fat milk solution for 1h, membranes were incubated with \u03b2-Actin, P-mTOR, mTOR, P-P70S6K P70S6K at 4\u00b0C overnight. Then, membranes were incubated with HRP-linked anti-rabbit IgG at room temperature for 1h. Finally, the membranes were stained with ECL detection buffer and visualized using ChemiDoc system . Primary antibodies including \u03b2-Actin (12620), P-mTOR (2971S), mTOR (2972S), P-P70S6K (97596), P70S6K (34475) were purchased from Cell Signaling Technology .Total RNA was extracted using TRIzol reagent followed by cDNA synthesis using RT Master Mix . Subsequently, cDNA was used to measure the mRNA levels of IFN-\u03b3, IL4, IL17, SLC7A5 and SLC1A5 using a Real-Time PCR System . \u03b2-Actin was used as the normalization control. All reactions were performed in triplicates. The relative quantifications were measured by the comparative CT method. The primer sequences used were as follows: IFN-\u03b3: forward: CAGCAACAGCAAGGCGAAA, reverse: CTGGACCTGTGGGTTGTTGAC; IL-4: forward: CGCCATGCACGGAGATG, reverse: CGAGCTCACTCTCTGTGGTGTT; IL17: forward: ATCTGTGTCTCTGATGCTGTTGCTG, reverse: TGGAACGGTTGAGGTAGTCTGAGG; SLC7A5: forward: CTGGATCGAGCTGCTCATC, reverse: GTTCACAGCTGTGAGGAGC; SLC1A5: forward: ATCGCACAACTAAACGGGGT, reverse: ACTGCTTCCAGGATGATGGC; \u03b2-Actin: forward: AACAGTCCGCCTAGAAGCAC, reverse: CGTTGACATCCGTAAAGACC.P\u2009<\u20090.05 (*); P\u2009<\u20090.01 (**); and P\u2009<\u20090.001 (***).Experimental data were expressed as the mean\u2009\u00b1\u2009standard error of mean (SEM), and comparisons between two groups were performed using one-way ANOVA analysis. Data were analyzed using GraphPad Prism 8.0.2. Statistical significance was determined at In order to verify the hepatoprotective effect of glutaminase antagonist JHU083 in a ConA-induced AIH model, the survival times of vehicle and JHU083 (0.3mg/kg BW) treated in vivo. CD25 and CD69 are two markers expressed on the surface of activated T cells and CD8(+) T cells and CD8(+) T cells in AIH mice, the differentiation marker of CD4(+) and CD8(+) T cells (IFN\u03b3 and Granzyme B for CTLs) were evaluated using flow cytometry. We observed that the frequency of IFN\u03b3- and IL17A-expressing CD4(+) T cells instead of IL4-expressing CD4(+) T cells were significantly lower in the spleens of JHU083-AIH mice compared to that of Vehicle-AIH mice (Consistent with the results in vitro.To further characterize the effect of DON on the differentiation of CD4(+) and CD8(+) T cells, the above-mentioned differentiation markers of CD4(+) and CD8(+) T cells were tested. DON significantly inhibited the differentiation of Th1 and Th17 cells rather than Th2 cells signaling is a master regulator of cell metabolism and promotes anabolic processes such as protein synthesis . The act CASTOR1 . Glutamiinolysis . In addiinolysis \u201327. We hThus, we examined the phosphorylated protein levels of mTOR signaling using proteins extracted from splenocytes that were activated by 1.5\u03bcg/ml ConA with or without treating 2.5\u03bcM DON for 24h. After activating by ConA, the protein levels of phosphorylated mTOR and 70 kDa ribosomal protein S6 kinase (P70S6K) increased sharply. But in the presence of DON, the levels of phosphorylated mTOR and P70S6K instead of their unphosphorylated proteins significantly decreased and glutamine transporter solute carrier family 7 member 5 (SLC1A5) affected both intracellular amino levels and activation of mTOR signaling \u201339. We dRecent studies connecting the fields of amino acid metabolism and immunology have dramatically improved our understanding of how immune cells benefit from a metabolic reprogramming to support their activation and differentiation \u201345. The in vivo and in vitro. However, the reduction of activation and differentiation of T cells may not be enough to explain the attenuation of serum transaminase and pathologic changes of livers. Blocking glutamine metabolism may also ameliorate the activation of mTOR through other mechanisms such as suppressing the production of glutathione .Conception and study design QY, HT, XY, YZ, HJ and QX. Acquisition of data QY, HT, XY, CP, CD, WY, WW and XG. Data analysis QY, HT, XY and CP. Data interpretation JL, HY, YZ, HJ and QX. Manuscript drafting and revising QY, HT, XY, CP, CD, WY, WW, XG, JL, HY, YZ, HJ and QX). All authors contributed to the article and approved the submitted version.This project was funded by National Key R&D Program of China 2018YFA0108200, National Natural Science Foundation of China grants 32000525, \u2018Three-Year Action Plan for Promoting Clinical Skills and Clinical Innovation in Municipal Hospitals\u2019 Key Supporting Projects SHDC2020CR5012 and Major clinical research projects SHDC2020CR2003A.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."} +{"text": "Statistically significant MAO-B inhibitory effects were exerted by some of the compounds where again the catecholic compound 3h was the most potent inhibitor similar to selegiline and rasagiline. The most potent antioxidant effect in the ferrous iron induced lipid peroxidation assay was observed for the three catechols\u20143h and 3j, 3q. The catecholic compound 3h showed scavenging capability against superoxide radicals and antioxidant effect in the iron/deoxyribose system. The study outlines a perspective multifunctional compound with the best safety profile, neuroprotective, antioxidant and MAO-B inhibiting properties.Oxidative stress is a key contributing factor in the complex degenerating cascade in Parkinson\u2019s disease. The inhibition of MAO-B affords higher dopamine bioavailability and stops ROS formation. The incorporation of hydroxy and methoxy groups in the arylhydrazone moiety of a new series of 1,3-disubstituted benzimidazole-2-thiones could increase the neuroprotective activity. In vitro safety evaluation on SH-SY5Y cells and rat brain synaptosomes showed a strong safety profile. Antioxidant and neuroprotective effects were evaluated in H Parkinson\u2019s disease (PD) is a major global health concern, being the second most prevalent neurodegenerative disorder after Alzheimer\u2019s disease, affecting more than 10 million people worldwide. As the incidence of PD rises significantly with age and the human life expectancy is increasing, a dramatic rise of PD prevalence is foreseen and expected to double by 2050, reinforcing the need for new and more effective therapies ,4. Despi50 = 7.5 \u03bcM), and it was also an excellent antioxidant and metal chelator function which estimates the free energy of the binding of the ligand from a given pose and consists of terms that estimate average gain/loss of rotational and translational entropy and loss of flexibility of the ligand. It measures the geometric imperfections of the hydrogen bonds and the desolvation energy of atoms. The best 50 poses for every ligand were further optimized with the Induced Fit methodology, using the AMBER10ETH force field/Born solvation model and optimization cutoff of 6A from the ligand. The GBVI/WSA dG [MOE] was used as rescoring function and the best 30 poses were collected for further analysis.Ligands were protonated according to their protonation state at 7.4 pH and conformation library for the docking study was generated using LowModeMD methodology with AMBER10EHT force field and energy window for collection of conformations 7 kcal/mol from the lowest energy conformation. Docking was performed by the Molecular Operating Environment (MOE) 2016 software package . Our mod1 and 2 with the detailed experimental procedures and IR and NMR spectral data were reported in our previous studies [1 was synthesized by the method previously developed by us, using Michael addition of the starting benzimidazole-2-thione to methyl acrylate in DMF medium [1 with hydrazine hydrate in ethanol led to compound 2, which was further refluxed in absolute ethanol with the respective methoxy and hydroxy-substituted benzaldehydes for obtaining the target 17 compounds [The synthesis of compounds studies . The synF medium . Condensompounds .1H NMR, and 13C NMR spectra. In the IR spectra, the most characteristic bands are for the stretching vibrations of the OH group (3400\u20133200 cm\u22121); the stretching N-H vibrations ; and the amide I (\u03bdC=O) band at ca. 1660 cm\u22121. In the 1H NMR spectra, particularly meaningful are the characteristic N-CH2CH2CO signals (multiplets), shifted downfield due to the deshielding effect of both N-atoms and the CO groups. The chemical shift values for N-CH2 vary in the range from 4.44 to 4.75 ppm, while those for the CH2-CO-groups were found from 2.72 to 3.10 ppm appearing as two separate multiplets. Splitting was observed also for the signals of the azomethyne protons around 8 ppm and the NH groups around 11 ppm (\u22121), while those arising from the rotation around the N-N bond have energy differences around 8 kJ\u00b7mol\u22121 [13C NMR spectra, the signals for the C-atoms of the thione group appeared around 172 ppm, while those from the carbonyl groups\u2014in the interval 166\u2013168 ppm. The azomethyne C-atoms resonate at ca. 143\u2013146 ppm. The signals for the aromatic C-atoms from the phenyl rings and the benzimidazole heterocycle are within the interval 110\u2013130 ppm. The signals of the methylene groups were found at ca. 30\u201333 ppm. The signals for the C-atoms bonded to the hydroxyl groups appeared from 146 to 160 ppm depending on the position. The methoxy groups gave signals at ca. 55 ppm.The structures of the new compounds were confirmed by IR, d 11 ppm . The intkJ\u00b7mol\u22121 . Therefo50 values were used as a robust parameter for comparison. The test compounds were dissolved in DMSO and serially diluted in cell culture medium to achieve final concentrations ranging from 1 to 500 \u00b5M; the culture medium containing DMSO in the corresponding concentration was used as untreated controls. A concentration dependent effect on cell viability was observed after 24 h incubation. The calculated IC50 values were in the range of 65.30\u2013301.10 \u00b5M showed a more pronounced toxicity effect. Their calculated IC50 values were in the range between 65.30\u201377.79 \u00b5M.It should be noted that compounds 2O2-induced oxidative stress in neuronal SH-SY5Y cells and then treated with H2O2 . The increase in cell viability compared to the H2O2-treated group was accepted for attendance of protective effect. For comparison, the effects of two compounds with well established antioxidant activity\u2014rasagiline and melatonin\u2014were also evaluated.The potential neuroprotective effects of the safest compounds were evaluated in a model of H5Y cells . The toxp < 0.001), vs. H2O2-treatment, while in the same concentrations rasagiline showed protection by 10% (p < 0.05), 20% and 39%, respectively (p < 0.001). The pre-incubation with test compounds revealed that they exhibit statistically significant protective effects. Notably, in this oxidative stress model, the neuroprotective effects of compounds 3h and 3i were even more pronounced than those of melatonin and rasagiline. Thus, the pretreatment of SH-SY5Y cells with compound 3h (50 \u00b5M) and 3i (50 \u00b5M) restored cell viability to 79% and 80%, respectively vs. H2O2-treatment (p < 0.001). For comparison, at the same concentration (50 \u00b5M), melatonin and rasagiline showed cell viability protection by 52% and 39% (p < 0.001), respectively vs. H2O2-treatment.The pre-incubation of SH-SY5Y cells with melatonin and rasagiline showed protective effects against oxidative damage . Melaton3e, 3h, 3i, 3m (1 to 250 \u00b5M) showed that they did not significantly reduce rat brain synaptosomes viability and did not change the level of GSH in concentrations < 250 \u00b5M ; after that, the samples were subjected to 6-OHDA . The protective effects were evaluated by measurement of synaptosomal viability (MTT-test) and GSH levels and restored the GSH level to 62% (*** p < 0.001), compared to 6-OHDA treatment. Compounds 3e, 3i, and 3m exhibited less pronounced protective effects.Rasagiline and melatonin diminished the lesions caused by the neurotoxicant 6-OHDA. Both compounds increased synaptosomal viability by 61% and 68%, respectively, and restored GSH levels, respectively by 60% and 70% vs. 6-OHDA treatment Among al3d, 3e, 3h, 3i, 3m, 3n, 3p) were evaluated for their potential inhibitory activity on hMAOB. Selegiline and rasagiline as potent MAO-B inhibitors were used as standard compounds for comparison.Monoamine oxidase B catalyzes dopamine metabolism and oxidation leading to the formation of reactive oxygen species and reactive quinones, which provoke dopamine neurotoxicity and neurodegeneration . In the 3h was the most potent with an hMAO-B inhibitory activity similar to selegiline and rasagiline. The current results indicate that the tested compounds effectively inhibit MAO-B at low concentration of 1 \u00b5M. This promising result should be elaborated by kinetic experiments and studies for selectivity and reversibility in order to be fully clarified the inhibition mechanism.The results indicated that all of the tested compounds had statistically significant inhibitory effects on hMAOB activity at concentration 1 \u03bcM . Notably3h and the best interaction energies of all studied compounds were found in the 5.5 kcal/mol energy window (EW), where 3h has about 30% better interaction energy than the next compound 3p (4-hydroxy-2-methoxy derivative). Compound 3n (2-hidroxy-6-methoxy) has the worst predicted interaction energy. The interactions of the ligands with MAO-B are illustrated on The interactions of the compounds with MAO-B were explored by a docking study. The best interaction energy was observed for the catecholic 2,3-dihydroxy compound 3h presented in o-OH groups and the N-azomethyne atoms, is more favorable than the binding poses with intramolecular hydrogen bonds by 1.073 to 1.118 kcal\u00b7mol\u22121 responsible for the chain reaction propagating the lipid peroxidation, the efficacy of new drug candidates in decreasing the lipid oxidative damage is an important additional beneficial feature. The obtained results indicate that all tested compounds possess the capability to influence lecithin oxidative damage by decreasing the absorbance compared to the control samples. Lower absorbance values suggest decreased generation of TBA-RS products and decreased% of the control value. The three used standard reference compounds exert different capability to decrease lecithin peroxidation 3h and 3j, and the 3,4-dihydroxy-5-methoxy hydrazone derivative 3q. The observed sample/control absorbance ration for all these compounds was around 40%.The values of the sample/control absorbance ration were in the range of 40\u201370%. The observed properties correlate well with the types of the structural modifications and their position in the molecular structure. All compounds have lower absorbance value compared to melatonin, corresponding to statistically significant lower lecithin peroxidation. The parameter determined in the system in the presence of compound 2\u2212\u25cf can easily dismutate, and the obtained hydrogen peroxide is relatively stable and possesses the capability to perform facilitated diffusion across the cellular membranes. The presence of both moderately reactive ROS (O2\u2212\u25cf and H2O2) in combination with the increased iron content in some part of the brain tissue are favorable for the generation of the most reactive among all ROS\u2014the hydroxyl radical [The possibility to diminish the concentration of superoxide anion radicals is essential since it is related to the autoxidation process of dopamine and the formation of dopamine quinones that are able to undergo redox reactions generating highly reactive aminochrome leading to the production of superoxide and subsequently deplete the cellular NADPH. The superoxide anion radical can initiate a cascade of reactions associated with the generation of more reactive and harmful ROS via enzyme- or metal-catalysed reactions. Furthermore, an increased SOD activity is present in the late stages of PD ,67. The radical . For the2/NBT) produced superoxide radicals and hydrogen peroxide (H2O2), has been observed. In the potassium superoxide-containing systems, superoxide radical generation is due to the direct addition of the KO2 to the water sample solution. The release of a superoxide anion was estimated via NBT reduction activity, indicating detectable superoxide anion levels. The application of these two alternative model systems will afford the possibility to perform a more accurate interpretation of the obtained results. Since in the enzyme-free model system, the release of the superoxide in the small sample volume is a very fast process, there is a risk of local effects that is avoided in the xanthine-xanthine oxidase system. The use of enzyme reaction provides a relatively slow generation of the superoxide radical and steady concentration.The potency of the compounds selected as the most promising from the cell model systems and hMAOB inhibitory studies was estimated against enzymatically (xanthine/XO system) and non-enzymatically and 3i decreased NBT reduction during the xanthine/xanthine oxidase assay. At the maximal tested concentration compound 3h decreased the \u201c% of the control\u201d ratio to 64%. The effect of compound 3i was moderate and only 15% decrease was observed. The observed effect could be attributed either to the capability of the compounds to capture the superoxide radical or capacity to modulate the activity of the enzyme xanthine oxidase.In the xanthine/xanthine oxidase model system, the salicyl derivative 3h to modulate iron induced deoxyribose degradation was estimated. Several alternative variants of the test have been proposed over the years\u2014H2O2/Fe(III)EDTA/Ascorbic acid [2O2/Fe(III)EDTA variant; Fe(III)EDTA/Ascorbic acid variant; Fe(III)EDTA variant [3h compared to the controls (C) suggesting lower level of MDA-like products reactive with TBA. The observed antioxidant effect was stronger than the reference melatonin and similar to Trolox.The capability of the most potent compound bic acid ; H2O2/Fe variant . The des3h in order to evaluate its capability to protect the deoxyribose molecules from iron induced oxidative damage that might induce strand breaking and formation of terminal fragmented sugar residues.3h and 3i possess the highest IC50 values, 295.90 and 301.11 \u00b5M calculated in SH-SY5Y cells, did not significantly reduce rat brain synaptosomes viability and the level of GSH in concentrations < 250 and were defined as the least toxic. The in vitro antioxidant activities and neuroprotective effects were evaluated in H2O2-induced oxidative stress on SH-SY5Y cells and in the model of 6-OHDA-induced neurotoxicity in rat brain synaptosomes and showed that compounds 3h and 3i demonstrated the most robust antioxidant activity. These effects were even more pronounced than those of melatonin and rasagiline. Further, our in vitro study estimated statistically significant MAO-B inhibitory effects of compounds 3d, 3e, 3h, 3i, 3m, 3n, 3p. It should be noted that the catecholic compound 3h was the most potent, inhibiting hMAOB similarly to selegiline and rasagiline. Additionally, the new benzimidazole derivative 3h demonstrated a better safety profile, higher antioxidant activity and stronger MAOB inhibitory effect than all the other evaluated compounds and was proven as the most promising for further studies. The obtained results indicated that all tested compounds possess the capability to influence lecithin oxidative damage to a different extent depending on the types of the structural modifications. The most potent protective effect in the ferrous iron induced oxidative damage of lecithin was observed for the dihydroxy substituted compounds\u20143h and 3j, , along the 3,4-dihydroxy-5-methoxy hydrazone 3q and the 3,5-dimethoxy-4-hydroxy hydrazone 3d. Moreover, hydrazone 3h showed scavenging capability against superoxide radicals and capability to decrease deoxyribose oxidation. A more general conclusion could be made based on our up-to-date studies stating that the presence of a hydroxyl group in position 2 of the arylhydrazone fragment is essential for the simultaneous display of high neuroprotective and antioxidant properties, as well as MAO-B inhibiting properties.The properties of the compounds subject of the current study surpass all our previous results on benzimidazole aldehyde hybrids as potential multi-functional compounds in terms of MAO-B inhibition and neuroprotection. The in vitro safety evaluation on SH-SY5Y cells and rat brain synaptosomes showed a strong safety profile. Moreover, compounds"} +{"text": "Even during the conflict, agricultural extension by the Palestinian Authority has played an important role in agricultural development in the West Bank of the Occupied Palestinian Territories (OPT). The Ministry of Agriculture of the Palestinian Authority provided the necessary agricultural extension services for Palestinian farmers affected by the Israeli settlements and Segregation Wall. Despite such importance of agricultural extension, few quantitative studies have examined its effect on Palestinian farmers. Therefore, the objective of this study was to quantify the effect of agricultural extension on technology adoption by Palestinian farmers for appropriate evaluation of the agricultural policies by the Palestinian Authority. The microdata of 79,446 agricultural holdings from the Agricultural Census 2010, which was the only microdata officially published and available at the time of this study, was used. Then, the Propensity Score Matching (PSM) method was employed to mitigate the endogenous bias caused by self-selection by farmers in receiving the agricultural extension. The results showed that agricultural extension has positively and significantly affected the adoption of five technologies, namely improved crop varieties, chemical fertilizers, organic fertilizers, pesticides, and biological control. The estimated increase in the adoption rate of those technologies as the average treatment effects on the treated (ATT) by the nearest-neighbor matching method were by 7.1, 7.7, 5.4, 6.8, and 3.8 percentage points respectively. This study proved that agricultural extension promoted the adoption of those technologies even in the conflict. Therefore, agricultural extension by the Palestinian Authority plays an important role in farming by Palestinian farmers. In order to maintain and improve farmers\u2019 livelihoods sustainably, it is necessary to continue the agricultural extension by the Palestinian Authority in the future, considering the behavior of farmers. Conflict is directly associated with poverty, hunger, and agricultural development, thus it is essential to understand that gains in agricultural productivity and food security improve poverty and hunger indicators . The effThe West Bank of the Palestinian territories has been under Israeli occupation since 1967. Under such an environment, Palestinian farmers continue to farm for their livelihood. The West Bank was selected as the target area for this study because assistance to such farmers was recognized as an urgent issue. Some parts of the agricultural land in the West Bank were confiscated by the Israeli Occupation Authorities for expanding Israeli settlements and constructing the Israeli Segregation Wall during the conflict Reviewers' comments:Reviewer's Responses to Questions Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. The Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0This paper analyzes the effect of the agricultural extension by the Palestinian authority on technology adoption by Palestinian farmers in the West Bank. The Palestinian authority may be able to promote broader adoption of these technologies by combining methods to increase yield per area with any measure to alleviate farmers\u2019 psychological anxieties is a policy implication recommended by the authors.Overall the article is well written and well organized, however the article has some minor typos.The abstract should follow the following outline: a reminder of the fundamental objective, estimation methods and data, main results, and recommendations.In the presentation of the methodology, the author should present the theoretical model, drawing on the models used in the literature review.The data used are quite old. More recent data would give more interesting results.On page 9, just after Table 2, the interpretation of the \"Distance from West Bank Barrier\" variable seems the opposite of the results. The author will need to revise the interpretation at this level.In Table 3, since the author used logistic estimation, are these the marginal effects that are presented in the table?In Tables 2 and 3, the R-squares are low, which does not validate the results presented.The article is publishable with minor modifications requested to the author.Reviewer #2: Dear Authors:Please find below my comments/improvements/suggestions/corrections, along with some supporting publications of mine, regarding the Manuscript (Ms.) with the ID: \u201cPONE-D-22-25946\u201d\u2022 The authors \u2013 all from Japan: Graduate School of Life and Earth Sciences, University of Tsukuba, Tsukuba, Ibaraki; 2 Faculty of Humanities and Social Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan; 3 Faculty of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan \u2013 need to provide explanation in the Abstract and somewhere under the \u201cIntroduction\u201d, why they chose the Occupied Palestinian Territories (OPT) to conduct their study on the OPT.\u2022 I recommend that this expression \u201cthe West Bank Barrier\u201d to be replace, under the Abstract and throughout the Ms. with \u201cthe \u201cIsraeli Segregation Wall\u201d, as the used expression in the Ms. leads to misunderstanding. It is not a \u201cWest Bank\u2019s\u201d but Israeli, and it is not a barrier but monstrous wall. Please see also the references suggested to support this.\u2022 Using the data of the Agricultural Census 2010, the authors need to explain why they relied on data 2010, considering the fact that it is relatively old data (13 years old).\u2022 \u201c\u2026 the Israeli authority \u2026.\u201d To be replaced throughout the Ms. with \u201c\u2026 the Israeli occupation authorities \u2026\u201d\u2022 Under the Abstract: \u201c\u2026 such as improved crop varieties, chemical fertilizers, organic fertilizers, and pesticides\u201d \u2026. \u201cestimated using nearest-neighbor matching method, were by 7.1, 7.7, 5.4, 6.8, and 3.8 percentage points respectively the examples provided are 4 and the results are 5, so they are not equal \u201crespectively\u201d.\u2022 On Page 3, last two lines: \u201cThe fruit yield was about 53%, field crop yield was about 33% and olive yield was about 36% of Israel\u2019s crop yield.\u201d Is not clear: Is it the \u201c\u201cThe Palestinian fruit yield was about 53%, Also, please council here and cite them some of Hilmi S. Salem\u2019s publications, given below.\u2022 Page 5, Second Parag.: coefficients of 0, 1, \u2026\u2022 Page 5, Third Parag.: \u201cWe used the following binary \u2026.\u201d \u201cAs covariates, we included distances from the West Bank Barrier and Israeli settlements \u2026\u201d \u201cWe also referred to earlier studies to select independent variables in this study.\u201d It is preferred not to use we, I, ours, etc. Please use instead, throughout the Ms., the passive form, such as: the following binary \u2026. were used, and so forth.\u2022 \u201cMuch of the West Bank is arid, and Israel has restricted use of water resources, which has led to chronic shortage of irrigation water [7].\u201d This is not correct; the West Bank has the very good fertile land in Historic Palestine that includes the occupied West Bank and Israel, especially what is classified, according to Oslo, as Area C, which is totally controlled by the Israeli occupiers.\u2022 Probably under \u201c3. Analytical framework\u201d \u2013 probably in the end of this part of the study \u2013 the authors need to clarify what kind of software used and applied for the analyses and the results obtained. Is it already available and the authors just applied it, or they had developed it for the purpose(s) of the present study.\u2022 Under 4., 1st Paragr., 1st two lines, the authors say: \u201cTo empirically prove the effect of the agricultural extension, we used the Agricultural Census 2010 microdata published by the PCBS.\u201d As mentioned above, the 2010 Census data is relatively old and, therefore, the authors need to provide explanation why the used such relatively old data, instead of relatively most recent data, if available.\u2022 Under 4. \u201cGeographic data on the West Bank Barrier, Israeli settlements, land classification by the Oslo II Accord, and boundaries of Palestinian localities was obtained from the \u2026\u201d were obtained \u2026\u2022 Page 7, the first two lines: \u201chave different social and natural environments, we treated them separately and used only the data for the West Bank in this study.\u201d Having different social and natural environments should make the authors to consider them. I see the opposite, meaning because they (WE & GS) have different characteristics, they should be considered for comparison purposes both in the analyses applied and the results obtained.\u2022 Figures 1 and 2 (the maps) are of bad quality. They should be highly improved or replaced by others of much better quality.\u2022 Page 7, 2nd Parag., \u201cFig 1 shows the shortest distance from the localities to the West Bank Barrier and Israel settlements. Fig 2 shows the classification of localities according to the Oslo II Accord.\u201d OK, fine, but what it mean within the perspectives of the Manuscript. Please explain.\u2022 Page 11 under the Table, the authors state: \u201cAs mentioned, most of the extension officers of the Palestinian authority as of 2010 were male officers (Please provide here a reference or more supporting your argument). Therefore, based on their religious background, it is inferred that male farmers, rather than female, are more likely to contact extension officers (Please provide here a reference or more supporting your argument). Regarding the holders\u2019 educational background, the holders with secondary or associate diploma and bachelor\u2019s degree or above are more likely to receive agricultural extension than those with preparation or less.\u201d (Please provide here a reference or more supporting your argument). Otherwise delete these statements if cannot support them with recent published research.\u2022 Page 12, last two lines: \u201cand the location of Hebron H1\u201d, please explain this and give a reference if possible.\u2022 Page 16, first three lines, the authors state: \u201cThese varieties are also available to farmers in the West Bank. The conflicted-affected agricultural holdings must adopt those varieties with high yields and resistance to pests and diseases to maintain their livelihoods on the limited farmlands.\u201d Please support this statement with citations from Yihedogo et al. (2019). Agricultural pest management policies \u2026. Please see below. \u201cAdditionally, as one of the measures of adaptation against climate change, the use of improved drought-resistant varieties could improve agricultural incomes\u201d Please support this statement with citations from Yihedogo et al. (2019). Agricultural pest management policies \u2026. Please see below.\u2022 Page 16, 2nd Paraag. 3rd line: \u201cof fertilizers in Palestinian was 120\u2013150 NIS\u201d in the Occupied Palestinian Territories (OPT).\u2022 Page 16, 2nd Paragr. 6 and 7, the authors state: \u201cTherefore, chemical fertilizers in the Palestinian territories were priced 1.6 to 2.0 times higher than those in Israel. Since 2008,\u201d The authors need to present here the discrimination policies that the Israeli occupation authorities apply against the Palestinians \u2013 the Indigenous population of the land. They need to cite here Salem, H.S. (2019a). No sustainable development\u2026.. and Salem, H.S. (2020). Geopolitical challenges, complexities, and future uncertainties\u2026. Please see the references given below.\u2022 Page 16, under Parag. 6.4. Pesticides: The authors need to support their arguments with recently published research, locally or internationally.\u2022 Page 17, under \u201cBiological Control\u201d, please council the publication of \u201cYihdego, Y., Salem, H.S., and Muhammed, H.H. (2019). Agricultural pest management policies during drought: \u2026..\u201d and cite there.\u2022 Under the \u201cConclusion\u201d, do NOT refer to any references cited previously in the text of the manuscript, but use ONLY your conclusions.  The authors thank \u2026..\u2022 Under \u201cAcknowledgments\u201d, please consider adding the following: The Authors express their thanks to Prof. Dr. Hilmi S. Salem, Sustainable Development Research Institute, Occupied Palestine, for his valuable inputs, improvements, and suggestions, as well as his critical review of the manuscript. Also, please correct this: The author thanks \ufffd\u2022 Please council the references given below, cite them and include them under \u201cReferences\u201d given in the manuscript.\u2022 Please cite the following references and add them to the List of References in the end of the Ms. where are being best appropriate and fitting. They are authored by the Reviewer and they describe well the status of land, water, agriculture, food security, socioeconomics, geopolitics, political conflict, gender, and so forth of the study areas investigated by the Authors of the Ms. Please the most recent publication highlighted in yellow and given in the end of the List below. These publications can be easily found and downloaded using the Links provided. The most recent publication by the Reviewer is the first one highlighted in yellow.https://research.sharqforum.org/mena-water-security-task-force/https://www.researchgate.net/publication/367190828_Chapter_4_Potential_Solutions_for_the_Water_Conflict_Between_Palestinians_and_IsraelisSalem, H.S. (2023). Potential Solutions for the Water Conflict between Palestinians and Israelis. A Book Chapter (PP: 123\u2013185) In: Hussein A. Amery (Ed.): \u201cEnhancing Water Security in the Middle East\u201d. MENA Water Security Task Force, Al-Sharq Strategic Research, Al-Sharq Forum, Istanbul, Turkey; and Colorado School of Mines, Denver, CO, USA. Published on 20 March 2023. https://www.palast.ps/en/publications/proceedings-1st-international-conference-water-values-and-rightsSalem, H.S. (2009). The Red Sea\u2013Dead Sea Conveyance (RSDS) Project: A solution for some problems or a cause for many problems? In: Messerschmid, C., El-Jazairi, L., Khatib, I., Al Haj Daoud, A. (Eds.): The Conference Proceedings of Water: Values and Rights. United Nations Development Programme (UNDP), Programme of Assistance of the Palestinian People (PAPP), Palestinian Water Authority (PWA), and Palestine Academy for Science and Technology (PALAST). Ramallah, Palestine, April 13\u201315, 2009. PP: 300\u2013366, 726p. https://www.researchgate.net/publication/299563326_The_Red_Sea-Dead_Sea_Conveyance_RSDSC_Project_A_Solution_for_Some_Problems_or_A_Cause_for_Many_ProblemsSalem, H.S. (2011a). Social, environmental and security impacts of climate change on the Eastern Mediterranean. In: Brauch, H.G., Spring, \u00da.O., Mesjasz, C., Grin, J., Kameri-Mbote, P., Chourou, B., Dunay, P., Birkmann, J. (Eds.): Coping with Global Environmental Change, Disasters and Security \u2013 Threats, Challenges, Vulnerabilities and Risks. The Institute for Environment and Human Security, United Nations University (UNU-EHS). Hexagon Series on Human and Environmental Security and Peace, Berlin \u2013 Heidelberg \u2013 New York: Springer-Verlag. PP: 421\u2013445. 1815p.https://link.springer.com/chapter/10.1007/978-3-642-17776-7_23https://www.researchgate.net/publication/299562984_Social_Environmental_and_Security_Impacts_of_Climate_Change_of_the_Eastern_MediterraneanSalem, H.S. (2011b). Pollution of coastal areas on the Mediterranean Sea: The Gaza Strip as a case study \u2013 A real environmental threat and a big challenge. A paper presented at the Working Meeting of the MIRA Project Expert Group on Decontamination of the Mediterranean (WP7) \u201cMediterranean Innovation and Research Cooperation Action\u201d (MIRA). Funded by the DG Research of the European Commission MIRA and FP7, Casablanca \u2013 Morocco, November 27\u201330, 2011.https://www.researchgate.net/publication/319391700_Pollution_of_Coastal_Areas_on_the_Mediterranean_Sea_The_Gaza_Strip_As_a_Case_Study_-_A_Real_Environmental_Threat_and_a_Big_ChallengeSalem, H.S. (2019a). No sustainable development in the lack of environmental justice. Environmental Justice, 12(3-June):140\u2013157.https://doi.org/10.1089/env.2018.0040https://www.liebertpub.com/doi/10.1089/env.2018.0040https://www.researchgate.net/publication/342110072_No_Sustainable_Development_in_the_Lack_of_Environmental_Justice_Full_PaperSalem, H.S. (2019b). Agriculture status and women\u2019s role in agriculture production and rural transformation in the Occupied Palestinian Territories. Journal of Agriculture and Crops, 5(8-August):132\u2013150.https://doi.org/10.32861/jac.5(8)132.150 https://arpgweb.com/journal/journal/14https://www.researchgate.net/publication/334770801_Agriculture_Status_and_Women's_Role_in_Agriculture_Production_and_Rural_Transformation_in_the_Occupied_Palestinian_Territories_Journal_of_Agriculture_and_Crops_2019_58_132-150https://doi.org/10.29311/nmes.v10i1.3639Salem, H.S. (2020). Geopolitical challenges, complexities, and future uncertainties in the Occupied Palestinian Territories: Land and population\u2019s perspectives. New Middle Eastern Studies, 10(1):45\u201382. https://journals.le.ac.uk/ojs1/index.php/nmes/article/view/3639https://www.researchgate.net/publication/344474119_Geopolitical_Challenges_Complexities_and_Future_Uncertainties_in_the_Occupied_Palestinian_Territories_Land_and_Population's_PerspectivesSalem, H.S., Isaac, J. (2007). Water agreements between Israel and Palestine and the region\u2019s water argumentations between policies, anxieties and sustainable development. A keynote paper presented at The International Conference on Green Wars: Environment between Conflict and Cooperation in the Middle East and North Africa (MENA). Beirut, Lebanon, November 2\u20133, 2007. Sponsored by the Middle-East Office of the Heinrich Boell Foundation (HBF), Berlin, Germany.http://www.afes-press.de/html/Report_Green%20Wars_%20Conference_Beirut_Nov2007.pdfhttps://www.researchgate.net/publication/242313866_Water_Agreements_between_Israel_and_Palestine_and_the_Region's_Water_Argumentations_between_Policies_Anxieties_and_Unsustainable_Developmenthttps://doi.org/10.2166/wh.2020.216https://www.researchgate.net/publication/345063663_The_Status_of_Freshwater_and_Reused_Treated_Wastewater_for_Agricultural_Irrigation_in_the_Occupied_Palestinian_Territories_httpsdoiorg102166wh2020216Salem, H.S., Yihdego, Y., Muhammed, H.H. (2021). The status of freshwater and reused treated wastewater for agricultural irrigation in the Occupied Palestinian Territories. Journal of Water and Health, 19(1-February):120\u2013158. https://doi.org/10.1007/s40899-022-00676-3https://www.researchgate.net/publication/361972621_Water_strategies_and_water-food_Nexus_challenges_and_opportunities_towards_sustainable_development_in_various_regions_of_the_WorldSalem, H.S, Yihdego, Y., Pudza, M.Y. (2022). Water strategies and water\u2013food Nexus: Challenges and opportunities towards sustainable development in various regions of the world*. Sustainable Water Resources Management, 8:114:54p. https://ascelibrary.org/doi/abs/10.1061/%28ASCE%29NH.1527-6996.0000312 and https://www.researchgate.net/publication/342110444_Agricultural_Pest_Management_Policies_during_Drought_Case_Studies_in_Australia_and_the_State_of_Palestine_Full_PaperYihdego, Y., Salem, H.S., and Muhammed, H.H. (2019). Agricultural pest management policies during drought: Case studies in Australia and the State of Palestine. Natural Hazards Review, 2019, 20(1-February), 1\u201310. DOI:10.1061/(ASCE)NH.1527-6996.0000312. , Reston, VA, USA). Kind regards,Prof. Dr. Hilmi S. SalemSustainable Development Research InstituteBethlehem, West Bank, Palestine (Occupied)********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0AttachmentReview of PLOS Manuscript by Prof. Hilmi S. Salem.pdfSubmitted filename: Click here for additional data file. 17 Jul 2023Responses to all comments are listed in the attached document: Response to Reviewers.AttachmentResponse to Reviewers PLOS ONE Nakamura 230707.docxSubmitted filename: Click here for additional data file. 27 Sep 2023
PONE-D-22-25946R1
Effect of agricultural extension on technology adoption by Palestinian farmers under Israeli occupation in the West Bank
PLOS ONE
Dear Dr. Tomoki,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Kindly respond to all the comments and issues raised by the reviewer. If not clarify why you did not respond.The following paper can help to strengthen the background of your manuscript.https://doi.org/10.1007/s00267-021-01436-3Ali, E. (2021). Farm households\u2019 adoption of climate-smart practices in subsistence agriculture: Evidence from northern Togo.\u00a0 Environmental Management 67, 949\u2013962. Ali, E., Monkounti, Y (2020) Adoption of Biofeed technology in fighting against fruits fly in Togo. Food Systems 5, 157 - 180. DOI: 10.15122/isbn.978-2-406-11062-0.p.0157plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Nov 09 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Essossinam Ali, Ph.DAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Comments from the Editorial Staff:One or more of the reviewers has recommended that you cite specific previously published works. Members of the editorial team have determined that the works referenced are not directly related to the submitted manuscript. As such, please note that it is not necessary or expected to cite the works requested by the reviewer.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #2:\u00a0(No Response)**********\u00a0 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2:\u00a0Yes**********\u00a0 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2:\u00a0Yes**********\u00a0 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. The Reviewer #2:\u00a0Yes**********\u00a0 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2:\u00a0Yes**********\u00a0 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #2:\u00a0Please find the attached PDF file.New comments on the improved manuscript: PONE-D-22-25946R1Dated and Submitted on: 29 August 2023Dear Respected Editor-in-Chief:Dear Respected Authors:First, it is my great pleasure to review the improved version of the Manuscript (Ms) re-submitted by scholar colleagues from Japanese universities. I appreciate their efforts.Commenting on the \u201cimproved\u201d manuscript re-submitted by the authors, please find below my recent (new-old) comments and kindly feel free to send this letter, with the comments below, to the authors, considering the fact that the authors have NOT responded positively to some of my comments given in the fist review, while they responded well on some other comments that I have made.Accordingly, most of my comments below are with reference to my comments in the first review.My final decision, based on the comments below, I support publishing the Ms in your Journal \u201cPlos One\u201d, if the authors consider the comments mentioned below. However, the final decision is the Journal\u2019s Editorial team............Please see the Attached file.**********\u00a0 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Yes:\u00a0Prof. Dr. Hilmi S. SalemReviewer #2:\u00a0**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0AttachmentHilmi S. Salems Comments_29 August 2023.pdfSubmitted filename: Click here for additional data file. 28 Sep 2023Thank you for your careful review of our manuscript and recommendation of the informative papers. We have incorporated all your comments into the manuscript, so please confirm it.AttachmentResponse to Reviewers PLOS ONE Nakamura 230928.docxSubmitted filename: Click here for additional data file. 13 Oct 2023
PONE-D-22-25946R2
Effect of agricultural extension on technology adoption by Palestinian farmers under Israeli occupation in the West Bank
PLOS ONE Nakamura Tomoki ,Dear Dr. Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Please review the abstract as suggested and send it back. Please check the Journal guide and comply with the reference style in the reference list.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Nov 27 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.Please include the following items when submitting your revised manuscript:https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Essossinam Ali, Ph.DAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Editor Comments :Dear Dr. Nakamura Tomoki,Thank you for revising your manuscript. Before proceeding with the publication, following comments should be addressed.1. The abstract needs to be reviewed. There is no need for the first sentence. It can be deleted. Please give a brief description of the problem statement following the objectives, the methodology, and data used in the paper. Then talk about the results and their implication as policy recommendations.2. The following papers can be helpfulhttps://doi.org/10.1007/s00267-01436-3Ali, E. (2021). Farm households\u2019 decision of adoption of climate-smart practices in subsistence agriculture: Evidence from Northern Togo. Environmental Management, 67: 949\u2013962 https://dx.doi.org/10.15122/isbn.978-2-406-11062-0.p.0157Ali, E., Mounkounti, Y. (2020). Adoption de la technologie Biofeed dans la lutte contre la mouche des fruits au Togo. Syt\u00e8mes Alimentaires/ Food Systems, 5(1), 157-180. https://doi.org/10.1080/23322039.2020.1783910Ali., E., Awade, E.N., Abdoulaye, T. (2020). Gender and impact of climate change adaptation on soybean farmers\u2019 revenue in rural Togo, West Africa. Cogent Food & Agriculture 6(1): 1743625. [Note: HTML markup is below. Please do not edit.] Comments from PLOS Editorial Office: We note that the decision letter has recommendations to cite specific previously published works. As always, we recommend that you please review and evaluate the requested works to determine whether they are relevant and should be cited. It is not a requirement to cite these works. We appreciate your attention to this request. https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 13 Oct 2023All comments from the editor have been reflected into the manuscript. For details, please refer to the attached file: Response to Editor Comment.I checked the Journal guide and modified the reference style in the reference list.AttachmentResponse to Editor Comments PLOS ONE Nakamura 231014.docxSubmitted filename: Click here for additional data file. 25 Oct 2023Effect of agricultural extension on technology adoption by Palestinian farmers under Israeli occupation in the West BankPONE-D-22-25946R3Dear Dr. Nakamura Tomoki,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Essossinam Ali, Ph.DAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 30 Oct 2023PONE-D-22-25946R3 Effect of agricultural extension on technology adoption by Palestinian farmers under Israeli occupation in the West Bank Dear Dr. Tomoki:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Essossinam Ali Academic EditorPLOS ONE"} +{"text": "The functional association between hip joint motion and defaecation/urinary function has attracted considerable research and clinical attention owing to the potential novel approaches for pelvic floor rehabilitation; however, the anatomical basis remains unclear. This study, therefore, aimed to analyse the anatomical basis of force transmission between the obturator internus, a muscle of the hip joint, and the levator ani, a muscle of the pelvic floor. Twenty\u2010three cadavers were used for macroscopic and histological analyses. The three\u2010dimensional structures of the muscles and fascia were recorded using a high\u2010definition camera and a 3D scanner. The arrangement and attachment of the muscle fibres, tendons and fascia were visualised using histological sections stained with Masson's trichrome. The obturator internus and levator ani were in broad contact through the obturator fascia. The height of their contact area was 24.6\u2009\u00b1\u20099.1\u2009mm. Histologically, the obturator internus and levator ani shared a large area of the obturator fascia, and the obturator fascia provided the attachment of several muscle layers of the levator ani. The contribution of hip joint motion to defaecation/urinary function can be explained by the broad \u2018planar\u2019 contact between the obturator internus and levator ani. This anatomical feature suggests that movement of the obturator internus creates the foundation for the function of the levator ani and contributes to pelvic floor support through the obturator fascia. This study provides an anatomical basis for the effectiveness of the hip muscles in improving defaecation/urinary function by enabling balanced and proper movements. This study clarified a broad \u2018planar\u2019 contact between the obturator internus, a muscle of the hip joint, and the levator ani, a muscle of the pelvic floor. This anatomical feature suggests that movement of the obturator internus creates the foundation for the function of the levator ani and contributes to pelvic floor support. This finding provides an anatomical basis for the effectiveness of the hip muscles in improving defaecation/urinary function through enabling balanced and proper movements. Among the muscles of the lower limb, one of the least recognised anatomical structures, also known as the \u2018secret\u2019 muscle, is the obturator internus. The obturator internus is one of the six deep lateral rotator muscles of the hip and is responsible for the external rotation and abduction of the hip joint Neumann,\u00a0. Most muSeveral recent reports have shown a functional relationship between the obturator internus and pelvic floor muscles, and the relationship between hip joint motion and defaecation/urinary functions has been discussed. For example, Tuttle et al.\u00a0 comparedThe obturator internus, which is one of the rotator muscles of the hip joint, is composed of the pelvic wall and is in contact with the levator ani, the largest of the pelvic floor muscles Neumann,\u00a0. Convent22.1Twenty\u2010three cadavers were donated to our department. The donation document format was congruent with the Japanese law entitled \u2018The Act on Body Donation for Medical and Dental Education\u2019 (Act No. 56 of 1983). Before their death, all donors voluntarily declared that their remains would be donated as materials for education and study. At that time, the purpose and methods of using body donor corpses were explained, and informed consent was obtained. After their death, we explained the informed consent to the bereaved families and confirmed that there was no opposition. All cadavers were fixed via arterial perfusion with 8% formalin and preserved in 30% alcohol. The study was approved by the Board of Ethics at Tokyo Medical and Dental University . All methods were performed following the relevant guidelines and regulations.2.2Nineteen cadavers were used for macroscopic examinations. From the 12 cadavers, 14 pelvic halves were obtained to dissect the obturator internus and levator ani. These two muscles and the surrounding connective tissues were observed from the medial and posterior aspects, focusing on their placement, the relationship between the two and the associated fascial structures. One of the dissected pelvic halves was captured using a 3D scanner and observed on a three\u2010dimensional image. Whole pelvises were sectioned in the oblique coronal plane parallel to the anal canal using the remaining seven cadavers. Since the levator ani pulls the anal canal anterosuperiorly, sectioning in such a plane parallel to the anal canal provides a cross\u2010section parallel to the muscle bundles at the origin of the levator ani. Sections of the obturator internus and levator ani were examined. We measured (1) the height of the contact area between the obturator internus and levator ani, (2) the maximum thickness of the obturator internus, (3) levator ani, (4) the width of the ischioanal fossa and (5) the depth of the ischioanal fossa using ImageJ and dehydrated. The blocks were embedded in paraffin and sectioned into 5\u2010\u03bcm\u2010thick specimens. The histological sections were then stained with Masson's trichrome. Finally, the stained specimens were scanned as entire slides using a high\u2010quality scanner . Additionally, local high\u2010magnification digital pictures were acquired using a digital slide scanner .Four cadavers were used for histological examination. To histologically observe the contact area between the obturator internus and levator ani, tissue blocks were collected in cross\u2010sections parallel to the muscle fibres of the levator ani using a diamond band pathology saw . These tissue blocks were fixed in 10% formalin, decalcified with Plank\u2013Rychlo solution and ligaments .The authors declare no financial disclosure and conflict of interest.The Board of Ethics at Tokyo Medical and Dental University approved the study . All methods were performed following the relevant guidelines and regulations.Appendix S1.Click here for additional data file."} +{"text": "Despite some research indicating what factors influence early exclusive breastfeeding interruption in Ethiopia's stable population, there is little evidence indicating what factors influence exclusive breastfeeding interruption in vulnerable populations such as refugee camps. Therefore, this study aimed to determine the factors that contributed to the early termination of exclusive breastfeeding in Ethiopian refugee camps in the Dollo Ado district.th to 25th, 2017. The eligible 112 cases and 224 controls were identified using the 24-hour recall method. The information was gathered using an interviewer-administered questionnaire that was pretested and organized. Logistic regression analysis was computed to assess the effect of independent variables.a case-control study was conducted at the Dollo Ado refugee camps from April 05the determinants for early interruption of exclusive breastfeeding were not counseled about infant feeding during antenatal care follow-up , not counseled about infant feeding during postnatal care service use , breastfeeding problem and late initiation of breastfeeding .in this study, early termination of exclusive breastfeeding was caused by breastfeeding problems and late commencement of breastfeeding, as well as not receiving infant feeding advice during antenatal care or postnatal care. The results of this study highlight the significance of concentrating on newborn and young child feeding counseling during prenatal and postnatal care services in order to promote exclusive breastfeeding. In addition, health providers should educate parents on the significance of starting exclusive breastfeeding on time and obtaining help right away if there is a problem, such as breast soreness or the infant refusing to eat due to oral trash, to avoid early exclusive breastfeeding interruption. For infants less than six months, exclusive breastfeeding (EBF) is one of the elements of ideal infant and young child feeding (IYCF), which is defined as supplying only human breast milk, including expressed human milk . The WorStudy design, setting and period: a case-control study was conducted at Dollo Ado refugee camps, Dollo Ado district from April 05th to 25th, 2017. Dollo Ado refugee camps are found in Dollo Ado district, Liben Zone, Ethiopia Somali Region at 935km southeast of Addis Ababa, the capital city of Ethiopia. Dollo Ado district refugee camps are the home of 251,987 Somali refugees population. The Ethiopian Government protects refugees in collaboration with national, international NGOs, and United Nations (UN) agencies.Sample size determination: the sample size was calculated using Open Epi version 3 statistical software for unmatched case-control studies considering the following assumption: two-sided 95% confidence level (Z\u03b1/2=1.96), power of 80%, the ratio of control to cases 2:1 (r = 2), odds to be detected 1.99 and 42% [ and 42% of the cSampling technique: for each sub-camp of the Dollo ado refugee camps, the total sample size was distributed proportionally. During the study period, screening questions using a 24-hour recall were given to all mothers who have infants younger than six months old at refugee camps in the Dollo Ado district and who come for ration collection. A 24-hour recall method, which is advised by the World Health Organization to identify cases and controls, was used to inquire about an infant's nursing status on the day when rations were distributed. Mothers who have an infant less than six months and responded \u201cyes\u201d for the screening question, which was \u201chave you given anything to eat or drink to your infant in the previous 24 hours or the previous day and night?\u201d considered as cases and who answered \u201cno\u201d considered as controls. In the Dollo Ado refugee camps, mothers of index infants who were less than six months old at the time of ration registration were identified and coded as part of the sampling procedure. For every one eligible case and two consecutive mothers in the controls were interviewed in the aforementioned refugee camps. The study included all sampled moms who had a child younger than six months at each of the five locations of the Dollo Ado district refugee camp during the study period. Mothers who were really unwell and unable to react were not included in the study.Exclusive breastfeeding: was defined as giving only human breast milk including expressed human milk to infants less than six months in the previous 24 hours, otherwise not.Cases: were those who have interrupted breastfeeding.Controls: were defined as those refugees exclusive breastfeeding at the time of the interview.Knowledge of a mother on exclusive breastfeeding: was defined as the mother\u00b4s information on the advantages and recommended duration of exclusive breastfeeding. Those who scored mean value and above considered as good knowledge, otherwise poor.Timely initiation of breastfeeding: infants who put to the breast within one hour of birth. Prelacteal feeding is when infants receive nutrition other than breast milk for the first three days of life before being breastfed.Data collection procedure: mothers who had been identified as cases and controls were face-to-face questioned using a standardized, tested questionnaire that was adopted from Ethiopian Demographic and Health survey (EDHS) 2016 [HS) 2016 . The queStatistical analysis: the data were analyzed using statistical package for the social sciences (SPSS) version 20. Descriptive statistics were undertaken. The results of the study were expressed in terms of frequencies, percentages and presented using tables. To determine the factors connected to the outcome variable, binary logistic regression analysis was used. To minimize the impact of confounding, independent variables with a p-value 0.2 in the bivariate analysis were fitted into the multivariable analysis. P-values under 0.05 were used to define the level of statistical significance. The Hosmer-Lemeshow goodness-of-fit test revealed that the model adequately fit the data (P = 0.7), indicating that the model was good enough.Ethics approval and consent to participate: the Institutional Review Board at Arba Minch University granted its ethical approval. With the reference number AMUIRB/88/2017, ethical approval was issued on January 25, 2017. The participants in the study were told of its objectives, their right to decline participation, the study's anonymity and confidentiality policies, and the fact that it was carried out in conformity with the Helsinki Declaration. The participants in the study provided their written informed permission.Sociodemographic characteristics: of the 112 cases and 224 controls recruited, 103 cases and 208 controls were interviewed yielding the response rate of 92% and 93% respectively. All study participants were Muslim by religion and speak the Somali language. The mean (\u00b1 SD) age of mothers was 25 (\u00b1 5) years. Rahan-wayn is the largest ethnic group, followed by Merihan and Hawiye. The majority of the mothers were married, uneducated, and all most all the mothers work inside the home ), not counseled about infant feeding during PNC service use , breastfeeding problem and late initiation of breastfeeding were the determinants of early interruption of EBF (n of EBF .et al. [Social services for refugees are not well established . The inaet al. revealedet al. .Strengths and limitations: this study's use of a 24-recall method, which lessens mothers' recall bias, and its attempt to identify the determining elements of EBF interruption on the most susceptible population at most peripheries are both strengths. Its weakness, though, was that it didn't deal with the problem's qualitative component. Due to a lack of literature in the refugee population, the study results were also contrasted with those from a stable population.Funding: this study did not received monetary fund, but the researchers have received transport and stationary support from Ethiopian National Intelligence and Security Service- Administration of Refugee and Returnee Affair and NOGs working in Dollo Ado refugee camps.In this study, early termination of exclusive breastfeeding was caused by breastfeeding problems and late commencement of breastfeeding, as well as not receiving infant feeding advice during antenatal care or postnatal care. The results of this study highlight the significance of concentrating on newborn and young child feeding counseling during prenatal and postnatal care services in order to promote exclusive breastfeeding. In addition, health providers should educate parents on the significance of starting exclusive breastfeeding on time and obtaining help right away if there is a problem, such as breast soreness or the infant refusing to eat due to oral trash, to avoid early exclusive breastfeeding interruption.In Africa, 68% of infants are interrupted from receiving only breast milk, compared to nearly 50% in Ethiopia;In sub-Saharan Africa alone 1.16 million infants die in their first month of life, but we could have saved 800,000 infant deaths by practicing exclusive breastfeeding;Infant and young child feeding best practices are less likely to be followed in an emergency than they would be under regular conditions.The proportion of infants with prelacteal feeding was 96% among cases and 87% among controls;The determinants for early interruption of exclusive breastfeeding were not counseled about infant feeding during antenatal care follow-up, not counseled about infant feeding during postnatal care service use, breastfeeding problem and late initiation of breastfeeding."} +{"text": "Ndufa4 overexpression promoted the proliferation of neurons and inhibited their apoptosis in vitro, which underwent reverse regulation by the Ndufa4 short hairpin RNAs. Ndufa4-knockout (KO) mice showed abnormal histological alterations in the brain tissue, in addition to impaired spatial learning capacity and exploratory activity. Ndufa4 depletion altered the microRNA expressional profiles of the cerebellum: Ndufa4 inhibited miR-145a-5p expression both in the cerebellum and neurons. miR-145a-5p inhibited the proliferation of neurons and promoted their apoptosis. Ndufa4 promoted and miR-145a-5p inhibited the expression of human homer protein homolog 1 and cyclin D2 in neurons. Thus, Ndufa4 promotes the proliferation of neurons and inhibits their apoptosis by inhibiting miR-145a-5p, which directly targets and inhibits the untranslated regions of Homer1 and Ccnd2 expression.The Dandy\u2013Walker malformation (DWM) is characterized by neuron dysregulation in embryonic development; however, the regulatory mechanisms associated with it are unclear. This study aimed to investigate the role of NADH dehydrogenase 1 alpha subcomplex 4 (NDUFA4) in regulating downstream signaling cascades and neuronal proliferation and apoptosis. The online version contains supplementary material available at 10.1007/s12035-023-03239-5. The Dandy\u2013Walker malformation (DWM), or Dandy\u2013Walker syndrome, is a severe congenital posterior fossa anomaly characterized by vermis agenesis and hypoplasia, cystic enlargement of the fourth ventricle, meningeal anomalies, occipital skull defects, and hydrocephalus \u20133. The iNDUFA4 expression and mutations are involved in the development of various cellular processes and human disorders such as gastric cancer, clear-cell renal cell carcinoma, colorectal cancer, and diabetes mellitus [NDUFA4 promotes the proliferation of gastric cancer cells and inhibits their apoptosis, which mediates long noncoding RNA macrophage migration inhibitory factor antisense RNA1-regulated pathogenesis of gastric cancer [NDUFA4 expression promotes the proliferation, migration, invasion, and apoptosis of colorectal cancer cells [NDUFA4 is a critical regulator of cell proliferation and apoptosis associated with the pathogenesis of many human disorders.NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4 (NDUFA4) is a subunit of complex I in the mitochondrial respiratory chain, which is involved in the assembly and functioning of cytochrome c oxidase during mitochondrial electron transport chain and aerobic metabolism \u201310. NDUFmellitus \u201314. For c cancer . In addier cells . NDUFA4 er cells . TherefoNDUFA4 mutation is closely associated with the development of Alzheimer\u2019s disease (AD) [NDUFA4 was critically associated with DWM [NDUFA4 haploinsufficiency and copy number variations (CNVs) [NDUFA4 also has a crucial role in neuronal functions and the development of neurological diseases. Genetic association analysis of\u2009>\u20091500 clinical samples showed that ase (AD) . Quantitase (AD) . In addiase (AD) . In our with DWM . Additios (CNVs) . NDUFA4 s (CNVs) . Moreoves (CNVs) . All theNdufa4-regulated microRNAs. This study investigated the potential functions of Ndufa4-regulated microRNAs in neuronal proliferation and apoptosis, in addition to downstream target genes and signaling cascades, using a cellular neuronal differentiation model, which was established by treating pluripotent mouse embryonal carcinoma cells (P19 cell line) with all\u2010trans\u2010retinoid acid (RA). Our data would reveal novel clues regarding neuron growth and apoptosis in embryonic development.Epigenetic regulations mediated by microRNAs have an essential role in various cellular biological processes and pathogenic conditions , 23. How2 atmosphere at 37\u00a0\u00b0C. Cell authentication was done using a short tandem repeat DNA profiling assay. Neural differentiation of cultured P19 cells was induced, as previously described [We purchased P19 cells from the American Type Culture Collection. Cells were cultivated with Minimal Essential Medium\u2014alpha modification containing 2\u00a0mM L-glutamine, 10% fetal bovine serum (Gibco), 100 units/mL of penicillin, and 100\u00a0\u03bcg/\u03bcL of streptomycin in a humidified 5% COescribed . BrieflyNdufa4 (shRNA: 5\u2032-GGAACAAACTGGGTCCCAATG-3\u2032) was obtained from GenePharma and integrated into the pSicoR-Ef1a-mCh-Puro vector . LV003 vectors for Ndufa4 overexpression were obtained from General Biology . The 3\u2032 untranslated regions (3\u2032UTRs) of Ndufa4, human homer protein homolog 1 (Homer1), and cyclin D2 (Ccnd2) were also obtained from General Biology and ligated with the pmirGLO vector. The miR-145a-5p inhibitor (5\u2032-GUCCAGUUUUCCCAGGAAUCCCU-3\u2032), its negative control (5\u2032-UCCAUCAAUCCCGUUCGUGCAGU-3\u2032), miR-145a-5p mimic (5\u2032-GUCCAGUUUUCCCAGGAAUCCCU/GGAUUCCUGGGAAAACUGGACUU-3\u2032), and its negative control (5\u2032-UGAUCUAGUGCCCGAACCCUCUU/AAGAGGGUUCGGGCACUAGAUCA-3\u2032) were obtained from GenePharma. Small interfering RNAs (siRNA) targeting Ndufa4l2 (sense 5\u2032-CCCGCUUCUACCGGCAGAUTT-3\u2032 and antisense 5\u2032-GGAACCGCAUGAGUCCCAATT-3\u2032) and its negative control (sense 5\u2032-UUCUCCGAACGUGUCACGUTT-3\u2032 and antisense ACGUGACACGUUCGGAGAATT) was obtained from GenePharma. All recombinant vectors and sequences were introduced into cultured P19-derived neurons with Lipofectamine 2000 Reagent (Thermo Fisher Scientific) according to the manufacturer\u2019s instructions.Short hairpin RNA (shRNA) targeting g for 5\u00a0min, washed twice with phosphate-buffered saline (PBS), and then seeded on 96-well plates. They were incubated with the MTS reagent (25 \u00b5L/well) for another 1.5\u00a0h at 37\u00a0\u00b0C, after which their optical density was measured at 490\u00a0nm (OD490) using a multiplex plate reader. The OD490 values from at least three biological replicates were measured for comparing the P19-derived neuronal proliferation rates.After treatment, the proliferation of P19-derived neurons was evaluated by 3--5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay using the Cell Proliferation Colorimetric Assay Kit according to the manufacturer\u2019s instructions. Briefly, P19-derived neurons were collected by centrifugation at 500\u2009\u00d7\u20095 P19-derived neurons were harvested by centrifugation, washed with PBS, resuspended in 100 \u00b5L of binding buffer, and incubated with gentle vortexing in 5 \u03bcL of Annexin V-APC and 5 \u03bcL of 7-AAD solution for 30\u00a0min at room temperature in the dark. Finally, the P19-derived neurons were washed again with PBS and the percentage of apoptotic P19-derived neurons was computed by flow cytometry.The P19-derived neurons were processed using the Annexin V-APC/7-aminoactinomycin D (7-AAD) Apoptosis Kit according to the manufacturer\u2019s instructions. Briefly,\u2009~\u20091\u2009\u00d7\u200910The whole body knockout of Ndufa4 had its limitations, but conditional knockout mice were difficult to obtain due to its long construction cycle, so our experiment was still conducted with the whole body knockout mice.Ndufa4-KO mouse model established by the Cre/LoxP system, as previously described, was purchased from Cyagen Biosciences . The methods of generating Ndufa4-KO mice are shown as follows or in Supplemental Figure The Ndufa4 gene (NM_010886.3) contains four exons. Exon 3 and 4 were selected as the constitutive KO region. Homologous arms containing upstream and downstream sequences of exon 3 and 4 were amplified by polymerase chain reaction (PCR) using the template DNA extracted from a BAC clone (4E12) to engineer the targeting vector. Then, the homologous arms were sequentially assembled to the 5' and 3' of a loxP-flanking PGK-neo cassette for positive selection. A diphtheria toxin A cassette for negative selection was located upstream of the 5' homologous arm. The targeting vector linearized with NotI was electroporated into C57BL/6 ES cells, followed by G418 antibiotic selection, PCR, and Southern blot validation. After correctly confirming targeted ES clones via Southern blotting, two clones were selected for blastocyst microinjection to produce the F0 generation. The F0 was bred with EIIa-cre mice from the Jackson Laboratory to delete the PGK-neo cassette. Homozygous F2 was acquired by mating the F1 heterozygotes. The mice were validated using PCR with the primers listed below.Ndufa4_F1 (5\u2032-3\u2032): TCATCTCAATCTCGCCTCCCCA.Ndufa4_R1 (5\u2032-3\u2032): GAGAGAAGCTGGAAGCAGTCG.Ndufa4_R2 (WT) (5\u2032-3\u2032): CACAGAACACCACTCTTTGGGAT.The mouse All mice were kept in a specific pathogen-free-grade atmosphere in a 12/12\u00a0h\u00a0day/night cycle at 20\u00a0\u00b0C\u201326\u00a0\u00b0C. They were fed a standard diet after sterilization, with free access to drinking water. Finally, the mice were euthanized using intraperitoneal 4% chloral hydrate, and mouse brain tissue was collected surgically.All experimental procedures using mice were approved by the Experimental Animal Care and Ethics Committee of the Forevergen Medical Laboratory Animal Center, Guangzhou, China .Ndufa4 KO on mouse behaviors, as previously described [Ndufa4-KO mice. Briefly, the mice were placed at one of four starting spots in a pool and their latency time (s), path length (mm), times on the platform, and time in target quadrants (s) were recorded using the EthoVision system version 2.3 . Next, after dark-adapting the mice for 25\u00a0min for the open-field test, they were placed in a 50\u2009\u00d7\u200950\u00a0cm open-field arena. To evaluate their exploratory activities, the total distance traveled (mm), number of crossings, center distance (mm), and center time (s) was recorded using the EthoVision system.The Morris water maze and open-field tests were used to assess the effects of escribed , 26. TheThe histological alterations in the brain tissue were analyzed using H&E staining with a commercialized H&E staining kit according to the manufacturer\u2019s instructions. Briefly, the brain sections were deparaffinized, hydrated in distilled water (DW), and incubated in Mayer\u2019s hematoxylin for 6\u00a0min at room temperature. Next, they were rinsed twice with DW, incubated in bluing reagent for 15\u00a0s at room temperature, and incubated again in Eosin Y solution for 3\u00a0min. Finally, these sections were rinsed and dehydrated with absolute alcohol and then cleared and mounted with synthetic resin.The apoptosis in brain tissue was analyzed using TUNEL staining with a commercialized TUNEL staining kit following the manufacturer\u2019s instructions. Briefly, the sections of brain tissue were deparaffinized and hydrated, then incubated with protease K (20\u00a0\u00b5g/ml) for 20\u00a0min. Next, these sections were rinsed thrice with PBS and incubated in the TUNEL solution for 60\u00a0min, avoiding light at 37\u00a0\u00b0C. Finally, the sections were rinsed thrice with PBS, followed by mounting with an antifade mounting medium . The signals were captured using a fluorescence microscope.The subcellular structures of brain tissue were observed using TEM. Briefly, the fresh brain tissue was fixed in TEM fixative solution for 2\u00a0h at 4\u00a0\u00b0C, washed thrice with 0.1\u00a0M PBS for 15\u00a0min, and dehydrated for 15\u00a0min using a graded series of ethanol solution (50\u2013100%), followed by 100% acetone for 15\u00a0min. Subsequently, the brain tissue was embedded in Spurr\u2019s EPON 812 Resin by heating it at 60\u00a0\u00b0C for 48\u00a0h and then sliced into 60-nm-thick sections. Finally, these sections were stained with 2% alcohol-saturated uranium acetate solution for 15\u00a0min, incubated in lead citrate for 15\u00a0min, dried, and observed using TEM.Ndufa4 KO using next-generation deep sequencing. Briefly, the total RNA samples from the brain tissue were isolated using the MagMAXmirVana Total RNA Isolation Kit according to the manufacturer\u2019s instructions. Next, the samples were analyzed using a NanoDrop 2000 spectrophotometer (Thermo Fishier Scientific) to evaluate the RNA quality and concentration, separated using polyacrylamide gel electrophoresis (PAGE), and the isolated RNA bands were arranged in 18\u201330 nt using the Small RNA PAGE extraction kit according to the manufacturer\u2019s instructions. Subsequently, ligation was performed with 3\u2032- and 5\u2032-adaptors and reverse transcription (RT)\u2013PCR to construct a sequencing complementary DNA (cDNA) library. The quality of the cDNA library was assessed using the Agilent 2100 Bioanalyzer , which was then denatured to single-stranded DNA (ssDNA) and sequenced using the Illumina NextSeq 500 platform for 52 cycles. Next, the reads that were obtained were filtered using SolexaSolexa CHASTITY to select clean reads, which were used for subsequent adaptor trimming and alignment with the miRbase database. Tag counts were applied to evaluate the expressional levels of microRNA or mRNA. Significantly different microRNA and mRNA expression was defined as a fold-change (FC) of\u2009>\u20091.5 and P\u2009<\u20090.05. The microRNA target genes and their interaction networks were predicted using Targetscan software release 3.1 (www.targetscan.org/mamm_31/) [Differentially expressed microRNAs and messenger RNA (mRNA) profiles were detected in mouse brain tissues caused by The relative mRNA or microRNA levels were determined using real-time qPCR. Briefly, total RNA samples were extracted from cultured P19-derived neurons or brain tissue using TRIzol reagent according to the manufacturer\u2019s instructions. NanoDrop 2000 (Thermo Fishier Scientific) was used to measure RNA concentrations. Next, cDNA samples were prepared using 2\u00a0\u00b5g of RNA from each group by RT using M-MLV Reverse Transcriptase according to the manufacturer\u2019s instructions. Real time-qPCR assay was performed using 2\u2009\u00d7\u2009SYBR Green PCR Mastermix according to the manufacturer\u2019s instructions. At least three biological replicates were performed for relative expression quantitation, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or ribosomal protein L7 (RPL7) as the internal standard for mRNA and U6 as the internal standard for microRNA. The sequences of primers were as follows: Ndufa4-F: GTATGTGATGCGCTTGGCAC; Ndufa4-R: TGTTCCATGGCTCTGGGTTG; GAPDH-F: AGGTCGGTGTGAACGGATTTG; GAPDH-R: TGTAGACCATGTAGTTGAGGTCA; RPL7-F: TTGATTGCTCGGTCTCTTGGTAA; RPL7-R: CTGGTCTTCCCTGTTGCCAG; mmu-miR-205-5p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGACT; mmu-miR-205-5p-F: TCCTTCATTCCACCGG; mmu-miR-145a-5p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAT; mmu-miR-145a-5p-F: GTCCAGTTTTCCCAGGA; mmu-miR-212-5p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGTAAG; mmu-miR-212-5p-F: ACCTTGGCTCTAGACTG; mmu-miR-139-5p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGGAG; mmu-miR-139-5p-F: TCTACAGTGCACGTGT; mmu-miR-196-5p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCAAC; mmu-miR-196-5p-F: TAGGTAGTTTCATGTT; Universe-R: GTGCAGGGTCCGAGGT; U6-F: CTCGCTTCGGCAGCACA; U6-R: AACGCTTCACGAATTTGCGT; Homer2-F: CACGTACCTTCCCCTTGGTG; Homer2-R: AGGGTTCGGAGAAACAGAGG; Smad3-F: GTGCGGAAACCCAAACTTTCT; Smad3-R: TAACTCTGGAGAACTTGCCCG; Homer1-F: AAGTCGCAGGAGAAGATGGAGC; Homer1-R: GGTGTTCTCTCATCGTCTGTCC; Ccnd2-F: GCAGAAGGACATCCAACCGTAC; Ccnd2-R: ACTCCAGCCAAGAAACGGTCCA; Col4a1-F: ATGGCTTGCCTGGAGAGATAGG; Col4a1-R:TGGTTGCCCTTTGAGTCCTGGA.Droplet digital PCR was performed according to a previous study . The proTotal protein samples were prepared from cultured P19-derived neurons or brain tissue using a radio immunoprecipitation assay buffer according to the manufacturer\u2019s instructions. Bicinchoninic acid assay was used to measure the protein concentration. Approximately 30\u00a0\u03bcg of total protein was boiled in loading buffer for 5\u00a0min at 100\u00a0\u00b0C, separated using 10\u201312% sodium dodecyl sulfate (SDS)\u2013PAGE, and transferred onto polyvinylidene difluoride\u00a0(PVDF) membranes . Subsequently, the PVDF membranes were incubated in 5% bovine serum albumin for 2\u20133\u00a0h at room temperature, incubated overnight in diluted primary antibodies at 4\u00a0\u00b0C, washed with Tris-buffered saline with 0.1% Tween\u00ae 20 detergent, and incubated again in horseradish peroxidase-conjugated secondary antibodies for 1\u20132\u00a0h at room temperature. Next, protein bands were developed using enhanced electrochemiluminescence substrates , and protein band intensities were scanned to compare protein abundance.The primary antibodies used were anti-Ndufa4 , anti-B cell lymphoma (Bcl2)-associated X protein , anti-Bcl-2 , anti-B cell lymphoma-extra-large , anti-caspase3 , anti-caspase-9 , anti-Homer1 , anti-Ccnd2 , and anti-Gapdh .Ndufa4, Homer1, and Ccnd2 3\u2032 UTRs in P19-derived neurons were separately validated using dual luciferase reporter assay with the Dual Luciferase Reporter Assay kit . Briefly, the Ndufa4, Homer1, and Ccnd2 3\u2032 UTRs were ligated with the pmirGLO vector. Next, the recombinant vectors were transfected into cultured P19-derived neurons, together with mmu-miR-145a-5p mimics or their negative control sequences, as designated using Lipofectamine 2000 Reagent (Thermo Fisher Scientific) according to the manufacturer\u2019s instructions. Finally, the P19-derived neurons were lysed using passive lysis buffer and their luciferase activity was measured using a GloMax-20/20 luminometer (Promega Corporation).The direct binding of mmu-miR-145a-5p with the t-tests were performed to define significant differences between two or more groups, and P\u2009<\u20090.05 was considered statistically significant.Quantitative data from at least biological replicates were analyzed using SPSS Statistics version 20.0 and presented as means\u2009\u00b1\u2009standard deviation (SD). Student\u2019s Ndufa4 in neurons in vivo, Ndufa4-KO mice were established using the Cre/LoxP system. Real time-qPCR showed that the Ndufa4 mRNA levels in the cortex, hippocampus, cerebellum, and whole brain were significantly lower in the Ndufa4-KO mice compared with wild-type (WT) mice . Real-time qPCR showed that shNdufa4 was considerably inhibited, but LV0003-Ndufa4 vectors increased Ndufa4 mRNA expression in P19-derived neurons , collagen 4a1 (Col4a1), and Ccnd2, in Ndufa4-KO mice compared with WT mice Fig.\u00a0. Subsequons Fig.\u00a0. In addiice Fig.\u00a0. Rela tions Fig.\u00a0. These rNdufa4, the Ndufa4 3\u2032 UTR in P19-derived neurons were overexpressed. Results showed that Ndufa4 3\u2032 UTR overexpression could considerably decrease miR-145a-5p levels and increase Homer1 and Ccnd2 mRNA levels in P19-derived neurons compared with neurons transfected with empty vectors , fibroblast growth factor 17 (FGF17), and Ndufa4 [Ndufa4 in neurons induced from P19 cells using RA treatment, which showed substantial proliferation-promoting and apoptosis-inhibiting functions of NDUFA4 in neurons. Using Ndufa4-KO mice, the contribution of NDUFA4 to maintaining structural homeostasis in the brain, spatial learning capacity, and exploratory activity was elucidated. Direct evidence of alterations in NDUFA4 expression alterations that cause considerable behavioral abnormalities in the mouse model was found. These cellular and animal results convincingly established Ndufa4 as a critical regulator of neuronal development, and behavior.The pathogenesis of DWM is closely associated with mutation and expressional alterations in various functional genes, such as forkhead transcription factor expression . In thisogenesis , 38. In ogenesis , 40. In 2 consumption rate and ATP generation in neurons may provide more powerful evidence for miR-145 mediated effects, which will be further explored in our future research.However, our research has limitations. First, the whole body knockout of Ndufa4 cannot completely avoid its influence on the behavioral phenotype of mice as a component of the respiratory chain. Regional specific deletion may be more appropriate, but at present, we are unable to obtain these mice. Second, the detection of OHomer1 and Ccnd2 expression. The inhibitory effects of Ndufa4 on miR-145a-5p functioning could be mediated by the direct association of the Ndufa4 3\u2032 UTR with miR-145a-5p. These findings reveal novel clues regarding the neuron growth and apoptosis in embryonic development and other neurological disorders.In summary, the mitochondrial respiratory chain component protein NDUFA4 was found to promote the proliferation of neurons and inhibit their apoptosis by inhibiting miR-145a-5p to enhance Supplemental Figure S1Ndufa4-KO mice. (PNG 1169 kb)The flow chart of generation of High resolution image (TIF 8219 kb)Supplemental Figure S2P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. RPL7, ribosomal Protein L7. (PNG 476 kb)Real time-quantitative polymerase chain reaction results of Figure 1A, 3A, 5A, 6E, 7A, and 7C using RPL7 as reference. (A) Real time-quantitative polymerase chain reaction results of Figure 1A using RPL7 as reference. (B) Real time-quantitative polymerase chain reaction results of Figure 3A using RPL7 as reference. (C) Real time-quantitative polymerase chain reaction results of Figure 5A using RPL7 as reference. (D) Real time-quantitative polymerase chain reaction results of Figure 6E using RPL7 as reference. (E) Real time-quantitative polymerase chain reaction results of Figure 7A using RPL7 as reference. (F) Real time-quantitative polymerase chain reaction results of Figure 7C using RPL7 as reference. *High resolution image (TIF 3083 kb)Supplemental Figure S3Alterations of NE-4C neural stem cells proliferation after Ndufa4 KO and overexpression. Neuronal proliferation was assessed using MTS assay. (PNG 35 kb)High resolution image (TIF 7867 kb)Supplemental Figure S4P < 0.01, ***P < 0.001 and ****P < 0.0001. (PNG 314 kb)Droplet digital polymerase chain reaction was used to evaluate the microRNA expression in Figures 4B\uff0c4C, 5A, and 7C. (A) Droplet digital polymerase chain reaction was used to evaluate the microRNA expression in Figure 4B. (B) Droplet digital polymerase chain reaction was used to evaluate the microRNA expression in Figure 4C. (C) Droplet digital polymerase chain reaction was used to evaluate the microRNA expression in Figure 5A. (D) Droplet digital polymerase chain reaction was used to evaluate the microRNA expression in Figure 7C. **High resolution image (TIF 2554 kb)Below is the link to the electronic supplementary material."} +{"text": "Caenorhabditis elegans foraging by covering systematically combinations of food density (across 4 orders of magnitude) and food type . We found that worms\u2019 response is dominated by a single environmental variable: food density measured as number of bacteria per unit surface. They disregard other factors such as biomass content or bacterial strain. We also measured experimentally the impact on fitness of each type of food, determining that the rule is near-optimal and therefore constitutes a rule of thumb that leverages the most informative environmental variable. These results set the stage for further investigations into the underlying genetic and neural mechanisms governing this simplification process, and into its role in the evolution of decision-making strategies.Rules of thumb are behavioral algorithms that approximate optimal behavior while lowering cognitive and sensory costs. One way to reduce these costs is by simplifying the representation of the environment: While the theoretically optimal behavior may depend on many environmental variables, a rule of thumb may use a smaller set of variables that performs reasonably well. Experimental proof of this simplification requires an exhaustive mapping of all relevant combinations of several environmental parameters, which we performed for C. elegans, follows low-dimensional behavioural rules in a set of complex foraging environments, and suggests that this model may be suitable to examine the neural basis of behavioural rules of thumb in the future.The model worm, For example, patch-leaving in parasitoid wasps seems to be adaptive regarding multiple indicators of patch and environment quality7, but this decision may be driven by a simple mechanism: One internal variable that decreases linearly with time and increases sharply whenever the wasp finds a host. The wasp leaves a patch when this variable reaches a threshold8. While being easy to implement, this rule yields near-optimal responses8. Identifying these rules of thumb is key to link the neural and mechanistic implementation of animal behavior to the selective pressures that shape it9.Sophisticated and highly optimal outcomes of animal behavior often emerge from simple rules, called rules of thumb10, demonstrating a simplified internal representation requires showing that any combination of environmental variables that leads to the same internal representation produces the same response. This is challenging, first because behavioral experiments tend to have a large variability which may hide small effects, and second because a convincing proof must test systematically a large number of equivalent combinations. Reaching at the same time a high number of combinations and a sufficient number of replicates to obtain highly accurate average behavior is beyond the experimental throughput in most behavioral experiments.Most rules of thumb rely on a simplified internal representation of the environment. For example, optimal food choice may require considering simultaneously many variables such as the spatial distribution of the food sources, their density, their composition in terms of numerous nutrients, etc. Processing all these variables separately is costly, so a rule of thumb may disregard the less informative variables and combine the rest into one or a few quantities, which constitute the internal representation of the environment and will determine the decision. While numerous studies identify variables that dominate behaviorCaenorhabditis elegans. We focused on foraging (i.e. search and exploitation of food) because it has a clear impact on fitness, the degree of success is relatively easy to measure (in terms of rate of food consumption), and it is thoroughly studied from a theoretical point of view11. Thanks to C. elegans\u2019 high offspring number and small size, we could perform experiments with more than 20 000 age-synchronized individuals in more than 2 000 experimental arenas. Besides allowing for high experimental throughput, C. elegans\u2019 small nervous system (\u2009~\u2009300 neurons), makes it an ideal candidate to implement simple rules of thumb, while its foraging behavior is complex enough to implement the basic elements of optimal foraging, which can be observed for example in its exploration19, learning23, and feeding35 behaviors.To address these challenges, we developed a high-throughput pipeline to study the foraging behavior of the nematode C. elegans\u2019 response to food, covering all relevant combinations of food density and food composition . Different bacterial strains differ in their composition in terms of many different molecules, as well in their size, shape and mechanical characteristics, encompassing a high number of variables. Despite this high degree of complexity, C. elegans\u2019 response to all our bacterial strains followed a simple universal trend.We systematically characterized C. elegans eats bacteria, and each food patch was a drop of bacterial culture whose density had been carefully adjusted by measuring its optical density (OD). The food patches were placed on the day before the experiment, and we ensured that bacterial density remained unchanged by preparing the agar plates without nutrients and with a low dose of bacteriostatic antibiotics. On the day of the experiment, young adult (48-h\u00a0old) worms were placed at the center of the plate, equidistant to all food patches, and freely explored the environment for 2\u2009h, a time that was short enough to prevent significant food depletion, but long enough for patch occupancy to be roughly constant at the end of the experiment .Our experimental setup consisted of round agar plates with 5 food patches of different densities, arranged as a regular pentagon Fig.\u00a0. C. elegA key challenge was to study a wide enough range of bacterial densities, because placing patches of very different densities on the same plate leads to noisy data: Worms accumulate on the high-density patches, leaving very few individuals to assess the low-density range. We solved this challenge by performing several experiments covering smaller and overlapping density ranges. For visualization purposes, we normalized the number of worms in each experiment with respect to a virtual reference to obtain a relative number of worms comparable across conditions .To investigate whether our results are applicable to different types of food, we performed our experiments with 12 different strains, distributed across 11 species and 7 families. Five of these strains are common in C. elegans to all bacterial strains can be described by our sigmoidal equation, after fitting its three parameters independently for each strain , which in a log-log plot corresponds to a line with slope 1 Fig.\u00a0. Therefomentclass2pt{minimE. coli OP50, which was also used to feed the worms before the experiment. This previous experience might explain the deviation, because C. elegans can learn odors and tastes associated with beneficial food22, and this learning might increase the attractiveness of OP50 with respect to unfamiliar strains. The other two outliers (Bacillus safensis CR164 and Pseudomonas viridiflava CR90) cannot be explained in this way. These deviations suggest that C. elegans\u2019 behavior is near-optimal but not perfectly optimal, although we must keep in mind that we only measure a proxy for fitness (number of eggs laid in 5\u2009h), and a more accurate measurement might partially explain the outliers. In any case, we conclude that C. elegans is using a rule of thumb, focusing on cues that allow it to adapt its behavior to most strains, and probably neglecting others that would be relevant for the outliers.Three outliers deviate from the general trend Fig.\u00a0. One of We next asked what properties of the food determine the observed rule of thumb. We first hypothesized that worms would choose the food patches with the highest biomass density, since biomass density determines the actual amount of food available. So far we have reported bacterial density using optical density (OD), which measures the amount of light absorbed by a bacterial culture. OD is proportional to biomass density for a given bacterial strain, but different bacterial strains have different cell size, shape and composition, which affect light transmission through the culture. Therefore, cultures of different strains at the same OD may have different biomass density. We hypothesized that the different values of attraction density between biomass content and C. elegans.While we did find a slight negative correlation at the same OD. We determined the cell density in our cultures by a combination of plating and microscopic observations (see Methods). As for biomass, we expected to find an inverse relation between p\u2009=\u20090.002, linear regression), and in this case the correlation was strong enough to explain all the variability in C. elegans behavior is simply bacterial density, but measured in number of cells per unit of volume . We confirmed this fact by plotting our original data with the bacterial density measured in cells/mm2, and comparing them with a single sigmoid , describes the experimental results with high accuracy , and use our sigmoidal model to predict the worm\u2019s response to it , with other factors that depend on bacterial strain, such as biomass content, having smaller effects.In our experiments, 35 showed large differences in preferences between certain strains, such as E. coli Hb101 and E. coli DA837, which is very similar to OP50 and elicits the same behavioral response is a pathogen of C. elegans, and actively avoided by the worms42. We did not find such avoidance behavior, but both the strong pathogenicity and the avoidance response require active production of a toxin by the bacteria, which was not possible in our experimental conditions due to the lack of nutrients in the plates. As a control, we checked that we could reproduce C. elegans\u2019 avoidance of S. marcescens when performing experiments on NGM plates rather than on our experimental plates 46. Most previous studies of C. elegans foraging used bacterial patches growing on rich media , where bacterial metabolism is active, and bacteria are therefore actively depleting oxygen. In contrast, our experiments took place on plates lacking nutrients for the bacteria, and with small amounts of bacteriostatic antibiotics to ensure that bacterial density remained constant during the 24\u2009h that elapsed between the deposition of the bacterial drops and the behavioral experiment. For this reason, we do not expect that our food patches depleted oxygen significantly . On the one hand, this difference raises the question of whether our results would still hold in situations with active oxygen depletion, a question that we could not answer experimentally because it is hard to control accurately the density of metabolically active bacteria. On the other hand, our results show that C. elegans is capable of foraging efficiently even without the aid of oxygen cues.The role of oxygen concentration deserves a separate comment, since our results differ from most of previous studies in this respect. 30. A more detailed study of these parameters might reveal differences that were not apparent here. This higher degree of detail was not possible at the level of throughput and coverage needed to reveal the rule of thumb, but is a natural next step towards unveiling its mechanistic and neural implementation.A limitation of our study is that we measured a single experimental outcome (patch occupancy). Differences in this outcome emerge from changes in elementary behavioral parameters, such as speed, turning rate, probability of different behavioral states , etcC. elegans\u2019 response. However, our strains did show great variability in many other variables: They cover 7 different bacterial families, show more than a 30-fold difference in volume between the smallest and largest strains , and that its response is independent of other characteristics of the bacterial strains .A second limitation of our study is that, while our collection of bacterial strains is larger and most diverse than the ones used in most previous studies, we were not able to sample the whole diversity of natural bacteria. In particular, experimental limitations restricted us to bacteria that grow aerobically on LB medium. Also, most of our strains turned out to be rod-shaped . However, it is worth noting that the factors affecting long-term fitness in a naturalistic environment are uncertain while an individual is exploiting a food patch. Therefore, foraging decisions are probably driven by the instantaneous benefit of the food on the worm\u2019s ability to produce offspring, which is well represented by the number of eggs measured in our experiment.A third limitation of our study is the use of egg-laying as a proxy to fitness. Fitness is an elusive magnitude, and measuring it directly is hard, because it requires long-term measurements over several generations42. Our experimental conditions were necessary to properly control bacterial density, and the good correlation of behavior and fitness benefit shows the ecological relevance of our observations. These controlled experimental conditions have revealed a core behavioral mechanism, which produces adaptive response by focusing on the single-most informative environmental variable.A fourth limitation of this study is the lack of bacterial growth, which limits the production of bacterial metabolites. These metabolites are probably relevant in natural conditions, as is certainly the case for pathogenic bacteriaCaenorhabditis elegans, strain N2, obtained from the Caenorhabditis Genetics Center , and maintained using standard practices53. Worms grew at 22\u2009\u00b0C on nematode growth medium , in 100mm-diameter Petri dishes seeded with 200\u2009\u03bcL of a saturated culture of E. coli OP50 bacteria (grown overnight on LB at 22\u2009\u00b0C). The worms were transferred to a fresh dish every 1\u20133\u2009days to prevent food depletion, so that worms used in any experiment came from a population that had not experienced food depletion for at least 5 generations. To prevent accumulation of mutations, we ensured that our population was never more than 30 generations away from the individuals received from the CGC. We performed all experiments with 48-h old worms, synchronized by bleaching and egg collection (i.e. experiments were performed 48\u2009h after re-feeding the L1 larvae obtained by the bleaching procedure).All experiments were performed with Escherichia coli (OP50), Escherichia coli (Hb101), Escherichia coli (DA837), Serratia marcescens (Db10), Bacillus megaterium (DA1880), and Bacillus simplex (DA1885) were obtained from the Caenorhabditis Genetics Center. Lysinibacillus boronitolerans (CR13), Bacillus flexus (CR87), Pseudomonas viridiflava (CR90), Ochrobactrum grignonense (CR155), Bacillus safensis (CR164), Corynebacterium variabile (CR181), Rhodococcus globerulus (CR266), Pseudomonas veronii (CR220), and Raoultella terrigena (CR225) were isolated by us from the gut of C. elegans N2 worms who had fed on organic compost (see below).E. coli Hb101 was an exception, as it took longer than 24\u2009h to reach saturation. In this case we skipped the second inoculation, continuing the incubation of the original culture for a total of 48\u2009h.Bacteria were streaked on NGM plates from a \u221280\u2009\u00b0C glycerol stock, stored at 4\u2009\u00b0C, and re-streaked to a fresh plate every 2\u2009weeks to ensure viability. To prepare liquid cultures, we inoculated one or two bacterial colonies in 5\u2009mL of LB medium, and incubated for 24\u2009h, at 22\u2009\u00b0C, with orbital shaking at 300\u2009rpm, in a closed 50\u2009mL Falcon tube. Then, 1\u2009\u03bcL of this culture was inoculated in either 5 or 10\u2009mL of fresh LB and incubated for another 24\u2009h in the same conditions. C. elegans were isolated by growing C. elegans on different types of rotten organic material, followed by washing and sterilizing the worms on the outside, grinding the worms and plating the resulting bacterial suspension on agar plates.The natural microbiota strains of E. coli OP50 by growing OP50 for 24\u2009h in 200\u2009mL tryptic soy broth at 37\u00b0C, followed by spinning down, resuspending in 4mL S-medium (prepared as described in53) and incubation at 80\u00b0C for 24\u2009h. This procedure results in 50x E. coli OP50 (50x compared to density at saturation).We first prepared heat-killed Two types of food sources were fed to the worms: different types of (i) compost and (ii) rotten fruits and vegetables. Some rotten apples were directly collected from the outside. Other fruits like apples, celery, almonds and parsnip were placed on local soil from Boston, MA in a household plastic box (Sterilite) with semi-open lid and incubated in the lab at room temperature until the fruits were strongly decayed (~3\u2009weeks). The compost samples were taken from two local compost piles in Boston, MA, that mostly contained kitchen and garden waste. Some amount of phosphate buffered saline and glass beads were added to the samples. The samples were homogenized by vortexing at high speeds. The resulting solution was filtered through a 5\u2009\u00b5m filter to remove bigger particles. The resulting emulsion was spread on S-media agar plates without citrate.C. elegans N2 were first grown on E. coli OP50 lawn on NGM plates. The worms were washed off the plates with M9 worm buffer with 0.1% Triton X-100. The worms were let sink down for about 1\u2009min and the supernatant was removed. The worms were resuspended in S-medium containing 100\u2009\u00b5g/mL gentamicin and 5x heat-killed OP50 (5x compared to density upon saturation). The worms were incubated in that solution for 24\u2009h at room temperature with gentle shaking . Finally, the worms were washed twice with M9 worm buffer + 0.1% Triton X-100.The germ-free worms were added to the plates with rotten organic material for around 1\u2009week. After that time the worms were washed off the plates with M9 worm buffer with 0.1% Triton X-100. The worms were washed twice with M9 worm buffer with 0.1% Triton X-100 . Afterwards the worms were re-suspended in 1\u2009mL ice cold M9 worm buffer with 0.1% Triton X-100 and incubated on ice for 10\u2009mins. 2\u2009\u00b5L bleach (Clorox) were added to kill bacteria on the outside of the worm and the worms were incubated for 6\u2009mins on ice. Afterwards the worms were washed 3x with ice cold M9 worm buffer with 0.1% Triton X-100. Single worms were transferred into 0.6\u2009mL reaction tubes (Eppendorf) and ground with a motorized pestle for at least 1\u2009min. The resulting solution was plated onto a tryptic soy broth agar plate . From the resulting colonies, physiologically unique colonies were picked. The colonies were streaked out again on tryptic soy broth agar and checked for contaminations. If contaminations were spotted the bacteria were re-streaked again. Finally, the bacteria were grown in tryptic soy broth at 30\u00b0C and stored as glycerol stocks. The species identity was analyzed by 16\u2009S Sanger sequencing .54 package trained on green gene 16\u2009S dataset55. Strains are available from the authors upon request.Phylogenetic identity was assigned from 16\u2009S rRNA gene sequence by dada24, 5\u2009mg/L cholesterol, 1\u2009mM CaCl2, 10\u2009mg/L chloramphenicol and 100\u2009mg/L novobiocin). The composition of these plates was designed to prevent bacterial growth, not containing any nutrients for the bacteria, and containing two bacteriostatic antibiotics. We chose this antibiotic cocktail after measuring the Minimum Inhibitory Concentration (MIC) for 6 different bacteriostatic antibiotics and all our bacterial strains. We aimed to prevent bacterial growth while keeping the bacteria as healthy as possible, and we determined that 10\u2009mg/L chloramphenicol and 100\u2009mg/L novobiocin was the best combination to prevent the growth of all strains while keeping the antibiotic concentrations as low as possible. We checked that all bacterial strains remained viable and with constant optical density after 24\u2009h of exposure to this cocktail of antibiotics. Plates were poured 1\u2009week before the assays, and stored at room temperature.Assays were run in foraging plates . After the last wash, we re-suspended the bacteria in foraging buffer, adjusting their OD with a spectrophotometer to the maximum OD needed for our experiment. We then performed serial dilutions in foraging buffer to obtain all needed densities.One day before the experiment, bacterial cultures were washed three times with foraging buffer placed drops of bacterial culture on the foraging plates. In all cases, we used 40 \u03bcL drops, which spread to a diameter of 11.2\u2009mm on average. Drops were left to dry overnight at 22\u2009\u00b0C. Some of our experimental conditions contained a food patch with zero bacterial density. In these cases, we simply left one of the drop positions empty (we did not pipet anything on that position), but then counted the number of worms in that area as if there was a food patch.We used 55mm-diameter foraging plates with five 40-\u03bcL drops of bacteria, forming a regular pentagon with the patch centers 13\u2009mm away from the plate\u2019s center. For each experimental condition (consisting of five different food densities), we prepared at least 4 different versions, randomly permuting the position of the 5 densities across the 5 food patches to minimize effects due to relative position of the food patches. We then prepared at least 8 replicates of each version, so we had a total of at least 32 plates per condition. We also randomized the order at which the different conditions were prepared. Food patches were placed on the experimental plates 1\u2009day before the experiment and dried overnight at 22\u2009\u00b0C.2PO4, 7.52\u2009g/L Na2HPO4.2H2O, 5\u2009g/L NaCl, 1\u2009mM MgSO4, 0.1% Triton X-100; Triton X-100 was added to prevent worms from sticking to the pipette tips). To remove all bacteria, we washed the resulting worm suspension 6 times with M9\u2009+\u20090.1% Triton X-100 using a table-top centrifuge (~5\u2009s spin was enough to pellet the worms while leaving the bacteria in suspension). Worms were then placed in the middle of the experimental plates by the pipetting robot, in drops of 10\u201315\u2009\u03bcL (adjusted for an average of 10 worms per plate). The full wash procedure took between 8 and 10\u2009min and placing the worms took at most 5\u2009min, so at most 15\u2009min elapsed between the breeding plate and the experimental plate.48-h old synchronized worms were washed off their cultivation NGM plates with M9 worm buffer + 0.1% Triton X-100 . Previous protocols that use similar scanners to quantify worm behavior proposed modifications to increase image quality and control temperature57.We aimed to have 32 plates for each experimental condition (8 plates for each version with permuted positions), with 10 worms per plate. However, the actual number of plates and worms was lower. First, we removed a small fraction of plates that presented imperfections on the agar surface or non-round food patches. Second, given that we could not control the exact number of worms placed on each experimental plate (just the volume and concentration of worm suspension), we had substantial variability in worm number per plate. To prevent any significant effects from food depletion, we removed from the analysis all plates that had more than 20 worms. After this filtering, we had 29\u2009\u00b1\u20094 plates per condition and 230\u2009\u00b1\u2009110 worms per condition (mean\u2009\u00b1\u2009standard deviation). See Supplementary Table\u00a0We assume that the number of worms found in a given food patch is proportional to its attractiveness, Then, the proportion of worms present in each food patch in a given plate will bek-th plate , so we have measurements for 11 out of our 12 strains. See Supplementary Table\u00a0We used 35\u2009mm foraging plates with one 40\u2009\u03bcL drop of bacteria in the center, placed on the plate the day before the experiment and dried at 22\u2009\u00b0C. 48-h old worms were washed from their breeding plates in the same way as for patch occupancy assays. Then, individual worms were fished using a pipette and placed on the bacterial patch (one worm per plate). A copper ring of 2\u2009cm diameter was then lodged into the agar, around the patch, to prevent the worm from escaping. Worms were left on the lawn for 5\u2009h and then put at \u221220\u2009\u00b0C for 5\u2009min. This brief period ensured quick refrigeration of the plates to immobilize the worms and stop egg-laying, without freezing the agar. Then, plates were stored at 4\u2009\u00b0C. Worms remained immobile and eggs didn\u2019t hatch, so eggs could be counted for at least 2\u2009weeks after the experiment. Eggs were manually counted, excluding any plates where more than one worm was placed by mistake, or where the worm escaped the area delimited by the copper ring. All experiments were performed on the same day to minimize experimental variability, but eggs were counted over the 2\u2009weeks following the experiment. Because of experimental complications, we failed to measure We counted unhatched eggs because of experimental limitations. Our experiment required more than 1500 plates, so it would have been impractical to remove manually every adult after 5\u2009h to allow for more time for the eggs to hatch. Also, the copper ring was not 100% effective at preventing worms from escaping. While it was easy to discard all cases in which the adult had escaped, missing larvae would have decreased the accuracy of our measurements.Another experimental limitation came from the age of the worms: Our behavioral experiments were performed with 48-h old worms, and fitness experiments had to be performed at the same age. However, at this stage worms are just starting to be fertile, and it may be that some individuals had not yet started to lay eggs at the beginning of our fitness experiment. This factor probably lowers the accuracy of our fitness measurements, but it does not change our conclusions. We randomized thoroughly the order in which worms were added to each experimental condition, so age effects should not produce any systematic bias. Also, all our results have 95% confidence intervals computed via bootstrapping, which take this experimental variability into account.To determine Optical Density (OD) was measured using a spectrophotometer . We found that this spectrophotometer is most accurate for OD\u2019s between 0.1 and 1, so we always diluted the bacterial cultures to obtain measurements in this range. Lower OD\u2019s could not be measured accurately, so they are inferred from the dilution factors used to prepare them.To determine density in cells per microliter, we combined plating to determine the amount of colony forming units (CFU) with microscopy to investigate the nature of each CFU.2PO4, 7.52\u2009g/L Na2HPO4.2H2O, 5\u2009g/L NaCl, 1\u2009mM MgSO4), and plated four 10-microliter drops of each dilution on an NGM plate. We incubated this plate at room temperature for 48\u2009h, counted the number of colonies in the drops that had around 10 colonies, and used these counts to derive the density of colony-forming units in our original culture. We computed the errorbars by bootstrapping the four drops for each measurement. We performed this plating procedure both before and after washing the bacteria with foraging buffer to prepare our experimental plates , and we did not find any consistent differences before and after the wash.We determined the CFU density as follows. After determining the OD of the bacterial culture, we performed 10-fold serial dilutions in M9 worm buffer (3\u2009g/L KHB. megaterium (DA1880) and B. flexus (CR87), form long filaments composed of several cells, and each of these filaments will form a single colony. Using DAPI staining to visualize individual cells in each filament, we counted the number of individual cells per filament, obtaining 9.6 and 8.7 cells per filament on average for B. megaterium (DA1880) and B. flexus (CR87), respectively. We used these factors to transform the CFU/\u03bcL determined from plating to cells/\u03bcL for these two strains.The number of CFU/\u03bcL is not identical to the number of cells/\u03bcL. First, not all cells that fall on the surface of an agar plate survive and manage to form a colony. To control for this effect, we performed a control using LB plates instead of NGM plates, and we did not find significant differences in viability across these two types of plates, which suggests that viability was high for all strains in both media. Second, each CFU may be a single cell, but it may also be a cluster of cells that clump together and form a single colony. To control for this effect, we studied our bacterial cultures under a microscope (LEICA DM6000). We found that 10 out of our 12 bacterial strains were mostly composed of individual cells, with few clumps, so for these 10 strains CFU/\u03bcL is a good estimate of cells/\u03bcL. In contrast, To determine the amount of biomass present in our bacterial cultures, we prepared 200\u2009mL of saturated culture for all strains, washed it 3 times with M9 worm buffer, and resuspended to a volume of 5\u2009mL. We then measured the OD of these suspensions, and placed them in glass tubes that we had previously weighed. We also added three tubes with M9 worm buffer without bacteria, to be able to account for the weight of the salts contained in the buffer. We evaporated all the water by incubating the tubes at 90\u2009C for 24\u2009h, and weighed them again. We checked that longer incubation did not change the weight, meaning that 24\u2009h were enough for all the water to evaporate. We then calculated the biomass contained in each tube by subtracting the weight after incubation minus the weight of the empty tube, and minus the weight corresponding to the salts from the M9 buffer . See detailed protocol at dx.10.17504/protocols.io.kxygxzn44v8j/v1. To compute confidence intervals, we assumed that all weight measurements had the same proportional error observed in the 3 measurements performed to estimate the weight of M9 salts, we estimated the error in OD measurements by performing 10 measurements of the same culture, and we combined these two sources of error using bootstrap.Bacteria were cultured from colonies in 5\u2009mL of LB, on a shaker at 300\u2009rpm, at 22.5\u00b0C, for 20-28\u2009h. They were then washed in M9\u2009+\u20090.5% Triton, incubated for 5-10\u2009min in DAPI (1:2 to 1:10 dilution in M9 from 1\u2009mg/mL stock), washed once and then resuspended in M9. One microliter from each culture was then imaged on Agarose 1% pads using a LEICA DM6000 optical microscope with x40 to x100 magnification (see full protocol at dx.10.17504/protocols.io.n92ldpjr8l5b/v1).58: For a given experimental condition for which we have P replicates , we chose P of these replicates randomly, with replacement . By doing this with all of our experimental conditions, we obtained a bootstrapped dataset. We thus generated at least 1000 bootstrapped datasets. These bootstrapped datasets are an estimate of what we should expect if we repeated our whole experimental process 1000 times, so they give an estimate of the reproducibility of our results58. For each errorbar shown in the paper, we computed the corresponding quantity for each of the bootstrapped datasets, removed the most extreme 2.5% of values at each side, and reported the remaining interval as an errorbar. For example, errorbars in We computed all errorbars using bootstrapSignificance of correlations was evaluated by fitting linear regression models, using Matlab\u2019s fitlm function (Matlab 2019a).Reproducibility of the results across measurements taken in different laboratories is shown in Supplementary Fig.\u00a0Consider mixtures of two strains, A and B, and let The model based on the sigmoidal rule assumes that the response to both strains follows the same sigmoid, with mentclass2pt{minimFurther information on research design is available in the\u00a0Peer Review FileSupplementary InformationDescription of Additional Supplementary FilesSupplementary Data 1Reporting Summary" \ No newline at end of file