diff --git "a/deduped/dedup_0177.jsonl" "b/deduped/dedup_0177.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0177.jsonl"
@@ -0,0 +1,42 @@
+{"text": "In our publication , the fre"}
+{"text": "Reconstruct software and applied to the semi-automatic tracing of individual axons in three dimensions. The progression of region growing is constrained by user-specified criteria based on pixel values and object sizes, and the user has full control over the segmentation process. A full montage of reconstructed axons was assembled from the \u223c200 individually reconstructed stacks. Average reconstruction speed is \u223c0.5 mm per hour. We found an error rate in the automatic tracing mode of \u223c1 error per 250 um of axonal length. We demonstrated the capacity of the program by reconstructing the connectome of motor axons in a small mouse muscle.We introduce a method for large scale reconstruction of complex bundles of neural processes from fluorescent image stacks. We imaged yellow fluorescent protein labeled axons that innervated a whole muscle, as well as dendrites in cerebral cortex, in transgenic mice, at the diffraction limit with a confocal microscope. Each image stack was digitally re-sampled along an orientation such that the majority of axons appeared in cross-section. A region growing algorithm was implemented in the open-source  C. elegans done by electron microscopy The nervous system is comprised of a large number of neurons with extensive and specific interconnections, but the wiring diagram is largely unknown. One approach to unravel neural circuits is to reconstruct the network by imaging its cellular components. A full wiring diagram (\u201cconnectome\u201d) would require complete reconstruction of all the connections between all cells within the network, and has only been attempted rarely, the most notable example being the nervous system of the nematode In recent years, with the adoption of confocal and two-photon microscopy as well as transgenic techniques to label neurons with fluorescent proteins These software packages do not perform satisfactorily when dealing with image stacks in which multiple neural processes branch and intertwine with each other. For instance, NeuronJ works on 2D image only, but the complexity of fasciculated nerve fibers makes it necessary to distinguish individual processes by exploring the full 3D data set. Moreover, when neural processes are closely apposed, the boundaries of such processes tend to smear into each other due to the diffraction-limited resolution of optical microscope and scattering. In this situation, the automatic or semi-automatic tracing functions provided by existing software do not guarantee correct tracing or segmentation. In addition, many of these programs do not allow segmentation tools to work on arbitrary slices. This limitation is serious because we find that reconstructing nerve fascicles is much easier from the cross-section orientation than a longitudinal one.Reconstruct software http://tech.groups.yahoo.com/group/reconstruct_users/), which also provides a forum for user support and technical discussions. As a demonstration of the capacity of the program we reconstructed the full connectome of axons in a small mouse muscle, which required analysis of over 20,000 images.To facilitate the tracing of complex bundles of axons we enhanced the thy-1-YFP-16 line, thy-1-YFP-H line We imaged the axons innervating the omohyoid muscle of transgenic mice  was converted into a series of individual 16-bit tiff files using ImageJ.We wrote Matlab this was performed with the imadjust function. Each XY stack  was chosen so that the majority of axons in the stack would appear in their cross-sections orthogonal to their long axes (Matlab (the imresize function with \u2018bicubic\u2019 option) to downsize the XY stacks before re-sampling to reduce the number of sections to be analyzed without losing the ability to track individual axons. This downsizing operation has two additional advantages: it in effect applies a mean filter to the original image and thus reduces the noise, and each re-sampled image will have square pixels as required by Reconstruct, since the original Z step size was twice that of the X-Y pixel size.XY files were first converted to 8-bit, in which the dimmest pixel in the stack was mapped to value 0 and the brightest pixel in the stack mapped to value 255. In XY stack  was thenong axes . AlthougReconstruct program allows a user to trace objects in serial sections by manually drawing the outline of each object on each section, which is time-consuming. We modified Reconstruct to enable semi-automatic tracing of axons using a region-growing algorithm called wildfire. The wildfire tool can be quickly guided by user input in an intuitive way, and generates a boundary enclosing the contiguous area of an axonal profile, while ignoring the outer halo of disjoint, scattered bright pixels common to confocal data.The original platform of the wildfire tool in Reconstruct allows the user to initiate region growing by selecting a \u201cseed\u201d pixel by a mouse-click. Region growing expands outward from the seed pixel to all 4-connected neighboring pixels , , , and , given the seed pixel coordinate ) that fail to satisfy user-specified stopping criteria based on hue, saturation and/or brightness. These pixels at which growth does not stop then serve as new \u201cseeds\u201d for the next iteration of growth. Region growth stops when all pixels at the frontier of growth satisfy the stopping criteria and thus provide no new seed. Once the growth process stops, a labeled boundary of the region is generated by tracing clockwise around the outermost frontier of pixels. The user can block region growing by using the mouse to define temporary boundaries.The wildfire tool then traces all noncontiguous profiles in the rectangle using the region growth algorithm and the same stopping criteria. A user-specified size threshold is used to block the generation of outlines around isolated pixels.When there are many fragments of the same structure appearing on the same section , it is desirable to be able to trace all these fragments on a single section with a single command rather than requiring the user to click inside every profile. We thus implemented a feature to allow the user to specify a rectangular region by dragging the mouse across the image. The wildfire on the next section. Successful region growing is thus repeated on successive sections automatically  can also be modified to improve performance after a stop. Another constraint is that different axons cannot overlap with each other. The user can set a minimal distance between axons , and the region-growing procedure will stop when it reaches such \u201cforbidden zones\u201d defined by the boundaries that have been already traced.Region growing is extended to serial sections by using the centroid of each trace to locate a seed pixel for atically . To contThe program also typically stops at branching points. Axons branch only at nodes of Ranvier, which show characteristically smaller diameters than the internode regions  and 3A awildfire on each piece.Another difficulty lies where axons do not go parallel to the preferred axis of re-sampling. Sometimes axons fan out and go in all directions, and no matter which axis is chosen for re-sampling, there are always some axons (or parts of axons) that go almost perpendicular to it . An axonReconstruct program provided at the download site).The reconstruction procedure described above generates multiple 2D contours of each axon throughout the stack. These contours can be rendered as 3D objects in different ways for visualization and subsequent merging  images of all stacks (in our case monochromatic images) to provide a reference map. The overlap between adjacent stacks enables accurate alignment of the MIP images into a complete montage. This reference map facilitates obtaining the correct magnification for reconstructions from different stacks.Reconstruct. The 3D rendering was rotated by a suitable angle to make it en face, i.e., viewed in the original XY orientation, and exported as a bmp or jpeg image. The rendering of all axons in the stack collectively was aligned onto the monochromatic montage with suitable resizing. Then each axon in the stack was rendered one by one and saved separately. These individual images were superimposed onto the montage subsequently, with one Photoshop layer per image. The collective rendering now serves as the reference for the alignment of individual axons. The reason to use a separate Photoshop layer per axon is to allow the user to turn on or off any axon from the view later. This procedure was repeated for each stack until the entire montage was aligned and colored. Then all layers belonging to the same axon were collapsed in Photoshop, allowing each axon to occupy a separate layer. In order to make the appearance of individual axons more distinguishable, we used the Photoshop magic wand tool to select one axon at a time on its layer, and used the paint bucket tool to fill its interior with a distinct color.For each reconstructed stack, all axons were rendered in 3D in Reconstruct can export 3D rendering of objects in VRML formats, it should also be possible to do the alignment using VRML objects in a 3D modeling program.The procedure described above produces a 2D montage of the entire sample . HoweverWe evaluated the effectiveness of the reconstruction method presented above in terms of the reconstruction speed and the error rate. The reconstruction speed depends on the complexity and layout of the axonal bundle, as well as image quality . A stack that contains axons that are homogenously labeled, well separated, and imaged with high signal to noise ratio can be reconstructed without much user intervention, and the reconstruction speed approaches \u223c4 mm per hour. In this case most of the time is consumed by the delay (a fraction of a second) after generating a contour on each section, which is deliberately introduced to enable the user to see the result clearly. However, stacks that contain axons that \u201cbleed\u201d into each other, or are dimly labeled, or travel along non-preferred directions, take much more human intervention and manual reconstruction to complete, and the speed is consequently much slower. According to our experience, the average reconstruction speed for the whole muscle sample is \u223c0.5 mm per hour wildfire segmentation as soon as it emerges, and correct it, so that the error does not propagate. Therefore, we believe that a better metric is the rate at which the semi-automated reconstruction process requires user intervention. This rate not only gives an estimation of the reliability of the automated processing, but affects the speed of reconstruction as well.The error rate of segmentation algorithms is usually determined by comparing the results of the automatic segmentation and that of manual segmentation. For our semi-automated approach, however, it seems that the usual metric of \u201cerror rate\u201d is not appropriate, because the program does not proceed all by itself and let the user correct the answers afterwards. In fact, the design of the semi-automated feature is to allow the user to discover any error in the The rate of intervention depends critically on the complexity of the data. We thus used stacks of different complexity to estimate the rate of intervention. We reconstructed 9 axons from 2 \u201csimple\u201d stacks , and 6 aReconstruct was developed and applied to the tracing of individual image stacks. The program employs a region-growing algorithm, and uses the centroid of an existing axonal contour as the seed for region-growth on the next section in order to proceed automatically. For a non-branching, well segregated axonal process the program can automatically segment it through the entire stack  without interruption or human intervention in 2\u20133 min (\u223c4 mm per hour). The program stops when ambiguity arises, and the user has full control over the segmentation process. A full montage can then be assembled from the reconstructed stacks.In this paper we introduced a method for large scale reconstruction of neuronal processes from fluorescent image stacks. The processes are imaged at the diffraction limit with a confocal microscope. Images are pre-processed to remove noise and re-sampled so that tracing of axons can be performed along a convenient orientation  which shows the cross-sections of the majority of axons. A semi-automatic program based on the infrastructure of Several factors must be considered in the design of a program for image reconstruction from large data sets. Obviously, it is desirable to automate as many operations as possible. For connectomics, automation is especially important, as the amount of data to be processed is usually large, and manual segmentation is one of the main bottlenecks. On the other hand, the variability and complexity of the structure of the objects to be reconstructed means that some user monitoring and intervention is necessary. A user-friendly interface is thus required. If online user monitoring is required, the algorithms used in the automatic segmentation cannot be too time-consuming. This is the reason that we adopted the fast and simple region-growing algorithm based on pixel values for segmentation. If the strategy is to first go through the data automatically and then let the user validate and correct the results, the automatic processing can employ more sophisticated and computationally expensive algorithms. Many image processing algorithms, such as live wire Reconstruct program processes images in an essentially 2D manner. Therefore one particular orientation must be selected and maintained for each stack at the re-sampling step. When objects within the stack assume very different main axes, this requirement of a single orientation leads to some inconveniences for objects along non-preferred directions. Manual segmentation is often necessary for such objects as discussed above. An alternative strategy would be to dynamically re-orient and re-sample the stack along the local preferred direction as tracing proceeds. This will ensure that at each step, the object is processed on its cross-section, which is advantageous for segmentation. This approach, however, is computationally more demanding, and remains to be fully explored.The Reconstruct program as reported previously The reconstruction method presented in this paper is applicable to the analysis of branching, tubular structures  imaged with fluorescent microscopy techniques that can obtain volumetric data . We also expect that the reconstruction method is compatible with fluorescent image stacks taken by Array Tomography thy-1-YFP-16 line  were used throughout these studies. Young adult mice (\u223c30 days old) received an intraperitoneal injection of 0.1 ml/20 g ketamine-xylazine , and were perfused transcardially with 4% paraformaldehyde (PFA) in 0.1 M phosphate-buffered saline . For the muscle preparation: the omohyoid muscle along with a short length of the innervating nerve was removed, post-fixed in 4% PFA for 30 min, rinsed in PBS , and then mounted on slides with the Vectashield mounting medium . Mounted slides were slightly squeezed between a pair of small magnets over night to flatten the tissue so that the distance from tissue surface to the coverslip was roughly constant. For the brain slice preparation: the whole brain was removed from the skull, post-fixed in 4% PFA over night, rinsed in PBS , sliced at 50 or 100 \u00b5m thickness with a vibrotome (Leica VT1000S), and mounted on slides with the Vectashield mounting medium.All animal experiments were conducted according to protocols approved by Harvard University Institutional Animal Care and Use Committee (IACUC). Transgenic mice of fmax must be sampled at least at frequency 2fmax to ensure that the signal can be accurately recovered from the sampling MultiTimeZ macro (developed by Carl Zeiss) to set up the coordinates and imaging conditions for each stack in the montage. Adjacent stacks had 10% overlap to guarantee the precision of later alignment and tracing.Samples were imaged using a confocal laser scanning microscope  equipped with a motorized stage. We used a 63\u00d71.4NA oil-immersion objective and optically zoomed-in by a factor of 1.5. YFP fluorescence was excited with a 488 nm Argon laser and detected through a band-pass emission filter of 530\u2013600 nm. Images were sampled at the Nyquist frequency in the x-y direction (pixel size\u200a=\u200a0.1 \u00b5m) and over-sampled by a factor of \u223c2 in the z direction (z-step size\u200a=\u200a0.2 \u00b5m), with 12 bit dynamic range. According to the well-known sampling theorem, a signal that contains data at maximal frequency http://rsb.info.nih.gov/ij/) and custom-written programs in Matlab , and reconstructed with Reconstruct (http://synapses.clm.utexas.edu/tools/reconstruct/reconstruct.stm). Final assembly into a complete montage was done with Adobe Photoshop (Adobe Systems Inc.). See Image stacks were pre-processed with ImageJ (NIH,"}
+{"text": "Benign maxillo-mandibular tumors and cysts, which are relatively common findings on radiographs, namely the ubiquitous panoramic view, have to be dealt with by dentists on a daily basis.The aim of this study is to evaluate the panoramic radiographic findings pertaining to benign and tumoral lesions in the maxilla and mandible.Applying a case series method, panoramic images of 61 patients with cysts, benign tumors and tumor-like lesions in the jaws who were referred to Hamedan dental school between 2009 and 2011 were evaluated by two radiologists. They were both blind to histopathological results as well as the objectives of our study. Lesions were assessed based on their location, periphery, internal structure and impaction on the surrounding structures. Then the obtained data were analyzed using descriptive tables.Cysts were mostly more common in men despite the equal propensity of both genders to benign tumors. In contrast, women showed a higher frequency of tumor-like lesions. The most common site of involvement was the posterior mandible, with peri-apical tooth lesions as the most prevalent dental association. Radiographically, what we most encountered was unilocular radiolucency pertaining to cysts and benign tumors; nevertheless, tumor-like lesions tended to present with a well-defined radiopacity.Despite its known shortcomings, like every other diagnostic tool, panoramic radiography can contribute to the early detection of maxillary/mandibular lesions that in turn enable the dentist to devise an appropriate treatment plan. Given the relatively high incidence of maxillary/mandibular cysts and tumors , dentistFurther studies include intraoral and occlusal radiographs as well as panoramic X-rays, each with their exclusive features. The latter, for instance, provides an overall view of the jaws and teeth structure that cannot normally be achieved by using other visual diagnostic modes. The former, however, fails to capture dento-alveolar lesions ; whereasA dentist can be the first health caregiver to come across a variety of lesions; namely cystic, tumoral lesions in the jaws. Better knowledge of radiological clues can contribute enormously to a precise and due diagnosis. The aim of this study is to evaluate the panoramic radiographic findings pertaining to benign and tumoral lesions in the maxilla and mandible.Our subjects, 61 cases, were selected among 120 patients with a panoramic radiography as well as histopathological reports pertaining to the lesions detected radiographically. These patients were all referred to Hamedan Dental School with a diverse range of complaints between 2009 and 2011. As it was meant to be a case study, data were all elicited from archived reports and files. The subjects, 34 males and 27 females, radiographically had cyst (s), benign tumor (s) or tumor-like lesion (s), in which each lesion affected the bone (intra-osseous) or the peripheral soft tissue plus an extension to the adjacent bone structure.Tumor like lesions ranged from reactive, such as giant cell granuloma and aneurysmal bone cysts, to fibro-osseous lesions . The X-ray apparatus used also differed from case to case: planmeca Model 2002 cc panoramic machine , CR system (cassette system with photostimulable phosphor plates) and Digora PCT . Two qualified radiologists reviewed the images separately under uniform light on EIZO MX241W monitor  and view box for digital and analogue images. Images were also subjected to contrast, zoom and density adjustment if necessary. Observers had no knowledge of the histopathological results as well as the objectives of our study. In case they did not concur, a third opinion was sought through consultation with another expert who was also blind to pathology reports.Lesions were assessed based on their location, periphery and internal structure. As far as the location was concerned, the lesions could be single-focal, multi-focal and generalized. They could also be situated in the anterior (incisor-canine) and posterior (pre-molar/molar/ramus mandible)/tuberosity (maxilla) of the mouth, or even extend from anterior to posterior. The peripheries of the lesions were described as either well-defined or ill-defined. The former could be corticated, sclerotic and non-corticated (punched-out). Ill-defined borders were either blending or invasive. The third variable, internal structure included three categories: radiolucent, radiopaque and mixed (radiolucent-radiopaque). A range of findings were also studied including root resorption, tooth displacement, cortical perforation, pathologic fracture, widening of periodental ligament (PDL), mandibular canal displacement due to mandibular lesions and maxillary sinus and nasal floor displacement owing to maxillary lesions.Having the findings assessed, already prepared checklists were filled for every individual case that encompassed clinical, radiographic and histopathologic sections. A third observer carried out the latter. If other clinically pertinent variables such as cortical expansion were necessary, the patients records were evaluated. Descriptive statistical analysis was finally carried out using SPSS software, Ver. 16.1 .In a population of 71 patients  with an average age of 36\u00b112.6 years (6-65), panoramic radiographs showed 31 cysts, 12 benign tumors and 18 tumor-like lesions. Odontogenic keratocyst (OKC) was observed to be the most common diagnosis among cysts, whereas ameloblastoma and giant cell granuloma [central (CGCG) and peripheral (PGCG)] were the most frequent findings in the benign tumor and tumor-like lesion category, respectively . With geAltogether, peri-apical tooth lesions were the most prevalent dental association. Impacted tooth coincided with dentigerous cysts, odontoma (one case) and ameloblastoma (two cases) . As to tBone expansion is normally invisible on panoramic radiographs owing to a technical default obstructing our view to the buccal and lingual plate. Therefore, we decided to investigate it clinically. It was found to be more commonly associated with benign tumors (58%) compared to cysts (51%) and tumor-like lesions (44%). Root resorption was associated with OKC and ameloblastoma in cysts and the benign tumor group, respectively. It was also linked with giant cell granuloma and a case of FLCOD in the tumor-like lesion group . There was also an association between tooth displacement and benign tumors. However, displacement of the sinus walls, nasal floor and mandibular canal was more common in cystic lesions . CorticaRadiographs are ordered when clinicians, bearing clinical evidence as well as past history of the patient in mind, intend to investigate their case at hand further, or to corroborate their clinical suspicion with regard to the list of differential diagnoses. Panoramic radiographies, in particular, are commonly used to assess dento-alveolar structures. This study investigated panoramic findings in 61 patients whose histopathological reports were beyond doubt or obscurity, indicative of cysts, benign tumors or tumor-like lesions, located either intraosseously or peripherally with bony impaction in the maxilla/mandible area.Cysts had a predilection for male gender while benign tumors were equally distributed. Hosseini Zarch  attestedThe predominant radiographic feature in cysts and benign tumors was unilocular lucency, as was confirmed by others , 6. The Despite its known shortcomings like every other diagnostic tool, panoramic radiography can contribute to the early detection of maxillary/mandibular lesions that, in turn enable the dentist to devise an appropriate treatment plan."}
+{"text": "Background: Luteal phase support is mandatory in assisted reproductive technologies (ART) for optimizing outcome, so the luteal phase is supported with either progesterone, addition of estradiol to progesterone, hCG or gonadotropin releasing hormone (GnRH) agonists. Supplementation of luteal phase with progesterone is prescribed for women undergoing routine IVF treatment.Objective: To compare oral dydrogestrone with vaginal progesterone for luteal-phase support in IVF.Materials and Methods: We performed this prospective, randomized trial in a tertiary infertility care unit in Taleghani Hospital, Tehran, Iran. In total 80 Women with a history of male factor infertility undergoing controlled ovarian stimulation for IVF treatment (fresh cycle) randomly were divided in two groups . The inclusion criteria were the use of GnRH analogue down-regulation and age less than 40 years old with regular menstrual cycles. All women were euthyroid and normoprolactinemic. Group A (n=40) received 10 mg dydrogesterone QID (40mg daily) and group B (n=40) received 400 mg suppository vaginal progesterone (cyclogest) twice per day (800 mg daily).Results: Clinical pregnancy rate in cyclogest group was higher than dydrogesterone group but the difference was not significant (p=0.52), furthermore the miscarriage rate in two group was the same .The difference between two groups regarding antral follicle, embryo number, luteal-phase duration, endometrial thickness, oocyte number and metaphase-II was not significant (p>0.05).Conclusion: The results showed that oral dydrogesterone is as effective as vaginal progesterone for luteal-phase support in women undergoing IVF. It is well established that luteal function is compromised in in vitro fertilization (IVF) cycles and studies on cases undergoing IVF demonstrated that there was a significant reduction in pregnancy rates without luteal-phase support (LPS) -3. In thIn assisted reproductive technologies (ART), luteal phase progesterone supplementation is common practice and several reports concurred that luteal support improves IVF outcome -9. ParenThese changes in formulation make dydrogesterone more stable and effective orally and it is proved that dydrogesterone has excellent patient compliance, low local adverse effects and ongoing pregnancy rate of 31% after IVF . Oral adDydrogesterone has a good safety and tolerability profile. It is structurally and pharmacologically similar to natural progesterone, has good oral bioavailability and few side effects. Dydrogesterone has no androgenic effects on the fetus, and does not inhibit the formation of progesterone in the placenta. The medication seemed to have no side effects on the mother. Only Pelinescu-Onciul\u2019s reported drowsiness. Gelle and Schaeffer reported nausea and vomiting, but in only one patient, and Chang, reported nausea and vomiting in two patients. However, nausea and vomiting may be due to early pregnancy itself rather than the medication . Dydrogesterone seemed to be associated with a higher birth weight, higher 1-min Apgar scores, and a lower incidence of growth retardation. However, these differences were not significant. There seemed to be very few birth defects. Many papers specifically reported no congenital anomalies . Other ret al indicated that the pregnancy rate is significantly higher with dydrogesterone than with micronized vaginal progesterone and placebo  were included in this study. The inclusion criteria were the use of GnRH analogue down-regulation and age less than 40 years old with regular menstrual cycles. All women were euthyroid and normoprolactinemic. Women with tubal factor, idiopathic infertility, endometriosis-related infertility, and ovulatory disturbances, moreover, women with baseline FSH >12 IU and adenomyosis, polysyctic ovary, endometriosis, myoma and chronic hepatorenal disease were excluded. All women received a daily subcutaneous (SC) injection of 500 \u03bcg GnRH agonist, , followed by recombinant FSH, 150-300 IU  or FSH highly purified .Ovarian follicular development was monitored by transvaginal ultrasonography, and 10000 IU human chorionic gonadotrophin  was administered IM when at least two or more leading follicles reached 18 mm in diameter. Oocytes were retrieved transvaginally under ultrasound guidance 34-36 hours after hCG injection. After egg collection ICSI process was performed. An average of three embryos was transferred 48 to 72 hours after insemination. Luteal-phase support began on the day of oocyte retrieval.Patients randomly were divided in two groups . for randomization; numbered sealed envelopes were prepared and provided by the study coordinator, according to random-number tables. Group A (n=40) received 10 mg dydrogesterone QID  and group B (n=40) received 400 mg vaginal progesterone twice per day . The serum \u03b2-hCG level was measured 12 days after ET. th week of pregnancy. The presence of at least one viable fetus at 12 weeks\u2019 gestation was classified as ongoing pregnancy.Luteal-phase support was continued up to 12 weeks of pregnancy. Outcome in the two groups was evaluated in terms of clinical pregnancy and miscarriage rates. Clinical pregnancy was defined when an ultrasound scan, performed 6 weeks after ET, revealed the presence of a viable fetus. Miscarriage is the loss of a fetus before the 20Statistical analysis2) or Fisher\u2019s exact test to compare categorical variables and the Student\u2019s t-test, to compare continuous variables in two groups. (p\u22640.05 is significant)Data were analyzed using SPSS version 20. Categorical data are presented as numbers (%), and continuous data as mean\u00b1SD. We used the Chai square (XThere were 82 patients who met the inclusion criteria and were randomly assigned to two groups. Some patients withdrew consent from the study (flowchart of patient participation), therefore for analysis; there were 40 patients in each group who continued participation. No differences between the groups were found in terms of mean age, body mass index and FSH level. This demographic data, including mean age, BMI, and FSH of women in two groups are summarized in Meanwhile, antral follicle, embryo number, lutheal-phase duration, endometrial thickness on the ET day, oocyte number and metaphase-II was similar between two groups . The difHormonal support of the luteal phase in assisted reproductive technologies (ART) has historically been an important issue among the researchers , 18. Recet al compared the clinical practice for luteal-phase supplementation (LPS) in stimulated IVF cycles in 35 countries, representing a total of 51,155 IVF cycles/year. Vaginal progesterone alone was used for LPS in 64% of cycles and in another 16% of cycles in combination with either i.m. (15%) or oral progesterone (1%). As a single agent, i.m. progesterone was used in 13% of cycles, oral progesterone in another 2% and human chorionic gonadotrophin (HCG) was still used in 5% of cycles  for LPS in stimulated IVF cycles in 80 women. Regarding demographic data such as age, BMI and FSH on day 3, two groups were properly matched and the difference between them was not significant (p>0.05). Our results showed the clinical pregnancy rate in cyclogest group was higher than dydrogestrone group (32.5% vs. 25%) but the difference was not significant (p=0.52), furthermore the miscarriage rate in two group was the same.et al indicated no significant differences in pregnancy rates, miscarriage rates, or viable delivery rates between women receiving oral dydrogestrone and vaginal micronized progesterone . Moreover, Ganesh  avoided . The maiIn general we confirmed the results of previous reports and showed that oral dydrogestrone is as effective as vaginal progesterone for luteal-phase support in woman undergoing IVF."}
+{"text": "Both cations are protonated at their pyridine N atoms and their geometries reveal amine\u2013imine tautomerism. In the 4-methyl\u00adbenzene\u00adsulfonate anions, the carboxyl\u00adate groups are twisted out of the benzene ring planes by 88.4\u2005(1) and 86.2\u2005(2)\u00b0. In the crystal, the sulfonate O atoms of an anion inter\u00adact with the protonated N atoms and the 2-amino groups of a cation via a pair of N\u2014H\u22efO hydrogen bonds, forming an R22(8) ring motif. These motifs are connected via N\u2014H\u22efO hydrogen bonds, forming chains running along the a-axis direction. Within the chains there are weak C\u2014H\u22efO hydrogen bonds present. In addition, aromatic \u03c0\u2013\u03c0 stacking inter\u00adactions  involving neighbouring chains are also observed.In the asymmetric unit of the title salt, C \u00c5b = 13.6212 (5) \u00c5c = 13.9887 (5) \u00c5\u03b1 = 106.307 (2)\u00b0\u03b2 = 97.946 (1)\u00b0\u03b3 = 92.103 (2)\u00b0V = 1360.31 (8) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.24 mmT = 293 K0.35 \u00d7 0.25 \u00d7 0.20 mmBruker Kappa APEXII CCD diffractometerSADABS; Sheldrick, 2004Tmin = 0.920, Tmax = 0.953Absorption correction: multi-scan (32534 measured reflections6237 independent reflectionsI > 2\u03c3(I)4709 reflections with Rint = 0.026R[F2 > 2\u03c3(F2)] = 0.040wR(F2) = 0.119S = 1.066237 reflections372 parameters6 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.33 e \u00c5\u22123\u0394\u03c1min = \u22120.37 e \u00c5\u22123\u0394\u03c1APEX2  global, I. DOI: 10.1107/S1600536814008587/su2726Isup2.hklStructure factors: contains datablock(s) I. DOI: Click here for additional data file.10.1107/S1600536814008587/su2726Isup3.cmlSupporting information file. DOI: 997539CCDC reference:  crystallographic information; 3D view; checkCIF reportAdditional supporting information:"}
+{"text": "Salmonella typhi to co-trimoxazole makes it a promising oral treatment for UFIs in general. We present a protocol of a randomized controlled trial of azithromycin versus co-trimoxazole for the treatment of UFI.Undifferentiated febrile illness (UFI) includes typhoid and typhus fevers and generally designates fever without any localizing signs. UFI is a great therapeutic challenge in countries like Nepal because of the lack of available point-of-care, rapid diagnostic tests. Often patients are empirically treated as presumed enteric fever. Due to the development of high-level resistance to traditionally used fluoroquinolones against enteric fever, azithromycin is now commonly used to treat enteric fever/UFI. The re-emergence of susceptibility of This is a parallel-group, double-blind, 1:1, randomized controlled trial of co-trimoxazole versus azithromycin for the treatment of UFI in Nepal. Participants will be patients aged 2 to 65\u00a0years, presenting with fever without clear focus for at least 4\u00a0days, complying with other study criteria and willing to provide written informed consent. Patients will be randomized either to azithromycin 20\u00a0mg/kg/day (maximum 1000\u00a0mg/day) in a single daily dose and an identical placebo or co-trimoxazole 60\u00a0mg/kg/day (maximum 3000\u00a0mg/day) in two divided doses for 7\u00a0days. Patients will be followed up with twice-daily telephone calls for 7\u00a0days or for at least 48\u00a0h after they become afebrile, whichever is later; by home visits on days 2 and 4 of treatment; and by hospital visits on days 7, 14, 28 and 63. The endpoints will be fever clearance time, treatment failure, time to treatment failure, and adverse events. The estimated sample size is 330. The primary analysis population will be all the randomized population and subanalysis will be repeated on patients with blood culture-confirmed enteric fever and culture-negative patients.Both azithromycin and co-trimoxazole are available in Nepal and are extensively used in the treatment of UFI. Therefore, it is important to know the better orally administered antimicrobial to treat enteric fever and other UFIs especially against the background of fluoroquinolone-resistant enteric fever.NCT02773407. Registered on 5 May 2016.ClinicalTrials.gov, ID: The online version of this article (doi:10.1186/s13063-017-2199-6) contains supplementary material, which is available to authorized users. The difficulty in determining the etiology of undifferentiated febrile illness (UFI), which designates fever without localizing signs, and the emergence of resistance to commonly used antimicrobials means that the appropriate management of UFIs is an ongoing clinical challenge. The non-specific clinical presentation of many infections that cause UFI makes it difficult to distinguish one cause from another based on clinical history, physical examination and basic initial laboratory investigations alone .Salmonella typhi or Salmonella paratyphi [n\u2009=\u200921/125) of patients [UFIs in industrialized countries are often attributed to a viral syndrome but in the developing world UFI may be commonly caused by enteric fever, rickettsial illness, malaria, dengue, chikungunya, etc. depending upon local epidemiology. The common causes of UFI in Kathmandu, Nepal includes enteric (typhoid and paratyphoid) fever and murine and scrub typhus , 3. The aratyphi . A studyThere is no reliable point-of-care diagnostic test to determine rickettsial infections, self-remitting viral infections and many other febrile illnesses. Blood culture which is the \u201cgold standard\u201d test to determine enteric fever takes from 3 to 7\u00a0days. Therefore, treatment has to be guided by the clinical characteristics of the syndrome that the patient presents with and knowledge of local epidemiology of these common diseases. We have observed that most patients with UFI in Nepal are empirically treated as presumed enteric fever (in a high-incidence area) or as fever without a focus requiring antimicrobials (in a relatively low-incidence area). Our working definition for UFI is fever of\u2009\u2265\u200938.0\u00a0\u00b0C for at least 4\u00a0days\u2019 duration with no clear-cut focus of infection such as productive cough, diarrhea, urinary symptoms, or any signs of neck stiffness or localized abscess. We exclude the patients with a fever duration of less than 4\u00a0days and a recorded temperature\u2009<\u200938\u00a0\u00b0C in an attempt to exclude the majority of patients with probable self-remitting viral infection. An appropriate antimicrobial, in addition to the supportive treatment, needs to be administered empirically to these patients in a setting where a large proportion of these UFIs is known to be caused by bacterial and rickettsial illnesses. Orally administered azithromycin is commonly used to treat UFI in Nepal and remains effective against enteric fever \u20137.S. typhi population [S. typhi in Nepal [Fluoroquinolones cannot now be used to treat enteric fever in Nepal and South Asia as high levels of resistance have emerged against them within the pulation \u201310. Thisin Nepal . This hiin Nepal . These din Nepal  recent rS. typhi and S. paratyphi A isolates from Nepal are now susceptible to this drug [S. typhi and S. paratyphi A [Co-trimoxazole has been commonly used in the past for the treatment of enteric fever , 15. Howhis drug , 16\u201318. his drug  and demoatyphi A , 20.Both azithromycin and co-trimoxazole are available in Nepal and are extensively used in the treatment of UFI. Therefore, it is important to know the better oral option to treat enteric fever and other febrile illnesses. This would also aid in securing an alternative oral treatment in case resistance to azithromycin emerges.S. typhi and S. paratyphi; scrub and murine typhus) than co-trimoxazole and will, therefore, be associated with more rapid fever clearance times (FCTs) and less treatment failure.We hypothesize that azithromycin has a wider spectrum of activity against the major causes of UFI in Nepal , Lalitpur, Nepal. Patan Hospital is a tertiary-care center located in urban Lalitpur, with a large number of patients visiting the hospital for clinical care from both rural and urban areas of Kathmandu Valley and also a large number of patients referred from different parts of Nepal.Participants will be the patients presenting with febrile illness to the emergency room and outpatient clinics of Patan Hospital and they will be recruited from the Fever Study Clinic at the hospital. The flow chart below illustrates the study plan for recruitment, intervention, outcome and follow-ups see Fig.\u00a0.Fig. 1DeFever of\u2009\u2265\u200938.0\u00a0\u00b0C and for at least 4\u00a0days without a clear-cut focus of infection Older than 2\u00a0years and below 65\u00a0years of ageAble to take tablets orallyResiding in Kathmandu ValleyAble to attend follow-up visitsCan be contacted by telephone/mobile phone 24\u00a0h a dayWritten informed consent to participate in the study including assent for minors in addition to parental consentFever for more than 14\u00a0daysPregnancyObtundationShockVisible jaundicePresence of signs of gastrointestinal bleedingHistory of hypersensitivity to either of the trial drugsPatient requiring intravenously administered antimicrobials or hospital admission for any reason as decided by the study physician and the attending physicianThe study physician considers either of the trial drugs to be contraindicated for any reason Any patient fulfilling the inclusion criteria but already taking antimicrobials and responding clinically to the treatment as judged by the study physicianGroup A: azithromycin tablets 20\u00a0mg/kg/day as a single daily dose for 7\u00a0days (maximum dose 1000\u00a0mg/day)Group B: co-trimoxazole tablets (trimethoprim 10\u00a0mg/kg\u2009+\u2009sulfamethoxazole 50\u00a0mg/kg) in two divided doses everyday for 7\u00a0days (maximum 3000\u00a0mg/day)Patient will be randomized to one of the two treatment groups:The drug doses will be adjusted according to the weight of individual patients. An additional Excel sheet illustrates this in more detail -dependent protein synthesis by binding to the receptor at the bacterial 50S ribosomal subunit . AzithroCo-trimoxazole is a combination of two antimicrobial agents, trimethoprim and sulfamethoxazole, in the ratio 1:5.Sulfamethoxazole is a sulfonamide, a structural analogue of para-aminobenzoic acid (PABA). It competes with PABA to bind to dihydropteroate synthetase and inhibit the conversion of PABA and dihydropteroate diphosphate to dihydrofolic acid, or dihydrofolate. This action inhibits the production of dihydrofolate intermediates and interferes with the normal bacterial synthesis of folic acid (folate) and deoxyribonucleic acid (DNA) synthesis .Trimethoprim is a 2, 4-diamino-5- pyrimidine. It has powerful inhibition activity on bacterial dihydrofolate reductase, which is the enzymatic step after the step in folic acid synthesis that is blocked by sulfonamides . It thusCo-trimoxazole is available as oral tablets, oral capsules and an oral suspension in different strengths combining trimethoprim and sulfamethoxazole in the ratio 1:5.The following medications should be avoided for patients in each treatment group:Aluminum and magnesium antacids delay absorption and reduce the peak serum concentration and should be avoided with azithromycinAngiotensin-converting enzyme (ACE) inhibitors and angiotensin-receptor blockers have an additive hyperkalemic effect when used with co-trimoxazoleThe hypoglycemic action of sulfonylureas and thiazolidinediones is enhanced when concomitantly used with co-trimoxazoleCo-trimoxazole interacts with warfarin through the CYP450 and CYP2C9 systems, increasing the risk of bleedingConcomitant administration of co-trimoxazole and methotrexate results in decreased renal clearance of free methotrexate and may result in severe pancytopeniaActive levels of phenytoin may be increased markedly by co-trimoxazole, especially in older patientsConcomitant use may increase the serum level of other drugs like rifampicin, dapsone, amiodarone, digitalis, amantadine, pyrimethamine, cyclosporine, fluoxetine, montelucast, zafirlukast, paclitaxelFever clearance time (FCT): this will be the time from the first dose of a study drug until a temperature of\u2009\u2264\u200937\u2009\u00b7\u20095\u00a0\u00b0C has been achieved for at least 48\u00a0h.Fever failure, defined by FCT above 7\u00a0days (168\u00a0h) post treatment initiationRequirement for rescue treatment as judged by the study physician and the attending physicianS. typhi or an S. paratyphi on day 7 of treatment regardless of fever Blood-culture-0positive for Culture-confirmed or syndromic enteric fever relapse within 28\u00a0days of initiation of treatmentThe development of any complication  or need for hospital admission within 28\u00a0days after the initiation of treatmentTreatment failure, defined as the occurrence of at least one of the following eventsTime to treatment failure, defined as the time from the first dose of treatment until the date of the earliest failure eventAdverse events S. typhi and S. paratyphi at the time of enrollment will be treated with injected ceftriaxone 60\u00a0mg/kg once daily (maximum dose 2\u00a0g/day) for 7\u00a0days and culture-negative individuals will be treated with injected ceftriaxone 60\u00a0mg/kg once daily (maximum dose 2\u00a0g/day) and doxycycline tablet 4\u00a0mg/kg/day in two divided doses (maximum 200\u00a0mg/day) for 7\u00a0days.Patients who meet the criteria for treatment failure as defined above will be administered rescue treatment. Rescue treatment will be as follows: treatment failures with a positive blood culture for Patients who develop adverse events  will stop receiving the study drug and be given rescue treatment as above.S. typhi or S. paratyphi the choice of the rescue treatment will be determined after full clinical assessment and consideration of the laboratory results by the study physician in consultation with the attending physician.If treatment failure occurs in patients who are found to be infected with organisms other than Patients requiring hospital admission for any reason, as decided by the study physician and the attending physician, will be admitted to the hospital and treated as per standard clinical care. They will remain in the study with all outcomes recorded. Patients will be treated according to standard clinical care for all adverse events and upon completion of the study as required.Patients aged 2\u00a0years and older and under 65\u00a0years who present at the emergency room and outpatient clinics of Patan Hospital, who have a temperature of\u2009\u2265\u200938.0\u00a0\u00b0C and a documented or self-reported history of fever for at least\u00a04\u00a0days and less than 14\u00a0days, without a focus of infection , will be identified by clinicians in the hospital and will be referred to the study clinic. At the study clinic, the study physician will screen the patients by study criteria for enrollment into the study.The study physician will obtain written informed consent from all the study participants aged over 18\u00a0years of age before enrollment in the study. For patients aged 12 to 18\u00a0years of age, written informed consent will be obtained from a legal guardian in addition to an assent from the participant. Written informed consent will be obtained from legal guardians for patients under 12\u00a0years of age. In case of legal guardians/patients who cannot read, an impartial witness, who is not a part of the research team , will sign to confirm that the Informed Consent Form was accurately read to the patient and that the patient agreed to participate. The study physician will also approach participants/legal guardians for an additional consent for storage of blood and urine samples for future studies. All study participants will receive a copy of the signed Informed Consent Form.After signing an informed consent, patient will be assigned a study number (this is the same as the randomization number) and will be enrolled into the study. The study staff will ensure that the participants\u2019 anonymity is maintained. Participants will be identified only by their initials and a study number. All documents will be stored securely and will be accessible to trial staff and authorized personnel only.Patients who do not meet the inclusion/exclusion criteria for the study will be informed that they cannot participate in the trial and will be treated according to the standard protocol of clinical care including antimicrobial therapy. Details of all patients who are approached for participation in the trial will be noted in the \u201cScreening Case Report Form (CRF).\u201dFull history and clinical examination including documentation of clinical manifestations according to a standard proformaComplete blood count (CBC): hematocrit, total white cell count, differential count, platelet count (blood volume 1\u00a0ml)Biochemistry: blood glucose, creatinine, serum glutamine oxaloacetate transaminase (SGOT), serum glutamine pyruvate transaminase (SGPT) (blood volume 1\u00a0ml)Urine for routine examination and storageBlood culture: blood volume 5\u20138\u00a0ml for patients aged at least 14\u00a0years of age and 3\u00a0ml for patients below 14\u00a0years of ageEDTA-preserved blood will be separated into plasma and a cell pellet and stored for future testing (3\u00a0ml)Stool culture: collect in readymade tubes with Cary Blair mediumAfter signing the informed consent, but prior to enrollment, patients will undergo:The causes of fever will be investigated in all patients according to routine clinical practice norms. Patients will be screened by other investigations for any specific diseases prior to enrollment in case of strong clinical suspicion during history taking and clinical examination; for example, a chest X-ray for patients with cough and/or pleuritic chest pain to rule out lower respiratory tract infections, urine routine examination for urinary symptoms, CBC to screen for leukocytosis if any symptom are suggestive of a specific focus of infection, etc.For each enrolled patient, study duration will be from day 0 (day of enrollment) until day 63 . The schedule for intervention and assessment during the study period is illustrated in a Standard Protocol Items: Recommendation for Interventional Trials (SPIRIT) Figure, see Fig.\u00a0Patients will be contacted by telephone calls twice daily by study nurses between 06:30 and 07:30 and 18:30 and 19:30 to record drug doses and administration times, oral temperatures and time of temperature readings, symptoms and potential adverse effects.Each patient will be given a digital thermometer and the \u201cPatient Copy of Temperature and Medication Record\u201d page of the CRF and will be asked to record their oral temperature and amount of paracetamol intake at 06:00 and 18:00 and during any febrile episode between each day; and indicate study-drug intake with a tick mark. \u201cHospital Copy of Temperature and Medication Record\u201d will be verified with the \u201cPatient Copy of Temperature and Medication Record\u201d when patients follow-up on day 7. A symptom checklist will also be completed daily and recorded to assess complications or adverse events.Patient will be followed up by home visits by community medical auxiliaries (CMAs) on day 2 and day 4 to monitor patients\u2019 vital signs, keep track of patients in case they are lost to follow-up and maintain patient rapport.S. typhi or S. paratyphi A at the day of enrollmentBlood will be collected in a 10-ml syringe for CBC, random blood glucose (RBG), SGPT, SGOT, creatinine, culture and plasma storage for patients whose blood culture is positive for Blood will be collected in a 5-ml syringe for CBC, RBG, GPT, GOT, creatinine and plasma storage for patients who are blood-culture-negative on the day of enrollment. If culture-negative patients have not cleared their fever on day 7, a blood culture will also be performedS. typhi or S. paratyphi A on the day of enrollmentStool culture (collected in readymade tubes with Cary Blair medium) for patients whose blood is culture-positive for Patients will be examined by the study physician at study clinic. The following tests will be performed:For the patients who are febrile on days 6/7, daily telephone calls and a record of oral temperature and symptoms will be continued in the same manner.Blood will be collected in a 3-ml syringe for plasma storageS. typhi or S. paratyphi A on the day of enrollmentStool culture (collected in readymade tubes with Cary Blair medium) for patients whose blood culture is positive for Patients will be reexamined by the study physician at the study clinic. The following tests will be performed:S. typhi or S. paratyhi. These tests will be conducted in the future to determine the causes of UFI and will not influence present clinical care. It will be explained to patients that if any additional tests performed on their blood samples are positive, they will be informed once the results are available.Further diagnostic tests for UFI, including enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR), will be performed on archived paired samples of blood collected on days 1 and 28\u2009\u00b1\u20093\u00a0days for scrub typhus, murine typhus, spotted fever group rickettsioses, Q fever, leptospirosis, hantavirus infection, brucellosis and dengue on patients whose initial blood culture shows no growth for If a patient or patient representative, who has given consent on their behalf, opts to discontinue the trial treatment for any reason, they are encouraged to follow the study procedures and attend follow-ups as far as possible instead of completely withdrawing from the trial. If they do not wish to remain on trial follow-up, however, their decision will be respected and the patients will be completely withdrawn from the trial. The reason for the patient withdrawing should be ascertained wherever possible. Prior to withdrawing from the trial, the patient will be invited to have assessments performed as appropriate for the final visit although they would be at liberty to refuse any or all individual components of the assessment.In addition, the investigator may decide to stop the study intervention if they feel that it is not in the best interest of the patient. Patients will be followed as per protocol.The target sample size for this trial is 330 participants (165 per study group). This sample size is based on the sample size justification for 300 patients with an additional allowance of 10% to account for potential loss to follow-up and other deviations from the protocol assumptions.n\u2009=\u2009300 (150 per treatment group) are reported below . Un-blinding will take place in the presence of the pharmacist and the attending physician. Un-blinding will be documented in the CRF.Patient data will be recorded on paper CRFs, and entered on electronic CRFs later on a secure database via laptop computers, by study physicians and study nurses and transferred to the Data Management Team. Original paper study records will be kept for a minimum of 15\u00a0years in a secure location.The final trial dataset will be accessible to the trial team in the two collaborating institutions, OUCRU-Nepal at PAHS and OUCRU-Vietnam. All decisions on trial data use for analysis will be made by the PI. The data-entry team, which comprises study nurses and study physicians, will have access to the database forms. The IT team at OUCRU-Vietnam will have access to the database worksheets which they will provide to the DSMB statistician for interim analysis and to the study statistical analysis team for the end-of-study analysis. All electronic data will be kept safe and securely backed up for at least 15\u00a0years after the end of the study.The primary analysis population for all analyses is the full analysis population including all randomized subjects. Patients will be analyzed according to their randomized arm (intention-to-treat). In addition, the analyses will be repeated in the subsets of patients with blood-culture-confirmed enteric fever and in culture-negative patients.The primary endpoint, the interval-censored FCT, will be compared between the two groups based on a Weibull accelerated-failure-time model with the treatment arm as the only covariate. The distribution of the FCT over time in each treatment arm will be further visualized using the non-parametric maximum likelihood estimator (NPMLE).To summarize treatment failures, we will analyze both the time to treatment failure and the absolute risk of treatment failure until day 28. The former will be displayed with Kaplan-Meier curves and compared between the two groups with a Cox regression model with treatment as the only covariate. The Kaplan-Meier estimate on day 28 will be used as the estimate of the absolute risk of treatment failure and the comparison will be based on standard errors according to Greenwood\u2019s formula.S. typhi or S. paratyphi A).Predefined subgroup analyses for both FCT and the time to treatment failure are by culture result (blood culture-positive or -negative), age (below 14\u00a0years or 14\u00a0years and older) and by pathogen in culture-confirmed patients . We are not using professional writers.An independent Data and Safety Monitoring Board will be set up which will consist of qualified volunteers with the necessary knowledge of clinical trials. The DSMB will review and approve a monitoring plan before the study commences. This will include how often the DSMB should receive summary reports. All data reviewed by the DSMB will be in the strictest confidence. A DSMB charter will outline its responsibilities and operational plan. The DSMB will be notified within 7\u00a0days of the PI being aware of the occurrence of a serious unexpected adverse event. An interim analysis to compare the primary outcomes in the two groups will be carried out once the data from the day-28 visit is available from the 100th and 200th patients and the report will be submitted to the DSMB.The PI will also submit an annual progress report (or when requested) to the relevant Research Ethic Committees , host organization and sponsor. In addition, an end-of-study notification and final report will be submitted to the same parties.Study procedures, including physical examination and phlebotomy, are standard clinical-care procedures and carry minimal risks. Phlebotomy may result in bruising, pain or infection at the site. The volume of blood drawn from children is below the WHO recommended limits for research in sick children .The investigators will retain custody of the data and samples that will be jointly protected by the collaborating institutions according to established procedures and security barriers. Any future use of stored samples carries risk of loss of privacy and possibly stigmatization. The appropriate ethical committees will evaluate these and other issues before any testing is performed.Treatments in both arms are commonly used in this setting with very few complications. Administration of the first dose of both will be in the hospital setting to reduce the risk associated with the possibility of allergic reaction.Common: diarrhea, nausea, abdominal painUncommon: palpitations, chest pain, jaundice, vomiting, dizziness, headache, vertigo, fatigue, inflammation and allergic reaction, decreased hearing, blurred vision, dark urineCommon: loss of appetite, nausea, vomiting, diarrhea, reversible exanthemas, headache, feverUncommon: severe allergic skin reactions , cholestatic jaundice, pancreatitis, colitis, nephritis, vasculitis, aseptic meningitis, neuropsychiatric symptomsSide effects will be monitored by telephone calls and the patients will be asked to attend to hospital when necessary.An adverse event (AE) is any untoward medical event that occurs to a study participant during the course of the study whether or not that event is considered related to the study drug. An AE can, therefore, be any unfavorable and unintended sign, a symptom, or disease  temporarily associated with the study drug, whether or not considered related to the study drug. Clinical or laboratory events are considered AEs only if they occur after the first dose of study treatment. Stable chronic conditions, such as arthritis, which are present prior to clinical trial entry and do not worsen are not considered AEs and will be documented in the subject\u2019s clinical chart as medical history.DeathLife-threatening event Inpatient hospitalization (new admissions) or prolongation of existing hospitalization Persistent or significant disability/incapacity Congenital anomaly/birth defectSerious adverse event (SAE) an AE is considered to be \u201cserious\u201d if it results in one of the following outcomes:Patients will be followed up until the resolution of such symptoms even after the study comes to an end.Any undiagnosed pregnancy during which treatment occurred will be followed until outcome. Any congenital abnormality or birth defect will be recorded as a SAE.Unexpected serious adverse events (USAEs) are untoward medical events which fit one or more of the criteria for SAEs above and which are not considered a part of normal clinical progression of disease or an expected reaction to standard treatment therapy. Any event that becomes of concern to the investigators or study physicians during the course of the trial may be reported as a USAE.All adverse events will be fully recorded in the \u201cAdverse events page\u201d in the CRF including duration, severity, outcome and relationship to the study drug. We will refer to the Common Terminology Criteria for Adverse Events (CTCAE V4). All adverse events will be noted in the study based on the Patient-reported Symptom Questionnaire and by probing questions based on the AE page of the CRF by the study physician on follow-up visits on days 7 and 14.The trial will undergo both internal and external auditing. Internal auditing will be performed on a day-to-day basis by study physicians, study nurses and the Clinical Trial Unit, who will check data details and any discrepancies will be met with follow-up maintenance and appropriateness of patient recruitment. External auditing will be carried out by the Clinical Trials Unit at our collaborating research unit, OUCRU-VN, twice a year with reassessment of all study documents and CRFs and a review of crucial trial events.There have been several published studies that used azithromycin or co-trimoxazole for the treatment of enteric fever, but there have been no head-to-head comparisons of the two drugs for UFI , 14, 15.Azithromycin is recommended for the treatment of the rickettsial fevers but its usefulness for UFI treatment in settings where rickettsial infections and enteric fever are common needs to be assessed . There hThere have been attempts to develop protocols for the initial investigations and management of UFIs in South Asia , but theThe findings of this study will be important for clinicians as it will help them choose the best empirical treatment for UFI and reduce the rates of treatment failures and the risk of complications, and thus directly reduce patient suffering. This will also avert the need of using multiple antimicrobials to treat a common presentation of illness in Nepal and South Asia and thus may prevent the overuse of antimicrobials especially in the treatment of UFI.This paper outlines the study protocol following the Standard Protocol Items: Recommendations for Interventional Trials (SPIRIT) guidelines for intervention trials  have been enrolled into the study.Additional file 1:Drug-dosing table. Calculation of drug dose according to the patients\u2019 weight in each arm. (XLSX 21\u00a0kb)Additional file 2:Simplified drug-dosing table. A simplified drug-dosing table derived from a drug-dosing table which explains the number of tablets required for each kilogram weight of the patient irrespective of the treatment arm. (XLSX 9\u00a0kb)Additional file 3:SPIRIT Checklist. A checklist according to Standard Protocol Items: Recommendations for Interventional Trials (SPIRIT) guidelines. (DOCX 52\u00a0kb)"}
+{"text": "The amount of released Cd into acidic sweat ranged from 16.4 to 1517 \u00b5g Cd per week, respectively 3.53\u2013253 \u00b5g/cm2/week. The limit of Cd for dermal exposure is not unequivocally determined in the countries of the EU (European Union) or in the U.S. Based on the US EPA  approach used to establish the reference dose (RfD) for Cd contained in food and information about the bioavailability of Cd after dermal exposure, we assessed our own value of dermal RfD. The value was compared with the theoretical amount of Cd, which can be absorbed into the organism from jewelry in contact with the skin. The calculation was based on the amount of Cd that was released into acidic and alkaline sweat. The highest amount of Cd was released into acidic sweat, which represents 0.1% of dermal RfD and into alkaline sweat, 0.5% of dermal RfD. These results indicate that the analyzed jewelry contains Cd over the limit for composition of jewelry available within the territory of the EU. The determined amount of Cd in analyzed jewelry does not, however, pose a threat in terms of non-carcinogenic toxic effects.The composition of the surface layer of 13 low-cost jewelry samples with a high Cd content was analyzed using an energy-dispersive X-ray fluorescence spectrometer (ED XRF). The analyzed jewels were obtained in cooperation with the Czech Environmental Inspectorate. The jewels were leached in two types of artificial sweat  for 7 days. Twenty microliters of the resulting solution was subsequently placed on a paper carrier and analyzed by an LIBS (Laser-Induced Breakdown Spectrometry) spectrometer after drying. The Cd content in the jewelry surface layer detected by using ED XRF ranged from 13.4% to 44.6% (weight per weight\u2014w/w). The samples were subsequently leached in artificial alkaline, and the acidic sweat and leachates were analyzed using laser-induced breakdown spectrometry (LIBS). The amount of released Cd into alkaline sweat ranged from 24.0 to 370 \u00b5g Cd per week, respectively 3.23\u201361.7 \u00b5g/cm Cadmium is a toxic metal that is easily accumulated in the human body. Even low exposure levels can cause accumulation in human tissues, especially in the kidneys . ChronicThe European Commission issued a document on the results of a risk evaluation and on risk reduction strategies for cadmium and cadmium oxide (2008/C 149/03) in 2008. The commission concluded that risk management measures were needed for the protection of consumers because of concerns for genotoxicity and carcinogenicity irrespective of the route of exposure, as the substance was considered a non-threshold carcinogen, arising from wearing (imported) jewelry. As of 2011, cadmium has been restricted in jewelry in EU/EEA (European Union/European Economic Area) countries by the REACH  regulation (No. 1907/2008), Annex XVII, entry 23(10). This restriction was implemented by Commission Regulation No. 494/2011 and limits the concentration of cadmium in the metal parts of jewelry and imitation jewelry articles and hair accessories to a maximum of 0.01% by weight. Jewelry and jewelry-like articles containing cadmium over the limit cannot be placed on the market in EU/EEA countries as of January 2012.The number of non-compliant jewelry articles on the market is deemed to be extremely high. The Czech Environmental Inspectorate tested, for example, 105 random pieces of jewelry placed on the market in the Czech Republic in 2015. Twenty-three articles contained cadmium levels over the limit. The average cadmium content of those non-compliant articles was 35% w/w (weight per weight). Non-compliant articles were found in 2016 as well, the maximum amount of cadmium found in an article was 91% w/w. It can be concluded that cadmium in jewelry is not present as an unwanted contaminant but is rather deliberately used during the production of jewelry articles. Cadmium is used in all probability in the production of such articles due to its favorable properties. It is easy to utilize, resistant to rust, and relatively cheap. Jewelry articles with cadmium are also abundant in other EU/EEA states. The database of the Rapid Exchange of Information System RAPEX (The Rapid Alert System for non-food dangerous products); EU alert system for unsafe consumer products) listed, for example, 157 notifications from member states regarding cadmium jewelry over the 2012\u20132016 period [Cd content is not only limited in jewelry, but also in other objects of human daily use, such as cosmetics,  articlesIn case of skin contact with objects containing Cd, the possibility of dermal exposure and the emergence of various types of irritation have been discussed. Assays for assessing the dermal toxicity of Cd have been described in several publications ,10,11. TTo determine the amount of released analyte from a solid sample, it is advisable to perform a leaching test. An artificial human sweat was used as a leaching agent for objects that may come into contact with the skin. A number of model solutions with defined content elements, organic compounds, pH, etc. were discussed. Artificial human sweat has been used to dissolve the chemical components of jewelry, textiles, cosmetics, pharmaceuticals, industrial chemicals, and others . Tests oNon-destructive methods such as X-ray fluorescence spectrometry (XRF) can be used for analysis of the surface composition of the jewelry . In ordeSamples of cheap Cd containing jewelry were obtained from the Czech Environmental Inspectorate. The subject of our interest was a total of 13 pieces of jewelry  originating from inspections of three e-shops trading in cheap Chinese goods. Illustrative photos of the analyzed jewelry are shown in The surface composition of the samples was analyzed using an Elva X energy-dispersive X-ray fluorescence spectrometer  equipped with a Pd X-ray tube and a thermoelectrically cooled Si-pin detector, PF 550 . The power supply of the X-ray tube was operated at 40 kV, and the current was set via the auto-optimization procedure taking into account the optimal loading of the detector in a range of 6000\u20136500 counts per second (cps). The spectra were integrated for 90 s. Each sample was analyzed at five measuring points evenly spaced on that part of the sample that was supposed to be in contact with the skin. Parts of the sample that usually do not come in direct long-term contact with the skin, such as the solder holding the stone, were omitted from the analysis. Concentrations of elements detected in the samples were calculated by the standard-less module based on the fundamental parameters method. l-histidine mono-chloride monohydrate (C6H9O2N3\u00b7HCl\u00b7H2O), 5 g of NaCl, and 2.2 g of NaH2PO4\u00b72H2O in 1 L of demineralized water. The pH value was adjusted by 0.1 moL\u00b7L\u22121 NaOH to 5.5. To prepare 1 L of alkaline sweat, 0.5 g of C6H9O2N3\u00b7HCl\u00b7H2O, 5 g of NaCl and 5 g of Na2HPO4\u00b712H2O was diluted in demineralized water. A solution of NaOH of a concentration of 0.1 moL\u00b7L\u22121 was added for a pH adjustment to 8. The volume of artificial sweat for the leaching of the particular jewelry piece was chosen based on the sample surface area, so that 1 mL of the reagent was used for each 1 cm2 of the surface. The sample parts, which were not supposed to come into direct contact with the skin , were not included into the calculated surface. These parts were covered by resistant adhesive tape during leaching to prevent the release of Cd. The leaching procedure lasted 7 days and was performed at 37 \u00b0C. The pieces of jewelry were then removed from the leachate, and 20 \u03bcL of the solution was spotted onto a circular piece of paper with a diameter of 17 mm and dried under an infrared lamp. The leaching of jewelry samples was performed with two types of artificial sweat\u2014acidic and alkaline . Acidic \u22121. Solutions of artificial sweat, spiked with Cd, were used as calibration standards. The precision and accuracy of the LIBS methods was validated comparing LIBS and ICP OES for a set of 5 samples of each sweat type. The mean concentration values measured by both methods were equal, although the LIBS results suffered from a higher standard deviation. The sample volume needed for the analysis was substantially lower, by contrast, in the case of LIBS, and this method also offered the possibility of the long-term storage of liquid samples deposited on the solid carrier.Leachate samples deposited on the paper carrier were analyzed using the commercially available compact LIBS spectrometer . The system consists of a dual pulse Q-switched Nd:YAG (Neodymium-doped Yttrium Aluminum Garnet) laser operating at 1064 nm. A nanosecond laser emitting two collinear pulses of 12 ns was operated at double-pulse mode with an inter-pulse delay of 7 \u03bcs. A laser beam with an energy of 110 mJ was focused on the sample surface, where the analytical point with a diameter of 200 \u03bcm was ablated. Each sample was analyzed at nine independent analytical points, while every point was ablated by one laser shot. Radiation emitted by arising plasma was led through the entrance slit of 25 \u03bcm into a Czerny-Turner monochromator and the spectral window in a range from 205 to 235 nm was recorded by a back-thinned and front-illuminated CCD (Charge-Coupled Device) camera (2048 \u00d7 14 pixels). Quantitative analysis of Cd was carried out on an analytical line of 214.441 nm. Separate calibration curves were constructed for acidic and alkaline sweat samples in a range from 0 to 40 mg\u00b7LThe analyzed jewelry samples revealed a truly variable surface composition. As can be seen in s, where \u03c3 is the standard deviation of intensity calculated from 36 repeated measurements of the lowest calibration standard (blank) performed under optimal conditions, and s is the slope of the calibration curve. The calculated LOD has a value of 0.08 mg\u00b7L\u22121 and 0.06 mg\u00b7L\u22121 for acidic and alkaline artificial sweat, respectively. The relative standard deviation  calculated for measuring data of jewelry leachates was in a range from 4.79% to 22.6%. After measuring calibration standards, the limit of detection (LOD) for both acid and alkaline artificial sweat solutions was determined. The LOD was determined according to definition 3\u03c3/r = 0.786, p = 0.04) or in acidic sweat  were quite high, but these results were strongly biased by the influential point of 1B. After exclusion of the influential 1B point, the correlation coefficients significantly decreased . The same relations were observed when the correlation coefficients were calculated for Cd content measured by ED XRF and for Cd released from one square centimeter of sample over one week (% Cd w/w vs. \u00b5g Cd/cm2/week). The correlation coefficients for alkaline  and acidic  sweat were also quite high and similar, but these results were also biased by the influential point of 1B. In this case, the sharp decline in the correlation coefficient was also observed after exclusion of the influential 1B point . It is apparent that the available set of samples is too small in number to be able to clearly describe the relationship between the surface composition of the sample and the amount of leached cadmium. Streicher porte et al. in their work from 2008 analyzed 21 samples of low cost jewelry containing 1.4\u201343.9% of Cd on the surface layer. Migration of the toxic metals was tested after sample submersion in 0.07 M HCl (Hydrochloric acid-simulation of gastric acid) for 7 days at 30 \u00b0C [2/week was low (r = 0.49), which is in agreement with our results, if we evaluate the correlation after exclusion of the influential points. One piece of each pair of earrings  was leached in acidic and one piece in alkaline artificial sweat. Data presented in The obtained sample set contained 3 pairs of earrings. One earring out of the pair was leached in acidic and the other in alkaline artificial sweat. When comparing the results from leachate extracts for pairs of earrings, alkaline artificial sweat provided higher results for dissolved Cd. This is surprising because it is generally assumed that metals are better dissolved in an acidic environment. 1/2) of 19 years, an exposure duration of 50 years, and an absorption of 4.5% of Cd contained in the food. US EPA postulated only 2.5% absorption of Cd from the food and consequently established the NOAEL (No-Observed-Adverse-Effect Level) value of 0.01 mg of Cd/kg/day. RfD of 0.001 Cd/kg/day was then obtained dividing NOAEL by the uncertainty factor (UF) of 10. The US EPA document shared at the IRIS (Integrated Risk Information System) database unfortunately does not provide any further information regarding the used toxicokinetic model. When the one-compartment standard first-order elimination model with bolus administration described by Amzal et al. [1/2 of 18.3 years. A reference dose (RfD) is the regulatory limit established by the United States Environmental Protection Agency (US EPA) representing the maximum oral dose of a toxic substance, below which no adverse non-carcinogenic health effects should result from a lifetime of exposure. According to the Integrated Risk Information System , the call et al.  was usedThe EPA did not establish a limit of a similar meaning as the RfD for dermal exposure. To be able to assess the health risk of Cd released from low-cost jewelry, we performed our own approximation of dermal RfD based on the same toxicokinetic model. The parameters mentioned above were used except for the absorption index, which was set to 0.6%. The calculated value of NOAEL for dermal exposure was 0.042 mg/kg/day. The resulting dermal RfD in this case was also obtained dividing NOAEL by the uncertainty factor UF = 10 with a value of 0.004 mg/kg/day. The dermal RfD estimated in such a way represents a kind of worst-case scenario, in as much as the Cd absorption into the plasma could be lower than the absorption into the renal cortex with published data for absorption into the plasma varying between 0.1% and 0.6% . The total amounts of Cd in \u00b5g released from a particular piece of jewelry  into acidic or alkaline artificial sweats over one week of leaching are summarized in A composition of a surface layer of 13 low cost jewelry samples with a high content of Cd was analyzed by ED XRF. These samples were subsequently leached in artificial acidic and alkaline sweat, and the resulting digests were applied onto solid carriers and analyzed by LIBS. The content of Cd in the jewelry surface layer ranged from 13.40% to 44.64% (w/w) with the measured values significantly exceeding permissible limits in the EU or U.S. The results of the analysis suggest that this jewelry should not be available in the countries of the EU. The analysis of the leachates indicates that acidic artificial sweat released an amount of Cd roughly 5-fold higher than that of artificial alkaline sweat. The relationship between the surface composition of the samples and the amount of Cd released into artificial sweat was not clearly demonstrated. The low bioavailability of Cd for dermal exposure, along with the small amounts of Cd released from the surface layer of the jewelry, leads to the conclusion that even the long-term use of these jewels does not constitute major health risks in terms of the biological and toxic effect of Cd. The maximum amount of released Cd from the analyzed jewelry makes up about 0.5% of a safe dose."}
+{"text": "Scientific Reports6: Article number: 3482410.1038/srep34824; published online: 10062016; updated: 12092016The Acknowledgments section in this Article is incomplete:\u201cWe are grateful to Gerrit Ansmann and Christian Geier for interesting discussions and for critical comments on earlier versions of the manuscript and by the Verein zur Foerderung der Epilepsieforschung e.V. (Bonn)\u201d.should read:\u201cWe are grateful to Gerrit Ansmann and Christian Geier for interesting discussions and for critical comments on earlier versions of the manuscript. This study was supported by the Deutsche Forschungsgemeinschaft DFG (Grant No.: LE 660/5-2) and by the Verein zur Foerderung der Epilepsieforschung e.V. (Bonn)\u201d."}
+{"text": "In this prospective 5-year follow up of patients with RA, we analysed several biomarkers, known to be associated with atherosclerosis and/or inflammation in the general population. The aim of this study was to find out whether the RA-disease Patients from northern Sweden diagnosed with early RA, are consecutively recruited into an ongoing prospective study on CVD comorbidity. A subgroup of patients, aged \u226460 years (n = 71) was included for ultrasound measurements of IMT at inclusion (T0) and after 5 years (T5) together with age-sex-matched controls (n = 40). The patients were clinically assessed. Blood was analysed for lipids, ESR and CRP and several biomarkers known to be associated with atherosclerosis in the general population.At T0, the patients with RA had significantly lower levels of MIF and significantly higher levels of interleukin (IL)-18 and MIC-1 compared with controls. At T5, the patients with RA had significantly higher levels of pentraxin3, MIC-1, TNF-R2, ICAM-1, VCAM-1 and endostatin compared with controls. At T0 the levels of MPO correlated with DAS28, sCD40L with CRP and IL-18 with systolic blood pressure and Reynolds risk score. Using PLSR on a CVD-panel analysed with multiplex immunoassay, the patients with RA could be correctly classified into those who had a worsening in their IMT over the five years or not. Here, MMP3 was identified as influential.This study indicates that the RA disease itself could affect several of the biomarkers in this study, and possibly also the processes involved in the development of atherosclerosis. Atherlarities , albeit larities , 8.Sub-clinical atherosclerosis precedes CVD and an increased intima media thickness (IMT), measured by ultrasonography, is regarded to be an early indicator of a generalized atherosclerosis , 10. We,per se affects biomarkers known to be associated with atherosclerosis in the general population. Further, to find out whether these biomarkers are associated with the progression of subclinical atherosclerosis among patients with early RA.In an inception cohort of patients with RA, we analysed several biomarkers, known to be associated with atherosclerosis and/or inflammation in the general population, and also known to be associated with subclinical atherosclerosis and traditional CVD risk factors. The aim of this study was to find out whether the RA-disease i.e., fulfilling the ACR criteria) [As described in detail previously \u201317 this riteria)  and beinriteria) . The DMAi.e. C-reactive protein (CRP). When calculating the Reynolds Risk Score, all patients were regarded as being non-diabetic due to a lack of information regarding haemoglobin A1c concentrations.All patients were examined clinically at their inclusion into the study and regularly thereafter for disease activity according to DAS28 . The exai.e., at T0 and T5, and serum was stored at -80\u00b0C. After thawing, serum concentrations were measured using commercial sandwich enzyme- linked immunosorbent assays (ELISAs) of pentraxin 3 (ptx3) , interleukin (IL)-18  and macrophage inhibitory cytokine 1 (MIC-1) . Serum concentrations of IL-6, monocyte migration inhibitory factor (MIF), myelopreoxidas (MPO) and soluble CD40 ligand (sCD40L) were measured using multiplexed Procarta immunoassays based on the Luminex technology (Affymetrix Inc). Serum concentrations of tumour necrosis factor receptor 1 and 2 (TNF-R1 and TNF-R2), endoglin, intercellular adhesion molecule 1 (ICAM-1), vascular adhesion molecule 1 (VCAM-1) and endostatin were analysed using commercial ELISAs . As a pilot study 19 patients with RA and 10 matched controls, a multiplex immunoassay was used for analysing 92 biomarkers potentially associated with cardiovascular disease . Rheumatoid factor (RF), soluble C-reactive protein  and ESR (mm/h) were measured at baseline according to routine methods. Blood was also drawn after an overnight fast for measurement of blood lipids, i.e., cholesterol (mmol/L), high-density lipoproteins  and triglycerides (mmol/L), using routine methods at each of the participating hospitals.As described in detail previously \u201317 all pThe patients with RA were included as soon as possible following a diagnosis of RA (T0), and were examined by ultrasound at mean (SD) of 16.2 (\u00b16.6) months after the primary symptom of RA. The ultrasound examinations at the follow up (T5) were performed at mean (and median) 60  months after the initial examination. All examinations were performed by the same experienced investigator and described in detail in previous publications , 17.Differences in variables between patients with RA and matched controls were analysed using simple conditional logistic regression analyses. Comparisons within the RA patient group or within the control group were performed using the Mann-Whitney U-test, or for comparisons over time, the Wilcoxon paired test. Simple and multiple linear regression analyses were used to identify certain variables associated with the different biomarkers. Correlations were tested with Spearman rank correlation or Pearsons correlation, whenever appropriate. For the results from the multiplex immunoassay, first a partial least squares regression (PLSR) was performed, with two components, where the X-variables are scaled by dividing each variable by its standard deviation. Using the scores from the PLSR a k-means clustering with two centers (2-means)  was performed in order to discriminate between the two groups. The result was evaluated by plotting the scores from the PLSR, that is using the scores as y and x coordinates. Each observation was assigned a colour (red or blue) according to the cluster assigned to that observation. The numbers represent the true group of the observation, that is ideally all observations with one number should have the same colour. Based on results from previous publications, calculations showed that a sample size of 26 in each group would render 95% power to detect a difference in IMT of 0.1mm and SD of 0.1 mm . For staAt T0, the patients with RA had significantly lower levels of MIF and significantly higher levels of IL-18 and MIC-1 compared with controls . At T5, The patients with RA had significantly lower levels of MIF and MPO at T5 compared with at T0 . Among tMPO with DAS28 , sCD40L with CRP  and IL-18 with systolic blood pressure  as well as with Reynolds risk score .Among the patients with RA there were some correlations between the different biomarkers at T0 and markers of disease activity in RA or traditional CVD risk factors; The correlations between the different biomarkers are presented in MPO with BMI  and CRP , IL-18 with smoking , MIC-1 with age , smoking , BMI , SCORE , Reynolds risk score  and IMT , TNF-R2 with ESR , endoglin with ESR  and DAS28 , sICAM-1 with Reynolds risk score  and IMT  as well as sVCAM-1 with Reynolds risk score .Also after 5 years of follow up there were correlations between the different biomarkers and markers of disease activity or CVD risk factors; Using PLSR on the CVD-panel analysed with multiplex, the patients with RA could be correctly classified into those who had a worsening in their IMT over the five years of follow up or not . Here, MIn simple regression analysis, none of the biomarkers were associated with IMT at T0 but some at T5 . Only MIBiomarkers of systemic inflammation, pro-inflammatory cytokines and chemokines have been suggested to be closely related to the atherosclerotic process. In this study we aimed to investigate some of these biomarkers, known to be associated with atherosclerosis and CVD in the general population, in a well characterised inception cohort of patients with early RA with data on prospective development of atherosclerosis. We found most of these potential biomarkers to be affected by the RA-disease itself, and therefore hard to identify as biomarkers of atherosclerosis in this setting. Among patients with RA, the area of surrogate endpoints is also difficult to interpret since several biomarkers of CVD are associated with general inflammation. Atherosclerosis is nowadays recognized as an inflammatory disease and there are many parallels between the pathological and immunological processes that occur in the synovium and the atheromatous lesions in the vessel walls . A previIn this study, a few of the measured biomarkers that were associated with subclinical atherosclerosis. One of these, with significant different levels in patients with RA compared with controls, was MIF, that was significantly lower among patients with RA at T0, and also decreased over the five years of follow up, both in patients with RA and controls. Our results are contrary to most other published studies since MIF is a cytokine with pleiotropic roles in both acute and chronic inflammatory diseases suggested to be associated with the progression and severity of atherosclerotic disease , 23.Metalloproteinases are all suggested to be markers of vulnerable plaques  and in tSome of the other biomarkers showed statistically significant differences between patients with RA and controls or were correlated with disease activity. Most well-known are the cellular adhesion molecules (CAMs) that mediate adhesion of circulating leukocytes to endothelial cells, promoting subsequent transendothelial migration and formation of atheroma. In this study both ICAM-1 and VCAM-1 were correlated with risk for future CVD and ICAM-1 also with subclinical atherosclerosis, in line with previous studies . Also thThe main strength of the present study is its prospective design from disease onset. Data were collected from the onset of disease and then continuously during five years of follow up. In northern Sweden, practically all of the patients with newly diagnosed RA are included in a structured follow up programme. Of these patients, all aged \u226460 years were invited to participate in the present study within 12 months of their diagnosis.The main limitation is the number of controls, and unfortunately it was not possible to include more controls. Furthermore, no variables of inflammation were available among the controls. The associations between these biomarkers and CVD must, however, be regarded as well studied in the general population. This study was directed at the interplay between biomarkers and other CVD risk factors among the patients with RA.In conclusion, this study indicates that the RA disease itself might affect several of the biomarkers in this study, and possible also the processes involved in the development of atherosclerosis. Subsequently, none of the biomarkers in this study could explain the burden of subclinical atherosclerosis in these patients with early RA. Nevertheless, further studies are important for a better understanding of the premature atherosclerotic process in patients with inflammatory diseases like RA.S1 Table(DOCX)Click here for additional data file."}
+{"text": "In hypothalamic slices bathed in HEPES-buffered solution a standing acidification of ~0.3\u2009pH units was recorded with pH-sensitive microelectrodes in the SCN but not extra-SCN areas. The NHE blocker amiloride alkalinised the pHe. RT-PCR revealed mRNA for plasmalemmal-type NHE1, NHE4, and NHE5 isoforms, whereas the NHE1-specific antagonist cariporide alkalinised the pHe. Real-time PCR and western blotting failed to detect day-night variation in NHE1 mRNA and protein levels. Cariporide induced intracellular acidosis, increased basal [Ca2+]i, and decreased depolarisation-induced Ca2+ rise, with the latter two effects being abolished with nimodipine blocking the L-type Ca2+ channels. Immunofluorescent staining revealed high levels of punctate colocalisation of NHE1 with serotonin transporter (SERT) or CaV1.2, as well as triple staining of NHE1, CaV1.2, and SERT or the presynaptic marker Bassoon. Our results indicate that NHE1 actively extrudes H+ to regulate pHi and nimodipine-sensitive [Ca2+]i in the soma, and along with CaV1.2 may also regulate presynaptic Ca2+ levels and, perhaps at least serotonergic, neurotransmission in the SCN.The central clock in the suprachiasmatic nucleus (SCN) has higher metabolic activity than extra-SCN areas in the anterior hypothalamus. Here we investigated whether the Na Nine genes are currently known to encode nine NHE isoforms (NHE1/SLC9A1\u2013NHE9/SLC9A9) in the mammals3. The isoforms NHE1\u20135 are known as plasmalemmal-type as they are commonly found at the plasma membrane, whereas the isoforms NHE6\u20139 known as endomembrane-type as they are found in the organelles3. NHE1 is ubiquitously expressed with minimal basal activity in most tissues, but can be activated by intracellular H+ and is the principle mechanism for H+ extrusion in many cell types1. Importantly, the differential localisation of NHE1 along with other ion channels/transporters to distinct subregions of the plasma membrane allows it to regulate local pHi to influence many different cellular processes including membrane excitability, Ca2+ homeostasis, and neurotransmission5.The Na6. The SCN is metabolically more active during the day than at night, exhibiting a diurnal rhythm in glucose uptake8, cytochrome oxidase activity9, and Na/K pump activity10. On the other hand, the SCN is sensitive to metabolic perturbation and subject to regulation by metabolic cues such as the availability of glucose (see ref.11). While there is only limited knowledge available about how metabolic stress, such as glucose shortage, regulates the SCN, recent evidence indicates an important role of energy metabolism in the regulation of membrane excitability in the SCN neurones via the Na/K pump12 and the ATP-sensitive K+ channel13.The hypothalamic suprachiasmatic nucleus (SCN) is the central clock controlling mammalian circadian rhythms of physiology and metabolism+\u200915, which may cause intracellular and extracellular acidification to impact H+ targets to regulate neuronal activity16. While steady pH gradient between the living tissue and the superfusate has been demonstrated in various neural tissues (see refs17), it is not known if this exists in the SCN. Such knowledge is particularly important, as we previously demonstrate that the SCN neurones are sensitive to mild extracellular acidification and express acid-sensing ion channels (ASIC), which contain high pH sensitivity of ASIC3 and ASIC1a subunits18. Furthermore, membrane conductances involved in neurotransmission such as NMDA receptors, GABAA receptors, and voltage-gated calcium channels are also sensitive to intra- and extracellular protons16 and play a role in the regulation of circadian clock (see ref.19).ATP hydrolysis during energy metabolism produces H8, we hypothesized that H+ produced during energy metabolism may be extruded by the NHE to influence both intracellular and extracellular pH in the SCN. We used ion-selective electrodes to measure the pHe values in hypothalamic slices containing the SCN, and ratiometric H+ and Ca2+ imaging to investigate the pHi and [Ca2+]i in reduced SCN preparations. Real-time PCR and western blotting were used to investigate the NHE1 mRNA and protein levels, whereas immunostaining was used to investigate the distribution pattern and localisation of NHE1. Our results show that NHE1 actively extrudes H+ to cause extracellular acidification in hypothalamic SCN slices and maintain a more alkaline pHi to regulate [Ca2+]i in the soma. Furthermore, double immunofluorescent staining revealed punctate colocalisation of NHE1 and CaV1.2 near the cell membrane, and triple staining of NHE1, CaV1.2, and serotonin transporter or the presynaptic marker Bassoon suggested that the NHE1 along with CaV1.2 may also regulate presynaptic Ca2+ levels and, perhaps at least serotonergic, neurotransmission in the SCN.As the SCN is densely packed with neurones and has higher level of metabolic activity than extra-SCN areas3\u2212/5% CO2 (pH\u2009=\u20097.55). Figure\u00a03\u2212/5% CO2, the pHe in the center of the SCN was ~7.40, an acidification of ~0.15\u2009pH units, whereas the pHe in extra-SCN areas remained not much different from the bath of pH 7.55. On average the extracellular acidification (the difference in pH between the SCN and superfusion solution) in pH unit was 0.18\u2009\u00b1\u20090.03 (n\u2009=\u20098 slices) in the SCN, significantly larger \u2009=\u200910.6, P\u2009=\u20090.0014, ANOVA) than the value of 0.015\u2009\u00b1\u20090.023 (n\u2009=\u20094 slices) and \u20130.006\u2009\u00b1\u20090.038 (n\u2009=\u20096 slices) in the dorsal and lateral extra-SCN areas, respectively (bottom panel).The extracellular pH (pHe) of the rat SCN was measured with double-barreled pH-sensitive microelectrodes calibrated as described in Methods Fig.\u00a0. Figure\u00a03\u2212 free) perfusion solution maintained at pH 7.4, the pHe in the center of the SCN was ~7.1, an acidification of ~0.3\u2009pH units. Figure\u00a0n\u2009=\u200919 slices), 7.25\u2009\u00b1\u20090.04 (n\u2009=\u200917 slices), 7.19\u2009\u00b1\u20090.04 (n\u2009=\u200917 slices), and 7.12\u2009\u00b1\u20090.04 (n\u2009=\u200919 slices), respectively. On average, the extracellular acidification in the center of the SCN was 0.27\u2009\u00b1\u20090.02\u2009pH units (n\u2009=\u200919 slices). Comparison of the extracellular acidification recorded between day (ZT 4\u201311) and night (ZT 13\u201320) indicates a similar degree of acidification, the values being 0.26\u2009\u00b1\u20090.02\u2009pH units (n\u2009=\u200910 slices) and 0.29\u2009\u00b1\u20090.05\u2009pH units (n\u2009=\u20099 slices) (t(17)\u2009=\u20090.58, P\u2009=\u20090.58, unpaired t-test), respectively  in extruding H+ to cause extracellular acidifications, the nonspecific blocker amiloride was applied to determine its effect on the pHe  indicates continuing productionpHe Fig.\u00a0. The respHe Fig.\u00a0, suggestNHE Fig.\u00a0.Figure 3n\u2009=\u200922 slices) during the day and 0.13\u2009\u00b1\u20090.01 (n\u2009=\u200911 slices) at night (t(31)\u2009=\u20090.63, P\u2009=\u20090.53, unpaired t-test)  Fig.\u00a0.RT-PCR was used to determine the expression of the plasmalemmal-type NHE1\u20135 isoforms in the SCN Fig.\u00a0. Positiv50 of 1.6\u2009\u00b5M in one study20 and an IC50 of 5.3\u2009\u00b5M and 813\u2009\u00b5M, respectively, for NHE1 and NHE4, in another21, but an IC50 of ~1.5\u2009\u00b5M and ~20\u2009\u00b5M, respectively, for human NHE1 and NHE522. An IC50 of 30\u2009\u00b5M (determined with doses of amiloride up to 1\u2009mM), as opposed to ~800\u2009\u00b5M for amiloride block of NHE4, suggests a minimal, if any, contribution of NHE4 in mediating extracellular acidification in the SCN. On the other hand, although an IC50 of 30\u2009\u00b5M is larger than those (1.5~5\u2009\u00b5M) for cloned rat NHE1, the lack of information of amiloride sensitivity for rat NHE5 precluded us from making meaningful inference as to the participation of NHE5 in mediating standing extracellular acid shifts.The NHE1\u20135 isoforms are blocked by amiloride with different sensitivity, with a decreasing sensitivity in order of NHE1\u2009>\u2009NHE5\u2009>\u2009NHE4. Specifically, amiloride blocks the cloned rat NHE1 with an IC50 ~0.03\u20133.4\u2009\u00b5M) much more potent than NHE5 (IC50\u2009>\u200930\u2009\u00b5M)23 and at a concentration of 1\u2009\u00b5M should have specifically inhibited NHE1. We thus compared the effect of 100\u2009\u00b5M amiloride and 1\u2009\u00b5M cariporide on the resting pHe from the same SCN slices  and 0.16\u2009\u00b1\u20090.02 (n\u2009=\u20095 slices) (t(4)\u2009=\u20090.72, P\u2009=\u20090.51, paired t-test), respectively. The result revealed a similar magnitude of alkaline shift induced by 100\u2009\u00b5M amiloride and 1\u2009\u00b5M cariporide. Figure\u00a050 of 0.094\u2009\u00b5M for cariporide-induced alkalinisation. This value falls within the range of reported values of IC50 for NHE1 and is much lower than that (IC50\u2009>\u200930\u2009\u00b5M) for NHE523. Together the results indicate that NHE1 is the major NHE isoform in mediating extracellular acidification in the SCN.Nevertheless, the benzoylguanidines cariporide has been shown to inhibit NHE1  \u2009=\u20092.14, P\u2009=\u20090.08, ANOVA) \u2009=\u200919.5, P\u2009<\u20090.0001, ANOVA) and rPer2 \u2009=\u200923.2, P\u2009<\u20090.0001, ANOVA) both exhibited a robust rhythmicity, with the highest expression at ZT 5 and lowest at ZT 14 for rPer1 \u2009=\u20090.55, P\u2009=\u20090.66, ANOVA)   Fig.\u00a0.Figure 5+ out of the cells to extracellular space in the SCN slice. In other words, NHE1 should help maintain intracellular pH (pHi) in more alkaline conditions. To test this idea, ratiometric proton imaging with BCECF-AM was used to measure the pHi change of cells in reduced SCN slice preparations. For the experiments, we investigated the effects of cariporide, as well as Na+-free solution, on baseline pHi , suggesting a constitutive activation of NHE1 to extrude H+ to maintain a more alkaline pHi. Na+-free solution  also reversibly acidified the pHi, but to a larger extent than cariporide. A larger response by 0-Na+ was expected, because, in addition to inhibiting H+ extrusion via NHE1 as cariporide did, 0-Na+ could also increase intracellular H+ concentrations by promoting H+ uptake via reverse NHE1 activity .The ability of cariporide to produce extracellular alkaline shifts suggests a constitutive activation of NHE1 in extruding HpHi Fig.\u00a0. The cen2+ handling, are highly sensitive to local pH change . We previously reported that both the Na+/Ca2+ exchanger (NCX) and mitochondria play a role in the regulation of [Ca2+]i in the rat SCN neurones, with NCX mediating fast Ca2+ decay following high K+-induced Ca2+ transients and mitochondria regulating basal [Ca2+]i29. Here we tested the idea that the constitutive activation of NHE1 may regulate [Ca2+]i in the SCN neurones. We used ratiometric Ca2+ imaging to determine the effects of cariporide on basal [Ca2+]i and Ca2+ rise in response to membrane depolarisation with 20\u2009mM\u2009K+. Figure\u00a02+ response to the application of 1\u2009\u00b5M cariporide, which increased basal [Ca2+]i on application and then transiently lowered it to a level below control (marked by arrow) on washout (an average of 15 cells). Right panel shows the histogram for the distribution of cariporide-induced change in basal [Ca2+]i, with most cells showing elevated basal [Ca2+]i in response to cariporide. On average, cariporide increases basal [Ca2+]i by 0.0036\u2009\u00b1\u20090.0004 (n\u2009=\u2009219 cells from 11 experiments).Many proteins playing important roles in cellular physiology, including membrane excitability and Ca2+]i, cariporide invariably inhibited the Ca2+ response to membrane depolarisation evoked by 20\u2009mM\u2009K+ . Figure\u00a0+-induced Ca2+ transients for better visualisation of the effect of cariporide. Normalisation of Ca2+ transients revealed similarly fast decay kinetics in the absence (dark traces) and the presence (grey traces) of cariporide . In contrast to the opposite effects of cariporide on increasing basal [Ca2+]i but decreasing 20\u2009K+-induced Ca2+ rise  and 20\u2009K+-induced Ca2+ rise. Figure\u00a02+ transients to show the inhibition of peak amplitude and the lack of effect on the fast decay by cariporide (left panel) and acetate (right panel). Inset shows the opposite response of basal [Ca2+]i to the application (marked by arrow) of cariporide and acetate.Figure\u00a0D1 shows the histogram for the distribution of cariporide- and acetate-induced percent change in Ca2+ transients (n\u2009=\u2009154 cells from 8 experiments). In contrast to the almost all suppressive effect of cariporide (black bars), which reduced (by more than 10% of) the peak Ca2+ transient in 82% (126 out of 154) cells, acetate (grey bars) may suppress or enhance it in different SCN neurones, with 49% (75/154) being suppressed and 21% (33/154) enhanced by acetate. On average, cariporide and acetate reduced the peak Ca2+ transients by 19\u2009\u00b1\u20091% (n\u2009=\u2009154 cells) and 8\u2009\u00b1\u20092% \u2009=\u200916.1, P\u2009<\u20090.0001, paired t-test) of control, respectively  and mostly larger, suppressive effect of acetate (grey bars) on basal [Ca2+]i. On average, 1\u2009\u00b5M cariporide increased basal [Ca2+]i by 0.0033\u2009\u00b1\u20090.0006 (n\u2009=\u2009154 cells), in contrast to a decrease of 0.019\u2009\u00b1\u20090.001 \u2009=\u20096.05, P\u2009<\u20090.0001, paired t-test) by 20\u2009mM acetate  and to 20\u2009K+-induced Ca2+ rise29, we reasoned that they might be involved in the suppressive effects of acetate on both basal [Ca2+]i and 20\u2009K+-induced Ca2+ rise. Indeed, 2\u2009\u00b5M nimodipine converted the suppressive effects of acetate  and 20\u2009K+-induced Ca2+ rise as indicated in Fig.\u00a02+ transients to indicate an enhancing effect of acetate in the presence of nimodipine, as opposed to a suppressive effect in its absence  and in nimodipine (grey bars), indicating a nimodipine-induced shift from mostly suppressive to stimulatory action of acetate (n\u2009=\u200999 cells from 5 experiments). On average, acetate reduced the peak Ca2+ transients by 8\u2009\u00b1\u20091% (n\u2009=\u200999 cells) in control but increased it by 20\u2009\u00b1\u20091% \u2009=\u200917.98, P\u2009<\u20090.0001, paired t-test) in the presence of nimodipine (right panel).As Caate Fig.\u00a0 to becom2+]i also indicates an increasing effect of acetate in the presence of nimodipine (grey circles) in contrast to a decreasing effect in its absence (dark circles)  and in nimodipine (grey bars), again indicating a nimodipine-induced shift from mostly decreasing to increasing effect of acetate (n\u2009=\u200999 cells). On average, acetate lowered the basal [Ca2+]i by 0.0075\u2009\u00b1\u20090.0010 (n\u2009=\u200999 cells) in control but increased it by 0.0054\u2009\u00b1\u20090.0008 \u2009=\u200910.13, P\u2009<\u20090.0001, paired t-test) in the presence of nimodipine (right panel). Together with Fig.\u00a02+]i and 20\u2009K+-induced Ca2+ rise.Similarly, superimposition of basal i in control (black bars) and in nimodipine (grey bars), again indicating a nimodipine-induced shift from positive-going changes to a distribution centered around no change in basal [Ca2+]i. On average, cariporide changed the basal [Ca2+]i by 0.0053\u2009\u00b1\u20090.0006 (n\u2009=\u2009101 cells) in control and \u22120.0003\u2009\u00b1\u20090.0004 \u2009=\u200911.27, P\u2009<\u20090.0001, paired t-test) in the presence of nimodipine (right panel). The abolition of cariporide effects by nimodipine suggests that the effects of cariporide on basal [Ca2+]i and 20\u2009K+-induced Ca2+ rise were mediated via the nimodipine-sensitive L-type Ca2+ channels.Figure\u00a0, insets and Fig.\u00a0Immunohistochemistry with the NHE1-specific antibody was used to study the distribution pattern of the NHE1 isoform Fig.\u00a0. The res11B\u2013FTo determine the possible presence of NHE1 in afferent inputs to the SCN, antibodies for the vesicular glutamate transporter type 2 (vGluT2), neuropeptide Y (NPY), or serotonin transporter (SERT) were used to perform double staining with NHE1 Fig.\u00a0. The res+-evoked somatic Ca2+ rise and fast Ca2+ decay30. Our immunofluorescent double staining showed a high degree of colocalisation (yellow) between NHE1 (green) and CaV1.2 (red)  Fig.\u00a0, but noted) Fig.\u00a0.Figure 131) and varicosity32. Together the results indicate high levels of colocalisation between NHE1 and CaV1.2 both in the soma and in the presynaptic structures including at least the serotonergic input.To further assess the possible involvement of NHE1 and CaV1.2 in the regulation of neurotransmission, we performed triple immunostaining to determine the colocalisation of NHE1, CaV1.2, and SERT Fig.\u00a0 or NPY . The res2+]i in the SCN clock. We show that NHE1 actively extrudes H+ to contribute to standing extracellular acidification in the SCN. The constitutive activation of NHE1 maintains a more alkaline pHi in the soma and regulates somatic [Ca2+]i by functional coupling with the nimodipine-sensitive L-type Ca2+ channels, in accordance with punctate colocalisation of NHE1 with CaV1.2 around the cell membrane. NHE1 is also present in presynaptic structures, particularly associated with serotonergic inputs. The triple staining of NHE1, CaV1.2 and SERT or Bassoon suggests that NHE1, along with CaV1.2, may also regulate presynaptic Ca2+ levels and, perhaps at least serotonergic, neurotransmission in the SCN.This study demonstrates a role of NHE1 in the regulation of pHe, pHi, and i in the SCN cells. We show that cariporide blockade of NHE1 increases basal [Ca2+]i but decreases depolarisation (20\u2009mM\u2009K+)-induced Ca2+ rise. The cariporide effect on [Ca2+]i appears to be closely associated with the Ca2+ entering the L-type Ca2+ channels, because 2\u2009\u00b5M nimodipine abolishes the cariporide effect on both basal [Ca2+]i and depolarisation-induced Ca2+ rise. In contrast, the weak acid acetate, which also induces intracellular acidosis, decreases both basal [Ca2+]i and depolarisation-induced Ca2+ rise. Nimodipine converts acetate inhibition to enhancement of basal [Ca2+]i and 20\u2009K+-induced Ca2+ rise, suggesting that intracellular acidosis evoked by acetate has opposite effects on nimodipine-sensitive and -insensitive [Ca2+]i, being suppressive for the former and stimulatory for the latter.The ability of NHE1 to maintain a more alkaline pHi plays a role in regulating i by buffering Ca2+ entering nimodipine-insensitive Ca2+ channels, including N-, P/Q-, and most likely also T-type Ca2+ channels29. Together, a simple explanation suggests that acetate-induced acidosis inhibits L-type Ca2+ channels to account for the inhibition of nimodipine-sensitive basal [Ca2+]i and depolarisation-induced Ca2+ rise, and also inhibits mitochondrial Ca2+ uptake to account for the enhancement of nimodipine-insensitive basal [Ca2+]i and depolarisation-induced Ca2+ rise29.It is not possible at this moment to provide a detailed account for the results, because intracellular Ca2+]i and Ca2+ transients, cariporide inhibits nimodipine-sensitive Ca2+ rise and yet increases nimodipine-sensitive basal [Ca2+]i. It is beyond the scope of this study to elucidate the underlying mechanisms for the opposite effects of cariporide on nimodipine-sensitive basal [Ca2+]i and 20\u2009K+-induced Ca2+ rise. Nonetheless, the mechanism most likely lies in the discrete localisation of NHE1 and its regulation of local pH around specific Ca2+ handling proteins, as opposed to the more homogenous change in the pHi induced by acetate. The combined results of Ca2+ imaging and immunostaining suggest that NHE1 could regulate local pH around the CaV1.2 channel to influence its activity and thus associated Ca2+ signaling. Similarly specific targeting of NHE1 to distinct regions of the cell membrane has been demonstrated in both atrial and ventricular muscle cells, with NHE1 predominantly localized to the intercalated disk region close to the gap junction protein connexion 4336. Since gap junction conductance is sensitive to small change in the physiological pHi38, NHE1 regulation of local pH around the gap junction could regulate intercellular communication.Unlike the parallel inhibition by acetate of nimodipine-sensitive basal i in the soma may also be at work in the presynaptic terminals to regulate neurotransmission, as suggested by the colocalisation of NHE1/CaV1.2 with Bassoon and, more specifically, the serotonergic input. The results may be taken to suggest the involvement of NHE1 along with CaV1.2 in regulating presynaptic Ca2+ levels and, perhaps at least serotonergic, neurotransmission. As serotonergic signaling via presynaptic 5HT-1B receptor is known to inhibit light (glutamate)-induced phase shifts  and, more profoundly, GABAergic neurotransmission in the SCN (see ref.43 and references therein), NHE1 along with CaV1.2 could potentially regulate glutamatergic and GABAergic neurotransmission. Further work is warranted to determine whether and how NHE1 and CaV1.2 play a role in the regulation of serotonergic, glutamatergic, and GABAergic neurotransmission.The same NHE1 regulation of pHi and i in the SCN neurones in reduced slice preparations. Further work is needed to obtain more detailed knowledge of pH regulation in the SCN in order to better understand whether and how the more acidic pHe may play a role in the regulation of the circadian clock of the SCN.On the other hand, although it is not known how NHE1-mediated extracellular acidification may play a role in SCN physiology, our previous study on acid-sensing ion channels (ASIC) indicates that the SCN neurones are sensitive to regulation by extracellular pH+ to maintain a more alkaline pHi and a more acidic pHe in the SCN. NHE1, by functional coupling to L-type CaV1.2 channels, helps regulate somatic and, perhaps, presynaptic Ca2+ levels to play a role in the regulation of circadian clock of the SCN.In conclusion, the constitutively active NHE1 extrudes H29. An animal of either sex was carefully restrained by hand to reduce stress and killed by decapitation using a small rodent guillotine without anaesthesia, and the brain was put in an ice-cold artificial cerebrospinal fluid (ACSF) prebubbled with 95% O2-5% CO2. The ACSF contained (in mM): 125 NaCl, 3.5 KCl, 2 CaCl2, 1.5 MgCl2, 26 NaHCO3, 1.2 NaH2PO4, 10 glucose. A coronal slice (200\u2013300\u2009\u00b5m) containing the SCN and the optic chiasm was cut with a DSK microslicer DTK-1000 , and was then incubated at room temperature (22\u201325\u2009\u00b0C) in the incubation solution, which contained (in mM): 140 NaCl, 3.5 KCl, 2 CaCl2, 1.5 MgCl2, 10 glucose, 10 HEPES, pH 7.4, bubbled with 100% O2.All experiments were carried out according to procedures approved by the Institutional Animal Care and Use Committee of Chang Gung University. Sprague-Dawley rats (18\u201324 days old) were kept in a temperature-controlled room under a 12:12 light:dark cycle (light on 0700\u20131900 hr). Lights-on was designated Zeitgeber time (ZT) 0. For daytime (ZT 4\u201311) and nighttime (ZT 13\u201320) recordings, the animal was killed at ZT 2 and ZT 10, respectively. Hypothalamic brain slices and reduced SCN preparations were made as described previously2+ and H+ imaging, a reduced SCN preparation was obtained by excising a small piece of tissue (circa one-ninth the size of SCN) from the medial SCN using a fine needle , followed by further trimming down to 4\u201310 smaller pieces with a short strip of razor blade. The reduced preparation  with a vertical pipette puller . The tips were broken to a diameter of ~10\u2009\u00b5m. The pH-selective barrel was selectively silanized with N,N-dimethyltrimethylsilylamine  according to a modified method46. The reference and pH-selective barrels were backfilled with a solution containing (in mM): 100 NaCl, 20 HEPES, 10 NaOH, pH 7.4. Positive pressure was applied to the back of pH-selective barrel to ensure a good backfilling. A column of hydrogen ionophore I-cocktail A  was then drawn into the tip of pH-selective barrel with or without suction. The electrode was calibrated before each experiment in a series of standard solutions . The resistance of the pH-selective barrel was 5\u201310 G\u03a9, whereas the reference barrel had a resistance between 20 and 50 M\u03a9. All recordings were made with a Duo 773 Electrometer  at room temperature (22\u201325\u2009\u00b0C), with the signal low-pass filtered at 1\u2009kHz and digitized online at 2\u2009kHz with a PowerLab 4/30 .Extracellular pH in the SCN was measured with double-barreled pH-selective microelectrodes based on established methods3\u2212\u2009buffered solution containing (in mM): 124 NaCl, 3 KCl, 26 NaHCO3, 1.0 NaH2PO4, 2.5 CaCl2, 1.5 MgCl2, and 10 glucose, equilibrated with 95% O2 and 5% CO2 (pH\u2009=\u20097.40). In some experiments the NaHCO3 was increased to 35\u2009mM and NaCl reduced correspondingly to provide a bath pH of 7.55 47 and the proton-sensitive fluorescent indicator 2\u2032,7\u2032-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM)48. The reduced SCN preparation was incubated in 10\u2009\u00b5M Fura2-AM or 2\u2009\u00b5M BCECF-AM in 50\u2009\u00b5l of bath solution in the dark for 60\u2009min at 37\u2009\u00b0C. Incubation was terminated by washing with 6\u2009ml of bath solution and at least 60\u2009min was allowed for de-esterification of the dye. All imaging experiments were performed at room temperature (22\u201325\u2009\u00b0C). For the experiments, the reduced SCN preparation was gently pressed on the edge against the coverslip to allow adherence of the tissue to the surface. Fluorescence signals were imaged using a charge-coupled device camera attached to an inverted microscope  and recorded with Xcellence imaging software integrated with the CellIR MT20 illumination system . The system used a 150-W xenon arc burner as the light source to illuminate the loaded cells. The excitation wavelengths were 340 (\u00b112) and 380 (\u00b114) nm (for Ca2+) or 440 (\u00b124) and 490 (\u00b120) nm (for H+) and emitted fluorescence was collected at 510\u2009nm. Pairs of 340/380\u2009nm and 440/490\u2009nm images were, respectively, sampled at 0.5 and 0.1\u2009Hz. Ca2+ or H+ levels in regions of interest (ROI) over the soma were spatially averaged and presented by fluorescence ratios (F340/F380 for Ca2+ and F440/F490 for H+) after background subtraction.Ratiometric fluorescence imaging was carried out as described previously+-free solutions were prepared with total replacement of extracellular Na+ with N-methyl-D-glucamine (NMDG+), and 20\u2009mM\u2009K+ solutions were prepared with equal molar substitution of K+ for Na+. All solutions were adjusted to pH 7.4 before use.Stock solutions of nimodipine (20\u2009mM in DMSO), amiloride (500\u2009mM in DMSO), and cariporide (10\u2009mM in DMSO) were stored at \u221220\u2009\u00b0C, and were diluted at least 1000 times to reach desired final concentrations. Nimodipine and cariporide were purchased from Tocris Cookson , and amiloride from Sigma-Aldrich . Na29. Sprague-Dawley rats (23\u201325 days old) were deeply anesthetized with Zoletil  and fixed by transcardial perfusion with PBS and then with 4% paraformaldehyde . Brains were removed and post-fixed overnight (more than 16\u2009hr) in 4% paraformaldehyde, followed by dehydration with 30% sucrose in PBS for another 24\u2009hr. Twenty-micrometer-thick coronal sections through the hypothalamus region containing the SCN were cut on a cryostat (\u221220\u2009\u00b0C), collected in antifreeze solution, and stored in \u221220\u2009\u00b0C freezer until further processing.Immunohistochemistry and immunofluorescence staining were performed as described previouslyFor Nissl staining, sections (20\u2009\u00b5m) were washed for 20\u201330\u2009min in PBS and then stained with 1% Nissl (cresyl violet acetate) . After gradient ethanol hydration, sections were coverslipped with DPX  and photographed using an inverted microscope .2O2 for 15\u2009min to quench endogenous peroxidase, and then incubated overnight at 4\u2009\u00b0C in PBS containing 2% serum, 0.3% Triton X-100, and primary antibodies NHE1 . Sections were then treated with respective biotinylated secondary antibodies for 1\u2009h at room temperature (22\u201325\u2009\u00b0C). After rinsed in PBS, sections were then incubated in avidin-biotin complex  for 1\u2009h according to the manufacturer\u2019s instructions. After two 10-min washes in 0.1\u2009M sodium acetate, sections were stained with diaminobenzidine. Sections were photographed and analyzed with an inverted microscope  integrated with the MT20 illumination system .For immunohistochemical staining, sections (20\u2009\u00b5m) were treated with 0.3% HFor immunofluorescence staining, sections (20\u2009\u00b5m) were washed for 20\u201330\u2009min in PBS and then incubated overnight at 4\u2009\u00b0C in PBS containing 2% serum, 0.3% Triton X-100, and primary antibodies against NHE1 , neurophysin II (NP2) , vasoactive intestinal peptide (VIP) , gastrin-releasing peptide (GRP) , vesicular glutamate transporter type 2 (vGluT2) , serotonin transporter (SERT) , neuropeptide Y (NPY) , CaV1.2 , NCX1 , and Bassoon . Sections were then treated with respective Alexa Fluor secondary antibodies 488, 568, or 633  and Hoechst 33342  for 1\u2009hr at room temperature. After rinse in PBS, sections were coverslipped with ProLong Gold anti-fade reagent  and photographed with Zeiss LSM 510 confocal microscope. Contrast and brightness were optimized using Adobe Photoshop .28. Total RNA of SCN was extracted using the Absolutely RNA Nanoprep kit  according to the manufacturer\u2019s guide; total RNA of rat brain was purchased from BioChain Institute Inc . RNA samples were treated with DNaseI for 13\u201315\u2009min at 25\u2009\u00b0C to eliminate genomic DNA contamination. The resulting RNA was reverse-transcribed (RT) to cDNA using ReverTra Ace  with oligo(dT) primers in a total volume of 20\u2009\u03bcl. One-tenth of RT products were used as templates (2\u2009\u03bcl) to perform PCR reaction. RT reaction with omission of reverse transcriptase was used as templates for negative control PCR. Primers used for RT-PCR were as follows: NHE1 forward 5\u2032-CACAGTTCCTGGACCACCTT-3\u2032 and reverse 5\u2032-GGATCTCCTCCTCCTTGTCC-3\u2032, NHE2 forward 5\u2032-TCTGCTTTGCACTGGTGTTC-3\u2032 and reverse 5\u2032-GATGCAAATGAGGGGACAGT-3\u2032, NHE3 forward 5\u2032-CCTTTCCGAATTGAAGTCC-3\u2032 and reverse 5\u2032-CGGCTGCTAGCTTTGGTATC-3\u2032, NHE4 forward 5\u2032-GGTGTGAGAGGAGCAGGAAG-3\u2032 and reverse 5\u2032-TAGCCCAGTCTCTGCCATCT-3\u2032, and NHE5 forward 5\u2032-CGTTAGGGGGCATTGTCTTA-3\u2032 and NHE5 reverse 5\u2032-TCAAAGACAGCCAACACAGC-3\u2032. The thermal cycling condition of RT-PCR was 94\u2009\u00b0C for 3\u2009min, followed by 35 cycles of 94\u2009\u00b0C for 30\u2009s, 60\u2009\u00b0C for 30\u2009s, and 72\u2009\u00b0C for 30\u2009s, and then 72\u2009\u00b0C for 7\u2009min. PCR amplified products were electrophoresed in 1.5% agarose gels, stained with ethidium bromide, and photographed.RT-PCR was performed as described previously25. Total mRNA of the SCN was prepared from freshly dissected tissue by extraction with Absolutely RNA Nanoprep kit  according to the manufacturer\u2019s instructions. The purity of total RNA in each sample was measured using a microplate spectrophotometer reader . Samples were volume-adjusted with RNAase-free water and normalized for their RNA content. The resulting RNA was reverse-transcribed to cDNA with Superscript III reverse transcriptase  and oligo(dT)12\u201318 primers in a total volume of 30\u2009\u00b5l.Real-time PCR was performed as described previouslyNHE1, rPer1, and rPer2 were measured by real-time PCR analysis with SYBR Green method. The target genes and GAPDH were amplified separately using the same group of cDNA template from each sample. Successful reverse transcription was confirmed for all samples by performing PCR amplification of the internal control GAPDH. Primer sequences for target genes were as follows: GAPDH forward 5\u2032-GCATCTTCTTGTGCAGTGCC-3\u2032 and reverse 5\u2032-TACGGCCAAATCCGT TCACA-3\u2032, NHE1 forward 5\u2032-CTGCAGTCGGACGTCTTCTT -3\u2032 and reverse 5\u2032- GTTCTCCGTGAACTGCCTCA -3\u2032, Per1 forward 5\u2032-TGTGTGGACTGTGGTAGC-3\u2032 and reverse 5\u2032-TCTGAGAAGAGAGGGTCGT-3\u2032, and Per2 forward 5\u2032-CCAGAGGCGAG- AGCTTC-3\u2032 and reverse 5\u2032-GATGGCGGTAGGCAGAC-3\u2032. PCR amplification was carried out using 2\u2009\u00d7\u2009Power SYBR Green PCR Master Mix  in the StepOne Real Time PCR System (48-well format) . The PCR reaction setup included 10\u2009\u00b5l of 2\u2009\u00d7\u2009Power SYBR Green PCR Master Mix, 0.6\u2009\u00b5l of 10\u2009\u00b5M forward primer, 0.6\u2009\u00b5l of 10\u2009\u00b5M reverse primer, and 2\u2009\u00b5l (10\u2009ng) of cDNA in a total reaction volume of 20\u2009\u00b5l. Cycle threshold (CT) values were obtained from the exponential phase of PCR amplification. The 2\u2212\u0394\u0394CT method was used to calculate the mRNA levels normalized to the GAPDH (\u0394CT\u2009=\u2009target gene CT \u2212 GAPDH CT)49.The mRNA expression levels of 25. Frozen SCN tissue samples were homogenized by sonication in ice-cold extraction buffer  and the protein concentration was then determined by a Bio-Rad DC protein assay kit . The proteins (20\u2009\u00b5g) were electrophoresed on 7.5% acrylamide gel and then electrotransferred to PVDF membrane . Membranes were blocked for 1\u2009hr at room temperature with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) and then incubated overnight at 4\u2009\u00b0C with primary antibody against NHE1 . After washing with TBST, membranes were processed with horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:5000), and the protein bands were visualized using chemiluminescence . After detection of NHE1-immunoreactive bands, the same membranes were stripped and reprobed with \u03b2-actin monoclonal antibody  to confirm equal protein loading. For each sample, the optical density of the NHE1 band was quantified with ImageJ 1.45\u2009s (NIH), normalized to the loading control (\u03b2-actin), and then averaged across all gels.Western blotting was performed as described previouslyLights-on was designated Zeitgeber time (ZT) 0. For comparing the data recorded between day (ZT 4\u201311) and night (ZT 13\u201320), the animal was killed at ZT 2 and ZT 10, respectively.t test. Multiple comparisons among means were analyzed with one-way ANOVA, followed by post hoc Tukey\u2019s test for selected pairs comparison . Data were given as means\u2009\u00b1\u2009SEM. Statistical comparisons of means between two groups were analyzed using the unpaired Figs\u00a0 and 3D oson Figs\u00a0 and 5A,BSupplementary information"}
+{"text": "P,P,P-triphenylphosphineimidato-\u03baN)-phosphorus(1+) 1,3,5,7-tetrathia-2,4,6,8,9-pentaazabicyclo[3.3.1]nona-1,4,6,7-tetraene(1\u2212), CAS [48236-06-2], prepared by the literature method, is found by crystallography to be a 1:1 CH3CN solvate. Disorder exists for the N atoms of the anion. A VT crystal structure study was conducted at 100 K, 120 K, 140 K, 172 K, 200 K, 240 K and 280 K. The 100 K structure is superior, with only 10% of a second anion position oppositely-oriented w.r.t the diad axis of point group 2mm. At 120 K, an adjacent two-site disorder is encountered, but at higher temperatures three-site disorder with both opposite and adjacent placements of S4N5\u2212 ions is required w.r.t. the primary component. At 240 and especially 280 K, the anion nitrogen atoms appear fully scrambled amongst the six possible sites on the edges of an S4 tetrahedron with 83.3% occupancy for each. The PPN+ geometry does not show strong cation-cation interactions. However, there are numerous supramolecular contacts corresponding mostly to non-classical H-bonds between PPN+ ions and S4N5\u2212 as well as CH3CN. The geometry of the anion is corroborated from B3LYP/6-311++G(3df) DFT calculations, and the infra-red spectrum was assigned with excellent agreement between experimental and calculated frequencies.The title salt, triphenyl( PPN+ iof 143.1\u00b0 . Some stormation . The catparation  of 3.82  <7.25 \u00c5 . In [PPN+][S4N5\u2212] crystals provides a substantial orienting effect on the almost globular shape of the anion; apparently this is opposed by thermal energy that smoothly leads to the randomization of the occupancies already below RT. An analysis has been undertaken of the intermolecular interactions in the two limiting data sets, the 100 K structure in its major and minor occupancies, and the 280 K structure with its averaged environment. A diagram showing the interactions which are < \u2211rvdW for these three situations is provided in 4N5\u2212 ion, with the same colours identifying the same symmetry relationships in each picture. The numerical data corresponding to these pictures is provided in rvdW \u2212 0.1 \u00c5).The combined results of these models developed for crystals with different thermal histories suggests that the lattice in [S4N5\u2212]\u2219CH3CN were prepared according to the literature method [N5S4]\u2219C2H3N, with a FW of 777.89 amu. The crystal system is monoclinic and the space group is P21/c at all temperatures with Z = 4. Data and parameters specific to the different crystals measured and the different data collection temperatures are presented in http://www.ccdccam.ac.uk/const/retrieving.html or from the Cambridge Crystallographic Data Centre (CCDC), 12 Union Road, Cambridge CB2 1EZ, UK; fax: +44(0)1223-336033 or e-mail: deposit@ccdc.cam.ac.uk.Samples of [S4N5\u2212]\u2219CH3CN is not random. Non-classical H-bonds interact with the anion in a well-defined manner. However, the results to date do not allow for a clear discrimination between possible \u201crotational jump\u201d or 1,3-nitrogen shift mechanisms for the internal reorganization of the anion that is observed by crystallography.A thorough analysis of both the disorder phenomenon and the supramolecular interactions within the crystal lattice provides evidence that the behavior of [PPNIn conjunction with the first high-resolution diffraction study, this report provides an updated computational structure by modern DFT methods. These are in excellent agreement with the best crystal structure geometry. Moreover, the calculated vibrational spectrum is found to match well with literature reports and allows for an assignment of the major infra-red spectral bands."}
+{"text": "Introduction: Preclinical and clinical studies suggest that cannabidiol (CBD) found in Cannabis spp. has broad therapeutic value. CBD products can currently be purchased online, over the counter and at Cannabis-specific dispensaries throughout most of the country, despite the fact that CBD is generally deemed a Schedule I controlled substance by the U.S. Drug Enforcement Administration and renounced as a dietary supplement ingredient by the U.S. Food and Drug Administration. Consumer demand for CBD is high and growing, but few studies have examined the reasons for increasing CBD use.Materials and Methods: A self-selected convenience sample (n\u2009=\u20092409) was recruited via an online survey designed to characterize whom, how, and why individuals are currently using CBD. The anonymous questionnaire was accessed from October 25, 2017 to January 25, 2018. Participants were recruited through social media.Results: Almost 62% of CBD users reported using CBD to treat a medical condition. The top three medical conditions were pain, anxiety, and depression. Almost 36% of respondents reported that CBD treats their medical condition(s) \u201cvery well by itself,\u201d while only 4.3% reported \u201cnot very well.\u201d One out of every three users reported a nonserious adverse effect. The odds of using CBD to treat a medical condition were 1.44  times greater among nonregular users of Cannabis than among regular users.Conclusion: Consumers are using CBD as a specific therapy for multiple diverse medical conditions\u2014particularly pain, anxiety, depression, and sleep disorders. These data provide a compelling rationale for further research to better understand the therapeutic potential of CBD. Cannabis sativa L (Cannabis spp. or Cannabis), a plant more well known colloquially as marijuana and hemp. CBD is typically the second most abundant cannabinoid found in Cannabis after tetrahydrocannabinol (THC).1 CBD was first isolated in 1940 and characterized structurally in 1963.3Cannabidiol (CBD) is one of more than a hundred cannabinoids found in 5 Neither abuse nor dependence has been demonstrated.5 In preclinical studies, CBD shows potential therapeutic efficacy against a diverse assortment of medical conditions. These include seizure disorders, psychotic symptoms, anxiety, depression, inflammation, cancer, cardiovascular diseases, neurodegeneration, symptoms of multiple sclerosis, and chronic pain, either used alone or when coadministered with THC.5\u201320CBD is well tolerated in humans and maintains a good safety profile.Cannabis compound approved as a drug by the FDA. Availability of Epidiolex is pending Drug Enforcement Administration (DEA) rescheduling of cannabidiol, which is expected to occur within 90 days.21\u201323 Sativex (nabiximols), a combination drug with equal parts CBD and THC extracted from marijuana, is currently approved to treat spasticity due to multiple sclerosis in >30 countries worldwide but is not approved in the United States.21In October of 2017, a New Drug Application was submitted to the U.S. Food and Drug Administration (FDA) to seek approval of CBD isolated from marijuana for the treatment of two pediatric seizure disorders. Approval was granted in June, 2018, making Epidiolex (cannabidiol) the first plant-derived 5 While CBD is legal in many countries as a component of prescription Sativex (nabiximols), it may be simultaneously illegal as a component of a nonapproved Cannabis extract containing >0.2% (particularly in European countries) or 0.3% THC. In Europe, individual European Union Member States currently determine the legality of CBD within their borders. Most allow prescription CBD products, as do Australia and New Zealand.24 Canada became the second nation in the world to legalize Cannabis for recreational use in June 2018.25 The World Health Organization's Expert Committee on Drug Dependence recommended that CBD should not be controlled by Schedule I of the 1961 UN Single Convention on Narcotic Drugs.5 Their comprehensive report is expected this year.The worldwide regulatory status of CBD is complex and constantly changing.26 Thus, hemp cultivated in compliance with the Farm Bill is not a controlled substance. The Court did not address the issue of CBD directly, however, and left open the issue of the legal status of CBD derived from industrial hemp, from imported \u201cnonpsychoactive hemp\u201d or from parts of the Cannabis sativa plant excluded from the legal definition of marijuana in the Controlled Substances Act of 1970.27\u201335 Despite conflicting legal interpretations, and DEA prohibition, hemp-derived CBD products can currently be purchased as dietary supplements both online and over the counter throughout most of the country. To complicate matters further, the FDA does not recognize CBD as a dietary supplement ingredient because of its status as an Investigational New Drug.36In the United States, until such time as it is rescheduled, CBD from marijuana is deemed by the DEA to fall within the purview of the \u201cmarihuana extract rule\u201d (Rule). A dispute over the scope of the Rule was litigated in federal court. The Court found that the Rule applies to extracts of marijuana but that the industrial hemp provisions of the 2014 Farm Act  preempt the Controlled Substances Act (CSA), which the DEA enforces.37 Although Cannabis users have been extensively studied data characterizing the individual use of CBD are scarce. The goal of this study was to collect survey data to elucidate how, and why, individuals are using CBD.This regulatory confusion has not deterred consumers from exploring the purported benefits of CBD. Retail sales of hemp-derived CBD products in the United States reached $170 million in 2016, and are projected to grow at a 55% compound annual growth rate over the next 5 years to reach >$1 billion. These estimates do not include marijuana-derived CBD.The study protocol was submitted electronically to the Institutional Review Board (IRB) of San Diego State University. Given the voluntary nature of the survey, and the lack of identifying information, the electronic approval process determined that no IRB approval was necessary.\u00ae Survey Software, a secure tool allowing participants to directly enter responses anonymously.We developed a novel questionnaire to assess broad characteristics of self-described CBD users and underlying reasons for, and methods of, CBD use. The survey consisted of structured questions answered by either yes/no or multiple-choice responses. Questions focused on several key domains: sociodemographics; reasons for use; duration and frequency of use; method of administration; perceived clinical efficacy; and adverse effects. Study data were collected and managed using QualtricsSubjects were a self-selected convenience sample who accessed the online survey from October 25, 2017 to January 25, 2018. Recruitment strategies included promotion on survey-specific Web pages on Facebook, LinkedIn, and ResearchGate. CBD product manufacturers and herbal vaporizer manufacturers assisted in recruitment by promoting links to the survey on their Facebook pages and/or via email to their customers. The only inclusion criterion was current or prior use of CBD. Respondents could skip any question(s) they did not wish to answer.Descriptive statistics including simple proportions were used to describe demographics, usage characteristics, medical conditions, perceived efficacy, side effects, and other CBD use preferences. Data analyses were conducted using SAS University Edition . Univariate and bivariate comparisons were conducted using PROC FREQ and chi-square tests. Odds ratios (ORs) were used to estimate strength of association using PROC LOGISTIC. Statistical significance was assessed using \u03b1=0.05. Figures were produced using DeltaGraph version 4.5 for Mac.n=412, 21.90%; Cannabis use was reported by 55.17% of respondents.A total of 2490 responses were collected. Eighty-one respondents were excluded from the analysis for failure to answer the first question regarding stated use of CBD, leaving 2409 respondents included in the final study population. The sample was balanced in terms of gender  with most respondents reporting ages between 55 and 74 years (39.97%). Most were either graduates of, or currently enrolled in, college or a postgraduate program (71.22%). The vast majority resided in the United States (91.23%). Respondents from all 50 U.S. states were represented in the survey with the majority residing in California (n=25) and wide CI .More than 60% (61.56%) reported using CBD to treat a medical condition(s) . The oddCannabis when compared with regular users.The odds of using CBD to treat a medical condition were 1.44  times greater among nonregular users of There were 1483 respondents who reported using CBD to treat at least one medical condition. A minimum of 3963 medical conditions were reported. This represents an average of more than two and a half (mean: 2.67) different medical conditions per respondent.In order of frequency, the top three medical conditions reported were chronic pain, arthritis/joint pain, and anxiety .n=48), autoimmune conditions (n=38), and fibromyalgia (n=37).Respondents selected \u201cOther\u201d 362 times. The most common \u201cOther\u201d conditions reported were neuropathy  different methods of administration per respondent. Overall, the most common method reported was the administration of CBD in a sublingual form . This inn=1130; missing=209; not including \u201cOther,\u201d n=31). On average, respondents who reported using one method of administration were 1.6 times more likely to use CBD for a medical condition than for general health and well-being . Medical users reporting one method of administration were 2.4 times more likely to use a topical form, 2.0 times more likely to use an edible form of CBD, and 1.8 times more likely to use CBD in a sublingual or pill or capsule form than general health and well-being users reporting one method.More than half (51.36%) of those reporting a method of administration reported using only one method  times greater among respondents using it more than once per day compared with those using it daily . Duration=1483). Almost 36% (35.80%) of respondents reported that CBD treats their medical condition(s) \u201cvery well by itself,\u201d while only 4.30% reported \u201cnot very well\u201d  or \u201cmoderately well by itself\u201d . Seven hundred eighty-five (59.74%) of these effects were categorized as adverse , euphoria , hunger , red eyes , and sedation/fatigue . Just under 30% (28.46%) of medical users reported an adverse effect when compared with 34.56% of general health and well-being users.The top five most frequently reported adverse effects were dry mouth  that specifically analyzes CBD users, as opposed to overall 39\u201347 CBD acts as an agonist for a wide variety of cell-surface receptors including adenosine A2A, 5-HT1A, TRPV1, \u03b17nAch, \u03b13 glycine receptors, and the peroxisome proliferator-activated receptor gamma (PPAR-\u03b3) nuclear receptor. These receptors are all associated with anti-inflammatory activity.48\u201358 Consistent with the efficacy reported by survey respondents, CBD has been shown to reduce inflammatory cytokines in murine models of inflammatory disease and chronic and acute pain.59The most common medical condition for which CBD was reportedly used was pain. In preclinical studies, CBD-based analgesia is associated with potent immune-modulatory, anti-inflammatory, and antioxidant activity.60The endocannabinoid system may also play a role in CBD-mediated analgesia. CBD inhibits enzymes  that degrade endocannabinoids. This inhibition is associated with increased endocannabinoid levels, analgesia, and opioid-sparing effects in preclinical models of pain.61\u201363 CBD may also reduce anxiety via the serotonin 5-HT1A and/or GABAA receptors.64 These receptor pathways are being explored in hopes of novel therapeutic strategies for phobias, post-traumatic stress disorder, and drug abuse.66Anxiety and depression were also commonly reported reasons for CBD use in this survey. CBD has long been proposed to inhibit THC-associated anxiety by antagonizing cannabinoid receptor activation by THC.67 This industry survey was collected from customers of an online medical marijuana recommendation service. Presumably, these respondents were seeking marijuana-derived products, so the frequency of inhalation as a method of administration is consistent with marijuana users overall.68 Our finding may be in part due to the fact that hemp-derived CBD products are largely distributed online and in health-food stores and widely offered as oral preparations.The majority of survey respondents learned about CBD from internet research, family members, or friends. This was the case for both medical and general health and well-being users. Over 74% of respondents reported using CBD daily or more than daily. Sublingual delivery was the most common route of administration in both groups. The frequency of use of sublingual preparations found in this study contradicts a recent industry-funded CBD survey where respondents reported more frequent vaping, smoking, and topical use.Cannabis use is markedly higher than national estimates. In 2015, an estimated 8.3% (\u223c22.2 million people) of individuals aged 12 years or older had used marijuana in the past month.69 The reason for the higher rate of Cannabis use among survey respondents is not clear, although one possibility is that Cannabis users would be more likely to have heard of CBD. However, CBD use by a relatively high percentage (44.83%) of nonregular Cannabis users suggests that individuals are not using CBD as a perceived legal route to THC consumption.The percentage of respondents (55.17%) who reported regular 7 other studies have demonstrated no adverse effects.70\u201372 This dichotomy may be related to dose, interactions with prescription medications, or both. More broadly, adverse effects may also be related to the method of administration and/or the use of purified, high-dose CBD as opposed to CBD in a whole plant extract. These questions and more reinforce the need for more research on unanticipated consequences of CBD use, particularly the impact of long-term usage.5 Many of the adverse effects reported in this study  are commonly associated with THC use.73 These analyses did not attempt to discriminate between hemp-derived CBD and marijuana-derived CBD products, which may have differing chemical constituents (including THC content) and therefore different effects. Further, no discrimination could be made between isolated CBD and CBD used as a constituent of a whole plant extract.Approximately half of all respondents reported using CBD for <1 year. Just over 10% reported using CBD for >5 years. Nonserious adverse effects were relatively common among respondents and higher among those using CBD for general health and well-being, despite the fact that this group reported less frequent use than medical users. While dry mouth, sedation/fatigue, decreased appetite, and diarrhea have previously been reported following CBD use,67\u201374 It is worth noting that independent research has confirmed that the CBD content in almost 70% of CBD-labeled products available online may be mislabeled. In one study, 43% of products were underlabeled and 26% were overlabeled for actual CBD content. More than 20% contained detectable levels of THC.75 Since CBD-containing products are largely unregulated there is no obvious way for users to know the quantity of CBD, or other constituents, which may be present in the products they use. Given this uncertainty, it is possible that some of the reported efficacy and the adverse effects may be in part due to the inclusion of other compounds in the CBD preparation, including THC.Industry-originated studies have found that users are confused about the source of their CBD and the concentration of CBD and other ingredients.This study has several strengths, including the size, geographic representation of the sample, wide age range of the respondents, and a focus on specific usage characteristics. In part, this was the result of utilizing multiple recruitment methodologies.Cannabis are more likely to have responded to the questionnaire than those with negative opinions and experiences. In addition, \u201cregular cannabis use\u201d was not defined in the survey and \u201cmarijuana\u201d was not distinguished from \u201cCannabis.\u201d Since the survey was primarily circulated via the internet, CBD users with limited social media connectivity would be underrepresented. Finally, no mechanism for identifying repeat respondents was incorporated into the survey. Although results were examined manually, it is possible that repeat respondents may have distorted the results .In terms of limitations, the study population was a self-selected convenience sample, and as such, may not be representative of the general population or the overall population of CBD users. Individuals with favorable opinions of or experiences with CBD or The use of CBD among individuals for both specific health conditions and general health and well-being is widespread. The results of this study demonstrate that individuals are learning about CBD from the internet, friends, or family members, rather than from healthcare professionals. CBD is being used as a specific therapy for a number of diverse medical conditions\u2014particularly pain and inflammatory disorders, in addition to anxiety, depression, and sleep disorders. A large percentage of respondents indicate that CBD treats their condition(s) effectively in the absence of conventional medicine and with nonserious adverse effects. These data provide a compelling rationale for further research to better understand the therapeutic potential of CBD in treating chronic pain, anxiety, depression, sleep disorders, and other medical conditions."}
+{"text": "Cannabidiol (CBD) is ubiquitous in state-based medical cannabis programs and consumer products for complementary health or recreational use. CBD has intrinsic pharmacologic effects and associated adverse drug events (ADEs) along with the potential for pharmacokinetic and pharmacodynamic drug\u2013drug interactions (DDIs). Given CBD use among patients with complex conditions and treatment regimens, as well as its expanded consumer use, awareness of potential safety issues with CBD is needed. Prescribing information for federally approved products containing CBD were reviewed. Data on ADEs and DDIs were extracted and summarized. Nearly one-half of CBD users experienced ADEs, which displayed a general dose-response relationship. Common ADEs include transaminase elevations, sedation, sleep disturbances, infection, and anemia. Given CBD effects on common biological targets implicated in drug metabolism  and excretion , the potential for DDIs with commonly used medication is high. General clinical recommendations of reducing substrate doses, monitoring for ADEs, and finding alternative therapy should be considered, especially in medically complex patients. CBD is implicated as both a victim and perpetrator of DDIs and has its own ADE profile. These effects should be considered in the risk-benefit assessment of CBD therapy and patients and consumers made aware of potential safety issues with CBD use. Cannabis sativa L.; or \u201cmarijuana\u201d) is the most commonly used illicit substance worldwide [Cannabis . However, recognition that this general benignancy of CBD is perhaps only applicable to younger, healthier individuals using cannabis recreationally creates a tremendous patient safety concern in this new era. Particularly given the potential for other adverse drug events (ADEs) and drug\u2013drug interactions (DDIs) with CBD.CBD exhibits both pharmacodynamic (PD) and pharmacokinetic (PK) properties that could lead to ADEs and DDIs ,4. WholeWith the wide proliferation of CBD, the potential for public harm, and the dearth of evidence surrounding CBD\u2019s potential for ADEs and DDIs, the objective of this narrative review was to summarize existing information regarding potential ADEs and DDIs with CBD from the prescribing information for approved pharmaceutical products and other existing literature for the use by clinicians and consumers. This review considers DDIs in the context of both medical and recreational/consumer use of CBD with consideration for CBD as both a victim and perpetrator of DDIs and synergistic ADEs. We further consider the underlying indications for CBD use and medications used for those disorders in the context of ADE/DDI risk and make general recommendations for co-prescribing  or avoiding certain combinations. We further introduce and discuss the regulatory environment for cannabis, hemp, and CBD as it pertains to the scope and magnitude of use.https://www.drugbank.ca/) was used as a consistent drug information resource to describe potentially interacting, enzyme substrates, and pharmacodynamic effects throughout the review.For this review, full prescribing information or monographs and new drug applications (NDA) were extracted from federal agency websites . Products included two federally approved and regulated products containing CBD: Sativex (THC + CBD or \u201cnabiximols\u201d)  and EpidN = 23 states) or a restrictive program based on CBD with restrictions on the THC allowed (N = 13 states) while four states  have no program in place [CBD is increasingly used in state-approved medical cannabis programs. These programs range from what is deemed a \u201ccomprehensive\u201d program that allows CBD and THC use N = 3 states in place . With muowed N =  states win place ,15,16.CBD is expected to have potential for broad therapeutic use. Potential uses of CBD alone or in combination with THC include epilepsy, pain, cancer, inflammation, anxiety, neurodegeneration, multiple sclerosis, psychotic disorders, and depression ,21,22,23CBD-based consumer products have entered the U.S. market spurred in part by the 2018 \u201cFarm Bill\u201d , which e\u00ae  [Two CBD containing pharmaceutical products are currently marketed. These include Sativexuticals) , a combiuticals) .Epidiolex contains only CBD in an oral solution with 100 mg/mL CBD. It is approved by the U.S. FDA for seizures associated with Lennox\u2013Gastaut or Dravet syndromes only and is dosed by weight at a recommended 10 mg/kg daily  or a maximum of 20 mg/kg daily (1000 mg for a 110-pound person) . Table 1Potential for ADEs and DDIs is based on pharmacologic targets of CBD, pharmacodynamic effects, and interactions between CBD and other medications related to metabolism, absorption, and elimination. Descriptions of potential ADEs and DDIs is henceforth divided by description of the mechanism of the DDI or ADE, which included metabolic inhibition and induction; phase II metabolic pathways; drug transport; and pharmacodynamic effects. A brief discussion of CBD\u2019s pharmacologic targets and effects is also included.1 is the primary target for most desired therapeutic effects of THC but is also dose limiting given effects on mood, memory, and anxiety. CBD actually has low affinity for CB receptors and is considered a negative allosteric modulator of the endogenous cannabinoid, anandamide [2, which is strongly implicated in the immune system, and may contribute broad and varied anti-inflammatory effects [Cannabinoid (CB) receptors make up part of the endocannabinoid system, which leads to many of the therapeutic uses of cannabis product with roles in appetite, sleep, and pain sensations, as well as roles in the immune system, thermoregulation, and so on ,30. CB1 andamide ,31. CBD  effects ,33,34. OA comprehensive review of these targets and potential effects can be found elsewhere . Other mCBD and its primary active metabolite 7-hydroxy CBD (7-OH-CBD) have similar reported effects on a number of CYP450 enzymes. CYP450 enzymes are implicated in the primary metabolism and biotransformation of the majority of therapeutic agents and xenobiotics . Each prmax decreased by 52%. Administration with omeprazole , a CYP2C19 inhibitor led to no changes [There is little in vivo evidence related to CBD as a victim of metabolic DDIs. When co-administered with 3A4 inhibitors CBD and its active metabolite have increased systemic exposures and decreased exposures when co-administered with a 3A4 inducer. In a study where Sativex (four sprays) was co-administered with ketoconazole , a strong 3A4 inhibitor, CBD bioavailability increased by 89% . In that changes .max of 73% and AUC of 47% for CBD and 7-OH-CBD. Moreover, clobazam concentrations increased by a mean 60% and its active metabolite norclobazam was increased by 3\u20135-fold. These findings were confirmed in additional in vivo studies with additional observed increases in topiramate, rufinamide, zonisamide, and eslicarbazepine [One study tested in vivo DDI potential between CBD and co-administered clobazam, which is metabolized extensively by CYP3A4, CYP2C19, and CYP2B6, and also may be a competitive inhibitor on these isoforms . Notablybazepine . It is wbazepine . CDB hasbazepine ,45,46,47For the confirmed CYP450 isoforms 3A4 and 2C19 that are important to CBD metabolism, these enzymes are associated with some of the most common drugs implicated as inhibitors and inducers. These drugs have overlap with CBD and cannabis-related indications including epilepsy, chronic wasting disease in HIV/AIDS, and cancer. As CYP3A and CYP2C families are implicated in the metabolism of at least ~30% and ~25% of medications  the probFor recreational and consumer use, CYP3A4/2C19 inhibitors, substrates, and inducers are common medications representing common indications  used both acutely and chronically. These interactions can potentiate a wide array of ADEs and negative clinical outcomes specific to the substrate and indicated treatment. Thus, caution should be taken with any concomitant use between CBD and many common medications used by otherwise healthy persons. Further polymorphisms and actionable phenotypes of CYP2C19 and, to a lesser extent, CYP3A4, are not rare (~20%) and should be considered an additional source of variability and concern in the presence of CBD and other substrates of these enzymes ,49. LastProduct labeling suggests CBD has inhibitory effects at clinically relevant dosing on UGT1A9, and UGT2B7 and recommends dosing changes in the presence of CBD . UridineCBD and its active 7-OH-CBD metabolite have no predicted activity on drug transporters. However, the inactive, hydroxylated, 7-COOH-CBD metabolite ,51, whicExtrapolations of common ADEs observed with CBD in clinical trials provide insight into synergistic DDIs that may occur. CBD is administered in patients with serious medical conditions that are treated with medications that have their own side effect profiles. Co-administration increases the potential of experiencing overlapping profiles even with direct DDIs via metabolic or transport pathways. CBD, compared to THC, does have noteworthy benefits in some complex patient profiles such as no addiction potential and fewer psychomimetic effects overall. However, these benefits and effects of THC are beyond the scope of this review.While clinical trials of approved products provide insight to pharmacodynamic DDIs, caution should be taken in interpretation as the study cohorts include children and adults with serious epilepsy, multiple sclerosis, or other conditions and are not fully generalizable to all users. While we have reviewed both Sativex and Epidiolex prescribing information, this section includes a review mostly of Epidiolex prescribing information and other literature only as that product contains only CBD and many side effects associated with Sativex are indicative of THC rather than CBD such as psychoactive effects and cardiovascular warnings. Further, adverse effects of Epidiolex are reported for the recommended maintenance dose of 10 mg/kg/day as well as the maximum recommended dose of 20 mg/kg/day . There iFurther, variation will be introduced by \u201cdosage\u201d form, such as edible, vapor, or purified liquids as well as the dispensary or manufacturer . EdiblesConsidering variation in cumulative ADE risk, consumer use versus medical or complementary health use may vary. Many users may sporadically be exposed to CBD while others may consume it daily or multiple times per day. Inhibitory actions on metabolism or drug transport and pharmacodynamic interactions can be immediate in most cases whereas inductive effects require prolonged exposures . Many ADEs such as somnolence, insomnia, and sleep disturbances are likely to occur even with sporadic and acute exposure while infections, transaminase elevations, and weight loss will require prolonged exposure.Adverse effects associated with CBD appear to be dose dependent though not proportional in all cases. In phase III clinical trials, 2.7% versus 11.8% patients discontinued CBD treatment between the 10 mg/kg/day and 20 mg/kg/day treatment arms versus 1.3% for placebo.The most frequent cause of discontinuation was transaminase elevation, which occurred in 8%, 16%, and 3% for the 10 mg/kg/day, 20 mg/kg/day, and placebo arms, respectively. Caution should be taken when CBD is used with medications with potential to cause hepatic injury or in people with pre-existing hepatic impairment, such as alcoholics or those with hepatitis. Such medications implicated with hepatic injury reports may include antiepileptics, antipsychotics, acetaminophen, certain antibiotics , antifungals, and verapamil. CBD as prescribed in Epidiolex carries a recommendation for a lowering by half for the starting, maintenance, and maximum doses  with mild hepatic impairment (Child-Pugh A), reduction to 1.25, 2.5, and 5 mg/kg/day for moderate impairment (Child-Pugh B), and further reduction for severe (Child-Pugh C) of 0.5, 1, and 2 mg/kg/day [Common to cannabis-derived therapeutics are the general side effects of somnolence, sedation, lethargy, fatigue, and asthenia. In clinical trials, these occurred frequently in treatment groups and exhibited a modest dose-response relationship. Somnolence in particular occurred in 23% and 25% of patients treated with CBD (10 and 20 mg/kg/day), followed by fatigue 11% and 12%), lethargy (4% and 8%), and sedation (3% and 6%). Such side effects are also attributable to commonly prescribed medications such as benzodiazepines, opioids, antidepressants, antiepileptics, and antihistamines, which are used by medically complex and healthy persons alike. Co-administration will likely potentiate lethargic and sedative effects and may lead to excessive sedation, interruption in daily activities or work, and create a public health hazard via sedated drivers. Where possible, co-administration should be avoided, and patients and consumers counseled or informed of the potential for excessive sedation and steps to mitigate risk to themselves and others such as not operating vehicles or reserving CBD use for nighttime use. Clinical trials suggest that this side effect may also diminish with prolonged therapy so, when needed, a lower starting dose and slower titration may allow for continued CBD use until tolerance is achieved [% and 12%Insomnia and sleep disruption were also observed with an inverse relationship to dose in 11% and 5% of patients in clinical trials. It is unclear if this dose-response relationship is related to target pathways and associated affinities for receptors or simply spurious. While a direct pathway for this adverse effect with CBD is uncertain, insomnia and sleep disruption are also side effects of other medications including antidepressants, dopamine agonists, stimulants, antiepileptics, steroids, diuretics, and beta-blockers. CBD users with these side effects should consider alternative regimens, dose of CBD or other medications, and the timing of doses. Additional pharmacotherapy to improve sleep with hypnotics or other sedatives would not be recommended given the aforementioned potential for excessive sedation. Sleep disturbances may also coincide with increased anxiety or mood changes, which should also not be managed by additional pharmacotherapy as the potential for ADE synergism is high.It is noted in prescribing information that all antiepileptic and many psychoactive medications have an increased risk of suicidal behavior and ideation, which is highest in epilepsy patients (3.5-fold increased relative risk). While not specifically assessed in a clinical study, prescribing information for Epidiolex mentions, though without any black box warnings, assessment of risk-benefit for CBD therapy related to suicide risk . In addiOther general side effects experienced by CBD users in clinical trials include weight loss, infections, and hematologic abnormalities. Weight loss is likely a result of decreased appetite, which was common with 16% and 22% of CBD-treated patients versus 5% in the placebo arm as well as increased diarrhea (9% and 20% vs. 9%). This can be complicated as other medications such as stimulants, antibiotics, chemotherapies, antiretrovirals, and some antidepressants also decrease appetite and increase weight loss. Particularly in cancer and HIV/AIDS, decreased appetite is a common indication for medical cannabis use and could conceivably be made worse with CBD in some users. While weight loss may be a desirable side effect for some users with other less serious conditions, weight loss or the underlying decreased appetite could complicate treatment, change how other medications are absorbed, or lead to other vitamin or mineral deficiencies. Complications can further include cardiovascular manifestations, liver damage, and osteoporosis if malnutrition is severe . In suchHematologic abnormalities were related to an increase in laboratory-defined anemia in 30% of treated patients versus 13% on placebo. The underlying mechanism is unknown; however, it may be due to decreased appetite and associated mineral deficiencies . Common Infection risk was 10% higher in CBD treated persons, particularly viral infections and pneumonia. Cannabinoids, via the CB-receptors, are thought to modulate the immune system and decrease immune response, particular of T-cell lymphocytes . CautionFor older patients with severe comorbidities in particular, it is noteworthy that Sativex carries a contraindication in its international product labeling for any users with pre-existing cardiovascular disease, which is likely attributable solely to THC sympathomimetic properties . HoweverContrary to popular belief and anecdotal evidence, CBD is not a biologically inert compound. Rather, CBD has a complex pharmacokinetic and pharmacodynamic profile similar to any other medication with the potential to interact with other medications and medical conditions. Medical CBD users under clinical supervision should be screened for potential DDIs and ADEs between CBD, other pharmacotherapies, and their underlying conditions. Increased awareness is needed among the lay public who are recreational or consumer CBD users. Healthcare providers should also be aware of the potential for DDIs and ADEs with CBD and strategically prescribe and manage patient regimens while also considering patient desires for complementary or alternative therapies."}
+{"text": "Streptomyces, Micromonospora, Mycobacterium, Brevibacterium, Curtobacterium and Kineococcus based on their 16S rRNA sequences. Further whole genome sequencing analysis of one of the isolated Streptomyces sp., which presented 99.13% sequence similarity with Streptomyces parvulus strain 2297, showed that it consisted of 118 scaffolds, 8,348,559 base pairs and had a 72.28% G\u2009+\u2009C content. In addition, genome-mining revealed that the isolated Streptomyces sp. contains 109 gene clusters responsible for the biosynthesis of known and/or novel secondary metabolites, including different types of terpene, T1pks, T2pks, T3pks, Nrps, indole, siderophore, bacteriocin, thiopeptide, phosphonate, lanthipeptide, ectoine, butyrolactone, T3pks-Nrps, and T1pks-Nrps. Meanwhile, the small molecules present in ethyl acetate extract of the fermentation broth of this strain were analyzed by LC-MS. Predicted secondary metabolites of melanin and desferrioxamine B were identified and both of them were firstly found to be produced by the Streptomyces parvulus strain. Our study highlights that combining genome mining is an efficient method to detect potentially promising natural products from mangrove-derived actinomycetes.Actinomycetes are a heterogeneous group of gram positive filamentous bacteria that have been found to produce a wide range of valuable bioactive secondary metabolites, particularly antibiotics. Moreover, actinomycetes isolated from unexplored environments show an unprecedented potential to generate novel active compounds. Hence, in order to search for novel antibiotics, we isolated and characterized actinomycetes strains from plant samples collected from a mangrove in Macau. Within the class of actinobacteria, fourteen actinomycetes isolates have been isolated and identified belonging to the genus of  Actinomycetes has been extremely useful to the medical industry due to their astonishing ability to produce secondary metabolites with diverse antimicrobial activities and complex chemical structures2. Actinomycetes are usually isolated from natural soil environment3, and many antibiotics and secondary metabolites have been derived from them and used extensively5. However, in recent years, the chances of discovering completely novel natural products from known actinomycetes strains have reduced6, which means that we need to focus on the isolation of actinomycetes strains from new, unexplored or extreme environments, such as the marine environment9.Secondary metabolites, also referred to as natural products, are small, organic molecules that have diverse and often very potent biological activities10. The mangrove has recently been demonstrated to be an ecosystem with many unique forms of actinomycetes due to its sediment properties of anaerobic condition, and due to being rich in sulphide, with high salinity and organic matter content11. Such conditions are extremely different from terrestrial conditions, such that microbial living there, especially actinomycetes, have distinctive characteristics from terrestrial actinomycetes and therefore might have the potential to produce special or unknown bioactive metabolites13. This unique adaptation characteristic of actinomycetes could serve a source of important or novel natural products14. Previous research supports this viewpoint and it has been demonstrated that actinomycetes from mangrove can produce novel types of new secondary metabolites15. Many secondary metabolites have also been obtained from mangrove actinomycetes strains and possess immense biological activities16.Mangroves, which are important inter-tidal estuarine wetlands along coastlines of tropical and subtropical regions, are often situated in areas of high anthropogenic influence, being exposed to pollutants18. Compared to traditional cultivation methods, an improved strategy is searching for secondary metabolites by combining DNA technology for capturing genes and complete pathways of secondary metabolites producers19. Approximately 50% of actinomycetes strains are from the genus Streptomyces, and about 75% of commercially useful antibiotics are derived from this genus20. The first complete genome of the model strain of Streptomyces coelicolor have was in 2002 and revealed unprecedented potential to synthesize antibiotic compounds previously undetected by traditional cultivation, extraction and bioactivity testing21. To date, several strains of Streptomyces have been characterized and are publicly available24. Therefore, sequencing actinomycetes strains from mangroves may provide insight for the discovery of novel secondary metabolites. Moreover, genome-guided investigation of secondary metabolites may also help us to detect biosynthesis genes that cannot be expressed, or are expressed at a very low level, in laboratory conditions25.Molecular ecological studies on microbial communities from mangrove environments revealed the presence of a rich diversity of actinomycetes taxaMacau mangrove forest is a unique habitat within a tropical and subtropical tidal area. It is located on the Pearl River Delta, which is vulnerable to developments in the area and is also a heavily exploited ecological niche. The aim of this study was (1) to isolate actinomycetes strain from mangrove plants using a culturable method and to identify the isolates using 16S rRNA sequences; (2) to use whole-genome sequencing to detect the biosynthetic gene cluster and enzymes related to antibiotic production; and (3) to do a preliminary analysis of small molecule compounds as fermentation products of LC-MS. With this study, we hoped to discover some prominent antibiotics candidates for further research and applications in the medical industry.Acanthus ilicifolius, Aegiceras corniculatum and Kandelia candel. Samples were collected at three different sites, including a high salt environment (1) (22\u00b08\u203230\u2032\u2032N 113\u00b033\u203211\u2032\u2032E), a coastal area (2) (22\u00b08\u203229\u2032\u2032N 113\u00b033\u20325\u2032\u2032E) and a polluted environment which is adjacent to a sewage plant (3) (22\u00b07\u203251\u2032\u2032N 113\u00b033\u20327\u2032\u2032E) (Table\u00a0Kandelia candel was only collected from area (2), because of which not found in the high salt and polluted environments while only Aegiceras corniculatum could be found near the sewage plant. Collected plant specimens were placed into sterile plastic bags and immediately transported to the laboratory.Plant samples were collected from a mangrove forest located in Macau, China from March 2017 to May 2017. Samples were collected from three different mangrove trees, including 2O3 for 10\u2009min, 75% ethanol for 7\u2009min and 10% NaHCO3 for 10\u2009min26. The cleaned samples were smashed by adding 50\u2009mL sterile PBS buffer. After dilution into 10\u22124, fractions (100\u2009uL) preparations were plated onto isolation plates.The plant samples were surface-cleaned with 1% Tween-20 for 1\u2009min, NaClO (0.4%) for 8\u2009min, 2.5% NaS27, ISP media 4 2SO4, 2.0\u2009g CaCO3, 0.001\u2009g FeSO4.7H2O, 0.001\u2009g MnCl2.4H2O, 0.001\u2009g ZnSO4.7H2O, 20.0\u2009g agar, pH 7.2)28, ISP media 7 22, Gauze No.1 29, Nutrient Agar 30, halothiobacillus HL2 medium 31 and Czapek 32. All mediums were supplemented with potassium dichromate (100\u2009mg/L) and incubated at 28 \u00b0C for 7\u201330 days33. Purified cultures were maintained on ISP media 2 and isolates were conserved at 4 \u00b0C for short-term storage, and as glycerol suspensions  at \u221220 \u00b0C for long-term storage.Dilutions of suspensions of each sample were spread onto seven different types of isolation medium: ISP media 2 34. The PCR reaction was performed in a final volume of 50\u2009\u03bcL, which was composed of template DNA (1\u2009\u03bcl upper aqueous layer), 1.5\u2009mM MgCl2, 0.2\u2009mM of each dNTP, 200 pM of primer, and 2U of Taq polymerase with the appropriate reaction buffer under the following conditions: initial denaturation at 95\u2009\u00b0C for 5\u2009min, followed by 35 cycles of 94\u2009\u00b0C for 1\u2009min, annealing at 55\u2009\u00b0C for 1\u2009min, and 72\u2009\u00b0C for 2\u2009min. The amplification products were separated by gel electrophoresis in 1% agarose gel. The products were then sequenced using the Sanger sequencing platform.The DNA of isolated colonies were extracted to identify the bacteria species. Each culture was suspended in 50\u2009mL Chelex-100 buffer and boiled for 15\u2009min at 99 \u00b0C and 650\u2009rpm. The resultant preparations were centrifuged at 17,000\u2009g for 30\u2009min at room temperature. The upper layers, which contained DNA, were transferred to new tubes and used as DNA template. The DNA yield and quality were assessed using 1.0% (w/v) agarose gel electrophoresis. The primer pair 27\u2009F (5\u2032-AGAGTTTGATCCTGGCTCAG-3\u2032) and 1492\u2009R (5\u2032-TACGGCTACCTTGTTACGACTT-3\u2032) were used for PCR amplificationGenomic DNA was isolated using the TIANamp Bacteria DNA Kit (TIANGEN Biotech Co. LTD). The genomic DNA library was constructed using the NEBNext Ultra II DNA Library Prep Kit for Illumina sequencing. The library was sequenced using an Illumina NovaSeq HiSeq. 4000. Genome assembly of the pooled sequencing reads was performed by IBDA, MetaGeneMark was used for gene prediction. Transfer RNAs (tRNAs) were predicted by tRNAscan-SE and ribosomal RNAs (rRNAs) by rnammer. Functional categories were assigned by searching against the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.Streptomyces sp.03 was retrieved from the annotation results. In our study, ten relevant actinomycetes species were selected, the sequences of which were downloaded from the NCBI database to further verify the branches.Mega 7.0 was used to demonstrate an evolutionary phylogenetic relationship among different species; 16S rRNA sequences of Streptomyces coelicolor A3(2) , Actinoplanes friuliensis HAG010964 , Streptomyces sp. SCSIO 01127 , Streptomyces viridochromogenes , Streptomyces kanamyceticus strain BCCO 10_900 , Streptomyces griseoflavus strain SAEM-16 , Streptomyces parvulus strain NBRC 13193\u2009T (Biosample accession: KY777591.1), Streptomyces parvulus strain 13193\u2009T (Biosample accession: KY771080.1), Streptomyces parvulus strain SPS-W1 (Biosample accession: KY458978.1), and Streptomyces parvulus strain K-15 (Biosample accession: KY038196.1).These species are https://antismash.secondarymetabolites.org/#!/about). The assembled scaffolds of the Streptomyces sp.03 were submitted to the anti-SMASH server to search for potential secondary metabolite biosynthetic gene clusters. The core structures of secondary metabolites biosynthetic gene clusters were identified by anti-SMASH and extracted for comparison with known gene clusters of other species using BLAST.The online software of anti-SMASH was used to predict the gene clusters and secondary metabolites (35 (http://www.hmdb.ca/).ISP media 2 was used as the fermentation medium. The purified isolates were transferred to a 50\u2009mL centrifuge tube containing 20\u2009mL of the fermentation medium and cultured at 250\u2009rpm, for 7 days at 28 \u00b0C. Crude extracts were prepared by adding 60\u2009mL ethyl acetate to the cultures, and the fraction of the resultant extracts were dried at 60 \u00b0C, dissolved in 3\u2009mL methanol and used in the biochemical screen. An 4000 Q TRAP LC/MS/MS system was interfaced with the mass spectrometer for secondary metabolites separation and analysis by micro-ESI-MS. Full-scan data was acquired in the positive ion mode from 100 to 1000\u2009m/z at an flow rate of 0.6\u2009s per spectrum through the MS analysis. ESI source were set as follows: capillary voltage of 3.0\u2009kV, sample cone voltage of 20\u2009V. The metabolic profiling including the chromatographic peak was identified by comparing with the Human Metabolome Database (HMDB)Streptomyces, Micromonospora, Mycobacterium, Microbacterium, Kineococcus and Brevibacterium. All the actinomycetes strains were isolated from seven isolation mediums, namely ISP2, ISP7, Nutrient agar, Gauze No.1 and Czapek. These results indicated that Gauze No.1 was the most suitable medium for isolation of actinomycetes strains from plant samples and most of the actinomycetes strains were isolated from Kandelia candel. Among them, one Streptomyces sp.03 which show 99.13% 16S similarity with Streptomyces parvulus was selected for further genome analysis and secondary metabolite identification.In total, 71 bacteria isolates were isolated from plant samples, among which 14 isolates were identified as belonging to the class of actinobacteria , but have a relatively long distance with Streptomyces kanamyceticus strain BCCO 10900, Streptomyces griseoflavus strain SAEM-16 and Actinoplanes friuliensis strain HAG 010964. Therefore, the results showed that Streptomyces sp.03 have a close genetic distance with Streptomyces parvulus strain, for which the name Streptomyces parvulus strain 03 was proposed.Phylogenetic analysis based on 16S rRNA sequences showed that Streptomyces parvulus strain 03 has 99.13% 16S rRNA gene similarity to the sequence of Streptomyces parvulus strain 2297. Streptomyces parvulus, a species firstly identified from a soil sample by Waksman in 1940, was reported to produce several bioactive compounds including Actinomycin D, Borrelidin, Manumacin A, B and C, and Oleficin36. Whole-genome sequencing of the Streptomyces parvulus strain 03 produced a total of 6,147,555 reads and 118 scaffolds , T2pks (type II polyketide synthases), T3pks (type III polyketide synthases), Nrps , indole, siderophore, bacteriocin, thiopeptide, phosphonate, lanthipeptide, ectoine, butyrolactone, T3pks-Nrps, T1pks-Nrps and other products , and 1 catalytic domain related to the non-ribosomal peptide synthetase  to the existing cluster of Streptomyces coelicolor A3(2), with respect to the similar amino acid sequence of 85% identity.The coelinchelin biosynthesis gene cluster of Streptomyces parvulus strain 03 have high potential for producing a friulimicin-analog.Another NRPS-type gene cluster contains 28 ORFs and is responsible for friulimicin biosynthesis  and desferrioxamine B .Fermentation studies were performed to test the hypothesis of whether the predicted secondary metabolites can be produced. Mass spectral data was obtained in positive mode. From the UPLC-MS profiles, the metabolic substances in the fermentation broth were identified according to the mass-to-charge ratio of molecular ions. Profiles of secondary metabolites present in isolates strain were compared with the genome mining data. In this case, two predicted secondary metabolites were identified in the extract, including melanin  revealed that more than 20 clusters coding for known or predicted secondary metabolites21. Engineered Streptomyces avermitilis host about twenty of the biosynthetic gene clusters for secondary metabolites52. In addition to that, some other Streptomyces strains have finished the genome sequencing. Such as the streptomycin-producing microorganism Streptomyces griseus IFO 13350 contains 34 gene clusters for the biosynthesis secondary metabolites53. Moreover, in previous studies, Streptomyces parvulus has been widely reported to produce actinomycin D, borrelidin (an angiogenesis inhibitor), manumycin A, B and C (antineoplastic agents) and oleficin 56. However, in our study comparing the rich genetic potential for secondary metabolites in the isolated Streptomyces parvulus strain 03 genome, only borrelidin was found in the biosynthetic gene cluster prediction. Moreover, these predicted compounds have never been identified and reported in any fermentation cultivation condition by Streptomyces parvulus54. Predicted gene clusters from the Streptomyces parvulus strain 03 were widely identified in other Streptomyces strains and non-Streptomyces strains, such as Actinoplanes friuliensis, Streptomyces sp. SCSIO 01127, Streptomyces viridochromogenes, Streptomyces griseoflavus, Streptomyces pristinaespiralis, and Streptomyces kanamyceticus62. Meanwhile, we can also observe that these mentioned species exhibited a relevant close relationship with the Streptomyces parvulus strain 03 in the phylogenetic tree. It is unquestionable, based on the analysis of the genome of Streptomyces parvulus strain 03 isolated from mangrove, that secondary metabolite production patterns are highly complex. Thus, genome sequencing results showed that bacteria will have adaptation strategies to cope with extreme environments64. Compared with normal strains, the genome of bacteria growing in extreme environments have a greater number of genes involved in various metabolic pathways65. Therefore, actinomycetes strains isolated from extreme environments, such as mangrove, with the support of DNA sequencing technology and bioinformatics may keep an unimagined potential to explore novel or more natural products.Sequenced genomes can provide substantial evidence of rich secondary metabolic pathways. For example, regarding the biosynthetic pathway of kanamycin B and kanamycin A in Streptomyces parvulus strain 03 can produce the secondary metabolites of melanin and desferrioxamine B via genome mining. This result highlights that most biosynthetic gene clusters are cryptic, at least under typical laboratory culture conditions66. As we know, secondary metabolites production of a microorganism are catalyzed by a series of enzyme-encoding genes67. The first NRPS-independent pathway of DKP biosynthesis was discovered in Streptomyces noursei in 2002, which showed that a probable tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase and a probable NADP-specific glutamate dehydrogenase were involved in the DKP biosynthesis pathway68. Thus, genes involved in the production of metabolic substances might be silenced, as influenced by a specific regulation mechanism in the genome69, or the gene cluster may be un-expressed under normal cultivation conditions in the laboratory70.In the fermentation experiment, we demonstrated that the isolated 71. Streptomyces has a long history for the production of melanin, meanwhile, melanin formation in the Streptomyces species is the key feature for the classification of the Streptomyces group72. In our study, the saccharide-melanin was found from the Streptomyces parvulus strain. Up to now, there is no report suggesting that Streptomyces parvulus strain can produce saccharide-melanin. Hence, our study indicated that the Streptomyces parvulus strain have more biosynthesis potential waiting to be explored. In addition, desferrioxamine B can also be found in the fermentation broth, which is a specific iron complexing agent. It is available for clinical use as \u2018Desferal\u2019 (desferrioxamine B methanesulphonate) and has undergone extensive evaluation in the treatment of chronic iron overload states73. Previous study have determined that desferrioxamine E can be produced by Streptomyces parvulus CBS548.68, but no report suggesting that Streptomyces parvulus strain can produce desferrioxamine B74. Our study represents the first record of saccharide-melanin and desferrioxamine B produced from Streptomyces parvulus strain. Thus, using genome mining combined with chemical database searches and LC-MS screening can facilitate exploration of the biosynthetic potential of actinomycetes strains.In both identified compounds, melanin are generally black or brown pigments, which are frequently used in medicine, pharmacology and cosmetics preparationIn conclusion, our data showed that the mangrove is a good source for isolation of actinobacteria having a high number of secondary metabolites. At least two secondary metabolites of saccharide-melanin and desferrioxamine B were found in the fermentation broth by combining with whole-genome results. In the future, the application of efficient strategies to mine metabolite-encoding gene clusters in bacteria from extreme environments, while identifying the corresponding metabolites, presents an opportunity and challenge with respect to natural products and drugs discovery. Continued efforts towards culturing actinomycetes strains from mangrove would also represent a unique and promising means of discovering diverse secondary metabolites.Supplementary table S1Supplementary table S2Supplementary figure S1Supplementary figure S2Supplementary figure S3Supplementary figure S4Supplementary figure S5Supplementary figure S6Supplementary figure S7"}
+{"text": "Streptomyces have shown an outstanding capacity for drug production, different campaigns in geographically distant locations currently aim to isolate new antibiotic producers. However, many of these newly isolated Streptomyces strains are classified as identical to already described species. Nevertheless, as discrepancies in terms of secondary metabolites and morphology are possible, we compared two Streptomyces strains with identical 16S rRNA gene sequences but geographically distant origins. Chosen were an Easter Island Streptomyces isolate (Streptomyces sp. SN25_8.1) and the next related type strain, which is Streptomyces griseus subsp. griseus DSM 40236T isolated from Russian garden soil. Compared traits included phylogenetic relatedness based on 16S rRNA gene sequences, macro and microscopic morphology, antibiotic activity and secondary metabolite profiles. Both Streptomyces strains shared several common features, such as morphology and core secondary metabolite production. They revealed differences in pigmentation and in the production of accessory secondary metabolites which appear to be strain-specific. In conclusion, despite identical 16S rRNA classification Streptomyces strains can present different secondary metabolite profiles and may well be valuable for consideration in processes for drug discovery.As  Actinobacteria have shown to be an exceptional source of new antibiotics and pharmaceuticals in general + m/z 579.53381. This chemical showed a polyprotonation pattern, which points towards a peptide structure. The reference strain, Streptomyces griseus subsp. griseus DSM 40236T showed an unknown metabolite with a molecular weight of [M+H]+ m/z 813.59229. The isolation of these compounds from the crude extracts and chemical analyses would be necessary for structure elucidation.Interestingly, Streptomyces crude extracts , but kept similarities in cell morphology. In terms of secondary metabolite production, we found that closely related Streptomyces species kept a common set of chemicals, which has been addressed as core secondary metabolites [Streptomyces strains with similar 16S rRNA gene sequences produce identical chemicals [Streptomyces strains have a set of accessory secondary metabolites that are unique for each isolate, despite of the identical 16S rRNA gene sequences. These findings have also been observed in other Streptomyces species. For example, Antony-Babu et al. [Streptomyces strains with identical 16S rRNA gene sequences and they found, that by evaluating characteristic features like halotolerance, optimal pH growth, coloration and GC content at least 5 out 10 clearly diverged as new species. These results were further supported with a multilocus sequence analysis and phylogenetic tree. This study also showed the production of a core set of secondary metabolites and an accessory chemical diversity.Our results showed that abolites . This fahemicals . Howeveru et al. , developStreptomyces strains. The evaluation of the biosynthetic gene clusters showed that the analyzed Streptomyces strains kept a core set of secondary metabolites and in addition, a set of strain-specific metabolites. Interestingly, Vicente et al. [Streptomyces, such as melanin, desferrioxamine B, hopene, isorenieratene and geosmin. However, none of them could be detected in our experimental work. This observation might be related with the evolutionary distance between S. griseus strains and the Streptomyces strains used by Vincente et al. [Another example was provided by Vicente et al. , who pere et al.  also repe et al. . This lae et al.  also repStreptomyces strains of the same species, isolated from geographical distant locations, can show important differences in the metabolite profiles. These may be overlooked if solely a genetic marker such 16S rRNA gene sequence is used as an indicator of secondary metabolite diversity. As described previously, genome sequencing and comparison, multilocus gene analysis or growth experiments associated with chemical analysis are three suitable alternatives to dereplicate closely related Streptomyces strains. This strategy can represent a valuable source of metabolites with biomedical and industrial application, by preventing the discard of unstudied Streptomyces.Our data indicated that Streptomyces is not essential for their life cycle, however these metabolites confer an evolutionary advantage over competitors, since these molecules can be used as a chemical weapon to control other bacterial and fungal competitors . Since Streptomyces can profit from these molecules, Streptomyces might adapt their chemical arsenal in function of their habitat and their competitors to succeed in new environments.Secondary metabolite production in Streptomyces strains. Different researchers have discussed this process in other actinobacterial genera, and the most widely accepted hypothesis is the horizontal transfer of genes (HGT) of entire biosynthetic pathways [Streptomyces strains are dwelling. However, gene duplication, mutation and genetic rearrangement should also not be discarded in the process of modifying secondary metabolite biosynthetic pathways. The gain and loss of secondary metabolites may be considered as a biochemical evolution of Streptomyces strains, since the process of selecting and discarding genes for the production of secondary metabolites may have direct relation to the environmental competition and survival needs of the strain. It seems reasonable to assume that phylogenetic almost identical Streptomyces strains may have diverged from a common ancestor because of their genetic and chemical similarities. Within a sufficient timeframe, Streptomyces strains may have acquired new biosynthetic abilities to produce different secondary metabolites, because of the need to adapt and specialize in their particular ecological niche. Environmental pressure may be a driving force for the retention/discarding/acquisition of the secondary metabolite genes. It has been shown that Streptomyces strains are capable of spontaneous combination of genetic information [Streptomyces hybrids have existed in the environment since many factors may influence the success of the new ecotypes.It remains an open but interesting question, how genes necessary for the production of a particular secondary metabolite have been gained by individual pathways , which mormation ,51, geneormation . HoweverStreptomyces strains since our analyses of the metabolite profiles showed differences in the production of secondary metabolites of strains identical on the basis of this genetic marker. While we found a core set of secondary metabolites that is identical in both strains, a set of even more diverse accessory metabolites appear to be strain specific. Based on the phylogenetic closeness and the similarity of the metabolites, it is suggested that both Streptomyces had a common origin which went through a subsequent specialization in function of their habitat. In conclusion, this study has demonstrated that Streptomyces strains, with an identical phylogenetic classification to already known strains, still represent a diverse and putative source of novel secondary metabolites with potential for drug discovery; therefore, they should not be discarded in screening processes for bioprospection.We established that 16S rRNA gene sequences do not provide information reliable enough to evaluate the chemodiversity of"}
+{"text": "Trueperella pyogenes strains isolated from an okapi (Okapia johnstoni) and a royal python (Python regius).The present study was designed to characterize phenotypically and genotypically two T. pyogenes chaperonin-encoding gene cpn60 with a previously developed loop-mediated isothermal amplification (LAMP) assay. Furthermore, sequencing of the 16S ribosomal RNA (rRNA) gene, the 16S-23S rDNA intergenic spacer region (ISR), the target genes rpoB encoding the \u03b2-subunit of bacterial RNA polymerase, tuf encoding elongation factor tu and plo encoding the putative virulence factor pyolysin allowed the identification of both T. pyogenes isolates at species level.The species identity could be confirmed by phenotypic properties, by MALDI-TOF MS analysis and by detection of T. pyogenes. The T. pyogenes strain isolated in high number from the vaginal discharge of an okapi seems to be of importance for the infectious process; the T. pyogenes strain from the royal python could be isolated from an apparently non-infectious process. However, both strains represent the first isolation of T. pyogenes from these animal species.Both strains could be clearly identified as  Trueperella pyogenes is worldwide considered as part of the commensal biota of skin and mucous membranes of the upper respiratory and urogenital tract of animals [T. pyogenes is also an important opportunistic pathogen that causes mastitis, abortion and a variety of diverse pyogenic infections in livestock, including cattle, sheep, goats, horses, and pigs [T. pyogenes appears to be responsible for infections of the reproductive tract [T. pyogenes is well known as a causative agent of different types of inflammation in various organs including the lung, heart, joints, mammary glands, and in the reproductive tract [T. pyogenes could be found in companion animals [T. pyogenes with Brucella abortus in a cat and dog. Additionally, various wildlife animals could harbour T. pyogenes [T. pyogenes strains isolated from a bearded dragon and a gecko. Additionally, T. pyogenes infections were reported from a bison and from camels [T. pyogenes were described in a galago [ animals . Howeverand pigs \u20134. In cave tract  and the ve tract , as wellve tract . In swinve tract , 9. Furt animals . More re animals  describepyogenes . In 2010pyogenes  charactem camels , 14, from camels  and fromm camels . Likewisa galago , in graya galago , 19 and T. pyogenes isolates, other new, fast and reliable techniques were described and utilized in this study: matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) [Besides conventional bacteriological methods for identifying -TOF MS) \u201323, a lo-TOF MS)  and 16S -TOF MS) , 26.T. pyogenes isolated from wildlife animals phenotypically and genotypically. To the best of our knowledge, the present study provides a first detailed description of T. pyogenes recovered from an okapi and a royal python.The present study was designed to identify and further characterize T. pyogenes 24398 was isolated from a vaginal discharge of an okapi (Okapia johnstoni) in high numbers (+++), together with Enterobacter cloacae (+) and Pasteurella spp. (+). The initial bacteriology analysis for T. pyogenes 24398 was performed at Hessian State Laboratory (LHL) Gie\u00dfen, Germany. As a result of post-mortem examination conducted in 2017, T. pyogenes 171003246 was recovered in low numbers (+) from a kidney of a seven-year-old female royal python (Python regius). The python was found dead in a bird park in Hesse (Germany) and was 107\u00a0cm in length and weighted 1.23\u00a0kg. In addition, Escherichia coli (+), \u03b1-hemolytic streptococci (+), Corynebacterium spp. (+) and Clostridium sardiniense (+) were cultured from the python specimen. The post-mortem analysis of the royal python revealed a good body condition and in the throat and head area a 15\u00a0cm lung edema and swelling, possibly caused by traumatic reasons. The post-mortem examination and the initial bacteriology analysis were also performed at Hessian State Laboratory. Both T. pyogenes strains were further investigated phenotypically and genotypically.As part of routine examination and diagnostics performed on zoo animals at Frankfurt Zoo  in 2019, A phenotypic characterization was performed using conventional cultural and biochemical assays as previously described , 20, 27 T. pyogenes DSM 20630T (pig), T. abortisuis DSM 19515T (placenta of sow after abortion), T. bernardiae DSM 9152T (human blood) and T. bonasi DSM 17163T (european bison) were extracted using the DNeasy blood and tissue kit , in accordance with the manufacturer\u2019s instructions. The concentration and purity of DNA were measured by utilizing a Nano Drop spectrophotometer .The genomic DNA of both isolates and the type strains cpn60 of T. pyogenes was performed using a previously designed loop-mediated isothermal amplification (LAMP) assay [T. pyogenes DSM 20630T, T. abortisuis DSM 19515T, T. bernardiae DSM 9152T and T. bonasi DSM 17163T.The detection of gene P) assay  with a pT. pyogenes isolates were also evaluated by PCR for the presence of five genomic targets: 16S rRNA gene (16S), 16S-23S rDNA intergenic spacer region (ISR), the \u03b2-subunit of bacterial RNA polymerase encoding gene rpoB, the elongation factor tu encoding gene tuf, and pyolysin encoding gene plo. The sequence of the oligonucleotide primers and PCR conditions were previously described by Hassan et al. [Both n et al. , \u00dclbegi-n et al. , Hijazinn et al. , Eisenben et al. , Wickhorn et al. , Wickhorn et al. .rpoB, tuf and plo from different Trueperella reference strains. Moreover, the resulting amino acid sequences of pyolysin of both T. pyogenes isolates were compared with the respective sequences of pyolysin of T. pyogenes DSM 20630T, closely related pore-forming toxins of genus Arcanobacterium and with other bacterial pore-forming toxins. All the nucleotide and amino acid sequences were obtained from the NCBI GenBank.The PCR products were purified and sequenced by Eurofins Umwelt Nord GmbH . The obtained sequences were analyzed via the cluster method of the MegAlign program  by comparing with the nucleotide sequences of 16S rRNA, ISR, T. pyogenes strains investigated in the present study showed a narrow zone of complete hemolysis on 5% sheep blood agar and CAMP-like reactions in the staphylococcal \u03b2-hemolysin zone with Rhodococcus hoagii as an indicator strain. The conventional biochemical properties and the results of the commercial identification system revealed almost identical results to previously investigated T. pyogenes of various origins and T. pyogenes DSM 20630T [T. pyogenes isolates yielded positive reactions for pyrrolidonyl arylamidase, alkaline phosphatase, \u03b2-glucuronidase, \u03b2-galactosidase, \u03b1-glucosidase and N-acetyl-\u03b2-glucosaminidase and negative reactions for nitrate reduction and pyrazinamidase. Additionally, the isolates hydrolyzed gelatine, but not esculin and urea. The isolates also fermented D-glucose, D-ribose, D-xylose, D-maltose, D-lactose and glycogen, but not D-mannitol. T. pyogenes 24398 fermented D-saccharose; however, T. pyogenes 171003246 was D-saccharose negative. In addition, both isolates showed a negative catalase reaction and a positive reaction on L\u00f6ffler agar . These log score values confirmed, in accordance with the current decision rules of the manufacturer, the species designation. Comparable to the present results, MALDI-TOF MS had already been shown to be a rapid and reliable technique for identifying bacteria of genera Arcanobacterium and Trueperella, including T. pyogenes [Moreover, MALDI-TOF MS identified pyogenes , 21.cpn60-specific LAMP assay could successfully be used to identify the species-specific gene cpn60 of T. pyogenes 24,398 and T. pyogenes 171,003,246 in the present investigation. This was comparable to the LAMP assay for detecting gene cpn60 of the previously described T. pyogenes of various origins [T. pyogenes strain isolated from an adult roebuck (Capreolus capreolus) [T. pyogenes strain isolated from a eurasian lynx (Lynx lynx) [cpn60 LAMP assay are shown in Fig.\u00a0The previously described preolus) , and a Tnx lynx) . The resT. pyogenes isolates. The nucleotide sequence data of T. pyogenes 24398 (GenBank accession numbers: MN946520) and T. pyogenes 171003246 (MN712476) were compared with type strain T. pyogenes DSM 20630T (AAC45754) and with the previously described strain T. pyogenes S 1276/1/18 isolated from a eurasian lynx (MN135984), T. abortisuis DSM 19515T (FN667628), T. bernardiae DSM 9152T (X79224), T. bialowiezensis DSM 17162T (EU194569), and T. bonasi DSM 17163T (EU194570). The nucleotide sequence data of T. pyogenes 24398 and T. pyogenes 171003246 revealed a sequence homology of 98.9% among both strains, a sequence homology of 99.5% and 98.7% with T. pyogenes DSM 20,630T, and a sequence homology of 99.9% and 99.1% with T. pyogenes S1276/1/18, respectively. The control strains of genus Trueperella yielded a sequence homology to both T. pyogenes isolates\u2009\u2264\u200998.7%  of 99.8% and 98.9% with T. pyogenes DSM 20630T (EU194563) and 100% and 99.8% with T. pyogenes S 1276/1/18 (MN164031), respectively with 98.5% identity between both strains. The additionally investigated gene tuf  showed a sequence similarity of 99.6% and 99.7% with T. pyogenes DSM 20630T (HG941716), and 99.6% and 99.7% with T. pyogenes S 1276/1/18 (MN163266), respectively; gene rpoB , a sequence similarity of 99.8% and 98.3% with T. pyogenes DSM 20630T (FN550375), and 98.8% and 98.3% with T. pyogenes S 1276/1/18 (MN163265), respectively, and gene plo , a sequence similarity of 99.5% with T. pyogenes DSM 20630T (U84782) for both isolates, and 99.1% with T. pyogenes S 1276/1/18 (MN163264) for both isolates.Both strains tuf and rpoB genes are presented in Fig.\u00a0Dendrograms of the ISR, plo of T. pyogenes 24398 (MN956806), and T. pyogenes 171003246 (MN741110) PLO of type strain T. pyogenes DSM 20630T (AAC45754), PLO of T. pyogenes S 1276/1/18 (MN163264), arcanolysin (ALN) of Arcanobacterium haemolyticum (ACV96715), phocaelysin (PHL) of Arcanobacterium phocae 10002T (SMR98720), listeriolysin O (HLY) of Listeria monocytogenes (NP_463733), intermedilysin (ILY) of Streptococcus intermedius (BAA89790), pneumolysin (PLY) of Streptococcus pneumoniae (ADF28298) and streptolysin O (SLO) of Streptococcus pyogenes (BAB41212). The results showed an amino acid similarity of 99.5% for both T. pyogenes 24,398 and T. pyogenes 171003246 with PLO of T. pyogenes DSM 20630T and 99.1% with PLO of T. pyogenes S 1276/1/18  encoded by gene T. pyogenes 24398 was isolated in high numbers from vaginal discharge of an okapi and seems to be responsible for the infectious process; T. pyogenes 171003246 was isolated from a non-infectious process of a royal python suffering from a throat swelling, possibly caused by trauma. Both T. pyogenes isolates were identified by a biochemical test, LAMP and MALDI-TOF MS. The genomic targets of the two isolates, 16S rRNA gene, ISR, tuf, rpoB and plo were sequenced and compared to the respective targets of reference and other strains. Thus, the report is the first to provide a detailed characterization of T. pyogenes strains of these origin."}
+{"text": "In remote measurement systems, the lead wire resistance of the resistance sensor will produce a large measurement error. In order to ensure the accuracy of remote measurement, a novel lead-wire-resistance compensation technique is proposed, which is suitable for a two-wire resistance temperature detector. By connecting a zener diode in parallel with the resistance temperature detector (RTD) and an interface circuit specially designed for it, the lead-wire-resistance value can be accurately measured by virtue of the constant voltage characteristic of the zener diode when reverse breakdown occurs, and compensation can thereby be made when calculating the resistance of RTD. Through simulation verification and practical circuit testing, when the sensor resistance is in 848\u20132120 \u03a9 scope and the lead wire resistance is less than 50 \u03a9, the proposed technology can ensure the measuring error of the sensor resistance within \u00b11 \u03a9 and the temperature measurement error within \u00b10.3 \u00b0C for RTDs performing 1000 \u03a9 at 0 \u00b0C. Therefore, this method is able to accurately compensate the measurement error caused by the lead wire resistance in two-wire RTDsand is suitable for most applications. High-precision temperature measurement provides basic data for product development and industrial automation applications to improve product quality and ensure production safety. Due to its excellent linearity, measurement repeatability and stability , a resisCurrently, the aforementioned problem is addressed by adding lead wires. For example, in Reference ,4 three-Therefore, researches have been carried out on the compensation method of two-wire sensors. In Reference , a compeThe aim of this paper is to solve the problem of lead-wire-resistance compensation for two-wire RTDs based on as simple interface circuit as possible, on the premises that the measurement accuracy and the update rate are acceptable. So that, a new technique for compensating the lead-wire-resistance measurement error of two-wire RTD is proposed, which can also resist the negative influence of the temperature drift of the lead wire resistance on the compensation circuit. This technique only adds one zener diode on the sensor side, and the lead wire resistance and RTD resistance can be accurately measured through time sharing based on the stability of the reverse breakdown voltage and the minuteness of reverse leakage current. A simple implementation and its validation of the interface circuit will be described later in this paper, which only requires one SPDT analog switch and a pair of reference power sources, and OPAMPs are not required. Compared to the current methods, the proposed technique not only uses fewer components, only one zener diode, for two-wire RTDs, but also can detect and diagnose the failures of the lead wires by measuring the lead wire resistance in real time.t represents an RTD, and Region A is the region of the object to be measured. The area B where the zener diode is located should be as close to the RTD as possible, and the ambient temperature in this area should not change significantly due to the change of the temperature in Region A. The RTD in Region A and zener diode in Region B are connected by two wires. As their length is very limited, the resistance of these wires is negligible. Region C represents the layout path of the lead wires. In the remote measurement system, the path is quite long. Its specific length depends on the practical engineering conditions and is often changed due to engineering changes and other reasons. The resistances Rw1 and Rw2 represent the lead wire resistance, and it is generally believed that Rw1 = Rw2 = Rw. Region D represents the remote-control room or equipment room, where the interface circuit is located. The other elements in Combined with the engineering application scenarios of remote measurement, the circuit schematic of the technique proposed in this paper is shown in 1.Measurement of lead wire resistance.In the proposed technique, a complete measurement procedure of RTD resistance consists of three steps:c through lead wire resistors Rw1 and Rw2, giving rise to the reverse breakdown of the zener diode and establishing a stable voltage Ud across it. Since the resistance of zener diode after reverse breakdown is very small, most of the current goes through the diode. Although the current flowing through Rt is relatively small, the negative influence of RTD\u2019s self-heating effect on the temperature measurement must be considered. The voltage at Position 3 marked as U3 is measured. Then the lead wire resistance Rw can be calculated by substituting U3 into Equation (1).Switch SW in Region D of 3 and Rw, which will be used in the following steps.Record the values for U2.Measurement of working current.c, which is not more than Ud. At this time, the zener diode works in the reverse cut-off mode, and the equivalent resistance is very large. The current passing through it marked as Id is in microamperes range [3\u2019, which is measured and satisfies Equation (2).SW is switched to Position 2. RTD is supplied by constant voltage source (CVS) with a voltage of Ues range , whose s2 and U3\u2019 for Step 3:s represents a calibration resistor.The I in Equation (2) represents the output current of the CVS. At the same time, the voltage measured at Position 2 is represented by U2. Thus, I can be obtained from Equation (3). Save the values of U3.Calculation of RTD resistance.By substituting Equations (1) and (3) into Equation (2), the resistance of RTD can be obtained, as shown in Equation (4).Equation (4) shows that it is a simple algebraic equation, which can be solved in a microcontroller to obtain RTD resistance. Then the RTD resistance can be converted to the temperature simply by look-up table method or directly computation of the polynomial.d and IdStability of Uc and IcStability of U2, U3 and U3\u2019Measurement accuracy of UsAccuracy and Stability of RFrom Equation (4), it can be seen that the factors affecting the measurement accuracy of RTD resistance are as follows:The first one is the key and most difficult factor to implementing the proposed technique. Other factors can be met by conventional technical means, such as using high-precision analog to digital sampling, low temperature drift power source and sampling resistance.d with its operating current is very small. At present, for high-precision zener diodes, the nominal error of the reverse breakdown voltage can reach 0.05%, and the device consistency is very high. Besides, the reverse leakage current of the zener diode can be kept relatively stable in the reverse cutoff region. These characteristics of zener diode make it possible to calibrate the system. In order to obtain higher measurement accuracy, it is necessary to calibrate the values of reverse breakdown voltage and reverse leakage current of zener diode in each measurement circuit and store them in the nonvolatile memory.Compared with the I-V curve of normal diode, the I-V curve of zener diode has a narrower breakdown voltage range and a larger curve slope. Therefore, the change of the reverse breakdown voltage of UBased on this principle, the update rate depends on the response time of zener diode under the step voltage input (200 \u03bcs), the single switching time of the analog switch (18 ns), the two analog to digital sampling times and the calculation time of the micro controller. The values in brackets above are from the device datasheet used in the circuit prototype in 2 was selected, which can cover most practical engineering application. The parameters of the simulation model are shown in The circuit model as shown in The selection of CCS current takes two factors into consideration: On one hand, in order to reduce the self-heating effect of RTD, the working current should be as small as possible. On the other, because the greater the CCS current is, the higher the stability of the voltage across the zener diode is according to the simulation results, in order to ensure the measurement accuracy, the voltage should be as stable as possible and the CCS current should be as large as possible. According to multiple simulation results, when the CCS current was selected as 10 mA, the change of voltage across the zener diode and the current through RTD are both appropriately small as shown in the following paragraphs. It not only guarantees the sufficient measurement accuracy, but also avoids the serious self-heating effect.If different types of zener diodes are used, the stability of the voltage shall be re-measured and converted it into measurement accuracy. Select the CCS current as small as possible within the allowable measurement accuracy.The specific procedures of simulation are shown in the following paragraphs.d when the resistance of RTD and lead wire is changing under CCS supply. The simulation results are shown in At first, Step 1 in Then, simulation results show that the current through RTD changes with its resistance value, as shown in After that, the switch SW is switched to Position 3 to simulate Step 2 in d is 2.413 V and Id is 6.40 \u03bcA. The resistance is calculated as temperature according to the polynomial in Reference [In the end, RTD resistance is calculated according to Equation (4) combined with the parameters in eference , and theThe simulation results show that the technique can effectively compensate the adverse effect of the lead wire resistance within 50 \u03a9 on the temperature measurement. Meanwhile, the accuracy of temperature measurement reaches \u00b10.52 \u00b0C or 0.3% of research range.Based on the feasibility of the above simulation, to implement validation experiment, the schematic of the RTD interface circuit was designed as shown in w1 and Rw2. RTD was simulated by a resistance box, the accuracy of that is 0.1%. The circuit employed a high-precision zener diode , and was excited by +5 V single power source. A current source chip  and voltage reference chip  integrated into the circuit to build the power supply circuit. Circuit switching realized by an analog switch . The photo of the circuit prototype was shown in The lead wire resistance was simulated by precise adjustable resistors RThe devices used in the experiment were shown in 2 and GND nearby in 3 and GND nearby were connected to the voltage measurement channel of the all-in-one instrument VB8012; terminal SW is connected to the digital output port of VB8012; terminals of +5 V and GND nearby were connected to the power output port of VB8012; terminals of RTD1 and RTD2 were connected to the resistance box.The electrical connection between the experimental devices is as follows: terminals of Us, Ud, Uc and Ic were measured one by one through the multimeter 34461A. They were recorded and would be used in the subsequent calculation.At the beginning of the experiment, the values of RSet the values of the resistance box for RTD and adjustable resistors for the lead wires.Enable the digital output port of VB8012 to be high to switch on the CCS and shut off the CVS.3 by VB8012.Measure and record the voltage of USet the digital output port of VB8012 to be low to switch on the CVS and shut off the CCS.3\u2019 by VB8012 and the voltage of U2 by 34461A.Measure and record the voltage of UThe experiment followed the following steps:After alternating the set points of the resistance box and the adjustable resistors, the above steps were repeated one time to obtain a second set of measurements. After many repetitions, more measurements were obtained. When the measurement was completed, all the data was input into a spreadsheet to calculate the measured value of the resistance box and the corresponding temperature.All experiments were carried out at an ambient temperature of 17.5 \u00b0C. The measured values of other constants required for calculation are shown in When the lead wire resistance was set to 1 \u03a9, under the thirteen set points of RTD resistance from 848 \u03a9 to 2120 \u03a9, the values of resistance box were measured by the proposed technique, and was translated into corresponding temperature by the polynomial in Reference [By changing the adjustable resistance, the lead wire resistance was set to the values shown in Experiment results shows that the lead-wire-resistance compensation technique proposed in this paper can accurately measure the RTD resistance when the lead wire resistance range is 0.5\u201350 \u03a9. In the measuring range of 848\u20132120 \u03a9 or \u221238.67 \u00b0C\u2013+299.86 \u00b0C, the measurement error of temperature is within \u00b10.3 \u00b0C according to the temperature characteristic polynomial of RTDs performing 1000 \u03a9 at 0 \u00b0C. This indicates that the proposed technique can effectively compensate RTD lead wire resistance, and the compensation accuracy can meet the requirements of most remote temperature measurement using RTDs.Besides being able to achieve lead-wire-resistance compensation for two-wire sensors, the benefits of this technique include: The component used is simple and small in size for only one zener diode is paralleled with the sensor; the time for measuring is short, because the working point of the zener diode can be established in a very short duration, the update rate of the sensor that is achievable is much higher compared to the scheme with the capacitor being charged and discharged; the consistency of the reverse breakdown voltage among the zener diodes is excellent, and its initial precision of 0.05% is available; the specific resistance of lead wires can be acquired in real time, which renders fault diagnosis of lead wire feasible.The proposed technique can be popularized to other applications of remote measurement using resistive sensors with lead wires such as resistive displacement sensors, magnetic field sensors, piezoresistive sensors, etc. For example, the strain gauge described in Reference  and the A new lead-wire-resistance compensation technique for two-wire resistive temperature sensor was described in this paper. The principle is proved to be feasible by circuit simulation and that the feasibility is verified by experiment. Firstly, the lead-wire-resistance compensation equation was derived based on the circuit principle. Then the components selection and circuit simulation were implemented in Multisim 14 to evaluate the measurement error and verify the feasibility of the technique. Finally, a prototype of interface circuit for experiment was fabricated. The experiment system was setup using a standard resistance box to simulate the RTD and with the help of a digital multimeter and an all-in-one instrument. The measuring values of the resistance box were obtained, and the temperature errors were figured out. The results show that the proposed technique fulfills RTD resistance measurement within the research range in this paper, and the temperature measurement error is less than \u00b10.3 \u00b0C or the percent error is better than 0.14%."}
+{"text": "Resource-limited farmers under communal farming environments slaughter goats for cultural beliefs and meat consumption using indigenous slaughter methods. These methods include transverse neck incision (TNI), piercing with a short spear on the suprasternal notch targeting the heart (SNP), and piercing with a short spear under-shoulder-blade chest-floor point-of-elbow (CFP) targeting the heart to induce insensibility and death. Unsatisfied animal welfare institutes consider these slaughter methods as cruel because goats are slaughtered while sensible; therefore, experiencing pain and suffering before death. In this study, we slaughtered castrates using the above-mentioned methods and collected behavioural responses before slaughter and while bleeding, the total blood expelled during bleeding, the time it took for the blood to be expelled, the time it took the goats to lose sensibility, and time to lose heartbeat. We found that goats slaughtered using CFP lost sensibility faster. We concluded that goats slaughtered using the CFP method experienced less pain and suffering during slaughter and died faster.p < 0.05) on stress-related behaviour. Rate of bleeding efficiency was highest (p < 0.05) for SNP slaughtered goats. Time to lose sensibility was lowest (p < 0.05) for goats slaughtered using the CFP (55 s) when compared to SNP (68 s) and TNI (75 s) slaughter methods. Time to post-slaughter trauma was highest (p < 0.05) for SNP (247 s) and lowest for TNI (195 s). These findings suggest that goats slaughtered with SNP experienced rapid death when compared to TNI and SNP slaughter methods. It was concluded that the SNP slaughter method is the most effective slaughter technique because it is associated with higher bleeding efficiency and lower time to lose sensibility before death.Resource-limited farmers slaughter goats without stunning. The objective of the current study was to assess the influence of indigenous slaughter methods used by resource-limited households on slaughter stress-related behaviour, bleeding efficiency, and time to post-slaughter trauma of goats. Thirty clinically healthy castrated Nguni goats aged between 15 to 18 months old with body condition score of three were randomly assigned to three non-stunning informal slaughter methods, (1) transverse neck incision (TNI); (2) suprasternal notch piercing in the direction of the heart (SNP); and (3) under-shoulder-blade chest-floor point-of-elbow (CFP) sticking in the direction of the heart. Ten goats were slaughtered using each method. Slaughter method had no effect ( Slaughter is any procedure which causes the death of an animal for human consumption. Death is achieved through stunning and bleeding under conventional slaughter or only bleeding for religious slaughter . In convIn Southern Africa, the regions total goat population was estimated at 10,000,000 of the 422,738,294 goats in Africa . Though Several studies have compared the influence of slaughter methods on the behavioural response before slaughter and while bleeding ,10,11, bThe objective of the study was, therefore, to assess the influence of indigenous slaughter methods on the behavioural response before slaughter and while bleeding, bleeding efficiency, and time to cardiac arrest for Nguni goats. It is hypothesised that the indigenous methods are just as good as the TNI slaughter referring to these relevant aspects.Ethical clearance (AREC/001/018D) for the study was granted by the University of KwaZulu-Natal.Thirty clinically healthy male castrates Nguni goats with a body condition score of at least 3 were used for the study. These goats were randomly bought from the local community and classified as Nguni based on their coat colour pattern and small and compact frame size. They were randomly assigned to each slaughter treatment group. Age of goats was between 15 to 18 months and was verified using dentition [A day before slaughter, all goats were detained in a kraal under the shade overnight where clean water was provided ad libitum. Goats were randomly assigned to each slaughter method and slaughtered without stunning either using a sharp knife or a short spear refer to A specifiThe suprasternal notch piercing (SNP) to the direction of the heart slaughter method was performed by two slaughtermen using a short sharp double-edged spear designed for slaughtering goats. During slaughter, goats were allowed to stand upright with hind limbs. While the goat was standing with hind limbs, front limbs were held by the two slaughtermen. The slaughterman that performed the piercing process held one front limb with one hand, and the second handheld a spear refer to A. The seThe under-shoulder-blade chest-floor point-of-elbow piercing (CFP) to the direction of the heart slaughter method was performed by five slaughtermen. The slaughter method also involved the use of a short sharp double-edged spear, which was also used in the SNP slaughter technique. Four slaughtermen held the goat in a dorsal recumbent position. The fifth slaughterman handling the spear performed the slaughter process by piercing the goat at the heart girth next to the chest floor and point his elbow to the direction of the heart. After piercing, the goat was placed into a lateral recumbent position allowing it to bleed out into a 5-litre water bucket C. If theFrequency of vocalisation, involuntary urination, and defaecation was measured to assess the influence of slaughter methods on stress behavioural response. The frequency of these events was recorded manually and using a video camera  by two different slaughtermen who were goat experts. Each slaughterman had a camera which recorded behavioural changes before slaughter and while bleeding. Urination frequency was measured by counting the number of times that the goat urinated during slaughter. Vocalisation frequency was measured by the number of bleats each goat made during slaughter. Involuntary defaecation was also measured by counting the number of times each goat defaecated during slaughter.Behavioural response scores for goats before slaughter and while bleeding is shown in The amount of blood lost during slaughter was measured from each goat by collecting blood into a 5-litre water bucket to obtain the total amount of blood expelled. Blood was then transferred from the 5-litre water bucket into a transparent glass-measuring cylinder . The blood volume in the body cavity was determined after dissecting each goat by collecting the amount of blood found in the chest cavity, using a 1000 mL transparent glass measuring-cylinder .Time of blood flow after major blood vessels were severed was recorded using a stop-watch . Bleeding time at sticking was recorded as the interval between the start of blood flow and the time the blood flow changed from a constant stream into drips. If continuous bleeding restarted after a short period of bleeding, the second endpoint was taken as the recorded bleeding time.The rate of bleeding efficiency was determined as the volume of blood (mL) expelled in a specific time. It was calculated by dividing bleeding quality (mL) with bleeding out time (s).Time to lose sensibility was recorded as the interval between neck cutting or piercing of the heart to the point were signs of sensibility were absent and the animal was rendered insensible and dead. Time to lose sensibility was observed by a trained observer; therefore, all goats were observed by the same observer to minimise variation caused by involving two or more observers. The following signs were monitored: the absence of rhythmic breathing movements, threat-, withdrawal-, corneal-, and eyelid reflex (eye blink from touch), natural blinking, eye tracking to a moving object, righting reflex, and nose twitching without stimulus . The eyeImmediately after the slaughter procedure was completed, time to cardiac arrest was recorded as the time (s) interval between the heartbeat after the slaughtering process until the heartbeat stopped. Heartbeats were observed using a stethoscope  and recording time using a stop-watch .After sticking, carcasses were hoisted and skinned using sharp knives, which were rotated depending on their level of sharpness, comfort, and balance on the hand of the slaughtermen. The dressed weight was measured by weighing each dressed carcass with a hanging scale to the nearest 0.5 kg after removing all internal organs. Dressed carcasses were weighed within one hour after slaughter. The dressed carcass comprised of the body after removing the skin, head , forefeet , hind feet  and the viscera. Kidneys and pelvic fat were retained in the carcass, and testes and scrotal fat were also removed. Dressing percentage was calculated by dividing dressed carcass weight with slaughter weight and multiplied by 100.All data were analysed using Statistical Analysis Software Version 9.3 . The effects of slaughter method on behavioural responses before slaughter and while bleeding, bleeding efficiency, bleed-out time, time to lose sensibility, and time to cardiac arrest were determined using PROC GLM of SAS (2010). The following model was used:thi slaughter method;The correlation procedure (PROC CORR) was used to establish the Pearson correlation coefficients between the bleed-out time at sticking and time to lose sensibility; bleeding time and time to cardiac arrest; and time to lose sensibility and time to cardiac arrest.p > 0.05) on behavioural changes before slaughter and during bleeding. Across slaughter methods, the behavioural changes that were most commonly observed before slaughter were: sitting (rests on thighs and front legs)\u2014calm but threatened (score 2), and during bleeding were: head-turning/and tail movement (wagging)\u2014aggression or panic (score 2).The slaughter method had no influence  on the bleeding out time at sticking. The bleeding out time was lowest (p < 0.05) for the CFP (81.8 \u00b1 38) slaughter treatment group when compared with the TNI (100.3 \u00b1 38) and SNP (108.8) slaughter treatment group. There was a significant correlation (p < 0.05) between bleeding time and time to lose sensibility (r = 0.37).The slaughter methods had a significant effect (p < 0.05) on the rate of bleeding efficiency. The rate of bleeding efficiency was higher (p < 0.05) for the SNP (5.57 \u00b1 0.57) slaughter method treatment group when compared with the TNI (2.51 \u00b1 0.51) and CFP (2.61 \u00b1 0.57) slaughter methods.The slaughter method had an effect (p > 0.05) the total blood volume in the chest cavity after sticking. The total blood volume in the chest cavity after sticking was significantly negatively correlated to bleeding quality .The slaughter method did not affect (p < 0.05). Goats slaughtered via CFP (54.9 \u00b1 5.4) had lower (p < 0.05) time to lose sensibility when compared with those slaughtered using TNI (74.5 \u00b1 4.9) and SNP (67.9 \u00b1 5.4) slaughter methods. Time to lose sensibility had a significant correlation (p < 0.05) with bleeding time (r = 0.37). The slaughter method influenced (p < 0.01) time to cardiac arrest. Time to cardiac arrest was lower (p < 0.05) for goats slaughtered with TNI (194.6 \u00b1 11) when compared with the SNP (247.2 \u00b1 12) and CFP (257.4 \u00b1 12) slaughter treatment groups. The slaughter method had no effect (p > 0.05) on dressed percentage. Dressing percentage was not correlated (p > 0.05) with all the other behavioural or bleeding parameters. The heart was the only organ injured during slaughter.Time to lose sensibility was significantly affected by the slaughter method  for the SNP slaughter method could best be explained by the high total blood volume expelled at sticking. To improve the rate of bleeding efficiency when slaughtering goats, resource-limited farmers should ensure that goats are handled properly before bleeding to minimise the effect of stress during bleeding. Straight long sharp knives twice the width of the neck should be used to reduce the number of cuts and increase the precision of severing major blood vessels when using the TNI slaughter method to induce insensibility and death. Resource-limited farmers who commonly use the SNP and CFP slaughter methods should be educated about the importance of severing major blood vessels that induces insensibility and death instead of severing the heart so they will improve bleeding efficiency, bleeding time, and rate of bleeding efficiency. The use of long sharp knives and spears also improves the size and patency of the wound at sticking which is important for higher total blood volume expelled at sticking, bleeding time, and rate of bleeding efficiency.Higher total blood volume expelled during bleeding for SNP was not expected as this slaughter aimed at injuring the heart with small wound size and patency, which allows less blood to be expelled during bleeding. Observed higher total blood volume expelled at sticking for the SNP slaughter method could be associated with the severing of major blood vessels instead of the heart and aggression or panic behavioural response influenced by breathing, causing the movement of blood towards sticking wound. The observed lower total amount of blood expelled at sticking for the TNI slaughter method could best be explained by shorter knife length and position of cutting causing jugular and carotid arteries running down in the neck not to be cut during neck incision. Moreover, such an observation could also be explained by false aneurysms as a result of not cutting major arteries, causing the retraction of severed arteries, creating engorgement with surrounding connective tissue sheath to form an orifice with severed arteries to stop the opening from the wound. Observed lower total blood volume expelled at sticking for the CFP slaughter method could best be explained by the shorter length of the spear resulting in not severing the heart and small wound size created by the circumference of the spear. The shortest observed bleeding time at sticking for the CFP slaughter method could best be explained by small wound size caused by the small circumference of the spear, therefore influencing small total blood volume passing through the wound. Prolonged bleeding time could also be influenced by the formation of large blood clots through the thrombosis process . The finThe shortest time to lose sensibility observed for the CFP slaughter method could best be explained by the spear in severing the carotid and basilar arteries during the piercing process , resultip < 0.05) for the TNI slaughter method when compared with SNP and CFP slaughter methods suggest that the observed shortest mean time to lose heartbeat for the TNI slaughter method could best be explained by ischemia caused by reduced blood flow in the brain or the functioning of neurons [The finding that time to cardiac arrest was shortest ( neurons . ReducedNguni goats slaughtered using SNP had a significantly higher rate of bleeding efficiency, bleeding time, and rate of bleeding efficiency. Time to loss of sensibility was significantly lowest for goats slaughtered using the CFP slaughter method. Time to cardiac arrest was lowest for goats slaughtered using the TNI slaughter method. It was concluded that SNP was the most effective slaughter method considering that the Nguni goats slaughtered using this technique died faster. The assessment of the interrelationship between the rate of bleeding efficiency, time to lose sensibility, and time to post-slaughter trauma is important in terms of pain experienced by goats during slaughter."}
+{"text": "Dear Editor,Pityriasis lichenoides (PL) is a rare cutaneous inflammatory disease of unknown etiology consisting of three clinical forms: pityriasis lichenoides et varioliformis acuta (PLEVA), pityriasis lichenoides chronica and the severe febrile Mucha-Habermann's disease.A 26-year-old male patient, previously healthy, complained of malaise, arthralgia, exanthema and 38\u00a0\u00b0C fever appearing two days after reinforcement with anti-tetanus and diphtheria adult vaccine (double-dose adult vaccine). Five days later, a dermatological examination revealed a polymorphous rash with generalized exanthema, associated with erythematous papules with adherent necrotic crusts and multiple hemorrhagic vesicles . The remThe histopathological examination revealed necrosis of the epidermis, suggestive signals of lymphocytic vasculitis and extravasation of red blood cells, supporting the clinical diagnosis of PLEVA . With thPLEVA is characterized by a polymorphous eruption of erythematous macules that rapidly evolve into 2\u20133\u00a0mm papules, vesicles, and vesicopustular or hemorrhagic lesions, which undergo necrosis with overlapping crusts. It can result in varioliform scars. Symptoms include burning and itching. The Mucha\u2013Habermann subtype is an intense, varicella-like, ulceronecrotic cutaneous disease associated with systemic repercussions, fever and impairment of clinical condition. Our case would be situated between the two acute subtypes of the disease.PL is caused either by an inflammatory reaction triggered by extrinsic factors or has lymphoproliferative origin, as an inflammatory response secondary to a T-cell dyscrasia; or, yet, immune complex mediated hypersensitivity vasculitis.None declared.Maira Renata Merlotto: Conception and planning of the study; elaboration and writing of the manuscript; review of the literature; critical review of the manuscript.Nat\u00e1lia Parente Bicudo: Approval of the final version of the manuscript; obtaining, analysis, and interpretation of the data; review of the literature; critical review of the manuscript.Mariangela Esther Alencar Marques: Approval of the final version of the manuscript; obtaining, analysis, and interpretation of the data; critical review of the manuscript.Silvio Alencar Marques: Approval of the final version of the manuscript; elaboration and writing of the manuscript; critical review of the manuscript.None declared."}
+{"text": "The manifestations and broad impact of Celiac disease (CD), a chronic inflammatory disorder of the small bowel mediated by immune responses to triggering peptides from dietary gluten, are now increasingly recognized . This spPopp and Maki outline the key changes in the epidemiology of CD and illustrate the likely environmental and other factors that may have derived these changes.The presentation patterns of CD have been observed to have changed and evolved in recent decades. In recent years, there have further advances in our understanding of CD. These include the role of cereals, intra-luminal digestion, epithelial barrier function, tissue transglutaminase enzymatic activity, genetic factors, and immune responses.Tye-Din et al. delineate the important aspects of the aetiopathogenesis of CD. Although the emphasis is upon genetic susceptibility and dietary exposure to cereal peptides, this report draws attention to other potential factors including host-pathogen interactions and concurrent environmental factors. As outlined, further advances in understanding these key aspects should assist in advances in diagnosis and management. The authors further emphasize that additional work is required to understand environmental triggers, interactions with the microbiota and raise potential for prevention and enhanced management and even prevention.In their review, Schweiger et al. explored the relationship between polymorphisms in genes linked to the inflammasome in CD and in type 1 Diabetes. The researchers evaluated the presence of polymorphisms in selected genes in small groups of Slovenian children with T1D, CD or both conditions. Although they documented a link between the development of T1D and a polymorphism in the protein tyrosine phosphatase non-receptor 22 (PTPN22) gene, this polymorphism was associated with protection from CD. While the mechanism of this protective benefit was not elucidated, this work emphasizes the importance of non-HLA genes in the development of CD. Further attention to this enzyme and it's potential adverse impacts is required.Smigoc Torsten and Aaron review the potential impact of microbial transglutaminase (TG). While it is well-established that mucosal TG plays an important role in de-amidating cereal peptides, the role of microbial sourced TG has not been fully considered. The authors outline the chemical nature of this enzyme, outline the current industrial roles, and characterize how this enzyme could also impact upon CD.In another aspect of the pathogenesis of CD, Nardecchia et al. reviewed the patterns of these extra-intestinal manifestations (EIM) with emphasis upon the particular patterns of these features in children (as distinct to adults). The authors also explored the potential mechanisms for CD-related EIM. Two key mechanisms were detailed: those consequent to intestinal malabsorption and those consequent to immune responses. This work helps to emphasis the nature of these EIM and draws attention to the early recognition of these features in children who may not present with any gastrointestinal symptoms.Although CD in primarily a condition affecting the small bowel, there may be various and widespread manifestations outside the gut. Meijer et al. discuss the potential for prevention of CD. Recent work has shown that early feeding steps may not prevent CD in children at greater genetic risk . Nevertheless, due to existing uncertainty it is suggested that oats should be added with caution to a GFD, only after all CD symptoms including weight loss and growth disturbances have resolved, after at least 6 months of a conventional GFD and only after normalization of serology. Furthermore, these patients should be closely monitored.Spector Lerner et al. outline the potential adverse implications of a GFD. This article highlights that a GFD could lead to nutritional deficiencies and mental health outcomes, and emphasizes the importance of dietetic oversight of a GFD.While the GFD is currently the only intervention available for individuals with CD, Together the articles comprising this special issue provide important and timely updates about the current status of CD in children across the world. Each report raises questions and indicates aspects that require further attention and scientific enquiry. While the understanding of the pathogenesis and manifestations of CD has advanced greatly in recent years, there remains controversy and lack of a cure.All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In vitro experiments, the effect of TMZ on high fat and high glucose (HFG) induced or TGF\u03b21-induced epithelial-to-mesenchymal\u00a0transition\u00a0(EMT) was examined in HK-2 cells. Our results showed that TMZ could maintain renal function without affecting hemodynamic and plasma metabolic levels in diabetic rats. The effect was associated with a reversion of pathological progression of DN, especially for tubulointerstitial fibrosis. EMT is an important contributor to renal fibrosis. In this study, we investigated the role of TMZ in the process of EMT in DN. Mechanistically; TMZ attenuated HFG-induced EMT by relieving oxidative stress via deacetylation forkhead box O1 (FoxO1) in a Sirt1-dependent pathway. And it suppressed TGF\u03b21-induced EMT by deacetylating Smd4 in a Sirt1-dependent manner. Moreover, our study found that TMZ upregulated Sirt1 expression by increasing the expression of nicotinamide phosphoribosyl transferase (Nampt), which is a rate limiting enzyme for nicotinamide adenine dinucleotide (NAD+) generation by salvage pathway. And the increased NAD+ promoted Sirt1 expression. In conclusion, TMZ can prevent renal dysfunction and pathogenesis of tubulointerstitial fibrosis in DN, partly by inhibition of EMT via FoxO1/ROS pathway and TGF\u03b2/Smad pathway in a Nampt/NAD+/Sirt1 dependent manner.Trimetazidine (TMZ), as a metabolic regulator, is effective in treatment of coronary atherosclerotic heart disease with rare side effects in the clinic for long years. Interestingly, studies have shown that TMZ protects against several acute kidney injuries (AKI). However, the effect of TMZ on chronic kidney diseases (CKD) remains unknown. This study aimed to investigate the role of TMZ in diabetic nephropathy (DN) and its potential mechanisms. A rat model of DN was established in male Sprague-Dawley rats by streptozotocin (STZ) intraperitoneal injection. Experimental rats were separated into three groups: control, DN and DN + TMZ treatment. Metabolic parameters, pathological features and renal function markers were evaluated after 20 weeks of diabetes induction.  Diabetic nephropathy (DN) is the leading cause of end-stage renal disease and increases the risk of death . Glomeruvia a process known as epithelial-to-mesenchymal transition (EMT), which is characterized by the loss of an epithelial marker and an increased mesenchymal phenotype, results in increased production of extracellular matrix (ECM) and contributes to the development of chronic kidney diseases (CKD)  can convert to myofibroblasts es (CKD) . Studieses (CKD) . In diabes (CKD) . And inhes (CKD) .via shifting cardiac energy metabolism from fatty acid oxidation to glucose oxidation (Trimetazidine (TMZ), a piperazine derivative, has been widely used in the treatment of coronary atherosclerotic heart disease xidation . TMZ canxidation  or inhibxidation . Other txidation . Howevervia the activation of Sirt1  were from Beyotime Biotechnology (Shanghai China). NAD+ (HY-B0445), FK866 (HY-50876), and Compound C  were purchased from MedChemExpress (Shanghai China).Streptozotocin  was purchased from Sigma-Aldrich . TMZ was provided by Servier (Tianjin China). Sirt1 siRNA and non-targeted siRNA were purchased from RiboBio (Guangzhou China). Lipofectamine\u2122 2000 Transfection Reagent (11668019) was from Invitrogen . Antibodies against Sirt1 (A11267), FN (A12932), Sirt3 (A5718), and pan-acetyl lysine (A2391) were purchased from Abclonal . Antibodies against E-cadherin (20874-1-AP), Col1a1 (A1352), \u03b1-SMA (55135-1-AP), TGF\u03b21 (21898-1-AP), FoxO1 (18592-1-AP), Smad4 (10231-1-AP), Nampt (11776-1-AP), and \u03b2-actin (60008-1-Ig) were purchased from Proteintech Group . Antibody against TGF\u03b2RI (sc-518018) was from Santa Cruz Biotechnology . Antibody against p-Ampk (50081) was from Cell Signaling Technology . Dihydroethidium , N-acetyl-L-cysteine , hydrogen peroxide detection kit (S0038), Sod activity detection kit (S0101), and NADMale Sprague-Dawley rats  were purchased from Hubei Research Centre of Laboratory Animals . Diabetes was induced by intraperitoneal injection of STZ . Rats in the control group received equal volumes of citrate buffer (n = 7). Diabetes was verified 72\u00a0h later after STZ injection by measuring blood glucose levels. Rats with fasting blood glucose > 11.1 mmol/L were selected as qualified diabetic models and used in the study (n = 15). Two weeks after the onset of diabetes, diabetic rats were randomly divided into two groups: rats in the DN group (n = 8) received vehicle , and rats in the DN + TMZ group (n = 7) received TMZ (5 mg/kg/day), respectively. The medications were given by oral gavage. After 20 weeks of treatment, blood and urine samples were taken for metabolite measurements. The rats were then sacrificed, and tissue samples were collected and stored at \u221280\u00b0C for paraffin embedding or snap frozen. All animal studies were approved by the Animal Research Committee of Tongji Medical College and followed the guidelines of the National Institutes of Health.Plasma levels of glucose, triglyceride, cholesterol, creatinine, and urea nitrogen and urine levels of albumin, creatinine, and N-acetyl-\u03b2-D-glucosaminidase (\u03b2-NAG) were detected using assay kits from Nanjing Jiancheng Bioengineering Institute  following the manufacturer\u2019s instructions.Kidney tissues were \ufb01xed with 4% paraformaldehyde, then dehydrated and embedded in paraffin. Sections (4\u00a0mm thick) were subjected to hematoxylin-eosin (HE), periodic acid Schiff (PAS), and Sirius Red staining. Glomerular area, mesangial area/glomerular area, and proximal tubular inner diameter were measured as previously described . GlomeruHK-2 cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences , and grown in DMEM/F12 supplemented with 10% FBS. Cells were transfected with siRNA against human Sirt1  or negative control , using Lipofectamine 2000, according the manufacturer\u2019s protocol. After transfection, cells were incubated with normal glucose (5 mM) or high fat  and high glucose (30 mM) for 48\u00a0h and then collected.Kidney tissues and cells were collected using Protein or IP lysate . The protein concentration was measured by BCA kit . A total of 10% gradient gels were used. The \u03b1-SMA antibody was diluted at 1:3,000, the \u03b2-actin antibody at 1:5,000, and the others at 1:1,000. Density analysis of the bands was performed using Gel Pro analysis software.2O2 levels, Sod activity, and DHE staining were all used for detection, according to the kit instructions.In order to reflect the degree of oxidative stress in tissues and cells under different treatment conditions, HForkhead box O1 (FoxO1) and Smad4 acetylation were measured by immunoprecipitation of collected protein lysate using antibody against FoxO1 and Smad4 respectively. Thereafter, acetylated-FoxO1 and acetylated-Smad4 were assessed with anti-pan acetyl lysine antibody.+) and NADH in kidney tissue and HK-2 cells were detected by the NAD+/NADH assay kit, according to the manufacturer\u2019s instructions. In brief, renal cortex (10 mg/sample) and HK-2 cells (1\u00d7106 cells/sample) were lysed with 200 \u03bcl of NAD+/NADH extraction reagent. In order to detect the total amount of NAD+ and NADH, 20 \u03bcl of lysate was added to a 96-well plate. To determine the content of NADH, the lysates was incubated at 60\u00b0C for 30\u00a0min to remove NAD+, and then 20 \u03bcl of supernatant was added to a 96-well plate. Subsequently, 90 \u03bcl of alcohol dehydrogenase working solution was added and incubated at 37\u00b0C for 10\u00a0min. Finally, 10 \u03bcl of color reagent was added to the 96-well plate and incubated at 37\u00b0C for 30\u00a0min. The absorbance was measured at 450 nm. According to the standard curve, the total content of NAD+/NADH and the content of NADH were calculated. The NAD+ content was equal to the total content minus the NADH content.The levels of nicotinamide adenine dinucleotide  with Newman-Keuls post analysis was used to compare the means of three or more different treatment groups. A After 20 weeks of STZ injection, metabolic indices associated with diabetes were measured. The weight gain of these rats was significantly reduced, but blood glucose, serum triglyceride and cholesterol levels were markedly increased. Treatment with TMZ in diabetic rats did not change these metabolic indices or blood pressure Table 1.These results indicate that diabetic rats induced by STZ injection experience a remarkable decline in renal function, which can be mitigated by treating with TMZ independent of affecting blood pressure and systemic metabolic levels.To investigate the effects of TMZ on renal pathological changes in STZ-induced diabetic rats, tissue sections of glomeruli and renal tubules were assessed. Glomerular area, ratio of mesangial area to glomerular area, and ratio of glomerular collagen fiber area to glomerular area (glomerular collagen content percentage) were calculated to evaluate glomerular remodeling. In HE-stained tissue sections, the glomerular area was significantly increased in STZ-injected rats compared to control rats, and treating with TMZ had no effect on glomerular enlargement induced by STZ injection  is known for as an essential coenzyme that mediates redox reactions. In addition, it is a substrate for NAD+-dependent enzyme such as sirtuins and PARPs  in diabetic rats  was more effective than Compound C  .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "However, high renal accumulation of activity for DARPins labeled with residualizing labels is a limitation for targeted radionuclide therapy. A better understanding of the mechanisms behind the kidney uptake of DARPins could aid the development of strategies to reduce it. In this study, we have investigated whether the renal uptake of [99mTc]Tc(CO)3-G3. Administration of sodium maleate before the injection of [99mTc]Tc(CO)3-G3 reduced the kidney-associated activity by 60.4\u2009\u00b1\u200910.3%, while administration of fructose reduced it by 46.9\u2009\u00b1\u20097.6% compared with the control. The decrease in the kidney uptake provided by sodium maleate was also observed for [99mTc]Tc(CO)3-9_29 DARPin. Preinjection of colchicine, probenecid, mannitol, or furosemide had no effect on the kidney uptake of [99mTc]Tc(CO)3-G3. Kidney autoradiography showed mainly cortical accumulation of activity for all studied groups.Co-injection of lysine or Gelofusine was not effective for the reduction of kidney uptake of [99mTc]Tc(CO)3-G3. Both fructose and maleate lower the cellular ATP level in the proximal tubule cells and their reduction of the kidney reuptake indicates the involvement of an ATP-driven uptake mechanism. The decrease provided by maleate for both G3 and 9_29 DARPins indicates that their uptake proceeds through a mechanism independent of DARPin structure and binding site composition.Common clinical strategies were not effective for the reduction of kidney uptake of [ Development of targeted radiopharmaceuticals for precise diagnosis and efficient therapy of cancer requires high target selectivity, low uptake in normal organs and tissues, and fast clearance. A new class of targeting molecules, engineered scaffold proteins (ESPs), is promising agents for tumor-targeted delivery of radionuclides . SeveralFor targeted radionuclide therapy, it is necessary to deliver a high local absorbed dose to tumors and low absorbed doses to normal tissues to be effective and safe. As radiolabeled targeting molecules are taken up not only in tumors but also in excretory organs, high tumor-to-normal organ ratios are required. Retention of activity in tumors and in normal organs depends on the rate of receptor internalization and residualizing properties of the label. In the case of rapid internalization in tumors, residualizing labels are preferable, as they provide longer retention of activity and higher absorbed dose to the tumor than non-residualizing labels . HoweverTargeted radionuclide therapy using radiometal-labeled peptides or small proteins is mainly limited by radionephrotoxicity. In order to deliver the required dose to tumors without exceeding the limiting dose to the kidneys 23\u00a0Gy), several strategies have been developed. The use of labeling approaches that provide non-residualizing radiocatabolites, such as radioiodination , 6 or th\u00a0Gy, seve111In]In-labeled affibody showed that modern SPECT cameras allow for imaging of metastasis in the adrenal glands close to the kidneys In-labeled somatostatin analogs. Rolleman et al. found that the administration of colchicine and fructose was effective for the reduction of kidney uptake of [111In]In-DTPA-octreotide [111In]In-DTPA-octreotide [111In]In-DOTATOC Tc(CO)3]+ to obtain a residualizing label was performed as described earlier Tc(CO)3-G3, except lysine and Gelofusine, which were co-administered with [99mTc]Tc(CO)3-G3. The effect of maleate administration on the kidney uptake was additionally studied for DARPin 9_29 . Radiolabeled DARPins G3  or 9_29  in 100\u00a0\u03bcL of 1% BSA in PBS/mouse were administered i.v. The injected amount of protein was adjusted using a corresponding non-labeled DARPin. At 4\u00a0h p.i. of 99mTc-labeled DARPins, mice were anesthetized by an i.p. injection of ketamine and xylazine solution and sacrificed by heart puncture. Blood was collected with a heparinized syringe, organs were collected and weighed, and activity was measured using a gamma spectrometer. The data was corrected for decay, and percent of ID/g of sample was calculated, except for GI tract and carcass where %ID per whole sample was calculated.Female NMRI mice (10\u00a0weeks old) were housed in standard conditions at 22\u00a0\u00b0C, with laboratory food and water provided ad libitum. Mice had an adaptation period of 1\u00a0week prior to the start of experiments. For biodistribution studies, 48 mice were randomized in 12 groups to include 4 animals per group. The average animal weight at the time of experiments was 24.9\u2009\u00b1\u20091.4\u00a0g. To test the effect of various compounds on the kidney uptake of After the gamma spectrometer measurement, two pairs of kidneys were taken from each group for autoradiography. The kidneys were embedded in the OCT cryomedium, frozen at \u2013\u00a080\u00a0\u00b0C, cut in serial sections (30-\u03bcm thick) using a cryomicrotome, and thaw-mounted on glass slides. For the digital autoradiography, the slides with sections were put in an X-ray cassette and exposed to phosphor screens overnight. The screens were scanned on a Cyclone Storage Phosphor System at a resolution of 600\u00a0dpi and analyzed using the OptiQuant software.t test was used to find the significant differences. For comparison of three or more sets of data, a one-way ANOVA test with Bonferroni correction for multiple comparisons was applied.Statistical analysis of data was performed using GraphPad Prism . When two sets were compared , an unpaired two-tailed 99mTc]Tc(CO)3 with 52% and 57\u2009\u00b1\u200911% radiochemical yield, respectively, and purified to provide a radiochemical purity over 97%.DARPins 9_29 and G3 were radiolabeled with [99mTc]Tc(CO)3-G3 was studied in mice at 4\u00a0h p.i. Female NMRI mice were first injected with either sodium maleate, mannitol, furosemide, mannitol, probenecid, or colchicine before the injection of [99mTc]Tc(CO)3-G3 as described in Table\u00a099mTc]Tc(CO)3-G3. The control group received a single injection of [99mTc]Tc(CO)3-G3.The effect of the administration of various compounds on biodistribution of [99mTc]Tc(CO)3-G3 is summarized in Fig.\u00a0p\u2009>\u20090.05, one-way ANOVA test) differences in the uptake in other organs or tissues were observed. Fructose administration also decreased the kidney uptake of [99mTc]Tc(CO)3-G3 approximately two times (98.5\u2009\u00b1\u200914.0%ID/g) in comparison with the control. However, the retention of activity in other organs and the carcass was higher than in control  different from the control. No significant  differences in the activity uptake in the blood, liver, spleen, or GI tract were observed between the control and other treatment groups.The data for renal activity uptake after the administration of [ol Table\u00a0. The adm99mTc]Tc(CO)3-labeled DARPin 9_29. As shown in Fig.\u00a0p\u2009<\u20090.05, t test) decreased the kidney uptake of activity compared with the non-treated control.To study whether the effect of maleate administration on the kidney uptake was specific for the G3 DARPin scaffold, the same experiment was repeated using Tc(CO)3-G3 from the control and treated groups are shown in Fig.\u00a0The average mouse weight was 24.9\u2009\u00b1\u20091.4\u00a0g, the average kidney weight was 264\u2009\u00b1\u200925\u00a0mg. The mice or kidney weights did not differ significantly  cannot benefit from this approach.Another way to reduce the retention of activity in the kidneys, while avoiding long circulation time in the blood, is the optimization of labeling chemistry and residualizing properties of the label. Careful selection of peptide-based chelators, such as mercaptoacetyl- , 41, 42 HER2:342 and ZHER2:2891 affibody molecules with ABD enabled efficient reduction of the kidney uptake and the higher dose delivered to the tumor than to the kidneys with 177Lu Tc(CO)3-G3 DARPin could be reduced by the administration of compounds that act on various parts of the reabsorption system in the kidney.In this study, we have investigated whether the renal uptake of [111In]In-DTPA-octreotide, which was additionally enhanced by co-injection of lysine [Colchicine is an anti-gout drug that inhibits microtubule polymerization and disrupts intracellular trafficking of organelles in cells. Colchicine was shown to move megalin from the brush membrane to other intracellular compartments . Adminisf lysine .Sodium maleate was also shown to affect the redistribution of megalin in the proximal tubules in rats . Maleate111In]In-DTPA-octreotide [Another compound that affects the ATP level in the kidneys is fructose. Parenteral administration of high doses of fructose leads to the sequestration of phosphates into metabolic intermediates and decreases ATP in the liver and kidneys . A largetreotide .111In]In-DOTATOC by 30% [111In]In-DOTATOC. Furosemide acts in the distal part of the loop of Henle, and mannitol is an osmotic diuretic. Furosemide administration led to a 44% increase in renal activity accumulation of [111In]In-DOTATOC, while mannitol had no effect.Probenecid is another anti-gout drug that inhibits organic anion transporter (OAT) and renal excretion of some drugs, thereby prolonging their half-life in the plasma. Stahl et al. reported that the use of probenecid reduced kidney uptake of [C by 30% . That st99mTc]Tc(CO)3-G3, similar to other targeting radiolabeled proteins and peptides. However, lysine and Gelofusine, which were effective for reducing the kidney uptake of somatostatin peptides and nanobodies, did not decrease the kidney uptake of DARPins. We have observed similar results earlier for another class of ESPs, affibody molecules Tc(CO)3-G3. Both fructose and maleate lower the cellular ATP level in proximal tubule cells, and their reduction of the kidney reuptake indicates the involvement of an ATP-driven mechanism of uptake. The decrease provided by maleate for both DARPins, G3, and 9_29, indicates that their uptake proceeds through a mechanism independent of DARPin structure and binding site composition. This knowledge could contribute to further understanding of the mechanisms behind the kidney reabsorption of radiolabeled ESPs.Common clinical strategies were not effective for the reduction of the kidney uptake of ["}
+{"text": "The role of surgery for circumscribed synchronous hepatic lesions of the pancreatic ductal adenocarcinoma (PDAC) remains controversial. Thus, the aim of our study was to compare survival outcome (OS) after surgery of patients with hepatic metastases (M1surg) to patients with only localized disease.Correlation analysis of clinicopathological data and OS after resection of M1surg patients and patients with localized PDACs (M0) was performed. Patients were included for survival analysis only if a complete staging including perineural, venous and lymphatic invasion was available.Out of the study collective, 35 patients received extended surgery (M1surg), whereas 131 patients received standardized surgery for localized disease (M0). Length of hospitalization and mortality was similar in both groups. FOLFIRNOX as an adjuvant treatment regime was administered in\u2009~\u200923 and\u2009~\u20098% of M1surg and M0 patients, respectively. In subgroup analysis of R0 resected patients and in multivariate analysis of the total cohort, there was no difference in overall survival between both groups. Only the resection status (R1 vs R0) and venous invasion (V1) were identified as independent prognostic factors. Site of recurrence in R0 resected M1surg patients and in M0 patients were homogenously distributed.This is the first study demonstrating a survival benefit after extended surgery for synchronously hepatic-metastasized PDACs. We found no difference in survival outcome of metastasized patients when compared to patients with localized disease. FOLFIRINOX as an adjuvant treatment regime for resected M1surg presumably is worthwhile. Larger multicenter studies are still needed to validate our results.The online version contains supplementary material available at 10.1007/s10147-021-01961-5. The ductal adenocarcinoma of the pancreas (PDAC) has a poor prognosis with a median overall survival of\u2009~\u20096\u00a0months and is estimated to become the second leading cause of cancer-related death in the United States and also in Germany by 2030 , 2. To dThe PDAC metastasizes primarily the peritoneum, the liver and to the lungs . At diagPalliative intended therapy or chemotherapy is the standard of care for patients with metastasized or locally advanced PDACs , 9. To dThe aim of our study was to analyze patients who received extended surgery in our department for synchronously hepatic-metastasized ductal adenocarcinomas of the pancreas (M1surg) and to compare those to two control groups: patients after multimodal therapy for localized disease (M0) and patients who received palliative intended therapy for metastasized disease .Patients with ductal adenocarcinoma of the pancreas who consecutively received surgery or palliative therapy between Sep 2006 and Dec 2019 at the Heinrich Heine University Hospital of Dusseldorf were included in the study. Exclusion criteria were patients with (1) malignancies of the pancreas other than ductal adenocarcinoma, (2) in whom the TNM staging did not include information about lymphatic, perineural and venous invasion , (3) in patients who were lost to follow-up, (4) in patients who received palliative intended therapy other than for isolated resectable hepatic metastases, (5) in patients who succumbed within the 30\u00a0day of surgery and (6) in which intraoperatively a routine liver sonography was not documented. Cut off point during follow-up was 60\u00a0months. Clinical data of these consecutively treated patients collected from patient\u2019s medical records were compiled into an Excel-file database and analyzed retrospectively.Oligometastastic disease was defined as resectable hepatic metastases isolated in one hepatic lobe, accessible only via an atypical resection, and independent on size and amount of metastases. Patients who received palliative intended therapy were included only if information about the number, size and location of the hepatic metastases were available. This data was compared to patients with extended surgery for metastasized disease. Information of the TNM staging system , along with grading, perineural invasion, lymphatic and venous invasion was retrospectively collected from the original histopathological reports for each patient. The TNM staging system, if applicable, was updated to the eighth edition of the UICC TNM classification of malignant tumors . Stated The analysis was performed in conformity to the Declaration of Helsinki and to good clinical practice. Furthermore, the study war approved by the Institutional Review Board (IRB) of the Ethics Committee, Heinrich Heine University Dusseldorf (IRB-no. 2019\u2013473-2).U test was used to examine numerical data and to correlate between clinic-pathological variables. For categorical data, the chi-square test was applied. The overall survival (OS) was determined as the period from the date of surgery until the date of death of any cause, or the last follow-up. Disease-free survival (DFS) described the period from the date of surgery until the date of diagnosed metachronous metastases or local recurrence. To perform the above mentioned correlation and survival analysis in one single study cohort, patients who succumbed during the first 30-postoperative days were removed from analysis and were only presented for correlation of mortality rate. Kaplan\u2013Meier curves were generated and analyzed using the log-rank (Mantel Cox) test, and hazard ratios (HRs) with 95% confidence intervals (CIs) were estimated. For multivariate survival analysis, all variables were included into a logistic regression analysis. Analyses were performed using SPSS\u00ae statistics for Windows . p\u2009<\u20090.05 was considered to indicate a statistically significant difference.The Wilcoxon test was used to analyze differences in clinicopathological data between the three subgroups. The Mann\u2013Whitney p\u2009=\u20090.450). Further 14 patients with oligometastatic disease to the liver and a similar ECOG performance status to group M0 and M1surg , who did not agree on an extended surgical approach, were treated with a palliative intended chemotherapy according to national guidelines [From a total cohort of 346 patients who scheduled surgery for PDAC with curative intend, regardless of tumor stage, 195 patients met our pre-defined inclusion criteria for the analysis of synchronous-metastasized PDAC and received oncologic surgery (pancreatic surgery with/without hepatic metastasectomy) in our hospital. 38 patients met the inclusion criteria of oligometastatic disease to the liver (group M1surg). In the same period, 143 consecutive patients were scheduled for surgery for localized disease (group M0). Fifteen patients succumbed during the first 30-postoperative days (Clavien-Dindo V 7.7%), which is in-line with published mortality rates . These widelines . None ofThe median age of all 180 patients at the time of surgery was 68\u00a0years (range 17\u201395\u00a0years). Our collective consisted of 107 males (59.4%) and 73 females (40.6%) and did not show any differences within the three groups. In 159 patients, the PDAC was located in the pancreatic head. In further 21 patients, the tumor originated from the pancreatic tail (Table p\u2009=\u20090.503)  and for patients who received extended surgery for metastasized disease (M1surg) was 22\u00a0days (range 9\u2013262\u00a0days) and 21\u00a0days (range 10\u201388\u00a0days) respectively (p\u2009=\u20090.312). Furthermore, the distribution of resection status (R1 vs R0) was independent on the number, size and sight of liver metastases in group M1surg .Of all analyzed clinicopathological variables, location of the PDAC (head vs. tail), T-stage and R-status were heterogeneously distributed between patients who received curative-intended surgery for localized and metastasized disease respectively (M0 vs M1surg) Table . Thus, aA correlation analysis of pathological data in the group with palliative intended therapy was not performed due to incomplete pathological staging for the primary tumor Table  and 2. An\u2009=\u2009166), 90.9% of the patients received a multimodal therapy . In group M0, 80 patients (61.1%) were given gemcitabine as monotherapy, whereas 35 patients (26.7%) received a combination therapy with paclitaxel. Only five patients (3.8%) were given FOLFIRINOX as a standardized adjuvant treatment regime. None of the M0 patients received neoadjuvant treatment. In the M1surg group, 15 patients received an adjuvant gemcitabine therapy (42.8%), while eight patients received FOLFIRINOX (22.8%) (four perioperative and four postoperative) and two patients received an adjuvant gemcitabine multidrug regime with either erlotinib or paclitaxel (5.7%). Further five patients entered the HEAT study and received adjuvant radiochemotherapy (14.2%). The distribution of chemotherapeutic regimes was heterogeneous between group M0 and M1surg (p\u2009<\u20090.001) .Out of the 180 patients, 117 patients (65.0%) died during the follow-up period. The median OS of all 180 patients was 15.1\u00a0months (95% CI 10.4\u201319.8\u00a0months). Out of patients who received curative-intended therapy  , patients with: higher median age, PDACs of the pancreas tail, surgically resected synchronous hepatic metastases, higher tumor grading, positive venous infiltration, positive resection margins and single drug chemotherapy had a significantly worse overall survival Table . Thus, pIn multivariate analysis however only positive venous invasion and positive resection margin were left as independent prognostic factors for poor OS Table .n\u2009=\u2009128, Table n\u2009=\u200917) was not statistically different compared to the median OS with 20.6\u00a0months (95% CI 16.7\u201324.6\u00a0months) in patients who received surgery for localized disease  and to the median OS with 21.1\u00a0months (95% CI 17.0\u201325.2\u00a0months) in patients who received histopathological proven tumor-free resection for localized disease  . By considering only margin-negative resected patients for the survival analysis (n\u2009=\u200917), patients treated with palliative intent showed a worse survival outcome compared to the M1surg group (p\u2009=\u20090.001)  Fig.\u00a0A. No patn\u2009=\u2009166, M0 and M1surg) a detailed follow-up of 121 patients was available for disease free survival (DFS) analysis (90 M0 and 31 M1surg). No detailed follow-up information was available for the remaining 45 patients of the study cohort. Anatomic distribution of metachronous disease were summarized in Table Out of the total cohort (p\u2009=\u20090.031 for M0 vs. M1surgR0 and p\u2009=\u20090.001 for M0 vs M1surg R1)  (1) Table , Fig.\u00a02Bn\u2009=\u2009121). Positive M-status, positive venous invasion and positive resection margins were found as independent prognostic factors for DFS  to patients with localized disease (M0).Taking the revised eighth edition TNM staging system into account with inclusion of lymphatic, perineural, and venous infiltration, our data demonstrated that patients with isolated synchronous hepatic metastases showed a similar overall survival in multivariate analysis compared to patients with localized disease (group M1surg vs. M0). Length of hospitalization, morbidity and mortality rates did not show any statistical difference between the two groups.Improved survival outcome by curative surgery, especially in regard to long-term outcome, has never been adequately studied in patients with limited and isolated synchronous hepatic metastases of PDAC. To date, surgery in these cases is not recommended in any current guideline. Curative intended therapy for patients with synchronous hepatic-metastasized colorectal cancer or pancreatic neuroendocrine tumors have been neglected in the past. However, over the last decade surgery became the gold standard of care. Moreover, it has been proven to be oncologically beneficial, to prolong survival, and to improve the quality of life , 14. In It is clear that the decision for a surgical approach is made after subjective reflection of the surgeon. To date, pancreatic resections with synchronous metastasectomies of the liver are rarely performed only in high-volume centers with adequate experience . Thus, tp\u2009<\u20090.001). In a large single-center study from Heidelberg, analogous results were reported [In two recent studies, a larger number of patients with synchronously hepatic-metastasized PDACs were analyzed , 18. Sixreported . No studInterestingly, the pattern of metachronous metastases was not statistically different in M0 and M1surgR0 patients in our cohort, even if the number of patients included was limited. In both groups, the majority of patients suffered from metachronous hepatic disease. Similar postoperative findings have never been described in previous literature. However, it is known that the foremost primary site of disease recurrence after curative-intended multimodal therapeutic approach for PDAC is the liver . Of noteOur study has several limitations including different applied adjuvant treatment regimes. FOLFIRNOX for a multimodal treatment setting was applied in 22.8% of all M1surg and only 8.1% of all M0 patients. An intensified gemcitabine/cisplatin based adjuvant radiochemotherapy was again only administered in M1surg patients. Presumably, this might have influenced the benefit in survival outcome in M1surgR0 patients , 22. AnoThe five years survival rate after multimodal therapy for PDAC has not changed over the past decades and is still below 10% . It is tIn our opinion, even if patients with synchronously hepatic-metastasized patients are susceptible to micro-metastases, and on the basis of our findings in survival outcome after R0 resection and extended chemotherapy, these new approved chemotherapeutic regimes could help us to open up indication windows for curative-intended therapy. Further multi-centric studies are clearly warranted to analyze the oncological benefit of this interdisciplinary therapeutic approach and foremost the setting of multimodality (neoadjuvant vs. adjuvant) , 22, 23.In summary, selected patients with synchronously hepatic-metastasized PDAC may benefit from extended surgery if an extended chemotherapeutic regime will be applied. Simultaneous pancreatic and liver resections are feasible and well justified by similar morbidity and mortality rates compared to patients with isolated pancreatic surgery. Despite the advanced stage of PDAC, survival outcome after extended surgery was prolonged and thus similar when compared to patients who received surgery for localized PDACs. To validate our results, future studies are warranted to determine which patients may benefit from simultaneous resections \u201326.Supplementary file1 (DOCX 17 KB)Supplementary file2 (DOCX 17 KB)Below is the link to the electronic supplementary material."}
+{"text": "However, these benefits are coupled with ethical challenges. For example, ADMS may produce discriminatory outcomes, violate individual privacy, and undermine human self-determination. New governance mechanisms are thus needed that help organisations design and deploy ADMS in ways that are ethical, while enabling society to reap the full economic and social benefits of automation. In this article, we consider the feasibility and efficacy of ethics-based auditing (EBA) as a governance mechanism that allows organisations to validate claims made about their ADMS. Building on previous work, we define EBA as a structured process whereby an entity\u2019s present or past behaviour is assessed for consistency with relevant principles or norms. We then offer three contributions to the existing literature. First, we provide a theoretical explanation of how EBA can contribute to good governance by promoting procedural regularity and transparency. Second, we propose seven criteria for how to design and implement EBA procedures successfully. Third, we identify and discuss the conceptual, technical, social, economic, organisational, and institutional constraints associated with EBA. We conclude that EBA should be considered an integral component of multifaced approaches to managing the ethical risks posed by ADMS.Important decisions that impact humans lives, livelihoods, and the natural environment are increasingly being automated. Delegating tasks to so-called  Automated decision-making systems (ADMS), i.e. autonomous self-learning systems that gather and process data to make qualitative judgements with little or no human intervention, increasingly permeate all aspects of society   are superfluous. In contrast, as stipulated by the AI HLEG , ADMS shEthics Guidelines for Trustworthy AI .[Automatic Decision-Making System] refers to sociotechnical systems that encompass a decision-making model, an algorithm that translates this model into computable code, the data this code uses as an input, and the entire environment surrounding its use.From an ethical perspective, it is primarily the autonomous, complex, and scalable nature of ADMS that either introduces new types of challenges or exacerbates existing societal tensions and inequalities. Although interlinked and mutually reinforcing, these three features pose different conceptual challenges. The autonomous nature of ADMS makes it difficult to predict and assign accountability when harms occur  and methods  are employed to verify claims and create traceable documentation. This documentation process enables the identification of the reasons why an ADMS was erroneous, which, in turn, could help anticipate undesired consequences for certain stakeholders and prevent future mistakes  has a long history of promoting trust and transparency\u00a0in areas like security and financial accounting ; (b) code auditing, which entails reviewing the source code of an algorithm; and (c) impact auditing, whereby the severity and prevalence of the effects of an algorithm\u2019s outputs are investigated.As demonstrated in section\u00a0It should be reemphasised that the primary responsibility for identifying and executing steps to ensure that ADMS are ethically sound rests with the management of the organisations that design and operate such systems. In contrast, the independent auditor\u2019s responsibility is to (i) assess and verify claims made by the auditee about its processes and ADMS and (ii) ensure that there is sufficient documentation to respond to potential inquiries from public authorities or individual decision subjects. More proactively, the process of EBA should also help spark and inform ethical deliberation throughout the software development process. The idea is that continuous monitoring and assessment ensures that a constant flow of feedback concerning the ethical behaviour of ADMS is worked into the next iteration of their design and application. Figure\u00a0EBA can provide decision-making support to executives and legislators by defining and monitoring outcomes, e.g. by showing the normative values embedded in a system AIEIG, . Here, EEBA can increase public trust in technology and improve user satisfaction by enhancing operational consistency and procedural transparency. Mechanisms such as documentation and actionable explanations are essential to help individuals understand why a decision was reached and contest undesired outcomes . However, regardless of which KPI an organisation chooses to adopt, audits are only meaningful insofar as they allow organisations to verify claims made about their ADMS. This implies that EBA procedures themselves must be traceable. By providing a traceable log of the steps taken in the design and development of ADMS, audit trails can help organisations verify claims about their engineered systems (Brundage et al., As a starting point, it should be acknowledged that ADMS are not isolated technologies. Rather, ADMS are both shaped by and help shape larger sociotechnical systems Dignum, . Hence, accountable (Ananny & Crawford, strategies, policies, and reward structures.Further, to ensure that ADMS are ethically-sound, organisational policies need to be broken down into tasks for which individual agents can be held dialectic process wherein the auditor ensures that the right questions are asked (Goodman, continuously, i.e. through \u2018oversight programs\u2019 (Etzioni & Etzioni, Importantly, EBA does not provide an answer sheet but a playbook. This means that EBA of ADMS should be viewed as a Goodman,  and answGoodman, . To manaGoodman, . InsteadFinally, the alignment between ADMS and specific ethical values is a design question. Ideally, properties like interpretability and robustness should be built into systems from the start, e.g. through \u2018Value-Aligned Design\u2019 (Bryson & Winfield, seven criteria. More specifically, to help organisations manage the ethical risks posed by ADMS, we argue that EBA procedures should be:Holistic, i.e. treat ADMS as an integrated component of larger sociotechnical contextsTraceable, i.e. assign responsibilities and document decisions to enable follow-upAccountable, i.e. help link unethical behaviours to proportional sanctionsStrategic, i.e. align ethical values with policies, organisational strategies, and incentivesDialectic, i.e. view EBA as a constructive and collaborative processContinuous, i.e. identify, monitor, evaluate, and communicate system impacts over timeDriving re-design, i.e. provide feedback and inform the continuous re-design of ADMSTaken together, these generalisable lessons suggest that EBA procedures, even imperfectly implemented, can make a real difference to the ways in which ADMS are designed and deployed. However, our analysis of previous work also finds that, in order to be feasible and effective, EBA procedures must meet Of course, these criteria are aspirational and, in practice, unlikely to be satisfied all at once. Nevertheless, we must not let perfect be the enemy of good. Policymakers and organisations that design and deploy ADMS are thus advised to consider these seven criteria when developing and implementing EBA procedures.Despite the methodological advantages identified in section\u00a0Conceptual constraints cannot be easily overcome by means of technical innovation or political decision. Instead, they must be managed continuously by balancing the need for ethical alignment with tolerance and respect for pluralism. Insofar as ethical guidelines often mask unresolved disputes about the definitions of normative concepts like fairness and justice, EBA of ADMS may be conceptually constrained by hidden political tensions. For example, the reviewed literature accommodates more than six definitions of fairness, including individual fairness, demographic parity, and equality of opportunity (Kusner et al., While EBA of ADMS can help ensure compliance with a given policy, how to prioritise between conflicting interpretations of ethical principles remains a normative question. This is because translating principles into practice often requires trade-offs between different legitimate, yet conflicting normative values. Using personal data, for example, may improve public services by tailoring them but compromise privacy. Similarly, while increased automation could make lives more convenient, it also risks undermining human autonomy. How to negotiate justifiable trade-offs is a context-dependent, multi-variable problem. While audits cannot guarantee that a justifiable balance has been struck, the identification, evaluation, and communication of trade-offs can be included as assessment criteria. One function of EBA is thus to make visible implicit choices and tensions, give voice to different stakeholders, and arrive at resolutions that, even when imperfect, are at least publicly defensible (Whittlestone et al., Moreover, EBA is constrained by the difficulty of quantifying externalities that occur due to indirect causal chains over time. This problem is exacerbated by the fact that the quantification of social phenomena inevitably strips away local knowledge and context (Mau & Howe, Technical constraints are tied to the autonomous, complex, and scalable nature of ADMS. These constraints are time and context-dependent and thus likely to be relieved or transformed by future research. Three of them are worth highlighting. First, consider how the complexity and the lack of transparency of machine learning models hinder their interpretation (Oxborough et al., A second technical constraint stems from the use of agile software development methods. The same agile qualities that help developers meet rapidly changing customer requirements also make it difficult for them to ensure compliance with pre-specified requirements. One approach to managing this tension is to incorporate agile methodologies (see e.g. Strenge & Schack, Finally, EBA is technically constrained by the fact that laboratories differ from real-life environments (Auer & Felderer, Economic and social constraints are those derived from the incentives of different actors. Unless these incentives are aligned with the normative vision for ethically-sound ADMS, economic and social constraints will reduce both the feasibility and effectiveness of EBA. Inevitably, EBA imposes costs, financial and otherwise. Even when the costs of audits are justifiable compared to the aggregated benefits, society will face questions about which stakeholders would reap which benefits and pay which costs. For example, the cost of EBA risks having a disproportionate impact on smaller companies Goodman, . SimilarMoreover, there is always a risk of adversarial behaviour during audits. The ADMS being audited may, for example, attempt to trick the auditor Rahwan, . An examAnother concern relates to the fact that ADMS increasingly mediate human interactions. From an EBA perspective, nudging, i.e. the process of influencing personal preferences through positive reinforcement or indirect suggestion (Thaler & Sunstein, ex ante regulation rather than relying on ex post judicial enforcement. However, the main takeaway is that EBA will only be as good as the institution backing it (Boddington et al., Organisational and institutional constraints concern the operational design of EBA frameworks. Because these constraints depend on legal sanctioning, they are inevitably linked to questions about power. Who audits whom? As of today, a clear institutional structure is lacking. To establish integrity and validity, EBA of ADMS must therefore adhere to a transparent and well-recognised process. However, both internal audits and those performed by professional service providers are subject to concerns about objectivity. A more plausible way to mandate EBA of ADMS would be the creation of a regulatory body to oversee system owners and auditors. Just as the Food and Drug Administration tests and approves medicines, a similar agency could be set up to approve specific types of ADMS Tutt, . Such anIn a similar vein, EBA is only effective if auditors have access to the information and resources required to carry out rigorous and meaningful audits. Thus, EBA is infeasible without strong regulatory compulsion or cooperation from system owners. Data controllers have an interest not to disclose trade secrets. Moreover, the resources required to audit ADMS can easily exceed those available to auditors. If, for example, auditors have no information about special category membership, they cannot determine whether a disparate impact exists. Consequently, the effectiveness of EBA is constrained by a lack of access to both relevant information and resources in terms of manpower and computing power.There are also fundamental tensions between national jurisdictions and the global nature of technologies (Erdelyi & Goldsmith, The responsibility to ensure that ADMS are ethically-sound lies with the organisations that develop and operate them. EBA\u2014as outlined in this article\u2014is a governance mechanism that helps organisations not only to ensure but also demonstrate that their ADMS adhere to specific ethics principles. Of course, this does not mean that traditional governance mechanisms are redundant. On the contrary, by contributing to procedural regularity and transparency, EBA of ADMS is meant to complement, enhance, and interlink other governance mechanisms like human oversight, certification, and regulation. For example, by demanding that ethics principles and codes of conduct are clearly stated and publicly communicated, EBA ensures that organisational practices are subject to additional scrutiny which, in turn, may counteract \u2018ethics shopping\u2019. Similarly, EBA helps reduce the risk for \u2018ethics bluewashing\u2019 by allowing organisations to validate the claims made about their ethical conduct and the ADMS they operate. Thereby, EBA constitutes an integral component of multifaceted approaches to managing the ethical risks posed by ADMS.In particular, continuous EBA can help address some of the ethical challenges posed by autonomous, complex, and scalable ADMS. However, even in contexts where EBA is necessary to ensure ethical alignment of ADMS, it is by no means sufficient. For example, it remains unfeasible to anticipate all long-term and indirect consequences of a particular decision made by an ADMS. Further, while EBA can help ensure alignment with a given policy, how to prioritise between irreconcilable normative values remains a fundamentally normative question. Thus, even if private initiatives to develop EBA mechanisms should be encouraged, the shift of power and ultimate responsibility from juridical courts to private actors\u00a0must be resisted. The solution here is that regulators should retain supreme sanctioning power by authorising independent agencies which, in turn, conduct EBA.The constraints highlighted in this article do not seek to diminish the merits of EBA of ADMS. In contrast, our aim has been to provide a roadmap for future work. While all constraints listed constitute important fields of research, social concerns related to the potentially transformative effects of ADMS deserve specific attention. By shifting the normative base on which liberal democracy is built, ADMS may undermine this trust. Therefore, the design and implementation of EBA frameworks must be viewed as a part of\u2014and not separated from\u2014the debate about the type of society humanity wants to live in, and what moral compromises individuals are willing to strike in its making.In conclusion, standardised EBA procedures can help organisations validate claims about their ADMS and help strengthen the institutional trust that is foundational for good governance. However, EBA will not and should not replace the need for continuous ethical reflection and deliberation among individual moral agents."}
+{"text": "Chlorella vulgaris (5% in the diet), supplemented or not with two exogenous carbohydrase mixtures on piglets\u2019 performance, nutrient digestibility and gut morphology, fermentation products and microbiota. Forty-four male piglets weaned at 28\u00a0days of age, with 11.2\u2009\u00b1\u20090.46\u00a0kg of live weight, were used and assigned to 1 of 4 dietary treatments: cereal and soybean meal based-diet , control diet with 5% of C. vulgaris , CH diet supplemented with 0.005% of Rovabio\u00ae Excel AP  and CH diet supplemented with 0.01% of a recombinant 4-carbohydrase mixture . Growth performance was not changed by the of C. vulgaris inclusion during 21\u00a0days of trial. However, total tract apparent digestibility of nutritional fractions was negatively impacted by the inclusion. In addition, the viscosity of duodenum plus jejunum contents slightly increased in all groups fed with the microalga. In contrast, dietary microalga increased duodenum villus height and promoted a healthier gut microbiota, with higher abundance of some specific bacterial taxa . This study indicates that the dietary inclusion of 5% C. vulgaris improves piglets\u2019 gut health without impairing performance. Data also indicate that C. vulgaris reduces nutrient digestibility but promotes compensatory developments of gut mucosa and prebiotic effects. Dietary supplementation with exogenous carbohydrases does not seem to be necessary for this inclusion level. Therefore, the incorporation of CH as a sustainable feed ingredient in piglets\u2019 nutrition is a viable alternative approach.The purpose of this study was to evaluate the impact of  Furthermore, the use of antibiotics for preventive or therapeutic purposes has been associated with an increased occurrence of antimicrobial resistant microorganisms, showing that strategies to reduce or prevent their utilization are necessary.The post-weaning period is one of the most critical periods in swine production. It is associated to social, environmental and nutritional changes. In addition, piglets\u2019 immune system is not yet fully developed and, therefore, animals are more susceptible to several digestive and respiratory pathologies. Also, recently weaned pigs experience strong structural and physiological changes in the intestine2. In addition, they are considered sustainable feedstuffs that do not compete for land and other resources necessary to produce food for human consumption3. Furthermore, they have the potential to fixate carbon dioxide from the atmosphere, thus contributing to mitigate global warming. Furbeyre et al.4 observed that a 1% dietary inclusion of Spirulina and Chlorella vulgaris as an alternative to antibiotics improved the intestinal health in weaned piglets. As mentioned in the literature, small inclusion levels of different microalgae in piglet diets increase gut health, albeit more research is needed in order to understand, establish and validate their effect on the intestinal microflora3.Among these strategies, several feed-based solutions are considered interesting alternatives. Innovative compounds and feedstuffs, like microalgae, are of interest for their prebiotic properties in order to cope with post-weaning stress5. However, enzymes that degrade the cell wall, like Carbohydrate-active enzymes (CAZymes or carbohydrases), might improve their utilization with positive effects on nutrient bioavailability, in addition to promote the prebiotic properties of the insoluble polysaccharides typical of these matrices. Accordingly, Coelho et al.6 described a 4-CAZyme mixture able to degrade in vitro the C. vulgaris cell wall. Furthermore, Martins et al.7 recently studied a higher level of dietary Spirulina incorporation (10% dietary inclusion), either individually and in combination with 2 commercial carbohydrases, in post-weaned piglets\u2019 diets. Authors showed that lysozyme is efficient in the degradation of this microalga cell wall in the piglet\u2019s gut.Although microalgae have a high nutritive value and are an interesting sustainable alternative to cereals and soybean in swine diets, the particular characteristics of their recalcitrant cell wall make them rather indigestible for monogastric animalsC. vulgaris in the diet, combined with 2 exogenous carbohydrase mixtures  of nutrients and consistency of faeces are shown in Table TTAD values of neutral detergent fibre (NDF), acid detergent fibre (ADF) and hemicellulose were significantly different between all experimental groups, with the control group showing the highest values, followed by the CH\u2009+\u2009R group, whereas the CH\u2009+\u2009M group had the lowest value of NDF and hemicellulose, and the CH group of ADF. TTAD of cellulose was higher in the CH\u2009+\u2009M group, albeit with no significant differences in comparison with the CH\u2009+\u2009R group. It showed, however, significant differences when compared with the CH group (6.3 percentage points increase). When we look at the results considering the 2 different collection periods, there were significant differences for TTAD for all nutrients, except for CF and ADF. For the second period, the TTAD results were lower than those of the first period.Concerning faecal scores, no significant differences between the experimental groups were detected, neither considering the effect of diet nor the effect of collecting period .In Table The control group had lower duodenum villus heights when compared with the other groups fed with the microalga. The incorporation of microalga caused an 18% increase by comparison with the control group. Consequently, the villus height to crypt depth ratio were higher for groups fed with microalga (P\u2009=\u20090.0088). The villus height for jejunum and ileum were similar for all experimental treatments. Additionally, for the other 2 variables measured, villus width and crypt depth, at 3 different gut locations, no significant differences were detected (P\u2009>\u20090.05).The effect of diets on volatile fatty acids (VFA) concentration of piglets\u2019 caecum and colon contents is shown in Table For VFA concentration in the colon, there was a significant influence of dietary treatments. By comparison with the control group, microalga-fed experimental groups had a significant decrease of 30%, 24% and 40%, respectively, for the concentration of C2. For the C3 concentration, the same comparisons led a decrease of 24%, 25% and 37%, respectively. For the C4 and C5 concentrations, only the CH\u2009+\u2009M group had a significant decrease of 45% and 57%, when compared with the control group. For iC5 and total VFA concentrations, comparatively with the control group, all microalga-fed groups had a significant reduction. Regarding the CH vs. CH\u2009+\u2009R groups\u2019 comparison, similar values were observed for all VFA concentrations in the colon. When the CH group was compared with the CH\u2009+\u2009M, the only recorded significant difference concerned the C3 concentration that was 16% increase in the CH\u2009+\u2009M group. When comparing the 2 groups supplemented with enzymes regarding C3 concentration, there was significant 16% increase in the CH\u2009+\u2009M group.As a sanity check for the sequencing procedure the rarefaction curve was plotted . Composition plots showing the relative abundance of the top 10 taxa for Phylum, Family and Genus are reported in Supplementary Fig. All the reads that were maintained in every step of the bioinformatic analysis are presented in Supplementary Table For the alpha diversity, Chao1, Shannon and InvSimpson indices were calculated. None of the treatment influenced the alpha diversity measures . Although, the pair-wise Adonis test does not evidence any significant results for each of the possible comparisons. However, when the results for all CH-fed groups are combined and compared against the control group, there is a significant effect . In addition, the PERMDISP test was not significant, confirming the results of the Adonis test.For the beta diversity, meaning the differences in microbial composition between samples, a PCoA plot using a Euclidian distance matrix . CH\u2009+\u2009R group had a higher abundance of genera Oscillospira and Lactobacillus. Whereas CH\u2009+\u2009M supplementation increased the abundance of bacteria from genus Helicobacter and horsej-a03 (family Oligosphaeraceae). Finally, animals from the control group were characterized by having bacteria belonging to Ruminococcus, Mitsuokella, Catenibacterium and some non-characterized bacteria belonging to Oscillospirales and Clostridia.As shown in Fig.\u00a0C. vulgaris, alone and in combination with 2 exogenous carbohydrase formulations, on recently weaned piglet performance, nutrient digestibility and intestine morphology, fermentation and microbiota. To the best of our knowledge, this is the first time that the subject was assessed in such detail in the newly weaned piglet. We established that the dietary inclusion of C. vulgaris as a feedstuff had no impact on growth performance of piglets, although ADFI was significantly higher in the groups fed with microalga. Such higher ADFI was not enough to significantly increase the growth rate of the animals. In the future, there is interest in confirming these results through a growth performance trial that involving a larger number of animals and ad libitum access to experimental diets. In addition, the supplementation of C. vulgaris-based diets with exogenous enzymes (Rovabio\u00ae Excel AP and the pre-selected 4-carbohydrase mixture) did not exert a particular influence on animal performance parameters of the piglets. Such results are in accordance with a performance study on growing-finishing pigs (59.1 to 101.9\u00a0kg), where the dietary inclusion of C. vulgaris and exogenous enzymes did not influence animal productive parameters9. Nevertheless, there are several studies on the subject that use C. vulgaris as a supplement (\u2264\u20091% in diet) in piglet feeding to have a prebiotic effect5. For instance, Furbeyre et al.4 used 1% C. vulgaris in piglets\u2019 diets to mitigate the post-weaning stress. These authors found no significant effects on ADFI, ADG and FCR. In addition, the same authors performed a trial with C. vulgaris via drinking water (385\u00a0mg/kg live weight) in weaning piglets with the same aim and also found no significant differences for ADFI, ADG and FCR10.This study assessed the effect of dietary inclusion of 5% C. vulgaris incorporation, particularly the fibre fractions. This indicates a low efficiency of carbohydrase formulations in the C. vulgaris cell wall degradation in the intestine. However, the CH\u2009+\u2009R group had values closer to those of the control group than to those of the CH\u2009+\u2009M animals. Therefore, it could be speculated that the Rovabio\u00ae Excel AP has a higher C. vulgaris cell wall degradation ability than the 4-carbohydrase mixture. As Rovabio\u00ae Excel AP contains predominantly \u03b2-xylanases and \u03b2-glucanases, such hydrolytic activity was likely due to the degradation of the small amount of xylans and \u03b2-glucans in the C. vulgaris cell wall11. After all, it is noteworthy to mention that dietary treatment influenced the fibre profile that reached piglets\u2019 large intestine. Furthermore, the TTAD of nutrients was significantly different for the 2 collection periods, with worse results for the second period. This indicates a difficulty of the piglets to adapt and digest diets containing high levels of C. vulgaris. Although no effects of diet and collection period on faecal consistency were observed, the higher value associated to animals fed with microalga in the second period seems to agree with the lower TTAD values determined.The TTAD of nutritional fractions was negatively affected by 7. However, this effect disappeared in the ileum content, where no differences in viscosity were found between experimental groups, and a compensatory small intestine enlargement was not found. Regarding the intestinal morphology, the incorporation of microalga in piglets\u2019 diets affected only the duodenum villus height. This effect indicates the development of intestinal tissue in order to increase nutrients absorption. Similarly, Furbeyre et al.4 detected an increase in villus height in the jejunum, highlighting the positive effect of C. vulgaris supplementation on mucosal restoration or development after weaning. In our study, the increase of duodenum villus height seems to be able to compensate, at least in part, the higher digesta viscosity promoted by the C. vulgaris feed incorporation.The viscosity of duodenum plus jejunum contents slightly increased in the groups fed with microalga by comparison with the control group. Thus, it could be suggested that this increase in digesta viscosity did not result from the presence of soluble polysaccharides, such as arabinoxylans and \u03b2-glucans, as commonly observed in wheat or barley-based diets, since the presence of xylanases and \u03b2-glucanases in the CH\u2009+\u2009R group had no effect on viscosity. It is well known that higher digesta viscosity limits the access of endogenous enzymes to their target substratesC. vulgaris, with the consequent change in the microbial fermentation profile. The recalcitrant cell wall may justify the presence of less fermentable cell wall constituents in this digestive compartment. Several studies have associated insoluble dietary fibre content of diets to the effect on fermentation, generation and absorption of VFA at the level of the large intestine12. Thus, the lower TTAD of fibre fractions of the CH\u2009+\u2009M group could also explain the lower VFA values. Additionally, Montoya et al.13 refer the importance of not extrapolating the results because the type of dietary fibre influences the quantity of VFA produced by fermentation. Information on physical characteristics, molecular structure and chemical composition of the fibre of C. vulgaris microalga is scarce and, therefore, further research has still to be conducted on this aspect.Regarding VFA concentration in the caecum, the CH\u2009+\u2009M group showed a significantly lower quantity of total VFA compared with all other groups. The lower degradation rate reported in this group may be associated with the lower quantity of cell wall material that reach the caecum. This aspect suggests a possible effect of the enzymatic mixture on the degradation of microalga cell walls at the level of small intestine. In the colon, the concentration of total VFA was decreased for all animals fed with the microalga. This decrease indicates a low level of fermentable carbohydrates in the colon of piglets fed with C. vulgaris in piglet feeding, in combination or not with enzymes, significantly affects the faecal bacterial structure of piglets, as previously observed in humans14. In addition, C. vulgaris incorporation supplemented with 0.005% Rovabio increased the relative abundance of Lactobacillus and Oscillospira. Lactobacillus which is one of the most represented genera. This bacterial taxon usually constitutes the core member of a healthy pig microbiota15, preventing intestinal colonization of enteric pathogens16. Oscillospira is an anaerobic bacterial genus from the Clostridial cluster, that is widely studied in human research due to its role in preventing specific diseases, such as obesity-related metabolic diseases17. In addition, due to its ability to produce short-chain fatty acids (SCFAs) such as butyrate, it has been proposed as a potential probiotic18. On the other end, the contrast highlighted that the CH\u2009+\u2009M group was characterised byHelicobacter genus, compared to the other groups. The highest prevalence of Helicobacter, together with the highest pH, in the upper part of the small intestine should be ascribed to the effect of enzyme mixture on the degradation of microalgae cell wall, thus providing a substrate for proteolytic bacteria. It thus seems that the efficacy of this enzyme mixture was site dependent. Indeed, the TTAD is lower, compared with that of the other CH groups, especially for the fibrous fractions. In accordance, VFA concentrations are lower in the CH\u2009+\u2009M group than in the other groups, particularly in the cecum. This suggests a lower efficiency of the 4-enzyme mixture to degrade microalga cell wall. In addition, C. vulgaris supplementation reduced the abundance of Ruminicoccus, a bacterial taxon known for its fibrinolytic activity and the production of VFA, especially butyrate19, which can also explain the lower VFA and TTAD of fibrous fractions.Microbiome results suggest that the use of C. vulgaris in the diet improves piglets\u2019 gut health without compromising animal performance. Data indicates that although nutrients digestibility, mainly for fibre fractions, decreases by the incorporation of microalga in the diet, production performance of piglets is not impaired. This is likely explained by two compensatory mechanisms, the gut mucosa development and the probiotic properties of some specific bacterial taxa in the intestine .In this study, we showed that the inclusion of 5% C. vulgaris-based diets at this level of incorporation.Moreover, the dietary supplementation with exogenous carbohydrases does not seem to be necessary for feeding piglets with C. vulgaris as a prebiotic and sustainable feed ingredient in the diet is an interesting strategy for swine production, particularly for the recently weaned piglet. However, its cost-effective utilization for this purpose warrants further investigation.Considering that weaning is a critical period for piglets\u2019 health, the inclusion of https://arriveguidelines.org/arrive-guidelines), all the procedures used in this animal experiment were revised by the Ethics Commission of ISA and accepted by the Animal Care Committee of the National Veterinary Authority .Following the principles and specific guidelines of the European Union legislation (2010/63/EU Directive), as well as the ARRIVE guidelines 2.0  cereal and soybean meal-based diet ; (2) control diet with 5% of C. vulgaris ; (3) control diet with 5% of CH supplemented with 0.005% of Rovabio\u00ae Excel AP  ; and (4) control diet with 5% CH supplemented with 0.01% of the 4-carbohydrase mixture described by Coelho et al.21 . The microalga was supplied by the company Allmicroalgae\u2014Natural Products SA, Pataias, Portugal as freeze-dried powder and included as supplied in the diets. Its chemical composition was previously described by our team in Coelho et al.9. The detailed description of the experimental diets is presented in Supplementary Table Forty-four post-weaned piglets (50% Pietrain\u2009\u00d7\u200925% Large White\u2009\u00d7\u200925% Landrace), weaned at 28 d of age and with an initial live weight of 11.2\u2009\u00b1\u20090.46\u00a0kg (mean\u2009\u00b1\u2009SD) were obtained from a commercial farm. Each animal was allocated to a crate equipped with a feeder, a stainless-steel nipple, a heating lamp and plates for separation of faeces and urines. The environmental conditions of the room were the same as described previouslyin\u00a0\u2212\u00a0Nout)/Nin)\u2009\u00d7\u2009100 was used. Nin represents the total intake of a specific nutrient in the feed and Nout represents the total faecal output for the same nutrient. In addition, the consistency of the faeces was recorded daily, according to the following scale: 0 , 1 (soft faeces) or 2 (diarrhoea).Piglets were fed daily, with the same amount of feed provided per animal. To calculate ADFI, feed refusals were recorded daily. Animals had ad libitum access to water. Moreover, the individual body weight was recorded weekly in order to calculate ADG and FCR. The faeces were collected for 2 periods of 6 d in order to calculate TTAD. The following equation: TTAD\u2009=\u2009 or stored at \u2013\u00a020\u00a0\u00b0C for VFA determination. For histological analysis, 3 segments of the small intestine were collected: duodenum (10\u00a0cm below pylorus), jejunum (5.5\u00a0m below pylorus) and ileum . These tissue samples were fixed into 10% buffered formalin solution and then processed for paraffin embedding. For microbiome analysis, faecal samples were collected and stored at \u2212\u00a080\u00a0\u00b0C until DNA extraction.7. Briefly, faecal samples were dried at 60\u00a0\u00b0C for 72\u00a0h in an oven with ventilation. Diets and dried faecal samples were ground in 1\u00a0mm diameter mesh mill and analysed, in duplicate, for DM, ash, CP and CF contents, following the methods described by AOAC22. NDF, ADF and acid detergent lignin (ADL) were performed sequentially using crucibles system by Van Soest et al.23. Hemicellulose and cellulose were calculated as NDF-ADF and ADF-ADL, respectively.All the methods used for diets and faeces analysis were previously described24. Briefly, cysteine and methionine were oxidised to cysteic acid and methionine sulphone, respectively, prior to hydrolysis. All the other amino acids, except tryptophan, were determined in hydrolysates of unoxidized samples. The determination of tryptophan in samples was performed according to la Cour et al.25. All amino acids were analysed by HPLC , combined with automated pre-column derivatisation using o-phthaldialdehyde and 9-fluorenylmethyl chloroformate, as reported by Henderson et al.26. FAME were analysed by extraction and acid transesterification, using fatty acid 21:0 as the internal standard27. Diterpene profile was conducted by a single n-hexane extraction succeeded by HPLC28. The determination of pigments was performed according to Teimouri et al.29, with small modifications. After overnight extraction with acetone, obtained solutions were centrifuged at 2000\u00d7g for 5\u00a0min and analysed by UV\u2013Vis spectrophotometry measuring the absorbance at different wavelengths . Pigment contents were calculated using the equations described by Hynstova et al.30. The mineral composition was performed following the previously described protocol31.Determination of amino acids, fatty acid methyl esters (FAME), diterpene profile, pigments and mineral composition were performed in the microalga and diets. The amino acids, except tryptophan, were measured as described in Commission Regulation (EC) No 152/2009The detailed chemical composition of the microalga and experimental diets is shown in Table 7.The pH measurement of the contents of stomach, duodenum plus jejunum, ileum, caecum and colon were immediately determined, using a glass electrode pH meter . The viscosity of small intestine contents was measured as previously described32, on the supernatant of thawed samples centrifuged at 8000\u00d7g for 10\u00a0min. The 4-Methyl valeric acid was used as internal standard.Caecum and colon contents (5\u00a0g) were collected in a 5% (v/v) o-phosphoric acid until the quantification of the following VFA: C2, C3, C4, C5 and. These compounds were quantified by gas chromatography as previously describedMicroscopic examination and measurement of villi heights and widths and crypt depths were performed in 7\u00a0\u03bcm thick tissue sections, stained with haematoxylin\u2013eosin. An Olympus BX 51 microscope equipped with 4\u00d7\u2009and 10\u00d7\u2009lenses was used. Images were digitally captured with an Olympus DP 21 camera. The height and width of the villi and the depth of the crypts were measured using the Olympus DP-Soft software. Ten intact and correctly oriented villi and crypts from each intestinal region were selected for each piglet.Total bacterial DNA was isolated and extracted with QIAamp\u00ae Fast DNA Stool Mini Kit  following the manufacturer\u2019s instructions. DNA concentration and purity (absorbance ratio 260/280 and 260/230) of the isolated DNA were checked by spectrophotometry on the NanoDrop .33.For the microbiological analysis of faecal samples, the V4 region of the 16S rRNA gene (~\u2009380\u00a0bp) was amplified 515f: 5\u2032\u2010GTGYCAGCMGCCGCGGTAA\u20103\u2032; 806r: 5\u2032\u2010GGACTACNVGGGTWTCTAAT\u20103\u2032 and sequenced using the Illumina 2\u2009\u00d7\u2009250\u00a0bp MiSeq platform 34 running on R 4.0.2. For the taxonomic assignment, the SILVA database release 138 was used as reference35.The bioinformatic analysis was performed using DADA2 1.14.0Data homogeneity and normality were verified. Growth performance, nutrient digestibility, intestinal morphology and VFA data were analysed using the PROC MIXED of SAS software package . The consideration of the model was the dietary treatment as single effect and the piglet as experimental unit. When significant effects of treatments were detected, least square means were compared using the PDIFF with Tukey\u2013Kramer adjustment options of SAS. TTAD data were analysed using the PROC MIXED, considering repeated measures over time to test the effect of diet, period and their interaction. Results were considered significantly different when the P-value\u2009<\u20090.05.36, Vegan37 and DESeq238 packages. To test the differences between the groups for the alpha diversity, a Multifactorial ANOVA (MANOVA) model was fitted, considering sequencing depth and group as factors. For the beta diversity, the Euclidian distance was calculated, and the differences between groups were tested using a non-parametric PERMANOVA (Adonis) model, with 999 permutations, pair-wise contrast were made using the pairwise Adonis function provided by the pairwise Adonis R package39. In addition, to tests the homogeneity of dispersion among them a PERMDISP test was used40. Samples abundances were normalized using variance stabilizing transformation provided by DESeq2 package. Differences for the taxonomic composition between treatments were tested using Linear discriminant analysis (LDA) effect size (LEfSe) aggregating the data at Genus level, LDA score cut-off of 3 was used to discriminate bacterial taxa41. The P-values were adjusted for multiple comparison using the False Discovery Rate (FDR) method. Significance was declared if P-value\u2009<\u20090.05 and a trend was considered when 0.05\u2009<\u2009P-value\u2009<\u20090.10.Regarding the statistical analysis of the microbiome, data on alpha diversity, beta diversity and taxonomic composition were carried in R 4.0.2 using phyloseqSupplementary Figure S1.Supplementary Figure S2.Supplementary Table S1.Supplementary Table S2."}
+{"text": "Aberrant WNT pathway activation, leading to nuclear accumulation of \u03b2\u2010catenin, is a key oncogenic driver event. Mutations in the tumor suppressor gene APC lead to impaired proteasomal degradation of \u03b2\u2010catenin and subsequent nuclear translocation. Restoring cellular degradation of \u03b2\u2010catenin represents a potential therapeutic strategy. Here, we report the fragment\u2010based discovery of a small molecule binder to \u03b2\u2010catenin, including the structural elucidation of the binding mode by X\u2010ray crystallography. The difficulty in drugging \u03b2\u2010catenin was confirmed as the primary screening campaigns identified only few and very weak hits. Iterative virtual and NMR screening techniques were required to discover a compound with sufficient potency to be able to obtain an X\u2010ray co\u2010crystal structure. The binding site is located between armadillo repeats two and three, adjacent to the BCL9 and TCF4 binding sites. Genetic studies show that it is unlikely to be useful for the development of protein\u2013protein interaction inhibitors but structural information and established assays provide a solid basis for a prospective optimization towards \u03b2\u2010catenin proteolysis targeting chimeras (PROTACs) as alternative modality. Targeting the armadillo repeat: We report the fragment\u2010based discovery of a small\u2010molecule binder to the key cancer target \u03b2\u2010catenin. Iterative virtual screening and ligand\u2010based NMR techniques enabled hit optimization in absence of structural information. The co\u2010crystal structure of a derivative in complex with a short \u03b2\u2010catenin variant revealed a novel small\u2010molecule binding site between armadillo repeats two and three. The WNT signal transduction cascade is a key regulatory pathway during embryonic development and adult tissue homeostasis. In the canonical WNT pathway, the armadillo repeat protein \u03b2\u2010catenin serves as the central signaling molecule, linking WNT ligand mediated pathway activation to target gene induction in the nucleus.in\u2005vitro and in\u2005vivo tumor models,[N\u2010terminal domain of the coactivator, CBP, thereby antagonizing its interaction with \u03b2\u2010catenin.141\u2013305) comprising only the first four armadillo repeats  spectroscopy and consecutive confirmation in two\u2010dimensional 1H/15N\u2010transverse relaxation optimized spectroscopy (TROSY) NMR experiments. Initially, the fragments were screened in mixtures of four compounds per well with STD NMR, and 145 hits were identified  could be detected. To evaluate potential binding to the BCL9 site we mapped the epitope of the BCL9347\u2212392 peptide by transferring the assignment from de la Roche et\u2005al.1  which is in good agreement with the previously determined binding affinity using ITC (Kd=540\u2005nM).2 was identified as a binder to \u03b2\u2010catenin141\u2013305 with a significant binding signal of \u0394\u0394Fnom of 7.5\u2030 compared to standard deviation with DMSO of 1.8\u2030 . Initially, the screening assay was validated by a titration with recombinant BCL915N TROSY NMR detected titration experiments. The racemic mixture of compound 3 showed the strongest CSPs and was titrated to yield an average Kd of 1100\u2005\u03bcM, which had to be extrapolated because the solubility of the compound was limited at 1000\u2005\u03bcM  corporate compound collection, utilizing a panel of different similarity search methods and metrics succeeded by data fusion,4. STD and WaterLOGSY experiments provide information about protein\u2010buriedness and solvent\u2010exposure of ligand protons in the bound state. Figure\u20054.Given the lack of detailed structural information at this stage of the project, conventionally provided by X\u2010ray crystallography, we performed ligand\u2010based NMR techniques\u2010GEM (group epitope mapping) by STD135\u2013663 construct was used, as STD\u2010 and WaterLOGSY\u2010experiments are more efficient with larger proteins and the observed ligand signals are not affected by underlying protein signals, usually observed with small protein constructs. There is a good consensus between the two methods, regarding the proton that is most deeply buried and has the closest contact to the protein, as indicated by the highest percentages. Both the STD GEMs and the LOGSY\u2010factors indicated that the phenyl ring is only partly buried and there might be an opportunity to grow into unoccupied binding site space. Hence a small series of phenyl derivatives were synthesized. The racemic mixture of compound 6 and 7 showed an improved CSP pattern and was subsequently subjected to chiral separation. The consecutive NMR Kd titration revealed that eutomer 6 exhibits improved affinity .The larger \u03b2\u2010catenin6 finally enabled the co\u2010crystal structure determination in complex with \u03b2\u2010catenin141\u2013305 at a resolution of 1.98\u2005\u00c5 \u2010distomer(7) pair, we attempted SPR analysis, which could serve as a high\u2010throughput assay for consecutive optimization cycles. The assay was validated using BCL9347\u2212392 as a positive control  In comparison, the Kd for eutomer 6 is weak  and data could only be acquired up to a concentration of 1\u2005mM and the fit curve is extrapolated . The sensorgrams show contribution from non\u2010specific binding and an over\u2010stoichiometric binding response is observed. Interestingly, distomer 7 shows a comparable non\u2010specific binding effect in the absence of any saturable behavior .The ligand's distinct three\u2010dimensional shape complements the pocket while orienting the N\u2010methyl lactam functionality towards the receptor. Thereby, the carbonyl moiety of compound 6 with the crystal structure of a \u03b2\u2010catenin\u2010BCL9\u2010Tcf4 complex6 does not interfere with binding of the selected transcription factors TCF4 and BCL9  with the accession number 7AFW.The authors declare that the data supporting the findings of this study are available within the publication and its Supporting Information. The coordinates of the crystal structure of \u03b2\u2010cateninD.K., M.M., S.K.Z., M.Z., S.W., A.B., J.Br., T.C., G.D., M.D., S.D., J.E.F., L.G., W.H., C.K., R.K., F.M., T.P., K.R., M.S., P.W., B.W., M.P., D.B.M., and J.B\u00f6. are employees of Boehringer Ingelheim.As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer reviewed and may be re\u2010organized for online delivery, but are not copy\u2010edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.SupplementaryClick here for additional data file."}
+{"text": "Neurocysticercosis (NCC), and cystic echinococcosis (CE) are two neglected diseases caused by cestodes, co-endemic in many areas of the world. Imaging studies and serological tests are used in the diagnosis of both parasitic diseases, but cross-reactions may confound the results of the latter. The novel multiplex bead-based assay with recombinant antigens has been reported to increases the diagnostic accuracy of serological techniques.Cysticercus cellulosae, causing cysticercosis) and r2B2t  recombinant antigens, for simultaneous and differential diagnosis of these infections. The antigens were tested on 356 sera from 151 patients with CE, 126 patients with NCC, and 79 individuals negative for both diseases. Specificity was calculated including sera from healthy donors, other neurological diseases and the respective NCC or CE sera counterpart. The diagnostic accuracy of this assay was compared with two commercial ELISA tests, Novalisa and Ridascreen, widely used in the routine diagnosis of cysticercosis and CE, respectively.We set-up an immunoassay based on the multiplex bead-based platform (MBA), using the rT24H  and 0.619  . For the diagnosis of CE, the sensitivity of the r2B2t-MBA ranged from 68.87\u201369.77% and of Ridascreen ELISA from 50.00\u201357.62%; specificities from 92.47\u201392.68% and from 74.15\u201380.98%, respectively. AUC values were 0.717 and 0.760, respectively.Overall, the recombinant antigens tested with the bead-based technology showed better diagnostic accuracy than the commercial assays, particularly for the diagnosis of NCC. The possibility of testing the same serum sample simultaneously for the presence of antibodies against both antigens is an added value particularly in seroprevalence studies for cysticercosis linked to control programs in endemic areas where these two parasites coexist. Taenia solium and Echinococcus granulosus sensu lato, respectively, and their distribution largely overlaps in many areas of the world. Currently, the WHO is calling for the need to map endemic areas for cysticercosis, where control programs should be applied. Serosurveys may serve this scope, but cross-reactivities may be an issue. This study evaluated the accuracy of two recombinant antigens (rT24H and r2B2t) specific for each parasite used together applying a novel multiple bead technology assay (MBA), and compared the results with two commercial ELISA tests for the diagnosis of these infections. We found that this method, although not 100% specific, provides better results than those obtained with the commercially available tests, with the added advantage of testing simultaneously for both infections using just one sample, and could prove an efficient and rapid support for serological screening studies to map areas of cysticercosis transmission. Importantly, this novel method based on MBA technology is open and flexible, allowing continuous improvement due to its ability to simultaneously introduce new recombinant antigens as they are discovered/defined.Cysticercosis and cystic echinococcosis are caused by infection with the larval stages of  Taenia solium, and Echinococcus granulosus sensu lato, respectively, which develop in host tissues. CC is prevalent in Latin-America, Asia and sub-Saharan Africa, although it is currently diagnosed also in regions where it was not previously endemic because of travel and migration , Leishmania donovani [KRP42], Toxoplasma gondii [SAG1], Wuchereria bancrofti [SXP1], HIV , and Vibrio cholerae [cholera toxin]). Furthermore, assessing multiple antigens of agent(s) causing one disease is also possible, as it has been done for malaria, for which antibodies against antigens of different Plasmodium species , have been detected in a single step [The multiplex bead-based technology derives from classical antibody detection techniques, such as ELISA; it has higher reproducibility and allows the analysis of multiple antigens simultaneously in a single well, with consequent saving of time and sample volume ,38. Thiset al.  performegle step .T. solium, T24 tetraspanin, a protein consisting of four transmembrane domains that correspond to the 24 and 42 kDa native antigen bands seen in the LLGP EITB [E. granulosus AgB2. r2B2t was chosen for its proven diagnostic value in ELISA [The success of MBA technology depends on the diagnostic quality of the used recombinant antigens. For CC, rT24H was selected because it had already shown to provide results in MBA similar to those obtained with the lentil-lectin glycoprotein enzyme-linked immunoelectrotransfer blot test (LLGP EITB), considered the gold standard for the diagnosis of CC in serum . The T24LGP EITB . For theT. solium-specific recombinant antigens, as both parasites have a close phylogenetic relationship, which is at the basis of antibody cross-reactivity [E. granulosus sequences (BI244014 and BF643023) [T. solium recombinant antigens with diagnostic usefulness, e.g., AgTs8B [MBA with recombinant antigens has not been used to date for the diagnosis of CE and we highlight the importance of applying this technology in conjunction with a activity . The resF643023) , the per, AgTs8B ,43, and When sera from uninfected subjects  were tested, specificity was similar to those of other studies investigating these antigens (~ 92% in both cases) ,23,28. BThe sensitivity of rT24H for NCC was significantly higher than that of the commercial Novalisa test, but lower than what reported in other studies. Sensitivity of seroassays is known to be influenced by the localization of cysticerci, as well as by their number and viability . CirculaSimilarly, the sensitivity of seroassays for CE depends on multiple factors, including cyst stage, number, size, organ affected and previous treatment ,45. GrouEchinococcus multilocularis and highly cross-reactive with E. granulosus could be evaluated by MBA in the future. Unfortunately, AE was not included in the present work due to unavailability of sera, representing a limitation of this study.The multiplex bead-based assay including the T24H recombinant antigen has recently been applied on sera obtained from whole blood samples collected on filter paper, showing its potential to be used on samples collected from underserved areas and to be used in the context of control programs . The incIn conclusion, the MBA technique showed a non-optimal, but improved diagnostic accuracy compared to commercialized ELISA tests for the separate diagnosis of the CC and CE. The use of the MBA technique will allow managing a large number of samples, providing an effective and rapid support to serosurvey studies to detect CC hot-spots where control programs might be implemented. Moreover, this technology has the potential to incorporate new antigens for the simultaneous diagnosis of a larger number of pathologies or improve current serodiagnostic characteristics in the future."}
+{"text": "Context: Continuous deep sedation (CDS) is regarded as a far-reaching form of sedative use for symptom control, but there are no established uniform definitions.Objectives: To propose types of sedative use related to CDS using treatment protocols with three parameters: documented treatment goals, rapidity of dose titration, and planned duration of treatment.Methods: Opinion article.Results: We propose four types of sedative use potentially related to CDS: (1) proportional sedation , (2) rapid proportional sedation , (3) deep sedation with a chance of cessation , and (4) continuous deep sedation until death (deep sedation indicated from initiation and maintained until death).Conclusion: This article proposes an idea that the use of treatment protocols that visualize treatment goals, rapidity of dose titration, and planned duration of treatment may help understand the existing variations in sedative use over the world. The use of treatment protocols in the same way when defining a medical treatment in other specialty fields might clear up the current confusion about the use of sedatives. If we accept this distinction, there are two types of deep sedation: one is a result of proportional sedation, and the other is an intended deep sedation from initiation.Empirical studies suggest that CDS has marked heterogeneity. Recent conceptual and empirical studies have suggested that there are potentially two different types of palliative sedation worldwide19\u201324 but it is unclear whether maintaining deep sedation is intended treatment from the initiation or a result of proportional sedation: some of them regard CDS as a result of proportional sedation for symptom relief,19\u201322 whereas some regard CDSUD as an intentional act to keep patients unconsciousness from initiation until death.24 More recently, a distinct form of CDS, deep sedation to be initiated simultaneously when life-sustaining treatment is withdrawn and maintained until death, was legalized in France.26Furthermore, the concept of continuous deep sedation until death (CDSUD: maintained deep sedation until death) was referred to in some studies,3\u201312 The traditional view based on the double effect theory stresses that physicians can intend symptom relief on using sedatives, but that they should not directly intend to decrease a patient's consciousness.27 This is because, when the principle of double effects is applied in the practice of sedation and a decrease in consciousness is viewed as a \u201cbad effect,\u201d a physician should not intend to decrease consciousness, and symptom relief should not be achieved through decreased consciousness.27The intention of physicians has been regarded as an important component to approve CDS ethically and legally.18 Similarly, United Kingdom and Japanese physicians were less likely to report that the common treatment goal was unconsciousness, compared with Italian, Dutch, and Belgian physicians: 22%\u201327% versus 54%\u201372%, respectively.18In contrast, a recent international survey revealed a divergent attitude toward physicians' intention regarding the use of sedatives. U.K. physicians were less likely to report that their intention on the continuous use of sedatives was a decrease in consciousness and !unconsciousness, compared with Italian, German, Dutch, Belgian, and Japanese physicians: 9% versus 30%\u201348%, 4% versus 11%\u201332%, respectively.28 These findings are in line with the statements that U.K. and U.S. palliative care specialists stress the proportional use of sedatives as a measure of symptom control, and generally disagree that the intention of sedation includes a decrease in consciousness.29\u201332In addition, a U.S. survey reported that 85% of U.S. physicians considered unconsciousness as an acceptable side effect of sedation but that it should not be directly intended.33\u201336 A Japanese guideline followed by empirical studies is trying to distinguish between proportional sedation and CDS using visualized treatment protocols on the assumption that there are two types of sedative use in practice.34Measuring a physician's intention is difficult, and we assume that a potential method to decrease the ambiguity in clinical practice may be visualizing treatment protocols with treatment goals documented using validated tools, instead of a physician's intention. To date, several studies have addressed the effectiveness of treatment protocols for sedative use in palliative care settings.34 Visualizing how to use sedatives with a documented treatment goal may thus be a promising method to clarify clinical practice of sedative use. Such visualization may be also valuable in quality assurance through standardization.37A multicenter study revealed that the treatment protocols well reflected the intention of treatment: a proportional sedation protocol achieved satisfactory symptom relief while maintaining some patients' consciousness, and a deep sedation protocol achieved good symptom relief while the majority of patients lost consciousness.The aim of this conceptual article was to propose four types of sedative use related to CDS using treatment protocols. IRB approval was waived according to the national guideline on human research.We propose four types of sedative use potentially related to CDS using three parameters : treatmeThe rapidity of dose titration is characterized as gradual or rapid, and the difference was visualized by the presence or absence of a loading phase. The planned duration of treatment was categorized as during intense symptoms or until death: the former means a patient has a chance to cease sedatives, but the latter means no chance to cease sedatives. In the protocols, differences are visualized by the presence or absence of regular monitoring to explore any chance of changes in the treatment goal from deep sedation to proportional sedation.The four types of sedative use are tentatively named as (1) proportional sedation , (2) rapid proportional sedation , (3) deep sedation with a chance of cessation , and (4) CDSUD (deep sedation indicated from initiation and maintained until death).Proportional sedation means the proportional use of sedatives with a low starting dose followed by careful dose adjustment . Deep se34 The fact that a relative minority of patients lost consciousness confirmed that the goal of the proportional sedation protocol is symptom relief and not deep sedation itself. This type of sedative use will be well accepted, as this may be regarded as a part of standard palliative care, like opioid titration.30Empirically, the proportional sedation protocol led 69% goal achievement  four hours after initiation, with a mean of 0.8 in the Support Team Assessment Schedule (STAS) and \u22120.7 on the modified RASS; deep sedation was induced in 31% as a result.Rapid proportional sedation is a form of proportional sedation, and thus the treatment goal is symptom relief, and regular monitoring is vital to explore the chance to decrease the dose of sedatives and cessation to maximize patient communication . The difRapid proportional sedation is usually indicated for patients in an emergency situation, such as bleeding, suffocation, or intense dyspnea, and may be indicated for some patients at home where rapid alleviation within short time intervals is practically required. Sedatives are used at a higher dose than in typical proportional sedation, but the treatment goal is not to decrease consciousness or unconsciousness itself.Deep sedation with a chance of cessation means deep sedation induced from initiation but with a chance of changing the treatment goal to proportional sedation . The ini34 Of note is that, in some patients (3/7 at 24 hours), the deep sedation protocol was discontinued because patients achieved adequate symptom relief before sedation reached a deep level.34 The fact that not all patients reached deep sedation with this protocol suggests that physicians who state that they intend to induce deep sedation may actually intend just symptom relief, even when using the deep sedation protocol.An empirical study revealed that this protocol led to 83% goal achievement  four hours after initiation, with a mean of 0.3 in STAS and \u22124.2 on RASS.18Therefore, this type of sedative use may be essentially the same as rapid proportional sedation. For physicians who believe that they should not directly intend to make patients unconsciousness, this type of sedation would not be acceptable; however, the fact that a considerable number of the physicians  state that the treatment goal of sedative use is unconsciousness indicates that this type of sedation does exist in current clinical practice over the world.26 Some insist that no chance of changing the treatment goal and no chance of discontinuing sedatives may be inappropriate as a palliative care measure.Continuous deep sedation until death means deep sedation indicated from initiation and maintained until death as a planned medical procedure . A diffe7 In this guideline, eventual deep sedation until death is interpreted as a result of the fact that repeated assessments identified no appropriate timing for the withdrawal of sedation due to continuing suffering . CDSUD as planned in the initial phase of sedation may be an essentially separate medical practice from the other three types of sedative use that involve a theoretical chance of recovery on the basis of regular assessment of the necessity of deep sedation.For example, the Japanese clinical guideline defines continuous sedation as \u201csedation in which a reduced level of consciousness is maintained without specifying plans to discontinue,\u201d and prohibits deep sedation until death without regular evaluation of its necessity.This article proposes the use of treatment protocols to understand the current practice of sedative use using three parameters: treatment goal described in the protocols (symptom relief vs. deep sedation), rapidity of dose titration , and planned duration of treatment (during intense symptoms vs. until death). Our initial proposal includes (1) proportional sedation, (2) rapid proportional sedation, (3) deep sedation with a chance of cessation, and (4) continuous deep sedation until death.29\u201331 This may be appropriate and true, but empirical studies suggest that there are variations observed in actual clinical practice in treatment goals (symptom relief vs. deep sedation), the rapidity of dose titration , and planned duration of treatment (whether maintaining sedation until death is planned).38One probable critique is the argument that sedatives should be used proportionally in all settings with the intention of symptom relief (should not directly intend to decrease consciousness or unconsciousness), and thus there is only one type of sedation: proportional sedation.18 Unconsciousness as a treatment goal of sedative use was reported in 22%\u201327% of U.K. and Japanese physicians and 54%\u201372% of Italian, Dutch, and Belgian physicians.18 The percentages of physicians who reported they started sedatives sufficiently high were 69%\u201372% in Belgium and Italy, 41%\u201354% in the Netherlands and Germany, and 22%\u201327% in the United Kingdom and Japan.18U.K. physicians reported that their intention on the continuous use of sedatives was a decrease in consciousness and unconsciousness in 4%\u20139%, whereas these values among Italian, German, Dutch, Belgian, and Japanese physicians were 30%\u201348% and 11%\u201332%, respectively.15 and 38% of Japanese palliative care specialists surveyed in 2016 reported that they intended to maintain unconsciousness until death.38 Our attempt is, therefore, to classify sedative use in current practice on the basis of these parameters: treatment goals, rapidity of dose titration, and planned duration of treatment, not to discuss how sedatives should be used.A qualitative study suggested that sedatives were often used to maintain induced unconsciousness until death in the Netherlands and Belgium,34 Second, this proposal addresses only the continuous use of sedatives, and other types of sedative use such as respite sedation, especially long-term respite sedation , are beyond the scope of this study. Third, the combination of sedative use and withdrawal of nutrition and hydration was not considered on the classification of types of sedative use. Finally, names and classifications themselves for each type of sedative use are tentative, and further discussion is needed to reach consensus.The proposal of this article is tentative, and should be regarded as a preliminary idea: there are several limitations to be considered. First, not all types of sedative use were tested in empirical studies: only two types of protocols  were tested in a single country.We propose an idea involving the use of treatment protocols that visualize treatment goals, rapidity of dose titration, and planned duration of treatment to help understand why the discussion about sedative use is confused. The use of defined treatment protocols may help understand the existing variations in sedative use over the world. Our aim is to facilitate discussion about the appropriate use of sedatives, and not to propose a definite definition of sedation. Further discussion is needed on how to define sedative use from an international perspective."}
+{"text": "Teleconsultation in vision centres, as a part of teleophthalmology services, is a critical component of primary patient care at the Aravind Eye Care System in India.Teleconsultation services are a key element of teleophthalmology. Teleophthalmology is a coordinated eye health care approach that connects patients and health care providers via information and communications technology (ICT) to enable health care to reach remote and underserved areas.In India, the Aravind Eye Care System (AECS) has been deploying teleophthalmology at the primary and secondary levels of eye care. The Aravind Teleophthalmology Network (ATN) provides accessible and affordable eye care service to people in remote areas using advanced communications technology, saving time and money that would otherwise be spent on travel.Vision centres are primary eye care facilities based in rural and semi-rural communities. The centres, which were started in India in 2004, have grown in number and become an important part of eye care services in both the government and private sectors.Each vision centre is managed by a trained ophthalmic technician and a coordinator. It has basic ophthalmic equipment, such as a slit lamp, an applanation tonometer, a trial lens set for refraction, and two computers with broadband internet connectivity.During a teleconsultation, the ophthalmic technician examines the patient, records the refractive error and the anterior segment and fundus findings (on 90D examination), and documents the findings in a secure electronic medical record (EMR) which can be accessed securely by ophthalmologists working at the base hospital. Next, during a video call with the patient and the ophthalmic technician, an ophthalmologist at the base hospital views the EMR along with the images and any additional information provided by the technician. The ophthalmologist then enters her or his advice in the EMR and discusses the next steps with the patient.Aravind vision centres together carry out more than 2,800 teleconsultations a day, and this model has been replicated by others in many states in India as well as across Bangladesh. Data from the AECS vision centre registry indicate that 15\u201317% of patients seen at AECS vision centres had to be referred to a tertiary centre.At the secondary level, technology can be used to support screening for conditions that affect the back of the eye, such as diabetic retinopathy (DR) and retinopathy of prematurity (ROP). Early diagnosis and treatment of these conditions can prevent needless blindness; however, not all secondary or district hospitals have retinal specialists who are able to to diagnose these conditions.The availability of tools based on artificial intelligence (AI) that can analyse retinal images has made the diagnosis of DR quicker and simpler. For ROP, retinal scans taken in neonatal intensive care units can be sent to specialists at tertiary hospital level for analysis and identification of ROP.When implementing teleophthalmology, the major barriers are the initial cost of investment, difficulties capturing high quality digital images, the shortage of trained and dedicated health care and teleophthalmology personnel, and concerns about the privacy and security of patient data."}
+{"text": "Primary eye care through technology-enabled vision centres is a key strategy to achieve universal eye health.One of the many reasons that primary eye care is gaining importance is that it is recognised as a necessary component of primary health care. In 2015, member nations of the World Health Organization (WHO) set universal health coverage as one of the targets of the Sustainable Development Goals (SDG).The costs associated with transport, lost wages, and the need for an attendant to accompany a patient reduce the affordability of eye care, adversely impacting health-seeking behaviour. Eye camps have been a means of providing accessible and affordable primary eye care in areas where there is little or no eye care. While the camp approach continues to be critical to delivering eye care to rural areas, its reach is quite limited and lacks sustainability, given the inherent limitation of eye camps being held for just a day or so in any given location.In a population of around 50,000, a significant proportion would be 40 years or older, many of whom would have an eye care need. It is likely that 25 to 30% of this population would need some eye care\u2014i.e., almost everyone above 45 years of age, constituting over 25% of the population,In addition to accessibility, another component of universal health coverage is the comprehensiveness of care. Trained ophthalmic technicians can provide comprehensive eye care at vision centres. It is also possible to provide comprehensive care with the use of technology and through referral linkages.To do this well, we have to define the scope of services, as suggested in The essential equipment in a vision centre should ideally include visual acuity charts, a trial set and retinoscope for refraction, a slit lamp for a detailed eye examination, an ophthalmoscope for fundus examination, a tonometer for intraocular pressure measurement, a glucometer, a weighing machine and height chart, as well as thermometer and blood pressure apparatus to measure vital signs. Vision centre staff are trained to carry out comprehensive eye examinations using the equipment mentioned above.In addition to centre-based activities, vision centres can support community-based activities such as school screening. Vision centres, by virtue of their easy accessibility, have the potential to enhance adherence to treatment in patients with chronic conditions, such as glaucoma or diabetic retinopathy, as well as follow up on patients who have been advised to have surgery or referred to a hospital.While rural vision centres are uniquely positioned to contribute to universal eye health, the reality is that many ophthalmologists and administrators are reluctant to work in small rural settings. Hence services would necessarily have to be delivered by an ophthalmic technician, supported by a similar cadre of staff taking care of administrative tasks. In this context, the service design and implementation will need to incorporate the following to achieve universal eye health:In the absence of an ophthalmologist, neither comprehensive eye examination nor the quality of diagnosis or care should be compromised. Telemedicine and electronic medical records can be very useful in providing quality eye care. In the context of the COVID pandemic, safer methods need to be adopted for completing comprehensive eye examination.The care cycle should be completed\u2014i.e., patients visiting the vision centre should receive a diagnosis if possible and treatment advice. They should be able to obtain spectacles and medicines as prescribed, or get help to visit an eye hospital for surgery or advanced management when indicated.All of this has to be affordable for the community. Where possible, each vision centre should also be able to sustain its own operating costs financially. This can happen through charging affordable consulting fees and making margins from the sale of medicines and spectacles, in the process saving patients money and effort.Integral to effective implementation is a robust monitoring system. Given the potential of vision centres to support the delivery of universal eye health, the success of a vision centre should be measured by comparing the number of people receiving eye care with the estimated number of people in the population or community who need eye care services (the denominator). The monitoring system should also monitor adherence to treatment or referral. Ultimately, it is the adherence to prescribed treatment or referral that will help manage eye health conditions. Ongoing monitoring and continuous review will result in improving eye care.Well-designed primary eye care approaches, such as technology-enabled vision centres, have the potential to contribute to the achievement of universal eye health. Since such an approach to delivering primary eye care mitigates the problem of accessibility, it may be less affected by factors such as the continuing COVID-19 pandemic. It was seen that once the Covid-19 travel restrictions were lifted in India in September 2020, most vision centres in our network, being at an easily reachable distance, reported that their patient volumes were back to normal much sooner than in secondary and tertiary eye hospitals."}
+{"text": "Correct B cell identity at each stage of cellular differentiation during B lymphocyte development is critically dependent on a tightly controlled epigenomic landscape. We previously identified HDAC7 as an essential regulator of early B cell development and its absence leads to a drastic block at the pro-B to pre-B cell transition. More recently, we demonstrated that HDAC7 loss in pro-B-ALL in infants associates with a worse prognosis. Here we delineate the molecular mechanisms by which HDAC7 modulates early B cell development. We find that HDAC7 deficiency drives global chromatin de-condensation, histone marks deposition and deregulates other epigenetic regulators and mobile elements. Specifically, the absence of HDAC7 induces TET2 expression, which promotes DNA 5-hydroxymethylation and chromatin de-condensation. HDAC7 deficiency also results in the aberrant expression of microRNAs and LINE-1 transposable elements. These findings shed light on the mechanisms by which HDAC7 loss or misregulation may lead to B cell\u2013based hematological malignancies. A longstanding fundamental question in the field of cell development has been: how do cells decide at a molecular level to acquire a specific cell fate during tissue and organ generation? The mammalian hematopoietic system is considered a paradigm model for answering this question. For instance, B cell lymphopoiesis is a complex developmental process that comprises several cellular transitions, including cell commitment and early and late cellular differentiation. Proper transcriptional control at each cellular transition is essential for the correct generation of B lymphocytes. Of note, aberrant establishment of specific transcriptional programs may lead to the development of B cell malignancies.Lineage-specific networks of transcription factors (TFs) have a central role in positively regulating the transition and maintenance of the distinct B cell developmental stages. In the bone marrow, lymphoid-primed multipotent progenitors (LMPPs) have the capacity and plasticity to become either common lymphoid progenitors (CLPs) or common myeloid progenitors (CMPs) . At thatBesides specific TF networks, B cell differentiation also requires that epigenetic regulators and architectural proteins establish the correct permissive/non-permissive chromatin structure (euchromatin/heterochromatin) . There iWe have previously reported that HDAC7 is a master transcriptional repressor in early B cell development, controlling the expression of lineage-inappropriate genes and thus the identity of pro-B cells. A lack of HDAC7 in pro-B cells leads to a block in B cell differentiation, aberrant activation of alternative lineage genes, a reduction of proliferation, and an increase in apoptosis . More re-deficient pro-B cells showed enhanced 5-hmC global levels, resulting not only in the activation of inappropriate lineage genes, but also in the aberrant expression of non-coding elements (such as active transposon LINE-1 elements and miRNAs). Thus, our findings unveil novel molecular mechanisms that govern the maintenance of correct B cell development and identity, working through the HDAC7\u2013TET2 axis.Using a combination of transcriptomic and epigenetic genome-wide analysis, we now shed light into the molecular mechanisms that are governed by HDAC7 during early B cell development. We identified HDAC7 as a regulator of proper chromatin compaction in different stages of B cell development (pro-B and pre-B cells). Importantly, we demonstrated that HDAC7 represses TET2 expression in pro-B and pre-B cells, and that its deficiency leads to TET2 up-regulation and subsequent alteration in global and specific 5-hmC patterns. In fact, HDAC7The study aimed to define unprecedented molecular mechanisms by which class IIa HDAC7 preserves B cell identity in mice. Experiments included 4\u20136 weeks-old wild-type and knockout mouse strains (C57BL/6). Mice selected in each experiment were littermates. Primary pro-B and pre-B lymphocytes were isolated by using cell sorting. Tet2 was identified as a direct target of HDAC7 with chromatin immunoprecipitation and expression analysis experiments. 5-hydroxymethylation levels in pro-B cells were quantified by ELISA and hydroxymethyl-DIP experiments. 5-hmeDIP-seq, ATAC-seq, H3K27ac and H3K27me3 ChIP-seq were performed to determine global and specific changes. All results were validated by qPCR assays and were successfully reproduced. No sample size calculations were performed, since these were selected on the basis of previous studies performed in our lab. The numbers of experimental replicates are included in the figure legends.fl/\u2212Hdac7\u00a0on C57BL/6 mice have been previously described (ki/+ on C57BL/6 (B6.C(Cg)-Cd79atm1(cre)Reth/EhobJ) mice were kindly provided by Dr Michael Reth . Experiments were performed with 4\u20136 week-old mice. Littermate controls were used for fl/Hdac7\u2212 mb1-cre mice. Animal housing and handling and all procedures involving mice, were approved by the Bellvitge Biomedical Research Institute (IDIBELL) ethics committee and the Animal Experimentation Ethics Committee (CEEA) of the Comparative Medicine and Bioimage Centre of Catalonia (CMCiB), at Germans Trias i Pujol Research Institute (IGTP), in accordance with Spanish national guidelines and regulations.escribed  and wereHAFTL pre-B cell line transduced with a MSCV-GFP-C/EBP\u03b1 retroviral vector (to generate C10 cells) and with a MSCV-hCD4-C/EBP\u03b1ER retroviral vector (to generate C11 cells), were described previously described . C10-MSC+ B cells from +/\u2212Hdac7 and fl/\u2212Hdac7 mice or C11 cells were infected with the shRNA Tet2 targeting vector(shTet2) or with an empty retroviral vector (shCtrl). Cells were infected twice, in a time gap of 24\u00a0h, and then, 48\u00a0h after second infection, GFP+ cells were sorted using a FACSAria\u2122 Fusion cell sorter (BD Biosciences). After isolation, CD19+ B cells were cultured on RPMI media supplemented with 2% FBS, 0,03% Primatone RL (Sigma), 1\u00a0mM penicillin/streptomycin, 50\u00a0\u03bcM \u03b2-mercaptoethanol and 1% IL-7 (Peprotech), whereas C11 cells were cultured in RPMI media supplemented with 10% FBS and 1mM penicillin/streptomycin. Tet2 knockdown was confirmed by qRT-PCR using SYBR green quantification.Retroviral vector for PGK-shRNATet2-GFP retroviral vector has been described in . CD19+ BC10-MSCV, C10-HDAC7, C11-shCtrl and C11-shTet2 cells\u00a0were cultured and treated as previously described .+/\u2212Hdac7 and fl/\u2212Hdac7 mice. Red blood cells were lysed with ACK lysis buffer. Cell counts were determined using a manual cell counter and T\u00fcrk's staining to facilitate the counting of white cells nuclei. Isolated cells were incubated with anti-CD16/CD32  (BD Bioscience) for 10 min on ice to reduce non-specific staining. The following antibodies were used for analysis (from BD Biosciences): anti-B220 (RA3-6B2), anti-CD43 (S7), anti-IgM (R6-60.2), anti-CD19 (1D3) and anti-Cd11b (M1/70). For Cd11b, Streptavidin-V50  was used as a secondary antibody. Cells were stained with primary antibodies for 30 min on ice in the dark. Cells were analyzed on a BDFACS Canto II (BD Biosciences) or sorted on BD FACSAria\u2122 Fusion cell sorter (BD Biosciences). Data were analyzed using FlowJo software . See \u2212, CD19+, B220+, CD43+; pre-B cells: IgM\u2212, CD19+, B220+, CD43\u2212).Cells were extracted from bone marrow (femur and tibia of both hind legs) of +/\u2212Hdac7 and fl/\u2212Hdac7 mice. Red blood cells were lysed with ACK lysis buffer. Cell counts were determined using a manual cell counter and T\u00fcrk's staining to facilitate the counting of white cells nuclei. Isolated cells were incubated with anti-CD16/CD32  (BD Bioscience) for 10 min on ice to reduce non-specific staining. The following antibodies were used for separation (from Miltenyi Biotec): anti-CD19-Microbeads (mouse), anti-Cd11b biotin , and Streptavidin-Microbeads. Samples were incubated for 20 min at 4\u00b0C in the dark. CD11b needed double incubation, first with anti-Cd11b and second with Streptavidin-beads. Samples were put into Ls columns (Miltenyi Biotec) to perform magnetic cell separation. After three washes, cell from positive fractions (CD19+\u00a0and Cd11b+) were kept for further experimentation.Cells were extracted from bone marrow (femur and tibia of both hind legs) of https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Paired-end reads from RNA-Seq were aligned to the murine reference genome (GRCm38) using Hisat2 (version 2.0.5). Quality of the alignments was assessed using FastQC (v0.11.2). A count table file indicating the number of reads per gene in each sample was generated using HTSeq (version 0.6.0)   \u00d7\u00a0sign[log(FC)]. As genesets collection, hallmarks (H) from the Molecular Signatures Database (MSigDB) were selected, adding the specified custom genesets.\u00a0Data from RNA-seq is available under accession code GSE171855.Total RNA was extracted from HDAC7-deficient and control pro-B and pre-B cells in the Genomics facility of Institute for Research in Biomedicine (IRB) in Barcelona. Samples were quantified and subjected to quality control using a Bioanalyzer apparatus . Samples were processed at BGI Genomics Service, (China). Briefly, low input library was performed in all samples. Later, they were sequenced in paired-end mode with a read length of 100\u00a0bp. Thirty-five million paired-end reads were generated for each sample. Quality control of the samples was performed with the FastQC tool (available at n 0.6.0) . Genes wn 0.6.0) , requiris (GSEA)  using a RNA from sorted pro-B and pre-B cells was extracted with an RNeasy Mini kit (Qiagen) and subsequently converted into cDNA using the High Capacity cDNA Reverse Transcription Kit (AB Applied Biosystems) according to the manufacturer's instructions. Real-time-quantitative PCR (RT-qPCR) was performed in triplicate using SYBR Green I Master (Roche). PCR reactions were run and analyzed using the LightCycler 480 Detection System (Roche). RT-qPCR primer pairs are shown in supplemental information +/\u2212Hdac7 and fl/\u2212Hdac7 mice were resuspended in 500\u00a0\u03bcl of lysis buffer  and incubated on ice for 10 min. Nuclei were collected by centrifugation at 300 g for 5 min at 4\u00b0C. The nuclear pellet was then resuspended in 400\u00a0\u03bcl of nuclear lysis buffer . Aliquots of 100\u00a0\u03bcl were incubated with 9 units of micrococcal nuclease  and digested at room temperature for 0, 1, 2 and 5 min, respectively. Then 3\u03bcl of 0.5M EDTA was added to stop digestion, and DNA was purified by using the QIAquick PCR purification kit (Qiagen). About 500\u00a0ng were used for gel electrophoresis and 12\u00a0ng of DNA were used for qPCR analysis using SybrGreen (Roche). Primers obtained from  according to manufacturer's instructions. CD19+ B cells were isolated by magnetic separation with LS column adapters (Miltenyi Biotec). Purified cells were lysed with RIPA buffer. Lysates were resolved on 8\u201315% SDS-PAGE  and transferred on nitrocellulose membranes (Amersham Biosciecnes). Membranes were blocked in 5% milk in TBS with 0.1% Tween (TBS-T) and incubated overnight at 4\u00b0C, with primary antibodies  1:1000; anti-PUMA 12450  1:500, anti-IRF4 sc-48338 (Santa Cruz Biotechnology) 1:500; anti-c-MYB sc-74512 (Santa Cruz Biotechnology) 1:500; anti-H3 ab1791 (Abcam) 1:1000; anti-Lamin B1 ab16048 (Abcam) 1:1000, and anti-Actin AC-15 (Sigma-Aldrich) 1:40000). Secondary antibody incubations , were carried out for 1h at room temperature. Protein signal was detected using ECL western detection kit (Amersham Biosciences).White cells from bone marrow of control and Hdac7+/\u2212 and Hdac7fl/\u2212 mice were crosslinked for 15\u00a0min in 1% formaldehyde, followed by inactivation in 125 mM glycine for 5 min and by two washes in cold PBS. Afterward, samples were incubated in cell lysis buffer from LowCell# ChIP kit (Diagenode) for 30\u00a0min at 8\u00b0C and sonicated with M220-Focused Ultra Sonicator (Covaris) according to manufacturer's instructions. Next steps of ChIP experiments were performed using resources from the LowCell# ChIP kit (Diagenode) according to the manufacturer's instructions. The following antibodies were used for immunoprecipitation: anti-HDAC7 , anti-H3K9/K14ac , anti-H3K27me3 , anti-H3K27Ac  and anti-H3k9me3 . Real-time quantitative PCR (RT-qPCR) was performed in triplicate and the results analyzed. Data are presented as the ratio between the HDAC7-bound fraction and histone modification antibody relative to the input control. ChIP-qPCR primer pairs are shown in supplemental information For chromatin immunoprecipitation (ChIP) assays, purified pro-B cells from the bone marrow of Hdac7+/\u2212 and Hdac7fl/\u2212 mice were crosslinked for 15\u00a0min in 1% formaldehyde, followed by inactivation in 125 mM glycine for 5 min and by two washes in cold PBS. Afterward, samples were lysed and sonicated with M220-Focused Ultra Sonicator (Covaris) to obtain fragments of 250\u2013500\u00a0bp. Samples were processed according to Blueprint Histone ChIP-Seq protocol (https://www.blueprint-epigenome.eu/). The following antibodies were used for immunoprecipitation: 2.5\u00a0\u03bcg of anti-H3K27me3 (07449) and 2.5\u00a0\u03bcg of anti-H3K27ac (ab4729). As experimental control we used input sonicated chromatin (not immunoprecipitated) in all experimental conditions. For the analysis, reads were checked for quality using FastQC (0.11.5) and then trimmed using trim galore (v.0.6.6) to remove the sequencing adapters. Reads were aligned to the mouse reference genome GRCm38 using Bowtie v2.3.2 with \u2018\u2013very-sensitive\u2019 parameters . Immediately after lysis, nuclei were spun at 500\u00a0g for 10 min using a refrigerated centrifuge, and pellet was resuspended in the transposase reaction mix  and 5.5 \u03bcl nuclease-free water). The transposition reaction was carried out for 1\u00a0h at 37\u00b0C, followed by addition of clean up buffer  and incubation for 30 min at 40\u00b0C. Tagmented DNA was isolated using 2\u00d7\u00a0SPRI beads from Beckman\u2013Coulter. Following purification, we amplified library fragments using 1\u00d7\u00a0NEBnext PCR master mix and 1.25 \u03bcM of Nextera PCR primers as described elsewhere (http://picard.sourceforge.net) and sambamba (v.0.7.0), respectively. For peak-calling, MACS2 v2.2.7.1  was used according to the manufacturer's protocol. First, genomic DNA from sorted cells was extracted using Quick-DNA Miniprep Plus kit . Next, the bottom of the provided well was coated with anti-5-hmC polyclonal antibody (pAb) for 1\u00a0h at 37\u00b0C in the dark. Wells were then blocked and 100 ng of denatured genomic DNA was added for 30\u00a0min at 37\u00b0C in the dark. After corresponding washes, anti-DNA HRP antibody was applied to wells for 30\u00a0min at 37\u00b0C in the dark. After corresponding washes, HRP developer  (Sigma-Aldrich)) was added to detect the DNA bound to the anti-5-hmC pAb for 20\u201330 min at room temperature in the dark. Afterward, the color reaction was stopped by the addition of sulfuric acid and the resulting color was analyzed at 450 nm by using a Glomax microplate reader (Promega). The percentage of 5-hmC DNA was estimated from linear regression.Genomic DNA was purified by using the same kit as in ELISA assay. 1 \u03bcg of genomic DNA from wild-type and HDAC7-deficient sorted pro-B cells was sonicated with M220-Focused Ultra Sonicator (Covaris) to obtain fragments of 300\u2013400 bp. Fragmented DNA were incubated with 2 \u03bcg anti-5hmC  and 20 \u03bcl of Dynabeads G (Life Technologies) for 16 h at 4\u00b0C, and 10% of DNA was kept to be used as input. After incubation, Dynabeads were washed 3 times with IP buffer  and then were resuspended in Proteinase K digestion buffer  for 30\u00a0min at 55\u00b0C. DNA from immunocomplexes was purified with the QIAquick MinElute kit (Qiagen). Real-time quantitative PCR was performed and the results analyzed. Data are presented as the ratio of the enrichment of 5-hmC relative to the input control.P\u00a0=\u00a00.005 and a\u00a0>1-fold difference in KO relative to WT samples. Motif enrichment was analyzed and peak depth quantified with HOMER software (v4.10). Data from hMeDIP-seq is available under accession code GSE135263.Purified genomic DNA (1 \u03bcg) from wild-type and HDAC7-deficient pro-B cells was sonicated to obtain fragments of 300\u2013400 bp. Adaptor ligations were performed and libraries constructed by qGenomics Laboratories . 2\u00a0\u03bcg of anti-5hmC  were incubated with 20 \u03bcl of Dynabeads G (Life Technologies) for 2 h at 4\u00b0C. Fragmented DNA was incubated with Dynabeads and antibody for 16 h at 4\u00b0C, and 10% of DNA was kept to be used as input. DNA was purified as described in hMeDIP qPCR assay. Amplified libraries were constructed and sequenced at qGenomics Laboratories . Fastq data were obtained with Trim Galore-0.4.2 and Cutadapt-1.6. Reads were mapped with bwa-0.7.12. Sorting Sam to Bam was carried out with Picard-2.8.0 SortSam and duplicates were removed with Picard-2.8.0 MarkDuplicates. Bigwig files were made with deeptools and normalized based on RPKM.\u00a0Peak calling was performed using MACS2 bdgpeakcall option (-c 250 -l 10 -g 10). To avoid false positives, peaks that intersect with peaks in the corresponding input samples were removed. DESEQ analysis (DESeq2 v1.20.0) was then used to define peaks and perform quantitative analyses. The Diffbind-2.6.6 R package was used for differential binding analysis. Differential enrichment was defined by a threshold value of + cells from control and HDAC7 deficient mice. Cell extracts were prepared in lysis buffer  with corresponding units of Benzonase (Sigma) and incubated at 4\u00b0C for 6 h. 50 \u03bcl of supernatant was saved as input and diluted with 2\u00d7\u00a0Laemmli sample buffer . Supernatant was first incubated with PureProteome\u2122 Protein A/G agarose suspension (Merck Millipore) for 1 h to remove background signal. Samples were then incubated overnight at 4\u00b0C with corresponding antibodies against TET2  and rabbit  IgGs (negative control) and A agarose beads. After that, beads were washed three times with lysis buffer. For sample elution, 100 \u03bcl of 1\u00d7\u00a0Laemmli sample buffer was added to the beads. Samples and inputs were denatured at 95\u00b0C in the presence of 1% \u03b2-mercaptoethanol.Co-IP assays were performed using CD19\u00ae Green master mix (Exiqon), and quantitative PCR was performed using the Roche LightCycler\u00ae 480 RealTime PCR system (Roche). Primers design for validations of miRNA\u2019s differential expression was performed with miRprimer software (https://sourceforge.net/projects/mirprimer/).We used miRCURY LNA\u2122 Universal RT microRNA PCR System (Exiqon) to determine miRNA expression profiles. The miRNA annotation of mirBase version 20.0 was used. Single-stranded cDNA was synthesized by reverse transcription of 8 \u03bcl of RNA, using the universal cDNA Synthesis Kit II (Exiqon). Diluted cDNA was mixed with ExiLENT SYBRImmgen is a public resource that is the result of a collaborative group of immunology and computational biology laboratories that share knowledge and expertise to perform a broad and deep dissection of the genome's activity and its regulation in the immune system. This public resource is broadly used by many immunology laboratories to interrogate biological questions of a gene of interest or more broad mechanistic insights within the hematopoietic system.Gene Skyline tool: expression data from microarrays collected from several participating laboratories is normalized with Robust Multiarray Average (RMA) algorithm ,45. RMA Modules and regulators tool: this tool uses an algorithm called Ontogenet in order to outline the regulatory networks that drive the hematopoietic cell differentiation .t-test and Mann\u2013Whitney test using GraphPad Prism (v7). P-values lower than 0.05 were considered statistically significant. Statistical methods for analysis of genome wide datasets involving hMeDIP-seq, RNA-seq, ChIP-seq and ATAC-seq are explained in detail under the respective section.Data were analyzed by Student's two-tailed unpaired Hdac7fl/\u2013; hereafter, HDAC7-deficient) and their control littermates   Figure . First, ) Figure . Based o) Figure . The lac) Figure . Among t) Figure , which i) Figure .+ B cells from HDAC7-deficient or wild-type mice and assessed the levels of H3K9me3, a well-known epigenetic mark involved in the establishment of heterochromatin, genome stability, and cell identity maintenance . Indeed, TET2 was expressed at much higher levels in myeloid cells than in lymphoid populations  assays to test whether s Figure , and wit-B cells . We alsoenhancer  , in HDAC7-deficient pro-B cells  followed by next-generation sequencing (hMeDIP-seq) in pro-B cells purified from 7 Figure . Indeed,s Figure . This cos Figure . Similarosb gene . The resosb gene . Upreguls Figure .Tet2 (shTet2) and compared them to counterpart cells transduced with control retroviral vector (shCtrl). We found that knocking down Tet2 prevented the upregulation of Jun and Fosl2 in HDAC7 deficient B cells  using three different experimental approaches. A graphical scheme depicting the three experimental approaches is shown in s Figure . Therefos Figure . Similars Figure . RT-qPCRn Figure . And thin Figure . These dFinally, we performed a motif enrichment analysis to determine whether HDAC7 deficiency produces an alteration in chromatin positioning that could lead to changes in TF occupancy. Although we found no differences associated with HDAC7, we did note enrichment of relevant TFs in the hematopoietic system, such as PU.1 Figure , which hfl/\u2013Hdac7 mice   . The finHdac7-null mice, is related to B cell development and performs tumor-suppressor functions in leukemic cells. miR-142 and miR-181 are highly expressed in a cell-specific manner  in pro-B cells. We recently identified HDAC7 to be a novel biomarker and prognostic factor in infants (<1-year-olds) with pro-B acute lymphoblastic leukemia (pro-B-ALL) and MLL-AF4 rearrangement . This suAltogether, our findings lead us to a proposed model by which HDAC7 functions during early B cell development are not restricted to controlling expression by direct recruitment to its target genes. Rather, HDAC7 governs the expression of another crucial epigenetic regulator, TET2. The identified HDAC7\u2013TET2 epigenetic axis is essential to preserve proper 5-hmC and histone marks levels, chromatin compaction, and expression of miRNAs and LINE-1 elements , ATAC-seq (GSE204672), ChIP-seq (GSE204673) and hMeDIP-seq (GSE135263).gkac619_Supplemental_FileClick here for additional data file."}
+{"text": "Novel derivatives of the tricyclic scaffold, including 1-phenylethynyl (5), 1-indol-3-yl (8), and azocinoquinoline (10) derivatives, were synthesized and characterized herein for the first time. Among the newly synthesized derivatives, 5c\u2013h proved to be MAO B inhibitors with potency in the low micromolar range. In particular, the 1-(2-(4-fluorophenyl)ethynyl) analog 5g achieved an IC50 of 1.35 \u03bcM, a value close to that of the well-known MAO B inhibitor pargyline.In this work, 2-alkyl-10-chloro-1,2,3,4-tetrahydrobenzo[ Aaptos suberitoides [b]naphthyridine showed antiproliferative (A) and cytotoxic (B) activities against various types of cancer cells naphthyridines (3) were prepared and used as starting materials to synthesize novel derivatives, e.g., bearing X-substituted phenylethynyl or indolyl groups at C(1). A 6\u21928 ring expansion reaction was also applied to compounds 3 to obtain azocinoquinoline derivatives.The interest in this bioactive azaheterocyclic moiety prompted us to further explore its reactivity by synthesizing new original derivatives that could possibly be targeted to the treatment of neurological disorders such as Parkinson\u2019s (PD) and Alzheimer\u2019s (AD) diseases ,17. Here\u03b2-carboline, found in the alkaloid harmine and other compounds displaying inhibitory activity toward MAO subtypes naphthyridines, which were obtained by the Pfitzinger reaction, to various derivatives under the action of activated alkynes. The structure of the products directly depended on the nature of the substituent in position 10 and Stevens rearrangement products, ylides, 2-vinylquinolines, and benzopyridonaphthyridines can be formed [b]naphthyridines 3a\u2013d were synthesized by the Niementowski reaction based on condensation of anthranilic acids 1a\u2013c with the appropriate piperidones 2a,b when heated in a phosphorus oxychloride atmosphere. After alkaline treatment of the reaction mass, compounds 3a\u2013d were obtained in the form of yellow crystals with yields of 68\u201392%   .5 were obtained after further alkynylation of the salt with copper acetylenide. The isolation of the reaction products was hampered by the presence of substituted hydrazine in the reaction mixture. This compound was obtained from DIAD and crystalized simultaneously with the target compounds, so it was necessary to use column chromatography.The nucleophilic addition of benzonaphthyridine tertiary nitrogen to DIAD led to the formation of a zwitterion, which then turned into an iminium salt. The target products 5a was determined by single crystal X-ray analysis  took place with the formation of compound 6, or further attack on the triple bond of the phenylethynyl fragment yielded adduct C (route b) and then proton migration and Hoffmann elimination completed this cascade of transformations to give minor product 7 -methyl analogues 5c\u2013h bearing phenylethynyl groups at C1. In contrast, N(2)-benzyl analogs 5a\u2013b and compounds 3, 8, and 10 were unpredicted as MAO ligands.Taking advantage of PLATO, a free online platform for structure-based target prediction  that rel5c\u2013h were then tested on human (h) recombinant MAO A and B using previously reported assays naphthyridine (3a).2-benzyl-10-chloro-1,2,3,4-tetrahydrobenzo+ ion 309.1159, found: 309.1176.b]naphthyridine (3b).2-benzyl-8-bromo-10-chloro-1,2,3,4-tetrahydrobenzo+ ion 387.0264, found: 387.0280. The observed characterization data (1H) were consistent with those previously reported in the literature [terature .b]naphthyridine (3c).2-methyl-10-chloro-1,2,3,4-tetrahydrobenzo+ ion 233.0846, found: 233,0831.b]naphthyridine (3d).2-methyl-8-nitro-10-chloro-1,2,3,4-tetrahydrobenzo+ ion 278.0696, found: 278.0704.3a,b in 5 mL of methanol with 0.5 mL of formic acid was added a 1.2 equivalent of activated alkyne. The reaction was kept at room temperature for 10 days. Compounds 4a,b spontaneously fell out of the reaction mass in the form of crystals and were released by filtration.To a solution of 0.2 g of benzonaphthyridines 3d in 5 mL of trifluoroethanol with 0.5 mL was added a 1.2 equivalent of activated alkyne. The reaction was kept at room temperature for 15 days. The product was obtained by crystallization from diethyl ether.To a solution of 0.2 g of benzonaphthyridines b]naphthyridin-2(1H)-yl)prop-2-enoate (4a)Methyl (2E)-3- \u03b4 (ppm): 8.21 , 8.02 , 7.76 , 7.63 , 7.65\u20137.61 , 4.89 , 4.57 , 3.71 , 3.70\u20133.69 , 3.27 . 13C NMR  \u03b4 (ppm): 169.8, 155.5, 151.4, 147.4, 130.5, 129.1, 129.1, 127.6, 125.3, 123.8, 86.5, 50.9. HRMS (MALDI+) m/z calcd for C16H15ClN2O2 in form of [M + H]+ ion 303.0900, found: 303.0911.b]naphthyridin-2(1H)-yl)prop-2-enoate (4b).Methyl (2E)-3- \u03b4 (ppm): 8.36 , 7.88 , 7.81 , 7.62 , 4.90 , 4.56 , 3.71 , 3.69 , 3.26 . 13C NMR  \u03b4 (ppm): 169.8, 156.1, 151.3, 146.0, 134.1, 130.9, 126.4, 126.1, 121.8, 86.8, 50.9. HRMS (MALDI+) m/z calcd for C16H14BrClN2O2 in form of [M + H]+ ion 381.0005, found: 381.0014.b]naphthyridin-1-yl)but-3-en-2-one (4c).(3E)-4- \u03b4 (ppm): 9.13 , 8.49 , 8.13 , 6.82 , 6.04 , 4.86 , 3.41\u20133.34 , 3.27\u20133.22 , 3.16 , 3.03\u20132.99 , 2.60 , 2.26 . 13C NMR  \u03b4 (ppm): 197.8, 161.2, 149.5, 146.0, 143.0, 140.9, 134.6, 131.0, 128.8, 124.7, 123.9, 121.5, 62.0, 45.6, 42.4, 31.4, 27.7. HRMS (MALDI+) m/z calcd for C17H16ClN3O3 in form of [M + H]+ ion 346.0958, found: 346.0981.3a,c (0.5 g) in 10 mL of THF was cooled to 0 \u00b0C, then a 1.5 equivalent excess of DIAD (diisopropylazodicarboxylate) was added. The mixture was stirred at room temperature for 1 h. After cooling it again to 0 \u00b0C, a 3 equivalent excess of the appropriate phenylacetylene and CuI catalyst were added. The reaction was stirred at room temperature and controlled by TLC in an ethyl acetate-hexane (1:5) system on Silufol plates. The product was separated by column chromatography.A solution of 2-benzyl-10-chloro-1-phenylethynyl-1,2,3,4-tetrahydrobenzo[b]naphthridine (5a). Colorless crystals, yield 24%. m.p. = 139\u2013140 \u00b0C. 1H NMR  \u03b4 (ppm): 8.22 , 8.01 , 7.72 , 7.57 , 7.50\u20137.43 , 7.38 , 7.34\u20137.28 , 5.31 , 4.09 , 3.91 , 3.35\u20133.41 , 3.31 , 3.18 , 3.08 . 13C NMR  \u03b4 (ppm): 156.7, 147.6, 140.6, 138.0, 131.9(2C), 130.2, 129.2(2C), 128.8, 128.6(2C), 128.4(2C), 128.3, 127.6, 126.9, 125.3, 124.2(2C), 122.8, 87.5, 84.3, 59.4, 52.8, 44.8, 33.4. IR spectrum (KBr), \u03c5/cm\u22121: 2223.1 (-C\u2261C-). HRMS (MALDI+) m/z calcd for C27H21ClN2 in form of [M + H]+ ion 409.1471, found: 409.1483.2-benzyl-10-chloro-1-[(3-methoxyphenyl)ethynyl]-1,2,3,4-tetrahydrobenzo[b]naphthyridine (5b). Oil, yield 35%. 1H NMR  \u03b4 (ppm): 8.21 , 8.01 , 7.71 , 7.57 , 7.47 , 7.37 , 7.31 , 7.20 , 7.05 , 6.96 , 6.86 , 5.30 , 4.08 , 3.90 , 3.78 , 3.41\u20133.34, 3.30 , 3.18 , 3.07 . 13C NMR  \u03b4 (ppm): 159.4, 156.7, 138.0, 130.3, 129.5, 129.2(2C), 128.8, 128.7(2C), 127.6, 127.5, 127.0, 125.4, 124.6(2C), 124.2, 123.8, 116.9(2C), 115.0, 87.5, 84.1, 59.4, 55.4, 52.9, 44.8, 33.3. IR spectrum (KBr), \u03c5/cm\u22121: 2222.9 (-C\u2261C-). HRMS (MALDI+) m/z calcd for C28H23ClN2O in form of [M + H]+ ion 439.1577, found: 439.1558.2-methyl-1-phenylethynyl-1,2,3,4-tetrahydrobenzo[b]naphthyridine (5c).10-chloro- Oil, yield 32%. 1H NMR  \u03b4(ppm): 8.23 , 8.01 , 7.72 , 7.58 , 7.39 , 7.25 , 5.30 , 3.41 , 3.28 , 3.18 , 2.98 , 2.69 . IR spectrum (KBr), \u03c5/cm\u22121: 2225.8 (-C\u2261C-). HRMS (MALDI+) m/z calcd for: C21H17ClN2 in form of [M + H]+ ion 333.1159, found: 333.1142.b]naphthyridine (5d).10-chloro-2-methyl-1-[3-(methoxyphenyl)ethynyl]-1,2,3,4-tetrahydrobenzo+ ion 363.1264, found: 363.1281.b]naphthyridine (5e).10-chloro-2-methyl-1-[4-(methoxyphenyl)ethynyl]-1,2,3,4-tetrahydrobenzo+ ion 363.1264, found: 363.1279.b]naphthyridine (5f).2-benzyl-10-chloro-1-{[4-(trifluoromethyl)phenyl]ethynyl}-1,2,3,4-tetrahydrobenzo+ ion 401.1032, found: 401.1041.b]naphthyridine (5g).10-chloro-1-[(4-fluorophenyl)ethynyl]-2-methyl-1,2,3,4-tetrahydrobenzo+ ion 351.1064, found: 351.1049.b]naphthyridine (5h).10-chloro-1-[(4-chlorophenyl)ethynyl]-2-methyl-1,2,3,4-tetrahydrobenzo+ ion 367.0769, found: 367.0780.5c,d,f,g were dissolved in isopropanol at room temperature and cooled for 10 min in the freezer, then a 1.2 equivalent of activated alkyne was added and the mixture was stored in the refrigerator for 1 week. The reaction was controlled by TLC in an ethyl acetate/n-hexane 1:1 system on Silufol plates. The product was separated by column chromatography.The appropriate tetrahydrobenzonaphthyridines b]naphthyridin-1-yl}prop-2-enoate (6a).Methyl (2E)-3-{10-chloro-1-[(4-fluorophenyl)ethynyl]-2-methyl-1,2,3,4-tetrahydrobenzo+ ion 435.1276, found: 435.1261.b]naphthyridin-1-yl}prop-2-enoate (6b).Methyl (2E)-3-{10-chloro-1-[(3-methoxyphenyl)ethynyl]-2-methyl-1,2,3,4-tetrahydrobenzo+ ion 447.1476, found: 447.1460.b]naphthyridin-1-yl]but-3-en-2-one (6c).(3E)-4-+ ion 401.1421, found: 401.1411.b]naphthyridin-1-yl}but-3-en-2-one (6d).(3E)-4-{10-chloro-1-[(3-methoxyphenyl)ethynyl]-2-methyl-1,2,3,4-tetrahydrobenzo+ ion 431.1526, found: 431.1539.b]naphthyridin-1-yl)but-3-en-2-one (6e).(3E)-4-(10-chloro-2-methyl-1-{[4-(trifluoromethyl)phenyl]ethynyl}-1,2,3,4-tetrahydrobenzo+ ion 469.1295, found: 469.1301.Methyl 5-(4-chloro-2-ethenylquinolin-3-yl)-4-(4-fluorobenzyl)-1-methyl-1H-pyrrole-3-carboxylate (7). Oil, yield 3%. 1H NMR  \u03b4(ppm): 8.07 , 7.99 , 7.69 , 7.56 , 7.25 , 7.07\u20137.04 , 6.74 , 6.68 , 6.32 , 5.42 , 4.40 , 3.60 , 3.46 . 13C NMR  \u03b4 (ppm): 165.0, 155.6, 133.7, 132.0, 132.0, 130.9, 130.9, 130.3(2C), 129.9, 128.2(2C), 127.7(2C), 126.9, 125.7, 124.5, 124.5, 124.5, 122.4, 114.5, 114.3, 51.0, 35.5, 26.8. HRMS (MALDI+) m/z calcd for: C25H20ClFN2O2 in form of [M + H]+ ion 435.1276, found: 435.1268.3a (0.5 g) in 10 mL of THF was cooled to 0 \u00b0C, then a 1.2 equivalent excess of DIAD (diisopropylazodicarboxylate) was added. The mixture was stirred at room temperature for 1 h. After cooling it again to 0 \u00b0C, a 1.5 equivalent excess of the appropriate indole was added. The reaction was stirred at room temperature and controlled by TLC in an ethyl acetate/hexane (1:1) system on Silufol plates. The product was separated by column chromatography.A solution of b]naphthyridine (8a).2-benzyl-10-chloro-1-(5-methoxy-1H-indol-3-yl)-1,2,3,4-tetrahydrobenzo+ ion 454.1686, found: 454.1669.b]naphthyridine (8b).2-benzyl-10-chloro-1-(1H-indol-3-yl)-1,2,3,4-tetrahydrobenzo+ ion 424.1581, found: 424.1591.b]naphthyridine (8c).2-benzyl-10-chloro-1-(5-chloro-1H-indol-3-yl)-1,2,3,4-tetrahydrobenzo+ ion 458.1191, found: 458.1183.b]naphthyridine (8d).2-benzyl-10-chloro-1-(5-bromo-1H-indol-3-yl)-1,2,3,4-tetrahydrobenzo+ ion 502.0686, found: 502.0678.8a,d were dissolved in isopropanol at room temperature and cooled for 10 min in the freezer, then a 1.2 equivalent of activated alkyne was added and the mixture was stored in the refrigerator for 1 week. The reaction was controlled by TLC in an ethyl acetate/hexane 1:1 system on Silufol plates. The compound spontaneously fell out of the reaction mass in the form of crystals and was released by filtration.The appropriate compounds E)-3-benzyl-7-chloro-6-(5-methoxy-1H-indol-3-yl)-1,2,3,6-tetrahydroazocinoquinolin-5-yl]ethanone (10a).1-+ ion 522.1948, found: 522.1956.E)-3-benzyl-7-chloro-6-(5-bromo-1H-indol-3-yl)-1,2,3,6-tetrahydroazocinoquinolin-5-yl]ethanone (10b).1-+ ion 570.0948, found: 570.0969.50 values were obtained by nonlinear regression using Prism software .All reagents were purchased from Sigma Aldrich . The fluorometric assay was performed as previously described  using hub]naphthyridines 3 were synthesized for the first time, specifically 1-phenylethynyl derivatives 5 and 1-indol-3-yl derivatives 8. Moreover, the interaction of these compounds with activated alkynes was studied, revealing that the substituent in the first position played a key role in these reactions and either Stevens rearrangement products or azocinoquinolines were formed.As a major outcome of this study, novel functionalized 2-alkyl-10-chloro-1,2,3,4-tetrahydrobenzo[5c\u2013h were discovered as MAO inhibitors, showing selectivity toward the human MAO B isoform and potency in the low micromolar range. In particular, the 4-F derivative 5g achieved an IC50 of 1.35 \u03bcM in vitro, which was almost equipotent with pargyline (IC50 2.69), a known MAO B irreversible inhibitor that was taken as the positive control. MAO B inhibitors are typically used in the treatment of early symptoms of PD [5g deserves further optimization studies for improving its pharmacological potential as an effective agent for the treatment of neurodegenerative syndromes.The 1-phenylethynyl derivatives ms of PD , while tms of PD . In this"}
+{"text": "Hemodialysis tunneled catheters are prone to failure due to infection or thrombosis. Prediction of catheter dysfunction chance and finding the predisposing risk factors might help clinicians to prolong proper catheter function. The multidimensional mechanism of failures following infection or thrombosis needs a multivariable and comprehensive analytic approach.A longitudinal cross-sectional study was implemented on 1048 patients admitted for the first hemodialysis tunneled catheterization attempt between 2013 and 2019 in Shahid Hasheminejdad hospital, Tehran, Iran. Patients\u2019 information was extracted from digital and also paper records. Based on their criteria, single and multiple variable analyses were done separately in patients with catheter dysfunction due to thrombosis and infection. T-test and Chi-square test were performed in quantitative and categorical variables, respectively. Competing risk regression was performed under the assumption of proportionality for infection and thrombosis, and the sub-distributional hazard ratios (SHR) were calculated. All statistical inferences were made with a significance level of 0.05.Four hundred sixty-six patients were enrolled in the analysis based on study criteria. Samples\u2019 mean (SD) age was 54(15.54), and 322 (69.1%) patients were female. Three hundred sixty-five catheter dysfunction cases were observed due to thrombosis 123(26.4%) and infection 242(52%). The Median (range) time to catheter dysfunction event was 243(36\u20131131) days.Single variable analysis showed a statistically significant higher proportion of thrombosis in females  and younger patients, respectively. Multivariate competing risk regression showed a statistically significant higher risk of thrombosis in females \u2009=\u20091.81), hypertensive (SHR\u2009=\u20091.82), and more obese patients (BMI SHR\u2009=\u20091.037). A higher risk of infection was calculated in younger (Age SHR\u2009=\u20090.98) and diabetic (SHR\u2009=\u20091.63) patients using the same method.Female and hypertensive patients are considerably at higher risk of catheter thrombosis, whereas diabetes is the most critical risk factor for infectious catheter dysfunction. Competing risk regression analysis showed a comprehensive result in the assessment of risk factors of catheter dysfunction. Suitable vascular access is the main concern in chronic hemodialysis patients. Tunneled central venous catheters (CVC) is a flexible tube with prolonged vascular access providing for the management of intravenous medication treatments, fluids, or total parenteral nutrition, repeated blood sampling, and hemodialysis (HD) . CVCs arIdentification and prevention of CVCs complications in hemodialysis patients (Common complications such as catheter infection and thrombosis) are serious to improving patient care. CVC\u2019s main complications include infection, catheter dysfunction, and central vein obstruction (CVO). Infection associated with hemodialysis catheters is the most serious complication that may cause significant morbidity and mortality, systemic complications, hospitalizations, and considerable costs to the healthcare system . CathetePrevious research about the variables influencing the complications of the tunneled central venous catheters occurred in hemodialysis patients is shown that the Localization of the catheter into the right internal jugular vein , duratioThis longitudinal cross-sectional study was implemented to assess the risk factors affecting the function of tunneled central venous catheters that had been fixed for end-stage renal disease (ESRD) patients to perform hemodialysis. The study was conducted in Haeshmei-Nedjad Kidney Center, Tehran, Iran, between June 2019- Feb 2020.All patients who underwent central venous catheterization for the first time between the years 2015\u20132019 in the hospital were included in the study if their medical records were completed from the first catheterization episode until its dysfunction, end of follow-up, or end of the study period. Inclusion criteria were the first attempt for tunneled hemodialysis catheterization. All catheterizations were performed ultrasound-guided and rechecked by fluoroscopy to confirm the proper replacement of the catheter in the Cava-atrial junction. Based During the observed period, all patients underwent hemodialysis 2\u20134 times per week based on the ward protocol, and their catheters were heparin locked by 2500\u2009units after each dialysis session.Patients who encountered catheter dysfunction in less than 1\u2009months, those who had been lost to follow for catheter dysfunction, and those who were referred for the second or more installation of the venous catheter were excluded from the study. Moreover, any patient with a history of a thrombotic event, thrombotic dysfunction, immunodeficiency, and also recent use of antithrombotic, antibiotics or chemotherapy medication were excluded too. Patients\u2019 information, including demographic, past medical, and current medical situation, was extracted from the hospital information system (HIS) and digital records. In case of missing data , we referred to a paper medical file to complete the data. All patients signed informed consent to allow use their medical information anonymously for research goals.Registered demographic information was age, BMI, educational level and residential area. Past medical history of patients such as diabetes mellitus (DM), hypertension, Ischemic Heart disease (IHD) and its related interventions, and cancer, in addition to their clinical and para-clinical information before and after the admission time includes were extracted. Anemia was defined as hemoglobin (Hb) levels <\u200912.0\u2009g/dL in women and\u2009<\u200913.0\u2009g/dL in men based on WHO definition . NotablyThe study\u2019s endpoint was defined as catheter replacement due to thrombosis or infection and the time between first and second catheterization.Thrombosis of the catheter was defined as a significant impairment of the blood flow in the catheter (Blood flow rate (QB)\u2009=\u2009150\u2013250\u2009ml/min adjusted based on patients\u2019 weight) upon initiating the dialysis session. Since thrombolytic agents (Such as Urokinase) as not covered by medical insurance, we did not use them in case of catheter thrombosis.The infected catheter was diagnosed based on the patient\u2019s clinical symptoms (fever or chilling) and subsequent positive blood culture test results from the catheter line or peripheral.After the descriptive report of variables in the study samples, single and multivariable analyses were performed using STATA software version 16. Single variable analysis was done using the independent sample t-Test and also the Chi-square test for quantitative or categorical variables.P-value was <\u20090.2. However, some variables were included in the model regardless of the p-value in the case of clinical intuition.Since the study\u2019s main outcome was the time to reach catheter dysfunction, the multivariate statistical analysis plan was based on survival analysis, and patients who had never experienced dysfunction were considered censored (even if death happened due to non-catheter related reasons). Two separate cox regression models were adjusted to assess the association between factors and two causes of catheter dysfunction (Thrombosis and infection). Proportionality assumptions were assessed for any assumed risk factors before involving in the regression models. Moreover, due to trigonal characteristics of patients\u2019 state , it seems infection and thrombosis compete for catheterization failure. Then the risk factors effect was evaluated using competing risk regression analysis between these two different outcomes and the sub-distributional hazard ratio was calculated for both infection and thrombosis competing with each other by STATA software. The significance level was considered as 0.05 in univariate analysis. Multivariate analyses were performed in the backward method. Variables were kept in the model if the univariate Throughout 1048 central venous catheterization cases in the study period, 466 patients were completely eligible for analysis (Fig. There was no case of death before catheter dysfunction. Jugular catheterization was performed in 95.5% of patients whereas sub-clavian and femoral catheter was fixed in 2.4 and 2.1% cases respectively. Patients\u2019 care level was 6.9, 50.5, 34.7 and 7.9% from level 1 to 4 respectively. Patients\u2019 clinical characteristics are described in Table\u00a0Single variable analysis showed that older patients\u2019 are at higher risk of thrombosis and lower risk of infection Table\u00a0, althougMultivariate regression for thrombosis, which competed by infection, demonstrated that female gender and hypertension predispose patients to thrombosis while DM is associated with a reduced risk of it. On the other hand, higher age and lower diastolic pressure are associated with a lower chance of infection in competing risk of thrombosis since diabetes makes patients more susceptible to infection Table\u00a0.Table 4CThis single-center study tried to investigate many predisposing risk factors for catheter dysfunction with about 116,000\u2009days follow-up through two types of a regression model. Findings proposed that female and hypertensive patients besides more obese individuals, are considerably higher at risk of catheter thrombosis. In contrast, diabetes is the most critical risk factor for infectious catheter dysfunction. The result of the competing risk model is more reliable due to the best adjustment.Previous studies reported different rates of thrombosis. A similar percentage were observed in 46.7% of cases with hemodialysis catheter in the Sahli study . DevelteThe infection rate reported widely from 6 to 29% in the various surgical settings and also patients population \u201314 whichMultivariate analysis to assess the risk factors of thrombosis and also infection in patients with tunneled central catheters is performed frequently using Cox or logistic regression, but most studies used these methods for each endpoint separately , 11, 15.On the base of the author\u2019s knowledge, the competing risk regression model has not been used for risk factor analysis in hemodialysis tunneled catheters but it was used recently for peritoneal dialysis-associated factors .Patients\u2019 age in our study is lower compared with most previous studies especially compared in developed countries , 12, 18 A higher rate of thrombosis in females was reported considerably by Ward in the direction of our results. However, Pasara et al. reported a higher mortality rate in men due to catheter dysfunction . Our resOur results show hypertensive patients have a considerably higher risk of thrombosis SHR\u2009=\u20091.4. Equivalent results were reported in the Ward study, where higher mean blood pressure at the time of dialysis is reported as a risk factor for thrombosis. Unfortunately, this variable is not available in our database, although to quantify the effect of hypertension on thrombosis, we include diastolic blood pressure at the time of catheter insertion in a multivariate competing regression model, but the results were not statistically significant. Pasara reported a lower chance of death in hemodialysis patients with previous hypertension history.Higher BMI and obesity are frequently mentioned as risk factors for catheter thrombosis, and this is entirely compatible with the current study\u2019s result .The current study introduces new methods of risk factor analysis for hemodialysis catheter dysfunction whit competing for risk calculation which is recommended to be considered for future studies. Single-center study population made the intervention protocol more homogenous, although this might reduce its external validity. The study\u2019s main limitation is its retrospective nature, leading to missing data, loss of patient follow-up, and a lack of good quality laboratory data registry."}
+{"text": "Circular dichroism and nuclear magnetic resonance data suggested that the presence of 3-Ser in WYSGK increased its \u03b2-sheet content, and that the active hydrogen atoms produced chemical shifts. In H2O2-induced PC12 cells, WYSGK substantially reduced ROS and MDA levels, and increased ATP levels. Transmission electron microscopy and Seahorse Analyze assay proved the peptide WYSGK to significantly alleviate mitochondrial damage and respiratory dysfunction (p < 0.05), thereby implying that a study of structure-activity relationships of the peptides can possibly be an effective approach for the development of functional factors.This study aimed to investigate the structure-activity relationship of the pine nut antioxidant peptide WYPGK and its derivative peptides, and to evaluate the protective effect of the latter on oxidative damage to mitochondrial structure and function in PC12 cells. Molecular docking revealed the derivative peptides WYFGK and WYSGK to have higher affinity to the active region of sirtuin 3 (SIRT3) , hence indicating that they are promising SIRT3 inducers and antioxidant factors. The derivative peptide WYSGK presented the highest ORAC value (5457.70 \u00b5mol TE/g), ABTS scavenging activity (70.05%), and Fe Oxidative stress can cause various types of damage to cells, including DNA breakage, protein inactivation, and cell membrane damage. Excessive reactive oxygen species (ROSs) accumulation in the body can cause cytotoxicity, resulting in many diseases, such as tumors, Alzheimer\u2019s disease, and diabetes ,2. MitocRecently, antioxidant peptides have drawn extensive attention as functional foods and supplements, although their structure-activity relationships and antioxidant mechanisms have not yet been fully elucidated. Many researchers have inferred that the sequence and position of amino acids in the peptides may affect the peptide structure and properties, thereby affecting their antioxidant activity . Yang etPinus koraiensis Sieb. et Zucc.) albumin. Our previous studies had shown WYPGK to have a high antioxidant capacity and to activate SIRT3 in order to enhance synaptic plasticity and improve learning and memory in mice [Sirtuin 3 (SIRT3) is a deacetylase in the mitochondria that regulates the antioxidant system. It has a conserved enzyme core (aa126-399), which contains the binding site of SIRT3 substrates, and is responsible for deacetylation . Previou in mice . Pro hasThe peptides WYPGK, WYSGK, and WYFGK were synthesized by Jiangsu Ji Tai Peptide Industry Science and Technology Co., Ltd. ; their purities were determined to be 99.18, 98.29, and 98.92%. The 2,2-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) diammoniumsalt (ABTS) and 2,2\u2032-azobis-(2-amidinopropane) dihydrochloride (AAPH) were obtained from Sigma Aldrich . The rat pheochromocytoma PC12 cells were purchased from Zhong Qiao Xin Zhou Biotechnology Co., Ltd. . Fetal bovine serum (FBS) and RPMI 1640 medium were obtained from Gibco-BRL . The bicinchoninic acid kit to measure protein concentration were obtained from Nanjing Jiancheng Bioengineering Institute . Assay kits to detect reactive oxygen species (ROSs), microscale malondialdehyde (MDA), and adenosine 5\u2032-triphosphate (ATP) were obtained from Beyotime Institute of Biotechnology .www.rcsb.org; accessed on 1 July 2021). The structures of the peptides were generated by Discovery Studio 2019. The molecular docking calculations between SIRT3 and the peptides were performed using AutoDock. A total of 150 independent runs were carried out with a maximum of 25,000,000 energy evaluations and a population size of 300. A grid box of dimensions (70 \u00d7 70 \u00d7 70), with a spacing of 0.375 \u00c5, was created. Lamarckian genetic algorithm (LGA) was applied for the docking calculations. The binding affinity of the peptide to SIRT3 was evaluated by binding energy, and the results were expressed as binding energy . The clusters were ranked according to the lowest representative energy from each cluster. The lowest energy conformation in the most populated cluster was chosen for further study. Discovery Studio software analyzes hydrogen bonds between residues at the SIRT3 binding site.Molecular docking is an important method to explore intermolecular interactions. The crystal structure of SIRT3 (PDB ID 3GLS) was obtained from the Protein Data Bank  proportion for 12\u201316 h in the dark. The ABTS stock solution was diluted to 0.70 \u00b1 0.02 absorbance at 734 nm wavelength by 5 mM phosphate-buffered saline , which was used as the working solution. Then, 10 \u03bcL of peptides (100 \u00b5M) and 190 \u03bcL of ABTS working solution were added into the 96-well microplate. After 6 min, the absorbance was assayed at 734 nm wavelength. The ABTS radical scavenging activity was calculated as follows:A0 is the control absorbance, A1 is the sample absorbance, and A2 is the blank absorbance.The modified ABTS assay was conducted according to the method of Re et al. . Briefly2+-chelating activity assay was conducted according to the method of Zhang et al. [2 (20 \u00b5M) and 1 mL of ferrozine (0.5 mM) were added in the reaction. The mixture was uniformly mixed in a water bath at 25 \u00b0C for 20 min, and the absorbance was measured at a wavelength of 562 nm. The same concentration of EDTA was taken as a control. The Fe2+-chelating activity was calculated as follows:A0 is the control absorbance, A1 is the sample absorbance, and A2 is the blank absorbance.Feg et al. , with a The secondary structure determination of peptides was performed using a J-1500CD spectrometer . The peptide solution at a concentration of 0.5 mg/mL was added to a quartz dish with a 0.1 mm optical path length. The spectral range was set to 190\u2013260 nm, with a scanning speed of 100 nm/min and a response time of 2 s. The scanning was performed 3 times. The secondary structure content was calculated using the Reed\u2032s Reference method.2O to analysis, and its 1H NMR spectra were obtained. Then, 10 mg of peptides were dissolved in 600 \u03bcL of DMSO solution and transferred to a 5 mm NMR tube, and the COSY and NOESY spectra were obtained. The main operating parameters were the sampling delay time of 6 s and the pulse width of 13 \u03bcs, which were recorded 32 times in total.NMR spectroscopy was conducted according to the method of Delaglio et al. . A Bruke2. Cells were seeded at a density of 2 \u00d7 105 cells/mL in 24- or 6-well plates, cultured with peptides for 24 h, and then exposed to concentration (0.4 mM) of H2O2 for 3 h. Cells in the control group were untreated, and cells in the model group were treated with H2O2.PC12 cells were maintained in RPMI-1640 medium , which was supplemented with 10% FBS at 37 \u00b0C and 5% CO2O2 for 3 h, 10 \u03bcM DCFH-DA was added to each well, and the cells were incubated at 37 \u00b0C for 30 min and washed twice with PBS to eliminate excess DCFH-DA. A fluorescence microscope  was used for photographs. Culture supernatant was collected and fluorescence was measured at excitation and emission wavelengths of 485 and 535 nm, respectively. Intracellular reactive oxygen levels were compared, based on relative fluorescence intensity.Fluorescent probe 2\u2032,7\u2032-dichlorodihydrofluorescein diacetate (DCFH-DA) was used to detect intracellular ROS. After incubation with peptides for 24 h and then with H2O2, washed twice with ice-cold PBS, collected, lysed for 30 min in cell lysis buffer  at low temperature, and centrifuged. Protein concentration in supernatants was measured using the BCA kit, and MDA and ATP levels were determined according to the appropriate kit instructions.For measurements of MDA and ATP levels, PC12 cells were cultured in 6-well plates, exposed to the peptides and HAfter peptide treatment, the cells were trypsinized and fixed in 0.1 M PBS (pH 7.4) at 4 \u00b0C with 2% glutaraldehyde for 2 h. After washing three times with 0.1 M PBS, the cells were exposed to 1% tetraoxide for 2 h. Then, the tissue was dehydrated using an ethanol gradient. Subsequently, the samples were embedded in Epon Resin 812, cut to 60\u201380 nm thinness, and stained with uranium and lead. The TEM  was used to observe the mitochondrial ultrastructure images.5 cells into Seahorse XF cell plates for 24 h. After the peptides and H2O2 were treated, the cells were incubated with the SIRT3 inhibitor 3-TYP (50 \u00b5M) for 2 h. During the detection of OCR, the drugs oligomycin , FCCP , rotenone , and antimycin A  were added in sequence. During the detection of ECAR, the drugs glucose (10 mM), oligomycin (1 \u03bcM), or 2-DG (100 mM) were added in sequence. Seahorse software was used to plot the results.The cellular oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were assessed using a Seahorse XF8 extracellular flux analyzer . Briefly, PC12 cells were seeded at a density of 3 \u00d7 10p < 0.05.Results were quantified and expressed as means \u00b1 standard deviation (SD). All experiments were performed in triplicate. One-way ANOVA was performed using GraphPad Prism 6 , and the Tukey test was applied to multiple comparisons. Differences were considered significant at Molecular docking results of the antioxidant peptide WYPGK and its derivatives with the SIRT3 active region are shown in p < 0.05 compared to the WYPGK group; 2+-chelating activities of WYPGK, WYFGK, and WYSGK were 70.67, 55.73, and 81.70%, respectively, which indicated that amino acids within the peptides significantly impact the antioxidant capacity. Habinshuti et al. had pointed out that tightness of the peptide structure affects its antioxidant property [To confirm the antioxidant activity of the peptides, WYPGK, WYFGK, and WYSGK were chemically synthesized, and their activities determined using an in-vitro chemical assay. In the ORAC assay and ABTS free radical scavenging activity assay A,B, actiproperty . The aroproperty . The amiThe CD spectra of WYPGK and WYSGK are shown in 1H NMR spectrum analysis of the active hydrogen atoms of peptides WYPGK and WYSGK in the chemical environment were investigated here. 2\u2212 (8.85\u20138.95 ppm), \u2212N\u2212CH2\u2212 (7.95\u20138.10 ppm), and \u2212OH (8.15\u20138.25 ppm). The active hydrogen atoms in WYSGK and their corresponding chemical changes are shown in 2\u2212 (8.75\u20138.84 ppm), \u2212OH (8.28\u20138.35 ppm), and \u2212OH (8.00\u20138.14 ppm). We observed that in WYSGK, substitution of serine changes the active site of the active hydrogen atom (\u2212N\u2212CH2\u2212 is converted to \u2212OH); the active hydrogen atom of the hydroxyl group on the serine side chain can be used as a hydrogen donor, which can possibly increase the antioxidant property of WYSGK. The unique cyclic structure of the proline side chain gives it a conformational rigidity, making it less free than other amino acids [2+-chelating activity experiments confirmed WYSGK to have stronger antioxidant activity than WYPGK. In addition, serine (S) substitution caused chemical shifts of the active hydrogen atoms on tyrosine (Y), glycine (G), and lysine (K), probably due to the different electronegativities of the bonding atoms. Therefore, WYSGK can scavenge free radicals, thereby acting as antioxidants.NMR spectroscopy is a general method for studying peptide-protein interactions in terms of binding affinity and binding kinetics; it shows the intramolecular and intermolecular interactions of peptide protons. no acids . In-vitr\u03b1H\u2212C\u03b1H chemical shift determines the position and arrangement of the amino acids. As shown in \u03b1H were 4.23, 3.66, 3.75, 4.63, and 2.77 ppm, respectively. Chemical shift positions of WYSGK  on 3-Pro and 3-Ser of the two peptides. In addition, there were five proton assignment peaks on the 3-Pro side-chain ring in WYPGK structure, which were 1.89, 4.37, 1.66, 3.84, and 4.54 ppm, respectively. In the structure of WYSGK, the assigned peaks of \u2212C\u03b2H\u2212OH on the side chain of 3-Ser were 4.63 and 4.35 ppm. The NOESY spectrum reflects the close relationship between the protons. The closer the protons, the greater would be their chance of contact with the outside world, and hence the greater would be the plasticity and activity of the peptide [Two-dimensional NMR COSY and NOESY patterns were used to analyze the close relationship across hydrogens in the spatial structure of WYPGK and WYSGK, and to further explore the relationship between peptide activity and configuration. The overlapping part of COSY spectrum and NOESY spectrum corresponds to the amino acid position, and the Nof WYSGK F indicat peptide . WYSGK h peptide . In addi2O2 treatment significantly increased intracellular ROS levels . However, ROS levels were significantly reduced in PC12 cells treated with the derivative peptides (p < 0.05). Pretreatment with WYSGK significantly decreased MDA levels in H2O2-induced PC12 cells (p < 0.05). Meanwhile, the ATP levels of WYPGK and WYSGK  were significantly increased over those of the model group (0.43 \u00b1 0.03) . Lai et al. used the mitochondrial aspect ratio to analyze mitochondrial morphology and evaluate mitochondrial integrity quantitatively [The protein encoded by SIRT3 exists only in the mitochondria, eliminating ROS and preventing neuronal damage. To evaluate the therapeutic effect of WYPGK, and its derivative peptide WYSGK, on abnormal mitochondria after oxidative damage, the ultrastructural changes in mitochondria were studied by transmission electron microscopy. As shown in tatively . Sisallitatively . The restatively . Specifitatively . Consist2O2. 2O2 was significantly lower than that in the blank group . In the WYSGK+3-TYP treatment group, we observed that when SIRT3 levels were inhibited, the regulation of maximum respiratory capacity and ATP production by WYSGK was also inhibited. Regulation of the mitochondrial oxidative phosphorylation pathway by WYSGK was speculated to be possibly dependent on SIRT3; however, this would need to be confirmed in future studies. Studies have shown that SIRT3 alleviates energy metabolism dysfunction in cells and improves mitochondrial function. We analyzed the extracellular acidification rate of PC12 cells . This showed that WYSGK has a protective effect on the energy metabolism disorder caused by H2O2 damage to the cells. Compared to the WYSGK group, the WYSGK+3-TYP treatment group showed no significant difference in glycolysis pathway regulation; WYSGK regulation of the glycolysis pathway was speculated to not depend on SIRT3. According to our current findings, WYSGK can regulate mitochondrial oxidative phosphorylation and glycolysis pathways, and the process of aerobic respiration may depend on SIRT3. Our result was consistent with a previous study, in which SIRT3 was reported to regulate mitochondrial function and biogenesis and protect against mitochondrial damage [The Seahorse extracellular flux analyzer was used to evaluate the effect of WYSGK on mitochondrial oxidative phosphorylation and glycolysis in PC12 cells damaged by H12 cells G. Comparchondria . In addil damage .2O2-induced mitochondrial damage and alleviate mitochondrial oxidative phosphorylation and glycolysis dysfunction. Notably, the regulation of mitochondrial oxidative phosphorylation by WYSGK was found to depend on SIRT3, which would need to be explored further in future studies. The characterization of pine nut-derived peptides would help clarify the relationship between peptide structure and antioxidant activity and support the application of peptides as functional food ingredients.The present study identified that, based on the results of molecular docking, pine nut-derived peptides WYFGK and WYSGK can stably bind to the active region of SIRT3. The SIRT3-WYSGK complex involved \u03c0\u2013\u03c0 interactions and a sandwich structure (Arg-158)/(WYSGK)/(His-248). Antioxidant activity of the derived peptide WYSGK was significantly higher than that of the pine nut peptide WYPGK, which could be associated with the increase in \u03b2-sheet content and the active hydrogen atom-produced chemical shifts. The results provided new insights into the effect of amino acids located within an active peptide, which could eventually affect the antioxidant activity of the peptide, possibly by influencing the neighboring amino acids to change the secondary structure of the peptide, the position of active hydrogen atoms, and steric hindrance. We speculated that the smaller side-chain structure of amino acids located inside the peptide chain might facilitate better antioxidant activity. In addition, studies on mitochondrial ultrastructure and respiration suggested that WYSGK can reduce H"}
+{"text": "Advanced glycation end products (AGEs) are glycated proteins or lipids formed endogenously in the human body or consumed through diet. Ultra-processed foods and some culinary techniques, such as dry cooking methods, represent the main sources and drivers of dietary AGEs. Tissue accumulation of AGEs has been associated with cellular aging and implicated in various age-related diseases, including type-2 diabetes and cardiovascular disease. The current review summarizes the literature examining the associations between AGEs and neurocognitive and mental health disorders. Studies indicate that elevated circulating AGEs are cross-sectionally associated with poorer cognitive function and longitudinally increase the risk of developing dementia. Additionally, preliminary studies show that higher skin AGE accumulation may be associated with mental disorders, particularly depression and schizophrenia. Potential mechanisms underpinning the effects of AGEs include elevated oxidative stress and neuroinflammation, which are both key pathogenetic mechanisms underlying neurodegeneration and mental disorders. Decreasing dietary intake of AGEs may improve neurological and mental disorder outcomes. However, more sophisticated prospective studies and analytical approaches are required to verify directionality and the extent to which AGEs represent a mediator linking unhealthy dietary patterns with cognitive and mental disorders. With global rates of cognitive impairment and mental disorders on the rise, the development of effective preventative and treatment measures is of paramount importance ,2. CogniOver decades, AGEs accumulate at the cellular level in body tissue, where they have the potential to irreversibly increase the rate of cellular aging ,11. It aDue to emerging evidence implicating AGEs in the development and progression of various aging-related diseases associated with brain health , there has been a focus on the neurological sequelae attributed to AGEs, namely neurological and mental disorders. A number of these studies have been conducted recently, adding to the body of knowledge relative to the impact of AGEs in neurological and mental disorders. Therefore, the current review aimed to provide an updated summary of the literature examining the relationship between AGEs and neurocognitive and mental disorders. This information may inform the development of preventative strategies and interventions targeting AGE accumulation.Schiff base, which occurs as a consequence of the condensation between a reducing sugar and the free amino group of proteins, lipids, and nucleic acids [\u03b5-carboxymethyl-lysine and the highly reactive derivatives of methyl-glyoxal, argpyrimidine, pentosidine, and methylglyoxal-lysine dimer and glyoxal-lysine-dimer [AGEs are proteins or lipids that are glycated exogenously and endogenously in the presence of reducing sugars, both within the food matrix and in the body, respectively . Specifiic acids . This isic acids ,25. The ne-dimer . AGEs are ligands for one main receptor, known as the receptor for advanced glycation end products (RAGE) . Upon bi\u03b5-carboxymethyl-lysine, N\u03b5-1-carboxyethyl-lysine, pyrroline, pentosidine, glyoxal, and methylglyoxal [\u03b5-carboxymethyl-lysine and methylglyoxal [\u03b5-carboxymethyl-lysine, pyrraline, pentosidine) concentrations independently of their consumption. The majority of uncooked food contains low levels of dietary AGEs, particularly fruits and vegetables [The amount of circulating and accumulated AGEs in vivo is influenced by dietary factors . Dietarylglyoxal ,38. Studlglyoxal . The diegetables . Howevergetables . Foods cgetables . This isgetables . Dry hea\u03b5-carboxymethyl-lysine content) with salmon that is broiled and fried compared to poached. Plant foods that are cooked or charred typically have fewer dietary AGEs compared to animal products, regardless of the cooking method, possibly due to their antioxidant and vitamin content, differences in amino acids, and lower fat content, which can all contribute to less AGE formation [Some foods generally recommended as healthy can have high AGE levels, depending on how they are prepared. For example, broiled and fried salmon contain relatively high amounts of dietary AGEs, even though salmon consumption is associated with better overall health and cardiovascular disease outcomes ,42. A stormation . Exceptiormation . Notablyormation . Howeverormation ,45. Based on a review of various studies, a daily average AGE intake between 9000\u201324,000 kU/day was reported amongst healthy people . HoweverA systematic review and meta-analysis of randomized controlled trials showed a reduction in insulin resistance, fasting insulin, and total and low-density lipoprotein cholesterol (LDL-C) in low dietary AGEs groups compared with high dietary AGEs groups . A 24-weStudies reporting urinary excretion, plasma, or tissue accumulation following AGE intake provide insights into the absorption and systemic bioavailability of exogenous AGEs . A numbeBacillus subtilis, Escherichia coli and Intestinimonas butyriciproducens AF211) can partially degrade an AGE precursor (fructoselysine) with a key kinase enzyme [E. coli [\u03b5-carboxymethyl-lysine, either partially or entirely, in anaerobic conditions [\u03b5-carboxymethyl-lysine has been found in faeces [High molecular mass protein-bound AGEs require enzymatic digestion before being absorbed and vehiculated into the systemic circulation . Given te enzyme ,55. For [E. coli . It has nditions . Some hinditions . As muchn faeces .Once absorbed, AGEs are distributed to various tissues, including the liver and kidneys, where they accumulate once they overwhelm the AGE detoxification systems . In addiAs mentioned, various enzymes and detoxifying systems are capable of degrading intracellular AGEs . FurtherA growing body of evidence implicates AGEs in neurodegenerative diseases such as Alzheimer\u2019s disease (AD) and Parkinson\u2019s disease (PD) ,63,64, aThe presence and accumulation of AGEs may contribute to neuronal cell death and dysfunction, due to their role in the generation of pro-inflammatory cytokines . Recentl42, and oxidative stress compared to mice fed a diet low in AGEs [When AGEs accumulate, activated RAGE signalling and production downregulates specific AGE detoxification pathways involving the ubiquitin\u2013proteasome system and autophagy ,83. In c in AGEs . Additionally, AGEs inhibit the brain-derived neurotrophic factor (BDNF)-tropomyosin receptor kinase B (TrkB) signalling pathway, thereby impairing neuroplasticity in the rat brain . Wu et aIntracellular accumulation of AGEs results in endothelial dysfunction , with thAlternatively, AGEs may play a role in mental disorders indirectly, by affecting a number of conditions that are often comorbid with mental disorders and cognitive impairment, such as obesity, T2DM, and cardiovascular disease ,101. AGEMoreover, preliminary research suggests that dietary AGEs may alter the gut microbiome composition and increase colon membrane permeability ,110,111.Several studies have investigated the association of circulating and tissue AGE levels with cognition ,119,120.In a prospective study involving two groups of older people  with either normal blood glucose levels (n = 425) or T2DM (n = 495), mid and high urine pentosidine levels (a biomarker of AGEs) were associated with lower scores on the digit symbol substitution test at baseline and longitudinally at nine years follow-up, in both groups . The incIn a sample (n = 3889) of older people , higher extracellular newly identified RAGE (EN-RAGE) was associated with higher prevalence of dementia . EN-RAGEIn 144 people with dementia, higher AGE levels were associated with functional mobility and progression to dementia over one year . AGE lev\u03b5-carboxymethyl-lysine and N\u03b5-1-carboxyethyl-lysine) in patients with PD and AD and healthy controls. In comparison to the controls, higher levels of N\u03b5-carboxymethyl-lysine were found in AD and PD patients [Preliminary research has indicated that there may be a link between AGE accumulation and a number of other neurological disorders, such as multiple sclerosis (MS) and Parkinson\u2019s disease (PD) ,125. Onepatients . A six-month randomized pilot trial was conducted to examine the effectiveness of reducing dietary AGE intake in older people with T2DM (n = 75) . Fifty-tA number of studies have indicated that AGEs may be associated with schizophrenia ,128. OneOne case-control study investigated whether skin AGEs were associated with recent-onset psychosis in a cohort of 111 patients . Skin AGHammoudeh et al. examined AGE concentrations in participants with chronic mental disorders while taking antipsychotics for at least six months . ResultsA recent cross-sectional study assessed the effects of AGEs on the volume of various brain regions in patients with recent-onset psychosis  . MagnetiThe relationship between pre- and post-operative sRAGE and delirium was examined following cardiac surgery . Deliriu\u03b5-carboxymethyl-lysine and N\u03b5-1-carboxyethyl-lysine were not independently associated with depressive outcomes.Associations between AGE and other mental disorders such as depression and affective disorders have also been observed. A large scale cross-sectional study (n= 862) investigated the association of skin and plasma AGEs with depressive symptoms and depressive disorder . The autA cross-sectional association was examined between skin AGEs and a number of affective disorders, which included major depressive disorder (n = 1702), dysthymia (n = 828), generalized anxiety disorder (n = 3313), panic disorder (n= 2345), and social phobia (n = 691) . Total eA large cross-sectional investigation involving a cohort derived from the Helsinki Birth Cohort Study  measuredAnother study investigated whether skin AGE concentrations mediated the association between affective disorders and excess mortality  . MortaliSeveral studies examined levels of soluble RAGE and depression ,142. OneThere are also a number of studies that failed to demonstrate a link between AGEs and mental disorders. In one small-scale cross-sectional study that involved a cohort of individuals with clinically diagnosed bipolar disorder  and 10 healthy control subjects , lower lThe current evidence provides preliminary support for the association between elevated AGEs levels in the pathology of cognitive and mental disorders. However, several limitations are present that require further investigation. Studies involving neurological disorders have been predominantly centred around dementia, and those focusing on mental disorders have focused on schizophrenia and depression. Although a number of large scale population-based studies examined associations between AGEs and these conditions, participants of non-Western descent were underrepresented, who may display varying amounts of AGEs as a result of varying race or socioeconomic status ,145. CroWhile a number of studies utilized clinically defined populations, others measured cognitive function and depressive symptoms or relied on self-reported measures in non-clinical populations. The severity of depressive symptoms may dictate the strength of associations with AGEs, particularly given that those with clinical depression may be diagnosed with related comorbidities that are linked to AGE accumulation. This association may be influenced by the type of depressive symptom examined, with one study demonstrating the highest AGE levels in those with melancholic depressive symptoms compared to other depressive symptoms . ExaminiA number of key confounders, including sociodemographic status  and gendRecent studies have suggested that the ratio of AGEs and sRAGE is a more accurate biomarker for age-related diseases than either alone , with a With regard to studies involving dietary AGEs, no validated questionnaires currently exist that enable the accurate estimation of dietary AGE intake at the population level . MoreoveFuture studies need to examine whether AGE concentration is a worthwhile target for interventions aimed at alleviating neurological or mental disorders. Similarly, this may prompt studies to better establish the risk factors that may be associated with mental and neurological disorders through the accumulation of AGEs, such as diets high in ultra-processed foods . A systeThe link between AGEs and T2DM is well recognized; however, the interplay between the two and risk of neurocognitive disorders and mental disorders requires further investigation. As mentioned previously, AGE accumulation represents a common contributing factor to both T2DM and neurocognitive disorders, such as AD and its associated pathologies . MoreoveThe reviewed literature indicates that elevated circulatory and skin AGEs are associated with neurological disorders, especially dementia, and mental disorders, such as depression and schizophrenia. Longitudinal investigations have revealed that elevated AGEs may increase the risk of cognitive impairment, which appeared to occur independently of metabolic risk factors. In addition, limited but supporting data show that higher skin AGE accumulation may be associated with depression and schizophrenia. Elevated oxidative stress and neuroinflammation are key pathophysiological mechanisms linking AGEs with impaired brain health. This paradigm is also supported by the close relationship between AGEs, T2DM, and cardiovascular disease, which in turn are strongly implicated in the pathogenesis of neurocognitive diseases and mental disorders. However, given that the majority of studies have largely relied on cross-sectional designs, with a notable lack of experimental research, directionality and causal pathways in the relationship between dietary sources of AGEs and cognitive and mental disorders remain unknown. Future studies are encouraged to address these gaps."}
+{"text": "The COVID-19 pandemic caused by SARS-CoV-2 remains a significant issue for global health, the economy, and society. When SARS-CoV-2 began to spread, the most recent serious infectious disease of this century around the world, with its high morbidity and mortality rates, it is understandable why such infections have generally been spread in the past, mainly from international travel movements. This perspective review aimed to provide an update for clinicians on the recent developments related to the microbiological perspectives in pandemics, diagnostics, prevention (such as the spread of a virus), vaccination campaigns, treatment options, and health consequences for COVID-19 based on the current literature. In this way, the authors attempt to raise awareness on the transversal nature of these challenges by identifying the main risk/vulnerability factors that the scientific community must face including our current knowledge on the virus capacity of the mechanism of entry into the cells, the current classifications of viral variants, the knowledge of the mathematical model on the spread of viruses (the possible routes of transmission), and the effectiveness of vaccination campaigns in a global context of pandemic, particularly from COVID-19, with a look at new or future vaccines. Microbiology is a branch of medicine and biology that studies the structure and functions of microorganisms  . CompareInsensitivity to traditional vaccines and normal immunological factors.Drug (antibiotics and others) resistance.Their persistence in the natural environment despite the action of disinfectants.The production in large quantities of already known or \u201cnew\u201d biotoxins.Current technical\u2013scientific knowledge in the biomedical field is used to study the virulence of pathogenic microorganisms already naturally present in the environment, and is the first point of analysis for examining how these pathogens become devoid of pathogenetic capacity. There may be many characteristics that make a microorganism difficult to treat in the field of health management  such as:It is worth underlining that the pathogens represented by microorganisms such as viruses show their effects after several days, and are responsible for epidemics or pandemics being more dangerous due to greater opportunities for transmission, especially inhalation. Indeed, since ancient times, we have descriptions of epidemic or pandemic conditions that have plagued humanity  3,4,5].,4,5.3,4,According to the World Health Organization (WHO), there are three conditions for a pandemic to occur: (a) the appearance of a new pathogen for which effective treatments are not known; (b) the ability of this agent to affect human beings; and (c) the ability of this agent to spread rapidly through contagion. Other factors can be environmental, ecological, and sociological influences that affect the likelihood of pathogens encountering new hosts. In fact, many of these factors alter the spread of pathogens and their hosts or vectors .Most of the viruses that have caused pandemics are zoonotic . These include the influenza virus, SARS-CoV-1, and, as far as we know, COVID-19. Finally, in emergency public health situations such as epidemics or pandemics, contagion is more frequently associated with RNA viruses. This is probably due to the greater genomic flexibility these viruses ,7.Coronaviridae family . Some positively polarized single-stranded RNA viruses have a large outer envelope and multiply in the cytoplasm of animal cells that act as receptors. Most coronaviruses (CoVs) belonging to the Sarbecovirus subgenus are found in bats [COVID-19 is a disease that spread rapidly around the world in 2020. It manifests both asymptomatically and symptomatically and primarily affects the respiratory and vascular systems. As of 5 December 2021, nearly 265 million confirmed cases, with over 5.2 million cumulative deaths, have been recorded, making it the deadliest pandemic since the Spanish flu . Coronav in bats . The mai in bats .The organization of the SARS-CoV-2 genome has been detected by PCR in many biological samples derived from, for example, the lung tissue, kidney, sputum, throat smear, upper airway aspiration, and flushing fluids . The virstable, keeps the virus in the environment , characteristic behavior of the virus in the primary host or reservoir; (b) in evolution, so the passage of the virus from the traditional population to a new one, belonging to the same host species or to different species, with progressive adaptation of the pathogen; (c) dead-end host, that is, the passage of the virus from the traditional host to a new one in which the virus is unable to transmit effectively for which it does not adapt, so may also be due to the high lethality of the virus which, causing the too rapid death of the new host, does not allow its transmission; and (d) resistant, so the infected host completely blocks the replication cycle of the virus (non-receptive host) [In general, the interactions between the virus and host can therefore be divided into four types: (a) ve host) ,7. To inve host) ,12. Therve host) .As with other infectious diseases, the amount of viral load  is probably the main cause of infection. The magnitude of the viral load is determined by: (a) the secretions of the patient who is the source of the infection, and (b) the distance between the original patient and the person to whom it is transmitted . The infection therefore varies over time, even during the symptomatic phase of the disease, and the virus is transmitted more easily in the advanced stages of the disease ,14.Susceptible , \u201cI\u201d stands for Infectious and are the individuals who have contracted the disease and are able to pass it on, and finally \u201cR\u201d stands for Recovered or Removed , and for SIR, they cannot be part of the transmission process . Thus, regarding the concept of infectious being when a pathogen establishes itself in an exposed individual, they become infected. Infected individuals who can transmit the disease are called infectious. In general, infected individuals may not be infectious for a so-called latency period. Historically, the use of deterministic and probabilistic models in the analysis of the development of infectious diseases has spread widely since 1760, when developed the first mathematical model was formulated by D. Bernoulli to support vaccination against smallpox. This was followed by Hamer in 1906 and Ross in 1911, which were aimed at the perception of malaria, and in 1927, the SIR model by Kermack and McKendrick was developed to explain the rapid growth and subsequent decrease in the number of infected people observed to some degree in that epidemic\u2019s era such as the plague or cholera. Subsequently, from the second half of the twentieth century, there was an increasing number of models and mathematical studies that were not only deterministic models, but some could also consider the stochastic effects [One of the models for obtaining demographic and epidemiological data is the SIR. The term of the SIR model is an acronym, where \u201cS\u201d stands for  effects ,16. The on force . Therefoon force .1 /\u03b3 + 1. If the pupils have been placed in isolation, the realized removal rate is greater than the natural recovery rate. Since this rate is in the denominator of the estimation equation, using the natural recovery rate positively skews our estimate because it is too large. For the 24 h isolation, we have \u03b3 = 1, which yields R0 = 1.094913 + 1 \u2248 2.09. For isolation in 12 h, we have an infectious period of \u03b3 \u22121 = 0.5, which implies \u03b3 = 2, yielding R0 = 1.094913/2 + 1 \u2248 1.55 [In Wuhan, during the lockdown, the infected reached their maximum about 35 days from the start, and the latest infection was observed 70 days from the start. In total, the population involved in this phase of the epidemic was about 80,000 people out of about 10,000,000. These 80,000 people were tracked and isolated in an extremely rigorous way, managing to extinguish the epidemic in just over 2 months after the start. Epidemiologically, the basic reproductive number provides the number of secondary cases that a single infectious individual produces in a population of all susceptible individuals. In fact, if the whole population is susceptible at the time of the arrival of the \u201cindex case\u201d, it means that it will find several of the susceptible equal to the carrying capacity, which is the ratio \u039b/\u03bc. Instead, the sum \u03b1 + \u03bc is the rate with which an individual \u201cleaves\u201d (it is no longer infected) the population of the infected and therefore the average time that each individual spends as infectious is 1/\u03b1 + \u03bc unit of time . The numrameters . Thus, trameters ,21. For 1 \u2248 1.55 .The prevention of future species leaps and the emergence of new pathologies, especially those of a zoonotic nature, requires, on one hand, the understanding in more detail of which mechanisms allow the virus to overcome the species barriers and adapt to a new host and, on the other hand, the identification and evaluation of the existing relationships between hosts that have a high potential to transmit new infections to other populations and hosts that show a high risk of acquiring new pathogens. Finally, an important distinction beyond the pandemic, which has a direct impact on the structure of the SIR mathematical model, is that between epidemic and endemic. As we know, an epidemic is an infectious disease that is extremely localized over time and its expansion is so rapid that the births and deaths of individuals are negligible. On the other hand, an endemic is an infectious disease that persists for a long time  and which, in its mathematical version, requires terms of birth and death. To make the analysis simpler, it was assumed that these new terms were in equilibrium to keep the total population \u201cN\u201d constant and that the offspring were all entered directly into the susceptible class \u201cS\u201d. Furthermore, the fewer the number of mutations required for the virus to achieve this goal, the greater the chances that this can occur  15,16,1,116,19.When the new coronavirus outbreak was recognized in China, one of the priorities was to estimate an important epidemiological parameter, which was the base reproduction number (R0). In the case of COVID-19, R0 shows that for each infection, 2\u20134 infections are directly generated, but the days of latency of infectivity vary from three to four. Thus, if we consider R = 4, the number of infectious cases will quadruple . This asThe rapid recognition of a microorganism such as this virus comes from collaborative research that uses high-tech laboratories with access to manifold techniques, from cell culture to electron microscopy and molecular microbiology. This demonstrates how a very well-organized effort may be able to respond to the threat of new infectious diseases that may arise in the 21st century ,13,30. EThe main resources for microbiology laboratories are antigen or antibody tests as well as pooling procedures or specimen collections. One of them is called immunoXpert \u2122, an ELISA-based test that accurately distinguishes between bacterial and viral infections and that measures the circulating levels of three host proteins that exhibit distinctive expression and complementary dynamics in host responses against bacterial and viral infections. These are as follows: (a) ligand-induced apoptosis related to tumor necrosis factor (TRAIL); (b) interferon-gamma inducible protein-10 (IP-10); and (c) C-reactive protein (PCR) . The avaThe throat swab searches for the progressive infection (as it searches for whether the virus is present in the airways at the time of examination), while the serological test searches for antibodies that the body has produced against the virus . Serologic tests may not be as reliable in very recent infections compared to swabs, but they are a tool that allows one to establish whether the body has developed the related antibodies against COVID 19 (it measures the immune system\u2019s response to infection) . There aDiagnostic tests are performed when a person has signs or symptoms of infection or when they are asymptomatic but have a recent history of known or suspected exposure. However, some diagnostic tests are licensed for use only in symptomatic individuals. In addition, a COVID-19 screening test searches for individual infections in a group  to make individual decisions based on the test results .Screening tests are different from diagnostic tests from a health benefit point of view. There are various social communities  that establish programs for authorized screening tests of asymptomatic individuals with no known or suspected exposure; various testing options are used in these communities. A licensed test is used to perform a screening that is highly sensitive and has fast response times. If the screening test does not have these characteristics, the use of a less sensitive authorized point-of-care test (such as antigen detection) should be considered ,44.It is important to note that tests, even in a series, are of limited value if appropriate measures such as quarantine for those who are positive, social distancing, and mask use\u2014even for those who are negative\u2014are not also implemented. Negative outcomes should also be considered \u201csupposedly negative\u201d by health professionals and should be studied in the context of clinical and epidemiological information as well as patient history. If there is doubt with a negative antigen test, the result of a different test may be as different as the highly sensitive authorized molecular one.Regardless of the test selected, it is important to monitor updates from national or international health control organizations such as the National Institutes of Health and Centers of Disease Control and Prevention (CDC), the FDA, and the WHO as well as the test developer for new information regarding the performance of the selected test with emerging virus mutations in the community ,45. It iBoth drug therapy and individual protective devices are needed to fight an infectious viral or bacterial pandemic. As in the current case of the COVID-19 pandemic, therapy cannot always prevent contagion. Current therapy for COVID-19 is based on dexamethasone, tocilizumab, remdesivir, and baricitinib in combination with remdesivir, anticoagulation drugs, three monoclonal antibody treatments (authorized by the FDA), and corticosteroids (such as dexamethasone) . Since tAccording to the WHO, globally, up to 17 August 2022, we had 589,680,368 confirmed cases, 6,436,519 deaths, reported to WHO, and up to 9 August 2022 a total of 12,355,390,461 vaccine doses were administered [An unprecedented worldwide effort to develop safe and effective COVID-19 vaccines began in January 2020 and rolling out in December 2020. The goal of facilitating fair and equitable access to COVID-19 vaccines gave birth to the institution of the COVAX Global Vaccine Facility co-led by the WHO, Gavi, and the Coalition for Epidemic Preparedness Innovations, in collaboration with UNICEF and others. In addition, the Strategic Advisory Group of Experts on Immunization (SAGE) approved by the WHO gave recommendations for any COVID-19 vaccine .The involvement of the pharmaceutical\u2013diagnostic industry is clearly desirable and necessary, but the problems that may arise from \u201cexclusive copyright\u201d must not create obstacles in the pursuit of scientific development . AccordiFinally, an experimental model found that the highest risk of establishment of resistant strains occurs when a large fraction of the population has already been vaccinated but transmission is not controlled ,65.Currently, the goal of the COVID-19 vaccination campaign around the world continues to be essential because it reduces hospitalizations, complications, and deaths while protecting health systems, so vaccination has continued with three booster doses, even extending from the age of 5 years old . AccordiLike all other vaccines, COVID-19 vaccines can have mild and short-term side effects. These can include fever, fatigue, headache, body aches, chills, diarrhea, and pain at the site of inoculation. However, rather serious  or possibly long-lasting side effects are possible, but are exceedingly rare . Based oAccording to the CDCs, vaccination for COVID-19 is recommended for pregnant women or those trying to get pregnant now or who may become pregnant in the future and while breastfeeding. Pregnant women can also be given the booster dose ,64.Furthermore, the evidence on the safety and efficacy of vaccination during pregnancy is increasing. The WHO, on 2 June 2021, recommended vaccination in pregnant women when the benefits of vaccination for the pregnant woman under potential risks . Furthermore, the WHO recommends vaccination in lactating women as in other adults. However, scientific authorities such as the CDC, the WHO, and regulatory authorities monitor the use of vaccines for COVID-19 to identify any problems regarding their safety that could arise to ensure their safe use throughout the global population .Finally, it must be mentioned that the adaptive natural immune response is very important for defense, and thus for patient outcome after SARS-CoV-2 infection and supports the efficacy of the vaccine. The T-cell responses develop early and are related to protection. The T-cell memory includes extensive recognition of viral proteins, estimated at approximately 30 epitopes within everyone . However, this natural immune memory could limit individual viral mutations and is likely to support protection against severe disease from COVID 19 viral variants (such as Omicron) ,72. HencIn a retrospective observational study involving 124,500 persons, they were divided into two groups and compared to each other. The first was with SARS-CoV-2 na\u00efve individuals who received a two-dose regimen of the BioNTech/Pfizer mRNA BNT162b2 vaccine, and the second was previously infected individuals who were never vaccinated, acquired immunity of the infected, but unvaccinated people, confers stronger protection against infection with the Delta variant of SARS-CoV-2 than the two-dose vaccine-induced immunity of BioNTech/Pfizer mRNA BNT162b2 . AdditioThe evolution of microorganisms  is a consequence of genotypic modification. This process occurs when there is less genomic complexity, as shown in the evidence. For this reason, in the case of viruses, and given the reduced number of genes they possess, they have the fastest evolution; this is the main success factor that allows them to adapt and survive. Among the viruses, RNA viruses show extreme variability and are responsible for pandemics, as has been noted in recent years. Coronaviruses, therefore, show a considerable propensity to transmit themselves to new hosts. Thus, there are several challenges facing the field of microbiology in the future including those posed by SARS-CoV-2. It has been noted that a key challenge is between prevention and rapid recognition, not only of the agent, but also of its virulence. One of the main problems is how we might conduct the effective surveillance of variants and how these variants might affect virus transmissibility, diagnostics, therapy, vaccine efficacy, and effective antivirals as well as how effective reinfection surveillance might be conducted in relation to SARS-CoV-2. Although it is not easy to predict exactly how infectiousness, pathogenicity, and the possibility of the virus \u201cescaping\u201d from the immune system might play out over time, we can predict what factors could influence these trends. One parameter is the immunity that has already built up the population that reduces the possibility of transmission and limits the development of new mutations.Finally, in the context of a pandemic and the continuous spread of an infectious agent, there must be an increase in the capacity for control at an international level and the collection of evidence on the elimination of the virus and its infectivity, it is necessary to update the present guidelines aimed at that infectious agent to put an end to the total isolation of communities or groups or individuals. Guidelines must then reflect on the information available at the time of publication and may change depending on the current epidemiological and scientific data of the pandemic. An early recognition by the health institutions in the possible pandemic zone, and relying on an R0, redeems the response faster. The exact duration of infectivity of patients must be known with certainty. For example, the greatest risk of transmission occurs in the period close to the onset of symptoms and may be initially detected in secretions such as those of the upper respiratory tract, possibly earlier than the appearance of symptoms. In our era, travel between cities and continents is easier than in the past, and this makes it necessary to control travelers first. Therefore, the crucial points of the management of a pandemic can be summarized as follows: (a) epidemiological surveillance measures and procedures by means of case definition, diagnostic confirmation procedures, tracing of contacts, telemedicine and psychological support; (b) management attention of some subgroups with special needs ; (c) prevention and containment measures  for health workers); (d) collaboration between the international public health strategies  with the various National Institutions; and (e) must remember the importance of correct communication between the institutions, health workers, and population.We believe that our current pandemic has taught us that we are too close in our remoteness."}
+{"text": "Emerging evidence indicates that the use of low-load resistance training in combination with blood flow restriction (LL-BFR) can be an effective method to elicit increases in muscle size, with most research showing similar whole muscle development of the extremities compared to high-load (HL) training. It is conceivable that properties unique to LL-BFR such as greater ischemia, reperfusion, and metabolite accumulation may enhance the stress on type I fibers during training compared to the use of LLs without occlusion. Accordingly, the purpose of this paper was to systematically review the relevant literature on the fiber-type-specific response to LL-BFR and provide insights into future directions for research. A total of 11 studies met inclusion criteria. Results of the review suggest that the magnitude of type I fiber hypertrophy is at least as great, and sometimes greater, than type II hypertrophy when performing LL-BFR. This finding is in contrast to HL training, where the magnitude of type II fiber hypertrophy tends to be substantially greater than that of type I myofibers. However, limited data directly compare training with LL-BFR to nonoccluded LL or HL conditions, thus precluding the ability to draw strong inferences as to whether the absolute magnitude of type I hypertrophy is indeed greater in LL-BFR vs. traditional HL training. Moreover, it remains unclear as to whether combining LL-BFR with traditional HL training may enhance whole muscle hypertrophy via greater increases in type I myofiber cross-sectional area. Both type I  and type II  fibers can increase in size when subjected to a sufficient stimulus such as resistance training. Although evidence indicates that the hypertrophic capacity of type II fibers is substantially greater than that of type I fibers , it is pThe seminal work of Henneman et al.  demonstrBased on the size principle, some researchers have surmised that HL training is required to recruit the highest threshold motor units . HoweverAlthough fiber recruitment is obligatory for eliciting increases in muscle size, the duration of the stimulus may also be of importance to anabolism . In thisThe potential to target type I fibers has important implications for sport. For example, achieving greater increases in type I fibers would further the ability of bodybuilders to maximize whole muscle hypertrophy, which is a basis upon which these athletes are judged. Moreover, athletes participating in sports that involve muscular endurance would seemingly benefit from a greater myofibrillar content in fatigue-resistant fibers. However, although some evidence does suggest a preferential hypertrophic effect on type I fibers with LL training , researcEmerging evidence indicates that the use of LL training in combination with blood flow restriction (LL-BFR) can be an effective method to elicit increases in muscle size, with most research showing similar whole muscle growth of the extremities compared to HL training . It is chttps://osf.io/5eapg). To locate relevant studies, we searched PubMed/MEDLINE, Scopus, and Web of Science databases from inception to February 2023. Two researchers (RB and AP) screened the retrieved abstracts and reviewed the full texts for studies that conceivably met inclusion criteria. Inclusion required agreement between both researchers; in cases where a disagreement arose, a third researcher (B.J.S.) resolved the dispute.The methods for this review were preregistered prior to data collection on the Open Science Framework website (The search syntax was performed using the following combination of terms: (\u201cblood flow restriction\u201d OR BFR OR kaatsu OR \u201cblood flow restricted\u201d) AND (\u201ctype I\u201d OR \u201cmuscle fiber\u201d OR \u201cmuscle fibre\u201d OR \u201cfiber-type\u201d OR \u201cfibre-type\u201d OR \u201cfiber type\u201d OR \u201cfibre type\u201d OR \u201cmyofiber\u201d OR \u201cmyofibre\u201d). In addition, we performed secondary searches by scrutinizing the reference list of each read full text as well as examining the papers that cited the included studies via Google Scholar. The methods followed guidelines set forth by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) . Figure We included studies that (1) investigated the longitudinal effects LL-BFR  on fiber-type-specific hypertrophy where at least one group performed resistance exercise using LL-BFR for at least 2 weeks; (2) involved combined concentric and eccentric actions; (3) included adults (18+ years of age) as participants; (4) were published in English-language peer-reviewed journals; (5) reported pre\u2013post study changes in fiber-type-specific hypertrophy employing an objective measure of assessment.Studies were excluded if (1) participants had pre-existing musculoskeletal disorders, cardiovascular disease, or any other condition that could be considered detrimental to resistance training performance; (2) they comprised a case report; (3) they only collected acute data; (4) they involved continuous aerobic-type exercise (defined herein as noninterrupted steady-state exercise lasting more than 15 min); (4) participants were provided with supplements intended to enhance muscle building; (5) there were insufficient numerical or graphical data to calculate relative changes.https://apps.automeris.io/wpd/). Any discrepancies in the extracted data were resolved through discussion and mutual consensus of the researchers. If consensus could not be reached, a third researcher (B.J.S.) resolved the dispute.Data were extracted from the respective studies and coded in an Excel spreadsheet  by two authors (R.B. and A.P.) using the following classifications: (1) study characteristics ; (2) participant demographics ; (3) study methods ; and (4) pre- and post-training means and standard deviations. In cases where studies lack sufficient information regarding pre\u2013post changes, we contacted the authors to request the missing data. If we were unable to acquire data from authors, we extracted values from figures using WebPlotDigitizer online software where applicable  and effect size (ES) scores for fiber-type-specific hypertrophy for each study. Values for determining \u0394% for a given outcome in a given condition were calculated as follows: ([post-training mean/pretraining mean \u00d7 100] \u2212 100). Values for determining the ES for a given outcome in a given condition were calculated as follows: ([post-training mean \u2212 pretraining mean]/[pooled pretraining standard deviation]) . When coAs previously described , we asseA total of 11 interventions met inclusion criteria see . Seven sTwo studies employed a one-group pre-/post-test design that investigated fiber-type-specific hypertrophy only in an LL-BFR training condition. Jakobsgaard et al.  submitteOne study compared LL-BFR training to a nontraining control using a randomized, parallel group design . The LL-Three studies directly compared fiber-type-specific hypertrophy between LL and LL-BFR. Yasuda et al.  allocater = 0.81). More recently, Hansen et al. [Two studies compared HL training to a program involving a combination of LL-BFR and HL training. Bj\u00f8rnsen et al.  randomizn et al.  randomizn et al. , only thTwo studies investigated the fiber-type-specific response between LL-BFR and traditional HL training. Davids et al.  randomizQualitative assessment of the studies via the Downs and Black checklist indicated a median score of 22 (range: 13 to 24 points). Nine studies were deemed to be of good quality ,28,29,30Researchers have speculated that LL-BFR may provide a greater hypertrophic stimulus to type I myofibers compared to traditional HL training ,32. IndeWhile the acute data provide a logical rationale for preferential type I hypertrophy with LL-BFR training, results of longitudinal research on the topic reviewed herein are somewhat equivocal. Studies that employed a single-group pre\u2013post study design or generally showed that LL-BFR elicited greater type I vs. type II hypertrophy ,28. AlteIt has been theorized that nonoccluded LL training may target type I myofiber hypertrophy. Studies directly comparing LL-BFR to LL training without occlusion provide mixed results in regard to preferential increases in type I fCSA. Yasuda et al.  showed tStudies directly comparing fiber-type-specific hypertrophy between LL-BFR and traditional HL training are contradictory. Davids et al.  found grIf LL-BFR does indeed promote preferential type I hypertrophy, then conceivably it could be beneficial to integrate the strategy into conventional RT programming. However, current evidence is conflicting on the topic. Bjornsen et al.  found anAlthough LL-BFR represents an intriguing strategy to preferentially target hypertrophy of type I myofibers, limitations of the current research preclude the ability to draw strong inferences on the topic. First, the designs of studies directly comparing type I fiber hypertrophy in LL-BFR are heterogenous. As noted above, some studies investigated the fiber-type-specific effects of LL-BFR in isolation, others compared LL-BFR to LL or HL training without occlusion, and yet others assessed the combination of LL-BFR and HL training. While the sum total of results from these studies provides a basis for triangulation of data, additional research is needed to directly compare fCSA adaptations in LL-BFR vs. HL training protocols. Moreover, the inherent heterogeneity of study designs precluded our ability to carry out a meta-analysis of findings and, consequently, to quantify the magnitude of effects on outcomes.Second, all studies on the topic to date have assessed fiber type adaptations in the vastus lateralis. Results therefore cannot necessarily be extrapolated to other skeletal muscles. For example, given differences in the use of the upper body vs. lower body muscles in activities of daily living, it is possible that myofibers in these bodily regions may respond differentially to LL-BFR. Moreover, the fiber type composition of a given muscle might play a role in the adaptative response to LL-BFR, whereby muscles with higher percentages of a given fiber type could show divergent results . These hypotheses warrant further exploration.Third, commonly used methods to assess fiber-type-specific hypertrophy have questionable accuracy and can be influenced by various factors including the depth of biopsy sampling, fiber count of the acquired sample, and number of obtained biopsies . HorwathFourth, studies to date have used relatively short durations, some lasting as few as 2 weeks, with a maximum length of 9 weeks. This raises the question as to whether the short-term beneficial effects achieved in some studies would manifest across longer time periods. Moreover, might LL-BFR be a strategy that can be intermittently implemented over the course of a training mesocycle to enhance muscular adaptations? These questions warrant further investigation.Finally, current research has almost exclusively involved younger participants. Research indicates that the age-related loss of muscle tends to be most specific to type II fibers . Given tThe current body of literature suggests that the magnitude of type I fiber hypertrophy is at least as great as, and sometimes greater than, type II hypertrophy when performing LL-BFR. This finding is in contrast to HL training, where the magnitude of type II fiber hypertrophy tends to be substantially greater than that of type I myofibers . The effDespite the intriguing preliminary evidence for preferential type I fiber development, limited data directly compare training with LL-BFR to nonoccluded LL or HL, thus precluding the ability to draw strong inferences regarding whether the absolute magnitude of type I hypertrophy is indeed greater in LL-BFR vs. traditional HL training. Moreover, it remains unclear as to whether combining LL-BFR with traditional HL training may enhance whole muscle hypertrophy via greater increases in type I fCSA. Further research is needed to improve our understanding of the topic and its potential practical implications for exercise program design."}
+{"text": "Addressing poverty through taxation or welfare policies is likely important for public mental health; however, few studies assess poverty\u2019s effects using causal epidemiology. We estimated the effect of poverty on mental health.n\u2009=\u200945\u200a497/observations\u2009=\u2009202\u200a207 following multiple imputation). We defined poverty as a household equivalized income <60% median, and the outcome likely common mental disorder (CMD) as a General Health Questionnaire-12 score \u22654. We used double-robust marginal structural modelling with inverse probability of treatment weights to generate absolute and relative effects. Supplementary analyses separated transitions into/out of poverty, and stratified by gender, education, and age. We quantified potential impact through population attributable fractions (PAFs) with bootstrapped standard errors.We used data on working-age adults (25\u201364\u2009years) from nine waves of the UK Household Longitudinal Survey  reporting poverty. The absolute effect of poverty on CMD prevalence was 2.15% ; prevalence in those unexposed was 20.59% , and the odds ratio was 1.17 . There was a larger absolute effect for transitions into poverty [2.46% ] than transitions out of poverty [\u20131.49% ]. Effects were also slightly larger in women than men [2.34%  versus 1.73% ]. The PAF for moving into poverty was 6.34% .PAFs derived from our causal estimates suggest moves into poverty account for just over 6% of the burden of CMD in the UK working-age population, with larger effects in women. Key MessagesMoving below the poverty line increases prevalence of common mental health problems in UK working-age adults by 2.5%, with an odds ratio of 1.21.New poverty explains 6.3% of the current burden of poor mental health in the UK, if these estimates are unbiased.The detrimental impacts of transitions into poverty are larger than the positive effects of moves out of poverty.The mental health of women is potentially more sensitive to poverty.,,Income levels are widely thought to be a key determinant of mental health and wellbeing, and in particular a key driver of mental health inequalities.However, there are methodological challenges in overcoming issues of bias and confounding when considering the income-health relationship, particularly the possibility of reverse causation due to health selection .,,Some studies have attempted to reduce potential bias by excluding those with pre-existing mental health problems to address reverse causation, or by using approaches such as fixed-effects regression which account for time-invariant confounding factors .Methods which explicitly incorporate potential causal pathways may be more appropriate to investigate a relationship of this complexity in observational data.We used data from nine waves of the UK Household Longitudinal Study , which includes around 40\u200a000 households randomly sampled from the community-dwelling population from 2009 to 2019.Data on monthly and annual household income and its source (i.e. unearned versus earned income) were collected in all UKHLS waves. We generated a binary variable indicating whether individuals were living in a household which was above or below the poverty line at each time point, defined as household equivalized income <60% of that year\u2019s median after housing costs. Our use of the after-housing costs measure provided the closest estimate possible to the true total disposable income and resources available to households once they had paid their necessary non-discretionary costs, and is in keeping with the approach taken by the UK Social Metrics Commission.Prevalence of mental health problems was assessed using the General Health Questionnaire-12 (GHQ-12), a validated screening tool for mental health problems used widely in epidemiological research.We prepared a directed acyclic graph (DAG) based on existing literature to highlight our assumptions regarding the causal relationship between variables of interest, and to inform our statistical approach. In the DAG presented , each tiWe examined the association between poverty and CMD within each sweep, after adjusting for both exposure and outcome in the previous sweep of data. We are therefore estimating the short-term impacts of poverty status on CMD, conditional only on the preceding year\u2019s exposure status (rather than the effect of persistent poverty over time). We identified the minimally sufficient adjustment set for this short-term poverty effect at a time point (t) as being: all time-invariant confounders; all time-varying confounders at t-1; employment status at time t (see below); and mental health at t-1. We also adjusted for sweep number to ensure that we accounted for any time trend in the exposure.Baseline confounders were self-reported gender , ethnicity (White/non-White), and highest educational attainment .Several important time-varying confounders were identified a priori: paid employment (yes/no); housing tenure (owner/renter); receipt of welfare benefits (yes/no); marital status (single/coupled); number of children aged <16\u2009years in the household; physical health [from the short-form survey (SF-12) physical component score (PCS)];As shown in the DAG, time-varying confounders were included as lagged terms (i.e. at t-1), to ensure that they preceded the exposure, with one exception. Employment status was adjusted for at both time t and time t-1, since we hypothesized that changes in income resulting from employment would be more immediate than any effects of income on employment, and we also wished to account for employment trajectory from the previous to the current wave.To ensure analyses adequately corrected for the influence of past exposure and outcome status , 1-year With all causal observational analyses there is potential for unmeasured or residual confounding to influence results, either from variables which are entirely unobserved or from variables which cannot be fully accounted for using the data available. In our case, potential sources of residual confounding would include historical disadvantage (e.g. adverse childhood experiences), changes in wealth or income security over time, and more nuanced measures of race/ethnicity.We considered three potentially important effect modifiers: gender, educational attainment, and age [dichotomized into younger (25\u201340\u2009years) and older (41\u201364\u2009years) working-age].To achieve our stated aim of determining the causal effect of poverty on mental health, the target causal parameter for our analysis was the causal risk difference:where Y is the outcome (CMD), and A is the exposure (poverty). Essentially, this represents the difference in the probability of CMD between those who were and were not experiencing poverty, if all else were equal. As a result, our required statistical estimand for analysis was:where W represents the set of measured confounding variables observed in our data. We used a double-robust approach, adjusting for baseline and time-varying confounding using inverse probability of treatment weights (IPTWs) and also adjusting for baseline and time-varying confounders in the outcome model.We aimed to address the positivity assumption of causal inference  were dropped. Income was logged prior to imputation to address non-normality, and interaction terms between income and the three effect modifiers were included in the imputation.IJE online) details the regression models used to impute each included variable.Gender, age, wave, and number of children were used as imputation variables; due to issues achieving model convergence, missing observations for region  between exposed and unexposed individuals were compared for all confounding variables before and after application of the weights, with residual SMD <0.2 reflecting reasonable balance and SMD <0.1 a negligible statistical difference.We ran additional models stratified by the three potential effect modifiers, recalculating IPTWs on the restricted sample following the approach outlined above. To test whether there was any differential effect magnitude for moves into poverty rather than out of poverty, we ran a separate analysis where the exposure variable was a transition into poverty since the previous wave of data collection, with the reference group restricted to include only those at risk of the outcome . The corresponding test for transitions out of poverty was also performed.For comparative purposes, we conducted a conditional fixed-effects logit regression with and without inclusion of the same lagged time-varying confounders, using post-estimation commands to generate the absolute difference in predicted probabilities. We also conducted a complete case analysis.As we imputed missing data, our primary analyses did not incorporate the longitudinal survey weights for attrition/non-response provided by UKHLS (which restrict the sample to those present in every wave of data collection). However, as an additional sensitivity analysis we conducted the same analysis on this restricted sample with and without incorporation of the survey weights into our IPTWs.Stata MP 16.1 was used for all analyses. Graphs were generated in R using ggplot2 and in Excel.n\u2009=\u200932\u200a138; observations\u2009=\u2009132\u200a962) had complete data . The characteristics of the observed and imputed samples are displayed in IJE online). In comparison with complete cases, the imputed sample included slightly more males, non-White individuals, and those from lower socioeconomic backgrounds. Prevalence of both the exposure and outcome were higher in the imputed sample: for poverty 22.40% versus 19.52%; for presence of likely CMD 19.85% versus 18.94%.The final analytical sample consisted of 45\u200a497 individuals across 202\u200a297 observations; of these, 70.6% (IJE online). Following application of IPTWs, good balance of confounders was achieved, with all SMDs \u22640.06 in the primary analysis. Good balance was also achieved in all stratified and sensitivity analyses, although for the analysis considering moves into poverty, the post-weighting SMD for previous employment status was slightly greater than what would be considered \u2018negligible\u2019, at 0.13  1.45, 2.84; %-point change] in the main analysis , indicatPoverty had a detrimental impact on CMD across all groups . AbsolutIJE online), the MSM effect size was close to the adjusted fixed-effects estimates in most analyses, though occasionally it fell between this and the unadjusted fixed-effects estimates. The confidence intervals around the MSM estimates were more precise than those generated by the fixed-effects models. Effect sizes were higher in complete case analyses compared with results from the imputed sample for all modelling approaches (IJE online), but the differences for the MSM analysis were particularly small compared with other estimation methods [2.29%  in complete cases versus 2.15%  in the imputation sample]. In the restricted sample of UKHLS who participated in all nine survey waves and have longitudinal weights provided (IJE online), MSM results were again fairly similar to those from the complete case and imputed sample analyses [2.52%  without incorporating these weights into IPTWs and 2.61%  incorporating them]. Estimates from fixed-effect models were less consistent across the different samples , and that the negative effect of moving below the poverty line is larger than the mental health improvement from moving out of poverty [2.46%  versus -1.49% ]. Interpreting our estimates causally suggests that moves into poverty cause 6.34% of the current burden of poor mental health in the UK population . Larger effects were seen for women than men, and possibly for those with lower educational attainment. In our sensitivity analyses, double-robust marginal structural modelling seemed to provide more consistent estimates across different samples compared with fixed-effects regression, with more precision.et al. which focused specifically on randomized trials of anti-poverty interventions and reported a meta-analysed effect size of SMD 0.09 (odds ratio 1.18),,Our finding of an average treatment effect for poverty of around 2%, with an odds ratio of 1.2, is in keeping with existing literature on income and mental health. Our recent systematic review and meta-analysis found that income changes which moved individuals across a poverty line had an average effect of SMD 0.13 .The presence of an asymmetrical relationship where \u2018[income] losses loom harder than gains\u2019 when considering one\u2019s future wellbeing is a well-established phenomenon within economics, known as loss aversion.,,The finding of a larger effect of poverty on women than men is in keeping with findings in some other contexts/settings,There is considerable literature on the relative benefits and disadvantages of different philosophical and statistical approaches to estimating causal effects.Finally, the cost of poor mental health to UK employers is estimated to be between \u00a342bn and \u00a345bn per year in early 2020,Our study has several important strengths. We used nine waves of longitudinal data from a UK-representative cohort to generate a large sample followed over a decade, and used multiple imputation to reduce the impact of attrition and item missingness on our findings. We pre-specified key confounders in a DAG to make clear our assumptions regarding the causal relationships of interest. We took a causally informed approach to statistical analysis based on this DAG, and included confounders in both exposure and outcome regression models (known as \u2018double-robust\u2019). We also report multiple sensitivity analyses to consider bias in our chosen methods and provide comparisons with more traditional approaches to analysis.However, our study does have some limitations. Causal interpretation of our estimates requires an assumption of no unmeasured or residual confounding, and although we have included indicators for all proposed confounders as far as the data allow, there may be some which are not fully represented by our set of measured variables and others which we had not identified. The presence of unmeasured or residual confounding such as this could lead to bias of unclear direction, which could substantially affect the results. Confidence intervals are wide in our stratified models, reducing the ability to draw definitive conclusions on effect modification. The use of a binary exposure assumes that any experience of poverty exerts a similar effect, which is likely to be an over-simplification of the nuanced experiences of those living with different levels and contexts of income poverty. We also note that we have chosen to focus on the short-term or instantaneous effects of poverty on mental health; this is certainly of policy interest, but it does not allow us to incorporate the complexity of prolonged exposure to poverty over time, or any effect of repeated or historical poverty exposures, which would be of interest to explore in future research. We also elected to include only employment status as a confounding variable in the concurrent sweep of data collection (due to the immediacy of its effect on poverty status) rather than any other time-varying confounders such as marital status, as we felt their inclusion risked over-adjustment or conditioning on a mediator; however, we appreciate that this is an assumption, and that different approaches could be taken. Due to small numbers, ethnicity, housing tenure, and marital status were dichotomized during imputation, introducing measurement error and, potentially, residual confounding. This is a particular concern for the ethnicity variable, where some nuance is likely to have been eliminated by collapsing the categories. We also required the exclusion of observations with large amounts of missing data to achieve model convergence during imputation, though our sensitivity analysis suggests this did not affect the representativeness of the imputed sample.Our findings add to the evidence base suggesting that poverty does have an effect on mental health, overcoming methodological criticisms posed by those who have argued that no effect exists. In fact, our PAFs suggest that if poverty were eradicated, the prevalence of common mental health problems in the UK population would be 6.3% lower. This suggests that policy makers should design income and welfare policies that protect working-age individuals from falling into poverty, especially given that any deleterious effects of this on mental health may not be entirely reversed by lifting someone back out of poverty in the future. Particularly close policy attention may be needed for women, and potentially those with least education. In addition, these causal estimates may be of practical use in policy or economic modelling to more accurately predict the impact of planned policy changes on mental health.Replication of our methods in other populations would be useful to determine the degree to which causal relationships between income and mental health may differ between settings and contexts, and to explore the effects of longer-term exposure to poverty. Given the consistency of our findings across samples in comparison with traditional regression, we believe our methods could also be usefully applied and extended to consider other social determinants of mental health with similarly complex causal structures.Our analysis suggests poverty is currently responsible for around \u223c6% of the burden of poor mental health in the UK working-age population, at considerable economic cost. Policy makers must consider the economic and health consequences of not protecting adults from falling below the poverty line, particularly women and those with least education.The University of Essex Ethics Committee has approved all data collection on the Understanding Society main study and innovation panel waves, including asking consent for all data linkages except to health records. Requesting consent for health record linkage was approved at Wave 1 by the National Research Ethics Service (NRES) Oxfordshire REC A (08/H0604/124), at BHPS Wave 18 by the NRES Royal Free Hospital & Medical School (08/H0720/60) and at Wave 4 by NRES Southampton REC A (11/SC/0274). Approval for the collection of biosocial data by trained nurses in Waves 2 and 3 of the main survey was obtained from the National Research Ethics Service . No further approval was required for the current analysis of the existing data.dyac226_Supplementary_DataClick here for additional data file."}
+{"text": "Insights in heart surgery: 2022Editorial on the Research Topic Cardiac surgery continues to evolve over the years beyond current challenges, technologies, and \u201ctraditional\u201d outcomes. This collection of articles \u201cInsights into cardiac surgery\u201d aims to highlight the latest advances in the field of cardiac surgery achieved during 2022.Surgical approaches in cardiac surgery experienced a tremendous evolution in the last two decades. A lot of changes happened since the first operation performed by Goldwin et al. in 1958 , secondary chordae, and splitting of PM], showed excellent results including freedom from repeat intervention of 96% and significant symptomatic relief with NYHA and left ventricular obstruction reduction during midterm follow-up as well as a reduction in terms of mitral valve regurgitation incidence and septal thickness.Different approaches have been previously described to treat HOCM . Raffa eChang et al. suggested in case of pathological features of dissection, a sinus replacement technique using a patch trimmed to a scallop shape similar to Valsalva sinus, aiming to decrease severe aortic root bleeding. However, a cornerstone like the Bentall procedure created a race on describing the benefits of the modified technique in large clinical studies  is still controversial. Certainly, the advancement of transcatheter procedures (TAVR) with valve-in-valve aortic replacement and even the stentless valve prostheses, should be considered in the need of a reintervention , underlined that the use of biological aortic prostheses has increased significantly in recent years in all age groups while mechanical valves are still higher in patients requiring dialysis. Although SAVR is an effective treatment with very low in-hospital mortality, in the last years, SAVR's rate is reducing especially in patients with high risk, octogenarians, and those requiring redo surgery due to the advent of TAVR.On the other hand, among aortic root repair strategies,  studies \u20135. In thrvention  such as Pasierski et al. highlight the importance of complete revascularization even in patients with pre-existing AF showing improved long-term survival and a lower rate of reinterventions. The advent of new technologies for CABG has been shown to be a benefit in improving the outcomes and increasing the heterogeneity of the patients. In this context, grafts\u2019 availability is undoubtedly the first component needed to perform a CABG. In case of the lack of suitable autologous bypass material, Fusco et al. describe tissue-engineered vascular grafts (20\u2005cm in length with an inner diameter of 3\u2005mm) tested in animal models that showed good patency after 4 weeks.Despite the spread-out of percutaneous coronary revascularization (PCI) CABG remains the most common cardiac surgery procedure worldwide and the best option for multivessel disease to achieve complete revascularization. Szalkiewicz et al. compare the use of saline with autologous blood vs. a preventive solution formulated with an endothelial damage inhibitor. The use of the second solution in the saphenous vein storage and testing during distal anastomosis has been described to be associated with lower levels of troponin after the procedure demonstrating superiority in preserving tissue functionality.Achieved the best available grafts, even their storage during the procedure, become crucial. Hasimbegovic et al. set the tone and paved the pathway to the adjustment of pre-procedural secondary prevention and optimization of medical therapy in patients undergoing TVS. Their \u201creal world\u201d study evidenced how patients with a high estimated plasma volume status (ePVS) have a significant impact on long-term outcomes after TVS. In this context, the author reported that the ePVS and Duarte's PVC were significantly lower in survivors. Risk predictors for long-term prognosis also included ePVS and gamma-glutamyltransferase levels.Beyond the surgical technique, in the current clinical practice, periprocedural risk predictors and optimization of medical therapy become fundamental before surgery to achieve a good outcome and to offer a tailored patient approach . For exaNow more than ever, cardiovascular surgery feels the need to set a balance between adequate pre-operative patient medical optimization, the correct surgical procedure based on individual patient profiles, and the desire of treating complex conditions pushing forward the boundaries of the achievable. All of the articles in this Collection inspire, inform, and provide guidance and direction to researchers in the field, and could help us understand where cardiac surgery is going.In conclusion, even if technology progresses by leaps and bounds significantly influencing surgical techniques and results, we must keep in mind that clinical success can be achieved only by multidisciplinary teamwork that adapts the chosen surgical strategy to the specific clinical profile of the individual patient."}
+{"text": "This cross-sectional study examines whether proposed myelin oligodendrocyte glycoprotein antibody\u2013associated disease (MOGAD) diagnostic criteria can exclude other diseases, such as multiple sclerosis, and rely on results of cell-based assays. We investigated the reliability of the MOGAD diagnostic criteria to address these 2 challenges.With recognition of myelin oligodendrocyte glycoprotein (MOG) antibody\u2013associated disease (MOGAD) as a distinct entity and wider availability of MOG-IgG testing, clinicians are frequently confronted with the challenge of diagnosing MOGAD.3 Institutional review boards of participating centers approved this cross-sectional study. All patients provided written informed consent. We followed the STROBE reporting guideline.We analyzed data from a multicenter study of patients with suspected or confirmed demyelinating diseases.4 with positive MOG-IgG results in a live cell-based assay (CBA) were included and independently rated by 2 neurologists  for final diagnosis (MOGAD2 or MS4). For challenge 2, patients with at least 1 core clinical demyelinating event suggestive of MOGAD2 and 2 independent MOG-IgG results in a live CBA and a fixed CBA were included , interassay, and intercenter diagnosic concordance rates were calculated . Challenge 1 group included 28 patients with positive MOG-IgG results, of whom 21  received MS diagnosis, 2  MOGAD diagnosis, and 5  discordant diagnoses. Twenty-seven patients (96%) presented records of core demyelinating events that were compatible with MOGAD. All 28 patients fulfilled imaging criteria for the MS diagnosis, 21 of whom (75%) also presented at least 1 supporting magnetic resonance imaging (MRI) feature compatible with MOGAD diagnosis. All 5 patients with discordant diagnoses presented positive cerebrospinal fluid (CSF)\u2013specific oligoclonal bands, which were usually associated with myelitis (4 [80%]), and supportive imaging features for MOGAD . The intChallenge 2 group included 134 patients, of whom 108  exhibited concordant MOG-IgG results. Among 26 patients with divergent results, 17 (65%) had low-positive results in either CBA. A 90% (121 of 134) diagnostic agreement rate was observed when applying the proposed criteria to each center\u2019s MOG-IgG results .Findings revealed that the proposed diagnostic criteria in some cases may not accurately distinguish MOGAD from MS, contributing to diagnostic inconsistencies across centers. MOG-IgG testing and consideration of MOGAD diagnosis are recommended only in the absence of better alternative causes, such as MS. While this recommendation prevents unwarranted MOG-IgG testing, with potential false-positive results, the precondition cannot always be met because patients often present with overlapping clinical and imaging features. Consideration of additional laboratory, advanced MRI, or optical coherence tomography features may be needed in establishing accurate diagnoses.2 additional strategies are necessary to mitigate the risk of false-positive or false-negative results. Standardized testing remains unavailable worldwide, but repeated testing of sera with alternative assays or CSF testing in cases of seronegative results may increase diagnostic certainty in patients with high disease suspicion. A study limitation was its retrospective and cross-sectional design.Inconsistent replicability of MOG-IgG detection across assays and decreased reproducibility of low-positive results pose additional challenges. Although the panel aimed to increase comparability by categorizing antibody results as clear-positive or low-positive,The proposed criteria mark a breakthrough toward improved MOGAD diagnosis. However, additional research and validation are needed to establish standardized assays and develop novel biomarkers to refine these criteria."}
+{"text": "Children and adults with MOGAD present with diverse clinical phenotypes such as monophasic or recurrent presentations of acute disseminated encephalomyelitis (ADEM), optic neuritis, or transverse myelitis, and less commonly with cerebral cortical encephalitis, brainstem\u2013or sole cerebellar presentations. For diagnostic and in particular for prognostic purposes, we recommend that the measurement of MOG-IgG titres should be done routinely both, at onset and follow-up for the following reasons:During the last years, myelin oligodendrocyte glycoprotein (MOG) IgG antibody associated disorders (MOGAD), a newly defined entity of acquired demyelinating syndromes, has been recognized as separate disease entity with recently published diagnostic guidelines. Both, a clear or low positive MOG-IgG serostatus is defined by quantitative results such as titres or flow cytometry binding ratios. Whereas clear positive MOG-IgG titres are strongly associated with the clinical features proposed for MOGAD  and at the same time distinguish them from clinical features characteristic of AQP4-IgG-seropositive neuromyelitis optica spectrum disorder (NMOSD) or multiple sclerosis (MS). In contrast, low titres of MOG-IgG are less specific and are also seen in a small proportion of patients with MS, other neurological diseases, and healthy individuals.25 The diagnosis of MOGAD can therefore be made based on key clinical features alone if the MOG-IgG result is clearly positive, whereas in the case of a low positive MOG-IgG result additional supporting clinical or magnetic resonance imaging (MRI) features are required. Moreover, recent international multicentre MOG-IgG assay comparison experiments clearly demonstrated that only high titre MOG-IgG results, but not low-titre MOG-IgG results, are comparable and reproducible among individual diagnostic centres.6 Thus, both the positive predictive value and the reproducibility of MOG-IgG results depends on quantitative values which clearly demands for the routine measurement of titres.In the recently proposed diagnostic criteria we have distinguished clear positive and low positive MOG-IgG results measured by fixed or live cell-based assays (CBA) for the diagnosis of MOGAD. At present it is not possible to predict who will have a relapsing disease course overtime. Neither MOGAD subtype, MRI features or clinical severity are helpful for predicting the future disease course. Likewise, onset serum MOG-IgG titres, despite being important for the diagnosis of MOGAD, do not predict recovery or relapse.7 In most patients MOG-IgG titres decline with time, but may also remain positive in other patients for years. Several studies found that persistent MOG-IgG seropositivity is associated with an increased likelihood of having a relapse by a factor of 2\u201310710 particularly when the MOG-IgG titre remains high.10The majority of children and adults with an initial MOGAD episode will have a monophasic disease course but depending on the study up to 40% will have further episodes. This decline of MOG-IgG titres was most prominent during the first 12 months after disease onset and a seroconversion defined as a MOG-IgG titre of less than 1:160 during the first 24 months was shown to have a high positive predictive value for a monophasic disease course. Interestingly, no patient in our cohort suffered from a relapse after time of first seroconversion, although fluctuating MOG-IgG titres with increase after a period of low or even negative MOG-IgG titres were reported in selected patients. This study shows that a seroconversion to negative MOG-IgG titres is associated with a significantly reduced risk for further relapses in paediatric MOGAD. In 70% of patients with monophasic MOGAD, titres decreased to negative levels during follow-up, whereas 93% of patients with polyphasic MOGAD still had elevated MOG-IgG titres at last follow-up.In a recent study of 116 children with MOGAD, MOG-IgG titres decreased significantly overtime in patients with a monophasic disease course compared to patients with a relapsing disease course in the majority of children. Lower MOG-IgG titres at remission or seroconversion to negative was associated with a significantly reduced risk for further relapses. Thus, both studies provide strong evidence that a decrease of MOG-IgG titres within the first 2 years after onset is associated with a reduced risk for a relapsing diseases course. Therefore, we suggest that longitudinal MOG-IgG titres should be routinely assessed in MOGAD patients.Similar results were reported in another study investigating 102 paediatric and adult patients with MOGAD.At present it is not possible at disease onset to predict the future course of a patient with MOGAD. But knowledge of persisting or in particular declining MOG IgG titres overtime is important because it has been shown to be associated with a more favourable disease course in the latter. Therefore, we recommend that serum MOG IgG titres should be performed routinely in the diagnosis and follow-up of MOGAD."}
+{"text": "Juvenile idiopathic arthritis (JIA) is one of the most common chronic inflammatory rheumatic diseases in children, with onset before age 16 and lasting for more than 6 weeks. JIA is a highly heterogeneous condition with various consequences for health and quality of life. For some JIA patients, early detection and intervention remain challenging. As a result, further investigation of the complex and unknown mechanisms underlying JIA is required. Advances in technology now allow us to describe the biological heterogeneity and function of individual cell populations in JIA. Through this review, we hope to provide novel ideas and potential targets for the diagnosis and treatment of JIA by summarizing the current findings of single-cell RNA sequencing studies and understanding how the major cell subsets drive JIA pathogenesis. According to a 2014 systematic review, the incidence of JIA ranges from 1.6 to 23 cases per 100,000 people and the prevalence from 3.8 to 400 cases per 100,000 people; overall, JIA incidence and prevalence vary by sex, region, and disease subtype.The treatment of JIA begins with nonsteroidal anti-inflammatory drugs (NSAIDs) and/or intra-articular corticosteroid injections, with a second line of traditional synthetic disease-modifying anti-rheumatic drugs (tsDMARDs), or biological DMARDs. Some patients respond unsatisfactorily to therapy and may develop severe complications, including uveitis, pulmonary lesions, and macrophage activation syndrome (MAS).Traditional transcriptome sequencing measures the average expression of individual genes across a large cell population and can be used to investigate differential expression among tissues. It is, however, insufficient for analyzing more diverse cellular systems, and much of the low-abundance information is lost in the overall characterization. Single-cell RNA sequencing (scRNA-seq) has evolved into a favorable technique for high-throughput transcriptome sequencing. It can present the expression profile at the individual cell level, allowing us to address intercellular heterogeneity more effectively, identify new and rare cell types, and gain insight into the regulation of expression mechanisms during cell growth. Utilizing scRNA-seq in the study of JIA can reveal disease heterogeneity, provide new ideas for elucidating the function of specific cell types, and guide treatment methods.Here, we attempt to summarize the findings from scRNA-seq studies on JIA, examine the challenges, and discuss the potential applications of combining scRNA-seq with multiomics technologies.,,Traditionally, cells can be defined according to cell morphology or specific expression patterns of certain functional proteins.Due to intrinsic stochastic processes and external factors, homogeneous cell populations may exhibit considerable heterogeneity in expression patterns. Neighboring cells that share the same microenvironment can express the same transcript at different levels, and this stochasticity leads to transcriptional noise, which is a random, abrupt fluctuation in gene expression that is important in a cell's fate.The first report on single-cell transcriptome sequencing by Tang et al was in 2009. Increasingly sensitive and precise single-cell transcriptome sequencing technologies have developed over the past few years, including Quartz-Seq, CEL-seq, MARS-seq, Drop-seq, Smart-Seq, and inDrop.,,,The crucial pathophysiology in sJIA, identified as a unique autoinflammatory disease, is the persistent activation of intrinsic immunity and secretion of pro-inflammatory cytokines by monocytes, macrophages, neutrophils, and T cells, resulting in the appearance of systemic clinical symptoms.Human monocytes are typically divided into three groups: classical, intermediate, and nonclassical populations.24,Bulk RNA sequencing of peripheral blood (PB) mononuclear cells (PBMCs) demonstrated that monocytes in sJIA exhibit altered transcriptional activity as an active phenotype. Interestingly, no significant difference between the monocytes of JIA patients with active disease and those with clinically inactive disease (CID) was detected.STXBP2 (syntaxin binding protein 2), verifying the correct identification of hemophagocytic macrophages.,IFN-\u03b3-induced macrophage profile is consistent with the demonstration that IFN-\u03b3 alone can interact directly with macrophages, inducing hemophagocytosis and leading to inflammatory desmoplastic anemia. ScRNA-seq enables researchers to reacquaint the cell types with their functional states more thoroughly.Furthermore, the up-regulation of IFN-\u03b3 and tripartite pattern-containing 8 (TRIM8) was observed in sJIA patients, and the overexpression of TRIM8 is a specific manifestation of sJIA.TP53 gene, induces TP53-dependent cell cycle arrest, and exerts antiproliferative effects as a tumor suppressor. TRIM8 can also function as an oncogenic protein that leads to cell proliferation by cooperating with nuclear factor \u03baB (NF-\u03baB) and STAT3.,,However, the link between IFN-\u03b3 and TRIM8 is not clear. Previous studies have elucidated that TRIM8 is involved in cell proliferation, cancer, immunity, and inflammation. It directly targets the in vitro assays demonstrated differentiation more toward macrophages rather than the dendritic cell phenotype. This process may increase the incidence of MAS in these patients. The overexpression of AIP and AHRR encoding AHR repressor leads to the down-regulation of the AHR pathway and transition to MAS, supported by the work of Cepika et\u00a0al.Comprehensive analysis of high-dimensional data reveals complex immune alterations in inflammatory diseases. Investigators have identified genes associated with specific cytokine environments and activated leukocyte subsets. Moreover, sJIA patients showed dysregulated responses to TLR4, TLR8, and TLR7 stimulation during disease remission and cessation of treatment. Isolated monocytes from sJIA were low in IL-1 inhibitor aryl hydrocarbon receptor (AHR) expression at baseline and accumulated higher levels of intracellular IL-1\u03b2 following stimulation.High expression of AHRR (AHR repressor) and HIF-1\u03b1 inhibits AHR signaling in Th17\u00a0cells and regulatory T cells (Tregs) in autoimmune hepatitis (AIH). The imbalance between Tregs and Th17\u00a0cells is linked to a low level of CD39, which is associated with the dysfunction of the AHR pathway that results from aberrant inhibition or nonclassical activation binding to Er\u03b1.,Together, monocytes in sJIA possess both anti-inflammatory and pro-inflammatory properties. Approximately 10%\u201315% of sJIA patients progress to MAS.,SJIA combined with pulmonary lesions is a disease that has been gradually recognized in recent years. Common pulmonary complications include pleurisy or pleural effusion. In the last decade, concerns about lung pathologies have increased.IL12A and CXCL9) but no changes in other polarization markers . There was also an increase in pro-inflammatory miR-146a, similar to monocytes in children with sJIA and some patients with rheumatoid arthritis (RA) or psoriatic arthritis (PsA).,(KLF)-13 mRNA is essential for M1 polarization in mice. Interestingly, the key regulatory miR-125a-5p, which directly targets KLF13, was not significantly altered in alveolar macrophages in a TLR9-induced MAS mouse model.KLF13, suppress M1 activation, and promote M2 polarization in mice. In vitro, miR-125a-5p overexpression in macrophages shifted polarization toward the M1 phenotype, similar to what was observed in monocytes of sJIA. Highly elevated miR-125a-5p levels were observed in monocytes from sJIA patients with active disease compared to those with inactive disease and were associated with systemic features.IL-18, IFN-\u03b3, CXCL9, and CXCL10 levels were significantly increased in the bronchoalveolar lavage fluid (BAL) of MAS model mice in the acute phase, similar to those of sJIA-LD patients. In contrast, there were few changes in other cytokines levels, such as IL-1\u03b2, IL-6, IL-10, IL-12, and TNF. AM\u03d5s showed significant up-regulation of IFN-\u03b3-induced pro-inflammatory genes , and Th17\u00a0cells (interleukin-17 secreting T cells) in adaptive immunity.+, CD8+, and \u03b3\u03b4T cells in the synovial fluid (SF) of oJIA patients, but they did not observe Th17\u00a0cell enrichment. Compared with control PB, oJIA joints had higher concentrations of memory CD4+, memory CD8+, and \u03b3\u03b4 T cells that expressed Th1 cytokines (IFN-\u03b3) and chemokine receptors (CXCR3) but not IL-17. The most pronounced upregulation of IFN-\u03b3 and CXCR3 was observed in SF-derived CD4+ memory T (Tmem) cells. However, the authors were unable to identify CXCR3+ IFN\u03b3+ cells because intracellular cytokine detection requires stimulation that causes CXCR3 down-regulation.Recently, Am\u00e9lie et al showed the expression of Th1-related markers by CD4+ CD4+ T cells in JIA SF.,+ IL-17+ CD4+ Tmem cells were slightly more frequent within the SF than in the PB. CD161 (Th17-associated chemokine receptor) is an alternative marker of Th17\u00a0cells. In the SF of oJIA patients, CD161+ CD4+ Tmem cells were slightly enriched but at a lower frequency than CXCR3+ CD4+ Tmem cells. IFN-\u03b3+ CD161+ CD4+ Tmem cells were increased in the joint, whereas IL-17+ CD161+ CD4+ Tmem cells were not. Over half of the CXCR3+ cells in the joint did not coexpress CD161, suggesting a considerable population of classical Th1 cells. Fergusson and colleagues proposed that CD161 also defines a population of innate-like T cells that produce IFN-\u03b3 in response to IL-12 and IL-18. Increased expression of IL-12 and IL-18 receptors was detected in SF CD4+ T cells in transcriptomic studies. KLRB1, which encodes CD161, was expressed in all effector memory clusters but was remarkably absent in central memory cells.+ Tmem cells in oJIA SF secreted IFN-\u03b3 but not IL-17.It has been reported that there is an increase in IL-17+ Tregs in oJIA SF also expressed Th1 markers. SF Tregs and SF Teffs up-regulated IFNG, CXCR3, and TBX21 expression, which encodes the Th1 lineage-defining transcription factor T-bet. Gene enrichment analysis revealed that genes involved in IFN-\u03b3 signaling were highly enriched in SF Tregs and Teffs compared to PB. Gene sets related to antigen presentation, T-cell receptor (TCR) signaling, and type I IFNs were also enriched in SF Tregs and SF Teffs. The abundance of Th17-related genes not expressed in SF Tregs was significantly higher than those in PB Tregs. Transcripts of the Th17 chemokine receptor CCR6 and master gene RORC increased slightly in SF Teffs compared to PB Teffs, but there was no difference in IL-17 expression.Th1 cells were predominantly found in oJIA SF and associated with disease severity. CD4+ SF Tregs remained hypomethylated in the conserved noncoding sequence 2 (CNS2) of FOXP3 and were considered stable Tregs. SF Teffs showed significantly lower methylation levels at the FOXP3, CTLA4, and IKZF2 loci. These genome-level studies demonstrated stable epigenetic imprinting of the Treg program, which preserved the inhibitory capacity of CXCR3+ and CXCR3\u2212 SF Tregs, both of which effectively inhibited SF Teff proliferation.,+ SF Tregs detected by flow cytometry may represent an unstable Treg population. Further work is necessary to understand the function of IFN-induced Tregs in oJIA.Tregs remain stable in oJIA SF.+ CD25+ T cells, which may actually contain activated nonregulatory T cells.,+ CD25+ CD127low T cells), while Am\u00e9lie et al focused on CXCR3+ Tregs.+ T cells in oJIA SF. Key genes related to Tregs  and Th1 cells  were detected in all Treg clusters.,TBX21, IL12RB2, and CXCR3, while the lowest levels of expression were CCR6 and KLRB1 and regulatory genes related to anti-inflammatory cytokines. Notably, cells in this cluster also expressed genes found in follicular Tregs related to T-cell\u2013B-cell interactions, including ICOS, PRDM1, MAF, and most markedly, BATF.Studies have defined Tregs as CD4+ Tph cells accumulated in the joints of ANA-positive JIA patients and promoted CD21low/\u2212 CD11c+ double-negative B-cell differentiation, which might cause the autoimmune response in the joints of ANA-positive JIA patients.+ T cells expressing multiple cytotoxic markers was found. CD4+ cytotoxic T lymphocytes (CTLs) kill cells in an MHC class II-restricted manner.+ CTLs have been found most frequently in viral infections or antitumor immunity and appear to be closely associated with Th1 cells.,The single-cell analysis also identified Tph-like Teff cells that were originally described in the rheumatoid arthritis synovium stimulating B-cell responses.+ T cells producing the Tph-associated cytokine IL-21 in ANA-positive JIA patients.The diverse groups of SF Teffs and their differentially expressed genes related to Th1, Th17, Tph lineage, T-cell activation and depletion, memory T cells, and CTLs are all involved in the pathogenesis of JIA. Blocking IFN\u03b3 to restore immune regulation in JIA may be a potential treatment.Fibroblast-like synoviocytes (FLS) are central to the persistence of JIA inflammation and can express key disease-specific chemokines.Chondrocyte-like cells have unique genetic embryonic fingerprints that distinguish JIA subtypes despite overlapping subpopulations. lRRC15, GREM1, and GREM2 are overexpressed in chondrocytes of persistent oJIA FLS compared to those in pre-expansion pJIA FLS. Kobayashi et al proposed that GREM1, a specific gene of cancer-associated fibroblasts (CAFs), was involved in bone morphogenetic protein (BMP) signaling. High levels of GREM1 and SLR in patients with colorectal cancer (CRC) were related to diverse survival.high, MFAP5high, and a few WIF1high were identified in systemic sclerosis-associated interstitial lung disease (SSc-ILD) mesenchymal cells via single-cell analysis, and the evidence suggested that this population actively proliferates.In addition, S100A4, TIMP3, and NBL1 were overexpressed in pre-expansion oJIA FLS compared to pJIA FLS. CRLF1, MFAP5, and TNXB were also overexpressed in persistent oJIA FLS compared to pJIA FLS.Chondrocyte-like cells are one of the most dominant cell populations in JIA. Chondrocyte-like cells in FLS of pJIA down-regulated the expression of genes that are specific to joint development and collagen formation. ETB JIA appears to have a unique genetic imprint that can be identified before progressing to a more severe state. As the disease progresses toward a polyarticular state, FLS become more chondrocyte-like and less like fibroblasts or smooth muscle cells, which may account for the impaired joint growth observed in JIA.Current scRNA-seq studies have elucidated a significant number of distinctive monocyte or macrophage populations, T cells, and B cells present in JIA, which might exacerbate the problem of distinguishing the targets that cause the pathological changes in JIA. However, the fine classification of various cell subtypes prompted us to explore various PB mononuclear cell types and potential biological markers at the individual cell level.Here, we summarize the application of single-cell analysis in distinguishing cellular subpopulations and potential biomarkers in the pathogenesis of JIA. The multilevel information supports the heterogeneity of JIA and suggests more stratification among patients is needed. Deeper mining of single-cell data may help in patient differentiation and precise diagnosis. It may even be integrated with treatment to advance clinical care and drug resistance recognition strategies. However, since JIA patients are subjected to drug use due to severe clinical symptoms early in the disease progression, it is difficult to obtain the pathological background of the disease before treatment and immune alterations after treatment, and there may be unavoidable destruction or loss of effective cells, low coverage, and biased sequencing results. Therefore, the optimization of single-cell sequencing combined with proteomics or other research strategies to identify cell subpopulations and signaling pathways will be beneficial for future multidimensional screening and validation of biomarkers, and accurate typing and early prognosis of JIA and complications.X.W.L. drafted the manuscript. X.M.T. contributed to the conception and critically reviewed and edited the manuscript. All authors approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflict of interests.National Key R&D Program of China (No. 2021YFC2702003).This work was supported by grants from the"
\ No newline at end of file