diff --git "a/deduped/dedup_0067.jsonl" "b/deduped/dedup_0067.jsonl" new file mode 100644--- /dev/null +++ "b/deduped/dedup_0067.jsonl" @@ -0,0 +1,57 @@ +{"text": "Emberiza bruniceps. Each experiment employed three groups (N = 6\u20137 each) of photosensitive birds that were held under 8 hours light: 16 hours darkness (8L:16D) since early March. In the experiment 1, beginning in mid June 2001, birds were exposed to natural day lengths (NDL) at 27 degree North for 23 days. In the experiment 2, beginning in early April 2002, birds were exposed to 14L:10D for 22 days. Beginning on day 4 of NDL or day 1 of 14L:10D, they received 10 (experiment 1) or 13 (experiment 2) daily injections of both melatonin and prolactin (group 1) or prolactin alone (group 2) at a dose of 20 microgram per bird per day in 200 microliter of vehicle. Controls (group 3) received similar volume of vehicle. Thereafter, birds were left uninjected for the next 10 (experiment 1) or 9 days (experiment 2). All injections except those of melatonin were made at the zeitgeber time 10 ; melatonin was injected at ZT 9.5 and thus 0.5 h before prolactin. Observations were recorded on changes in body mass, testicular growth and feather regeneration.Little is known about how hormones interact in the photoperiodic induction of seasonal responses in birds. In this study, two experiments determined if the treatment with melatonin altered inhibitory effects of prolactin on photoperiodic induction of seasonal responses in the Palearctic-Indian migratory male redheaded bunting Under NDL (experiment 1), testis growth in birds that received melatonin 0.5 h prior to prolactin (group 1) was significantly greater than in those birds that received prolactin alone (group 2) or vehicle (group 3). Although mean body mass of three groups were not significantly different at the end of the experiment, the regeneration of papillae was dramatically delayed in prolactin only treated group 2 birds. Similarly, under 14L:10D (experiment 2) testes of birds receiving melatonin plus prolactin (group 1) and vehicle (group 3) were significantly larger than those receiving prolactin alone (group 2). Also, birds of groups 1 and 3, but not of group 2, had significant gain in body mass. However, unlike in the experiment 1, the feather regeneration in birds of the three groups was not dramatically different; a relatively slower rate of papillae emergence was however noticed in group 2 birds. Considered together, these results show that a prior treatment with melatonin blocks prolactin-induced suppression of photoperiodic induction in the redheaded bunting, and suggest an indirect role of melatonin in the regulation of seasonal responses of birds. In many birds, day length regulates seasonal changes in fattening and body mass gain, gonadal growth and development, molt, and plasma levels of several hormones, including luteinizing hormone (LH), prolactin and melatonin -4. TherePrevious studies on how hormones interact in photoperiodic induction of seasonal responses in birds have yielded conflicting results. A number of early findings show prolactin acting both as pro- and anti-gonadal in birds exposed to stimulatory day lengths -11. HoweEmberiza bruniceps), in which melatonin is not directly involved in the photoperiodic time measurement based on circadian rhythm of photosensitivity [-1 suppresses ovarian response in buntings subjected to long days [The production and secretion of melatonin encodes a photoperiodic calendar to birds as they exhibit changes in both the duration and amplitude of melatonin secretion corresponding to the duration of night length/ day length ,14,15. Asitivity ,23. Prevong days . In thisWe used adult male redheaded bunting caught in late February from the overwintering flock at 25\u00b0N. Buntings are migratory finch that breed in summer in west Asia and east Europe (~ 40\u00b0N) and overwinter in India. Birds were held outdoors and acclimatized to captive conditions for two weeks, and then brought indoors and maintained on short days until subjected to experiments. Under short days, buntings do not fatten, and remain reproductively immature and responsive to photostimulation ; birds pThis experiment began in mid June 2001. Photosensitive birds maintained indoors on 8L:16D since early March were brought outdoors in the aviary and exposed to natural day lengths (NDL) at 27\u00b0N . After three days of acclimatization, they were divided in three groups (N = 6 each). Beginning on day 4, they received subcutaneous injections once daily for 10 days as follows: group 1- first melatonin and 0.5 h later prolactin; group 2- prolactin alone; group 3- vehicle (control). After 10 consecutive injections (days 4\u201313), birds were left uninjected for the next 10 days (day 14\u201323). The experiment was terminated on day 24.To confirm results of the experiment 1, we performed the experiment 2 under artificial conditions providing light-dark (LD) cycles corresponding to that was available outdoors (NDL) to birds of the experiment 1. This experiment began in the second week of April 2002. Three groups (N = 6\u20137) of photosensitive birds were subjected to 14L:10D. Beginning on day 1, they received 13 injections (days 1\u201313) as in the experiment 1: group 1- first melatonin and 0.5 h later prolactin; group 2- prolactin alone; group 3- vehicle (control). Thereafter, birds were left uninjected for the next 9 days (days 14\u201322). The experiment was terminated on day 23.Melatonin was administered at zeitgeber time 9.5 in view of our previous study and seve-1 day-1 in 200 \u03bcl injection volume. Prolactin was obtained from Sigma Chemical Co. USA and melatonin from Genzyme Fine Chemicals Ltd., Haverhill, Suffolk, UK). Melatonin injections were prepared as described by Kumar [In both experiments, melatonin and prolactin were administered each at a dose of 20 \u03bcg birdby Kumar . Brieflyab2, where a and b denote half of the long and short axes, respectively. Feather papillae regeneration was recorded as follows. On day 1 of the experiment, feathers in a specific area on the left chest were plucked. A permanent ink marker marked an area on bare epidermis measuring 1 cm2. Beginning 24 h after the first injection, the number of papillae emerged from the epidermis were counted daily throughout the experiment 1 or till 4 days after the last injection in the experiment 2, and scored subjectively as outlined by Boswell [We measured the effects on changes in body mass, testis size and regeneration of feather papillae. Body mass and testis size were measured at the beginning , in the middle (body mass only) and at the end of the experiments. Birds were weighed on a top pan balance providing accuracy nearest to 0.1 g. In view of the findings that the fattening accounts for the most of the gain in body weight in photostimulated passerine birds ,28, in t Boswell . Brieflyad libitum. In an artificial LD cycle, light was provided by white compact fluorescent lamps at ~ 500 lux. Data are presented as mean \u00b1 SE. They were analyzed using one-way analysis of variance (1-way ANOVA) with or without repeated measures, followed by post-hoc tests if ANOVA indicated a significance of difference. 1-way repeated measure ANOVA was used to compare data generated from the same group as a function of time, and 1-way ANOVA was used to compare data of different groups at one observation. Two-way (2-way) ANOVA was used to analyze data when two factors were considered together, for example the effect of the treatment and duration of the treatment. Significance was taken at P < 0.05. In the experiment 1, one bird of group 1 and two birds of group 2 died, and their data are excluded from the statistical analyses.Food and water were available F = 4.656, P = 0.0319; 1-way ANOVA). Testes were significantly larger in birds that received melatonin prior to prolactin (group 1) compared to those that received prolactin alone (group 2) or vehicle (group 3) = 3.3.19, P = 0.0701; 2-way ANOVA) although in group 1 birds the emergence of the first papilla was delayed by at least a day = 15.26, P < 0.0001; 2-way ANOVA) and group 3 = 16.49, P < 0.0001; 2-way ANOVA) Fig. . The ratday Fig. . Whereascf. Fig. .F = 12.16, P = 0.0021; group 3: F = 6.978, P = 0.0098; 1-way RM ANOVA; Fig. F = 0.2839, P = 0.7379; 1-way RM ANOVA; Fig. F = 3.857, P = 0.0416; 1-way ANOVA). Although testes were stimulated in all groups = 4.343, P = 0.0299; 1-way ANOVA). Testes grew to full size in birds of groups 1 and 3, and hence were significantly larger than those of group 2 in which they grew to less than half-maximal size = 3.9550, P < 0.0485; 2-way ANOVA) and group 3 = 24.76, P < 0.0001; 2-way ANOVA) than those received prolactin alone (group 2) or vehicle (group 3). A role of melatonin in enhancing responsiveness of the photoperiodic response system is shown in an experiment on the blackheaded bunting , an allied species that shares breeding and wintering grounds with the redheaded bunting. In blackheaded buntings exposed to 11.75L:11:25D of red light (650 nm), testes grew significantly larger in individuals that carried implants filled with melatonin compared with those that carried empty implants [A second possibility is that exogenous melatonin changes phase-relationship between daily rhythms of endogenous endocrine rhythms, and this somehow enhances sensitivity of the circadian response system to stimulatory effects of long day lengths. Testicular response in birds of the experiment 1 supports this Fig. . Birds timplants .P < 0.05, Student t-test) smaller testes than those of the experiment 2. This occurred perhaps because of one or both of the following reasons. First, there was a difference in the lighting environment between two experiments, both in the shape of LD cycle (saw-tooth shape in NDL versus square-wave shape in 14L:10D) and intensity of light period versus a continuous ~ 500 lux intensity for 14 h within the photoperiodic chambers in 14L:10D). It is reported that the duration of photoperiod and light intensity do affect photoperiodic induction of body mass and testis recrudescence in the blackheaded bunting [However, one observation of the present study is not entirely consistent. Controls of the experiment 1 had significantly , for example, melatonin given in drinking water influences the reproductive cycle [Estrilda amandava) [Psittacula cyanocephala) and the Indian weaver bird (Ploceus philippinus) [Ploceus philippinus) [The present study indicates that melatonin could be involved indirectly in regulation of photoperiod-induced seasonal responses in the redheaded bunting by modulating effects of other hormones such as the prolactin. This appears consistent with another finding on this species suggestive cycle . Daily mmandava) , and cauippinus) . Inhibitippinus) althoughippinus) . DiffereThe present results show that a prior treatment with melatonin blocks prolactin-induced suppression of photoperiodic induction in the migratory redheaded bunting. How melatonin acts to negate the effects of prolactin is unclear. Whatever is the actual mechanism of action, the current result provide evidence that melatonin modulates photoperiodic induction of seasonal responses in birds by interacting with prolactin. Whether such effect will vary during different seasons of the year remains to be investigated.AKT and SR carried out the experiments and prepared the first draft of the manuscript. VK supervised the experiments and the final version of the manuscript. The study was conceived by VK but then the experiments were discussed jointly. All the authors approved the final manuscript."} +{"text": "Human Plexin-B1 is expressed in two truncated forms. The long form encodes a trans-membranal protein, while the short form, which is bound to the cell surface and partially secreted, possibly serves as a decoy receptor. Plexin receptors are trans-membrane proteins. The sema domain, found in the extracellular region, is common to all plexins, semaphorins, and the scatter factor receptors and is crucial for the biological activity and plexin receptor specificity. Semaphorin-4D/Plexin-B1 binding provides attractive and repulsive cues for the navigation of axonal growth cones, and new studies suggest that this system also plays a role in the regulation of the biological functions of endothelial cells, specifically in the control of angiogenesis. In a previous study, we have demonstrated the expression and possible role of Plexin-B1 in the mouse ovary. The present study was designed to test the hypothesis that Plexin-B1 effects are mediated by Semaphorin-4D.In vivo expression and localization of mouse ovarian Sema-4D were tested by immunohisto-chemistry. The role of Sema-4D in follicular development was examined by in vitro growth of preantral follicles in the presence or absence of Semaphorin-4D, with or without neutralizing antibodies against Plexin-B1. Follicular growth and steroid hormone secretion rates were tested.Semaphorin-4D is expressed in the mouse ovary in vivo mostly in the granulosa cells and and its expression is modulated by PMSG and hCG. In the presence of Semaphorin-4D, in-vitro constant growth was observed as indicated by follicular diameter during the culture period and elevated steroid hormone secretion rates compared with control. These effects were abolished after addition of neutralizing antibodies against Plexin-B1.In the ovarian follicle, the effect of Plexin-B1 is mediated by sema-4D. Semaphorins and Plexins are independently identified protein families that share a striking structural similarity and are believed to derive from a common ancestor . SemaphoThe class 4 Semaphorin (Sema-4D), through binding of its receptor, Plexin-B1, exerts important biological effects on a variety of cells. A significant role for these molecules has been established in cardiac and skeletal development , immune Plexin-B1 is highly expressed in endothelial cells (EC) and its activation by Sema-4D elicits a potent pro-angiogenic response and induces EC migration . Sema-4DPlexin activation hinders cell attachment to adhesive substrates, blocks the extension of lamellipodia, and thereby inhibits cell migration .Plexin activation in adhering cells rapidly leads to retraction of cellular processes and cell rounding (cell collapse) .Sema-4D is able to activate the invasive growth program in epithelial cells, a complex process including dissociation of cell-to-cell adhesive contacts, anchorage-independent growth, and branching morphogenesis .The plexin-semaphorin system is implicated in cyto-skeletal re-organization, adhesion and cell proliferation. All these functions are utilized during the process of follicular development during the estrus cycle. The growing follicle must reshape by creating an antrum and at least two cell populations. The follicle also must expand and proliferate in order to grow into mature graafian follicle. We hypothesize that the effect of Plexin-B1 in the ovarian follicle is mediated by sema-4D. The present study was designed to test this hypothesis.All experiments were conducted using female ICR mice , housed and bred in a temperature- and light-controlled room, and provided food and water. The study was approved by the local ethics committee (840201).(a) \u2013 Thirty female mice, 26 days old, were injected with 5 IU pregnant mare serum gonadotropin (PMSG). Ten mice were sacrificed 48 hours following injection. The remaining 20 mice were injected with 5 IU human chorionic gonadotropin (hCG), 24 hours after PMSG injection. Ten were sacrificed 6 hours following injection and the last 10 were sacrificed 24 hours following injection. A group of 10 immature female mice that were not treated served as control for untreated mice. The ovaries were fixed in 4% formalin and embedded in paraffin for immunohistochemistry analysis(b) \u2013 Preantral follicles were collected from sixteen, 12-day-old, female ICR mice by ovarian micro-dissection.Ovaries from 12-day old ICR mice were removed aseptically, separated from the connective tissue, and placed in 2.5 mL of M-199 supplemented with 5% fetal calf serum (FCS), 100 mIU/mL penicillin, and 100 mg/mL streptomycin at 37\u00b0C. For each mouse, ovaries were dissected mechanically using a 26-gauge needle in M-199 medium supplemented with 5% FCS.2 in air. On days 3, 4, 5, 8, 9, 10, 11 and 12 of the culture period, 10 \u03bcL of culture medium from each drop was collected and frozen for subsequent hormonal assay. After 9 days of culture, 1.5 IU/mL Human chorionic gonadotropin (hCG) was added to the culture medium to induce follicular rupture [Isolated follicles were rinsed three times in 30 \u03bcL of culture medium composed of M-199 medium supplemented with 100 mIU/mL FSH and 100 mIU/mL LH , 5% FCS in the a2), Progesterone (P4), and Testosterone (T) were measured using EIA commercial kits according to the manufacturer's recommendations.In five independent experiments, conditioned media from surviving follicles were collected at different times of culture. Surviving follicles were defined as the attached follicles that had retained their oocytes in the granulosa cell mass. Media were frozen and hormonal measurements were performed at the end of each experiment. Estradiol . The slides were incubated with anti-Sema-4D primary antibodies at a 1:100 dilution, and developed using the streptavidin-biotin system according to the manufacturer's instructions. Sema-4D was identified as brown membrane staining in ovarian sections counterstained with hematoxylin. Tissue used as positive control in this study was obtained from the spinal cord (data not shown). Negative controls were run routinely in parallel by replacing the primary antibody with rabbit IgG antibody. No specific immuno-reactivity was detected in these negative control specimen tissues.All specimens taken from the untreated and PMSG, hCG treated 26-day old mice were fixed in 4% formalin and embedded in paraffin. For immuno-histochemical staining, the endogenous peroxidase in formalin-fixed paraffin-embedded tissue was inhibited by incubating specimens with 0.5% HThe immunohistochemistry photos were analyzed by Image Pro software that quantifies density per area. At least 3 sections from each ovary were evaluated.t-tests were used to compare between two groups as post ANOVA test; P < 0.05 was considered significant.Each independent experiment was repeated at least 3 times. All data are presented as mean \u00b1 SEM. Statistical analysis of the data was carried out with one-way analysis of variance (ANOVA). Immunohistochemistry of ovaries obtained from 26-day old untreated and treated mice revealed staining for Sema-4D, mainly in the periluminal granulosa cells, at all stages Figure . Sema-4DIn vitro cultures of preantral mouse follicles, obtained from 12-day old ICR female mice, were cultured for 12 days in medium , medium containing Sema-4D alone and medium containing Sema-4D and neutralizing antibodies against Plexin-B1 . On day 9, hCG was added to the culture. Follicular growth and development were estimated by measuring follicular diameters, using a microscope scale, and represented as mean \u00b1 SEM.P < 0.05). A statistically significant difference was found between follicular diameter on day 1 of the culture period (mean primary follicular diameter) and follicular diameter on day 11 of the culture period . The mean diameter was 100.65 \u00b1 0.28 versus 190.93 \u00b1 3.32, respectively was significantly higher than in the group treated with Sema-4D and neutralizing antibodies against Plexin-B1 (day 8 of culture period) , follicles treated with Sema-4D alone , and follicles treated with Sema-4D and neutralizing antibodies against Plexin-B1 were analyzed for E2 secretion rate was significantly increased during the culture period in the control and Sema-4D groups . Comparison of E2 levels in each group during the culture period revealed a significant difference . The addition of neutralizing antibodies against Plexin-B1 (200 ng/mL) abolished the increase seen with Sema-4D .As illustrated in Figure 4 secretion rate in the control and study groups. In the control and Sema-4D groups, P4 secretion rate remained unchanged during the first days of the culture period and increased significantly on days 10 and 12, respectively (P < 0.005.) Comparison between the mean peak of P4 secretion level in the control versus sema-4D group, revealed no significant change . In the presence of neutralizing antibodies against Plexin-B1 (200 ng/mL), the P4 secretion rate remained unchanged during the culture period.Figure 4 levels between follicles treated with Sema-4D and follicles treated with neutralizing antibodies against Plexin-B1 revealed a significant difference between the two groups .Comparing the peak PFigure Immunohistochemical studies revealed staining for Sema-4D in the mouse ovary at all stages, mainly in the peri-luminal granulosa cells. The staining became more evident following PMSG or hCG injection. Following hCG injection, Sema-4D was observed in the lumen. Sema-4D is the only semaphorin for which membrane and soluble forms are endowed with functional properties, and for which bidirectional signaling has been suggested. Both human and mouse Sema 4D are cleaved and released from the membrane as a 120 kDa soluble form . Sema-4DSince there is no known Semaphorin inhibitor, the effect of the ligand had to be studied by stimulation. In this study, the addition of Sema-4D revealed no significant difference in follicular diameter. However, the time needed to reach maximal diameter in the Sema-4D treated group was significantly shorter.In this study we could not examine endothelial cell-formation, however one can speculate that the growing follicle require induction of angiogenesis together with growth and remodeling of new blood vessels from a pre-existing vascular network, to ensure the delivery of oxygen, nutrients, and growth factors, similar to tumor growth . It is aIn the control group, after the addition of hCG to the culture, follicular diameter was reduced. This could be explained by rapid follicular rupture which mimics the follicular rupture that occurs following ovulation (i.e. granulosa collapse into the lumen). It is known that the addition of hCG causes a change in the follicular phase from growing phase into differentiating phase by causing granulosa cell luteinization . At thisIn our previous study we have shown that the addition of neutralizing antibodies against Plexin-B1 causes a significant reduction in follicular growth. In the present study, the addition of Sema-4D increased steroid hormone secretion rate when compared with the control group, and neutralizing antibodies against Plexin-B1 abolished this effect. Both estrogen and progesterone secretion patterns were different between the control and the Sema-4D treated groups. While estradiol constantly increased, and remained high in the control group, in the Sema-4D group estradiol level reached its peak and was subsequently reduced to a lower secretion level. The reverse pattern was observed in progesterone secretion. In the control group, one day after hCG injection, a reduction in progesterone secretion was demonstrated, while in the Sema-4D treated group progesterone secretion rate reached its peak only three days after the addition of hCG.The signaling pathways mediated by the Plexin/Semaphorin system have not been fully elucidated. We cannot exclude the possibility that changes in cytoskeleton re-organization influence receptor expression, or that stimulating the Plexin/Semaphorin-cascade influences down stream cytoplasmic signals involved in steroidogenesis. It has been reported that the cytoplasmic domain of plexin-B1 associates with the activated form of the small GTPase R-Ras, and promotes its inactivation through an intrinsic R-Ras-GAP activity . BindingNevertheless, these results suggest that Sema-4D modulates follicular development rates. The mechanism by which Sema-4D/Plexin-B1 system affects follicular growth and steroidogenesis demands clarification.AR took part in designing the study and analyzing the data, performed the experiments and drafted the manuscript. SG took part in designing the study and analyzing the data, controlled all the experiments, and revised all drafts of the manuscript. ES designed the study, analyzed the data and edited the drafts of the manuscript. All authors read and approved the final manuscript."} +{"text": "Melatonin \"the light of night\" is secreted from the pineal gland principally at night. The hormone is involved in sleep regulation, as well as in a number of other cyclical bodily activities and circadian rhythm in humans. Melatonin is exclusively involved in signalling the 'time of day' and 'time of year' to all tissues and is thus considered to be the body's chronological pacemaker or 'Zeitgeber'.The last decades melatonin has been used as a therapeutic chemical in a large spectrum of diseases, mainly in sleep disturbances and tumours and may play a role in the biologic regulation of mood, affective disorders, cardiovascular system, reproduction and aging. There are few papers regarding melatonin and its role in adolescent idiopathic scoliosis (AIS). Melatonin may play a role in the pathogenesis of scoliosis (neuroendocrine hypothesis) but at present, the data available cannot clearly support this hypothesis. Uncertainties and doubts still surround the role of melatonin in human physiology and pathophysiology and future research is needed. N-acetyl-5-methoxytryptamine, tryptophan is first converted by tryptophan hydroxylase to 5-hydroxytryptophan, which is decarboxylated to serotonin (figure N-acetyltransferase and hydroxyindole-O-methyltransferase) (HIOMT) that are largely confined to the pineal gland [The biological pathway of melatonin is not simple. In the biosynthesis of melatonin, or n figure and 2. Tal gland ,2. Melatal gland .a1- and b1-adrenergic receptors in the gland increases [N-acetyltransferase, the enzyme that regulates the rate of melatonin synthesis, is increased, initiating the synthesis and release of melatonin. As the synthesis of melatonin increases, the hormone enters the bloodstream through passive diffusion.In humans melatonin is produced mainly in the pineal gland and a small portion in the retina. The synthesis and release of melatonin are stimulated by darkness, melatonin is the \"chemical expression of darkness\" and inhibited by light . Photic ncreases . The actEnvironmental lighting does not cause the rhythm but entrains it . Light hIn humans melatonin has diurnal variations. The hormone secretion increases soon after the onset of darkness, peaks in the middle of the night, between 2 and 4 a.m., and gradually falls during the second half of the night figure . This ciThere is a seasonal variation in human melatonin, with an earlier phase in summer and increased levels and duration of secretion in winter in high geographical latitudes .Serum melatonin concentrations vary considerably according to age. Infants younger than three months of age secrete very little melatonin. Melatonin secretion increases and becomes circadian in older infants, and the peak nocturnal concentrations are highest at the age of one to three years, after which they decline gradually 10\u201315% per decade , which are now widely available in drugstores and food stores, result in serum melatonin concentrations that are 10 to 100 times higher than the usual night time peak within one hour after ingestion, followed by a decline to base-line values in four to eight hours. Very low oral doses (0.1 to 0.3 mg) given in the daytime result in peak serum concentrations that are within the normal night time range .Melatonin is available in drugstores in tablets , timed release tablets and liquid . No serious side effects or risks have been reported in association with the ingestion of melatonin. The dose-dependent physiologic effects of the hormone, however have not yet been properly evaluated in people who take large doses for prolonged periods of time. Despite the general absence of a marked endocrine action, decreased serum luteinizing-hormone concentrations and increased serum prolactin concentrations have been reported after the administration of pharmacologic doses of melatonin in normal subjects ,14.The amphibian melatonin receptor was cloned in 1994, and cloning of the sheep and human receptors was reported shortly thereafter with high structural similarity (80%) between sheep and human clones ,16. Two Melatonin receptors have been located in the suprachiasmatic nucleus, the pars tuberalis, and in the cerebellum ,20. AlthActivation of ML1 melatonin receptors, which belong to the family of guanosine triphosphate-binding proteins, a family that includes the serotonin and b-adrenergic receptors, results in the inhibition of adenylate cyclase activity in target cells ,23. ML1 With the use of the polymerase chain reaction (PCR), two subtypes of a high-affinity melatonin receptor (ML1), were cloned from several mammals, including humans: the Mel1a and Mel1b receptors, which are now referred to as the MT1 and MT2 receptors, respectively ,24. ThisThe ML2 receptors are coupled to the stimulation of phosphoinositide hydrolysis, are a distinct molecular species, but their distribution has not been determined. The ML2 receptor was poorly characterized and enigmatic until a recent study identified it as a form of quinone reductase. This enzyme is widely distributed in different tissues and across different species. The importance of melatonin binding to this enzyme is unclear. Specific melatonin agonists are becoming available, which lack binding to the MT3/quinone reductase receptor; these agents will help to isolate the specific effects mediated by the high-affinity melatonin receptors, and may become important options for pharmacologic treatment of insomnia without the potential for side effects from interactions with the MT3/quinone reductase binding site .Melatonin may also act at intracellular sites. Through binding to calmodulin figure the hormMoreau at al investigIn humans the circadian rhythm for the release of melatonin from the pineal gland is closely synchronized with the habitual hours of sleep. Alterations in synchronization due to phase shifts are correlated with sleep disturbances.A phase shift in endogenous melatonin secretion occurs in airplane passengers after flights across time zones , in nighThe ingestion of melatonin may alter the normal circadian rhythm of melatonin secretion, but the reports on this effect are inconsistent, probably because of variations in the timing of the administration of melatonin in relation to the light-dark cycle . The admSerum melatonin concentrations were found to be significantly lower, with later peak night time concentrations, in elderly subjects with insomnia than in age-matched controls without insomnia .Ingestion of melatonin affects sleep propensity , as well as the duration and quality of sleep, and has hypnotic effects. Oral administration of five mg of melatonin caused a significant increase in sleep propensity and the duration of rapid-eye-movement (REM) sleep ,37. In oOphthalmic exams show that elevated intraocular pressure and large cup-to-disk ratios (index of optic nerve damage in patients with glaucoma) are independently associated with earlier melatonin timing (early phase). Lower illumination exposure also has independent associations with earlier melatonin timing. Conceivably, ophthalmic and illumination factors might have an additive effect on the timing of melatonin excretion, which in turn might predispose individuals to experience early morning awakenings. It is evident that daily illumination, ophthalmic factors, sleep duration, and race each have independent associations with melatonin. The observation that Blacks have lower illumination exposure, greater ophthalmic dysfunction, and higher 6-sulfatoxymelatonin levels merits further empirical study .Although humans are no photoperiodic, bright light is essential for the suppression of melatonin and the phase shift of the circadian rhythm . Low nigAbnormally high or pharmacologic concentrations of melatonin in women are associated with altered ovarian function and anovulation. It is believed that the hormone also has antigonadal or antiovulatory effects in humans, as it does in some seasonal and nonseasonal mammalian breeders. Melatonin acts in gonades indirectly, reducing the secretion of gonadotropines and mainly LH . The menThe age at menarche in healthy population regressed by northern latitude showed that there is a statistical significant correlation . For lower latitudes there are no, at least recent, data available for the prevalence of scoliosis. Late age at menarche is noted in northern geographic latitudes and in Inuits (Eskimos) and the age of menarche decreases as the latitude is approaching the 30\u00b0-25\u00b0 then it increases again ,49. The The decrease in night time serum melatonin concentrations that occurs with aging, together with its multiple biologic effects, has led several investigators to suggest that melatonin has a role in aging and age-related diseases ,51. StudThere is evidence from experimental studies that melatonin influences the growth of spontaneous and induced tumours in animals. Pinealectomy enhances tumour growth, and the administration of melatonin reverses this effect or inhibits oncogenesis caused by carcinogens . MelatonThe evidence obtained during the last years suggests that melatonin exerts certain effects upon the cardiovascular system. The presence of vascular melatoninergic receptors binding sites has been demonstrated. It has been shown that patients with coronary heart disease have a low melatonin production rate, especially those with higher risk of cardiac infarction and/or of sudden death. There are clinical data, reporting alterations of melatonin concentrations in serum in coronary heart disease. People with high levels of low-density lipoprotein (LDL)-cholesterol have low levels of melatonin. It has been shown that melatonin suppresses the formation of cholesterol, reduces LDL accumulation in serum and modifies fatty acid composition of rat plasma and liver lipids. People with hypertension demonstrate lower melatonin levels versus those with normal blood pressure. It is questionable whether the administration of the hormone will decline blood pressure to normal range .Melatonin may have a direct effect on bone. Suppression of melatonin secretion lowered serum calcium concentration, an effect prevented by melatonin administration. Treatment of ovariectomized rats with melatonin prevents bone loss by an effect partly dependent on residual estradiol levels. Melatonin presumably acts as an autacoid in bone cells since it is present in high quantities in bone marrow, where bone cell precursors are located. Melatonin dose-dependently augments proteins that are incorporated into the bone matrix, like procollagen type I c-peptide. Osteoprotegerin, an osteoblastic protein that inhibits the differentiation of osteoclasts is also augmented by melatonin in vitro. Melatonin through its free radical scavenger and antioxidant properties may impair osteoclast activity .Many investigators have noted abnormalities in the structure and the function of thrombocytes in patients with idiopathic scoliosis. Those with larger scoliotic curves have a higher concentration of a more dense type of platelet, compared with those with small curves or control subjects . CalmoduThe cause of adolescent idiopathic scoliosis (AIS) in humans remains obscure and probably multifactorial. \u00c1t present there is no proven method or test available to identify children or adolescent at risk of developing AIS or identify which of the affected individuals are at risk of progression. Reported associations are linked in pathogenesis rather than etiologic factors. A number of suggestions concerning its aetiology have been proposed including neuromuscular, connective tissue structure, vestibular dysfunction, melatonin secretion, platelet microstructure, mechanical, growth related and developmental, asymmetry in the brainstem, genetic factor, equilibrium dysfunction and impairment of proprioception leading to the idea that a disturbance of postural control but no single factor has been identified so far. Many authors think that a relation exists between the origin of scoliosis and balance troubles. Visual impairment has been shown to increase the prevalence of idiopathic scoliosis in human subjects when compared to the prevalence of the general population -70. ReseMelatonin may play a role in the pathogenesis of scoliosis (neuroendocrine hypothesis) but at present, the data available cannot clearly show the role of melatonin in producing scoliosis in humans.Machida et al found that pinealized chickens developed scoliosis and attributed this effect to decreased melatonin production. They show that scoliosis could be prevented by administration of melatonin. ,72. In aThus the data regarding human melatonin levels is mixed at best and the melatonin deficiency as a causative factor in the aetiology of scoliosis cannot be supported. The biological relevance of melatonin in AIS is controversial because: a) no significant decrease in circulating melatonin level has been observed in a majority of studies, b) experimental pinealectomy did not lead systematically to a scoliosis in all pinealectomised chicken, c) melatonin injections in pinealectomised animals did not always prevent the formation of scoliosis.There are good physiologic reasons why the chicken model cannot be simply extrapolated to the human situation. The distribution of melatonin receptors in the chicken is more widespread than in other species. They are found throughout the brainstem and in the dorsal grey matter of the signal cord, particularly in the lumbar region. Receptors have even been demonstrated in the chicken ovary and testicle. In humans no extrapineal source of melatonin production has been shown to affect the circadian rhythm of hormone levels. In humans pinealectomy leads to a loss of the night time melatonin peak and a drop in basal levels below detection, whereas in chickens, it only eliminates the night time peak. Although melatonin serves as the zeitgeber for many animals, its actions appear to differ between humans, other mammals, and other vertebrates ,76. MoreAnother implication for the melatonin deficiency hypothesis is that increase incidence of scoliosis has not been observed in children after pinealectomy or pineal irradiation because of pineal neoplasias, although they have luck of serum melatonin ,84. MuraMoreau et al performeThe prevalence of scoliosis differs at different countries. In Northern latitude the prevalence is high compared with this towards 25\u201330\u00b0 . The age at menarche regressed by latitude showed that there is a statistical significant correlation. The regression curves of prevalence of adolescent idiopathic scoliosis by latitude and age at menarche by latitude are of similar pattern .The prevalence of scoliosis in a population of blind women was 42,3% while the prevalence in the general population in the same region is 2,9%. Melatonin may play a role in the pathogenesis of scoliosis . It coulMelatonin the \"light of night\" is not a simple hormone. It has many complex functions, which are only recently being defined. In comparison with other signalling molecules the numerous actions that have been attributed to melatonin are exceptional. Unfortunately there are differences in the pharmacology of melatonin between the species and different biological circadian rhythms. Chicken model cannot be simply extrapolated to humans. No permanent deficiency of secretion of melatonin occurs in patients with AIS. Evidence for a transient deficiency before and/or during development of scoliosis is scant and requires confirmation in a large number of subjects. The diurnal variations in melatonin levels and the circadian rhythm of secretion play an important role. There is now evidence that melatonin may have a role in biologic regulation of circadian rhythms, sleep, mood, and perhaps reproduction, tumour growth, cardiovascular system and aging. However, uncertainties and doubts still surround the role of melatonin. It will be an important issue of future research to investigate the role of melatonin in human biology, the clinical efficacy and safety of melatonin under different pathological situations.SRS: Scoliosis Research SocietyFDG, PET: F-18 fluorodeoxyglucose (FDG) brain positron emission tomography (PET)cAMP: cyclic adenosine monophosphateGpp (NH)p: guanilyl 5'-imidophospate, nonhydrolysable analogue of GTPGTP:guanosine 5'-triphosphate (cell and molecular biology) A nucleoside triphosphate that is instrumental in many cellular processes, including microtubule assembly, protein synthesis, and cell signalling, due to the energy it releases upon removal of its terminal phosphate group (producing guanosine 5'-diphosphate).Forskolin: is a labdanediterpene that is produced by the plant plectranthus barbatus. Forskolin is commonly used to raise levels ofcAMP in the study and research of cell physiology. Forskolin resensitizes cell receptors by activating the enzyme adenylyl cyclase and increasing the intracellular levels of cyclic Adenosine Monophosphate (cyclic AMP or cAMP). Cyclic AMP is an important signal carrier that is necessary for the proper biological response of cells to hormones and other extracellular signals. It is required for cell communication in the hypothalamus/pituitary gland axis and for the feedback control of hormones.TBG conducted the collection of literature, and involved in drafting the article. ODS conducted the collection of literature, and involved in drafting the article. Both of the authors read and approved the final manuscript."} +{"text": "In many mammals, the duration of the nocturnal melatonin elevation regulates seasonal changes in reproductive hormones such as luteinizing hormone (LH). Melatonin's effects on human reproductive endocrinology are uncertain. It is thought that the same hypothalamic pulse generator may both trigger the pulsatile release of GnRH and LH and also cause hot flashes. Thus, if melatonin suppressed this pulse generator in postmenopausal women, it might moderate hot flashes. This clinical trial tested the hypothesis that melatonin could suppress LH and relieve hot flashes.Twenty postmenopausal women troubled by hot flashes underwent one week of baseline observation followed by 4 weeks of a randomized controlled trial of melatonin or matched placebo. The three randomized treatments were melatonin 0.5 mg 2.5\u20133 hours before bedtime, melatonin 0.5 mg upon morning awakening, or placebo capsules. Twelve of the women were admitted to the GCRC at baseline and at the end of randomized treatment for 24-hour sampling of blood for LH. Morning urine samples were collected twice weekly to measure LH excretion. Subjective responses measured throughout baseline and treatment included sleep and hot flash logs, the CESD and QIDS depression self-ratings, and the SAFTEE physical symptom inventory.Urinary LH tended to increase from baseline to the end of treatment. Contrasts among the 3 randomized groups were statistically marginal, but there was relative suppression combining the groups given melatonin as contrasted to the placebo group Similar but not significant results were seen in blood LH. There were no significant contrasts among groups in hot flashes, sleep, depression, or side-effect measures and no significant adverse effects of any sort.The data are consistent with the hypothesis that melatonin suppresses LH in postmenopausal women. An effect related to the duration of nocturnal melatonin elevation is suggested. Effects of melatonin on reproductive endocrinology should be studied further in younger women and in men. Larger studies of melatonin effects on postmenopausal symptoms would be worthwhile. In vertebrates, melatonin serves as a hormonal signal of night, and consequently, as a signal of the night's duration through the changing seasons. In a number of mammalian species, the duration of the nocturnal melatonin elevation regulates seasonal changes in reproductive hormones such as luteinizing hormone (LH), follicle-stimulating hormone (FSH), and prolactin -4.Whether melatonin regulates reproductive endocrinology in humans has been uncertain. On the one hand, melatonin was tested with some success as a contraceptive . In a coa disturbing loss of pituitary volume. In that one man, LH and FSH increased during a period of normal nights that followed 15 weeks of long nights, suggesting that secretion of these hormones had been suppressed during the long nights [Wehr and colleagues subjected experimental subjects to 8 and 14 hours of complete darkness, without attempting to regulate light levels when subjects were out of bed. Dramatic effects of long nights on melatonin, cortisol, and prolactin were demonstrated . The durg nights .On the other hand, some controlled trials of melatonin have observed no suppressive effects on reproductive hormones . In a plIn menopausal women, hot flashes are often synchronous with pulsatile release of LH ,24. AlthThe current study was planned as an expanded test of the hypothesis that melatonin could suppress LH and relieve hot flashes by suppression of the hypothalamic pulse generator. Wishing to mimic the broader nocturnal melatonin elevation occurring naturally in winter, we gave melatonin not at bedtime but either 2.5\u20133.0 hours before bedtime or at the time of awakening. We intended to compare effects of evening and morning melatonin administration, which might have opposite effects on circadian timing. Lewy et al. had suggested that excessive melatonin doses might be ineffective stimuli of the circadian system, because blood levels might be elevated for too long . TherefoPostmenopausal women troubled by hot flashes were recruited for the research by newspaper advertising. Out of 34 women interviewed for the study, 20 signed written informed consent and completed the research. Almost all of the others withdrew before or shortly after signing consent, mostly because their symptoms were not suitable, because they did not wish to adhere to the protocol, or because inspection of arm veins suggested that establishment of an intravenous sampling line might be difficult. A steady dosage of hormone replacement therapy was not considered an exclusion if it did not eliminate hot flashes. The study adhered to the principles of the Helsinki Declaration and was approved and supervised by the local Institutional Review Boards.The protocol consisted of one baseline observation week followed by 4 weeks of double-blind randomized treatment with either melatonin 0.5 mg or placebo in identical-appearing capsules Figure . ParticiDuring the baseline week and throughout the 4 weeks of randomized treatment, participants completed a Daily Log of Sleep and Hot Flashes. This consisted of daily notations of a) bedtime, b) wake-up time, c) the self-estimated percentage of time-in-bed asleep, d) number of hot flashes in 24 hours, and e) a 10 cm. visual analog estimate of daily hot flash severity ranging from \"mildest\" to \"most severe.\" These self-observations were averaged on a weekly basis. In addition, at the end of each of the 5 weeks, the participants completed two scales for self-rating depression for the previous week, the Center for Epidemiological Studies Depression Scale (CESD) and the Quick Inventory of Depressive Symptomatology self-rating version (QIDS-SR), as well as the SAFTEE, a 96-item symptom inventory designed to monitor adverse effects in clinical trials .At the end of the baseline week, participants were admitted to the General Clinical Research Center for 25 hours, so that venous blood could be sampled repeatedly. An intravenous catheter in a forearm, with long extensions, was established. So far as possible, 2.5 cc blood samples were drawn every 20 min. for 24 hours for assays of luteinizing hormone. Also at this first admission, the baseline CESD, QIDS-SR, and SAFTEE scales were collected, the participants were instructed in urine collection procedures, and the randomized coded medications were provided for 4 weeks of treatment at home. During the randomized treatment, participants collected a first morning urine specimen twice a week, measuring the volume, recording the collection intervals, and freezing aliquots, so that urinary LH excretion could be examined. On the last day of the 4 weeks of randomized treatment, participants were readmitted to the General Clinical Research Center for repeated 24-hour blood sampling and collection of all data forms. Participants who completed the study were paid $440, or pro-rata for early discontinuation.The staff experienced considerable difficulty in maintaining the venous catheters and obtaining blood specimens. For the first 12 participants, of 1898 planned samples, only 1090 samples were successfully frozen. However, at least a few samples were obtained from each of the 12 participants, making it possible to estimate daily mean LH blood concentration. Because of the missed samples and the small number of subjects completing the blood sampling procedures, it was not possible to analyze the parameters of pulsatile LH secretion.We had originally planned to complete study of 30 subjects to have reasonable power for the endocrine studies, recognizing that for the sleep, hot flashes, and symptom data, a much larger number of subjects would be desirable for adequate power . After 1R LH Elisa kits This is an enzymatically amplified \"one-step\" sandwich-type immunoassay. The manufacturer states that there is no detectable cross-reactivity with TSH, FSH, and hCG. Blood samples were measured by direct addition of 50 \u03bcL serum, whereas urine samples were measured by diluting 1:1 with zero standards (each at 25 \u03bcL). For accuracy, above-scale LH urine samples (> 180 mIU/ml) were re-assayed at increased dilutions. The sensitivity of the EIA is 0.1 mIU/ml. At mean LH concentrations of 3.2 mIU/ml and 30.8 mIU/ml, intra-assay coefficients of variation were 2.2% and 4.9% respectively, and inter-assay CVs were 2.9% and 4.8% respectively. Urinary rates of LH excretion (mIU/hr) were computed by multiplying the urine LH concentration (mIU/ml) by the urine excretion rate (ml/hr) calculated over the interval between voidings. Measured urinary LH excretion was quite erratic from day to day, with the daily standard deviation being 69% of the mean. Therefore, for each subject, daily urine LH mIU/hr values outside a range of \u00b1 2SD were ignored, in most cases leaving 8\u20139 values for computation of slopes. The first and last values meeting the \u00b1 2SD criteria were also selected to explore changes in urinary LH excretion during treatment.LH levels in blood and urine were measured using DSL-10-460 ActiveContrasts between groups were examined using ANOVA, with the initial score as the covariate. When appropriate due to the distributions, these results were confirmed with nonparametric analyses, which in the case of LH measures, were applied to change scores.The 20 participants completing the study had a mean age of 59 years (range 51\u201369).percent changes between first and last samples divided by the initial level of the first sample were examined to determine effects of randomized treatments. Contrasting urinary LH excretion among the 3 groups, these change scores adjusted for the initial level were marginally different ; however, combining the two melatonin groups because of the small N and the prospective prediction that melatonin at both times would suppress LH, there was suppression among those given melatonin as contrasted to the placebo group Likewise, the slopes of the urine LH excretion (including up to 8 bi-weekly samples) were lower among those receiving melatonin than placebo . There were no significant differences between morning and evening melatonin results. Urinary luteinizing hormone results are shown in Figure As expected due to random group assignment, baseline values of urinary LH excretion among the 3 groups were not significantly different, but the group which would be randomized to receive melatonin in the evening averaged substantially higher excretion than the other two groups. Therefore, the In the smaller subgroups which provided blood LH samples, the averaged baseline concentrations were 55 mIU/ml among those that would randomly be given melatonin in the evening, 28 mIU/ml among those to receive morning melatonin, and 23 mIU/ml among those receiving only placebo . For blood LH, change scores were not significantly different among the 3 groups, or when contrasting the two melatonin groups combined with the placebo group. On overall average, mean blood LH increased slightly (not significantly) from the first to the last collection, with a 17% \u00b1 SD 27% increase in the placebo group, a 9% \u00b1 SD 19% increase in the evening melatonin group, and an 11% \u00b1 SD 24% decrease in the morning melatonin group. For the observed differences between the morning and evening melatonin groups and the placebo group in blood LH change scores, 14 cases in each group would be needed for 82% power to distinguish the groups, modeling ANOVA. Using the observed urine data, 27 cases in each group would be needed for 80% power. Blood LH results are shown in Figure S = 0.84 (P < 0.001). The final treatment measures were correlated rS = 0.73 (P < 0.01). The adjusted changes in urine LH excretion and blood LH concentration were positively but not significantly correlated.The rank-order correlation of average blood LH at baseline versus the first urine excretion sample was rReported hot flashes per day averaged 8.9 in the baseline week and 7.8 in the final week of randomized treatment. There was no significant difference between groups in hot flashes change, but the trend was for the placebo group to report the most improvement (contrary to prediction). Similarly, reported severity on the visual-analog scales dropped from 47 at baseline to 37 in the final week, with the greatest drop in the placebo group, though group contrasts were not significant. Likewise, changes were not significant between groups in the product of the reported number of hot flashes times the reported severity. Changes in hot flashes from baseline to the end of treatment were not significantly correlated with changes in blood or urinary LH over the same interval.In the baseline week, the participants reported an average bedtime of 10:52 PM and an average uptime of 06:41 AM, with an average of 85% of the time-in-bed spent asleep. Though reported sleep percent increased to 88% at the end of treatment, there were no significant contrasts between treatment groups. The prediction that evening melatonin administration would phase-shift sleep times earlier than would morning melatonin (based on the melatonin phase-response curve) was not On the CESD, mood improved from an average score of 7.5 at baseline to 6.9 in the final week. A CESD score >16, which is a sensitive screening criterion for major depression, was reported by 4 women at baseline, but only by 2 at the end of treatment. Perhaps because the group which would receive morning melatonin included the participant with the highest CESD (which improved during the study), that group showed the greatest improvement, but the contrasts between groups were not significant. Similarly, the average QIDS scores improved from 5.2 to 4.3 from baseline to the end of randomized treatments, with no significant differences between groups.There were no clinically significant or severe adverse effects reported during randomized treatment with melatonin or placebo. Some women felt that the medication caused mild sleepiness, but it was tolerable. The SAFTEE symptom inventory displayed a 9.2% average reduction of diverse medical symptom reports from baseline to the end of treatment. Seventeen classes of symptoms and 10 individual items related to sleepiness and mood were examined, but there were no significant contrasts between randomized groups.To summarize, this trial tended to confirm a preliminary study of Suhner et al. and suppIt was interesting to observe that morning melatonin was associated with more suppression of LH than evening melatonin, though not significantly so. Perhaps melatonin administration 4\u20135 hours before bedtime might have served to make the evening onset of melatonin more dramatically early and more effective. The investigators had not chosen to give evening melatonin 4\u20135 hours before bedtime, because it was believed that evening sedation and a possibly unwanted advance in sleep timing might be more severe with earlier administration.It would be important to examine melatonin effects on the reproductive endocrinology of women of other ages and effects on men. Due to the excess LH secretion of postmenopausal women, effects of melatonin were not expected to be harmful to this group. However, if melatonin interferes with the reproductive endocrinology of women attempting to have children or suppresses LH (and thus testosterone) among men, such effects might be quite unwelcome. Since melatonin is becoming popular in the treatment of children with developmental problems, it would also be important to explore whether melatonin interferes with their endocrine development.The observations were consistent with the hypothesis that photoperiodic mechanisms are active in human physiology. The timing chosen (well before bedtime or after arising) and the low dosage of melatonin, designed to simulate effects of a natural winter photoperiod upon the melatonin profile, may explain why we were able to demonstrate this marginal melatonin effect on LH, when other studies have not had similar results. Both the before-bedtime and morning administration would tend to extend the duration of the nightly melatonin elevation. Possibly, other studies have failed to document an effect of melatonin on LH because bedtime dosing or use of higher doses creates 24-hour melatonin profiles less similar to those produced by a natural winter photoperiod.Nevertheless, it might be possible to further optimize timing and dosage.The results of this study did not support our hypothesis that melatonin would improve sleep and suppress hot flashes among symptomatic postmenopausal women, but there were no significant adverse effects, and LH was possibly suppressed. There were too few subjects to provide adequate power for exploration of symptomatic effects, especially considering the well-known placebo responses in studies of this type . TherefoThe author(s) declare that they have no competing interests.Dr. Kripke conceived the study, admitted the participants to the GCRC, and performed data analyses. Drs. Kline, Shadan, Dawson, and Poceta contributed to study planning and administration and provided clinical coverage. Dr. Elliott contributed to experimental design, performed the luteinizing hormone assays, and calculated urinary excretion rates. All authors contributed to manuscript preparation.The pre-publication history for this paper can be accessed here:"} +{"text": "N1-acetyl-N2-formyl-5-methoxykynuramine (AFMK) and N1-acetyl-5-methoxykynuramine (AMK), which have been shown to also dispose of protective properties. Thus, melatonin may be regarded as a prodrug, too. AMK interacts with reactive oxygen and nitrogen species, conveys protection to mitochondria, inhibits and downregulates cyclooxygenase 2.Melatonin, originally discovered as a hormone of the pineal gland, is also produced in other organs and represents, additionally, a normal food constituent found in yeast and plant material, which can influence the level in the circulation. Compared to the pineal, the gastrointestinal tract contains several hundred times more melatonin, which can be released into the blood in response to food intake and stimuli by nutrients, especially tryptophan. Apart from its use as a commercial food additive, supraphysiological doses have been applied in medical trials and pure preparations are well tolerated by patients. Owing to its amphiphilicity, melatonin can enter any body fluid, cell or cell compartment. Its properties as an antioxidant agent are based on several, highly diverse effects. Apart from direct radical scavenging, it plays a role in upregulation of antioxidant and downregulation of prooxidant enzymes, and damage by free radicals can be reduced by its antiexcitatory actions, and presumably by contributions to appropriate internal circadian phasing, and by its improvement of mitochondrial metabolism, in terms of avoiding electron leakage and enhancing complex I and complex IV activities. Melatonin was shown to potentiate effects of other antioxidants, such as ascorbate and Trolox. Under physiological conditions, direct radical scavenging may only contribute to a minor extent to overall radical detoxification, although melatonin can eliminate several of them in scavenger cascades and potentiates the efficacy of antioxidant vitamins. Melatonin oxidation seems rather important for the production of other biologically active metabolites such as In several countries, melatonin is sold over the counter; in others its free sale is prohibited. The usefulness of melatonin as a food additive continues to be a matter of debate. Meanwhile, countless people have used melatonin for mitigating the symptoms of jet lag, an application which has been tested and is recommended -4; any pIn terms of application it seems necessary to thoroughly analyze the mechanisms of antioxidant actions of melatonin and to distinguish between effects observed at pharmacological or physiological concentrations. These considerations must not be restricted to the melatonin released from the pineal gland into the circulation and to the classic hepatic degradation route of 6-hydroxylation followed by conjugation. On the contrary, we would like to lay emphasis on the significance of tissue melatonin and the alternate oxidative pathways of catabolism leading to different, biologically active products. The relationship between melatonin and nutrition will be discussed, with regard to the presence of the compound as a natural food constituent sometimes affecting circulating levels, to the post-prandial release of melatonin from the gastrointestinal tract, and to interactions with other antioxidants present in food. Finally, a model of mitochondrial protection is reviewed.Melatonin is a natural compound of almost ubiquitous occurrence -17. Its Scutellaria baicalensis, e.g., melatonin is accompanied by acteoside, baicalein, baicalin, wogonin and ganhuangenin, substances with antioxidant, antiinflammatory, sedating and immunomodulatory properties, interfering also with NO synthases and P450 monooxygenases, i.e., functions within the action spectrum of melatonin or affecting melatonin metabolism . HoweveThe gastrointestinal tract deserves particular attention, not only with regard to melatonin uptake, but, even more, as an extrapineal site of melatonin biosynthesis, where this molecule is present in amounts exceeding those found in the pineal gland by several-hundred-fold, and from where it can be released into the circulation in a post-prandial response, especially under the influence of high tryptophan levels -36. Gastet al. merits special attention because of its analytical value. This extremely long-lived radical which is stable for many days provides a good example for single-electron donation by melatonin [Meanwhile, melatonin has been shown to react with many other oxidants, such as carbonate radicals -60, singelatonin ,68. Thiselatonin . Single-elatonin -72 and nelatonin ,73-75. Eelatonin . Single-elatonin ,78 which2 adduct (ONOOCO2-), namely, carbonate radicals (CO3\u2022-) and \u2022NO2 [2, this pathway is favored and the primary interaction of melatonin is that with CO3\u2022- [3\u2022- scavenging [3\u2022- and \u2022NO2 represents the physiologically most efficient nitration mixture, because of the high availability of CO2 in biological material. It is worth noting that melatonin can, in fact, decrease 3-nitrotyrosine levels, as shown in guinea pig kidney [Reactive nitrogen species represent another category of potentially destructive substances, which react with melatonin. Scavenging of nitric oxide by melatonin in a nitrosation reaction is well documented ,79-81. Wand \u2022NO2 . In the th CO3\u2022- , a conclavenging -60. The g kidney .in vivo, under conditions of long-lasting experimental oxidative stress induced by a high cholesterol diet [Another highly interesting aspect of melatonin's antioxidant actions, which may be particularly important from the nutritional aspect, is its interactions with classic antioxidants. In both chemical and cell-free systems, melatonin was repeatedly shown to potentiate the effects of ascorbate, Trolox , reduced glutathione, or NADH ,68,69,87rol diet .N1-acetyl-N2-formyl-5-methoxykynuramine , as far as they are not released unmetabolized, have to enter a pathway different from monooxygenation. AFMK formation is highly likely.These findings do not represent a peculiarity of non-vertebrates, but rather seem to reflect the non-hepatic melatonin catabolism in vertebrates. Contrary to statements in the earlier literature claiming that almost all melatonin is metabolized in the liver to 6-hydroxymelatonin followed by conjugation and excretion, recent estimations attribute about 30 percent of overall melatonin degradation to pyrrole-ring cleavage . The ratN1-acetyl-5-methoxykynuramine (AMK) derived from AFMK by deformylation, was identified as a main metabolite [cisterna magna, about 35 percent was recovered as AMK. Under the conditions used, AFMK and AMK were the only products formed from melatonin in the brain and no 6-hydroxymelatonin was detected. In this case, the high turnover in the kynuric pathway of melatonin catabolism is the more remarkable as it cannot be explained on the basis of the enzymes capable of catalyzing the formation of AFMK: (i) indoleamine 2, 3-dioxygenase which uses tryptophan as the main substrate, exhibits sufficiently high activities only after inflammatory stimulation of the microglia [The significance of pyrrole-ring cleavage in oxidative metabolism of tissue melatonin is particularly illustrated in the central nervous system, where a secondary product, tabolite . When meicroglia -95; (ii)icroglia ,96,97, i2\u2022-, or CO3\u2022- and O2\u2022-, or organic cation radicals and O2\u2022-, oxidation by singlet oxygen, by ozone, or by O2 under photoexcitation of melatonin all lead to AFMK. Even another product formed from melatonin by interactions with free radicals, cyclic 3-hydroxymelatonin [It is a remarkable fact that AFMK is formed by many different mechanisms [summarized in refs. ,59,66,89elatonin , can be elatonin . All theAs already mentioned, AFMK is easily deformylated to AMK. To date two enzymes capable of catalyzing this reaction have been identified, arylamine formamidase and hemoperoxidase ,89,98. TThe deformylated product AMK, easily formed from AFMK , appearsIt is a remarkable fact that the kynuric pathway of melatonin metabolism includes a series of radical scavengers, which may be regarded as a scavenger cascade , with a Antioxidative protection by melatonin is not just a matter of direct radical scavenging Fig. , as becoMelatonin upregulates several antioxidant enzymes. Most frequently, this has been demonstrated for glutathione peroxidase ,104-118 Contrary its effect on the enzymes of glutathione metabolism, the effect of melatonin on superoxide dismutase subforms and catalase strongly depends on organs and species. Stimulation was observed in some tissues, but not in others; in some cases, even decreases were reported. This may not only be a matter of differences in responsiveness of cell types. The complexity in the regulation of the respective enzymes has to be considered. Frequently, they exhibit compensatory rises in response to oxidative stress. When melatonin is counteracting experimentally induced stress, the result may be a normalization of enzyme activity, i.e., lower values, compared to animals treated with oxidotoxins, rather than inductions. Such normalizations were, in fact, described ,125. HowAn additional aspect of melatonin's actions on antioxidant enzymes deserves future attention: In two neuronal cell lines, physiological concentrations of melatonin not only induced glutathione peroxidase and superoxide dismutases at the mRNA level, but concomitantly increased the life-time of these mRNAs .2, carbonate (CO3\u2022-) and hydroxyl (\u2022OH) radicals. Suppressions of both lipoxygenase and NO synthase may additionally set limits to inflammatory responses, although the immunomodulatory actions of melatonin are certainly more complex and may involve additional effects of melatonin and AMK, too.Melatonin also contributes to the avoidance of radical formation in several independent ways. It downregulates prooxidant enzymes, in particular 5- and 12-lipoxygenases ,126-128 Another widely unexplored but potentially important signaling effect of melatonin in antioxidative protection concerns quinone reductase 2 ,135,136.Drosophila and the Syrian Hamster [Although less relevant from a nutritional point of view, melatonin also contributes indirectly to radical avoidance, e.g., by its antiexcitatory effects in the central nervous system, and as an endogenous regulator molecule controlling rhythmic time structures. This last action may be particularly important for well-timed alimentary melatonin supplementation in the elderly, who exhibit a strongly reduced amplitude in the circadian melatonin rhythm. The significance of appropriate timing for maintaining low levels of oxidative damage has been overlooked for quite some time. However, temporal perturbations as occurring in short-period or arrhythmic circadian clock mutants lead to enhanced oxidative damage, effects observed in organisms as different as Hamster ,137,138.In the last few years, mitochondrial effects of melatonin have been discovered which may turn out to be even more important than the protective actions described above. Mitochondria are the main source of free radicals in the majority of animal cells and are implicated in aging processes. The importance of mitochondrial diseases is increasingly perceived. Mitochondria play a key role in apoptosis. Notably, several of the mitochondrial effects of melatonin were obtained at low pharmacological doses in drinking water ,139,140 10 [Several studies of mitochondrial effects revealed attenuation of mitochondrial lipid peroxidation, prevention of oxidative protein and DNA modifications, preservation of ultrastructure, resistance against toxins etc., findings which were widely in line with previous concepts of protection ,142-146.10 .More importantly, beyond these rather conventional findings, with few exceptions, melatonin was found to increase mitochondrial respiration and ATP synthesis, in conjunction with rises in complex I and IV activities ,149,150.2 consumption are presumably not decisive for protection, but can serve as good indicators for the reduction of electron leakage from the respiratory chain. Electron transfer to molecular oxygen at the matrix side, largely at iron-sulfur cluster N2 of complex I [2O2 [50 of 0.8 \u03bcM [The improvements of ATP formation and Oomplex I , is a maomplex I ,154, coux I [2O2 , doxorubx I [2O2 or oxyge2O2 formation was found to be reduced by melatonin [2\u2022- formation. In addition to the electrons being largely recycled, most of the melatonin is also. Therefore, such a mechanism would only require very low, quasi-catalytic amounts of melatonin, in accordance with the effects demonstrated with nanomolar concentrations. Because the recycled electrons are not lost for the respiratory chain, this would also lead to improvements in complex IV activity, oxygen consumption and ATP production. Alternately, the melatonin metabolite AMK, which is also highly reactive and can undergo single-electron transfer reactions [The effects of melatonin on the respiratory chain open new perspectives for diminishing radical formation, instead of seeking only antioxidant effects for the elimination of radicals already formed. We have proposed a model of radical avoidance Fig. in whichelatonin . The baselatonin , followeeactions , may acteactions : AMK wasA highly attractive aspect of mitochondrial protection results from the small quantities required: experimentally induced mitochondrial damage in rat fetuses was even prevented by maternally administered melatonin . The mecCan all these findings on antioxidant and radical-avoiding actions of melatonin justify its intake as a food additive or as a medication? The idea of substitution therapy may seem especially attractive for the elderly who have more or less lost the nocturnal peak of circulating melatonin. Nevertheless, the use as a food additive is still a matter of controversy. The argument for a naturally occurring compound, which is a normal food constituent, cannot suffice alone, since commerical preparations would always lead to at least transient pharmacological concentrations in the blood, and the immunomodulatory actions of melatonin may not be desired in every case. Therefore, experience will have to answer the question of its usefulness. Without any doubt, melatonin is remarkably well tolerated. Of course, one can find in any large statistical sample of melatonin users some individuals who complain about side effects, scientifically understandable or not. In a currently running study on ALS, patients receiving daily very high doses of melatonin (30 or even 60 mg per day), we did not see any harmful side effects and haveProblems of dosage and side effects may also arise from impurities in the melatonin preparations sold over the counter. Contaminants have repeatedly been detected in such material, including our own experience of that kind. As long as the contaminant is only AFMK, this may be less serious, but one should be aware that the pharmacology of kynuramines is only partially known. Moreover, manufacturers must consider that an easily oxidizable compound like melatonin can undergo reactions under air exposure. On large surfaces, such as silica gels, we see this every day in the laboratory.Another important aspect for the use of melatonin as a food additive is timing. As soon as the substance is given as a pill or as a preparation from a medicinal plant causing relatively high pharmacological blood levels, the situation is entirely different from the uptake with normal food or from the postprandial gastrointestinal release. Since circulating melatonin peaks at night, pharmaceutical preparations should be strictly given at the same time of day in the evening. The usual recommendation \u201eat bed time\" may be insufficient since this could mean in practice different hours of the day. Here, one has to consider the chronobiological functions of melatonin. When given during the day, a high dose of melatonin would cause mild narcotic effects, drowsiness etc. and the practice is not recommended for this reason. It would not shift the circadian oscillator much, because of the silent zone of the phase response curve for melatonin, in which phase shifts are negligibly small. This is the same reason that a postprandial release of gastrointestinal melatonin does not shift the circadian oscillator. Advance shifts of the endogenous clock by melatonin are much larger at late afternoon and early night ,158. TheIn terms of nutrition, melatonin is interesting both as a natural constituent of food, and as a food additive. Its use for the latter purpose can be recommended only with some caution, given the present state of our knowledge, although the risks by melatonin appear remarkably low, compared to other medications and food additives. Melatonin's antioxidant capacity is based not only on direct radical detoxification, but comprises manifold effects. Some of the most promising areas, modulation of mitochondrial metabolism by melatonin and actions of its kynuric metabolites, deserve particular attention in the future and may change our view of the value of these compounds profoundly.bis-(3-ethylbenzthiazoline-6-sulfonic acid)ABTS: 2, 2'-azino-N1-acetyl-N2-formyl-5-methoxykynuramineAFMK: ALS: amyotrophic lateral sclerosisN1-acetyl-5-methoxykynuramineAMK: c3OHM: cyclic 3-hydroxymelatoninCOX-2: cyclooxygenase 2GSSG: oxidized glutathioneAuthors declare that they have no competing interests concerning the use of melatonin or melatonin-containing preparations as a food additive.This review was initiated by SRP-P; a first version by RH was jointly revised."} +{"text": "Amyloid-\u03b2 toxicity is antagonized by melatonin and one of its kynuramine metabolites. Cytoskeletal disorganization and protein hyperphosphorylation, as induced in several cell-line models, have been attenuated by melatonin, effects comprising stress kinase downregulation and extending to neurotrophin expression. Various experimental models of AD, PD and HD indicate the usefulness of melatonin in antagonizing disease progression and/or mitigating some of the symptoms. Melatonin secretion has been found to be altered in AD and PD. Attempts to compensate for age- and disease-dependent melatonin deficiency have shown that administration of this compound can improve sleep efficiency in AD and PD and, to some extent, cognitive function in AD patients. Exogenous melatonin has also been reported to alleviate behavioral symptoms such as sundowning. Taken together, these findings suggest that melatonin, its analogues and kynuric metabolites may have potential value in prevention and treatment of AD and other neurodegenerative disorders.Increased oxidative stress and mitochondrial dysfunction have been identified as common pathophysiological phenomena associated with neurodegenerative disorders such as Alzheimer's disease (AD), Parkinson's disease (PD) and Huntington's disease (HD). As the age-related decline in the production of melatonin may contribute to increased levels of oxidative stress in the elderly, the role of this neuroprotective agent is attracting increasing attention. Melatonin has multiple actions as a regulator of antioxidant and prooxidant enzymes, radical scavenger and antagonist of mitochondrial radical formation. The ability of melatonin and its kynuramine metabolites to interact directly with the electron transport chain by increasing the electron flow and reducing electron leakage are unique features by which melatonin is able to increase the survival of neurons under enhanced oxidative stress. Moreover, antifibrillogenic actions have been demonstrated Som125I]-iodomelatonin was shown to bind to mitochondrial membranes . One cacf. ref. ,261]. WhAt least, melatonin has several obvious advantages over other comparable compounds, in particular, most other antioxidants. Because of its balanced amphiphilicity, it crosses the blood-brain barrier and enters any cellular compartment, including mitochondria ,40,262.The question whether melatonin has a causal value in preventing or treating AD, affecting disease initiation or progression of the neuropathology and the driving mechanisms, remains to be answered in future studies. Double-blind multicenter studies are urgently needed to further explore and investigate the potential and usefulness of melatonin as an antidementia drug. Its apparent usefulness in symptomatic treatment, concerning sleep, sundowning etc., even in a progressed state, further underlines the need for such decisive studies.Melatonin as a sleep-promoting agent has been tried in a small non-homogenous group of elderly patients with primary insomnia (3 mg p.o. for 21 days) associated with dementia or depression. Seven out of ten dementia patients having sleep disorders treated with melatonin (3 mg p.o. at bed time) showed a significant decrease in sundowning and reduced variability of sleep onset time . In anotThe major findings were confirmed in a double-blind study, with regard to sleep-wake rhythmicity, cognitive and non-cognitive functions . In a la25\u201335 microinjection into the SCN .2O2 formation, to which dopamine oxidation by MAO contributes should While complex I inhibition is a plausible cause of neurodegeneration in the toxicological animal models, it would be of particular importance to know whether mitochondrial dysfunction is relevant in the PD patient. In fact, decreases in complex I activity were reported for mitochondria from platelets and in the substantia nigra of parkinsonian individuals -294. HowThe pleiotropy of melatonin's antioxidant and otherwise protective effects is, on the one hand, a hindrance for relating cell survival to a particular, single mechanism in a given experimental situation, but, on the other hand, may give an impression of the powerful concerted actions of this indoleamine. Protection by melatonin was demonstrated in a variety of experimental PD models. . I+-induced cell death, but also activation of Cdk5 and cleavage of p35 to the hyperactivator p25 [+ study [Recently, a possible melatonin-sensitive link between mitochondria, hyperphosphorylation and neuronal apoptosis became apparent, with general implications for mental deficits. In a study conducted in cerebellar granular neurons, melatonin did not only antagonize MPPator p25 . This prator p25 -301. Morator p25 . These fator p25 -305. Howator p25 . Whether[+ study influencWhile all experiments on MTPT- or 6-OHDA-induced oxidative stress unanimously report protection by melatonin -290,307,These findings show that antioxidative protection and even potentially beneficial mitochondrial effects do not suffice for judging the value of a drug under systemic aspects. The multiplicity of melatonin's actions, including the receptor-mediated ones, has to be a matter of responsible caution.L-DOPA-treated but not in untreated patients, as compared to control subjects [L-DOPA, daytime melatonin was additionally increased [Melatonin secretion patterns have been studied in patients suffering from PD. A phase advance of the nocturnal melatonin maximum was noted in subjects -313. UndIn rats, fluctuations in serum melatonin levels were also related to variations in motor function and attributed to the interaction of monoamines with melatonin in the striatal complex . MelatonStudies undertaken in elderly insomniacs have convincingly demonstrated that melatonin can increase sleep efficiency and decrease nighttime activity ,318. Adm2+ dependence explains the relationship to NMDA receptor-mediated excitation, and the selective vulnerability of frequently excited neurons carrying this receptor [in vivo relevance. An alternate experimental model, using 3-nitropropionic acid as a blocker at complex II [Among neurodegenerative disorders, HD is the most clearly mitochondria-related disease. Primary cause is a mutation in the huntingtin gene, leading to an extended polyQ repeat, which causes protein misfolding and secondary effects hereof. Although huntingtin misfolding has multiple consequences, including some concerning iron metabolism , mitochoreceptor ,327. Forreceptor -331. Addreceptor , a findimplex II ,333,334,1/MT2 blocker luzindole [Melatonin was shown to prevent quinolinic acid-induced lipid peroxidation in rat brain homogenates and celluzindole . Therefouzindole . In braiuzindole . Lipid puzindole . CollectThe most striking feature of melatonin is its pleiotropy, with regard to both target cells and mechanisms. Any consideration of the possible value of melatonin has to take this into account and to weigh advantages and eventual disadvantages of effects exerted at the various levels of action. A balanced and responsible view will only be achieved if the meaning of the multiplicity of actions is clearly seen and distinctions are made between the various experimental systems and the relevance of their outcome relative to the situation in a patient.Without any doubt, melatonin is one of the most powerful antioxidants acting at various levels, from direct radical scavenging and enzymatic regulation of oxidant formation to mitochondrial radical avoidance . AdditioNevertheless, one should not forget to what extent the model systems represent artificial situations, which can only partially portray the disease of a patient, and which are frequently based on powerful pharmacological or toxicological means. Consequently, doses of melatonin required are frequently in an upper pharmacological range, too, setting limits to the judgment on melatonin's value. With all due reserve, one can, however, state that the application of melatonin is still a source of hopes for possibilities of intervention, also because melatonin is usually remarkably well tolerated by the treated individual, contrary to many other medications. Long-term administration of oral melatonin of 30 or 60 mg per day in a slow-release formulation was surprisingly unproblematic and safe in ALS patients . In a mo+ [Caution seems due at the present state of our knowledge in the case of PD. At least in rat models, suppression of membrane receptor-mediated melatonin effects alleviated symptoms induced by 6-OHDA or MPP+ -310. ThiContrary to this, the balance seems to be largely in favor of melatonin in the case of AD. Apart from the positive effects in experimental systems concerning antagonism of oxidative stress, fibrillogenesis and tangle formation, the sleep-promoting effects \u2013 even if not demonstrable in all individuals \u2013 and the suppression of sundowning are important results justifying the use melatonin. Mild cognitive improvements should also be welcome. The problem in AD remains to which extent melatonin may be effective in retarding disease progression. One should not expect too much in an advanced state. Nevertheless, the preventive potential of melatonin deserves attention and continued investigation. Even from a cautious and realistic, perhaps even sceptical point of view, the findings obtained to date should be taken as a good reason for planning further multicenter trials, in which, however, the collectives of patients have to be large enough for distinguishing between different stages of disease progression. Whether or not melatonin may have a preventive potential might become clear in subpopulations of high-risk individuals, e.g. those with pertinent familial history or carrying unfavorable apolipoprotein variants.With regard to prevention, melatonin should also be seen in the general context of aging. In the past, this has been a matter of controversy, but mainly for methodological reasons. Recent studies show that age-dependent patterns of gene expression can be reverted to a more juvenile state in the mouse CNS . Life ex"} +{"text": "It has been well documented that the pineal hormone, melatonin, which plays a major role in the control of reproduction in mammals, also plays a role in the incidence and growth of breast and mammary cancer. The curative effect of melatonin on the growth of dimethylbenz [a]anthracene-induced (DMBA-induced) mammary adenocarcinoma (ADK) has been previously well documented in the female Sprague\u2013Dawley rat. However, the preventive effect of melatonin in limiting the frequency of cancer initiation has not been well documented.The aim of this study was to compare the potency of melatonin to limit the frequency of mammary cancer initiation with its potency to inhibit tumor progression once initiation, at 55 days of age, was achieved. The present study compared the effect of preventive treatment with melatonin (10 mg/kg daily) administered for only 15 days before the administration of DMBA with the effect of long-term (6-month) curative treatment with the same dose of melatonin starting the day after DMBA administration. The rats were followed up for a year after the administration of the DMBA.The results clearly showed almost identical preventive and curative effects of melatonin on the growth of DMBA-induced mammary ADK. Many hypotheses have been proposed to explain the inhibitory effects of melatonin. However, the mechanisms responsible for its strong preventive effect are still a matter of debate. At least, it can be envisaged that the artificial amplification of the intensity of the circadian rhythm of melatonin could markedly reduce the DNA damage provoked by DMBA and therefore the frequency of cancer initiation.In view of the present results, obtained in the female Sprague\u2013Dawley rat, it can be envisaged that the long-term inhibition of mammary ADK promotion by a brief, preventive treatment with melatonin could also reduce the risk of breast cancer induced in women by unidentified environmental factors. MBYDJC equally carried out the experimental studies. MHP made a contribution to the acquisition of data. AM performed the histological analysis. RS participated in the design of the study and performed the statistical analysis. BK conceived the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript."} +{"text": "Aging is associated with a decline in immune function (immunosenescence), a situation known to correlate with increased incidence of cancer, infectious and degenerative diseases. Innate, cellular and humoral immunity all exhibit increased deterioration with age. A decrease in functional competence of individual natural killer (NK) cells is found with advancing age. Macrophages and granulocytes show functional decline in aging as evidenced by their diminished phagocytic activity and impairment of superoxide generation. There is also marked shift in cytokine profile as age advances, e.g., CD3+ and CD4+ cells decline in number whereas CD8+ cells increase in elderly individuals. A decline in organ specific antibodies occurs causing reduced humoral responsiveness. Circulating melatonin decreases with age and in recent years much interest has been focused on its immunomodulatory effect. Melatonin stimulates the production of progenitor cells for granulocytes-macrophages. It also stimulates the production of NK cells and CD4+ cells and inhibits CD8+ cells. The production and release of various cytokines from NK cells and T-helper lymphocytes also are enhanced by melatonin. Melatonin presumably regulates immune function by acting on the immune-opioid network, by affecting G protein-cAMP signal pathway and by regulating intracellular glutathione levels. Melatonin has the potential therapeutic value to enhance immune function in aged individuals and in patients in an immunocompromised state. Aging is a complex physiological process that involves a number of biochemical reactions, with molecular changes that are manifested in single cells as well as in the whole organism. Aging reflects the sum total of all changes that occur in living organisms with the passage of time that lead to functional impairment and increased pathology. Aging is characterized by a diminished ability to respond to stress . Among tAging is associated with a decline in immune function known as immunosenescence. This situation implies increased susceptibility to infectious diseases and cancer due to a decreased capacity of the immune system to respond to antigenic stimulation . This reMelatonin is a natural antioxidant with significant anti-aging properties . Indeed,Immunosenescence is associated with increased incidence of cancer and of degenerative and infectious diseases. The progressive functional T cell and B cell deficits may be the main responsible factors for age-associated disorders ,14,15. TAging affects the innate immune system . In the Functional impairment of macrophages and granulocytes are reported in the elderly. Diminished intracellular phagocytic activity, degranulation and decrease in chemotactic and phagocytic activity have all been found in polymorphonuclear leukocytes of elderly individuals ,28. In aDiminished IL-1 levels and diminished generation of reactive oxygen species (ROS) from monocytes of elderly subjects has been reported (reviewed by ). IL-6 occurs with increase in age. An extensive review on T cell function in aging was published by Pawelec et al. . With agRA+CD4+ oMelatonin (N-acetyl-5-methoxytryptamine) is formed mainly in the pineal gland of most mammals including man . In the The age-related impairment of the immune system first appears around 60 years of age coinciding with the decrease of plasma melatonin concentration. Indeed, melatonin has a defined immunomodulatory role both in animals and humans ,73. The Melatonin exerts its many physiological actions by acting on membrane and nuclear receptors although many of its actions are receptor-independent . The two melatonin receptors cloned (MT1 and MT2) are membrane receptors that have seven membrane domains and belong to the superfamily of G-protein coupled receptors . MelatonIn recent years much attention has been devoted to the possible interaction between melatonin and the immune system ,73,80. MA number of studies support the immunoregulatory action of melatonin on the body's innate immunity . MelatonNK cells play an important role in immunosurveillance against neoplasia and virus infected cells ,98. IFN-Melatonin has been proposed to regulate the immune system by affecting cytokine. production in immunocompetent cells . MelatonHuman lymphocytes themselves play an important role in stimulating IL-2. production in an autocrine or paracrine fashion . After mMicronutrients like zinc, selenium and vitamin E play a vital role in phagocytic function . Since mBesides its stimulatory action on the production of several cytokines that regulate immune function, melatonin's immunoenhancing properties have been attributed to a direct action on the immunocompetent cells . Earlier studies demonstrated that the thymus is a primary target of melatonin's action. The thymus is an organ of youth in mammals, yet any influences on the thymus in youth will have profound effects on the immune system of elderly mammals. A milestone, earlier demonstration revealed that pinealectomized, young mice underwent accelerated involution of the thymus . The pre7, while it dropped to 7.3 \u00d7 107 cells in 24 months-old animals; in melatonin treated old mice the total number of thymocytes was 9.1 \u00d7 107 cells -melatonin high affinity binding sites and a signal tranduction pathway for melatonin have been characterized in human lymphocytes [The immunostimulatory role of melatonin is exerted mainly on Th cells and on T lymphocyte precursors. There is a possibility that melatonin could act as an autocoid in bone marrow as shown by the demonstration of melatonin synthesis in bone marrow cells of mice and humans . The exiphocytes ,124. Melphocytes . Collectphocytes .Besides the release of proinflammatory Th-1 cytokines, such as IFN-gamma and IL2 administration of melatonin to antigen-primed mice increased the production of IL10, indicating that melatonin can also activate anti-inflammatory Th-2-like immune responses in certain circumstances . TherefoStudies by Drazen and Nelson indicateIt has been suggested that Th-1 responses are readily transformed into Th-2 dominance through depletion of intracellular GSH . GSH in Since melatonin stimulates the production of glutathione its immuRecent studies reveal that not only melatonin but also its oxidation product N1 acetyl-N2-formyl-5-methoxykynuramine (AFMK) is very effective in acting onneutrophils ,145. BotA number of recent studies point out that seasonal changes exert influence on immune function and melatonin may play an important role in this aspect. Seasonal changes of immune function in animals are mediated by the duration of melatonin secretion, which acts as a photoperiodic signal . Such seThe age-associated decline in immune function, known as immunosenescence, is characterized by a decrease in the functional activity of NK cells, granulocytes and macrophages. There is significant reduction in IL-1 and diminished generation of ROS from monocytes. In addition, there is an increase of IL-6 production. Besides causing changes in innate immunity, aging is associated with changes in cellular and humoral immunity. Decreases of CD3 and CD4 and increases of CD8 cells occur in elderly individuals. The decrease in IL-2 production that occurs during aging causes a reduced antibody formation. Melatonin seems to play a significant immunomodulatory role. Melatonin enhances both innate and cellular immunity. It stimulates the production of progenitor cells of granulocytes and macrophages and of NK cells. Production of IL-2, IL-6 and IL-12 is stimulated by melatonin. Increased T-helper production, particularly of CD4+ cells, occurs after melatonin supplementation. Melatonin decreases CD8+ cells. Melatonin may act through the immune-opiod network. The regulation of immune function by melatonin appears to involve cAMP signal transduction, L-type Ca2+ channels and glutathione. The seasonal changes in immune function observed in animals and humans are likely to be mediated by the changes in the duration of melatonin secretion."} +{"text": "C. elegans eat-6 gene encodes a Na+, K+-ATPase \u03b1 subunit and is a homolog of the familial hemiplegic migraine candidate gene FHM2. Migraine is the most common neurological disorder linked to serotonergic dysfunction. We sought to study the pathophysiological mechanisms of migraine and their relation to serotonin (5-HT) signaling using C. elegans as a genetic model. In C. elegans, exogenous 5-HT inhibits paralysis induced by the acetylcholinesterase inhibitor aldicarb. We found that the eat-6(ad467) mutation or RNAi of eat-6 increases aldicarb sensitivity and causes complete resistance to 5-HT treatment, indicating that EAT-6 is a component of the pathway that couples 5-HT signaling and ACh neurotransmission. While a postsynaptic role of EAT-6 at the bodywall NMJs has been well established, we found that EAT-6 may in addition regulate presynaptic ACh neurotransmission. We show that eat-6 is expressed in ventral cord ACh motor neurons, and that cell-specific RNAi of eat-6 in the ACh neurons leads to hypersensitivity to aldicarb. Electron microscopy showed an increased number of synaptic vesicles in the ACh neurons in the eat-6(ad467) mutant. Genetic analyses suggest that EAT-6 interacts with EGL-30 G\u03b1q, EGL-8 phospholipase C and SLO-1 BK channel signaling to modulate ACh neurotransmission and that either reduced or excessive EAT-6 function may lead to increased ACh neurotransmission. Study of the interaction between eat-6 and 5-HT receptors revealed both stimulatory and inhibitory 5-HT inputs to the NMJs. We show that the inhibitory and stimulatory 5-HT signals arise from distinct 5-HT neurons. The role of eat-6 in modulation of excitatory neurotransmission by 5-HT may provide a genetic explanation for the therapeutic effects of the drugs targeting 5-HT receptors in the treatment of migraine patients.The The first two FHM genes are conserved in this organism and are designated as unc-2 and eat-6, respectively. Analysis of unc-2 mutants has been undertaken for modeling of FHM1 migraine channelopathy eat-6 to gain new insights into biochemical and physiological mechanisms of migraine pathology.Serotonin functions as a neuromodulator by inhibiting and enhancing synaptic transmission of other neurotransmitters. Dysregulation of 5-HT signaling has been implicated in pathophysiology of many disorders, including migraine +,K+-ATPase is a sodium pump that uses energy derived from ATP hydrolysis to extrude cytoplasmic Na+ in exchange for extracellular K+ across the plasma membrane +,K+-ATPase \u03b1 subunits C. elegans genome harbors four other Na+,K+-ATPase \u03b1 subunit genes besides eat-6eat-6 deletion mutant is reported to be embryonic lethal/early larval arrest (http://www.wormbase.org). Four other eat-6 mutations were initially isolated for feeble contractions and delayed relaxations of the pharyngeal muscles eat-6 is localized at the NMJs in the bodywall muscles and regulates synaptic efficacy eat-6 function in C. elegans might provide a deeper insight into the mechanisms of migraine in humans.The Naeat-6 may also act in locomotory cholinergic neurons, and that mutations in eat-6 disrupt inhibitory 5-HT input to the control of excitatory synaptic transmission at C. elegans bodywall NMJs.Here we provide evidence that ad467, ad601 and ad997 alleles are missense mutations leading to the following amino acid substitutions in the EAT-6 protein: L359F, G522E and S761F, respectively ad792 allele carries a missense mutation that results in the R569H substitution. All four eat-6 mutations substitute amino acid residues that are conserved in human FHM2. Three out of four mutated residues are in the intracellular 4\u20135 loop mutation Sequencing of mutant genomic DNA confirmed that 4\u20135 loop , which cC. elegans due to accumulation of acetylcholine (ACh) at the locomotory NMJs, and is therefore frequently used to measure the steady state ACh release in living C. elegans animals eat-6 alleles, the ad467 mutant showed the strongest defects in the function of the pharyngeal muscles ad467 animals were hypersensitive to aldicarb and completely resistant to 5-HT treatment mutation disrupts 5-HT regulation in the egg-laying circuit as well as 5-HT-induced modulation of ACh neurotransmission at the bodywall NMJs. The differential effects of the eat-6 mutations on the function of the pharyngeal muscles To further characterize the effect of g laying [18]. Theat-6 mutants, we used RNA interference (RNAi) to knock down eat-6 gene activity. The strain rrf-3(pk1426) has enhanced neuronal sensitivity to RNAi rrf-3 worms fed with E. coli expressing dsRNA targeted to eat-6, but not the empty vector (mock RNAi), showed abnormalities similar to, but stronger than those seen in the eat-6 mutants. They had a smaller body size, a reduced number of eggs in the uterus, hypersensitivity to aldicarb and resistance to 5-HT ]. As it has been shown previously ad467 mutant mutant carrying a single copy of the nT1 balancer contains two copies of the eat-6(ad467) mutant gene and one copy of the WT eat-6 gene from the balancer; these animals showed significantly reduced aldicarb hypersensitivity, compared to the eat(ad467) mutant without the balancer (eat-6(ad467) is a reduction-of-function mutation ad467 mutant.Extrachromosomal arrays usually carry multiple copies of the transgene, so to test whether the aldicarb hypersensitivity of the balancer . This re6. In contrast to the effect on aldicarb sensitivity, expression of Ex[eat-6(+)] in WT background did not change EPG triggered an action potential (AP) in the pharyngeal muscles (eat-6(ad467) mutation did not change the probability of AP generation, but reduced the rate of AP decay, which corresponds to a reduced amplitude of the recovery (R) peak in EPG and generated multiple transgenic lines from independent injections of this construct. Like that of many other GFP reporters, the expression of peat-6::gfp was mosaic, but was consistent in terms of cell types in at least three lines that were carefully examined in several generations. In agreement with a previous study eat-6 expression in many neurons, including the ventral cord ACh neurons, as well as in several head and tail neurons mutant animals were hypersensitive to paralysis induced by levamisole, a specific agonist of the nicotinic ACh receptor UNC-29 (Ex[eat-6(+)] transgene, a transgene expressing the WT eat-6 cDNA under the bodywall muscle-specific myo-3 promoter (Muscle::eat-6) also caused strong hypersensitivity to levamisole in the WT background (eat-6(ad467) and eat-6(ad601) mutants by expressing eat-6 in the muscles eat-6 in the transgenic arrays.EAT-6 function at the postsynaptic site of ACh neurotransmission at the bodywall NMJs has been reported by others r UNC-29 . Furtherckground . This reeat-6 also functions in the ACh neurons to regulate neurotransmission. We knocked down eat-6 expression in the ACh neurons using cell-specific RNAi eat-6 was silenced in the ACh neurons were hypersensitive to aldicarb, but not to levamisole . Like Ex[eat-6(+)] and Muscle::eat-6, ACh::eat-6 did not correct aldicarb hypersensitivity or 5-HT resistance in eat-6 mutant animals mutant significantly reduces ACh release, and therefore is resistant to aldicarb-induced paralysis ACh::eat-6 transgene was crossed into the unc-17(e245) background, the transgenic animals became completely resistant to aldicarb animals. We found that UNC-29::GFP fluorescence at the bodywall NMJs was slightly increased in the ad467 animals relative to WT , which is again consistent with the previous report eat-6(ad467) mutation does not cause any gross defect in morphology of the NMJs.We also examined fluorescence of the GFP-tagged synaptic vesicle marker synaptobrevin eat-6(ad467) mutant is resulted from alterations in synaptic vesicle formation or distribution, we carried out ultrastructural analysis of the ACh synapses by transmission electron microscopy (TEM). We found that the mean number of vesicles per synaptic profile was greater in the mutant relative to WT mutant. G\u03b1q EGL-30 promotes production of diacylglycerol (DAG), which facilitates ACh release from the ventral cord motor neurons egl-30(ad806) loss-of-function mutant animals are resistant to aldicarb egl-30(ad806) eliminated aldicarb hypersensitivity of ad467 lf mutation also suppressed hypersensitivity of the eat-6 mutant to aldicarb gain-of-function mutation are resistant to aldicarb ad467 mutation into the slo-1(ky399) background, the double mutant remained as hypersensitive to aldicarb as the single eat-6(ad467) mutant (eat-6(ad467);egl-30(ad806) double mutant that became resistant (slo-1(ky399).There are no predicted voltage-gated Na) mutant , in contesistant . This reeat-6 in the WT background caused hypersensitivity to aldicarb as did the ad467 mutation (slo-1(ky399);Ex[eat-6(+)] transgenic animals exhibited aldicarb sensitivity similar to that of WT animals worms was suppressed by egl-30(ad806), but not by slo-1(ky399), we tested whether 5-HT can modify aldicarb sensitivity in slo-1 mutants. We found that both loss- and gain- of-function slo-1 mutants were resistant to 5-HT treatment (Ex[eat-6(+)] remained partially responsive to 5-HT treatment animals and 3 coreatment . Furtherreatment . We concreatment , indicatC. elegans genome encodes one ionotropic 5-HT receptor and seven predicted G protein-coupled 5-HT receptors ser-4(ok512)ser-4 gene rescued 5-HT sensitivity of the ser-4(ok512) mutant in the ok512 background. The 5-HT response in such animals was fully restored mutant , indicatrestored . Deletioreatment , suggesteat-6(ad467);ser-4(ok512) double mutant. Surprisingly, although the ser-4(ok512) mutant itself showed WT sensitivity to aldicarb, the ser-4 mutation significantly suppressed aldicarb hypersensitivity of the eat-6(ad467) mutant mutant mutant . Likewis) mutant . These reat-6(ad467) mutant by the ser-4 mutation raises a possibility for a stimulatory 5-HT input to ACh neurotransmission. Genetic analysis of C. elegans has demonstrated that distinct serotonergic neurons regulate specific aspects of behavior C. elegans hermaphrodites, 5-HT is primarily produced in the ADF chemosensory neurons, the NSM secretory neurons in the head region, and the HSN motor neurons responsible for egg laying Suppression of aldicarb hypersensitivity of the tph-1 cDNA either in the ADF neurons or the NSM neurons in a tph-1 null background. To prevent neurons from absorbing extracellular 5-HT, we introduced individual neuron-specific tph-1 transgenes into the tph-1;mod-5 double mutant. We confirmed the presence of 5-HT in specific neurons by staining the transgenic animals with anti-5-HT antibodies (data not shown). When the tph-1 transgene was expressed in the ADF neurons in the tph-1;mod-5 background, the worms became strongly hypersensitive to aldicarb , a wave of transient neuronal depolarization that spreads over the brain cortex and presumably activates the trigeminovascular system resulting in migraine headache. Mutations in all FHM genes have been predicted to cause increased levels of the neurotransmitter glutamate and Keat-6 mutations may enhance ACh neurotransmission at the NMJ? A postsynaptic role for eat-6 has been shown convincingly before by others eat-6 RNAi results suggest that eat-6 may also function in the ACh neurons to regulate neurotransmission. We observed an increased number of synaptic vesicles in the eat-6(ad467) mutant. Although the mechanism by which Na+,K+-ATPase regulates the abundance of synaptic vesicles is unclear, our genetic analyses shed some light on a possible role of EAT-6 in regulation of ACh neurotransmission. The aldicarb hypersensitivity by reduced EAT-6 function could be, at least in part, ascribed to exaggeration of EGL-30 G\u03b1q signaling to the EGL-8 phospholipase, because a reduction of egl-30 and egl-8 function suppressed aldicarb hypersensitivity of the eat-6(ad467) mutant. Moreover, we found that a slo-1(gf) mutant overexpressing EAT-6 exhibited WT aldicarb sensitivity, although slo-1(gf);eat-6 double mutant worms were as hypersensitive to aldicarb as the eat-6 single mutant. These results suggest that, while both reduced and excessive EAT-6 function may increase ACh neurotransmission, their mechanisms differ. One possibility would be that the hyperactivity of SLO-1 compensates for the effects caused by increased EAT-6 function, whereas a reduced transmembrane K+ gradient in eat-6 mutant animals renders this hyperactive SLO-1 channel inefficient. It has been reported that EAT-6 possesses a novel function that is unrelated to the pump function of this enzyme eat-6 mutants by expressing EAT-6 in the ACh neurons, other experiments are necessary to determine its role in regulation of presynaptic neurotransmission.What are the molecular mechanisms by which eat-6 not only regulates ACh neurotransmission, but it is also involved in modulation of this process by exogenous and endogenous 5-HT. Our observation of eat-6 mutants as well as mutants of many synaptic components being completely resistant to 5-HT treatment suggests that eat-6 is one component mediating the inhibitory input of 5-HT to ACh neurotransmission. This result could be relevant to the therapeutic effects of drugs targeting 5-HT receptor subtypes in the treatment of migraine We demonstrated that ser-4 revealed dual stimulatory and inhibitory 5-HT inputs to ACh neurotransmission. One the one hand, ser-4 appears to be the primary receptor that mediates inhibition of ACh neurotransmission by exogenous 5-HT. On the other hand, deletion of ser-4 significantly suppressed aldicarb hypersensitivity of the eat-6(ad467) mutant, suggesting that SER-4 activity is required for the increased aldicarb sensitivity of the eat-6 mutant. Such dual activities of 5-HT receptors have been observed in mammals. For example, the 5-HT1A receptor can both stimulate and inhibit adenylyl cyclase ser-4 may function in different neurons to inhibit or stimulate ACh neurotransmission. In rodents, in vivo binding assays showed that the 5-HT1A receptor expressed in different neurons in the CNS has different affinities to 5-HT. It is plausible that different levels of 5-HT differentially activate SER-4 in different neurons to modulate ACh neurotransmission. Consequently, the ser-4 mutation would abolish both the inhibitory and stimulatory 5-HT inputs to ACh neurotransmission, while loss of EAT-6 may selectively block the inhibitory 5-HT input. Interestingly, we found that specific serotonergic neurons are responsible for stimulatory and inhibitory 5-HT inputs to ACh neurotransmission at the bodywall NMJs. Genetic analyses in C. elegans have demonstrated that 5-HT released from specific neurons regulates specific behavior Analysis of the G protein-coupled 5-HT receptor C. elegans strains were maintained at 20\u00b0C as described N2. Mutants used were: AQ279 unc-29(x29);Ex, CX6741 tph-1(mg280);Ex[ADF::tph-1], CX7749 tph-1(mg280);Ex[NSM::tph-1], DA1239 eat-6(ad467);adEx1239, eat-6(ad467), eat-6(ad601), eat-6(ad792), eat-6(ad997), VC836 eat-6(ok1334)/nT1[qIs51], egl-8(n488), egl-30(ad806), egl-30(tg26), mod-1(ok103), mod-5(n3314), MT15434 tph-1(mg280), NM670 Ex, ocr-2(yz5), rrf-3(pk1426), ser-1(ok345), ser-3(ok1995), ser-3 (ok2007), ser-4(ok512), ser-5(tm2647), ser-5(tm2654), ser-7(tm1325), slo-1(js379), slo-1(ky399), tom-1(ok285), unc-17(e245).eat-6(ad467) double mutants were generated in this study: eat-6(ad467);egl-30(ad806), eat-6(ad467);egl-8(n488), eat-6(ad467);slo-1(ky399), eat-6(ad467);tph-1(mg280), eat-6(ad467);ser-4(ok512), eat-6(ad467);nT1. In the case of the deletion alleles n488, mg280 and ok512 that can be identified by PCR, we first isolated homozygous ad467 based on its slow pharyngeal pumping, small body size and fewer eggs , then isolated the homozygous deletion mutations. In the case of the missense alleles ky399 and ad806, we first isolated cross-progeny showing the phenotypes of the homozygous ky399 ]eat-6 cDNA was amplified from RNA isolated from WT animals by RT-PCR and fused with unc-54 3\u2032 UTR and either the unc-17myo-3punc-17::mCherry was generated by fusion of the unc-17 promoter element with the sequence of mCherry and unc-54 3\u2032-UTR. The Ex[ser-4(+)] transgene has been described previously ser-4 cDNA amplified from WT RNA was fused with the unc-17 promoter and unc-54 3\u2032 UTR. The construction and characterization of the transgenes expressing tph-1 in the ADF (under the srh-142 promoter) or NSM (under the ceh-2 promoter) neurons have been described All the constructs were generated by PCR, and purified PCR fragments were used to generate transgenic animals. Unless specified otherwise, eat-6 expression specifically in ACh neurons, we used a cell-specific RNAi approach eat-6 exon-rich 1089 bp genomic fragment, which was used to generate the eat-6 RNAi clone in the RNAi feeding library unc-17 promoter and unc-54 3\u2032 UTR, so that the eat-6 gene fragment can be transcribed by the unc-17 promoter in the sense and antisense orientations. The two constructs were coinjected into worms in equal concentrations (\u223c100 ng/\u00b5l).To knock down GFP fluorescence was monitored using a 63\u00d7 objective lens with an AxioImager Z1 miscroscope (Zeiss). Images were captured at 2\u00d72 binning with an AxioCam MR digital camera using the AxioVision software (Zeiss). The neutral density filter #5 of the microscope was used to reduce the intensity of fluorescence excitation light to mitigate bleaching. The same exposure time (500 ms) was used for all samples. The ImageJ software (NIH) was used for image analysis.Sensitivity to drugs was determined by scoring paralysis after placing the animals on plates containing aldicarb or levamisole (Sigma) at the concentrations indicated in the figures. L4 stage animals were transferred to plates seeded with food and incubated at 20\u00b0C overnight, and resultant young adults were analyzed. An animal was scored as being paralyzed if no movement was detected after prodding with a platinum wire. In all experiments except that in Egg-laying behavior was evaluated by two well-established methods . In both cases L4 stage animals were picked onto fresh plates seeded with food and allowed to develop at 20\u00b0C, and one-day old adults were analyzed. To test the response to 5-HT, animals were placed individually into wells of a 96-well plate, with each well containing 100 \u00b5l of a solution (M9 buffer or M9 buffer containing 5 mg/ml of serotonin). The number of eggs laid was scored after 1 h. To score the number of eggs carried in the uterus, individual one-day old adults were placed into a drop of solution containing commercial bleach and 2N NaOH on a glass slide. The bleach solution dissolved the body of the adult animal, and eggs, which were protected by their eggshells, were scored immediately. Eight animals per genotype for each condition were assayed in each trial.Extracellular recording of the electrical activity of the pharynx was made from intact worms as previously described For transmission EM one-day old adult animals were fixed by high-pressure freezing and freeze-substitution, using 2% osmium tetroxide in acetone as the primary fixative t test. Throughout the article data are expressed as mean \u00b1 SEM.Statistical analyses were performed using Origin 7.0 software . Significance was tested using an unpaired two sample Student's Figure S1eat-6 gene rescues the aldicarb hypersensitivity of the eat-6(ad467) mutant. Relative reciprocal T50 values of aldicarb-induced paralysis of worms with different ratios of WT to mutant eat-6 gene. An extra copy of the eat-6(+) locus was introduced by the nT1 translocation into the eat-6 (ok1334) deletion background or into the eat-6(ad467) background. Heterozygous ad467 animals were included as a control. The genotypes of the tested strains are schematically represented at left. The chromosomes IV and V are shown as long black and white bars, respectively. A short black bar represents the WT eat-6 gene, the horizontally hatched short bar: the eat-6(ad467) allele, and the white short bar: the eat-6(ok1334) allele. The short obliquely hatched bar represents the gfp marker. The error bars indicate SEM (n>3 replicates).A single copy of the genomic (0.48 MB TIF)Click here for additional data file.Figure S2eat-6 cDNA in ACh neurons or body-wall muscles does not rescue the aldicarb hypersensitivity of eat-6 mutants. Relative reciprocal T50 values of aldicarb-induced paralysis of worms pretreated with 5-HT (hatched bars) and those without 5-HT treatment (black bars). The values of 5-HT-treated WT worms and mutants are normalized to that of WT worms without 5-HT treatment. The error bars indicate SEM (n>3 replicates).Expression of (0.21 MB TIF)Click here for additional data file.Figure S3unc-17(e245) and unc-17(e245);ACh::eat-6 transgenic animals. The error bars indicate SEM (n\u200a=\u200a3 replicates).Time courses of aldicarb-induced paralysis of the (0.15 MB TIF)Click here for additional data file.Figure S4eat-6(ad467) background, as compared to WT. Measurements were performed in 18 ad467 and 47 WT worms. In each worm, an anterior section of the ventral cord (\u223c100 \u00b5m length) was photographed. The values of punctal fluorescence intensity were calculated from profiles drawn across the middle of the puncta along the ventral cord of individual worms. The error bars indicate SEM between worms.Intensity of UNC-29::GFP fluorescence in (0.36 MB TIF)Click here for additional data file.Figure S5egl-30 or egl-8 do not suppress hypersensitivity of the eat-6(ad467) worms to levamisole. Relative reciprocal T50 values of paralysis were calculated as shown in Mutations in (0.41 MB TIF)Click here for additional data file.Figure S6eat-6 and eat-6;ser-4 mutants on1 mM (a) and 0.25 (b) mM aldicarb. The difference between the two hypersensitive strains, which is not significant on 1 mM of the drug, is clearly resolved on the lower concentration. The error bars indicate SEM (n>3 replicates).Time courses of aldicarb-induced paralysis of (0.30 MB TIF)Click here for additional data file."} +{"text": "Positional cues target sensory axons to appropriate volumes of the developing nervous system independently of their synaptic partners. Drosophila sensory neurons as a model system in which to study the way in which growing neurons are guided to terminate in specific volumes of the developing nervous system. The mediolateral positions of sensory arbors are controlled by the response of Robo receptors to a Slit gradient. Here we make a genetic analysis of factors regulating position in the dorso-ventral axis. We find that dorso-ventral layers of neuropile contain different levels and combinations of Semaphorins. We demonstrate the existence of a central to dorsal and central to ventral gradient of Sema 2a, perpendicular to the Slit gradient. We show that a combination of Plexin A (Plex A) and Plexin B (Plex B) receptors specifies the ventral projection of sensory neurons by responding to high concentrations of Semaphorin 1a (Sema 1a) and Semaphorin 2a (Sema 2a). Together our findings support the idea that axons are delivered to particular regions of the neuropile by their responses to systems of positional cues in each dimension.During the development of neural circuitry, neurons of different kinds establish specific synaptic connections by selecting appropriate targets from large numbers of alternatives. The range of alternative targets is reduced by well organised patterns of growth, termination, and branching that deliver the terminals of appropriate pre- and postsynaptic partners to restricted volumes of the developing nervous system. We use the axons of embryonic Drosophila nerve cord controls the position of sensory terminals independently of their synaptic partners. This work revealed that there might be additional cues operating in a similar fashion in the dorso-ventral axis of the nerve cord. Here we report the discovery of a dorso-ventral system of positional cues, in the form of a gradient of secreted Semaphorin 2a acting at right angles to the Slit gradient, and membrane bound Semaphorin 1a differentially distributed across the neuropile. The two Semaphorins dictate the termination positions of sensory axons in the dorso-ventral axis. Together with a third signal acting in the antero-posterior axis, Semaphorins and Slit deliver axons to appropriate volumes of the neural network. These studies support a model in which axons branch and terminate, independently of synaptic partners, in response to pervasive systems of volumetric positional cues.Axons and dendrites of synaptic partners must be targeted to a common region of the developing neural network so that appropriate connections can be formed. The mechanisms underlying this targeting are incompletely understood. We showed previously that a positional cue (Slit) acting in the medio-lateral axis of the During the development of neural circuitry, neurons of different kinds must establish specific synaptic connections by selecting appropriate targets from large numbers of different alternatives. The range of these alternative targets is reduced by well organised patterns of growth, termination, and branching that deliver the terminals of appropriate pre- and postsynaptic partners to restricted regions of the developing nervous system. The mechanisms that control the coordinate projection of pre- and postsynaptic neurites to a common region are incompletely understood. Although there has been substantial progress in identifying molecular mechanisms of axon growth and guidance, far less is known about the way in which appropriate target areas are identified, leading to termination and branching Drosophila sensory neurons as a model system in which to study the way in which growing neurons are guided to terminate in a specific region of the developing nervous system. These neurons have their cell bodies in the periphery of the embryo, either close to or embedded in the body wall. Their axons grow into a central ganglion where they terminate in a neuropile that consists of a dense meshwork of interweaving axons and dendrites. Anatomically the neuropile shows few overt signs of organisation apart from clear regularities such as the commissures that cross the midline and a set of longitudinal axon bundles at stereotyped positions that provide a series of landmarks with respect to which other structures can be mapped We have used the axons of embryonic We previously showed that Slit secreted at the midline and acting through its Robo receptors constitutes a repellent gradient to which sensory neurons respond by terminating and branching at specific positions in the medio-lateral axis of the neuropile Our previous study provided evidence for at least one further signal that operates to determine positions in the dorso-ventral axis. Sensory terminals that are shifted experimentally along the medio-lateral axis of the neuropile maintain their characteristic dorso-ventral location in their new position, suggesting that the factor that determines this position may be a \u201cdorso-ventral\u201d patterning cue that is present at different positions in the medio-lateral axis. This additional finding led us to propose a general model for the cues that delineate domains within a neuropile in which presynaptic axons and their postsynaptic partners terminate and form connections termination domains within the neuropile. Since these are the domains within which specific functional sets of connections will be formed, the terminating sensory axons, by responding to pervasive positional cues, are able to lay out part of the characteristic functional architecture of the forming network.Here, we test and augment this model by using a genetic screen to identify cues and their receptors that guide terminating axons in the dorso-ventral axis of the neuropile. We find that dorso-ventral layers of neuropile contain different levels and combinations of semaphorins. We demonstrate the existence of a central to dorsal and central to ventral gradient of Sema 2a, perpendicular to the Slit gradient. We show that a combination of Plexin A (Plex A) and Plexin B (Plex B) receptors specifies the ventral projection of sensory neurons by responding to high concentrations of Semaphorin 1a (Sema 1a) and Semaphorin 2a (Sema 2a). These signals together with the Slit/Robo system acting in the medio-lateral axis limit the arborisations of sensory axons to specific Previous studies have shown that the axons of sensory neurons project to distinct medio-lateral, dorso-ventral, and antero-posterior domains in the neuropile in correlation with their modality and dendritic morphology ppkEGFP, which labels one intersegmental nerve (ISN) and two segmental nerve (SN) neurons in each hemisegment We have extended these studies using Fasciclin II (Fas II) positive tracts as reference points [6],[10]The position of termination in the neuropile does not correlate with the nerve route by which the sensory neurons reach the neuropile see . SensoryTo investigate mechanisms that confine sensory projections of different modalities to different dorso-ventral layers of the neuropile, we carried out a gain-of-function screen for trans-membrane proteins, which, when expressed selectively in sensory neurons, shift sensory terminals with respect to Fas II tracts.PO163GAL4, UAS-n-synaptobrevin-GFP flies to target gene expression selectively to sensory neurons and simultaneously to visualise their terminals that change the pattern of sensory terminals, without altering the number of neurons or preventing sensory axons from reaching the central nervous system (CNS) . Of the layer 2 . If plex layer 1 . We also layer 1 .Drosophila there are two Plexins (A and B) and five Semas: 1a, 1b, and 5c (transmembrane) and 2a and 2b (secreted). Plex B binds Sema 2a and mediates the Sema 2a-dependent repulsion of motor and sensory axons in the periphery and the fasciculation of longitudinal tracts in the ventral nerve cord (VNC) The Plexins are receptors for the Semaphorins (Semas), a diverse family of secreted and membrane-associated proteins The Plexin overexpression phenotypes suggested that their Sema ligands might act as cues to position the terminals of neurons along the dorso-ventral axis of the forming neuropile. We therefore used antibody labelling to analyse the expression of Semas 2a and 1a in the CNS at different stages of embryogenesis: prior to sensory axon ingrowth (11-h AEL), at stages when sensory axons form their terminal arbors (13-h AEL), and several hours after sensory axons have completed their terminal arbors (21-h AEL).Sema 2a expression first becomes detectable at 11 h as the outgrowth of sensory axons begins, persists strongly until 16 h, but has disappeared by 21 h, when the embryo is mature and ready to hatch. At 13 h, when sensory axons are forming their terminal arbors, the highest levels of Sema 2a are in layer 2 in the centre of the neuropile . StrikinSema 1a expression is present at 10-h AEL, before sensory axons have entered the neuropile and persists throughout embryogenesis (unpublished data). By 13 h the highest levels of Sema 1a are in the lateral and intermediate portions of layers 1 and 3, at lower levels in layer 2, and not detectable in layer 4 . In addiWe also analyzed the distributions of Sema 1a and Sema 2a in the antero-posterior axis, at the time of sensory axon ingrowth into the CNS, and found they appear uniform .sema 2a and sema 1a dependence of the Plex B and Plex A overexpression phenotypes in sensory neurons.To confirm that Sema 2a and Sema 1a act as the ligands for Plex B and Plex A in our experiments, we tested the 03021sema 2a loss of function embryos plex B was overexpressed in sensory neurons in a 03021sema 2a background. In 03021sema 2a embryos we find ectopic sensory terminals in layer 2 to the motor neurons GADGAL4n\u200a=\u200a10 embryos). We conclude that the GABAergic interneurons are likely to be a significant source of Sema 1a in layer 1 and also in layer 3.We were able to identify potential cellular sources of the transmembrane Semaphorin Sema 1a by looking for neuronal populations that project to layers 1 and 3 . One sucsingle minded mutants; single mindedGAL4 line sema 2a mutant background see , in layeAL4) see , but in ppkEGFPTo investigate the role of the Sema/Plexin system in determining the position at which axons terminate within the layered structure of the neuropile we decided to focus our experiments on a single class of sensory cells with well defined terminal branches, the nociceptive class IV md neurons. Class IV md neurons can be identified with ppkEGFP-expressing axons with respect to Sema expression we confirmed that at 13-h AEL these axons terminate in a region of low Sema 2a rescues the sema 2a mutant phenotype of class IV axons C3plex A mutants, class IV axons project aberrantly to central and/or dorsal neuropile , sema 2a , or plex A (plex B/plex A) all exhibit class IV termination phenotypes, indicating a genetic interaction between these mutations (unpublished data). To further test whether Plex B functions to prevent termination in regions with high Sema 1a levels we analysed the patterns of sensory terminals that overexpress Plex B in a sema 1a mutant (Df(4)C3plex A mutants, indicating that Plex A function is required to prevent termination in regions with highest levels of Sema 1a C3PO163GAL4, UAS-plex B; plex A embryos) .plex A and B are required in the central targets of sensory neurons, in which case the mutant phenotypes might be a result of aberrations in normal target directed growth and (b) the possibility that Plex A and B are acting as guidance cues we restored their expression selectively to sensory neurons using the P0163 GAL4 driver. Restoration of Plex B expression selectively in sensory neurons in a KG00878plex B mutant background, rescues the phenotype of class IV md neurons (plex B-rescue embryos as compared to plex B mutants (To exclude (a) the possibility that neurons . Quantif mutants . The Fas mutants .Df(4)C3plex A mutant background, rescued the phenotype of class IV md neurons The most ventrally located sensory terminals, the Drosophila require Sema signalling through Plex A for their proper exclusion from the most dorsal neuropile.In vertebrates genetic studies show that proprioceptive axons are excluded from the superficial dorsal horn by Sema 6D/6C signalling mediated by Plex A1. Loss of Plex A1 allows proprioceptive collaterals to invade the superficial dorsal horn although most succeed in projecting through it to their normal more ventral target zones plex A appears to affect class IV terminals less strongly than loss of sema 1a. One explanation could be that Plex B might also function as a receptor for Sema 1a in this system. Our observation that in plex B mutants class IV axons aberrantly terminate in layers 1, 2, or 3 supports this possibility. We also find that Plex B overexpression in sensory neurons in plex A mutant embryos, prevents aberrant expansion of sensory terminals into intermediate portion of layer 1, which contains very high levels of Sema 1a axons excludes Plex A expressing maxillary palp ORN axons from inappropriate glomeruli Our findings suggest that much of the Sema 1a expression in the neuropile of the VNC is on the surfaces of motor neuron dendrites and on the projections of the GABAergic interneurons. Thus, there appear to be two kinds of positional cues in the neuropile. Slit and Sema 2a are examples of secreted and possibly glia-mediated positional cues. Sema 1a on the other hand is presented on membranes of particular neuronal classes (GABAergic interneurons and motorneurons) and is a repellent for the axons of at least one other type of neuron (class IV md neurons). Thus, the presentation of repellent molecules on the surfaces of subsets of neurons can act to exclude specific classes of axons from particular regions of the neuropile.Theoretical models for gradient-guided axonal growth and targeting during the formation of 2-D neural maps, such as the retinotopic projections, require at least one gradient in each of the two\u2014not necessarily Cartesian\u2014dimensions Our findings address the larger issue of how termination of distinct neuron classes is regulated within a complex meshwork of differentiating axons and dendrites. They suggest that similar mechanisms that are used for the establishment of neural maps, only involving generalized positional cues in each dimension, control targeting of many different classes of neurons to specific termination domains within a complex neuropile.Although the evidence we provide here suggests that positional cues can specify particular domains for the termination of sensory neurons, we do not suppose that the control of termination and branching by a pervasive system of positional cues would necessarily be sufficient to allow connections to form selectively and specifically between appropriate pre- and postsynaptic partners. What such a system does provide is a framework of signals that could regulate simultaneously the growth of axons and dendrites of many different neurons and induce their termination and branching in appropriate parts of the developing network. Within these restricted regions it is likely that further, localised mechanisms, including competitive interactions, patterns of activity, and target derived cues might all be required to control synaptogenesis and determine the emergence of precise patterns of connectivity within a termination domain.If the pattern of sensory axon termination within the neuropile is controlled by a system of positional cues, most likely, in three dimensions, it may well be that the location of their postsynaptic dendrites is determined in a similar fashion. If this were the case, the matched expression of receptors for the same system of signals by pre- and postsynaptic neurites would guide them to a common volume as a prelude to the formation of synaptic connections between them. Recent studies that show that developing motor neuron dendrites respond to some of the same cues as terminating sensory axons provide indirect evidence for common systems of positional cues leading to the coordinate targeting of presynaptic axons and postsynaptic dendrites 03021sema 2aP1sema 1aDf(4)C3plex AKG00878plex BppkEGFPUAS-robo3UAS-plexBUAS-plexA-HAUAS-robo2UAS-ephrinUAS-ephUAS-unc5UAS-frazzledUAS-drl-DNUAS-commUAS-robo, 410 EP-lines from the Rorth collection PO163GAL4, UAS-n-syb-GFP stock UAS-sema 1a, P1sema 1a; PO163GAL4, ppkEGFPP1UAS-sema 1a, sema 1a; HB9GAL4, ppkEGFP; UAS-plexA-HA/+; PO163GAL4, ppkEGFP/+; Df(4)C3plex A, and UAS-plex B/PO163GAL4, ppkEGFP; KG00878plex B. We also used OK371GAL4 (gift of M. Landgraf), GADGAL4single mindedGAL4UAS-reaperD7wnt5 stocks For mutant analyses Embryos were staged and VNCs dissected out embryos as previously described We used the following primary antibodies: anti-Sema 2a , anti-Slit , anti-Fas II , and anti-Repo supplied by the Developmental Studies Hybridoma bank (1\u223610 dilution); anti-Sema 1a along the medio-lateral axis we quantified the normalised surface area occupied by sensory terminals in the medial domain of the neuropile in randomly chosen transverse confocal sections from 30 different hemisegments for each genotype. Within a single embryo, we selected every tenth section . A Student's t-test was used to compare the mean SAM/T for the different genotypes.For a statistical analysis of defects in the pattern of sensory terminals into different dorso-ventral layers we compared SA in layer 2 (SA2/h\u200a=\u200aSA(layer 2)/[hemisegment surface area]) or SA in layers 1, 3, and 4 (SA1+3+4/h\u200a=\u200aSA[layer 1+3+4]/[hemisegment surface area]) in randomly chosen transverse confocal sections from more than 30 different hemisegments for each genotype. Within a single embryo, we selected every tenth section . A Student's t-test was used to compare the mean SA2/h or SA1+3+4/h for the different genotypes.For a statistical analysis of expansion or exclusion of sensory terminals \u00d7100 and the total percentage of hemisegments with aberrant terminals per embryo [Hat(1+2+3)\u200a=\u200aHat(1)+Hat(2)+Hat(3)]. A Student's t-test was used to compare the mean Hat for the different genotypes. In some cases we also quantified the average (per embryo) relative proportion of hemisegments with aberrant terminal in each layer: Hat(1)/Hat(1+2+3), Hat(2)/Hat(1+2+3), and Hat(3)/Hat(1+2+3). We counted as \u201caberrant\u201d only those hemisegments with terminals in layers 1, 2, or 3 in layers 1, 2, and 3 per embryo (per 14 hemisegments): Hat\u200a=\u200a Diagram showing the pathways in the neuropile taken by sensory neurons that run in the ISN (magenta) and the SN (green) en route to their termination domains (yellow) in wild type (21 AEL), with respect to Fas II tracks (red). Diagram represents a projection of a confocal z series of transverse sections through an abdominal segment. Dorsal up. White arrowhead shows midline. Magenta lines indicate the pathways taken by ISN neurons in the neuropile. Green lines indicate the pathways taken by SN neurons in the neuropile. 2, 3, and 4 indicate sensory neuron termination domains in layers 2, 3, and 4, respectively. Scale bar: 10 mm. Sensory axons whose cell bodies are located ventrally in the body wall join the SN nerve, whereas axons whose cell bodies are located dorsally or laterally in the body wall join the ISN nerve. There is no correlation between the nerve that axons travel in and the position of their termination in the neuropile. Sensory axons running in the SN terminate in layers 2, 3, or 4, in correlation with their modality and dendritic morphology 109(280)GAL4, UAS-CD8GFPGFP (white) in 21-h embryos. Dorsal is up. Red arrowheads show the midline. Magenta arrows indicate pathways taken by ISN neurons in the neuropile. Green arrows indicate pathways taken by SN neurons in the neuropile. 2 and 4 indicate md neuron termination domains in layers 2 and 4, respectively. Scale bar: 10 \u00b5m. Upper: a single section from a confocal z series through an abdominal segment showing the ISN pathways. Lower: a single section from the same series showing the SN pathways. Both ISN and SN md neurons terminate in layers 2 or 4, depending on their dendritic morphology.(0.93 MB TIF)Click here for additional data file.Figure S2Distributions of Sema 2a and Sema 1a along the antero-posterior axis of the neuropile. (A and B) Immunofluorescence visualisation of Sema 2a (A) and Sema 1a (B) (white) in ppkeGFP embryos (13-h AEL). Upper images show projections of confocal z series of longitudinal sections through the VNC. Central and lower images show single more dorsal and more ventral sections from the stack, respectively. Anterior is to the left. Red arrowheads show midline. a and p indicate the position of anterior (a) and posterior (p) commissures in each segment. Scale bar: 35 \u00b5m. (A) Levels of Sema 2a are uniform along the antero-posterior axis, thus Sema 2a is unlikely to provide instructive information for controlling neurite termination along this axis. Both in more dorsal (layer 2) and in more ventral (layer 3) longitudinal sections, levels of Sema 2a appear uniform along the antero-posterior axis. (B) Levels of Sema 1a are uniform along the antero-posterior axis. thus Sema 1a is unlikely to provide instructive information for controlling neurite termination along this axis. Both in more dorsal (layer 1) and in more ventral (layer 3) longitudinal sections, levels of Sema 1a appear uniform along the antero-posterior axis.(1.34 MB TIF)Click here for additional data file.Figure S3Cellular sources of Sema 1a in the neuropile. (A\u2013E) Sema 1a is brought into dorsal neuropile, in part, by motor neurons. Immunofluorescence visualisation of motor neuron dendrites labelled with OK371GAL, UAS-CD8-GFP control (white), in OK371GAL4, UASCD8GFP embryos (A) and in OK371GAL4, UASCD8GFP, UAS-reaper embryos (B) at 21-h AEL. Immunofluorescence visualisation of Sema 1a pattern (white) in OK371GAL4, UASCD8GFP control (B) and OK371GAL4, UAS-CD8GFP, UAS-reaper (C) embryos 21-h AEL. Dorsal is up. Arrowheads indicate the midline. Magenta lines, neuropile boundaries. Red lines, layer boundaries. Numbers indicate layers. Scale bar: 10 \u00b5m. A. In control embryos processes of motor neurons labelled with OK371GAL, UAS-CD8-GFP are readily detectable and they are located in layer 1, which normally contains high levels of Sema1a. (B) In control embryos Sema 1a is present at high levels in layers 1 and 3. (C) Motor neuron dendrites are not detectable in OK371GAL4, UAS-CD8GFP, UAS-reaper. (D) Sema 1a expression in the same animal, as in (C). Sema 1a levels in layer 1 are reduced relative to layer 3 in the absence of motor neuron dendrites. (E) Quantification of Sema 1a levels in layer 1 relative to layer 3 in the same hemisegment, for OK371-GAL4, UASCD8GFP control and OK371GAL4, UAS-CD8GFP, UAS-reaper, 21-h old embryos. For this purpose, embryos of the two genotypes were stained with antibody against GFP (to distinguish between embryos with and without motor neurons). In each embryo seven sections from seven different hemisegments where chosen at random, and for each section the ratio of the pixel intensity (PI) for the channel showing Sema 1a staining in layer 1 relative to layer 3 (PI1/3\u200a=\u200aPI[Sema 1a in layer 1]/PI[Sema 1a in layer 3]) was calculated. A significant decrease in pixel intensity in layer 1 relative to layer 3 was observed in OK371GAL4, UAS-CD8GFP, UAS-reaper embryos compared to OK371GAL4, UAS-CD8GFP controls . (F and G) Sema 1a is brought into dorsal and ventral neuropile, in part, by GABAergic interneurons. (F and G) Immunofluorescence visualisation of motor neurons and GABAergic processes labelled with GADGAL, UAS-CD8-GFP (white) (F) and of Sema 1a pattern (white) in GADGAL4, UAS-CD8GFP, UAS-reaper (G), 21-h old embryos. Dorsal is up. Arrowheads indicate the midline. Magenta lines, neuropile boundaries. Red lines, layer boundaries. Numbers indicate layers. M, medial; I, intermediate; L, lateral domains. Scale bar: 10 \u00b5m. (F) Processes of GABAergic interneurons and motor neurons together (white) cover the dorsal and central regions of the neuropile, which normally contain high levels of Sema 1a. (G) Sema 1a (white) levels appear highly reduced in embryos that lack both GABAergic interneurons and motor neurons. The characteristic Sema 1a distribution pattern is no longer detectable.(1.73 MB TIF)Click here for additional data file.Figure S4Restoration of sema 2ain midline cells partially rescues the aberrant central projection of Class IV axons. (A\u2013C) Immunofluorescence visualisation of Sema 2a (white), in sema 2a mutant (A) and in sema 2a, UAS-sema 2a; single-mindedGAL4, ppkeGFP (B and C) embryos (21-h old). (D) Projections of class IV axons (green) and Fas II tracts (red) in sema 2a,UAS-sema 2a;single-mindedGAL4,ppkeGFP embryos (21-h old). (A and B) Image shows projections of a confocal z series of longitudinal sections through the VNC. Anterior is to the left. Red arrowheads show midline. Magenta line: neuropile boundary. Scale bar: 14 \u00b5m. (C and D) Images show projections of a confocal z series of transverse sections through A7. Dorsal is up. Arrowheads show midline. Magenta line (C): neuropile boundary. Red (C) and white (D) lines, layer boundaries. Numbers indicate layers: M, medial; I, intermediate; L, lateral domains. Scale bar: 9 \u00b5m. (A) Sema 2a expression is not detectable above background levels in the neuropile of 21-h-old sema 2a mutant embryos. (B) High levels of Sema 2a expression are detectable in sema 2a, UAS-sema 2a; single-mindedGAL4, ppkeGFP embryos. (C) Transverse view of Sema 2a expression in sema 2a, UAS-sema 2a; single-mindedGAL4, ppkeGFP embryos. Sema 2a expression in midline cells, in an otherwise mutant background, results in its distribution throughout the neuropile, with lower levels detectable on the lateral edges of the neuropile and in the ventral-most neuropile. (D) Restoration of Sema 2a expression in midline cells alone reduces the aberrant central projection of class IV neurons is significantly higher in sema 2a \u200a=\u200a3.3%; n\u200a=\u200a24 embryos, 336 hemisegments), than in sema 2a/+ controls (average Hat(2)\u200a=\u200a0%, n\u200a=\u200a30 embryos, 420 hemisegments). sema 2a, UAS-sema 2a; sim-GAL4,ppkeGFP show a significant reduction in Hat(2) \u200a=\u200a0.7%, n\u200a=\u200a29 embryos, 406 hemisegments), compared to sema 2a mutant embryos (average Hat(2)\u200a=\u200a3.3%).(1.28 MB TIF)Click here for additional data file.Figure S5Examples of growth and termination errors of class IV axons in mutant embryos. Projections of class IV axons (white) in mutant embryos (21-h AEL). Images show projections of a confocal z series of transverse sections through A7. Dorsal is up. Arrowheads show midline. Magenta arrows point to aberrant terminals of class IV axons. Green arrows point to class IV axons that initially grow normally in the neuropile, but afterwards turn dorsally, and terminate in aberrant layers . Red arrows point to class IV axons that grow aberrantly in dorsal or central neuropile. We define terminals as large structures that form at the tips of axons . These structures are thicker than the axon itself and we assume they contain presynaptic specialisations. Class IV axons exhibit several kinds of phenotypes in sema and plex mutant embryos. The most striking is normal initial growth with aberrant termination, where the axon initially grows appropriately towards its target area in the ventral medial neuropile, but then makes a sharp dorsal turn, and terminates in layers 1, 2, or 3 , but we counted as \u201cnormal\u201d those hemisegments that exhibit the aberrant growth, with normal termination phenotype . (A) Examples of normal initial growth with aberrant termination, where class IV axons grew in normally, and afterwards aberrantly turned dorsally or centrally and terminated there, in sema1a, sema 2a double mutant embryos (21 AEL). These examples show that the position of entry does not determine the position of termination. Despite the fact that these axons initially grow appropriately in the ventral neuropile, they afterwards alter direction of growth and invade aberrant neuropile layers, where they terminate. (B) Example of class IV axons showing both aberrant growth and aberrant termination in a sema 1a mutant embryo. The axons initially grow in dorsal neuropile, where they also forms a terminal at the midline. (C) Example of class IV axons showing aberrant growth, but normal termination in a plex B mutant embryo. The axon grows through dorsal neuropile, but turns ventrally at the midline, without forming a terminal. It forms a terminal once it reaches the ventral neuropile, in its appropriate location.(1.35 MB TIF)Click here for additional data file.Figure S6Defective positioning of Fas II tracts in different mutant backgrounds. Graphs show percentages of segments (n\u200a=\u200a175) in which L1 (blue), I2 (green), I3 (yellow), M1 (black), and M2 (white) tracts project aberrantly in P1/+sema 1a (A), P1sema 1a (B), sema 2a (C), and P1sema 1a, sema 2a double mutant (D) 21-h embryos. (A) In P1/+sema 1a control embryos Fas II tracts grow normally in the dorso-ventral axis. In both P1sema 1a and sema 2a embryos Fas II tracts are affected (B and C) and the disruption is more severe in double mutants (D).(0.29 MB TIF)Click here for additional data file.Figure S7Role of Semas in patterning the antero-posterior axis of the neuropile. We assessed the potential role of Sema 1a and Sema 2a in controlling termination of class IV axons in the antero-posterior axis by analysing their projections in a top-down view of the neuropile in wild type and in sema 1a, sema 2a double mutants Projections of class IV axons labelled with ppkEGFP (white) in sema 1a/+; ppkEGFP control (A) and sema 1a, sema 2a; ppkEGFP (B), 21-h embryos. Images show projections of confocal z series of longitudinal sections of the VNC (from T1 to A4). Anterior left. Arrowheads show midline. a, anterior half of the segment; p, posterior half of the segment. Scale bar: 16 \u00b5m. (A) Top-down view of wild-type class IV projections in T1\u2013A4. Wild-type class IV axons grow asymmetrically, within their normal ventral and medial termination domain, forming a thick anterior branch and very thin processes that extend posteriorly. (B) Top-down view of class IV projections in T1\u2013A4 in sema 2a, sema 1a double mutants. Note that while the class IV terminals appear disorganised compared to wild type, they still appear asymmetric and largely confined to the anterior portion of the segment. We assume the observed disorganization is a consequence of the major defects in growth and termination in the dorsoventral axis. (C) Quantification of the average surface area occupied by class IV terminals in the posterior half of the hemisegment, relative to the total surface area covered by class IV terminals in a hemisegment [SAp/(p+a)\u200a=\u200aSA(posterior)/SA(posterior+anterior]. Quantification of SAp/(p+a) does not reveal a significant increase \u200a=\u200a0.22; SD\u200a=\u200a0.16; n\u200a=\u200a50 hemisegments) for the double mutants with respect to wild-type embryos (average SAp/(p+a)\u200a=\u200a0.19; SD\u200a=\u200a0.1; n\u200a=\u200a55 hemisegments). For comparison we analyzed the antero-posterior distribution of class IV projections in embryos mutant for the gene wnt 5, that has previously been implicated in controlling axon projections in the antero-posterior axis . The Wnt 5 receptor Drl is present on the growth cones and axons of neurons crossing in the anterior commissure and is required to prevent these cells from crossing aberrantly in the posterior commissure sema1a, sema 2a double mutants, when we analysed class IV projections in D7wnt 5 mutants and in PO163GAL4,UAS-DN-drl embryos, we did find a significant increase in SAp/(p+a) compared to wild type \u200a=\u200a0.34; SD\u200a=\u200a0.12; n\u200a=\u200a16 hemisegments; for PO163-DN-drl, p\u200a=\u200a2.2\u00d710\u22127; Student's t-test; average SAp/(p+a)\u200a=\u200a0.33; SD\u200a=\u200a0.12; n\u200a=\u200a30 hemisegments). Thus Sema 1a and Sema 2a do not appear to play a major role in confining class IV terminals to the anterior portion of the segment.ants see . We chos(1.15 MB TIF)Click here for additional data file.Figure S8Plexin expression in sensory neurons and in the CNS (C). (A and B) Immunofluorescence visualisation of sensory neuron cell bodies labelled with antibody against horseradish peroxidase (HRP) (A) or PPK-EGFP (red) (in B) and Plex A (A and B) at 13-h AEL. Dorsal is up. (A) Plex A expression (white in ii and green in iii) in dorsal (d) and lateral (l) clusters of sensory neurons (white in i and red in iii). Strong Plex A expression is visible in sensory neuron cell bodies in both clusters. Scale bar: 15 \u00b5m. (B) Plex A protein (white in ii and green in iii) is strongly expressed in class IV md neuron cell bodies (white in i and red in iii). Scale bar: 10 \u00b5m. (C) Immunofluorescence visualisation of Plex A protein (white in ii and green in iii) in a transverse section of the neuropile labelled with HRP (white in i and red in iii) at 13-h AEL. Image shows a projection of a confocal z series of 1-mm thick transverse sections through abdominal segment A7. Dorsal is up. Arrowheads show the midline. Outlines indicate neuropile boundaries. Scale bar: 5 mm. (D) In situ hybridisation showing plex B mRNA expression in dorsal (d) and lateral (l) clusters of sensory neurons in the embryonic body wall. Dorsal is up. Scale bar: 20 \u00b5m. In situ hybridization protocol: DIG-labelled RNA antisense and sense probes were generated with the Ambion Megascript kit and DIG-UTP (purchased from Roche), following the manufacturer's instructions. In situ hybridization was performed according to a protocol kindly provided by Nipam Patel . DNA templates for in vitro transcription: DNA fragments were amplified by PCR with Primer1 (GCGCGCGTAATACGACTCACTATAGGG) and Primer2 (GCGCGCAATTAACCCTCACTAAAGGG) from pBluescript(SK)-PlexinB-CK00213 (AA142091) using the following key PCR parameters: annealing at 66\u00b0C, 5 min extension at 72\u00b0C, 30 cycles; Primer1 and Primer2 include the T7 and T3 promoter sequences. In vitro transcription: plex B: T3 (antisense), T7 (sense).(3.90 MB TIF)Click here for additional data file.Figure S9Plex B and Plex A prevent expansion of sensory terminals into regions with high Sema 1a levels. (A\u2013D) Representative images of sensory terminals labelled with PO163GAL4, UAS-n-syb-GFP (white) in 21-h embryos (left) and diagrams showing patterns of sensory terminals superimposed for different genotypes (right). In all cases images show projections of a confocal z series of transverse sections through A7. Dorsal is up. Arrowheads show midline. White lines, layer boundaries. Numbers indicate layers: M, medial; I, intermediate; L, lateral domains. Scale bar: 10 \u00b5m. (A) Expressing Plex B in sensory neurons in a wild-type background results in exclusion of sensory neuron terminals from neuropile layer 2 /[hemisegment surface area]) reveals a significant decrease with respect to wild-type embryos . However, in these embryos, ectopic sensory terminals in layer 1 still remain largely excluded from intermediate and lateral portions of layer 1, which contain highest Sema 1a levels. Right: Diagram showing the pattern of Plex B expressing sensory terminals (green) superimposed on the wild-type pattern (yellow). (B) Expressing Plex B in sensory neurons in a sema 1a mutant background still excludes sensory terminals from neuropile layer 2. However, in these embryos ectopic sensory terminals invade the entire layer 1 and are no longer excluded from its lateral portions, which normally contain highest Sema 1a levels. This results in an overall increase in the surface area occupied by sensory neuron terminals in layers 1 and 3. Right: Diagram showing the patterns of Plex B expressing sensory terminals in sema 1a mutant (green) and wild-type (yellow) backgrounds, superimposed. Quantification reveals a significant increase in SA1+3+4/h (SA1+3+4/h\u200a=\u200aSA[layer 1+3+4]/[hemisegment surface area]) when Plex B is overexpressed in sensory neurons in a sema 1a mutant background , compared to embryos in which Plex B is overexpressed in wild-type background . (C) In plex A mutant embryos, sensory terminals aberrantly invade neuropile layers 1, 3, and to a lesser extent layer 2. As in the case of sema 1a mutant embryos, this results in an overall increase in the surface area occupied by sensory neuron terminals in layers 1 and 3. Right: Diagram showing the patterns of sensory terminals in plex A mutant (green) and wild-type (yellow) backgrounds, superimposed. Quantification reveals a significant increase of SA1+3+4/h in plex A mutants , with respect to wild type . (D) Expressing Plex B in sensory neurons in a plex A mutant background is sufficient to exclude sensory terminals from lateral and intermediate portions of neuropile layer 1. In these embryos ectopic sensory terminals do not invade regions of layer 1, which contain highest Sema 1a levels. As a result, sensory neuron terminals in layers 1 and 3 occupy a smaller surface area than in plex A mutants. Thus, in the absence of Plex A, Plex B is sufficient to exclude sensory terminals from regions of highest Sema 1a expression. Plex B may therefore function as a receptor for Sema 1a. Right: Diagram showing superimposed patterns of sensory terminals with and without Plex B expression in plex A mutants. Terminals with Plex B expression: green. Terminals without Plex B expression: yellow. Quantification reveals a significant decrease of SA1+3+4/h when Plex B is expressed in sensory terminals in a plex A mutant background , compared to plex A mutants . (E and F) Bar charts show the average SA1+3+4/h under different conditions as indicated. (E) The average SA1+3+4/h is significantly higher , when Plex B is expressed in a sema 1a mutant background, compared to its expression in wild-type background . (F) The average SA1+3+4/h is significantly lower for sensory terminals that express Plex B in a plex A mutant background, compared to plex A mutants . In contrast, we did not observe a significant difference between the SA1+3+4/h of sensory terminals that express Plex B in a plex A mutant background and those that express Plex B in wild-type background .see also . Quantif(1.24 MB TIF)Click here for additional data file.Figure S10Fas II defects are not rescued by selective restoration of Plex B expression in sensory neurons. Graphs show percentage of segments (n\u200a=\u200a175) in which L1 (blue), I2 (green), I3 (yellow), M1 (black), M2 (white) tracts project aberrantly. (A) In ppkEGFP; plexB embryos Fas II tracts are severely affected. (B) When Plex B expression is selectively restored in sensory neurons alone, in UAS-plexB;PO163GAL4,ppkEGFP;plexB embryos, Fas II tracts continue to exhibit the mutant phenotype.(0.19 MB TIF)Click here for additional data file.Table S1Results of the misexpression screen. We identified 11 genes (2.6%) that change the pattern of sensory terminals, without producing pronounced changes in neuron number or preventing sensory axons from reaching the CNS. In these experiments, sensory terminals shift independently of Fas II tracts, which remain in their wild-type position and relation to each other. Of the 11 genes, two produced specific shifts along the dorso-ventral axis. The table gives the list of 11 genes, which, when misexpressed in sensory neurons alone, produce specific shifts in the dorso-ventral, medio-lateral or antero-posterior axes.(0.04 MB DOC)Click here for additional data file."} +{"text": "B. subtilis is an important organism in the biotechnological application. The efficient expression system is desirable in production of recombinant gene products in B. subtilis. Recently, we developed a new inducible expression system in B. subtilis, which directed by B. subtilis maltose utilization operon promoter Pglv. The system demonstrated high-level expression for target proteins in B. subtilis when induced by maltose. However, the system was markedly repressed by glucose. This limited the application of the system as a high-expression tool in biotechnology field. The aim of this study was to further improve the Pglv promoter system and enhance its expression strength.glv. The transcription level from four mutants was increased. Production of \u03b2-Gal from the mutants reached the maximum 1.8 times as high as that of wildtype promoter. When induced by 5% maltose, the production of \u03b2-Gal from two mutants reached 14.3 U/ml and 13.8 U/ml, 63.5% and 57.5% higher than wildtype promoter (8.8 U/ml) respectively. Thus, site-directed mutagenesis alleviated the repression of glucose and improved the expression activity. To further improve the promoter system, the B. subtilis expression host was reconstructed, in which B. subtilis well-characterized constitutive promoter P43 replaced the promoter of the glv operon in B. subtilis chromosome through a double crossover event. The \u03b2-galactosidase production from the improved system (21.1 U/mL) increased compared to that from origin system. Meanwhile, the repression caused by glucose was further alleviated.Here, site-directed mutagenesis was facilitated to enhance the expression strength of Pglv-M1 through site-directed mutagenesis, which demonstrated high expression strength and alleviated the repression caused by glucose. Moreover, we alleviated the repression and enhanced the expression activity of the Pglv-M1 promoter system via reconstruction of the B. subtilis host. Thus, we provided a valuable expression system in B. subtilis.In this study, we obtained a mutated promoter P B. subtilis is an important organism in the biotechnological application, regarding its non-pathogenic and well-characterized biochemical and physiological property . In bri and . InApaI and EcoRI was carried out as described previously [Southern blot analysis of chromosomal DNA digested with eviously . Probe lReducing sugar was measured by the dinitrosalicylic method (DNS) using glThe concentration of glucose was determinate as previously described The authors declare that they have no competing interests.MMY initiated and coordinated the project. WWZ and MMY were responsible for site-directed mutagenesis and its analysis. WWZ and YLC performed the batch cultivation. MMY and Y-S Gong performed construction of expression system. All authors wrote the paper and approved the final version of the manuscript.B. subtilis 1A747 harboring different plasmids when cultured in LBThe growth curves from . (black diamond) represents OD595 from B. subtilis 1A747 harboring pLJ-7; (black square) represents OD595 from B. subtilis 1A747 harboring pJRINM1; (black triangle) represents OD595 from B. subtilis 1A747 harboring pJRINM2; cross (x) represents OD595 from B. subtilis 1A747 harboring pJRINM3; asterisk (*) represents OD595 from B. subtilis 1A747 harboring pJRINM4.Click here for fileB. subtilis 1A747 harboring different plasmids when cultured in LB supplemented with 5% maltoseThe growth curves from . (black diamond) represents OD595 from B. subtilis 1A747 harboring pLJ-7; (black square) represents OD595 from B. subtilis 1A747 harboring pJRINM1; (black triangle) represents OD595 from B. subtilis 1A747 harboring pJRINM2; cross (\u00d7) represents OD595 from B. subtilis 1A747 harboring pJRINM3; asterisk (*) represents OD595 from B. subtilis 1A747 harboring pJRINM4.Click here for fileThe growth curves from B. subtilis 1A747 harboring different plasmids when cultured in LB supplemented with 5% maltose plus 5% glucose. (black diamond) represents OD595 from B. subtilis 1A747 harboring pLJ-7; (black square) represents OD595 from B. subtilis 1A747 harboring pJRINM1; (black triangle) represents OD595 from B. subtilis 1A747 harboring pJRINM2; cross (\u00d7) represents OD595 from B. subtilis 1A747 harboring pJRINM3; asterisk (*) represents OD595 from B. subtilis 1A747 harboring pJRINM4.Click here for filePlasmids used in this study.Click here for filePrimers and oligonucletides used in this study.Click here for file"} +{"text": "C. elegans eat-3 gene encodes a mitochondrial dynamin family member homologous to Opa1 in humans and Mgm1 in yeast. We find that mutations in the C. elegans eat-3 locus cause mitochondria to fragment in agreement with the mutant phenotypes observed in yeast and mammalian cells. Electron microscopy shows that the matrices of fragmented mitochondria in eat-3 mutants are divided by inner membrane septae, suggestive of a specific defect in fusion of the mitochondrial inner membrane. In addition, we find that C. elegans eat-3 mutant animals are smaller, grow slower, and have smaller broodsizes than C. elegans mutants with defects in other mitochondrial fission and fusion proteins. Although mammalian Opa1 is antiapoptotic, mutations in the canonical C. elegans cell death genes ced-3 and ced-4 do not suppress the slow growth and small broodsize phenotypes of eat-3 mutants. Instead, the phenotypes of eat-3 mutants are consistent with defects in oxidative phosphorylation. Moreover, eat-3 mutants are hypersensitive to paraquat, which promotes damage by free radicals, and they are sensitive to loss of the mitochondrial superoxide dismutase sod-2. We conclude that free radicals contribute to the pathology of C. elegans eat-3 mutants.The C. elegans as a model to study the underlying causes of Opa1 pathologies. C. elegans Opa1 is encoded by the eat-3 gene. Mutants are sluggish, grow slowly, remain small, and have small broodsizes. These phenotypes are not suppressed by mutations in cell death genes, suggesting that apoptosis does not contribute to eat-3 pathogenesis. Instead, eat-3 mutants are hypersensitive to paraquat, which promotes damage by free radicals, and they are sensitive to loss of the mitochondrial superoxide dismutase sod-2, which is needed to eliminate free radicals from the mitochondrial matrix. Moreover, eat-3 mutants overexpress SOD-2, most likely compensating for increased free radical production. These results show that C. elegans EAT-3 is important for resistance to free radicals and they raise the possibility that free radicals contribute to DOA in humans.Dominant Optic Atrophy is a progressive eye disease caused by degeneration of retinal ganglion cells. The most prevalent form of DOA is caused by mutations in the Opa1 protein. This protein is required for fusion between mitochondria, it has an anti-apoptotic function, and it is required for mitochondrial DNA segregation. It has, nevertheless, been difficult to understand why mutations in Opa1 specifically affect retinal ganglion cells. We used rhe nematode Dominant optic atrophy (DOA) is one of the leading causes of inherited blindness. DOA is a progressive eye disease caused by degeneration of the retinal ganglion cell layer with ascending atrophy of the optic nerve The three dynamin-related proteins that affect mitochondria have different topologies and play different roles in fission and fusion. Mammalian Drp1 and the homologous proteins in C. elegans and yeast are cytosolic proteins that are required for mitochondrial division in vitro reconstitution experiments using mitochondria isolated from yeast Mgm1 mutants Evidence for the role of Opa1 in fusion between mitochondrial inner membranes initially came from studies of the yeast homologue of Opa1, which is called Mgm1. The mitochondria of yeast Mgm1 mutants are fragmented, they form aggregates and they lose their mtDNA Biochemical analysis shows that yeast Mgm1 and mammalian Opa1 are localized to the mitochondrial intermembrane space The importance of Opa1 for housekeeping functions, such as mitochondrial fusion and redistribution of mtDNA, is apparent from these cell biological studies. It has, nevertheless, been difficult to establish the exact sequence of events leading to retinal ganglion cell death in DOA, even with the mouse models that have recently become available C. elegans eat-3(ad426) strain ad426 mutation leads to fragmented mitochondria similar to those cause by mutations in Opa1 and Mgm1. Electron microscopy shows that eat-3(ad426) mitochondria have disorganized inner membranes and a large number of inner membrane septae. We also find that eat-3(ad426) growth defects are attributable to impaired oxidative phosphorylation and increased damage from free radicals within mitochondria.Here we show that the previously described C. elegans has a single homologue of yeast Mgm1 and mammalian Opa1. This protein is encoded by the D2013.5 gene. It has a predicted molecular weight of 106.8 kDa and 46% amino acid identity to human Opa1. Similar to yeast Mgm1 and mammalian Opa1, this C. elegans protein has a putative mitochondrial targeting sequence followed by domains that are typical of dynamin family members: a conserved GTPase domain, a middle domain and a GED or assembly domain eat-3 mutant, which was previously identified in a screen for mutations that cause abnormal or defective eating in C. eleganseat-3 locus (within 0.2 map units) and the overall appearance of D2013.5 RNAi animals is similar to that of eat-3 animals.BLAST homology searches show that eat-3(ad426) animals, we found a single point mutation, changing a valine at position 328 to an isoleucine , has a mutation that is also very close to the G2 threonine eat-3(ad426), which further demonstrates the importance of this particular residue (Upon sequencing the D2013.5 gene from oleucine . Althoug residue .eat-3(ad426) is indeed a D2013.5 mutant, we injected this strain with a wildtype D2013.5 cDNA under control of the D2013.5 gene promoter. The number of progeny reaching the L4 larval stage increased from 10 per uninjected eat-3 animal to 30 per transgenic animal , showing that a wildtype D2013.5 construct partially rescues the eat-3 mutant. Partial rescue is common for C. elegans genes with a maternal effect, since transgenes are often poorly expressed in the germline. We obtained further evidence that D2013.5 encodes the eat-3 locus with a second allele, named tm1107. The tm1107 allele is most likely a null, since it has a 419 bp deletion that causes a frameshift at position 329 and thus eliminates two thirds of the D2013.5 protein. The absence of EAT-3 protein in tm1107 animals, but not in ad426 animals, was confirmed by Western blot analysis using an antibody raised against the C. elegans EAT-3 protein (eat-3(tm1107) animals survive but they have fragmented mitochondria, a decrease in broodsize, sluggishness and slow growth phenotypes, similar to the phenotypes of eat-3(ad426) animals. More importantly, tm1107 fails to complement eat-3(ad426), indicating that ad426 and tm1107 are both alleles of eat-3 and that the phenotypes are due to mutations in the D2013.5 gene (data not shown). The C. elegans D2013.5 locus is henceforth called eat-3.To verify that protein . Homozygeat-3 were isolated in an F2 screen for suppressors of eat-3(ad426) mutant phenotypes. The progeny of 36,000 F1 animals were screened for restored growth rate, size and fecundity. This screen yielded seven new mutants with restored growth rates. Five of these mutants have second site mutations in the eat-3 gene (cq6-cq10), while two mutants have mutations that lead to premature stops in the drp-1 gene (cq5 and cq11). The new mutations in the eat-3 locus all cause substitutions in the GTPase domain (dyn-1(ky51) also yielded a series of substitutions in the GTPase domain or yellow fluorescent protein (YFP), and mitochondrial outer membrane markers, consisting of a resident outer membrane protein (TOM70) fused to GFP, CFP or YFP myo-3 promoter. The dominant negative mutations that we used here are T322A, which disrupts the G2 motif of the GTPase domain, and K300A, which is analogous to the K44A mutation in the G1 motif of dynamin To investigate how eat-3(ad426) and in eat-3(tm1107) animals and this phenotype is reversed in transgenic animals expressing wildtype eat-3 cDNA under control of the myo-3 promoter mutants are less severe in fzo-1(tm1133) mutants and fzo-1 RNAi animals than in eat-3 mutants (data not shown), even though fzo-1(tm1133) is also a null allele . These results suggest that there might be functional differences in the ways that EAT-3 and FZO-1 proteins affect the gross anatomy of C. elegans.Similar mitochondrial fragmentation is observed in muscle cells of mutants , which heat-3(ad426) show a range of mitochondrial morphology defects (eat-3(ad426cq10), they are partially restored to their filamentous morphology in eat-3(ad426cq8) and completely restored in eat-3(ad426cq6) commensurate with the suppression of gross anatomical defects. We conclude that mutations in fzo-1 and eat-3 both cause mitochondrial fragmentation, but their effects on size, growth rate and broodsize are different.In contrast, intragenic revertants of defects ; the miteat-3(ad426) worms. C. elegans mitochondria contain tightly packed tubular cristae.To further investigate how mitochondria are affected, we conducted electron microscopic analysis of wildtype and eat-3 mitochondria are almost all round (eat-3(ad426) animals (n\u200a=\u200a221). The frequency of internal septae in eat-3 animals is likely to be even higher, because the thin sections will have missed septae outside of the plane of sectioning. We conclude that the majority of eat-3(ad426) mitochondria are divided by internal membrane septae. In contrast, wildtype mitochondria are rarely if ever further divided by septae.In contrast, ll round and oftell round . The numeat-3(ad426) animals often have shorter and reduced numbers of cristae. These cristae typically project no more than 100 nm into the matrix , compared with 7.34 \u00b5m in wildtype mitochondria . The length of inner boundary membranes is also decreased: 2.62 \u00b5m per eat-3 mitochondrion , compared with 5.38 \u00b5m per wildtype mitochondrion . There is, however, still a 66.2% decrease of total cristae length when normalized with the lengths of inner boundary membranes or a 70.3% decrease when normalized with the surface area of the mitochondrial section. We conclude that most eat-3 mitochondria have fewer cristae than wildtype mitochondria.The mitochondria of x \u201c2\u201d in , while ceat-3 mitochondria have internal curved or ring-shaped structures formed by two concentric membranes enclosing a matrix-like material inclusions. Given their internal location, all of these membrane inclusions are likely to be derived from the inner membrane.Some mutant mitochondria have long inner membrane invaginations, which could in principle be enlarged cristae, but are more likely membrane folds resulting from a surplus of inner membrane \u201c3\u201d in . It is, l \u201c4\u201d in . These ms \u201c5\u201d in , but theeat-3 mitochondrion are shown in eat-3 mitochondria also show that some of the membrane inclusions that appear free floating in the matrix are indeed physically separated from the inner membrane and \u03b2-galactosidase coding sequences. This pattern was similar to that of C. elegans drp-1To investigate the role of eat-3 loss of function on the growth and brood size of worms. Worms injected with eat-3 dsRNA give viable progeny but their brood size is reduced . The F1 worms remain small, are sluggish and develop slowly. Similar effects were observed with chromosomal mutations in the eat-3 gene. In an experiment with ad426 and tm1107 alleles, the averages were 302 for wildtype , 51 for eat-3(ad426) and 50 for eat-3(tm1107) . In an experiment with intragenic revertants of eat-3(ad426), the averages were 75 for eat-3(ad426cq6) , 190 for eat-3(ad426cq7) and 65 for eat-3(ad426cq8) . These numbers are variable, as one might expect from different allele strengths, but they are all reduced when compared with wild type animals.We then conducted experiments to assess the effects of eat-3 dsRNA were on average only 0.15 mm in length at four days after hatching , whereas wild type animals were 1 mm in length . Even after three weeks, the eat-3 RNAi worms rarely reach 0.5 mm, consistent with a previous study showing that the eat-3(ad426) mutant also remains small eat-3 gene animals eat-3 RNAi progeny whereas wildtype animals take 2 days). It would thus appear that developmental decisions are normal, but the rate of development is greatly reduced as one might expect from a general decrease in metabolic activity.Growth was quantified by measuring the lengths of progeny from RNAi injected worms . Progenyt-3 gene . Worms weat-3 RNAi animals are affected, we stained the gonads of injected worms with Rhodamine 123, as was previously done with C. elegans drp-1 RNAi animals eat-3 RNAi on mitochondria is, however, much less dramatic than that of drp-1 RNAi, which causes mitochondria to form large aggregates eat-3 mutant and RNAi treated animals.To see how mitochondria in the gonads of eat-3(ad426) have premature stop codons in the drp-1 gene, showing that defects in mitochondrial fission suppress the defect in mitochondrial fusion caused by a mutation in eat-3. Similar genetic interactions were previously observed with mutations in the orthologous yeast genes eat-3 suppression by drp-1 loss of function. First, we tested whether the fragmentation of mitochondria is reversed by the dominant negative mutant DRP-1(K40A), which blocks division of the mitochondrial outer membrane myo-3::DRP-1(K40A) and a mitochondrial outer membrane marker were injected into eat-3(ad426) worms or into wildtype worms along with the Pmyo-3::antisense-eat-3 construct. DRP-1(K40A) gives rise to interconnected mitochondria, regardless of whether it is expressed in a wildtype background, with antisense eat-3, or in an eat-3 mutant . The drp-1(cq5) allele, which was isolated as a suppressor of eat-3(ad426), also causes hyperconnectivity of mitochondria in eat-3(ad426) animals, similar to the connectivity observed in the drp-1(cq5) single mutant (eat-3.Two of the mutants that were isolated in our screen for suppressors of e mutant . We conceat-3(ad426) mutant are reversed by a defect in mitochondrial division, we determined the brood-size of eat-3(ad426) mutants grown with or without drp-1 RNAi. Our results show that drp-1 RNAi significantly restores the brood-size of eat-3(ad426) mutants ; drp1(cq5) animals allele was also partially suppressed by fzo-1 RNAi, while the eat-3(tm1107) allele, which is most likely a null allele, was not suppressed by drp-1 or fzo-1 RNAi (eat-3(tm1107) animals is reversed by drp-1 RNAi (eat-3(ad426) allele has some residual protein function that is masked by wildtype DRP-1 and FZO-1 proteins. In support of this residual activity, we find that eat-3 RNAi reverses the restoration of brood size by the drp-1 mutation in eat-3(ad426); drp1(cq5) animals and ced-3(n717) or ced-4(n1894) mutations. The ced-3 gene encodes a caspase and the ced-4 gene encodes APAF-1. Mutations in either gene block programmed cell death in C. elegans. The effects on broodsize were determined by counting the numbers of progeny that survive to the L4 larval stage. The brood sizes were reduced to varying degrees in each of the single mutants, but the brood size defects of the eat-3(ad426) animals were not significantly affected by the additional mutations in ced-3 and ced-4 loci that might contribute to cell death under other circumstances. We tested these csp genes with feeding RNAi, but saw no effect on the brood size of eat-3(ad426) mutants. Some redundancy between the caspases remains possible, but redundancy does not apply to ced-4, since it encodes the single C. elegans homologue of APAF-1.It is well-established that Opa1 has an anti-apoptotic function in mammalian cells d-4 loci . Althougced-4 gene is central to all caspase dependent cell death in C. elegans. The absence of an effect of ced-4 mutations on the eat-3 broodsize defect, as shown here and eat-3(tm1107) embryos at the comma stage. Those numbers were not significantly different from the numbers for wildtype embryos and ced-4(n1894) mutant embryos. As expected, these mutants show strongly reduced numbers of dying cells. We conclude that ced-3 and ced-4 dependent cell death does not contribute to the reduced brood size of eat-3 animals. The eat-3; ced-3 and eat-3; ced-4 double mutants also grow slowly and remain small similar to the eat-3 single mutants (data not shown), suggesting that cell death does not contribute to these other maladies.The own here , is ther embryos . To verieat-3 mutants resemble those of gas-1 and mev-1 mutants, which have defects in Oxidative Phosphorylation complexes. Those mutants are also more susceptible to damage from free radicals, as shown by their sensitivity to paraquat, which produces superoxide radicals through a radical ion intermediate eat-3 mutants are also sensitive to free radicals, we grew eat-3(ad426) animals with increasing concentrations of paraquat. We find that eat-3(ad426) animals are significantly more sensitive to paraquat than wildtype animals (eat-3(ad426) animals and 0.44 mM for wildtype (N2) animals (averages of four independent experiments). Increased sensitivity to paraquat is also observed with eat-3(tm1107) animals (eat-3 function. The sensitivity of eat-3(ad426) animals to paraquat is suppressed by the drp-1 mutations in eat-3(ad426); drp-1(cq5) and in eat-3(ad426); drp-1(cq11) animals mutant, which has a defect in mitochondrial outer membrane fusion, are also sensitive to paraquat. Our results show that this mutant is not more sensitive to paraquat than wildtype animals encode Fe/Mn superoxide dismutases. These proteins have mitochondrial leader sequences, which most likely target them to the mitochondrial matrix.To test whether the induction of superoxide dismutase genes aids survival of eat-3(ad426) animals on feeding RNAi bacteria with RNAs for the sod genes that are not secreted , since those might affect the survival of eat-3 mutants. There were little or at best modest effects with sod-1, sod-3 and sod-5 RNAi treatments, but the effects of sod-2 RNAi on eat-3(ad426) animals were consistent and strong mutant animals grow much more poorly with eat-3 RNAi (eat-3(ad426) in one experiment and eat-3 RNAi in the second experiment confirms that the enhancement of sod-2 defects are indeed caused by eat-3 loss of function. We conclude sod-1, sod-3 and sod-5 are not necessary for survival of the eat-3 mutant, but a mutation in the sod-2 gene and sod-2 RNAi both strongly affect survival of animals with eat-3 deficiencies.We first grew d strong . To verit-3 RNAi . The effeat-3 by sod-3 RNAi and the sod-3(gk235) mutant is noteworthy since SOD-2 and SOD-3 have 88% amino acid identity and both proteins have mitochondrial leader sequences, indicating that they are both targeted to the mitochondrial matrix. The genetic interactions between sod-2 and eat-3 might, however, be different from those between sod-3 and eat-3, because sod-2 and sod-3 genes are differentially expressed sod genes correlates with the different effects that we observe with sod-2 and sod-3 genes.The weak or negligible enhancement of eat-3(ad426) animals and in the intragenic revertant of eat-3(ad426cq8) (fzo-1(tm1133) animals show little or no induction of SOD expression. We conclude that SOD-2 protein levels are dramatically increased in eat-3(ad426) animals, but not in fzo-1(tm1133) animals. This increase is partially reversed in intragenic revertants and fully reversed by the drp-1 mutation in the eat-3(ad426); drp-1(cq5) double mutant. It seems likely that increased expression of SOD-2 helps prevent damage from free radicals, but this increase is still not enough to prevent the hypersensitivity of eat-3 mutants to paraquat.Our blots show that Fe/Mn-SOD expression is induced more than two-fold in animals . This inpression . The indd426cq8) . SimilarC. elegans eat-3 mutants have many of the same features that were previously observed with yeast Mgm1 mutants and mammalian cells transfected with Opa1 siRNA. The mitochondria in eat-3 mutants are fragmented, these fragmented mitochondria are further divided by inner membrane septae and fragmentation is reversed by loss of Drp1. C. elegans eat-3 mutants are also affected at the organismal level. The mutant animals grow slowly, are sluggish and have greatly reduced broodsize, consistent with severely compromised mitochondrial function. However, heterozygous eat-3 mutations have no overt defects in worms, unlike heterozygous Opa1 mutations in humans, which cause optic neuropathies through haploinsufficiency. The eat-3 mutants are nevertheless still useful for unraveling pathogenic mechanisms, since the phenotypes in C. elegans and in mammal are both due to loss of protein function and therefore their effects on other cellular pathways are also most likely similar.eat-3 mutants are due to increased apoptosis in the gonad. In wildtype worms, approximately 50% of germ cells die prior to oogenesis, but more death can be induced by DNA damage, by pathogens and by other forms of stress. These death-inducing conditions all converge on the classic apoptosis machinery that requires the caspase CED-3 and the APAF1 homologue CED-4 eat-3 mutants by analyzing eat-3; ced-3 and eat-3; ced-4 double mutants and by counting the numbers of dying cells in eat-3 mutants. There was no increase in the numbers of dying cells in eat-3 embryos, nor was there suppression of the eat-3 broodsize defects in the double mutants. C. elegans does have several other caspases , but RNAi of these genes had no effect on eat-3 animals (data not shown) nor are they known to contribute to apoptotic cell death in C. elegans ced-4, which encodes the only APAF1 homologue in C. elegans. In summary, none of the RNAi treatments or chromosomal mutations in cell death genes showed a suppressive effect on eat-3 mutants, from which we conclude that caspase-dependent cell death does not contribute to the pathology of eat-3 in worms.It was conceivable that the broodsize defects of C. elegans eat-3 mutants, such as small size, slow growth and reduced broodsize are consistent with caloric restriction as observed in feeding mutants with pharyngeal defects eat-3 mutants are not due to retention of eggs, nor are there increased numbers of dead eggs or larvae on plates (data not shown). There is, however, a paucity of nuclei in the gonads of eat-3 RNAi animals defects with drp-1 RNAi and mutations in drp-1 is consistent with stochastic loss of mtDNA in eat-3 mutants. Mutations in the yeast DRP-1 homologue Dnm1 similarly suppress Mgm1 growth defects and they restore cristae morphology eat-3 mutants: First, drp-1 RNAi does not rescue the C. elegans eat-3(tm1107) deletion allele, while it does rescue the eat-3(ad426) allele. Second, C. elegans fzo-1(tm1133) mutant animals are not as severely affected as eat-3 mutants, nor are they rescued by drp-1 RNAi (data not shown), even though one might expect them to be equally susceptible to loss of mtDNA, since yeast Fzo1 mutants do lose their mtDNA The ability to suppress C. elegans eat-3 mutants, which may also be relevant for the selective degeneration of retinal ganglion cells in patients with dominant optic atrophy. C. elegans eat-3 mutants are hypersensitive to paraquat and sod-2 RNAi, suggesting increased production of free radicals or an impaired disposal mechanism. A drp-1; eat-3 double mutant and an fzo-1 mutant are not more sensitive to paraquat, suggesting that there might be something specific about the effects of eat-3 on mitochondria, for example contributing to the maintenance of cristae, as was suggested for Opa1 in mammalian cells eat-3 phenotypes by sod-2 RNAi and a mutation in the sod-2 gene, but not by RNAi or mutations in other superoxide dismutase genes, suggests that damage from free radicals is confined to the mitochondrial matrix or the mitochondrial inner membrane. The effects are most likely not direct, since SOD-2 is a mitochondrial matrix protein while EAT-3 is primarily localized to the mitochondrial intermembrane space and other mutations that affect oxidative phosphorylation in C. elegans, such as the mev-1 and gas-1 mutants with mutations in complex I and II proteins, also show increased sensitivity to paraquat Our results suggest an alternative explanation for the sickness of If free radicals also contribute to dominant optic atrophy in humans, then the underlying cause of this disease might be more similar to that of other optic neuropathies than previously understood. Patients with Leber's hereditary neuropathy (LHON) have mutations in subunits of Oxidative Phosphorylation complex I, which increases free radical production by disrupting the flow of electrons through complex I along with their more obvious effects on ATP production C. elegans eat-3 have many of the same effects on mitochondrial morphology that were previously observed with mutations in yeast Mgm1 and mammalian Opa1. Mutations in key components of the major cell death pathway show that this pathway does not affect the eat-3 phenotype. Instead, eat-3 mutants are sensitive to damage from free radicals and they show hallmarks of ATP deficiency. The effects of sod-2 loss of function and partial compensation by induced expression of SOD-2 suggest that damage from free radicals is localized to the mitochondrial matrix. These observations might help design more effective treatments for patients with DOA.In conclusion, mutations in eat-3(ad426) was sequenced using amplified genomic DNA from two independent PCR reactions. The C. elegans eat-3 cDNAs yk10h8 and yk21c2 were obtained from Y. Kohara . The pPD expression vectors were kindly provided by A. Fire, J. Ahnn, G. Seydoux, and S. Xu . The Peat-3::NLS::GFP::\u03b2-galactosidase construct was made with an eat-3 gene promoter fragment (positions 23335 to 25288 of cosmid D2013), fused to the reporter sequences of pPD95.67. The rescue construct contained this same promoter fragment fused to the yk21c2 cDNA. This cDNA lacks the N-terminal 70 amino acids. The missing sequence was generated by PCR of genomic DNA. Mutations were introduced by PCR and verified by sequencing. EAT-3 was expressed in muscle cells using the myo-3 promoter of pPD96.52. The antisense construct has the insert of yk21c2 cloned in the antisense orientation in pPD96.52. Production of dsRNA, mitochondrial markers, microinjection, light microscopy and feeding RNAi procedures were described previously The D2013.5 gene of C. elegans strains were obtained from the C. elegans stock-center and from Dr. S. Mitani . Strains provided by Dr. Mitani were backcrossed with wildtype (N2) animals to remove adventitious mutations. Revertants of dyn-1(ky51) and eat-3(ad426) were generated with EMS mutagenesis. The dyn-1(ky51) is temperature sensitive for growth and motility dyn-1(ky51) animals were screened at the restrictive temperature (25\u00b0C) while eat-3(ad426) animals were screened at 20\u00b0C. Newly identified mutants were backcrossed with wildtype (N2) worms to determine whether the new mutations are intra- or extragenic and to rid them of adventitious mutations. The three revertants of dyn-1(ky51) were genetically inseparable from the original dyn-1 mutation and five of the seven eat-3(ad426) revertants were inseparable from eat-3, suggesting that these are intragenic revertants. New mutations in the intragenic revertants were identified by sequencing their respective dyn-1 and eat-3 genes. New mutations in the two extragenic revertants of eat-3(ad426) were identified by sequencing their drp-1 genes.To determine paraquat sensitivity, increasing concentrations of paraquat were added to 30 mm NGM agar plates. These plates were seeded with OP50 bacteria E. coli or dry baker's yeast and 10% methanol Young gravid worms were mixed with For tomography, 500 nm thick sections were cut and stained with uranyl-acetate and lead citrate. Colloidal gold particles (10 nm) were applied as alignment markers. A tilt series of 122 images was made on the Albany AEI EM7 MkII HVEM at 1000 kV. The images were recorded around two orthogonal tilt axes, each over an angular range of 120\u00b0 with a 2\u00b0 tilt interval. The double-tilt images were aligned, further processed to make a tomographic reconstruction, followed by surface rendering as previously described Samples for Western blot analysis were prepared by freeze/thawing worms, followed by solubulization in SDS-PAGE sample buffer, boiling for 10 min and clearing of debris by centrifugation for 2 min at 3,000 rpm in an Eppendorf microfuge. Western blots were probed with superoxide dismutase antibody from Abcam . Western blots were quantified with densitometry using a Personal Densitometer SI and ImageQuant software .Figure S1C. elegans.Western blot showing EAT-3 expression levels in wild type and mutant C. elegans EAT-3 protein detects a strong band of approximately 90 kDa in all strains except for eat-3(tm1107), which has a deletion in the eat-3 gene. This band is the size predicted for mature protein, assuming multi-step processing similar to that of yeast Mgm1. A faint upper band of approximately 100 kDa is also detected in all strains except for eat-3(tm1107). This upper band most likely results from the initial cleavage of the mitochondrial leader sequence . The line between lanes with eat-3(ad426); drp-1(cq5) and eat-3(tm1107) samples shows that an empty lane between the two, which served as a buffer against spillover, was cut out. Tubulin and cytochrome serve as loading controls. The EAT-3 antibody was raised in a rabbit against recombinant protein. The recombinant protein was made by expression in bacteria with a his-tag and purified with Ni-NTA column chromatography. The serum was blot purified C. elegans proteins for Western blots.An antibody raised against recombinant (0.51 MB TIF)Click here for additional data file.Figure S2eat-3(tm1107) animals.Reversal of mitochondrial fragmentation in eat-3(tm1107) animal stained with the membrane potential dependent dye Rhodamine 6G (A) Mitochondria in muscle cells of an eat-3(tm1107) animal grown with drp-1 feeding RNAi showing reversal of the fragmented phenotype. This indicates that drp-1 loss of function is epistatic to an eat-3 null allele. The scale bar is 5 \u00b5m.(B) Mitochondria in muscle cells of an (1.72 MB TIF)Click here for additional data file."} +{"text": "Virtual slides are viewed using interactive software that enables the user to simulate the behaviour of a conventional optical microscope, like adjusting magnifications and navigating to any portion of the image. Nowadays, information about the performance and features of web-based solutions for reading slides in real environments is still scarce. The objective of this study is analyzing the subjective experience of pathologists with virtual slides, comparing the time needed to read slides using different web viewers and different network connections.Eight slides were randomly selected (4 biopsies and 2 cytologies) from Hospital General de Ciudad Real (HGCR) archives. Three different virtual slide web-viewing solutions were analyzed: Aperio web server, Olympus NetImage Server, and Aurora mScope. Five pathologists studied to time needed to access images of each virtual slide, selecting a panoramic view, 10 low magnification fields, and 20 high magnification fields.Aperio viewer is very efficient in overview images. Aurora viewer is especially efficient in lower magnifications (10\u00d7). For larger magnifications (20\u00d7 and 40\u00d7) no significant differences were found between different vendors. Olympus was found to be the most user-friendly interface. When comparing Internet with intranet connections, despite being slower, users also felt comfortable using virtual slides through Internet connection.Available web solutions for virtual slides have different advantages, mainly in functionalities and optimization for different magnifications. Pathologist should select the solutions adapted to their needs. Virtual slides, also known as digital slides or whole slide images (WSIs) are usually viewed using interactive software \"virtual microscopy\" which enables the user to simulate the behaviour of a conventional optical microscope, like adjusting magnifications and navigating to any portion of the image . NowadayThis is a transversal study with biopsies and cytologies obtained from the Hospital General de Ciudad Real (HGCR) archives. Eight slides was 2520 Kbps/270 Kbps .In the hospital environment, the same computer was used . In the residential environment, each pathologist used a different computer . All web viewers were run using Microsoft Internet Explorer in Windows XP operating system.All measurements were made using a screen size of 1024 \u00d7 768 pixels.The following variables were recorded twice , using maximized/full screen window:1. Time to show complete virtual slide panoramic view (default overview)2. Time to show complete 10\u00d7 image (recording 10 fields)3. Time to show complete 20\u00d7 image (recording 10 fields)4. Time to show complete 40\u00d7 image (recording 10 fields)Quantitative data analysis was performed using Kirkman's tools and conf\u00a9 plug-in, and Aurora viewer environment, the difference was only statistically significant (p = 0.05) when Aperio viewer was compared with the Olympus viewer. In residential ADSL (Internet) connections Aperio viewer was faster than Aurora viewer (p = 0.010) and it was also faster than Olympus viewer (p = 0.017) to show overview images.Lower magnifications (10\u00d7) fields in most systems took longer to show sharp and clear then larger magnifications. Aperio web viewer was slower in showing 10\u00d7 images (mean 5.96 SD 1.12 in intranet), and both in intranet and Internet; it was significantly slower than Aurora viewer and Olympus viewer . The best results for 10\u00d7 magnifications were obtained with Aurora viewer, which was also significantly faster than Olympus viewer.Working with larger magnifications (20\u00d7 and 40\u00d7) was considered fast by all users in all tested systems, only the Aperio system showed a trend to be slower in 20\u00d7, and faster in 40\u00d7 fields, but in the intranet connection, there was no statistically significant difference between the three systems in both Intranet and Internet connections.It is noticeable that in larger bandwidth networks, Aurora viewer shows quite homogeneous results in all magnifications.Using Aurora viewer we did not find significant differences in the time to access Aperio SVS files and Olympus VSI files.The Health Care Services of Castilla-La Mancha (SESCAM) has implemented virtual slides imaging in eight hospitals of that part of Spain . A previThe subjective experience of using virtual slides by pathologists can be affected by many factors on sever side and on client side. On server side we need to consider factors associated to physical resources and those related to software performances like web server optimization or file accessing optimization, this is especially important in virtual slide technology. Our study took into consideration both sever and client factors, to compare similar environments. In Internet connections, our study did not control for available network bandwidth at the moment of the study nor factors associated on client side (PC performance), except for similar screen size (1024 \u00d7 768 pixels).Efficiency and performance of studied viewers is dependant on the magnification used. Aperio viewer is very efficient in overview images. The pyramidal optimized structure of Aperio images allows aAurora viewer is especially efficient in lower magnifications (10\u00d7). For larger magnifications (20\u00d7 and 40\u00d7) no significant differences were found between different vendors.File size (dimensions in pixels and file size in disk) did not have a significant impact in measured times.Performance information can help pathologists to decide which viewer is more suitable for their specific needs. Lower magnifications are difficult to optimize for speed in virtual slides but they are important in screening and larger biopsies studies.The authors declare that they have no competing interests."} +{"text": "Sir,One cannot but agree with the pitch for substantial changes in the current pharmacology curriculum. TraditioCurrent medical graduates learn their first lessons in rational and appropriate prescribing in busy out patient departments during their internship. Their knowledge about practical drug dosing and modifications to be made in various clinical scenarios leaves much more to be desired. The new guidelines for teaching pharmacology must be radical in scraping what is useless and in recommending a practical patient-based learning. This will bring the interest of medical students back into pharmacology classes."} +{"text": "Molecular oxygen is toxic for anaerobic organisms but it is also obvious that oxygen is poisonous to aerobic organisms as well, since oxygen plays an essential role for inducing molecular damage. Molecular oxygen is a triplet radical in its ground-stage (.O-O.) and has two unpaired electrons that can undergoes consecutive reductions of one electron and generates other more reactive forms of oxygen known as free radicals and reactive oxygen species. These reactants possess variable degrees of toxicity. Nitric oxide (NO\u2022) contains one unpaired electron and is, therefore, a radical. NO\u2022 is generated in biological tissues by specific nitric oxide synthases and acts as an important biological signal. Excessive nitric oxide production, under pathological conditions, leads to detrimental effects of this molecule on tissues, which can be attributed to its diffusion-limited reaction with superoxide to form the powerful and toxic oxidant, peroxynitrite.Reactive oxygen and nitrogen species are molecular \u201crenegades\u201d; these highly unstable products tend to react rapidly with adjacent molecules, donating, abstracting, or even sharing their outer orbital electron(s). This reaction not only changes the target molecule, but often passes the unpaired electron along to the target, generating a second free radical, which can then go on to react with a new target amplifying their effects.This review describes the mechanisms of oxidative damage and its relationship with the most highly studied neurodegenerative diseases and the roles of melatonin as free radical scavenger and neurocytoskeletal protector. Free radicals (pro-oxidants) are highly reactive, unstable molecules that have an unpaired electron in their outer shell. They react with several cellular components including nucleic acids, proteins, fatty acids, complex lipids, carbohydrates, etc. . Reactivvia several cellular oxidase systems. Once formed, it participates in several reactions yielding various reactive products such as hydrogen peroxide, peroxynitrite, etc. In turn, these can lead to chain reaction byproducts that also act to damage cells . An example of a very potent reactant is peroxynitrite which is 1,000 times more potent as an oxidizing compound than hydrogen peroxide [Examples of free radicals are hydrogen peroxide, hydroxyl radical, nitric oxide, superoxide anion and peroxyl radical. Superoxide is generated peroxide , 25.via the iron-catalyzed formation of reactive oxygen species [The whole nervous system is rich in metals, particularly, the brain is a specialized organ that accumulates iron ions and it is specially susceptible to oxidative damage since has a high metabolic activity and high content of unsaturated fatty acid , 45. The species , 65.Neurodegenerative diseases are a heterogeneous group of disorders characterized by the gradually progressive and irreversible destruction of specific neuronal populations. That loss of anatomically or physiologically related neuronal systems is complex and multifactorial. Although the etiology of the major neurodegenerative is unknown, there is substantial evidence that oxidative stress is a common critical factor in these diseases , 77.Antioxidant properties of melatonin and its metabolites , 69, 1232. These reactions are summarized as follows [The relationship between changes in atmospheric oxygen levels and the evolution of life on the earth are well documented biologically , 60. The(Anaerobic metabolism) glucose \u2192 2 lactate + 56 Kcal/mol glucose2 \u2192 6CO2 + 6H2O + 686 Kcal/mol glucose(Aerobic metabolism) glucose + 6O2 + 4e + 4H+ \u2192 2H2O includes 4 univalent steps (only one electron is transferred): Because of this, aerobic life forms had an advantage over anaerobes. Anaerobic organisms were also at a disadvantage because the extra oxygen was toxic to them. Oxygen metabolites are toxic to all life forms. For instance, obligated anaerobic organisms develop only in the absence of oxygen. Oxygen toxicity raises several questions: why it is toxic? Why can aerobic organisms prosper in an oxygen-containing atmosphere? Oxygen, in its fundamental state is not toxic, nevertheless, due to its electronic structure, which is includes two unpaired electrons. There are restrictions on its reactivity as an electron acceptor. It has been proposed that reaction of O2 + 1e \u2192 O2\u2013\u2022O2\u2013\u2022+ 1e + 2H+\u2192 H2O2O2O2 + 1e + H+\u2192 H3O2 \u2192 H2O + HO\u2022 H\u2022 + 1e + H+\u2192 H2OHO2 + 4e + 4H+ \u2192 2H2ONet: O2\u2013\u2022) and hydroxyl radical (HO\u2022) are intermediates; this represents a major problem for organisms, since these intermediates are potent oxidizing agents. HO\u2022 is the strongest oxidizing agent known; this radical can be formed in the following reaction:If oxygen reacts in this manner (and probably it does), the production of superoxide anion is formed within the cells by the interaction of two O2\u2013\u2022 in the presence of superoxide dismutase (SOD). Isoforms of SOD in mitochondria and cytosol have been described. Also, H2O2 is formed by two electron reduction of O2.Hydrogen peroxide formed during the propagation phase is toxic enough to restart the peroxidation of another PUFA[Free radical damage to macromolecules such as DNA, proteins, and polyunsaturated fatty acids (PUFA) probably produces the most notable functional cellular deficits , 122. PUther PUFA.2O2 produces neurocytoskeletal damage similar to that found in neurodegenerative diseases. Moreover, free radicals produce neurite damage, and neuronal loss [2O2 show distribution changes in beta-tubulin and the 2 isoforms of microtubule associated protein (MAP2) and an abnormal microtubule organization [2O2 inhibits cytoskeletal dependent processes such as dopamine release by the substantia nigra pars compacta of guinea pig brain [Products of lipid peroxidation can achieve access to the nucleus and harm DNA, besides changing the physiology and structure of the cellular membrane. These changes may be involved in cancer initiation among other pathological processes . Also, cnal loss , 87 and nal loss . Additionization . Moreoveig brain . Nitric oxide is a multifunctional molecule that participates in processes such as vasodilatation, bronchodilatation, neurotransmission, antimicrobial activity, inhibition of both phagocyte and platelet aggregation , 36,40, 2. NOS contains a reductase and oxygenase domain, with specific recognition sites for flavine mononucleotide (FMN), flavine-adenine dinucleotide (FAD), and nicotinamide-adenine phosphate dinucleotide (NADPH). NADPH, FMN, and FAD transport electrons to heme molecules bound to the oxygenase domain of the enzyme [2 (O-O) in order to modify the substrate (L-arginine) that will finally result in L-citrulline and NO production [NO is produced from the enzymatic conversion of the L-arginine mediated by oxide nitric synthase (NOS). The process consumes five electrons and results in formation of L-citrulline and NO, with the participation of electron enzymatic transporters. Such synthesis involves the successive oxidation with the use of NADPH as a transporter of electrons donated by Oe enzyme , 122. Thoduction .NOS was originally purified from rat cerebellum and seveThe difference relative to calmodulin dependence between iNOS and eNOS is that iNOS has strongly coupled domains for the calmodulin structure even with the lack of calcium. eNOS and nNOS require previous formation of calcium-calmodulin complex, followed by the enzymatic engagement, for which prior rises of intracellular calcium are required . 2\u2013\u2022. NO can react with molecular O2 giving highly reactive radicals in addition to nitrites and nitrates, which are easily measurable. Under physiological conditions, O2 is not the primary target of NO. The most probable reactions are:The NOS in absence of L-arginine works in an uncoupled mode and produces large quantities of O\u2022 + O2 \u2192 2NO2\u2022\u2192 NO2O42NO2O4 + H2O \u2192 HNO2 (nitrite) + HNO3 (nitrate)NO\u2022 + H2O \u2192 NO2O3NO2O3 + H2O \u2192 HNO2NO2\u2013\u2022 initiately, yielding NOO\u2013 and eventually HO\u2022, both of which are highly reactive; moreover, intermediate products are powerful inducers of lipid, protein, and DNA peroxidation; the consequences of these reactions are analyzed later [NO also reacts with Oed later .\u2022 + O2\u2013\u2022\u2192 OONO\u2022 \u2192 OONOH \u2192 NO2 + HO\u2022NOWith transition metals, especially heme iron, NO binds to the heme moiety of guanylyl cyclase and activates it to form cGMP. When cyclic oxygenase binds to the heme group the production of prostaglandin is increased; as a result, other enzymes that contain iron within a heme group are targets of NO. Catalase, cytochrome C, hemoglobin and peroxidase are examples:\u2022 + X-Fex\u2192 (X- Fex - NO\u2022) \u2192 X-Fex-1- NO+ (nitrosum ion)NO\u2022 + Y-Fey\u2192 (Y- Fey - NO\u2022) \u2192 Y-Fey-1- NO- (nitroxidum ion)NO\u2022 + Hb(Fe2+)O2\u2192 Hb (Fe3+) + NO3-NO- activates poly-ADP ribose synthetase (PARS) which coordinates DNA repair through the addition of ADP-ribose and the regulation of histones, high mobility proteins (HMGPs), nuclear matrix proteins (NMPs), topoisomerase I and the Ca++-Mg++-dependent endonuclease. When NO inhibits ribonucleotide reductase (RR) the delivery of deoxyribonucleotide triphosphate is decreased (NTP\u2192dNTP). The prolonged repair of DNA increases the activation of PARS. At the same time, constitutive poly-ADP ribose glycohydrolase degrades poly-ADP ribose. Four ATP molecules are required to rebuild nicotineadenine-diphosphate (NADP) from nicotinamide. Glycohydrolase from poly-ADP-ribose and PARS initiates a vicious cycle which reduces the levels of NAD, cellular energy and, ultimately, produces cell death [DNA damage induced by NO or ONOOll death , 137. Bell death .++ [Because NO has an important role in neurotransmission it is important to consider the mechanisms involved in its synthesis. NO production requires the engagement of calcium-calmodulin complex for the activation of constitutive synthases in neurons and endothelial cells (nNOS and eNOS) . This is++ . Accordi++ , 136.The activation of glutamate receptors is the main postsynaptic stimulus for NO synthesis. NMDA receptors associated with ionic channels have a high permeability to calcium ; althoug\u2122 and lithium [An increase in the levels of NOS mRNA has also been detected in response to stress , lactati lithium .In the pineal gland the production of NOS is regulated by a physiological stimulus. After 8 days of constant light exposure (which reduces melatonin synthesis), the activity of NOS decreases by 80% and the normal activity is restored by normal light/dark cycles for two days. Noradrenaline appears responsible for this photoneural regulation .A problem with NO occurs when it is produced in large quantities. iNOS can produce high amounts of NO for long periods. The iNOS route therefore represents a response element of the cytotoxic cellular immune response, and the induction of iNOS results in 30-fold increase in NO formation in the CNS .Macrophages, smooth muscle cells, and endothelial cells express iNOS when induced by proinflammatory agents such as LPS, IL-1\u03b2 and/or TNF-\u03b1. Structurally, iNOS is strongly bounded to calmodulin; therefore, calcium-calmodulin complex is not required for activation. The main step in the synthesis of NO is the cellular concentration of the enzyme; its signaling pathway involves protein-kinase C and induThe properties of NO are peculiar. For example, though it is a gas it stays dissolved in solution as a non-electrolytic substance capable of spreading to any compartment, since it is both liposoluble and hydrosoluble. NO at 1 nM is sufficient to interact with a billion synapses . The hal2. The mechanisms involved are complex, with greater inhibition occurring as the O2 concentration decreases, through a mechanism that includes regulation by the mitochondrial inner membrane [2O3 and ONOO- alter mitochondrial function through the irreversible modification of proteins. For instance, ONOO- induces inhibition of complex II, inhibition of the ATP synthase and nitration of Mn superoxide dismutase [via modification of specific cysteine residues in the proteins [With respect to mitochondrial cytochrome c oxidase regulation, NO binds reversibly to the binuclear oxygen binding site in cytochrome c oxidase (complex IV) in competition with oxygen , 31, 75,membrane , 30, 112membrane . Higher membrane . It was membrane ,107. In ismutase , 67, 89.proteins .Ginkgo biloba, and selegiline are three putative antioxidants that have been tested in randomized multicenter trials in the US [Recent evidence has focused attention on the role of oxidative stress in various acute and chronic neurodegenerative diseases . An incrn the US .Oxidative insults, whether over-excitation, excessive release of glutamate or ATP depletion caused by stroke, ischemia or inflammation, exposure to ionizing radiation, heavy-metal ions or oxidized lipoproteins may initiate various signaling cascades leading to apoptotic cell death and neurodegenerative disorders . Pathoph1); mitochondrial structures are also very susceptible to oxidative stress, as evidenced by massive induction of lipid peroxidation, protein oxidation, and mitochondrial DNA (mtDNA) mutations [Mitochondria are intimately involved in the production of ROS through one-electron carriers in the respiratory chain is reduced in multiple tissues, including brain, from patients with Parkinson's disease (PD) and Alzheimer's disease (AD). The ETC defects are specific to each illness, e.g., complex I in PD and complex IV in AD. In mtDNA-deficient clonal neuronal cells hybridized with mtDNA (\u201ccybrids\u201d) from PD or AD patients these defects are transferable with mtDNA and lead to increased production of ROS . ETC inh2--/H2O2/oxo-iron-mediated oxidations of 5-hydroxytryptamine might be endotoxins that contribute to neurodegeneration in brain regions innervated by serotonergic neurons. These metabolites are caused by methamphetamine (MA), glutamate-mediated oxidative toxicity, ischemia-reperfusion, and other neurodegenerative brain disorders [There exists the possibility that tryptamine-4,5-dione and perhaps other putative intraneuronal metabolites formed by the Oisorders .\u2022, inducing secondary initiation of lipid peroxidation and by promoting the oxidation of proteins. The iron chelator, deferoxamine, can limit these oxidative reactions and it scavenges peroxynitrite independent of iron chelation [via the Fenton reaction. The intracellular iron is usually tightly regulated, being bound by ferritin in an insoluble ferrihydrite core. The neurotoxin 6- hydroxydopamine (6-OHDA) releases iron from the ferritin core by reducing it to the ferrous form [in vivo.Also, metals have an important role in neurodegeneration. Iron can contribute to free radical damage by catalyzing the formation of the OHhelation . The incous form . In the in situ oxidation and readily catalyzes an H2O2-dependent oxidation. With deferoxamine the iron can be re-bound to the lesions. Characterization of the iron-binding site suggests that binding is dependent on available histidine residues and on protein conformation.Iron accumulation could be an important contributor to oxidative damage of AD . Redox-a2+, nitroxide spin probes, and membrane proteins of neocortical synaptosomes [In relation to free radical membrane damage and neurotoxicity in AD, an emerging hypothesis contends that \u03b2-amyloid toxicity results from peptide-mediated free radical reactions and the generation of ROS. Recently, it has been reported that reactivity of \u03b2-amyloid toward the oxidation-sensitive enzyme glutamine synthetase is related to the peptide's reactivity toward the spin trap phenyl-tert-butyl nitrone (PBN) and the neuronal damage may be due, in part, to oxidative processes initiated by amyloid-derived free radicals species. Electron paramagnetic resonance (EPR) spin labeling techniques and spectrophotometric assays provide evidence that a portion of synthetic \u03b2-amyloid -36 demonptosomes .2+ and ROS, and potentially contributes to neurotoxicity induced by other neurotoxins [2+ flux and homeostasis, and facilitates peroxidation of membrane lipids. Since both abnormal increases of intracellular Ca2+ and oxygen free radicals are present in pathways leading to neurodegeneration, the effect of aluminum on these parameters was examined in vitro using primary cultures of cerebellar granule cells. Exposure to glutamate (1-300 \u00b5M) caused a concentration-dependent uptake of 45Ca in granule cells to a maximum of 280% of basal value. Pretreatment with AlCl3 (1-1000 \u00b5M) has no effect on 45Ca accumulation, but increased the uptake induced by glutamate. Similarly, AlCl3 has no effect on intracellular free Ca2+ levels measured using the fluorescent probe fura-2, but it potentated the increase induced by glutamate. The production of ROS was examined using the fluorescent probe dichlorofluorescin. By itself, AlCl3 had little effect on ROS production; however, AlCl3 pretreatment increased ROS production induced by 50 \u00b5M Fe2+ [Aluminum may facilitate increases in intracellular Carotoxins . Althoug \u00b5M Fe2+ . Such me2O2 resulting in free radical production; in AD, the reduction of Cu(II) to Cu(I) by APP involves an electron-transfer reaction and could lead to a production of OH\u2022, thus, copper-mediated toxicity of APP-Cu(II)/(I) complexes may contribute to neurodegeneration in AD[AD and Familial ALS may be linked through a common mechanism. In Familial ALS, SOD-Cu(I) complexes are affected by Hion in AD.NO is involved in acquired immune deficiency syndrome (AIDS) dementia complex and viral encephalitis . It has Evidence exists, as seen previously, for oxidative damage to macromolecules in ALS, Huntington disease, PD, and AD. Potential therapeutic agents, based on the pathophysiology described, include inhibitors of glutamate release, antagonists of excitatory aminoacids, strategies to improve mitochondrial function, trophic factors and free radical scavengers , 92.Melatonin (N-acetyl-5-methoxytryptamine) a molecule produced by a diversity of organisms, from algae to humans, has an evolution parallel to that of aerobic metabolism , 135. In2\u2022 and OH\u2022. The primary sources of these oxidants include endothelial cells, macrophages, polymorpho-nuclear leucocytes, and hepatic cells. Experimentally, advanced administration of melatonin in animals experiencing ischemia-reperfusion reduces the levels of malondialdehydes (MDA) and 4-hydroxyalkenals (4-HDA), metabolites of membrane-lipid peroxidation, and therefore indicators of injure [2-\u2022 becomes the metabolite kynuramine [Melatonin\u2019s capacity to reduce lipoperoxidation damage of the membrane lipids it is also manifested during the process of ischemia-reperfusion. In a study of these phenomena, high quantities of highly toxic free radicals are generated, including Of injure . The mecf injure . Thereafnuramine .2-\u2022 [in vivo, the administration of melatonin prevented carbon tetrachloride (CCl4) damage, CCl4 is a toxin metabolized by cytochrome p450, to produce trichlorometyl radicals and cause the production of other free radicals which produce lipid peroxidation in the kidney and liver. In other studies, rat brain homogenates were incubated with kainate or hydrogen peroxide resulting in lipid peroxidation, but in the presence of melatonin, there was a reduction in lipid damage. Additionally, melatonin\u2019s effect was in a dose-dependent fashion [\u2022 radicals, which toxic enough to initiate lipid peroxidation [\u2022) [The protective effects against lipid peroxidation by melatonin has been evaluated extensively utilizin2-\u2022 , 138. Me fashion , 83. The fashion ; b) It sxidation , 98; c) xidation , 97, 98 xidation ; d) it mtion [\u2022) , 99 who tion [\u2022) ; e) it ition [\u2022) , 92, 95.In rat brain homogenates in the presence of NO, liberated by sodium nitroprusiate it was pIt is known that lipid peroxidation disturbs order and the lipid dynamic in biological membranes. After oxidative stress, membrane fluidity, a parameter that reflects activity in the phospholipid bilayer, is decreased . Melaton2O2 causes loss of neurites and a cytoskeletal retraction toward the perinuclear region. Melatonin prevents microfilament and microtubule collapse in N1E-115 cells as well as the increased lipid peroxidation and apoptosis caused by H2O2. Our findings also indicate that melatonin restores neurite formation, microtubule enlargement, and microfilament organization in microspikes and growth cones in cells cultured with H2O2. While, the PKC agonist caused cytoskeletal reorganization in the presence of H2O2, the PKC inhibitor, bis-indolylmaleimide, blocked neurite formation and cytoskeletal reorganization elicited by melatonin. In addition, the CaM antagonist, ophiobolin, was not able to protect the cells against the damage caused by H2O2. However, PMA and ophiobolin resembled the melatonin effects in cells treated with H2O2 and a cytoskeleton organized in neurites and a network all over the cytoplasm was observed. By contrast, the melatonin receptor antagonist did not abolish the protective effects of melatonin against the damage caused by H2O2. Our data suggest that melatonin can be a potential therapeutic agent in the treatment of neurodegenerative diseases through prevention of the cytoskeletal damage caused by free radicals and by restoration of cytoskeletal organization and neurite formation.HSince melatonin levels often are decreased in psychiatric illnesses, and as we described here the indolamine elicits neurite formation, it is plausible that the low levels of melatonin found in patients with schizophrenia and depression affect neurite formation and therefore neurodevelopment in these individuals. Furthermore, abnormalities in the process of neurite outgrowth could explain increased pruning found in patients with schizophrenia as abnormally formed neurites could be prone to higher rates of removal. Moreover, disconnectivity between brain structures, which has been proposed as the anatomical basis for psychosis could result from defects in neurite formation associated with low levels of melatonin. These data suggest that melatonin could have utility in the treatment of schizophrenia but this needs further study .2+/Calmodulin (CaM) decreases the activity and autophosphorylation of CaM kinase II, a key protein kinase, involved in neurite maturation [2O2) [2O2 through PKC activation. The PKC agonist, phorbol 12-myristate 13-acetate (PMA) caused cytoskeletal reorganization in the presence of H2O2, while the PKC inhibitor, bisindolylmaleimide, blocked neurite formation and microfilament reorganization elicited by melatonin. Thus, the stimulatory properties of melatonin on neuritogenesis as well as its modulatory actions on cytoskeletal protein phosphorylation suggest that melatonin may reestablish neurite formation and the basal levels of phosphorylated tau in N1E-115 cells treated with okadaic acid. Thus, in the present study, we evaluated the effects of melatonin in neuritogenesis by counting the damage rounded cells as well as cells bearing microspikes and neurites. Also, we measured the amount of phosphorylated levels of tau in N1E-115 cells treated with okadaic acid and melatonin. The results showed that in N1E-115 cells, melatonin reestablished neuritogenesis in okadaic damaged cells and blocked abnormal tau phosphorylation caused by this compound. Data strongly suggest that melatonin may improve cognition by impeding neuronal damage caused by tau hyperphosphorylation and cytoskeletal collapse and through establishing new neuronal pathways by neuritogenesis stimulation.Melatonin, the main product synthesized by the pineal gland has important properties that make this compound useful in the treatment of dementia , 96, 102turation , and cauturation . Recentl2) show that okadaic acid treatment increased the phosphorylation of tau at Ser-404. Melatonin added before, simultaneously or after okadaic acid treatment decreased tau hyperphosphorylation caused by this compound respectively . Densitometric analysis showed that okadaic acid augmented phosphorylated tau by 121% regarding the vehicle incubated cells. While melatonin decreased the relative quantity of phospho-tau when was added before, simultaneously, or after okadaic acid by 76%, 41%, 81%, respectively . No differences were found when tau was recognized by C-17 antibody in cell extracts obtained from cells cultured with okadaic acid, melatonin or combination of melatonin and okadaic acid treatments.To test whether melatonin at the physiological cerebrospinal fluid circulating concentration modified hyperphosphorylation of tau caused by okadaic acid, protein cell homogenates were separated in SDS-PAGE, proteins transferred to nitrocellulose paper and tau identified by Western blot by using an antibody that recognized phosphorylated 404 serine and C-17 antibody that recognized two tau isoforms at carboxyl terminal site. Fig. , a specific inhibitor of the serine/ threonine proteins phosphatases 1 and 2A that induces molecular and structural changes similar to those found in Alzheimer\u2019s disease. It is known that tau protein plays a key role in microtubule stabilization and in neurite formation and that dynamic change in microfilament organization also occurs during neurite formation. Therefore, in this work we evaluated the effects of melatonin on neuritogenesis and tau phosphorylation in N1E-115 cells incubated for 24 h with 15 nM OA in the presence of 10-11, 10-7 or 10-5 M melatonin added before, simultaneously or after OA treatment.Neuroprotective actions of melatonin have been shown to occur through its intracellular antioxidant mechanisms and its neurocytoskeletal protective effects. Previously, we showed in N1E-115 cells damaged with HMicrofilament organization was studied by RITC-phalloidin staining and fluorescence microscopy. Tau phosphorylation and tau levels were determined by Western Blot. The proteins were immunodetected by using a specific antibody that recognizes the tau\u00b4s 404 serine and the C-17 antibody that recognizes the tau COOH terminal sequence. The results showed that OA causes microfilament retraction toward the perinuclear region. The effect of OA was partially prevented by melatonin added 6h before simultaneously or after OA treatment. In addition, we found that melatonin added before, simultaneously or after OA treatment abolished tau hyperphosphorylation caused by OA. The results strongly suggest that melatonin acts as a neurocytoskeletal protector by decreasing tau hyperphoshorylation preserving the cytoskeletal structure. Data strongly suggest that melatonin may improve cognition by impeding neuronal damage by hyperphosphorylation and through establishing new neuronal pathways. Oxidative stress is a critical aspect of age-associated diseases, such as cancer, heart diseases and neurodegeneration. Most of free radical-related pathologies may have some another origin, but the common pathway once the process has begun, is oxidative damage. Since oxidative damage has the inherent capacity for perpetuating itself, free radical damage can be very severe.Oxidant damage and mitochondrial dysfunction go together. This occurs under \u201cnormal\u201d conditions in ageing, and under a variety of pathological conditions. Antioxidants, including melatonin should be tested for their efficacy in reducing the degenerative sign of aging as well as a protective agent against age-associated diseases that have an oxidative stress component."} +{"text": "The resulting cascade of reactions greatly magnifies melatonin's efficacy in reducing oxidative stress and apoptosis even in the presence of mitochondrial electron transport inhibitors. The actions of melatonin at the mitochondrial level are a consequence of melatonin and/or any of its metabolites. Thus, the molecular terrorism meted out by reactive oxygen and nitrogen species is held in check by melatonin and its derivatives.The intracellular environmental is a hostile one. Free radicals and related oxygen and nitrogen-based oxidizing agents persistently pulverize and damage molecules in the vicinity of where they are formed. The mitochondria especially are subjected to frequent and abundant oxidative abuse. The carnage that is left in the wake of these oxygen and nitrogen-related reactants is referred to as oxidative damage or oxidative stress. When mitochondrial electron transport complex inhibitors are used, e.g., rotenone, 1-methyl-1-phenyl-1,2,3,6-tetrahydropyridine, 3-nitropropionic acid or cyanide, pandemonium breaks loose within mitochondria as electron leakage leads to the generation of massive amounts of free radicals and related toxicants. The resulting oxidative stress initiates a series of events that leads to cellular apoptosis. To alleviate mitochondrial destruction and the associated cellular implosion, the cell has at its disposal a variety of free radical scavengers and antioxidants. Among these are melatonin and its metabolites. While melatonin stimulates several antioxidative enzymes it, as well as its metabolites (cyclic 3-hydroxymelatonin, N N-acetyl-5-methoxytryptamine) is an endogenously-produced molecule found throughout the animal kingdom from unicells to humans which is coupled to oxidative phosphorylation provides cells with their major means of generation of its energy requirements inhaled and eventually taken up by cells is processed in the mitochondrial ETC where it is converted to water following its four electron reduction. However, during this reductive process, partially reduced species of O2 are also produced including reactants that are reduced by one, two or three electrons, i.e., the superoxide anion (O2\u00b7\u2013) and hydroxyl radical (\u00b7OH) and one non-radical product, hydrogen peroxide (H2O2). Collectively, these agents are referred to as reactive oxygen species (ROS).The majority of molecular oxygen , respectively. Since H2O2 is the immediate precursor of the highly damaging \u00b7OH, it is imperative that H2O2 be removed from the intramitochondrial environment as quickly as possible. The major enzyme that accomplishes this is glutathione peroxidase (GPx), which metabolizes H2O2 to water and O2; in this process GPx also converts reduced glutathione (GSH) to its oxidized metabolite (GSSG). Given the major importance of GSH in mitochondrial physiology, it is essential that GSSG be reduced back to GSH; this is accomplished by glutathione reductase (GRd) . O2O2 from the mitochondrial environment is never complete and, via the Fenton reaction, some damaging \u00b7OH are always formed. Cellular organelles have no enzymatic means to remove \u00b7OH so it must either be neutralized by a free radical scavenger or it mutilates a bystander molecule. This carnage occurs in the immediate vicinity of where the \u00b7OH is formed because of its extremely rapid reaction rate; the damage is referred to as being site specific.The removal of H\u2013). Mitochondrial NO functions as a reversible antagonist of complex IV of the ETC by competing with O2 for its binding site. Usually tissue concentrations of NO and O2 are, respectively, in the ranges of 100\u2013500 nM and 10\u201330 \u00b5M. In these concentration ranges, NO causes roughly half maximal inhibition of mitochondrial respiration. Thus, NO is a physiological regulator of respiration and also of the rate of ATP synthesis ; two of these are nitric oxide (NO) and the peroxynitrite anion has been proposed to exist in mitochondria (mtNOS) . This latter product was identified by mass spectral analysis and carbon and proton-nuclear magnetic resonance (Tan 1-acetyl-N2-formyl-5-methoxykynuramine (AFMK) , GPx and GRd. The SOD isoforms dismutate Oet al., et al., et al., et al., It has been known for more than a decade that the activities of the antioxidative enzymes mentioned above are heightened in the presence of exogenously administered, pharmacological doses of melatonin , in the production of this tripeptide antioxidant. Often, under elevated oxidative stress conditions, melatonin preserves intracellular GSH levels. This is not necessarily related to the ability of melatonin to stimulate \u03b3-GCS since the indoleamine could preferentially scavenger free radicals and thereby preserve basal intracellular GSH concentrations. The stimulation of \u03b3-GCS, as originally described by Urata et al., .One final aspect should be considered when melatonin's ability to attenuate molecular impairment due to ROS/RNS is discussed. It is what Hardeland refers tThis section briefly summarizes the multiple processes by which melatonin may restrict the destruction of molecules and organelles normally inflicted by ROS/RNS. Whereas these processes have all been documented in vivo, the significance of each in forestalling oxidative damage may be cell specific.Several drugs have been identified which are classified as mitochondrial poisons, i.e., they interfere with the transfer of electrons through the ETC. These drugs greatly exaggerate the escape of electrons into the mitochondrial intramembraneous space leading to a reduction of molecular oxygen and formation of radicals. Additionally, reduced oxidative phosphorylation precipitates a depletion of ATP Beal, . These cet al., et al., Rotenone, a specific inhibitor of complex I of the mitochondrial ETC, causes the generation of an excessive number of free radicals. The damage inflicted by this drug is believed to be a consequence of the \u00b7OH , strongly potentiated rotenone-mediated death of pheochromocytoma (PC12) cells, a response attenuated by melatonin. Furthermore, in the presence of melatonin, free radicals were not detected to be released from PC12 cells co-exposed to rotenone plus the Ca2+ ionophore. Since melatonin did not change the concentration of Ca2+ nor did it prevent the inhibitory effect of rotenone on mitochondrial complex I, the authors concluded that the beneficial effects of melatonin on the mitochondria were primarily related to the antioxidative and free radical scavenging capacity of the indoleamine . It was immediately suspected that the drug caused damage to the dopaminergic cells of the substantia nigra which are the major neurons lost in individuals with idiopathic PD. When these individuals died and the brain was examined there was, in fact, a selective destruction of the mesencephalic dopamine-containing neurons. As tragic as these instances were, the identification of this destructive drug provided experimentalists with an agent that causes parkinson-like signs in animals. Use of MPTP has now become a model of examine the processes of PD as well as to investigate drugs that may modify the course of the disease.+). The latter molecule is then released from the glial cells and is taken into dopaminergic nerves via the dopamine transporter. MPP+ interferes with complex I of the mitochondrial ETC; this leads to cellular energy depletion and eventually to the death of dopaminergic cells.When administered to animals, MPTP is taken up by astrocytes surrounding dopaminergic neurons and terminals where it is metabolized to 1-methyl-4-phenylpyridinium was increased by melatonin treatment. The reduction in cyanide-mediated neural toxicity by melatonin was assumed to be related to the free radical scavenging activity of the indoleamine.Yamamoto and Tang performeWhen cultured rat cortical neurons were exposed to potassium cyanide over a range of concentrations (0.01\u20131.0 mM) lactate dehydrogenase efflux, indicative of cellular damage, into the culture medium was observed. Melatonin significantly reduced escape of the enzyme from the neurons and preserved their morphology opening, cytochrome c release, positive YOPRO-1 staining of the early apoptotic nuclei and DNA laddering. Besides inhibiting the apoptotic events initiated in astrocytes by H2O2, melatonin also reduced free radical formation and other degenerative cellular processes that resulted from the exposure of cells to either tert-butyl hydroperoxide or cumene hydroperoxide. Additionally, the protective effect of melatonin against these damaging agents was better than that provided by vitamin E (Jou et al., In a second, more complete study, this group examined in detail many aspects of apoptosis and showed that melatonin also prevented death of cells caused by the oxidizing agent, Het al., et al., et al., The greater efficacy of melatonin in reducing observable free radical generation and apoptotic processes than vitamin E is a common observation. A number of studies have compared melatonin with classic antioxidants, e.g., glutathione, mannitol, vitamin C, vitamin E, etc., and invariably melatonin performs in a superior manner (Sofic et al., According to Jou and colleagues the openet al. (Besides reducing free radical-mediated, mitochondrial-dependent apoptosis, a process that does not require an interaction of melatonin with a receptor, melatonin may also have a receptor-mediated means of reducing the likelihood of apoptosis. Kilic et al. examinedet al. concludeet al., et al., et al., et al., et al. (L and the reduction in cytochrome c release from mitochondria by melatonin in the damaged newborn rat brain.A follow-up study by the same group that melatonin acts to preserve the function of the PI-3 K/Akt pathway (Kilic , et al. who repoMitochondria are the site of a large percentage of free radicals and related toxicants that are generated in cells. These reactive products cause damage to essential mitochondrial molecules which result in opening of the mitochondrial transition pore, release of cytochrome c and activation of the down stream events that culminate in free radical-mediated, mitochondrial-dependent apoptosis.Since melatonin was discovered to be an indirect antioxidant and direct efficient free radical scavenger, its ability to reduce oxidative stress and to curtail cellular apoptosis has been repeatedly documented. It has also been shown that part of melatonin's ability to quell the oxidation of key molecules stems from its conversion to metabolites, i.e., cyclic 3-OHMEL, AFMK and AMK when it incapacitates free radicals and their related products.The ability of melatonin to protect against oxygen- and nitrogen-based reactants is obvious in situations where toxins that inhibit the mitochondrial electron transport complexes are used. The mitochondrial poisons cause electron leakage with the resultant formation of large numbers of free radicals and consequentially molecular damage. This mutilation is inhibited by melatonin and its metabolites.et al., et al., et al., et al., et al., et al., et al., et al., et al., While melatonin readily resists mitochondrial oxidative damage and cellular apoptosis, there are many unanswered questions remaining. Some of the most noteworthy relate to the intramitochondrial concentrations of melatonin, the precise location of the indoleamine in relation to the complexes of the ETC, is it melatonin or a melatonin derivative that is the active agent in mitochondria and a definitive explanation for its high efficacy in preventing mitochondrial and cellular free radical-mediated destruction. Melatonin's very low toxicity combined with its high efficacy, however, portends its use in clinical medicine to treat conditions that are associated with elevated free radical damage, e.g., septic shock (Gitto"} +{"text": "Crocidura russula is an ideal study model to address questions related to aging and associated changes in biological functions: its lifespan is short and is substantially increased in captivity; daily and seasonal rhythms, while very marked the first year of life, are dramatically altered during the senescence process which starts during the second year. Here we report on an investigation of the effects of melatonin administration on locomotor activity of aging shrews.Laboratory conditions nullify the extrinsic factors that determine the wild expected lifespan and release the intrinsic or potential lifespan. Thus, wild animals reared in a laboratory often show an increased lifespan, and consequently an increased senescence phase. Senescence is associated with a broad suite of physiological changes, including a decreased responsiveness of the circadian system. The time-keeping hormone melatonin, an important chemical player in this system, is suspected to have an anti-aging role. The Greater White-toothed shrew 1) The diel fluctuations of melatonin levels in young, adult and aging shrews were quantified in the pineal gland and plasma. In both, a marked diel rhythm was present in young animals but then decreased in adults, and, as a result of a loss in the nocturnal production, was absent in old animals. 2) Daily locomotor activity rhythm was monitored in pre-senescent animals that had received either a subcutaneous melatonin implant, an empty implant or no implant at all. In non-implanted and sham-implanted shrews, the rhythm was well marked in adults. A marked degradation in both period and amplitude, however, started after the age of 14\u201316 months. This pattern was considerably delayed in melatonin-implanted shrews who maintained the daily rhythm for significantly longer.This is the first long term study that investigates the effects of continuous melatonin delivery. As such, it sheds new light on the putative anti-aging role of melatonin by demonstrating that continuous melatonin administration delays the onset of senescence. In addition, the shrew appears to be a promising mammalian model for elucidating the precise relationships between melatonin and aging. Its mass-specific metabolic rate is among the highest ever measured in terrestrial mammals C. russula's lifespan is only 18 months in the wild C. russula exhibits seasonal and daily rhythmic components in most of its biological functions including reproduction, thermoregulation, coat replacement and locomotor activity C. russula is an ideal study model to investigate the possible effects of melatonin on the deterioration of biorhythms due to senescence.As in all shrews, Greater White-toothed shrew C. russula. We monitored the daily activity rhythms of animals starting just before the first clues of senescence appeared until death, i.e., over a period of more than 500 days. To the best of our knowledge, this is the first time that such a long-term survey has been performed. We show that a continuous delivery of melatonin through subcutaneous implants, maintains the rhythmic activity pattern in aging animals for an additional year when compared to controls.To determine whether it is the rhythmic administration of melatonin or the administration itself that impacts traits related to aging, we investigated the effect of a long-term continuous melatonin delivery on adults vs. young (<6 mo) shrews. In aged (>12 mo) shrews, nocturnal melatonin levels were similar to diurnal levels both in the pineal gland and plasma.A similar pattern of melatonin production was observed in the pineal gland and plasma (sample size of respectively 31 and 44) . Night-tin vitro system, melatonin release diminished with time, fitting an exponential decay , and decreased to 120 pg/ml 3 months later . In the al decay . High atAll individuals, aged 11\u201315 mo, displayed a marked diel activity rhythm, which was the highest during the first half of the night (expressed as the number of nest exits per hour) . A seconThis study provides new and important data on the role of melatonin in both the regulation of clock-controlled processes and aging. The continuous monitoring of spontaneous locomotor activity has emerged as one of the most widely used behavioral outputs in circadian research. More specifically, it is considered as extremely useful for the description of the effects of aging on circadian rhythms C. russula and its lifespan which is only 18 months in the wild N-acetyltransferase, linked to an impaired pineal catecholaminergic neurotransmission, could result in diminished or suppressed nocturnal production. Moreover, the aging process leads to pineal gland calcification This is the first set of experiments aimed at characterizing the diel pattern of melatonin secretion in the shrew. Two main characteristics were found. First, in untreated animals, pineal gland and plasma variations in melatonin content were strongly correlated. Second, in agreement with studies of other vertebrates C. russula, turns out to be extremely useful for the characterization of the effects of aging on daily rhythms. This unique system provides original and interesting data on the effects of melatonin on the age-related loss of locomotor activity rhythm.Adult shrews (12 mo) exhibited a significant bimodal diel pattern of activity of marked amplitude. We found that the amplitude of the rhythm decreased dramatically in controls and sham-implanted shrews, starting the second year of life, such that no rhythm was apparent after month 17. This is consistent with observations made on another Crocidurinae in vitro system to an intrinsic or potential lifespan. Moreover, thanks to their unique physiology, shrews provide a portal through which we can discern the possible role of melatonin in aging: the hormone alone, under continuous administration, delays the appearance of one aspect of senescence, the loss of daily activity rhythm. The mechanisms of melatonin action in the implanted shrews and the physiological significance of our findings are among the crucial questions that remain to be answered. Melatonin could be acting either through receptor-based mechanisms C. russula were collected in the Banyuls-sur-Mer area using non-baited pitfall traps. All the animals were transported to the Laboratoire Arago's animal facility. Shrews were housed in cages with 3 cm soil substratum, and provided with a hollow cylindrical piece of cork for shelter and moss for nesting material. All experimental procedures were approved by the Centre National de la Recherche Scientifique (CNRS).Wild White-toothed shrews The pharmacological dose of melatonin continuously delivered to individuals was supplied using implants adapted to the average body weight of shrews (10 g) shrews ranging from 1 to 32 mo. Individuals were randomly assigned to a treatment (implanted with melatonin or not implanted), an age, and a light phase group. Animals were euthanized either during the night or during the day (4 pm or 11 pm UT respectively). A total of 57 control shrews born in captivity were sampled from 1 to 32 mo, both for plasma and pineal gland assays. Plasma levels of melatonin were also measured in 4 implanted animals, 1 week and 3 months (2 each) after implantation.Plasma and pineal levels of melatonin were measured for the first generation of wild-trapped \u22123 Torr) until the liquid was completely removed. Samples were suspended in 50 \u00b5L ultra pure water, and stored at \u221220\u00b0C until the assay was performed. Blood was collected in heparin tubes and kept on ice for 4 hours. Samples were centrifuged for 10 min at 2,500 rpm at room temperature to extract the plasma and then stored at \u221280\u00b0C until use.Pineal glands were flash frozen in liquid nitrogen immediately after collection, and stored at \u221280\u00b0C. In order to extract melatonin, they were defrosted and ground in 200 \u00b5L methanol using a sonicator . The mix was completed with 300 \u00b5L methanol and homogenized by vortexing for 2 min. Samples were centrifuged for 2 min at 3,000 rpm at room temperature. The supernatant was then transferred to a new collection tube, and placed under high vacuum , and renewed every day for 130 days. The melatonin content of the liquid was measured from day 1 to 7, 10 to 22, 30 to 48, and finally at days 59, 78, and 130.Physiological buffer, plasma and pineal melatonin levels were measured using an enzyme-linked immunosorbent (ELISA) kit after purification according to the kit protocol . A nonparametric two-way analysis of variance and mealworms (Tenebrio molitor). Water and food were supplied outside the nest and at a different time each day. The acclimation period to the daily activity monitoring system lasted at least 60 days before the beginning of the experiment. By the age of 12 months, male and female shrews were randomly assigned to three treatment groups consisting of animals that received a subcutaneous melatonin implant (seven shrews) whereas control shrews received either an empty implant or no implant at all . The implants were renewed two times every five months. The sample size corresponded to 11, 9, and 6 shrews at, 12, 17 and 21 mo respectively. Only four individuals remained alive until 30 mo. Mortality was not significantly affected by the melatonin treatment . Recording the animal entrances and exits of the nest was performed using two infrared emitting diodes coupled to phototransistor sensors placed at the entrance of each plaster nest. The sensors were connected to a computer via a multiplexer. The data were acquired simultaneously and continuously for each individual of the three treatments for up to 535 days, and managed by generating a MySQL database.Juvenile (one to 2 mo) wild shrews were housed separately from mating pairs. By the age of nine to 10 months, they were transferred from a 12\u223612 light\u2236dark (LD) cycle to a natural one. The ambient temperature was 22\u00b12\u00b0C. They were housed in 50\u00d730\u00d770 cm individual glass q(p) statistic for p\u200a=\u200a24 h:p\u200a=\u200aperiod (24), n\u200a=\u200arow number (10), kx\u200a=\u200anumber of exits behaves as a khi-2 variable with p\u22121 degrees of freedom. A critical value 1/p corresponds to the \u201c24 h-period significance index\u201d.We used the khi-2 periodogram to define the activity rhythm periodicity. We looked for periods in the time series between 14 and 34 h. Ten day-long subseries were analyzed applying the moving window principle: successive subseries overlapping by one day were built and analyzed I was also built in order to track the evolution of the amplitude. I(d) was obtained by calculating the mean activity profile on the first 30 days of the series and then by measuring the difference between this mean profile and each successive daily profile, according to the formula: d\u200a=\u200aday, h\u200a=\u200ahour, RF\u200a=\u200amean exit activity on the 30 first days for hour h, dF (h) \u200a=\u200aexit activity at d day and h hour.An amplitude degradation index Activity profiles obtained for shrews that received an empty implant or no implant were pooled because the data obtained from the two groups did not differ significantly."} +{"text": "A total of 48 rabbits were randomly divided into four groups: control group, SAH group, SAH + vehicle group, and SAH + melatonin group. All SAH animals were subjected to injection of autologous blood into cisterna magna twice on day 0 and day 2. The melatonin was administered intraperitoneally at a dose of 5\u2009mg/kg/12\u2009h simultaneously with SAH from day 0 to day 5. The basilar arteries were extracted on day 5 after SAH. As a result, we found that vascular inflammation and oxidative stress were induced in all SAH animals. In animals given melatonin, basilar arterial NF-\u03baB and pro-inflammatory cytokines were decreased in comparison to vehicle-treated animals. Measures of oxidative stress also showed significant downregulation after melatonin treatment. Furthermore, administration of melatonin prevented vasospasm on day 5 following SAH. In conclusion, post-SAH melatonin administration may attenuate inflammatory response and oxidative stress in the spasmodic artery, and this may be one mechanism involved in the therapeutic effect of melatonin on the subsequent vasospasm after SAH.The aim of this study is to analyze whether melatonin administration influenced the nuclear factor-kappa B (NF- Cerebral vasospasm is the most common cause of disability and death in patients suffering from aneurysmal subarachnoid hemorrhage (SAH) . CerebraRecently, several studies on experimental models of SAH have demonstrated that melatonin can prevent vasospasm \u20137; howev\u03baB (NF-\u03baB) and proinflammatory cytokines, such as tumor necrosis factor \u03b1 (TNF-\u03b1), interleukin (IL)-1\u03b2, and IL-6, may be key factors contributing to the inflammation in spasmodic arteries ATP . EMSA was performed according to our previous study [\u03baB DNA binding activity were quantified by scanning the developed Kodak XAR-5 film with a computer-assisted, linear scanning densitometer in transparent mode . Data were expressed as arbitrary densitometry units (ADUs) obtained from the densitometric scans.Nuclear protein was extracted and quantified as described . EMSA waus study . After e\u03b1 from Diaclone Research, Besan\u00e7on, France; IL-1\u03b2, IL-6 from Biosource Europe SA, Nivelles, Belgium) and our previous study [The levels of inflammatory mediators were quantified using specific ELISA kits for rats according to the manufacturers' instructions SOD assay kit. The method of the assay employs xanthine and XOD to generate superoxide radicals which react with INT to form a red formazan dye. The SOD activity is then measured by the degree of inhibition of the reaction. One unit of SOD is that which causes a 50% inhibition of the rate of reduction of INT under the conditions of the assay. SOD activities of the samples were given as U/mg protein.2O2, oxidizing reduced GSH to form GSSG. GSSG is then reduced by GR and \u03b2-nicotinamide denine dinucleotide phosphate forming NADP+ (resulting in decreased absorbance at 340\u2009nm) and recycling the GSH. Because GSH-Px is limiting, the decrease in absorbance at 340\u2009nm is directly proportional to the GSH-Px concentration. GSH-Px activity is reported as units based on the definition: 1\u2009U of GSH-Px\u2009= the amount of enzyme necessary to catalyze the oxidation (by H2O2) of 1.0\u2009\u03bcmol GSH to GSSG per minute at 25\u00b0C, pH 7.0. GSH-Px activities of the tissue samples were given as units per milligram of protein.GSH-Px Assay kit was used for the determination of tissue GSH-Px activities and this assay is an adaptation of the method of previous studies , 15. TheP < .05.All data were presented as mean \u00b1 SD. SPSS 12.0 was used for statistical analysis of the data. All data were subjected to one-way ANOVA. Differences between experimental groups were determined by the Fisher's LSD posttest. Statistical significance was inferred at No significant changes in body weight, mean arterial blood pressure, temperature, or injected arterial blood gas data were detected in any of the experimental groups (data not shown). The rabbits all survived from the procedure of induction of experimental SAH.P < .01). A significant difference was detected between the SAH (211745.2 \u00b1 19158.4\u2009\u03bcm2) and the control (416253.4 \u00b1 32508.4\u2009\u03bcm2) groups (P < .01) (\u03bcm2) and SAH\u2009+\u2009vehicle (213345.6 \u00b1 12213.5\u2009\u03bcm2) groups (P < .01) (P > .05).As shown in P < .01) . There wP < .01) . No sign\u03baB binding activity in the basilar arteries post SAH, EMSA was performed to detect the changes of NF-\u03baB as described in \u03baB DNA binding activity of in the basilar arteries was shown in \u03baB binding activity (weak EMSA autoradiography) was found in the control group. Compared with the control group, NF-\u03baB binding activity in the artery was significantly increased (P < .01) in SAH or SAH\u2009+\u2009vehicle group on day 5 after SAH. There was no statistically significant difference between SAH group and SAH\u2009+\u2009vehicle group (P > .05) (\u03baB binding activity was significantly downregulated (P < .01) after melatonin injections.To determine the influence of melatonin on NF-P > .05) . In SAH\u2009\u03b2, TNF-\u03b1, and IL-6 were low in the basilar arteries of the control group . CompareP < .05) and significantly decreased the tissue SOD and GSH-Px enzyme activities (P < .05) when compared with controls. Melatonin treatment has shown protective effect via decreasing significantly (P < .05) the elevated MDA levels and also significantly increasing the reduced antioxidant enzyme activities .The values of the tissue MDA levels and tissue SOD and GSH-Px enzyme activities were shown in The main findings of this study are that (1) vascular inflammatory mediators were induced after SAH and could be remarkably repressed when treated with melatonin; (2) the increased lipid peroxidation in the artery tissues could be significantly downregulated after melatonin injections following experimental SAH; (3) after melatonin administration, the postSAH reduced antioxidative status was ameliorated in this two-hemorrhage model; (4) in agreement with the previous research , treatmeThere have been many studies focusing on the neurovascular protective effects of melatonin in SAH models \u20137, 16. M\u03baB and Proinflammatory cytokines played important roles [In the circumstance of SAH, a complex series of cellular and molecular events is elicited by the presence of a blood clot in the subarachnoid space, culminating in a robust inflammatory response. Following cellular and molecular events were involved: (1) expressions of adhesion molecules that evoke leukocytes adhesion to the endothelium; (2) cytokines production; (3) immunoglobulin and complement activation. Cerebral vasospasm might result from the interaction among those events . During nt roles .\u03baB in rat skeletal muscle after acute exercise [\u03baB activation, and iNOS over-expression. At the same time, the results from another previous study showed that melatonin exhibited a superior capacity to reduce the Proinflammatory cytokines in amyloid-beta-induced oxidative stress model [\u03baB, IL-1\u03b2, IL-6, and TNF-\u03b1, which has been reported in the previous studies [In the research regarding melatonin and inflammatory mediators, Alonso et al. investigated the effects of melatonin on the expressions of inducible nitric oxide synthase (iNOS) and NF-exercise . Their rss model . However studies , 9. Furt+-K+-ATPase activity were restored to control levels. However, for the vascular tissues, the effect of melatonin on oxidative stress following SAH still remains unknown. Our data demonstrated that treatment with melatonin induced the antioxidant defense system, downregulated lipid peroxidation in the basilar artery, and resulted in a significant increase of the cross-sectional area of basilar artery after SAH. Therefore, our results suggested the possibility of a vascular oxidation preventive function of melatonin administration following experimental SAH.Excessive production of free radicals and subsequent lipid peroxidation has been suggested causally related to cerebral vasospasm after SAH , 20. TheIn summary, to the best of our knowledge, this is the first study to demonstrate the effects of melatonin on inflammation and oxidative stress in the cerebral artery after SAH. We found that SAH could upregulate the inflammatory mediators, increase lipid peroxidation, and inhibit the antioxidant defense system in the rabbit basilar artery, which could be markedly modulated by melatonin administration. The treatment of melatonin in this SAH model resulted in attenuation the degree of cerebral vasospasm following SAH. These results suggest that SAH could induce vascular inflammatory process and oxidative stress in the arterial wall which might play a central role in the pathogenesis of cerebral vasospasm. The therapeutic benefit of postSAH melatonin administration might be due to its salutary effect on modulating Proinflammatory mediators and biomarkers of oxidative stress."} +{"text": "To investigate the effects of melatonin treatment in a rat model of white matter damage (WMD) in the developing brain. Additionally, we aim to delineate the cellular mechanisms of melatonin effect on the oligodendroglial cell lineage.A unilateral ligation of the uterine artery in pregnant rat at the embryonic day 17 induces fetal hypoxia and subsequent growth restriction (GR) in neonatal pups. GR and control pups received a daily intra-peritoneal injection of melatonin from birth to post-natal day (P) 3.in vitro.Melatonin administration was associated with a dramatic decrease in microglial activation and astroglial reaction compared to untreated GR pups. At P14, melatonin prevented white matter myelination defects with an increased number of mature oligodendrocytes (APC-immunoreactive) in treated GR pups. Conversely, melatonin was not found to be associated with an increased density of total oligodendrocytes (Olig2-immunoreactive), suggesting that melatonin is able to promote oligodendrocyte maturation but not proliferation. These effects appear to be melatonin-receptor dependent and were reproduced These data suggest that melatonin has a strong protective effect on developing damaged white matter through decreased microglial activation and oligodendroglial maturation leading to a normalization of the myelination process. Consequently, melatonin should be a considered as an effective neuroprotective candidate not only in perinatal brain damage but also in inflammatory and demyelinating diseases observed in adults. Brain injury and subsequent neurodevelopmental disabilities resulting from premature birth are a major public health concern. Indeed, preterm birth survivors can suffer from long term clinical, educational and social problems: 10\u201315% of infants surviving from very preterm delivery develop cerebral palsy and 50% show adverse neurodevelopmental outcome at 30 months of age. Due to dramatic improvement in perinatal management of high risk preterm neonates, pathological conditions associated with neurological impairment have changed over the past 10 years. Major focal destructive lesions remain serious but have become less common. In contrast, the most prominent neuropathological lesion is diffuse white matter damage (WMD) showing an association of glial injury together with microglial activation and, ultimately, myelination defects.Many factors are associated with WMD, including: infection, hypoxia, ischemia, endocrine imbalances, genetic factors and growth restriction in vivo and in vitro. In particular, melatonin acts as a direct and indirect antioxidant, specifically as a powerful scavenger of superoxide anion and stimulator of the synthesis of anti-oxidant enzymes. However, the consequences of melatonin treatment on the myelination process remain largely underexplored. Nonetheless, this question is crucial to thoroughly assess the potential impact of melatonin on myelination repair in perinatal and adult demyelinating diseases.The pleiotropic effects of melatonin, combined with its anti-oxidant, NMDA-blocking and anti-inflammatory properties, probably make this molecule an ideal candidate for pre-clinical studies. Moreover, this pharmacological agent has been proven to be safe for neonates when crossing the blood-brain barrier. Several experimental data have shown potent neuroprotective effects of melatonin both in in vivo and in vitro. Our results suggest that melatonin could be an effective neuroprotective candidate not only in perinatal white matter damage but also in inflammatory and demyelinating white matter diseases observed in adult.We addressed this question by testing melatonin treatment in a recently described rat model closely mimicking WMD observed in very preterm neonates Unilateral ligation of the intra-uterine artery was performed on pregnant Sprague-Dawley rat during embryonic day 17 (E17) 1 and MT2 with comparable affinities (affinity selectivity ratio MT1/MT2\u200a=\u200a15.5). To ensure that there were no differences in circadian rhythm between experimental groups, all rat pups were injected once a day at noon.Pups from at least three different litters were used in each experimental group. From birth (P0) to postnatal day 3 (P3), controls and GR pups received a daily i.p. injection with one of the following drugs (or combination of drugs) diluted in a final volume of 5 \u00b5l: 0.002 mg/kg/d to 20 mg/kg/d melatonin (Sigma), 5.0 mg/kg luzindole (Sigma) +/\u2212 20 mg/kg/d melatonin. Luzindole blocks melatonin receptors MTIn each experimental group, we studied 6 to 10 pups on P3 and P14 in three separate experiments. Animals were sacrificed under anaesthesia with inhaled isoflurance . Brain tissues were immersed in formol 4% during 5 days, embedded in paraffin and cut into 10-\u00b5m-thick sections.Immunolabeling with the primary antibody listed in All quantitative measurements were done by observers who were blinded to the experimental group of the studied animal.2 grid (at \u00d7400 magnification), in at least 6 animals per group.Immunoreactive cells were counted in the white matter underlying the cingular cortex (+2.16 to \u22120.36 mm from the bregma) on at least 4 non continuous sections at P3 and P14. Immunoreactive cells were counted within a 0.065 mmhttp://rsb.info.nih.gov/ij/) that read optical density as grey levels. Nonspecific background densities were measured at each brain level in a region devoid of MBP immunostaining and were substracted from the cingulum values.The optical density of MBP-immunoreactive fibers was measured in the thickest white matter in rodents, ie cingular white matter assessed in coronal sections (+2.16 to \u22120.36 mm from the bregma). At least 4 sections of 6 to 10 animals per group were examined on P14. Optical density was measured at \u00d7100 magnification using a computerized image analysis system in phosphate buffer. After a 10 min wash in a phosphate buffer, sections were dehydrated in graded alcohol baths and successively incubated in alcohol/araldite (v/v) for 1 h at 37\u00b0C, araldite for 15 h at 37\u00b0C, and araldite supplemented with 2% accelerator (Fluka) for 3 h at 37\u00b0C. Sections were then embedded in araldite (2 days at 60 \u00b0C). Silver ultrathin sections of the cingulate white matter (about 70 nm-thick) were made using an ultramicrotome and then collected on copper grids. They were counterstained with lead citrate for 10 min at room temperature in a drying chamber and examined using a Leo 912 electron microscope. In order to study the qualitative aspect of the myelin, the number of axons surrounded with an uncompacted myelin sheet was reported as the total number of myelinated axons counted of 20 electromicrographes at magnification \u00d74000. A qualitative score was applied to each myelinated axon see .Primary neuronal cultures (>98% purity assessed by MAP-2 (microtubule-associated protein-2) immunostaining, data not shown) were prepared using E18 embryonic rats. For oligodendrocyte, astrocyte and microglia primary cultures, cell populations were isolated from P0\u2013P2 newborn rats and subsequently cultured according to published protocols from 6 days to 3 weeks DNA-free total mRNA from cell cultures and cortical plate from rat aged from 1, 7 and 14 day-old rats were extracted from these cells using the previously published protocol in vitro. We used a well-established model of microglia subjected to LPS leading to both morphological and immunocytochemical changes and a dramatic increase in cytokines and free radicals production. In microglial cell cultures, the melatonin treatment was performed after 5 days of culture, 12 h before and at the same time as LPS exposure (100 ng/ml LPS) .Oligodendoglial cells were exposed to melatonin at 1 and 100 \u00b5mol diluted in DMSO 20% after 6, 8 and 10 days of culture. As our in vivo model is characterized by early microglial activation within developing white matter we further tested the ability of melatonin to modulate microglial activation 4 , tomato lectin and MBP overnight at 4\u00b0C. The appropriate secondary antibody was conjugated with either Alexia 488 or Alexia 594 , added to the coverslips and incubated for 1 hr. Nuclei were stained by adding Hoechst 33258 at a final concentration of 2 \u00b5g/ml for 1 min. The coverslips were mounted onto glass slides with FluoroMount and kept dark at 4\u00b0C. Cell images were captured with a fluorescence microscope equipped with a digital camera (Leica DMRB with Apogee Instruments Inc.). Quantification of labelled cells were based either on the density of immunoreactive cells compared to the total number of nuclei or the optical density of tomato-lectin immunoreactivity using ImageJ analysis system at \u00d7200 magnification.After treatments, cells were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature, washed 3 times with PBS, and blocked with PBST containing 5% goat serum for 1 hr at room temperature. The coverslips were incubated with mouse monoclonal antibodies O12. The following oligonucleotides 5\u2032-ATTGTCAAGTTAGTGCCTTCC-3\u2032 and 5\u2032-TTGAGACTGTGGCAAATGTAG-3\u2032, 5\u2032-GTCATTGGCTCTGTCTTCAAC-3\u2032 and 5\u2032-GTAGGTCGCACTGTGACAGAT-3\u2032 were used as sense and antisense primers, for MT1 and MT2. The nature of the amplified DNA was confirmed by sequencing. To standardize gene expression across samples, we first compared the expression levels of four well-known housekeeping genes within the samples. For reverse transcription, we used 600 ng of total RNA and the Iscript cDNA synthesis kit . Real-time PCR was set up using sybergreen-containing supermix (Bio-Rad) for 50 cycles with a three-step program . Amplification specificity was assessed by melting curve analyses. Each experiment was run twice with a least 6 animals per group, and in both cases, samples were assessed in triplicate.The DNA-free total RNA from control and GR brain cortex including white matter was obtained using a protocol adapted from Chomczynski and SacchiAll data were reported as means \u00b1 S.E.M. Analysis of variance was performed with age and groups (PBS- and melatonin-treated controls and GR pups) as the factors, and the Newman-Keuls post-test was used. Statistical tests were run on GraphPad Prism version 4.00 .Systemic treatment using 20 mg/kg/d melatonin given within the first 3 postnatal days was associated with a significant 58% attenuation of myelination defects detected in the cingulate white matter in P14 GR pups (p<0.001) . SimilarIn melatonin-exposed GR rats, the blockage of melatonin receptors, using luzindole co-treatment, eliminated the neuroprotective effect of melatonin on white matter myelination . In the Further experiments using electronic microscopy demonstrated ultrastructural quantitative and qualitative effects of melatonin on myelinated axons of rat pups that are subjected to antenatal uterine ligation. In PBS- or melatonin-treated control P14 pups, the developing white matter exhibited a high density of cells and myelinated ovoid axons with well-compacted myelin sheets . In contand mature (APC+) oligodendrocytes at P14 , we next asked the question whether these two receptors were expressed in the various cell types populating the developing white matter at the time melatonin treatment was given. We tested this using RT-PCR drocytes . Immunocdrocytes .in vitro. In the oligodendroglial lineage model we observed that 1 \u00b5mol melatonin exposure was associated with an enhancement of oligodendroglial maturation to myelinating oligodendrocytes behind the neuroprotective benefits of melatonin are not yet fully elucidated. To date, it has been shown that the effect of melatonin include endocrine, autocrine and paracrine actions, decreased inflammation, and antioxidant effects. Melatonin has also some benefits in other \u201ctoxic models\u201d of perinatal brain damage based on excitotoxic cascade In conclusion, our results demonstrate that melatonin could preserve axonal myelination in adverse conditions. The neuroprotective pathway appears to implicate both melatonin receptors and inflammatory modulation, leading to a promotion of oligodendrocyte maturation. The present study also delineates the cellular mechanisms of melatonin neuroprotective benefits. Furthermore, our data strongly suggest that melatonin could be of great interest not only in perinatal white matter damage but also as a potential neuroprotective strategy for myelinopathy diseases observed in adults.Figure S1Double immunolabeling using GFAP and Olig2 markers in cingulate white matter. Most of Olig2 nuclei did not colocalized with GFAP+ cells in the developing white matter.(7.60 MB TIF)Click here for additional data file.Figure S2Quantification of TUNEL+ cells detected in the hemispheric white matter at P3 from control (Ctl) and GR rat pups treated or not with Melatonin (Mel).(2.36 MB TIF)Click here for additional data file.Figure S3Quantitative analysis of the MBP-positive fibers optical density in the cingulate white matter of internal controls and sham control pups treated with either PBS or with melatonin 20 mg/kg.(1.99 MB TIF)Click here for additional data file.Figure S4Quantitative analysis of Ki67+ nuclei in the cingulate white matter according to the experimental groups at P3 and P14.(1.83 MB TIF)Click here for additional data file.Figure S5Immuno-labelling of primary oligodendroglial cell cultures using either APC or PLP at DIV6 and DIV10, respectively with or without treatment with 1 \u00b5mol melatonin.(8.15 MB TIF)Click here for additional data file.Table S1Brain weight (mean +/\u2212 SD) from delivery to P14 of rat pups in the experimental groups.(0.03 MB DOC)Click here for additional data file."} +{"text": "The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA\u2013directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA\u2013Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA\u2013encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V\u2013loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM\u2013independent and comes specifically at chromosome 4, in addition to the RdDM pathway. de novo methylation of cytosines at repeated sequences. The RNA polymerases Pol IV and Pol V are two key components of the RdDM pathway. Pol IV acts with RDR2 (RNA\u2013dependent RNA polymerase 2) and DCL3 (Dicer-Like protein 3) to generate short interfering RNAs (siRNAs). Pol V, in a partnership including AGO4 (Argonaute4) and DRM2 (Domains Rearranged Methyltransferase 2), drives DNA methylation at the targeted sequence. Changes in 5S rDNA methylation, 5S rDNA chromatin compaction, and 5S siRNA accumulation in Pol IV/V mutants have been reported. However, 5S rDNA arrays were considered together. In the present study, we observed an overexpression of the atypic 5S-210 transcript, restricted to the 5S rDNA array from chomosome 4. This derepression is specific to the Pol V\u2013loss of function (and not to Pol IV) and comes in addition to the RdDM pathway. The Pol V\u2013loss of function induces also the chromatin decondensation of the derepressed 5S locus at chomosome 4. Our results highlight a new role for Pol V which, suprisingly, appears to be Pol IV\u2013 and RdDM\u2013independent.In plant genomes, the RNA\u2013directed DNA methylation (RdDM) process induces Previous study revealed that in adult wild-type plants, only \u00abmajor\u00bb 5S RNA genes were expressed whereas \u00abminor\u00bb genes, which diverge from \u00abmajor\u00bb ones at only one or several positions, are repressed To determine the individual contribution of Pol IV and Pol V in the transcriptional silencing and heterochromatic state of each 5S array, we assayed 5S-210 transcript expression, chromatin compaction and DNA methylation during early development. We have shown that Pol IV, Pol V and several actors of the RdDM, contribute to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we showed an additional Pol V activity, Pol IV- and RdDM-independent which drives silencing of 5S rDNA specifically at chromosome 4. The large silencing release observed at chromosome 4 in NRPE1 and NRPE5a (Pol V) mutants, is accompanied by a decompaction of the corresponding 5S rDNA locus, as well as decompaction of NOR loci.We previously identified a 5S transcript, 210 bases-long (5S-210) which is a marker of silencing release at 5S RNA genes. This 5S-210 transcript homologous to the 120 nt genic region and 90 nt from the adjacent intergenic region nrpd1 (mutant of the largest subunit of Pol IV), nrpd2 (mutant of the common subunit of Pol IV and Pol V), nrpe1 (mutant of the largest subunit of Pol V) and nrpe5a and Pol V (formerly Pol IVb) on 5S RNA genes silencing, we analysed 5S-210 accumulation by RT-PCR experiments in WT, nrpe1, nrpd2 and nrpe5a compared to WT plants. On the contrary, nrpd1, rdr2, dcl3, hen1, ago4, drm2 and sil1 plants accumulate similar 5S-210 transcripts quantities than WT of the nrpe1 and (77%) of nrpd2 nuclei harbor decondensed 5S signals at chromosome 4. From these analyses, we conclude that 5S arrays from chromosome 4 are decondensed in nrpe1, and these results are confirmed with nrpd2 observations, whereas nrpd1 has no visible effect on this compaction. Therefore, NRPE1/Pol V has the ability to act on the chromatin of 5S rDNA from chromosome 4 in a NRPD1/Pol IV- independent manner.FISH analysis revealed that 36% of the WT nuclei contain one or two decondensed 5S signals at chromosome 4. The proportions are similar in WT and nrpd1, nrpe1 and nrpd2 plants with the 5S array from chromosome 4. Therefore, we hypothesized that both rDNA arrays (5S and 45S) might be co-regulated and be the site of common decompaction events.nrpd1, nrpe1 and nrpd2 mutants can occur without changes of the 5S RNAs quantity The quantitative 5S RNA derepression associated with chromatin decompaction is unambiguously limited to the 5S array from chromosome 4 in PolV-loss of function mutants. However, previous results have unequivocally shown that 5S rDNA is hypomethylated in NRPD1, RDR2 and DRM2 mutants of the RdDM pathway nrpd1, nrpe1, nrpd2, rdr2 and drm2 compared to the WT. It demonstrates the impact of Pol IV, RDR2, DRM2 and Pol V on the 5S array from both chromosomes.We therefore decided to analyze the heterogeneity of 5S-210 transcripts produced by 5S arrays from chromosomes 4 and 5 to test whether NRPD1, RDR2, DRM2 and NRPE1 act on each 5S array. As shown i.e. a derepression of heterogenous 5S RNA genes is observed without increasing the total amount of 5S-210 RNA. Silencing of 5S RNA genes from chromosome 4 is controlled by Pol IV, RDR2, DRM2 and Pol V at the qualitative level, and Pol V exerts an additional role acting at the quantitative level.These results refine our previous conclusions indicating that silencing of 5S RNA genes from chromosome 5 is controlled by Pol IV, RDR2, DRM2 and Pol V at the qualitative level. Their mutation has an equivalent effect The results show that Pol IV, RDR2, DRM2 and Pol V act in the RdDM pathway, to maintain the repression of heterogenous 5S RNA genes from chomosomes 4 and 5. They also show a specific and additional role of Pol V, Pol IV-, RDR2- and DRM2- independent and therefore RdDM-independent, on 5S array from chromosome 4. There is therefore a differential Pol V impact on 5S arrays from chromosomes 4 and 5.nrpe1 and nrpd2 compared to RdDM mutants is not expected nrpd1, nrpe1, nrpd2, rdr2 and drm2 mutants compared to the WT for both 5S rDNA arrays. Moreover, the same reduction of methylation is observed at chromosome 4 in all the mutants. These results reveal that derepression and decompaction of the 5S array at chromosome 4 in nrpe1 is not associated with specific changes of 5S rDNA asymmetric methylation. They also show that the similar reduction of methylation observed at both arrays results from the loss of RdDM pathway.To confirm that Pol V-additional activity at chromosome 4 is RdDM-independent, we assayed cytosine methylation in asymmetric sequence context (CHH), which largely results from RdDM. Indeed, if the Pol V-additional activity is RdDM-independent, a lower DNA methylation in Previous results have shown that 5S rDNA is subject to a variety of overlapping regulation pathways, such as the limiting amount of TFIIIA nrpd1, rdr2, drm2, nrpe1, ago4 or dcl3 mutants In this paper, we have shown that silencing of 5S RNA genes from chromosomes 4 and 5 is controlled at the qualitative level by RdDM including Pol IV, RDR2, DRM2 and Pol V activities. Loss of this silencing pathway leads to the derepression of heterogenous 5S RNA genes, without an increase of total 5S RNA amount and without a detectable chromatin decompaction. These results are consistent with the previously reported reduction or elimination of 5S siRNAs (the 1003 siRNA) as well as with the 5S rDNA hypomethylation observed in nrpe1 and nrpe5a, two Pol V-specific subunits, correlating with a specific decompaction of this 5S rDNA array in nrpe1 and nrpd2. On the contrary, similar amounts of transcripts were obtained in WT and all the tested RdDM mutants, and chromatin decompaction is absent in nrpd1. Therefore, the additional role of Pol V on chromosome 4 is Pol IV- and RdDM- independent. Moreover, the Pol V activity observed specifically at chromosome 4 is not associated with changes of 5S rDNA asymmetric methylation, in agreement with the similar global 5S rDNA methylation observed in nrpd1 and nrpe1 , nrpd1b-1 (nrpe1), nrpd2a-1 (nrpd2), rdr2-1, dcl3-1, drm2-2 and the corresponding wild type young plantlets were from Columbia ecotype. nrpd1a-1, nrpd1b-1, rdr2-1, dcl3-1 seeds were obtained from Dr T. Lagrange . nrpd2a-1 and drm2-2 seeds were obtained from the Arabidopsis Biological Resource Center (Stock # SALK 095689 and 150863 respectively). sil1, ago4-1 and WT plants were in Landsberg erecta background. Seeds of WT, sil1 and ago4-1 plants were obtained from the NASC . nrpe5a-1 and WT WS seeds were obtained from Dr T. Lagrange. After synchronization 2 days at 4\u00b0C, seeds were grown on a germination medium in a growth chamber using a 16 h light (120 \u00b5E.m\u22122.sec\u22121)/8 h dark regime at 23\u00b0C. Plantlets at 4 days post-germination were used.Prior to use, tissues were fixed in ethanol/acetic (3\u22361) solution. Probes were labeled by PCR using gene specific primers with biotin-16-UTP (Roche) or digoxigenin-11-UTP (Roche). FISH experiments were performed according to Mathieu et al. (2003). Biotin-labeled (5S rDNA) and digoxigenin-labeled (25S rDNA) probes were used. Avidin conjugated with Texas Red followed by goat anti-avidin conjugated with biotin and avidin\u2013Texas Red (1\u2236500) were used for the detection of the biotin-labeled probe; mouse anti-digoxigenin followed by rabbit anti-mouse fluorescein isothiocyanate (FITC) and Alexa 488-conjugated goat-anti-rabbit (Molecular Probes) were used for the detection of the digoxigenin-labeled probe. Before microscopic analysis, nuclei were stained with DAPI .For microscopic analysis, an epifluorescence Imager Z1 microscope (Zeiss) with an Axiocam MRm camera (Zeiss) was used. Fluorescence images for each fluorochrome were captured separately through the appropriate excitation filters. The images were pseudocolored, merged and processed with the Adobe Photoshop software (Adobe Systems). 45 to 62 nuclei were analyzed for each genotype.Compaction of 5S arrays from chromosomes 4 and chromosomes 3+5 were considered separately. Each group of 5S array (4 or 3+5) was considered as decompacted when at least one signal was decondensed. The number of NOR signals was analyzed in 45 to 62 nuclei for each genotype.Proportion of 5S-210 transcripts from chromosomes 4 and 5 and percentage of heterogenous 5S-210 transcripts were compared with Fisher's exact test for a 2\u00d72 contingency table. The probabilities were calculated from a one-tailed test. Statistical analysis of 5S-210 transcripts amounts were performed using the nonparametric Mann-Whitney U-test with mean values comparison. For statistical analyses of 5S rDNA and NOR compaction, a comparison of proportions Z-test was used. The probabilities were calculated from a one-tailed test. Interval confidence (IC) was calculated for each proportion with a confidence level of 99%.ACTIN2 RNA was used as an internal control and to normalize RNA amounts. Detection of 5S-210 and ACTIN2 transcripts was performed in the same reaction tube. Amplification conditions: 50\u00b0C for 30 min (reverse transcription step); 95\u00b0C for 15 min (reverse transcriptase inactivation step); 30 cycles ; 72\u00b0C for 10 min. 5S-210 transcripts were amplified using primers RTPCR5S1 (5\u2032-GGATGCGATCATACCAG-3\u2032) and 5SUNIV2 (5\u2032-CGAAAAGGTATCACATGCC-3\u2032). ACTIN2 transcripts were amplified using primers ACT2-F and ACT2-R according to Vaillant et al. Aliquot of 1 \u00b5g of total RNA was treated with DNA-free\u2122 Kit (Ambion) and 100 ng of DNase-treated total RNA was used as input in semi-quantitative RT-PCR reactions using the OneStep RT-PCR Kit (Qiagen). Controls were performed without reverse transcription step to detect contaminating DNA. Amplification of Amounts of amplicons were estimated using a Versadoc coupled to the QuantityOne software (Biorad).www.infobiogen.fr).PCR products were subcloned in the pGem-T easy plasmid using the pGem-T vector system (Promega). Sequencing was performed using the CEQ 2000 Dye terminator cycle sequencer (Beckman). Computer sequence analysis was performed with the Clustawl program (CATCCCTC(T)17 specific for chromosome 4, CATCCCTCTTTTATGTTTAACC specific for chromosome 5 and TCGAAAACAATGCTTGAACAAG used for both arrays. The specificity of this amplification was tested on YACs containing respectively the 5S array from chromosome 4 (YAC 9D3) and from chromosome 5 (YAC 6A1) Genomic DNA was extracted from seedlings according to the cetyltrimethylammonium bromide (CTAB) method ACTIN2. ACTIN2 amplification was used to control equal templates concentration.Primers ACT2-F and ACT2-R Vaillant et al. APETALA1 gene (accession AT1G69120.1) which contains 2 non methylated NlaIII sites. Primers: 2F: TTTGGTTGGTTCAGATTTTGTTTCG and 2R: CCAAGAATCAGTGGAGTATTCGAAG were used for PCR amplification.Total digestion was controlled with ACTIN2: 28 cycles ; 72\u00b0C for 10 min. APETALA1: 25 cycles ; 72\u00b0C for 10 min. 5 to 8 experiments were performed.Amplification conditions: 20 cycles ; 72\u00b0C for 10 min for 5S rDNA. Amounts of amplicons were estimated using a Versadoc coupled to the QuantityOne software (Biorad). The DNA methylation level was calculated with the ratio: Amount of amplicon in digested DNA/Amount of amplicon in non-digested DNA.Figure S1Sequence alignment of 5S-210 transcripts. Representative sequence alignment of heterogenous 5S-210 transcripts from chromosomes 4 and 5 with the reference sequence from the same chromosome. Nucleotide positions diverging from the reference are in black box. The chromosome-specific T-stretch is in grey.(2.91 MB EPS)Click here for additional data file."} +{"text": "Apart from the chapter on pathology, this is a single author book and has most of the advantages and few of the drawbacks of such an approach. The author is a nuclear medicine physician/\u2018thyroidologist\u2019 with several decades of recent practice at Stanford in USA, preceded by working in the UK and enriched by sabbaticals elsewhere. The target audience is wide, mostly within the medical specialties in a wide range of disciplines but also nurses, students and patients. The detail of the text and comprehensive scope of the reviews make it entirely suitable for those with a major interest in thyroid cancer who will appreciate it for its clear presentation of principles and rationale for treatments and as a guide to the management of difficult problems.An understanding of basic principles is not assumed. The sections on epidemiology and radiation physics and dosimetry especially develop the principles clearly and logically and are well worth attention. It therefore functions well both as a book to dip into for specific questions and as a comprehensive presentation of the evidence and process necessary to provide a modern practice. There is a consistent approach with a logical progression between the chapters that reinforce the principles without undue repetition. The broad personal experience provides a series of anecdotes and, while personal preferences are certainly expressed, these are always placed on an extensive and balanced background of literature review.The volume is some 398 A4 pages long and comprises 12 chapters. There are extensive references for each ranging from 60 or so for the epidemiology to 680 for the main management chapter. The majority relate to papillary and follicular tumours but lymphoma, medullary and anaplastic cancers are presented. The anatomy, physiology, aetiology and pathology are well covered with up to date information, especially on the genetics. There is good use of illustrative photographs and clear explanatory diagrams. The principles of nuclear medicine scanning, the interpretation of the scans and the physics underlying therapy are explained from first principles and would be very valuable to all non-nuclear medicine physicians in the field.He does not fail to tackle the current controversial issues that are the extent of surgery necessary, the need for ablation, the use and difficulties with thyroglobulin and the developing role of recombinant TSH. Very specific guidelines are outlined and examples of information sheets provided. These could be easily adapted for centres needing to update their own written information.I have few and minor reservations. In view of the detail in which the majority of the book is presented, a greater discussion about loco-regional relapse, its impact on the patient and its management and outcome would have been a welcome addition. It is generally very well presented but there are places where the figures are at some distance from the text that refers to them and impedes the ease of reading.In summary this is a well-presented text, comprehensive in content, logical and well presented. It combines clear management principles based on both personal experience and extensive familiarity with the literature. It is highly recommended for those with a major interest in thyroid cancer and would be a good reference volume on this topic for a library."} +{"text": "Chronic infection with hepatitis B virus (HBV) is associated with the majority of cases of liver cirrhosis (LC) in China. Although liver biopsy is the reference method for evaluation of cirrhosis, it is an invasive procedure with inherent risk. The aim of this study is to discover novel noninvasive specific serum biomarkers for the diagnosis of HBV-induced LC. We performed bead fractionation/MALDI-TOF MS analysis on sera from patients with LC. Thirteen feature peaks which had optimal discriminatory performance were obtained by using support-vector-machine-(SVM-) based strategy. Based on the previous results, five supervised machine learning methods were employed to construct classifiers that discriminated proteomic spectra of patients with HBV-induced LC from those of controls. Here, we describe two novel methods for prediction of HBV-induced LC, termed LC-NB and LC-MLP, respectively. We obtained a sensitivity of 90.9%, a specificity of 94.9%, and overall accuracy of 93.8% on an independent test set. Comparisons with the existing methods showed that LC-NB and LC-MLP held better accuracy. Our study suggests that potential serum biomarkers can be determined for discriminating LC and non-LC cohorts by using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. These two classifiers could be used for clinical practice in HBV-induced LC assessment. Patients with liver cirrhosis (LC) caused by chronic hepatitis B virus (HBV) are at high risks of developing hepatocellular carcinoma (HCC) \u20134. In ChRecently, proteomics studies using high-throughput spectrometric methods such as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF\u2009MS) and surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF\u2009MS) have proved possible methods for the identification of new disease biomarkers . Up to nFrom December 2009 to August 2010, a total of 162 serum samples including 44 LC patients with chronic hepatitis B (CHB), 46 patients with CHB, and 72 healthy individuals were collected with informed consent in Jinan Military General Hospital . The design of the study was approved by the Hospital Ethical Committee. Two groups of consecutive subjects were enrolled. The first group consisted of patients with HBV-infected LC. LC patients were diagnosed mainly depending on clinical history, physical examination, laboratory results, and ultrasonographic and/or computed tomographic imaging with liver biopsy . The secBlood sampling from patients was done before the initiation of specific therapy. The blood samples were collected in 5\u2009mL BD Vacutainers without anticoagulation and allowed to clot at room temperature for up to 1\u2009hr . The ser\u03bcL serum was mixed with 5\u2009\u03bcL beads and 20\u2009\u03bcL of binding solution. The beads were washed three times with 100\u2009\u03bcL of wash solution after 10\u2009min incubation [\u03bcL of eluent buffer were used to elute the bound peptides. After mixing with 1\u2009\u03bcL of CHCA matrix solution, the eluent was spotted onto a 600\u2009\u03bcm-diameter spot size 384 MTP target plate until dry. The peptide calibration standard was applied to target spots for external calibration of the instrument in the same matrix. To obtain the peptidome of serum samples, the analysis of the processed samples was performed by an Autoflex MALDI-TOF MS equipped with a pulsed ion extraction ion source.Copper-chelated magnetic beads and solutions were used for extracting peptides from serum samples . In briecubation . Then, 2Serum pools were analyzed from healthy volunteers 5 times for reproducibility. Within-run assays were carried out by using MALDI-TOF MS. The mean value and coefficient of variance (CV) were calculated, respectively.n = 81) and the test sets (n = 81) were created. Based on the training set, peak statistics were done by the SVM-based strategy in WEKA. In feature selection, \u201ccross-validation\u201d was selected as the attribute selection mode, and tenfold splits as default were performed. Finally, we obtained a list of peaks sorted along the statistical difference between two classes , which was used for further data analysis.Three bioinformatics tools were employed for data processing and analysis, including ClinProt Tools software 2.2 , flexAnalysis , and Waikato Environment for Knowledge Analysis (WEKA) . First, To predict liver cirrhosis, five classifiers were constructed based on the training set using five supervised machine learning methods in WEKA, respectively. A 10-fold cross-validation was performed to avoid model-specific overfitting. To perform cross-validation, all the records were randomly divided into ten parts; nine sets were used for training and the rest one for testing. The process was repeated ten times and the accuracy for true, false and total accuracy was calculated. The final accuracy is the average of the accuracy in all ten tests. With the test set , we evaluated the generalization performance of the five classifiers by considering the number of correctly classified and incorrectly classified samples in the test set. Accuracy (ACC), sensitivity (SE), and specificity (SP) were also calculated. To evaluate the performance of a range of classifiers, StAR was usedThe reproducibility with ten mixed serum samples from the healthy controls was evaluated by the Autoflex MALDI-TOF MS. The mixed serum samples were spotted on five spot WCX magnetic beads. Overall, the Autoflex revealed the mean CV (19.8%) for within-run assay .m/z between 800 and 10000\u2009Da were obtained from the 162 serum samples. Fifty percent of subjects serum spectra were used as training set (n = 81) and others as test set (n = 81) . The complete mass spectrum comparison of serum samples between LC and non-LC groups is listed in (n = 81) . After dTo predict LC, five classifiers including LC-NB, LC-MLP, LC-SVM, LC-DT, and LC-CART were constructed by five supervised machine learning methods, that is, NB, MLP, SVM, DT, and CART, respectively. To evaluate the performance of the five classifiers, we applied a preliminary test by tenfold cross-validation on the training set . LC-MLP P = 0.7871). The ability of a classifier to discriminate data correctly in the test set is known as its generalization performance . We thusIn this study, we obtained thirteen serum peptides for the prediction of HBV-induced liver cirrhosis by statistical comparison of serum peptide pattern of LC and control with MALDI-TOF MS. Subsequently, we investigated five supervised machine learning methods for predicting liver cirrhosis. We found that LC-NB and LC-MLP gave better results (AUC > 0.950) among the five classifiers. Our results indicate that the two classifiers are useful tools for predicting HBV-infected liver cirrhosis through analysis of the serum peptide pattern.LC is defined as the histological development of regenerative nodules surrounded by fibrous bands in response to chronic liver injury, which is mainly caused by HBV in China , 31. TheFeature selection is an important step of data preprocessing . In thisP = 0.7871). As a result, both of them were selected as our prediction classifiers in this study (Classifier performance depends greatly on the characteristics of the data to be classified. There is no single classifier that works best on all given problems. Therefore, in this study, five supervised machine learning methods were employed to construct classifiers for predicting LC. First, we compared their classification accuracy on the training set by 10-fold cross-validation. The ACCs were 93.8%, 97.5%, 90.1%, 86.4%, and 85.2% for LC-NB, LC-MLP, LC-SVM, LC-DT, and LC-CART, respectively. Because a subset of features that have high classification accuracy on the training set may not have good generalization properties , we thusis study .When we compared the results of the aforementioned studies with that of this study, we found that no protein/peptide peak can be identified with same molecular mass. Possible reasons for this contradiction may lie in the following aspects. First, prefractionation strategies and detection technology were used in different studies. Second, different statistical and computational methods may lead to the variability. Third, both the patients infected with HBV and healthy individuals were included in the control group in this study.As is known to all, analytical reproducibility is a significant challenge in MALDI protein profiling . DiffereIn conclusion, we describe two classifiers, LC-NB and LC-MLP, based on the serum peptide pattern for prediction of HBV-infected LC from MALDI-TOF MS in this study. The higher accuracy of the LC-NB and LC-MLP suggests that they have a great potential to emerge as noninvasive approaches in the screening of LC. Consideration has been made for further verification of their accuracy, sensitivity, and specificity in larger population from different regions and different age ranges."} +{"text": "Whereas IS2404 qPCR reconfirmed the presence of M. ulcerans DNA, viability testing of M. ulcerans by analysis of mycobacterial ribosomal 16S RNA through a newly established 16S rRNA RT qPCR (unpublished data) and culture were negative which are likely to be triggered by mycobacterial antigens and immune-stimulators released from killed mycobacteria M. ulcerans infection or mycobacteria surviving antimycobacterial treatment and may have been resolved by immune responses triggered by successful treatment of primary lesions.Ruf et al. recently reported two BUD patients from Benin who developed a series of secondary BUD lesions after completion of chemotherapy M. ulcerans lesion was laboratory confirmed by microscopic detection of acid fast bacilli and IS2404 real-time qPCR, whereas cultures remained negative. Furthermore, analysis of mycobacterial ribosomal 16S RNA did not provide evidence for the presence of viable bacilli.In accordance with the other cases published so far, in the present case a secondary As shown by Ruf et al. histopathological analysis of surgically excised late-onset secondary lesions revealed characteristical features of BUD as well as massive leukocyte infiltration of necrotic areas characteristic for successfully treated lesions. As there was no surgical intervention for the secondary lesion of the Togolese patient, clinical samples for histopathological analysis were not available.M. ulcerans during antibiotic chemotherapy ten months earlier which became clinically apparent due to a late inflammatory response to residual mycobacterial antigens , or to re-inoculation of M. ulcerans that was cleared by an elevated immune response primed by the successful initial treatment. However, available laboratory methods did not allow distinguishing between late paradoxical reaction and spontaneous host clearance during a second exposure.Pathogenesis of the secondary BUD lesion in the present case might either be attributable to a second unrecognized focus of killed While mycolactone plays a major role in the pathogenesis of primary BUD lesions, the question whether and to which extent the toxin is involved in the pathogenesis of secondary BUD lesions remains unresolved. Sarfo et al. recently demonstrated the detection of mycolactone in human tissue, suggesting its usefulness as a biomarker for monitoring the clinical response to treatment Beside previous anecdotal observations on spontaneous clearance of lesions in clinically suspected BUD cases, Gordon et al. recently reported the first case of spontaneous resolution of a laboratory confirmed BUD ulcer in a patient from Australia In the absence of evidence-based guidelines for reliable identification of late-onset secondary immune-mediated lesions and their clinical management, it may be advisable to consider the possibility of spontaneous healing under stringent clinical observation and regular wound care.Secondary BUD lesions may occur as paradoxical reaction during or shortly after treatment; late-onset secondary lesions may occur up to more than one year after completion of treatment.Characteristic diagnostic results for secondary BUD lesions are positive microscopy and PCR results without evidence for viable bacilli.The case of the Togolese patient shows that complete healing of secondary lesions without antibiotic or surgical treatment occurs. Therefore, conventional wound care can be considered as a treatment option if continuous clinical observation is possible."} +{"text": "Nowadays, data collection is a key process in the study of electrical power networks when searching for harmonics and a lack of balance among phases. In this context, the lack of data of any of the main electrical variables adversely affects any time series study performed. When this occurs, a data imputation process must be accomplished in order to substitute the data that is missing for estimated values. This paper presents a novel missing data imputation method based on multivariate adaptive regression splines (MARS) and compares it with the well-known technique called multivariate imputation by chained equations (MICE). The results obtained demonstrate how the proposed method outperforms the MICE algorithm. The presence of harmonics in an electrical system is associated with many problems in its performance. The main problems are overheating in conductors, especially in the neutral ones, due to the skin effect, and activating automatic breakers producing problems with supply continuity. Finally, the deterioration of the waveform of the voltage harmonic distortion associated would cause malfunctions of some devices.etc., must be studied.As the existence of harmonics cannot be avoided, monitoring in real-time is necessary in order to control them within certain limits. Additionally, sometimes they can be transferred by acting on the installation in order to avoid its effects by means of filters either active or passive. In these cases, the use of isolation transformers, super-immunized differential breakers, Another problem frequently encountered in an electrical installation is the imbalance between phases. Although it is well known that balance is achieved by working at the highest levels of the installed capacity in order to take full advantage of the installation, sometimes this is not possible. An imbalance is usually caused by a bad load distribution between phases and provokes a high current return displayed by the neutral, as it has to compensate for the gap being at the center of the scheme vectors. These problems will increase if these charges are also producing linear and harmonic distortion. In addition, imbalances may also cause the performance of the protection of the low voltage at the output of the transformer arise above its caliber in the overloaded phase currents.etc., that cause failures or disability of electrical or electronic devices [In this context, the quality of electricity is a problem represented in all of its parameters: voltage, current, frequency anomalies, devices . Nowaday devices . Science devices .There are several different contributions with the above-mentioned aim. For example, in a new poetc.In some buildings it would be of interest to monitor the main electrical parameters. This real-time monitoring and control is required in order to balance new loads and reduce the general consumption of the building by means of the assessment of the residual consumption (or consumption out of working hours). Such information is also useful to optimize the rates to be contracted. Additionally, this monitoring would be useful for studying supply problems due to lack of balance or harmonics, for analyzing the quality of the energy, and also for preventing incidents with the machinery due to poor signal quality. Finally, it would also be of interest to study the operation of the building and analyze its efficiency depending on parameters such us the number of people who use it, power installed, square meters in use, During the data collection process it is possible, due to different circumstances, for a small amount of the information retrieved to be lost. For these situations it is important to have missing data imputation. A process of missing data imputation consist of filling missing values in data series with estimated ones.The quality of the electric supply of buildings is not only limited to the continuity of the supply, as concepts such as reliability, safety, and maintenance are also important indicators. It is also necessary that the available information be complete. The lack of information in some records, generally translated as zeros, distort the results.etc., were implemented.There is also an important economic component of the data record, and that is the optimization of supply contracts, in other words, knowing the consumption of a building distributed over time. It is possible to associate the activities in the building so that we obtain a balanced installation, performing the most demanding activities at the most convenient hours of the day. To this end, it is necessary to collect information both before the decision and after the implementation of measures, in order to compare similar periods of expenditure. The latter would also serve in the event that energy-saving measures of another kind, such as replacing lighting by low consumption, placing detectors in corridors, placing inverters in circulation pumps, This paper evaluates a new imputation method, which allows the system to fill in the missing data of any of the sensor devices that are used in this research for the recording of voltages, currents and power factors. The proposed algorithm is based on multivariate adaptive regression splines and outperforms the results obtained by a benchmark method, as it is the multivariate imputation by chained equations (MICE) .Nowadays, the two major methods for missing data imputation are multiple imputation and maximum likelihood. The maximum likelihood chooses as parameter estimates those values which, if true, would maximize the probability that have in fact been observed. The multiple imputation is based on different methodologies but all follow these steps: some random variation is introduced into the data set and several imputed data sets are generated. After that, those data sets are used for problem analysis and finally the combination of the results into a single set of parameter estimates, standard errors and test statistics is made. Since the missing at random (MAR) assumption cannot be checked from the data at hand, it is important to take into account if missing data can be considered as MAR. In those cases that cannot be considered, they called not missing at random (NMAR). Several models of NMAR data have been developed and its detailed analysis is beyond the scope of the present research.The rest of the paper is organized as follows: In the present research, the devices employed are specific to the measurement of power quality variables, which are described in this section. They have some common measurement features in common, namely: Voltage Line/Neutral (V. L/N), Voltage Line/Line (V. L/L), Current by line (Current), Power Input/Output (+/\u2212 Watts), Energy Input/Output (+/\u2212 Wh), Reactive Power (+/\u2212 VARs), Reactive Power Input/Output (+/\u2212 VARh), Apparent Power (VA), Apparent Energy (VAh), Power Factor (PF), and Frequency (Frequency). The four devices used in the present study can perform all the mentioned measurements ; also, eOne of the options included for this equipment is the optical IrDA port, which allows the programing of the device from a laptop or personal digital assistant (PDA). Additionally, it incorporates V-Switch technology. This tool lets the users update and include the required functions using programing commands, even after the installation of the device installation. The offered VSwitches (VSw) offered are:\u2022 VSw 1\u2014Volts and Amperes Meter\u2014Default.\u2022 VSw 2\u2014Volts, Amperes, kW, kVA, kVAR, Frequency, PF.\u2022 VSw 3\u2014Volts, Amperes, kW, kVA, kVAR, Frequency, PF, kVAh, kVARh, kWh and Distributed Network Protocol (DNP) v.3.0.\u2022 VSw 4\u2014Volts, Amperes, kW, kVA, kVAR, Frequency, PF, kVAh, kVARh, kWh, %THD , Boundary Alerts and Distributed Network Protocol (DNP) v.3.0.A RS485 Port can be added as an option. With it, communication is feasible by using Modbus or DNP 3.0 Protocols. In addition to the RS485, the device also incorporates a KYZ pulse, which is used to send instantaneous information regarding energy consumption to other devices. It is possible to add an Ethernet option with the INP10 module, which is a 10/100BaseT Ethernet with the Modbus TCP protocol.The Shark 200 system is a small-size device used for power and energy measurements. It provides an invoicing measuring feature, in conjunction with an advanced data recording system, measurement of the electrical power quality, communication, and I/O capabilities. This equipment also includes V-Switch technology. The V-Switches in this case incorporate the features shown in the The Shark 200 device from feature V2 to V6, offers the possibility of data recording by using historic tendencies, limit alerts, input/output deviations, and events categorization. For the V5 and V6 models, the waveform can be recorded.It is possible to make an independent CBEMA (Computer and Business Equipment Manufacturers Association\u2019s) log plotter: The system records an independent CBEMA and it makes an autonomous CBEMA record for size, as well as potential event times.The S-200 model offers an on-line harmonic analysis from to the 40th up to the 255th order for current and voltage inputs.\u2022One port RS485 port allows communication using Distributed Network Protocol (DNP) v.3.0 or Modbus protocols.\u2022KYZ Pulse\u2014this device incorporates Pulse Outputs mapped to total energy.\u2022Furthermore, it has an optical IrDA port with the same functions as the previously-explained model.Regarding communication, this model includes the following features:In general terms, this device has advanced features that offer a global view of power and energy usage and, of course, visualization of the quality of electrical power within a power network. The device is able to capture a maximum of 512 samples per working cycle by event. Additionally, this device performs events analysis by 16 bits A/D converter, for electric voltage and electric current, which offers high-resolution. Furthermore, it is possible to activate a waveform datalogging by triggers that enable power quality surveys, fault detection, and the like, to be performed.In terms of harmonic measurements, the device is capable of measuring up to the 255th order, in the case of current and voltage. If necessary, it can measure the harmonics in real time up to the 128th order. The device provides the THD percentage and the K-Factor with the harmonics. Additionally, it is possible to monitor switching noise from several elements of an installation. Like the previous device, the Nexus 1252 is able to make an independent CBEMA, and it makes an autonomous CBEMA log for size and time of potential events, which gives the consequent advantages mentioned previously.In terms of communications, the device has four ports, and each one is able to communicate in several common protocols, with the aim of reading purposes and control simultaneously. Several peripherals are available for displaying or for external I/O options.The MP200 model measures and provides information of power usage from eight three-phase WYE circuits or from twenty-four single-phase systems. The MP200 system can create precise reports of power usage, analyze peak demand, and provide control signals to limit peak demand and billing based on usage and demand.The MP200 offers communication possibilities like the previous models. One typical USB port and two standard RS485 ports, with optional RJ45 wired, or 802.11 WiFi, are provided. These ports support standard protocols as Modbus ASCII, RTU, and TCP/IP. By V-Switch options, the MP200 can be configured for basic sensors with real-time data (V1) to Advanced Logger up to 2400 Days (V3).The data set employed for the present research corresponds to measurements of the voltage phase to neutrum, (three variables) phase-to-phase voltage (three variables), current in each phase (three variables) and the average power factor (one variable) of a three-phase electrical supply of a building. The records were taken each 15 min from 27 November 2014 at 18:45 to 31 May 2015 at 23:45.2. This building holds the Information Technology Services of the University including their server rooms and some scientific laboratories that include equipment such as nuclear magnetic resonance spectrometers, electron microscopes, X-ray diffractometers, and the like. For all these kind of facilities it is essential to guarantee a good quality standard of electrical supply 24 h a day, every day of the week. A total of 78 employees work in this building, which has an average daily energy consumption of 190,572 kWh.The building under study in the present research belongs to the University of Oviedo (Spain). This building is called Severo Ochoa after the Nobel Prize-winning scientist and has five floors and two basement levels that sum a total of 8150 mThe large number of heterogeneous receivers in the building, such as computers, uninterruptible power supply devices, ballasts of fluorescent lighting systems, variable speed drives, induction ovens, and capacitors all create harmonic distortions in the net. All of these non-linear loads cause the flow of harmonic currents in the distribution system.According to Fourier\u2019s theorem, a periodic continuous function formula :(1)f(x)Harmonic frequencies are multiples of the waveform\u2019s fundamental frequency. The harmonic distortion may be defined as the degree to which a waveform deviates from a pure sinusoidal wave. In the case of an ideal sine wave, its harmonic component is equal to zero. The total harmonic distortion (THD) is defined as the sum of all harmonic components of the voltage or current waveform compared to the fundamental component of the voltage or current wave. For the case of the current, the THD formula can be expressed as follows:The data set is made up of a total of 17,763 samples that correspond to the period of time referred in the description of the data. It is used to test two different algorithms: multiple imputation by chained equations (MICE) and the proposed algorithm AAA (Adaptive Assignation Algorithm). The dataset is submitted to a process of random data deletion. This process consisted of supposing that the probability of an observation being missing does not depend on observed or unobserved measurements. It is called missing-completely-at-random (MCAR). The process of random data deletion was repeated five times for three different levels of missing data: 10%, 15%, and 20% of the total. After each deletion process, both algorithms were applied to the resulting data subset and the performance of the two methods compared.a priori assumptions about the functional relationships between dependent and independent variables [The algorithm proposed in the present research is based on the computation of multivariate adaptive regression splines (MARS) models, for the prediction of the missing values. MARS is a multivariate nonparametric technique . Its maiEquation ,14:(5)yariables ,16,17. TMARS is a generalization of classification and regression trees and is aIn order to introduce the new algorithm, let us assume that we have a dataset formed by In other words, if the dataset is formed by variables Model 1: a model that uses as output variable Model 2: a model that uses as output variable Model 3: a model that uses as output variable Model 4: a model that uses as output variable Model 5: a model that uses as output variable Model 6: a model that uses as output variable Model 7: a model that uses as output variable Model 8: a model that uses as output variable Q, of not having at least two non-missing values in a certain row can be expressed by the following formula:N is the number of variables; P is the rate of missing data in a MCAR case.After the calculation of all the available models, the missing data of each row will be calculated using those models that employ all the available non-missing variables of the row. In those cases in which no model was calculated, the missing data will be replaced by the median of the column. Please note in that the case of large data sets with a not-too-high percentage of missing data, these will be an infrequent case. In the case of missing completely at random data, the probability, represented by letter In the case of our example, none of the rows was in this situation for the 10 and 15% of missing data, while in the case of 20% of missing data it happened only in one line . These results are in line with those expected by the formula.As a general rule for the algorithm, it has been decided that when certain value can be estimated using more than one MARS model, it must be estimated using the MARS model with the largest number of input variables; the value would be estimated by any of those models chosen at random. Finally, in those exceptional cases in which no model is available for estimation, the median value of the variable will be used for the imputation.The algorithm called multiple imputation by chained equations (MICE) algorithm was developed by van Buuren and Groothuis-Oudshoorn . This reThe chain must be able to reach all parts of the state space. This means that it is irreducible.The chain should not oscillate between different states. In other words, the Markov Chain must be aperiodic.Finally, the chain must be recurrent. This means, as in any other Markov Chain, that the probability of the chain of starting from According to the experience of the algorithm creator , and alsThe MICE algorithm for the journal . For a m journal .Algorithm 1. MICE algorithm for imputation of multivariate missing data [ing data .Specify an imputation model For each Repeat for Repeat for Define Draw Draw imputations End repeat End repeat The performance of the proposed algorithm in comparison with MICE has been evaluated using the mean absolute error (MAE) and the root mean square error (RMSE). MAE measures the average magnitude of the error in a set of forecasts without considering their direction. It is a linear score, which weights all the individual differences equally, while RMSE is a quadratic scoring rule, which measures the average magnitude of the error. In the case of the RMSE, as errors are squared before they are averaged, it gives a relatively higher weight to large errors. When results are analyzed using both variables, it should be noted that the greater the difference between them, the greater the variance in the individual errors in the sample, taking into account that the lower their values, the better the model.The formulae for both kind of errors are as follows:The present article uses both RMSE and MAE. The underlying assumption when presenting RMSE is that In this section the results of the MICE algorithm and the proposed one AAA package are presented and their performances compared. As was already stated in the section describing the data, due to the random component of both algorithms, a process of MCAR data deletion of 10%, 15%, and 20% of the information was performed five times. The performance of both algorithms was compared by means of RMSE and MAE metrics. In order to verify that the results obtained with the proposed AAA package for the five different iterations were better than those achieved by other methods, the results of the five iterations are presented. Those tables also contain the average values of the five replications the iterations with the same number use the same database. Something similar to the RMSE occurs with the values obtained for the MAE metric. In this case, also, the values obtained with the new AAA package are significantly lower than those obtained for the MICE algorithm in the three cases: 10% , 15% Ta, and 20%For each of the ten variables involved in the present study, two-way ANOVA tests were performed in order to examine the influence of the kind of algorithm employed for the imputation , the level of missing data and the interaction of both factors. These studies were carried out for the RMSE and MAE metrics. The influence of the model employed was found in all the variables for both metrics. Neither the percentage of missing data nor its interaction with the model employed for imputation were found to be significant in any of the variables. For the RMSE parameter the p-value was of In the case of the metric MAE, the p-value was of Finally, all the calculi of both the MICE and the AAA algorithm was performed with a computer equipped with an Intel Xeon E5-1650 processor and 16 GB RAM. The average time of the MICE algorithm runs was of 123.54 s. The AAA algorithm average completion time was of 74.36 s with a standard deviation of 8.32 s. In both case the dataset was formed by 17,763 samples each on them with 10 variables.The existence of harmonics in electrical installations is an unavoidable issue nowadays. The use of real-time data collection devices is indispensable. During the process collection, it is possible for some data to be missing and, in this context, the use of missing data imputation techniques is essential.The algorithm proposed in this research greatly improves the results obtained by means of one of the most renowned and common techniques used today. From the point of view of the authors, this new algorithm is of great interest for applications like the one proposed in the present paper. In spite of the good performance of the proposed algorithm, it must be also be taken into account that the proposed algorithm, like many others, would have imputation problems in those cases in which most of the missing data belonged to the same column or to a reduced subset of columns. In future research the use of support vector machines (SVM) ,25 and hThe estimation of missing data is required in many different applications, such as time series analysis. The use of missing data imputation techniques allows the creation of prediction models using incomplete datasets."} +{"text": "However, lack of confidence in geologic CO2 storage security remains a barrier to CCS implementation. Here we present a numerical program that calculates CO2 storage security and leakage to the atmosphere over 10,000 years. This combines quantitative estimates of geological subsurface CO2 retention, and of surface CO2 leakage. We calculate that realistically well-regulated storage in regions with moderate well densities has a 50% probability that leakage remains below 0.0008% per year, with over 98% of the injected CO2 retained in the subsurface over 10,000 years. An unrealistic scenario, where CO2 storage is inadequately regulated, estimates that more than 78% will be retained over 10,000 years. Our modelling results suggest that geological storage of CO2 can be a secure climate change mitigation option, but we note that long-term behaviour of CO2 in the subsurface remains a key uncertainty.Carbon capture and storage (CCS) can help nations meet their Paris CO 2 emissions but the confidence in geologic CO2 storage security is uncertain. Here the authors present a numerical programme to estimate leakage from wells and find that under appropriate regulation 98% of injected CO2 will be retained over 10,000 years.Carbon capture and storage can help reduce CO Despite worldwide interest and the successful implementation of several tens of CO2 storage research, pilot and commercial projects5, some scientists, publics and stakeholders remain concerned that leakage of CO2 poses a threat to the viability of long duration CO2 storage as an effective climate mitigation tool12. Leak rates of 0.01% per year, equivalent to 99% retention of the stored CO2 after 100 years, are referred to by many stakeholders as adequate to ensure the effectiveness of CO2 storage14. We assert that secure storage must allow global average temperature rise, driven by excess CO2, to remain well below 2\u2009\u00b0C, and for geological timescales, typically modelled to be at least 10,000 years15.Limiting global average temperature rise to well below 2\u2009\u00b0C above pre-industrial levels, in order to comply with the Paris 2015 Agreement, requires that fossil carbon use is curtailed, and/or large tonnages of CO2 storage security and the likelihood of this target being achieved, beyond the individual site scale, and across a global CO2 storage industry. Many studies that assess the global industry-wide risk of subsurface gas leakage do not specifically assess subsurface CO2 retention mechanisms17, despite experimental measurements showing that residual trapping may effectively immobilise a significant proportion of the CO2 almost immediately on injection into the subsurface18. The published studies that incorporate subsurface CO2 retention into their risk assessments are for site-specific, real or hypothetical, hydrogeological models20, rather than industry-wide, regional, or global scenarios. A recent tool developed by the National Risk Assessment Partnership (NRAP) applies a system-modelling approach and Monte Carlo analysis to detailed subsurface storage reservoir models21. This tool can provide long-term storage security predictions and uncertainties for individual sites, but to date, no comprehensive case studies have been published that facilitate an industry-wide assessment of CO2 storage security.However, there is a lack of quantitative predictions on long-term CO2 storage will be secure enough, and secure for long enough, to effectively mitigate climate change. This program uses two routines: one using established and measured geological processes to assess retention in the geological reservoir; the second calculating surface leakage flux rates, which vary through time. The input parameters for these routines are derived from a data compilation, based on extensive literature review of empirically measured data and simulated data, encompassing CO2 immobilisation, and surface leakage of CO2 or appropriate analogues. A summary of this review is provided in Supplementary Notes\u00a0In order to address this gap in knowledge and prediction assessment, we present a new numerical program\u2013the Storage Security Calculator (SSC). The SSC has been designed to determine if global adoption of geological CO2 storage is already undertaken in both onshore and offshore environments, with each exhibiting differing implementation and operational challenges. We thus apply the SSC to three different scenarios, that differ in their input parameters. For regional implementation of CO2 storage in a realistically well-regulated industry, with a moderate density of legacy wells, our program calculates a 50% probability that more than 98% of the injected CO2 will remain trapped in the subsurface over 10,000 years. Applying the SSC to a worst-case, unrealistic scenario of CO2 storage being inadequately regulated and implemented in a region with a high risk of leakage along abandoned wells, calculates that at least 78% of the CO2 will be trapped in the subsurface over 10,000 years. These results assume that our data compilation and subsequent input parameters are representative of the scenarios we modelled, and the SSC has thus been designed to accept new, improved, or case-specific input parameters, as appropriate. Key uncertainties remaining in the program include a lack of empirical data, and thus understanding, of CO2 behaviour in the subsurface over the thousands of years timescale, long-term behaviour of abandoned wells as fluid migration pathways, and long-term evolution of leakage rates.Practical CO2 injected into the subsurface for geological storage and the total CO2 leakage to the atmosphere. Once injected, the CO2 will be subject both to immobilisation processes CO2 remaining in the reservoir. The integrated program runs until 10,000 years, with leakage ceasing once no mobile (leakable) CO2 remains in the reservoir (see Methods).The SSC is designed to quantify the immobilisation of COocesses , and a CO2 leakage model (2). The CO2 immobilisation model wells . Leakage can also occur instantaneously, but it cannot remove CO2 from the reservoir that has already been residually trapped. The chemical trapping model includes both solubility and mineral trapping and is based on a published trapping model25 that incorporates both solubility and mineralisation in a time scale appropriate for CO2 storage. Figure\u00a0Residual trapping occurs on geologically instantaneous timescales, and can be measured in laboratory and field tests over experimental timescalesThe SSC uses three different calculation techniques. The Base Case Scenario applies a single value for each input parameter determined as the most likely conservative value by the authors, based on currently available data (see Methods). A Monte Carlo analysis applies ranges of values for most parameters and facilitates an assessment of the overall uncertainty of the model results. Finally, a sensitivity analysis is carried out where only one parameter is varied across multiple simulations, allowing an assessment of the influence and uncertainties of each parameter to the model. Further details on the program and parameters are provided in the Methods section and the R-code is available in Supplementary Data\u00a02 in the reservoir: structural and stratigraphic, residual, solubility, and mineral trapping1. The process of structural and stratigraphic trapping prevents injected CO2 migrating to the surface due to impermeable layers of rock being present above the CO2 reservoir. CO2 remains in the permeable reservoir as a free-phase and could be contained indefinitely in this state in a secure trap26. However, this mechanism does not immobilise the CO2 in the subsurface permanently, and a failure in storage integrity, via caprock or well failure, could allow the CO2 to migrate out of the reservoir. Structural and stratigraphic trapping are implicitly invoked in the SSC, so that all mobile CO2 remaining in the reservoir is assumed to be structurally/stratigraphically trapped.There are four trapping mechanisms that retain injected CO2 would require injection of a fluid to re-mobilise the CO2 in much the same way that tertiary oil production ) is conducted. Solubility trapping may only be reversed by significant reservoir depressurisation, and even then, a subset of this would be irreversible in the form of ionic trapping, where aqueous CO2 has dissociated and is now in bicarbonate or carbonate ion form27. Reversing mineral trapping, where CO2 precipitates as carbonate minerals, would require dissolution of these minerals and hence is the most secure form of trapping27.The three other trapping mechanisms\u2013residual, solubility and mineral trapping\u2013are more secure and would require deliberate engineering to reverse. For example, displacing residually trapped CO18, who calculated the proportion of residually trapped CO2 from experimental residual CO2 saturation values. These data indicate that residual trapping immobilises between 12.8% and 91.6% of the injected CO2. Residual trapping values are also now available for a number of reservoir-scale experiments. The Otway 2B experiment used a range of techniques to calculate residual CO2 pore space saturations of between ~7% and 42% over two separate experiments in 2011 and 201429. These values are comparable to the residual CO2 saturation of 33%, determined by core flooding experiments on a sample of Paaratte Formation sandstone24 , and indicate that laboratory-scale residual trapping experiments are representative of reservoir-scale conditions.The SSC incorporates separate sub-models for residual trapping (1a), and for chemical trapping . The residual trapping sub-model (1a) draws on 44 residual trapping values compiled by Burnside and Naylor2 dissolution occurs on timescales of hundreds of years. Whilst this is essentially instantaneous on geological timescales, it is a slower process than residual trapping and leakage. Mineral trapping is a much slower process that occurs over the 1000-year timescale. Hence, chemical trapping (1b) is computed in the SSC following residual trapping (1a) and leakage (2) calculations. Chemical trapping consumes both mobile and residually trapped CO2, so the amount of residually trapped CO2 decreases over time. The chemical trapping sub-model (1b) is based on the reactive transport equilibrium simulation carried out by Xu et al.25, which simulates the transfer of injected CO2 between free-phase (gas), dissolved (aqueous) and mineralised (solid) phases, over 10,000 years. To the best of our knowledge, this26 is the only model in the literature that quantifies both dissolution and mineral trapping rates over geological storage timescales specifically for CO2 storage (see Methods and Supplementary Note\u00a0Solubility trapping via CO2 injection\u20132a); abandoned wells ; and natural examples of gases leaking from geological features . For a given storage reservoir, the degree of leakage along a fluid migration pathway will depend on a number of factors, including: the areal density and depth of the migration pathways, proximity of the migration pathway to the injection well, plume geometry, reservoir pressure, free-phase CO2 column height, the relative permeability of all geological formations and migration pathways, capillary entry pressure, fluid pore pressure, hydrodynamic flow regime, and temperature35. Precise modelling of potential leakage along migration pathways at a given storage site requires detailed constraints on all of these parameters, injection volume and pressure, and appropriate model-grid spacing and equations of state32. Generalising these factors to estimate global or regional storage security is unrealistic, and so we base our estimates on a combination of directly measured surface fluxes of subsurface fluids leaking from depth (via wells and fault systems) and published numerical leakage models. This approach allows resolution of a globally averaged surface flux that is independent from the multiple complex factors of specific subsurface conditions project, USA). This is supplemented with experience from a number of large tests such as Lacq (France)36 and Ketzin (Germany)37 and multiple CO2 EOR projects which have operated since the early 1970s38. No leakage has yet been detected from dedicated CO2 storage projects so direct leakage data does not exist. We therefore base our active (2a) and abandoned (2b) well leakage estimates on data from the wider hydrocarbon industry, including underground gas storage (UGS) and EOR. Geological storage of CO2 employs expertise, techniques and technology from the hydrocarbon industry, making this industry a suitable analogue of the CO2 geological storage technology40. Input parameters for active and abandoned well leakage include the frequency of leakage events, (continuous leakage and discrete events/blowouts), and mass lost per leaking well during a leakage event. For each scenario, assumptions are made about the quality of the engineered well barriers we utilise measured areal fluxes of CO2 and natural gas from areas containing natural gas seeps at regional to global scale, to provide a mass per km2 per year for natural leakage .In any highly explored subsurface area with numerous wells, it can be difficult to identify all abandoned wells and to determine their integrity and associated leakage risk2, combined with CO2 immobilisation and pressure dissipation within the subsurface. To incorporate leakage decay into our model, we created two exponential decay curves that foves (Eq. ) are a fves , comparable to the 2050 storage target of the European Union47. Injection commences in 2020, finishes in 2050, and the SSC is run for 10,000 years into the future. CCS will very likely be required to continue well beyond the year 205048, but for simplicity we focus on modelling CO2 storage security during the initial decades of CCS implementation. The three scenarios vary in their model parameter inputs: Onshore and Offshore Scenarios differ in the frequency of leaking injection wells, abandoned well areal density, and abandoned well integrity; the Onshore Well-Regulated and Poorly-Regulated scenarios differ in the proportion of unidentified abandoned wells, and the integrity status of abandoned wells.The Offshore Scenario can be considered to be analogous to CO2 storage environment. The assigned abandoned well density (0.44\u2009wells km\u22122) is based on recent well densities of the North Sea 1. Abandoned well integrity and frequency of leaking wells are based on data from offshore hydrocarbon fields. The Onshore Well-Regulated Scenario uses Texas as a CO2 storage environment exemplar, with an abandoned well density of 2.5\u2009wells km\u22122, based on estimates of the number of hydrocarbon wells in Texas41, and well integrity and leakage risk based on data from onshore hydrocarbon fields. The Poorly-Regulated Onshore Scenario investigates CO2 storage security if implemented in a region with inadequate regulations (either past or current) regarding drilling and abandonment of wells. For this scenario, we use Pennsylvania (USA) as an exemplar due to the high number of undocumented legacy wells (to give a well under-estimation factor) and the proportion of abandoned wells that are unplugged are less than 1.89% leakage.Amounts of CO2), but leakage continues over the subsequent 9000 years resulting in higher total cumulative leakage (P50 at 1000 years is 8.18%). This results in 95% of leakage simulations leaking less than 25.71% over 10,000 years. This is despite a lower modelled frequency of leakage from injection wells, and a lower proportion of degraded abandoned wells in the Onshore Well-Regulated Scenario compared to the Offshore Well-Regulated Scenario. However, the Onshore scenarios have a much higher areal density of abandoned wells (2.5\u2009wells km\u22122 as opposed to 0.44\u2009wells km\u22122 for the Offshore Scenario); while leakage rates from individual abandoned wells remain low for the Well-Regulated Scenario, the cumulative leakage for such a high well density becomes significant.The Onshore Well-Regulated Scenario shows that total cumulative leakage remains low at the 1000 years scale outcome that 89% of injected CO2 is permanently stored . Of these, only nine influenced the results to cause a deviation of greater than 5% (relative) from the base case value in at least one of the scenarios. These nine parameters are the focus of our sensitivity analysis discussion and are presented in Fig.\u00a02 and preventing it from leaving the reservoir. A lower level of residual trapping only causes a higher leakage result for scenarios where the simulation runs out of mobile CO2. This does not occur for any of the base case scenarios, and so the maximum leakage results that derive from minimising residual trapping are the same as the base cases.Residual trapping is a significant influence on total leakage results for scenarios that involve a high level of leakage. In the SSC, residual trapping only directly limits leakage by immobilising CO49, then CO2 migration would be more pronounced, leading to higher levels of residual and solubility trapping51. This would result in the amount of CO2 available for leakage being lower and over time increased immobilisation due to plume spreading will outweigh the increased leakage risk posed by a larger plume area. These interactions between plume geometry, migration, and immobilisation are too complex to incorporate into our generalised model, but are likely to result in lower leakage than our model results.A parameter that exerts a strong influence on all scenarios is the plume areal extent Fig.\u00a0. This is2 leakage are the minimum long-term leakage rate (parameter A in the leakage reduction function), the long-term well-blowout frequency and mass lost per blowout, abandoned well density (frequency of wells per until of area), the abandoned well under-estimation factor, the proportion of degraded wells, and the natural leakage rate. Of these, the natural leakage rate is one of the least influential parameters, with leakage associated with abandoned wells having a stronger influence. Well density is solely responsible for the leakage increase between the Offshore and Onshore Well-Regulated Scenarios. For the Offshore Well-Regulated Scenario, which has a low abandoned well density, changing the well density produced the largest difference in leakage results, confirming that the SSC is highly sensitive to this parameter, likely due to the small amount of long-term leakage we assume for each well . Varying the proportion of degraded wells, and thus the amount of continuous leakage imparts a minor influence on the SSC results and has the greatest impact in the Poorly-Regulated Scenario where degraded abandoned wells may not be identified and remediated. Variation of the low-level leak-rate experienced by intact wells was not modelled due to a lack of available data, but reducing this is expected to significantly enhance storage security. Leakage during a blowout exerts a moderate influence on the results, and is based on conservative estimates of leakage that do not account for improvements in well remediation techniques and technologies that are likely to occur with time and experience2 is reduced by either immobilisation or leakage. This function was introduced to counter the lack of coupling between our surface flux leakage model and subsurface immobilisation model, and is based on observed and simulated leak rate decays over time. A parameter that defines this function is the minimum long-term leakage rate - the percentage of the initial yearly leakage rate that leakage will reduce to over time. This parameter exerts a strong influence on the results due to high uncertainty and thus a large range in values. Applying an optimistic leakage reduction function to the SSC significantly reduces leakage, with the worst-case poorly-regulated scenario leaking just 7.8% of the injected CO2 were especially selected to be conservative as large uncertainties remain in our knowledge of cement behaviour on the thousands-of-years timescale. In our simulations, natural leakage is also likely over-estimated. Our natural leakage input parameters are based on measured surface fluxes and represent mature leakage systems presumed to have reached a steady state. They do not account for the possibility of a time-lag between initiation of leakage from the reservoir, and the leaked material reaching the surface, as would be expected if the leakage pathway was connected to the overlying reservoirs2 storage in regions with moderate abandoned well densities and that are regulated using current best practice will retain 98% of the injected CO2 over 10,000 years in more than half of cases, and result in maximum leakage of 6.3% of the injected CO2 in fewer than 5% of cases. As expected, we find that unregulated storage is less secure. Here, however, over 10,000 years, only 22% of injected CO2 will leak in half of cases, with the possibility that up to 33% of the injected CO2 could leak in 5% of cases. This leakage is primarily through undetected and poorly abandoned legacy wells, and could be reduced through identification and remediation of leakage if a comprehensive site screening and monitoring program is deployed. Importantly, natural subsurface trapping mechanisms mean that this leakage will not continue indefinitely. Consequently, even with mitigation actions restricted solely to repair of abandoned wells that blow out, regions with a legacy of poorly regulated subsurface operations can reliably and robustly store and retain 78% of injected CO2. We find that regulators can most effectively improve CO2 storage security by identifying and monitoring abandoned wells, and perform reactive remediation should they leak.Even when applying these conservative input parameters, results from the SSC illustrate that CO2 is a secure, resilient and feasible option for climate mitigation even when applying pessimistic values for input parameters and in poorly regulated storage scenarios. Hence, deployment of carbon capture and storage can be recommended to all governments as part of their actions to comply with the Paris 2015 target of keeping the global mean temperature\u00a0rise well below 2\u2009\u00b0C.Overall our findings indicate that geological storage of CO2 in a subsurface reservoir were identified and a literature review carried out for each factor to determine the type of appropriate quantitative data available. The \u2018Storage Security Calculator\u2019 (SSC) structure was designed to make best use of the available data and resulted in the development of two separate models\u2013a subsurface immobilisation and retention model, and a surface leakage model . The increase in injected CO2 over the injection period is modelled as a linear increase.The model assumes a timeline with a 30-year injection period, during which the amount of CO2 injected into the reservoir. The residual trapping and chemical trapping are calculated using separate models, but these models interact as residually trapped CO2 is consumed by chemical trapping . Computationally, this is achieved by calculating the amount of chemically trapped CO2, subtracting this from the total injected CO2 and calculating the amount of residually trapped CO2 from the remaining free-phase CO2.The immobilisation model for a given year, to calculate the amount of CO2 chemically trapped in that year. The amount of residually trapped CO2 is derived by subtracting the amount of chemically trapped CO2 for a given year from the total injected CO2, and multiplying this by the fraction of CO2 residually trapped by the well injectivity . The areal extent of the CO2 plume is calculated by multiplying the injection target by the Plume Area parameter, which is an empirically derived ratio of area: mass . The second type of leakage is discrete events (blowouts) which are considered in terms of minor and major blowouts. Leakage from minor and major blowouts is calculated by multiplying the blowout frequency (events per well per year) by the mass leaked per blowout (t CO2 per event). The amount of CO2 leaked via continuous leakage, minor blowouts, and major blowouts are summed to give a maximum annual leakage from active wells. This leakage rate is only applied to the first 30 years\u2013the injection period\u2013of the model. More details are available in Supplementary Note\u00a0Two types of leakage are defined for active (injection) wells [2a]. The first is continuous leakage, which is calculated by multiplying the frequency of leaking wells (% of wells that leak) by the amount of COSimilar to active wells, leakage from abandoned wells [2b] is defined in terms of continuous leakage and blowouts. However, there are many more variables associated with abandoned wells, and thus calculating this leakage rate is more complex. A step-by step description of how abandoned well leakage is calculated is presented in Supplementary Note\u00a0\u22122), and leakage rates are initially calculated as leakage per km2 and finally multiplied by the plume area to calculate absolute leakage.The number of abandoned wells are introduced into the model as areal densities ; from this the areal density of known and unknown wells are calculated. The areal densities of unplugged, plugged but degraded, and plugged and intact wells are then calculated by multiplying the well densities by the proportion (frequency) of each well status. We then assume that all known abandoned wells will be investigated and that known unplugged wells will be remediated and converted to plugged and intact wells prior to injection.\u22122 per year) AB1, applied for the injection period.During the injection period, continuous leakage is calculated by multiplying the areal well density for each well status by its associated leakage rate. Leakage via abandoned well blowouts is calculated by multiplying the short-term blowout frequency by the number of plugged wells, and the mass lost per blowout. Additionally, all unplugged wells (only present in Poorly-Regulated Scenarios where the well under-estimation factor >1) are assumed to blowout. Summing the masses lost per year gives the abandoned well leakage rate AB2, which is applied to the post-injection period.Post injection, the continuous leak rate is again calculated by multiplying the areal well density for each well status by its corresponding leak rate. Leakage due to blowouts is calculated by multiplying the long-term blowout frequency (events per well per year) by the total well density and the mass leaked per blowout. Summing these masses lost per year gives an abandoned well leakage rate . The natural leakage rate parameter adopts gas flux data from regional and global scales. The minimum and maximum values are based on\u00a0the estimate of global fluxes of geological CO2 (0.44\u2009t km\u22122 per year), and the average areal flux from total petroleum systems (10\u2009t km\u22122 per year), respectively. The most likely natural leakage rate assumed, 2\u2009t km\u22122 per year, is based on the areal fluxes observed at the Ojai Valley natural seeps and data from the Rangely EOR field. More details are available in Supplementary Notes\u00a0The yearly amount of CO2, to influence the amount of CO2 that can be leaked.The Leakage model sums the leakage from natural pathways, active wells, and abandoned wells to give two leakage rates applied to the injection period and the post-injection period. These leakage rates are not calculated in a way that is coupled to the subsurface, but we expect changes in subsurface conditions, such as pressure and the amount of mobile CO2 over the injection period, we invoke a linear increase in leakage rate from 0 to 100%, mirroring the simplified total injection rate. For leakage reduction once injection has ceased, we invoke a leakage decay curve that is based on empirical data (see Supplementary Note\u00a0A and B are the iteratively derived input parameters for the leakage reduction function.To address the increase in injected CO2 per year) for that year.For a given year, the % of the maximum leak rate is calculated and multiplied by the post-injection total leak rate, to give the leak rate and 1.1 for the well-regulated scenarios.For parameters that are defined by normal or lognormal distributions in the Methods Section, we defined the minimum and maximum values as \u00b12 standard deviations . For other parameters we defined minimum and maximum values based on the range of data. Abandoned well areal density is defined as a single value for each Scenario, but we assessed the sensitivity of the models to this factor by varying between 0 and 5\u2009wells kmThe R code is presented in a single file (SSC.R) which contains multiple sections and functions.\u22122 per year), based on the input parameters. The Monte Carlo analysis is carried out using the function SSCMC, which calls SSCBase and carries out n realisations using randomly selected numbers from within the defined parameter ranges.The base-case calculation is contained in the function SSCBase. This calls on a function called AbSetUp which calculates the AB1 and AB2 leakage rates values.Section 1 includes functions that are not part of the base case or Monte Carlo calculations but are required to be loaded into the R environment to be called by SSCBase or SSCMC. Included here are the function AbSetUp (described above) and rtriangle2; 3\u2009=\u2009CO2 leaked that year; 4\u2009=\u2009Cumulatively leaked CO2; 5\u2009=\u2009Leakage reduction parameter A; 6\u2009=\u2009Leakage reduction parameter B; 7\u2009=\u2009Mineral-trapped CO2; 8\u2009=\u2009solubility trapped CO2; 9\u2009=\u2009residually trapped CO2; 10\u2009=\u2009remaining mobile CO2).Section 2 contains the code for the function SSCBase. It creates a 2-dimensional matrix output, which consists of 10,000 rows (1 per year of the model) and 10 columns (1\u2009=\u2009time (year); 2\u2009=\u2009Injected COSection 3 contains the code for function SSCMC, which creates a list output, based on 10,000 iterations of SSCBase. To make the large amount of data generated more manageable, this function runs SSCBase using randomly selected numbers from the defined ranges, and then extracts the results for years 1, 3, 10, 30, 100, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 and 10,000, storing the results for each year in a separate matrix. This process is repeated 10,000 times to create a list of 16 matrices, each containing 10,000 rows. The data is then interrogated using the FigLoss function described below.2 partitioning over time calls the results from SSCBase and plots parameters of interest against time. The function FigLoss converts the SSCMC cumulative CO2 leakage output to leakage as a percentage of the injection target and calculates the P5, P50 and P95 leakage percentiles for each year.Section 4 contains functions for interrogating the SSCBase and SSCMC outputs. The Basic function returns the total cumulative leakage, as a percentage of the total injected, at the end of the model run . MinMaxSA is code that allows minimum and maximum values to be substituted for the base case in SSCBase. The desired values are entered for the appropriate Min_/Max_ pair. For parameters where the minimum and maximum values are to be defined by standard deviations, the values can be entered as a mean plus or minus the standard deviation. Multiplying the standard deviation by SDN (standard deviation number) allows the minimum and maximum values to be quickly changed to check a different number of standard deviations. Code to plot the COThe R code for the Storage Security Calculator is available as a supplementary code file (Supplementary Data\u00a0All data used to determine input parameters are summarised in Supplementary Notes\u00a0Supplementary InformationDescription of Additional Supplementary FilesSupplementary Data 1"} +{"text": "AbstractChlamydothecaunispinosa , were discovered on the Caribbean island of Montserrat. These are the first records of the species on Montserrat and extend its known distribution approximately 113 km northwest and 63 km southeast of the closest known populations on \u00celes des Saintes (Guadeloupe) and Nevis, respectively. We provide the first DNA barcode for C.unispinosa, a 686 bp fragment of the COI gene which may be used for future comparative studies of this widely distributed species.Four populations of the large freshwater ostracod, Chlamydotheca Saussure, 1858 contains primarily tropical large freshwater ostracods. There are 36 species . Chlamydothecabarbadensis was described from Barbados, recorded from northern South America and several islands off the South American coast Schott, along the Blackwood Allen trail, Baker Hill, Montserrat . Living specimens . On January 17, 2017, empty valves were collected from a muddy temporary puddle along the Jack Boy Hill trail Trant\u2019s Estate, Montserrat. Living specimens were collected from Dowdye Pond dominated by water lettuce, Pistiastratiotes L., along the road north of Gerald\u2019s, St. Peter, Montserrat on January 16, 2018 . The ostracods collected were identified as C.unispinosa in 95 % ethanol ANSP GI-19490). Empty valves were collected from a dry temporary pool dominated by the aroid, 9490. Empispinosa by compal margin .QIAGEN) and a 710bp region of the mitochondrial COI gene was amplified using HCO2198 and LCO1490 (QIAGEN) and sequenced using the same primers as the PCR . PageBreakComplimentary forward and reverse sequences were aligned and edited in BioEdit as an outgroup (MEGA). Pairwise distances were calculated between the nucleotide sequences of the Montserrat ostracod and the four most similar published sequences, as well as one with the outgroup sequence of C.cuminata (MEGA).Genomic DNA was extracted from one entire animal using a DNeasy Blood & Tissue Kit . No COI, DNA, or amino acid sequence in GenBank was highly similar to the sequence obtained from the Montserrat ostracod. The most similar nucleotide and amino acid sequences included representatives from the genera Bennelongia De Decker & McKenzie, 1931; Strandesia Stuhlmann, 1888; Eucypris Vavra, 1891, and Paracypria Sars, 1910 to 0.22 . The translated amino acid COI sequence of the Montserrat ostracod differed from its closest match, S.velhoi, by a p-distance of 0.02, and from B.timmsi by a p-distance of 0.04.The COI sequence generated for this Montserrat ostracod was deposited in GenBank could be used to identify and compare similar sequences from other populations of C.unispinosa, particularly those reported from temperate regions.It is also possible that es exist or wheth"} +{"text": "Streptomyces species, which become the significant resource for antibiotics production. Among them, Streptomyces lydicus has been known as its ability of streptolydigin biosynthesis. Herein, we present the genome analysis of S. lydicus based on the complete genome sequencing. The circular chromosome of S. lydicus 103 comprises 8,201,357 base pairs with average GC content 72.22%. With the aid of KEGG analysis, we found that S. lydicus 103 can transfer propanoate to succinate, glutamine or glutamate to 2-oxoglutarate, CO2 and L-glutamate to ammonia, which are conducive to the the supply of amino acids. S. lydicus 103 encodes acyl-CoA thioesterase II that takes part in biosynthesis of unsaturated fatty acids, and harbors the complete biosynthesis pathways of lysine, valine, leucine, phenylalanine, tyrosine and isoleucine. Furthermore, a total of 27 putative gene clusters have been predicted to be involved in secondary metabolism, including biosynthesis of streptolydigin, erythromycin, mannopeptimycin, ectoine and desferrioxamine B. Comparative genome analysis of S. lydicus 103 will help us deeply understand its metabolic pathways, which is essential for enhancing the antibiotic production through metabolic engineering.More and more new natural products have been found in Streptomyces species are high-GC Gram-positive bacteria found predominantly in soilStreptomyces species could produce many specialized metabolites used for agricultural antibioticsStreptomyces are widely used in transgenic plantsStreptomyces lydicus can produce antibiotics or siderophore for suppressing fungal growthStreptomyces species have been announced. S. lydicus could produce streptolydigin which acts on catalytic function of RNA polymerase and inhibits RNA synthesisS. lydicus to pitching ratios during streptolydigin production11S. lydicus, i.e., S. lydicus A02 (accession number CP007699.1), was available in GenBank. Therefore, we have carried out the complete genome sequencing of S. lydicus 103 and constructed its metabolic pathways of antibiotic biosynthesis, including primary metabolism and secondary metabolism. Previous work has shown that heterologously expression of chit42 gene from Trichoderma harzianum P1 in S. lydicus A01 could enhance the chitinase activity and natamycin productionWith the development of genome sequencing technology, more and more complete genomes of S. lydicus 103 has a chromosome of 8.20\u2009Mb with 72.22% GC content, which contains 6,872 annotated protein-coding genes in S. lydicus 103 based on GC-Profile than strain 103 . Besides, the genome size of S. lydicus 103 is smaller than two other neighbor species, Streptomyces bingchenggensis BCW-1 and Streptomyces albus J1074 , amino acid transport and metabolism (E), carbohydrate transport and metabolism (G) and the signal transduction mechanisms (T) are more than the other function related genes system has been identified in families . BesidesPrimary metabolism significantly influences secondary metabolism and serves as building precursors for antibiotic biosynthesis, including acetyl-CoA, glucose-6-phosphate, glyceraldehyde-3-phosphate, and oxaloacetateS. lydicus 103 has the complete glycolysis, citrate cycle and pentose phosphate pathway. Acyl-CoA is the important precursor of acetyl-CoA, malonyl-CoA, methylmalonyl-CoA, and ethylmalonyl-CoA fatty-acid biosynthesis systemS. lydicus 103 lacks the O-palmitoyltransferase, which is responsible for the hexadecanoyl-CoA degradation. Besides, S. lydicus 103 contains the tesB gene that encodes acyl-CoA thioesterase II [EC:3.1.2.-], taking part in biosynthesis of unsaturated fatty acids, e.g. palmitic acid, stearic acid and oleic acid.In the fatty acids biosynthesis, S. lydicus 103 contains the complete pathway to transfer glutamine or glutamate to 2-oxoglutarate, supplying the citrate cycle [EC:2.3.1.168], thus influencing the biosynthesis of branched chain fatty acid and terpenoid backbone. S. lydicus 103 harbors the complete pathways of lysine, valine, leucine, phenylalanine, tyrosine and isoleucine biosynthesis. In addition to the acyl-CoA, L-valine contributes to the biosynthesis for methylmalonyl-CoA and ethylmalonyl-CoA, and L-methionine contributes to the biosynthesis for chloroethylmalonyl-CoA. Proteomics and metabolomics analyses showed that the pitching ratio influenced the activity of glutamate and proline pathways (both precursors of streptolydigin), and exogenously addition can increase the yield of streptolydigin productionS. lydicus 103 harbors the complete pathways to transform among the arginine, ornithine, glutamate and proline.Among the amino acids, glutamic acid was the most favorable as the nitrogen source to form streptolydiginte cycle . In the S. lydicus 103 harbors 67 ORFs covering a region of 111.2\u2009kb, which are putatively assigned as streptolydigin biosynthesis genes encoding amino-acid permease, isocitrate dehydrogenase, lysophospholipase, erythronolide synthase, phenolphthiocerol synthesis polyketide synthase, cadicidin biosynthesis thioesterase, squalene cyclase, cytochrome P450, methylmalonyl-CoA mutase, glucose-1-phosphate thymidylyltransferase, lipopolysaccharide, biosynthesis protein and electron transfer flavoprotein etc.Streptolydigin was a polyketide compound synthesized by type I polyketide pathway, which shares same or similar precursors with the type II polyketide pathwaysS. lydicus can produce a lot of important secondary metabolites, and a total of 27 gene clusters were predicted to be involved in secondary metabolism by antiSMASH. They are mainly focused on polyketide (PKS), nonribosomal peptide (NRPs) and terpene, and most of them have the really low similarity with the known clusters biosynthesis and glycosylation modificationS. lydicus 103 harbors the ectione biosynthetic pathway that shows 47% similarity with Streptomyces albulus PD-1. As one kind of compatible solute, ectoine can be used for protecting enzymes, membranes and whole cells against stressesHalomonas elongatawas was improved by the heterologous expression of the ectoine hydroxylase gene from Streptomyces chrysomallusS. lydicus 103, which shows 75% similarity with known ectione biosynthetic cluster (BGC0000853_c1). As the family of siderophores, desferrioxamines can form strong hexadentate complexes with ferric iron. Desferrioxamine B has been used for the treatment of iron overload in humanS. lydicus 103 harbors the desferrioxamine B biosynthetic pathway that shows 80% similarity with known desferrioxamine B biosynthetic cluster (BGC0000941_c1). Previous research has unambiguously identified desferrioxamine E as the major desferrioxamine siderophore produced by S. coelicolor M145 and has identified a cluster of four genes (desA-D) that directs desferrioxamine biosynthesis in this model actinomycete3+-siderophore transport system in S. lydicus 103.Besides, S. lydicus has the activities mentioned above, the yield from the original strain is not very high yet. To achieve higher antibiotic streptolydigin productivity through metabolic regulation, propionate was fed during the fermentation of S. lydicusslgE1-slgE2-slgE3 is involved in 3-methylaspartate (the precursor of the tetramic acid) supply. SlgE3, a ferredoxin-dependent glutamate synthase, is responsible for the biosynthesis of glutamate from glutamine and 2-oxoglutarate. The expression of slgE3 is increased up to 9-fold at the onset of streptolydigin biosynthesisS. lydicus. Over-expression of slgZ and slgM in S. lydicus led to a considerable increase in streptolydigin productionSlnM gene overexpression with different promoters can improve the natamycin production in S. lydicus A02S. lydicus 103 and identified the pathways related to streptomyces biosynthesis from primary metabolism to secondary metabolite, which would provide more accurate analysis of the metabolic network and a more rational adjustment of metabolic regulationAlthough streptolydigin produced by Streptomyces spp. could produce up to 100,000 antimicrobial metabolites, while only a small proportion have been identifiedS. avermitilis was expressed in E. coli, resulting in the synthesis of the novel tricyclic sesquiterpene, avermitilolet al.et al.S. griseus and discovered three new PTMs. Besides, transcriptome and metabolome can identify the potential biosynthetic genes by correlating the expression of the secondary metabolite related geneS. lydicus 103, we found many new gene clusters that have really low similarity with known clusters : glucose 5, starch 30, yeast extract 2, peptone 4, K2HPO4 1.5, NaCl 0.5, and MgSO4.7H2O 0.5. Isolation of genomic DNA was carried out using SDS method. Total DNA obtained was subjected to quality control by agarose gel electrophoresis and quantified by Qubit. The genome was sequenced by Single Molecule, Real-Time (SMRT) technology. Sequencing was performed at the Beijing Novogene Bioinformatics Technology Co., Ltd. SMRT Analysis 2.3.0 was used to filter low quality reads and the filtered reads were assembled to the chromosome without gaps. The circular skeleton of chromosome was identified by the long fragment across the head and tail.oriC) and putative DnaA boxes were identified using Ori-FinderTransfer RNA (tRNA) genes, Ribosome RNA (rRNA) genes, small RNA (sRNA) genes were predicted with tRNAscan-SES. lydicus 103 genome has been deposited at DDBJ/EMBL/GenBank under the GenBank accession number CP017157.The sequence of the How to cite this article: Jia, N. et al. Complete genome sequencing and antibiotics biosynthesis pathways analysis of Streptomyces lydicus 103. Sci. Rep.7, 44786; doi: 10.1038/srep44786 (2017).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."} +{"text": "D1r locus. We identified a functional interaction between DISC1 and Kr\u00fcppel-like factor 16 (KLF16). KLF16 translocates DISC1 into the nucleus and forms a regulatory complex by recruiting SIN3A corepressor complexes to the D1r locus. Moreover, DISC1-deficient mice have altered D1R-mediated signaling in the striatum and exhibit hyperlocomotion in response to cocaine; the blockade of D1R suppresses these effects. Taken together, our results suggest that nuclear DISC1 plays a critical role in the transcriptional regulation of D1R in the striatal neuron, providing a mechanistic link between DISC1 and dopamine-related psychiatric symptoms.Disrupted-in-Schizophrenia 1 (DISC1) is a scaffold protein implicated in various psychiatric diseases. Dysregulation of the dopamine system has been associated with DISC1 deficiency, while the molecular mechanism is unclear. In this study, we propose a novel molecular mechanism underlying the transcriptional regulation of the dopamine D1 receptor (D1R) in the striatum via DISC1. We verified the increase in D1R at the transcriptional level in the striatum of DISC1-deficient mouse models and altered histone acetylation status at the The online version of this article (10.1007/s12035-019-1566-6) contains supplementary material, which is available to authorized users. Disruptions in dopamine signaling are critical factors in the pathophysiology of a number of mental disorders, such as schizophrenia and addictive disorders , 2. In tDisc1 gene was initially discovered as a susceptibility factor for schizophrenia and related psychiatric conditions [The nditions . Subsequnditions , 9. Linenditions . Transgenditions . Similarnditions . HoweverKLF16 belongs to the Sp/Kr\u00fcppel-like transcription factor family and binds to GC and GT boxes in the D1A and D2 dopamine receptor promoters with Cys-2-His-2 zinc finger motifs . KLF16 iD1r locus in the mouse striatum. We show that the DISC1-deficient mouse model has an increased level of D1R in the striatum and exaggerated cocaine-induced hyperlocomotion, which is suppressed by the blockade of D1R. Our findings provide a novel route for the epigenetic regulation of dopamine signaling.In this study, we discovered a functional interaction between DISC1 and KLF16. This interaction induces the translocation of DISC1 into the nucleus and forms a regulatory complex with the SIN3A corepressor at the D1r mRNA showed significant upregulation compared with wild-type. To further confirm this preliminary observation, we used two DISC1-mutant mouse models: Disc1 (\u03942\u20133/\u03942\u20133) mice and Disc1-LI mice [D1r mRNA expression, we performed real-time quantitative reverse transcription PCR (qRT-PCR) using the dissected medial prefrontal cortex, striatum, and hippocampus of adult male mouse brains, which are the primary brain subdomains for dopamine receptor expression. The D1r mRNA level was significantly higher in the striatal region of Disc1 (\u03942\u20133/\u03942\u20133) mice than in wild-type mice, while no significant differences were detected in other regions cells with considerable dopamine receptor expression [D1r mRNA assay using an anti-acetylated histone H3 (AcH3) antibody. The level of AcH3 at the D1r locus was remarkably lower in the DISC1-overexpressing CAD cells than in control cells , a D1R downstream signaling pathway , by west1/2 Fig.\u00a0. This reDisc1-LI mice because D1R is known to be essential for cocaine-induced locomotor sensitization [Disc1-LI mice showed more active locomotion than wild-type mice upon 20\u00a0mg/kg of cocaine, indicating exaggerated behavioral sensitization of Disc1-LI mice to cocaine because D1R is involved in the acquisition of cocaine CPP [Disc1-LI mice is contributing to the increased place preference. Taken together, the upregulation of D1R caused by DISC1-deficiency is responsible, at least in part, for behavioral changes in DISC1-deficient mice.To test the behavioral effect of elevated D1R signaling by DISC1-deficiency, we performed cocaine-induced locomotor sensitization in combination with SCH23390 using tization . The dosice Fig. . In bothd 5 Fig. , indicataine CPP . DISC1 dD1r transcription by physical interaction with KLF16 and recruitment of the SIN3A repressor complex to the D1r locus. Multiple studies have reported potential roles for DISC1 in the nucleus. Millar et al. [PDE4D9 gene in collaboration with ATF4 and N-CoR, which is under the control of D1R signaling [D1r locus, similar to that in DISC1/ATF4. These findings reveal a novel role of DISC1 as a general nuclear scaffold protein related to the transcriptional repression complex and suggest its functions for fine-tuning dopamine signaling, which is disrupted under DISC1 deficiency, thereby generating a hyper-dopaminoceptive condition. This finding is also in line with the evidence that dopaminergic pathways governed by dopamine receptors are altered in several neurological and psychiatric conditions such as schizophrenia [Disc1-LI mice might be related to an aspect of these psychiatric disease pathologies.Here, we present a novel epigenetic regulatory mechanism for D1R expression that is achieved by the participation of DISC1, a factor associated with major mental illnesses. We demonstrated that DISC1 functions as a negative regulator of r et al. initiallr et al. narrowedignaling . As DISCophrenia . Moreoveophrenia , 30. In Disc1-LI mice used in this study did not show a difference in locomotive activity in the open field test and motor coordination in the rotarod test, implying that their presynaptic functionality related to dopamine release was not significantly affected. On the other hand, the augmented expression of D1r mRNA in the striatum of Disc1-LI is consistent with the findings in some other DISC1-deficient mice or dominant-negative DISC1 mice [Disc1-LI mice shown in this study. Collectively, our results suggest that DISC1 is relevant to the interface among substance dependence and other psychiatric conditions.We demonstrated that deficiency of DISC1 leads to the enhancement of cocaine-induced dopamine signaling through postsynaptic D1R. Previously, hyperactivity in response to psychostimulants has been shown in multiple DISC1 mutant and transgenic mouse models , 12. TheSC1 mice , 12. ThuSC1 mice . The effSC1 mice . Of noteSC1 mice \u201335. SuppSC1 mice . This phKlf16 cDNA was cloned in pEGFP-N1 (Clontech) and pcDNA 3.1/HA (Invitrogen) vectors. Mouse Disc1 cDNA was cloned in pFlag-CMV2 (Sigma) vector, and mouse Sin3a was cloned in pcDNA 3.1/Myc-His (Invitrogen) vector.Mouse Disc1 (\u03942\u20133/\u03942\u20133) mutant , and DISC1 locus impairment mouse had been described previously [Pregnant wild-type (B57BL/6) mice were obtained from Hyochang Science for striatal neuron culture. Production and management of wild-type (B57BL/6), eviously , 37\u201339. Primary culture of mouse embryonic striatal neuron was conducted as described previously , 40 withv/v) fetal bovine serum (GIBCO) and 1% penicillin/streptomycin. The CAD cell line was a kind gift from Dr. MD Nguyen . We confirmed its capacity of morphological differentiation upon serum deprivation. Cultured neurons and differentiated CAD cells were transfected using Lipofectamine 2000 (Invitrogen).Neuroblastoma CAD cell line was maintained in DMEM (Hyclone) supplemented with 10% supplemented with protease inhibitor (Pierce). Antibodies were added to the lysates and incubated for 4\u00a0h or overnight at 4\u00a0\u00b0C. Immunocomplexes were precipitated using protein A-agarose (Roche). The pellets were washed three times with the NP40 lysis buffer and prepared for subsequent SDS-PAGE and western blot assay.2, 40\u00a0mM KCl, 2\u00a0mM DTT, 0.5\u00a0mM PMSF, and protease inhibitor. After incubation on ice for 30\u00a0min, 10% of each lysate was kept as the whole lysate and the last was centrifuged at 1000g, 4\u00a0\u00b0C for 5\u00a0min. The supernatant was centrifuged at 13,000g, 4\u00a0\u00b0C for 10\u00a0min and kept as the enriched cytoplasm fraction. The pellet was washed twice with the lysis/extraction buffer and centrifugation at 1000g, then resuspended in the nuclear extraction buffer containing 10\u00a0mM HEPES (pH\u00a07.9), 1.5\u00a0mM MgCl2, 420\u00a0mM NaCl, 0.1\u00a0mM EGTA, 25% glycerol, 0.5\u00a0mM DTT, 0.5\u00a0mM PMSF, and protease inhibitor. After incubation on ice for 30\u00a0min and sonication, cellular debris was removed by centrifugation at 13,000g, 4\u00a0\u00b0C for 10\u00a0min, and the supernatant was kept as the enriched nuclear fraction.Cytoplasm- and nucleus-enriched lysates were prepared as described previously with som2) before lysis. Ten microgram SCH23390 was pretreated 15\u00a0min before DA treatment.Protein concentration was determined by the Bradford method. Fifteen to eighty micrograms of proteins was subjected to SDS-PAGE. The antibodies used are as follows: anti-DISC1 , anti-GFP , anti-Myc , anti-GAPDH , anti-FLAG M2 , anti-FLAG , anti-HA , anti-Lamin B , anti-Actin , anti-SIN3A , anti-D1R , p44/42 MAPK (ERK 1/2) , P-p44/42 MAPK (phospho-ERK 1/2) , rabbit IgG , and goat anti-mouse and goat anti-rabbit HRP-labeled secondary antibodies . For D1R western blot, the protein samples were denatured at 37\u00a0\u00b0C for an hour. For phospho-ERK 1/2 and ERK 1/2 western blot, cells were treated with 10\u00a0\u03bcM DA for 30\u00a0min in the 37\u00a0\u00b0C incubator , respectively. Hoechst 33342 dye (Thermo Scientific) was used for nuclear staining. Images were obtained by a laser scanning confocal microscopy and Mander\u2019s overlap coefficients and Pearson\u2019s correlation coefficients were analyzed by CellSens software (Olympus). All images were processed with the auto-threshold option of CellSens software, and none of the images were manipulated manually.D1r gene.D1R F: 5\u2032-GGTGGAGGAGGACTGGTGTCAA-3\u2032D1R R: 5\u2032-CTTGGAAATCACTTTGCCTGGA-3\u2032GAPDH F: 5\u2032-AACGACCCCTTCATTGAC-3\u2032GAPDH R: 5\u2032-TCCACGACATACGCAC-3\u2032ChIP assays were carried out from differentiated CAD cells as described previously . PolycloD1R F: 5\u2032-GGGCCCTACTACGAATAATG-3\u2032D1R R: 5\u2032-CATAGTCCAATATGACCGATAAG-3\u2032D2R F: 5\u2032-GCTCAGGAGCTGGAAATGGAGAT-3\u2032D2R R: 5\u2032-CTTCCTGCGGCTCATCGTCTT-3\u2032,D3R F: 5\u2032-GTCCTGCCCTCTCCTCTTTGGTTT-3\u2032D3R R: 5\u2032-AGTCTACGGTGCCCTGTTTAC-3\u2032D4R F: 5\u2032-TGCCCTCAACCCCATCATCTACAC-3\u2032D4R R: 5\u2032-AATACTTCCGACCCCCAACCCT-3\u2032D5R F: 5\u2032-GGGAGATCGCTGCTGCCTATGTC-3\u2032D5R R: 5\u2032-TTTTAGAGTGGTGAGTGGGGGTTA-3\u2032GAPDH F: 5\u2032-CACTGAAGGGCATCTTGG-3\u2032GAPDH R: 5\u2032-TTACTCCTTGGAGGCCATG-3\u2032Total RNA was extracted using Tri-Solution (Bioscience Technology) from striatal tissues or differentiated CAD cells. For reverse transcription, 1\u00a0\u03bcg of RNA was used to synthesize first-strand cDNA using the ImProm-II\u2122 Reverse Transcription System (Promega). For real-time qPCR, we used FastStart Universal SYBR Green Master (Rox) (Roche) and the StepOnePlus real-time PCR system (Applied Biosystems) according to the manufacturer\u2019s protocol using the following primers:Cocaine sensitization was conducted as described previously . All micAll mice were allowed to rest in the testing room for 30\u00a0min prior to performing any behavioral assessment in the open field test. Animals were placed in the center of the arena and their behaviors were recorded for 30\u00a0min by a video tracking system .Mice were trained in an elevated rotating rod at a fixed speed of 10\u00a0rpm, and then tested in an accelerating rod from 4 to 40\u00a0rpm for 2\u00a0min, where the latency to fall in seconds was registered.Mice were conditioned to cocaine using a conditioning apparatus, which consisted of three distinct environment chambers . On day 1, mice were placed in the middle chamber and allowed to explore the conditioning apparatus. On days 2 and 3, mice received two pairings per day: saline in the morning and cocaine in the evening on the opposite side of the place preference chambers. SCH23390 was injected 15\u00a0min ahead of the cocaine administration. At the post-test on day 4, mice were placed again in the middle chamber with free access to all chambers, and the time spent in each side was quantified. Data represents the time spent on the cocaine-paired side minus the time spent on the saline-paired side (CPP score).t tests using the GraphPad Prism software for Windows (version 5). Statistical significance is indicated as follows: *P\u2009<\u20090.05; **P\u2009<\u20090.01; ***P\u2009<\u20090.001.All data are presented as mean \u00b1 SEM. Statistical significances were analyzed using one-way ANOVA with post-hoc Tukey tests, two-way ANOVA with post-hoc Bonferroni tests, or two-tailed independent-samples Student\u2019s"} +{"text": "Salivary antioxidants , peroxidase (Px), superoxide dismutase (SOD), uric acid (UA), reduced glutathione (GSH), albumin), redox status , total oxidant status (TOS), oxidative stress index (OSI)), and oxidative damage products (advanced glycation end products (AGE), advanced oxidation protein products (AOPP), malondialdehyde (MDA)) were evaluated. We have demonstrated the significantly higher activity of SWS GPx and SOD, as well as elevated concentrations of UA and albumin in NWS and SWS of CKD children vs. the control group. TAC, TOS and OSI were significantly higher only in SWS, while oxidative damage products were significantly higher in both NWS and SWS of CKD children. ROC analysis showed a considerably high diagnostic value of AOPP in both NWS and SWS of CKD children compared to controls . CKD is responsible for disturbances in salivary antioxidant systems and oxidative damage to proteins and lipids. Salivary AOPP can be a potential biomarker of CKD in children.There are still missing non-invasive biomarkers of chronic kidney disease (CKD) in children. Therefore, the aim of the study was to evaluate oxidative stress indicators in the non-stimulated (NWS) and stimulated saliva (SWS) of CKD children ( In addition to arterial hypertension, diabetes and obesity, chronic kidney disease (CKD) is one of the most common civilization diseases . CKD is Recently, a significant influence of oxidative stress in the pathogenesis of chronic kidney diseases has been increasingly emphasized ,5,6. TheThe research was approved by the local Research Ethics Committee of the Medical University of Bialystok, Poland (permission number R-I-002/43/2018). All the examined persons and/or their legal guardians agreed in writing to participate in the study.2; Stage 2: 60\u201389 mL/min/1.73 m2; Stage 3: 30\u201359 mL/min/1.73 m2; Stage 4: 15\u201329 mL/min/1.73 m2; and Stage 5: <15 mL/min/1.73 m2. The estimated glomerular filtration rate (eGFR) was calculated using the updated Schwartz formula\u2014eGFR (mL/min/1.73 m2) = 0.413 \u00d7 (height in cm/s Cr) [The study included 25 CKD patients (15 boys and 10 girls) aged 7\u201318 (median 12.9 years of age) treated in the Department of Paediatrics and Nephrology of the University of Bialystok Children\u2019s Clinical Hospital of L. Zamenhof. The causes of CKD in the patients included: urological defects (28%), glomerulopathies (28%), congenital nephropathies (20%), kidney dysplasia (12%), and undetermined aetiology (12%). CKD was defined and staged according to the Kidney Disease Improving Global Outcomes (KDIGO) criteria based on different Eger distribution: Stage 1: >90 mL/min/1.73 mBlood pressure (BP) was measured by means of either the manual auscultatory technique or an automated oscillometric device after the subject had rested for 5 min in a sitting position. The average values of the second and third measurements of systolic BP and diastolic BP were used for subsequent analyses and based on a diagnosis concerning hypertension. According to its definition, hypertension occurred when the average value of the systolic and/or diastolic BP measurements were \u226595th percentile for age, gender, and height .n = 25; 15 boys and 10 girls; median 12.9 years of age) consisted of generally healthy children selected by age and sex, among patients attending control visits at the Special Dental Clinic of the Medical University of Bialystok.The control group and periodontal inflammation identified in the course of a dental examination. In addition, patients taking antibiotics, non-steroidal anti-inflammatory drugs, glucocorticosteroids, vitamins and dietary supplements were also not included in the experiment.Upon the diagnosis of CKD, all patients were on a renal diet that was low in sodium and/or phosphorous and/or protein depending on patients\u2019 condition and CKD stage . DetaileNon-stimulated saliva (NWS) and stimulated saliva (SWS) were collected using the spitting method. The saliva was gathered after an all-night rest, always between 8 a.m. and 10 a.m. For at least 2 h before saliva collection, participants of the study and control groups did not consume any meals or drinks other than pure water, and did not perform any hygienic procedures within the oral cavity. In addition, the study subjects did not take any medications for at least 6 hours before saliva collection.g, +4 \u00b0C; MPW 351, MPW Med. Instruments, Warsaw, Poland). In order to protect the samples from oxidation during their processing and storage, butylated hydroxytoluene was added to the obtained supernatants [The saliva was collected on the first day after admission to hospital, always in the same child-friendly room, so that the patients did not feel uncomfortable or nervous. After at least 5 min of the adaptation period and two rinses of the oral cavity with distilled water at room temperature, the saliva was collected in a sitting position with the head slightly inclined downwards, and minimized movements of the face and lips. The saliva accumulated at the bottom of the oral cavity was spat into a sterile Falcon tube placed in an ice container. The collection time for NWS was 10 min; however, the saliva collected during the first minute was disposed of . After arnatants ,18. The The dental examinations were performed in artificial lighting using a mirror, an explorer, and a periodontal probe in accordance with the criteria of the World Health Organization . The exar = 1.00; for SBI: r = 0.96; for GI: r = 0.98, and for API: r= 0.98.Inter-rater agreements between the examiner (JS) and another experienced dentist (AZ) were assessed in 15 patients. The reliability for DMFT was \u00ae K3 EDTA blood collection system . To separate plasma and erythrocytes, the samples were centrifuged . Erythrocytes were washed three times in cold 0.9% NaCl (v:v) and haemolysed by the addition of cold 50 mM phosphate buffer (pH 7.4) 1:9 (v:v) [After an overnight fast, 9 mL of venous blood samples were collected in S-Monovette:9 (v:v) . In orde:9 (v:v) . All samThe performed analysis included: antioxidant enzymes , salivary peroxidase , and superoxide dismutase ), non-enzymatic antioxidants (uric acid (UA), reduced glutathione (GSH), and albumin), total antioxidant/oxidant status , total oxidant status (TOS), and oxidative stress index (OSI)), as well as oxidative damage products (advanced glycation end products (AGE), advanced oxidation protein products (AOPP), and malondialdehyde (MDA)). All parameters were analysed in the saliva samples. Enzymatic antioxidants were also estimated in erythrocytes, while non-enzymatic antioxidants, total antioxidant/oxidant status and oxidative damage products also in the blood plasma.Unless stated otherwise, all assays have been performed in duplicate samples. The absorbance/fluorescence was measured using Infinite M200 PRO Multimode Microplate Reader from Tecan. All results were standardised to mg of total protein. The total protein concentration was determined via the method with bicinchoninic acid and bovine serum albumin as a standard ).2O2) [2O2 per minute.CAT activity was determined colorimetrically in triplicate samples by measuring the decomposition rate of hydrogen peroxide (H2O2) . The absPx activity was determined colorimetrically according to Mansson-Rahemtulla based onSOD activity was determined colorimetrically in triplicate samples by measuring the cytosolic activity of SOD by inhibiting the oxidation of epinephrine to adrenochrome . It was 3+ and UA. The absorbance was measured at 630 nm.UA level was measured colorimetrically using the commercial kit , as instructed by the manufacturer. In this method, 2,4,6-tripyridyl-s-triazine forms a blue complex with FeGSH concentration was determined colorimetrically using Ellman\u2019s method with 5,5\u2032-dithiobis-2-nitrobenzoic acid . The absAlbumin concentration was measured colorimetrically using bromocresol green (BCG) assay with bovine serum album as a standard . The absTAC level was measured colorimetrically in triplicate using 2,2-azinobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) radical cation . The abs2+ to Fe3+ in the presence of the oxidants contained in the sample [2O2 equivalent per litre.TOS level was determined bichromatically (560/800 nm) based on the oxidation of Fee sample . The resOxidative stress index (OSI) was calculated using the formula: OSI = TOS/TAC \u00d7 100 . v:v).The AGE content was determined fluorimetrically by measuring the AGE-specific fluorescence at 350/440 nm . Saliva v:v) and a calibration curve was prepared for chloramine solutions.The AOPP concentration was determined colorimetrically by measuring the oxidative capacity of the iodine ion at 340 nm . Saliva The MDA concentration was measured colorimetrically using thiobarbituric acid reactive substances (TBARS) assay . 1,1\u2032,3,P \u2264 0.05. Due to the lack of significant differences between the different types of CKD, the results of the redox assays were presented as CKD and a control group. The diagnostic value of the redox salivary biomarkers and the optimum cut-off values were determined based on receiver operating characteristic (ROC) analysis, known as the area under the curve (AUC).Statistical analysis was performed using the GraphPad Prism and Statistica 10.0 system . The Kolmogorov\u2013Smirnov test showed no normal distribution of the obtained results, therefore nonparametric methods were implemented. The Mann\u2013Whitney U test was used to analyze quantitative values between the study and control groups. The data was expressed as median, minimum, and maximum values. The associations between the measured parameters were tested by Spearman\u2019s rank correlation coefficient. Statistical significance was established at In patients with CKD we demonstrated considerably higher levels of serum creatinine, UA, urea, and 24-h urinary protein, albumin excretion compared to the controls. The detailed clinical characteristics of the patients are presented in We found no significant differences between oral hygiene indexes (APIs) and periodontal disease indexes in patients from both the study and control group .P = 0.0005) and stimulated (P = 0.0005) saliva in CKD patients compared to the controls. The content of total protein was considerably lower only in the non-stimulated saliva of patients from the study group vs. healthy children (P = 0.1442). The activity of salivary amylase was significantly lower in both non-stimulated (P < 0.0001) and stimulated saliva (P = 0.8901) of CKD patients in comparison with the control group . In stimulated saliva, the activity of Px and SOD was significantly higher in CKD patients , while the activity of CAT did not differ considerably from that of the control group did not differ significantly from the data obtained from the healthy controls. Only the SOD activity was noticeably higher in the study group and stimulated saliva in patients with CKD than in the controls. However, CKD patients showed significantly lower concentration of GSH both in non-stimulated (P = 0.0299) and stimulated saliva (P = 0.0027) compared to the healthy controls .P = 0.0235; P = 0.0003; P = 0.0007) and in stimulated saliva compared to the controls (In patients with CKD we observed a significant increase in the concentration of the markers of oxidative protein (AGE and AOPP) and lipid (MDA) damage both in non-stimulated saliva in children with CKD compared to controls .The results of statistically significant correlations are presented in P = 0.0003) in NWS differentiating the two groups was the value above 37.85 nmol/mg of protein, at which sensitivity was 81.25%, and specificity 81.82%. The optimum SWS AOPP concentration , differentiating CKD patients from the control group, was >25.58 nmol/mg of protein, at which sensitivity was 92.00%, and specificity 92.31% may be potential diagnostic biomarkers of chronic kidney disease in children.With the development of sensitive analytical methods we can observe an increased interest in the use of other body fluids than blood in the diagnosis of chronic systemic diseases. Non-invasive collection of test material plays an important role in reducing patients\u2019 anxiety associated with this procedure and may contribute to more frequent performance of control tests. In the therapeutic process, early diagnosis is crucial in enabling quick recognition of the disease and applying appropriate therapy. An interesting alternative to blood, commonly used in diagnosis, is saliva\u2014the exudation of large salivary glands as well as numerous smaller glands located in the oral mucosa . Saliva Chronic kidney disease is a major clinical problem not only in the adult population but also, above all, in children and adolescents . Due to UA plays an important role in the overall antioxidant potential. It is believed that this compound determines 70\u201385% of antioxidant capacity of plasma or saliva . From thA significant part of the study was to evaluate the diagnostic usefulness of salivary biomarkers of oxidative stress in diagnosing CKD in children. ROC analysis has shown that salivary advanced oxidation protein products (AOPP) may constitute a particularly interesting parameter. At high sensitivity and specificity we observed that AOPP very accurately differentiate between children with CKD and healthy controls . Correlations between AOPP and eGFR, urine protein and serum urea also prove the usefulness of salivary AOPP. Although AOPP are used as indicators of various disease units may affect the evaluated oxidative stress parameters. Therefore, patients whose dental examinations revealed poor oral hygiene (API > 20) and gingivitis were excluded from our experiment. Furthermore, the assessed oxidative stress markers are not exclusively specific to kidney inflammatory diseases. However, on the other hand, our study indicates the adequacy of the evaluation of redox parameters in saliva, which may be an alternative diagnostic material for the blood. We showed that the most salivary biomarkers correlated with their level in the blood plasma, and therefore, saliva may be considered in laboratory diagnostics of CKD in children.Disturbances of redox homeostasis observed in the study may result not only from the intensity of the disease process, but also from hypofunction of salivary glands in the course of CKD. Importantly, we have demonstrated reduced non-stimulated and stimulated saliva secretion in children with CKD as well as significantly lower activity of salivary amylase, which is considered the most important marker of salivary gland secretion activity . A decreFinally, it is also worth noting certain limitations connected with the study. We evaluated only selected (though most commonly used) oxidative stress parameters, therefore we could not fully characterize the redox equilibrium in patients with CKD. Moreover, most pathological processes in the course of CKD occur in kidney, which reduces the evaluation of salivary redox biomarkers to an auxiliary value. In addition, the observed changes in endogenous antioxidant systems may be disturbed by the implemented pharmacological treatment (pro-oxidant iron or antioxidant ACE inhibitors), increased ferritin level as well as may also result from hypofunctions of salivary glands during CKD. However, it has been the first study to evaluate salivary redox biomarkers in children with CKD and it has indicated their potential use in laboratory diagnosis. The study was attended by carefully selected patients with a healthy oral cavity, without most other systemic diseases.CKD is associated with disorders within salivary antioxidant systems, and oxidative damage to proteins and lipids. The salivary parameters of oxidative stress, especially AOPP, may serve as potential biomarkers of CKD as alterative to the blood. CKD leads to impaired secretion activity of salivary glands in children, resulting in a decrease in salivary flow rate, total protein, and \u03b1-amylase. Antioxidant supplementation should be considered in children with CKD."} +{"text": "Chronic kidney disease (CKD) is one of the most common modern-age diseases in children. Kidney failure does not reveal any symptoms for a long time; therefore, new biomarkers are sought, preferably those reflecting an early stage of CKD. The aim of our study was to evaluate total antioxidant potential as a biomarker differentiating the degree of CKD advancement. The study included 30 children with CKD and a control group matched by age and gender. Non-stimulated saliva (NWS), stimulated saliva (SWS), plasma and urine were used as study material. Total antioxidant potential was determined spectrophotometrically using the FRAP method (ferric ion reducing antioxidant parameter) by measuring total FRAP and uric acid (UA)-independent FRAP (FRAP-UA). We demonstrated that total FRAP, FRAP-UA and UA were significantly higher in stimulated saliva, as well as urine of CKD patients compared to the controls. These biomarkers increase with the progression of chronic kidney disease and their concentration in SWS reflects their content in urine. Interestingly, salivary FRAP and uric acid clearly differentiate between various stages of CKD as well as between healthy and ill children. Special attention should be paid to total FRAP which\u2014measured in SWS\u2014distinguishes patients with mildly to moderately decreased kidney function from those with severe renal impairment . Although salivary FRAP may be a potential CKD biomarker in children, further studies are needed in a larger group of patients. Other CKD indices include: albuminuria, abnormal urine sediment, electrolyte changes and deviations in imaging and kidney biopsy [Chronic kidney disease (CKD) is a syndrome giving a multitude of symptoms and resulting from a permanent reduction in the number of nephrons, or their permanent damage . CKD is y biopsy . Howevery biopsy . TherefoIt is assumed that oxidative stress plays a key role in CKD aetiology ,7,8. It In modern laboratory diagnostics there is a growing interest in alternative biological materials to be collected without specialist equipment and supervision of medical personnel. This may contribute to the reduction of patients\u2019 anxiety, encourage people to monitor their health more frequently, and enable early diagnosis of the disease. Saliva serves as a non-invasive, and at the same time non-infectious, diagnostic material . AlthougAs we have demonstrated in the previous studies , CKD is The research project was approved by the Local Bioethical Committee in Bialystok (permission number R-I-002/43/2018). It was conducted in accordance with the Declaration of Helsinki determining ethical principles for medical research involving humans. All subjects and/or their legal guardians consented in writing to participate in the experiment.The study included 30 CKD children with normal body weight, treated at the Department of Pediatrics and Nephrology of the Medical University of Bialystok Children\u2019s Clinical Hospital. The patients\u2019 condition was assessed based on medical history, physical examination, and laboratory and imaging results. The causes of CKD were: glomerulopathy (30%), urological abnormalities (23.3%), nephropathy (16.7%), kidney dysplasia (16.7%) and unknown aetiology (13.3%).2) = 0.413 \u00d7 (height in cm/sCr) [CKD was defined according to the Kidney Disease Improving Global Outcomes (KDIGO) criteria based on cm/sCr) . Kidney Blood pressure was measured using either a manual auscultatory or an automatic oscillometric device after the patient had rested for 5 min in a sitting position. The average values of the second and third measurements were used for subsequent analyses, based on a decision concerning hypertension. Hypertension was defined as the average value of the systolic and/or diastolic blood pleasure of \u2265 95th percentile for age, gender, and height .From the moment of positive CKD diagnosis, all patients were on renal diet low in sodium and/or phosphorous and/or protein, depending on a patient\u2019s condition and CKD stage .The control group consisted of generally healthy children with normal body weight who attended follow-up visits at the Children\u2019s Dental Clinic at the Specialist Dental Clinic of the Medical University of Bialystok. The control was matched by age and gender to the study group.The exclusion criterion in both groups was the occurrence of systemic, metabolic, autoimmune, neoplastic, and infectious diseases, as well as diseases of the digestive tract, thyroid and lungs. Patients taking glucocorticosteroids, non-steroidal anti-inflammatory drugs (NSAIDs), hormones, antibiotics, vitamins and dietary supplements for at least three months prior to the study, as well as cigarette smokers and people with poor oral hygiene and/or gum inflammation, were excluded from the study .Detailed clinical characteristics of patients and the controls are presented in Total mixed non-stimulated saliva (NWS) and stimulated saliva (SWS) were used for assays. Saliva was collected between 7:30 a.m. and 9:00 a.m. after an overnight rest from patients who had refrained from increased physical activity for the preceding 24 h. Patients were advised not to consume any food or drink other than clean water at least 2 h before saliva collection and not to perform any oral hygiene procedures . Furthermore, subjects from the study as well as the control group had not taken any medicines at least 8 h prior to saliva collection.g; MPW 351, MPW Med. Instruments, Warsaw, Poland). In order to protect the samples from oxidation processes, butylated hydroxytoluene was added to the obtained supernatants in the amount of 10 \u03bcL 0.5 M BHT in acetonitrile (ACN)/1 mL of saliva [Saliva was collected via the spitting method, each time in the same, child-friendly room (after at least a 5-min adaptation period). Before the collection, the oral cavity was rinsed twice with distilled water at room temperature. Saliva was collected in a sitting position with the head slightly inclined downwards, and with limited movements of the face and lips. Saliva was spat into a sterile tube placed in a container with ice, and the samples collected during the first minute were discarded. NWS was collected for 15 min. SWS was collected similarly to NWS and its secretion was stimulated by sprinkling the tip of the tongue with 10 \u00b5L of 2% citric acid every 30 s. SWS was collected for 5 min. No blood contamination was observed in any of the samples. Immediately after collection, saliva was centrifuged .Right after saliva collection, a clinical dental examination was performed in every patient according to the World Health Organization criteria . A mirroPersons with poor oral hygiene (API > 20) and gum inflammation were excluded from the experiment. All the dental examinations were performed by the same dentist (J. S.). In 10 patients we assessed the inter-rater agreements between the examiner (J. S.) and another experienced dentist (A. Z.). The reliability for DMFT was r = 0.96; dmft = 0.92; API was r = 1.0; SBI was r = 0.98; and GI was r = 0.96.\u00ae K3 EDTA blood collection system was used, and samples were centrifuged immediately . No haemolysis was found in any sample, and the supernatant fluid (plasma) was preserved for further assays.Whole blood was collected between 7 a.m. and 8 a.m. in a sitting position, from fasting patients after an overnight rest. S-Monovetteg, 4 \u00b0C, 10 min).Urine was collected into a sterile container from the middle stream, after an overnight resting period and morning crotch hygiene procedures. Within 1 h of collections, the samples were delivered to the laboratory and centrifuged immediately was added to plasma and urine samples that were then frozen at \u221280 \u00b0C until assayed .The total protein content was determined via the bicinchoninic acid (BCA) method using a commercial kit ). Bovine serum albumin (BSA) was used as a standard.3+ ions in the form of a complex with 2,4,6-Tri(2-pyridyl)-s-triazine (TPTZ) to Fe2+ ions. The TPTZ-Fe2+ complex has intense colour with a maximum absorption at 593 nm wavelength. The colour intensity is directly proportional to the concentration of Fe2+ ions. Since uric acid strongly affects the value of total antioxidant potential, both total FRAP and UA-independent FRAP (FRAP-UA) were measured after the addition of uricase. UA concentration was calculated from the difference between total FRAP and FRAP-UA, whereas uric acid level in the total antioxidant potential of saliva, plasma, and urine was expressed as:The total antioxidant potential of saliva, plasma and urine was determined spectrophotometrically using FRAP . This me3 (20 mM/L) at a volume ratio of 10:1:1. All the said substances were mixed, and after 8 min we measured the absorbance changes at 593 nm wavelength as compared to the blank test. The absorbance was measured with Infinite M200 PRO Multimode Microplate Reader from Tecan. The standard curve was prepared by dissolving uric acid (84 mg) and lithium carbonate (60 mg) in deionized water (30 mL) at 60 \u00b0C. The resulting solution was diluted with deionized water to 100 mL (5 mM/L stock UA standard solution). The solution was protected from light, and used directly to prepare the diluted solutions of the standards [All reagents were purchased from Sigma-Aldrich . 60 \u03bcL of PBS (pH 7.4) or 60 \u03bcL of uricase (10 U/mL) were added to 200 \u03bcL of the sample, then mixed thoroughly and incubated for 20 min at 25 \u00b0C. Next, 100 \u03bcL of the sample was taken, and 3 mL of freshly prepared FRAP reagent was added to the sample by mixing acetate buffer , TPTZ (10 mM/L in 40 mM/L HCl) and FeCltandards .All measurements were performed in triplicate samples. The results were standardised to mg of total protein.t-test (comparisons between two groups). Multiplicity adjusted p values were also calculated. The correlation of the obtained results was assessed using the Pearson correlation coefficient. The zero hypotheses were falsified at the materiality level p = 0.05. The results (expressed as an arithmetic mean \u00b1 SEM) are presented in the figures and tables included herein. ROC (receiver operating characteristic) analysis was used to assess the diagnostic usefulness of the assayed biomarkers. Diagnostic value of salivary FRAP was evaluated between healthy and CKD patients as well as between patients with weak/moderate renal failure (stages 1\u20133) and those with severe CKD (stages 4\u20135). The number of patients was selected based on the previous pilot study, with the value of 0.9 assumed as the test strength.Statistical analysis was performed using the GraphPad Prism 7 . The Shapiro\u2013Wilk test was used to determine the normality of distribution, and comparisons were made with the one-way ANOVA variance analysis and the Tukey test or the unpaired Student\u2019s p = 0.003), 2 (p = 0.01), 3 (p = 0.008) and 5 (p = 0.007) of chronic kidney disease, as well as in all patients with CKD (p < 0.001) compared to the controls. The same changes were observed at all stages of CKD in stimulated saliva (p < 0.001 versus the controls) was significantly lower in NWS of children at stage 1 (ontrols) .p < 0.001). The rate of SWS secretion was lower in children at stage 1, 2, 3 and 4 of CKD, as well as in all patients with chronic kidney disease compared to healthy controls (p < 0.001) .We have not observed any significant differences in the incidence of caries, oral hygiene, or the condition of the gums between the studied groups .p < 0.001) .p = 0.01) and 5 (p = 0.04) of CKD compared to healthy controls, similarly to all CKD patients (p = 0.001) vs. the control. The level of UA-independent FRAP was also higher in SWS and urine of children at stages 2\u20135 of CKD and in all patients compared to healthy subjects (p < 0.001) (UA-independent FRAP (FRAP-UA) was significantly higher in NWS of children at stage 2 (< 0.001) .p < 0.001) .p = 0.03) and in the group of all patients with chronic kidney disease versus healthy controls (p = 0.003). This parameter was considerably higher in urine of only the group of all CKD patients compared to the controls (p = 0.001) .All the biomarkers evaluated in stimulated saliva and urine significantly differentiated patients from healthy subjects. High diagnostic value in distinguishing children with chronic kidney disease from the controls was also confirmed for total FRAP and FRAP-UA in non-stimulated saliva, and total FRAP and UA in plasma .ROC analysis demonstrated that at high sensitivity and specificity, total FRAP, FRAP-UA and UA in stimulated saliva significantly differentiated children at stage 1\u20133 of CKD from patients at stage 4 or 5 of the disease. Interestingly, the level of total FRAP > 17.92 \u03bcM/mg protein in stimulated saliva differentiated between patients with weak/moderate renal failure and those with severe CKD . All urinary biomarkers significantly distinguished children at stage 1\u20133 of CKD from those at stage 4\u20135 of renal failure .The correlations between redox biomarkers evaluated in saliva, plasma and urine of patients with chronic kidney disease are presented in The correlations between salivary antioxidant potential and clinical parameters for patients with CKD are presented in Chronic kidney disease is inseparably connected with oxidative stress ,7,8. In All antioxidants basically fulfil the same function: they impede the formation of ROS and interrupt free radical reactions, preventing the interaction of oxidants with cellular components. However, it is difficult to draw conclusions about redox homeostasis solely based on the assessment of individual antioxidants. A much better parameter is total antioxidant potential which determines the total capacity of our biological system to scavenge free radicals. It is believed that total antioxidant potential includes interactions between all antioxidants ,29. In oA rich source of antioxidants is saliva ,30. ThisLaboratory evaluation of kidney function is an important element of CKD diagnostics. Progressive renal failure reveals no symptoms for a long time, and early stages of CKD may be latent in both clinical and laboratory tests. Therefore, new biomarkers are constantly being sought to reflect particularly the initial stage of kidney damage ,5. AlthoThe term \u2018laboratory biomarker\u2019 refers to an endogenous substance which, measured by validated and reproducible methods, correlates with the pathological process, is characterized by high sensitivity and specificity, and at the same time is easy to interpret . The resGFR (glomerular filtration rate) is the gold standard in CKD diagnostics . HoweverRenal anaemia is a significant clinical problem in children with CKD . Its priThe diagnostic value of the assessed redox biomarkers was also confirmed by ROC analysis. With high sensitivity and specificity, total FRAP, FRAP-UA and UA in stimulated saliva significantly differentiated healthy subjects from CKD patients, as well as children at stages 1\u20133 from those at stages 4\u20135 of the disease progression. A particularly interesting parameter is total FRAP, which\u2014at the level of over 17.92 \u03bcM/mg protein in SWS\u2014differentiates patients with weak/moderate renal failure from those with severe CKD . However, further studies in a larger population of patients are needed to confirm the clinical usefulness of salivary FRAP.In view of the constant increase in CKD incidence and high costs of therapy, salivary redox biomarkers may serve as the basis for developing laboratory tests that would enable early, non-invasive diagnosis of chronic kidney disease in children. The FRAP method is cheap and fast, characterized by high repeatability and reproducibility, and\u2014due to the presence of commonly available commercial diagnostic kits\u2014the results of tests can be compared with each other .However, despite the undeniable advantages, salivary redox biomarkers have certain limitations. Diseases of the oral cavity and periodontium may affect FRAP values in saliva. What is more, such factors as medicines taken , angiotensin receptor blocker (ARB)), environmental factors and other systemic diseases of proven oxidative stress aetiology may also disturb total antioxidant potential.Summarising, salivary total FRAP, FRAP-UA and UA can be useful for monitoring CKD progression in children. These biomarkers increase with the severity of chronic kidney disease and their concentration in stimulated saliva reflects their content in urine. However, special attention should be paid to salivary total FRAP which distinguishes children with mildly to moderately decreased kidney function from those with severe renal impairment. Further studies are needed to confirm the diagnostic value of salivary FRAP in a larger population of CKD children."} +{"text": "Currently, no specific biochemical markers can either predict progression to psoriatic arthritis or response to therapies. This study aimed to identify osteoimmunological markers applicable to clinical practice, giving a quantitative tool for evaluating pathological status and, eventually, to provide prognostic support in diagnosis. (2) Methods: Soluble (serum) bone and cartilage markers were quantified in 50 patients with only psoriasis, 50 psoriatic patients with psoriatic arthritis, and 20 healthy controls by means of multiplex and enzyme-linked immunoassays. (3) Results: Differences in the concentrations of matrix metalloproteases (MMPs), tissue inhibitors of metalloproteinases (TIMPs), receptor activator of nuclear factor kappa-B- ligand (RANK-L), procollagen type I N propeptide (PINP), C-terminal telopeptide of type I collagen (CTx-I), dickkopf-related protein 1 (DKK1), and sclerostin (SOST) distinguished healthy controls from psoriasis and psoriatic arthritis patients. We found that MMP2, MMP12, MMP13, TIMP2, and TIMP4 distinguished psoriasis from psoriatic arthritis patients undergoing a systemic treatment, with a good diagnostic accuracy (Area under the ROC Curve (AUC) > 0.7). Then, chitinase-3-like protein 1 (CHI3L1) and MMP10 distinguished psoriasis from psoriatic arthritis not undergoing systemic therapy and, in the presence of onychopathy, MMP8 levels were higher in psoriasis than in psoriatic arthritis. However, in these latter cases, the diagnostic accuracy of the identified biomarkers was low (0.5 < AUC < 0.7). (4) Conclusions. By highlighting never exploited differences, the wide osteoimmunological biomarkers panel provides a novel clue to the development of diagnostic paths in psoriasis and psoriasis-associated arthropathic disease. Adult psoriatic disease depicts a continuum encompassing disease progression from psoriasis (Ps) to psoriatic arthritis (PsA) . In contA biochemical marker that clearly predicts PsA in a cohort of Ps patients is still elusive. A biomarker is defined as a measurable characteristic indicating a biological or pathophysiological process and can be used to identify the risk to develop a certain disease . SeveralBased on this background, this study aimed to investigate the possible association between a wide panel of osteoimmunological biomarkers with Ps and PsA, and in the relative sub-cohorts in order to identify a possible laboratory tool that could support PsA diagnosis and early prediction.2, respectively.In both Ps and PsA groups, a prevalence of male subjects, 66% and 78%, respectively, was observed despite no gender prevalence being reported. Median ages were 48 (19\u201382) years in Ps, 51(28\u201379) years in PsA, and 48 (29\u201367) years in controls. The body mass index (BMI), in the three groups, was 25 (23\u201329), 26 (23\u201328), and 24 (22\u201325) kg/mThe Psoriasis Area Severity Score (PASI) was higher in Ps (6 (5\u201312)) than in PsA (4 (1\u20137)). Onychopathic signs were present in 38% of Ps subjects and 48% of PsA subjects, according to the literature ,12, PsA When considered in their entirety, without any subgrouping for treatment status, no significant differences were observed for any of the tested markers between Ps and PsA. Conversely, compared to the control group (CTRL), both Ps and PsA groups differed for most of the analyzed molecules, except for MMP3, MMP7, MMP12, tissue inhibitors of metalloproteinase (TIMP)-1, TIMP-2, OPG, C-telopeptide of type II collagen (CTx-II), and chitinase-3-like protein 1 (CHI3L1) .Furthermore, statistically significant correlations were found between markers\u2019 concentration and duration of both Ps and PsA: MMP2, MMP12, MMP13, TIMP1, TIMP2, TIMP3, sclerostin (SOST), and CHI3L1 in Ps (positive correlation) and with MMP10 and TIMP2 in PsA (negative correlation). Moreover, in Ps group, MMP8, MMP10, and CTx-I positively correlated with PASI score, while TIMP4 was negatively correlated .The Ps and PsA cohorts were further divided based on the therapy regimen (subjects undergone to systemic treatments (ST) and not systemically treated (NST)).n = 19 and n = 17, respectively) were compared, MMP2 , MMP12 , MMP13 , TIMP2 , and TIMP4 were higher in Ps to PsA (p = 0.004).When Ps and PsA subjects ST (s to PsA A. As expThe Relative Operating Characteristic (ROC) analysis shows that the area under the ROC curve (AUC) for both the single markers and their combination (0.755 to 0.845) display a moderately accurate diagnostic potential in discriminating Ps from PsA ST patients. Noteworthy, the combination of all these markers gave the highest diagnostic accuracy (AUC = 0.845) .n = 31) and PsA NST (n = 33) significantly differed for MMP10 , and CHI3L1 (p = 0.002).By focusing on the NST group, Ps NST (= 0.042) B, with tp = 0.011), and negatively with PsA duration .In Ps NST, MMP10 positively correlated with CHI3L1 , Ps ST (n = 19) had significantly increased serum levels of MMP2 , MMP3 , MMP12 , MMP13 , TIMP2 , TIMP3 , and CTx-I .n = 17) vs. PsA NST (n = 33).Interestingly, no osteoimmunological biomarkers were statistically different in the comparison PsA ST (p = 0.009) and higher circulating MMP8 compared to onychopathic PsA patients (PsA O) (Ps patients with onychopathy (Ps O) had higher PASI (6.5 vs. 3.7 (PsA O) . ROC ana (PsA O) .p = 0.002). Non-onychopathic Ps compared to PsA counterparts achieved significance only for PASI gave a good diagnostic accuracy. Consequently, this panel is particularly promising because of the wide use of MTX in both Ps and PsA. The effects of systemic treatments on the osteoimmune function is clearly depicted, in our study, by the decrease in the circulating levels of most of the markers here considered. A second set of biomarkers seems to be useful in differentiating between Ps and PsA that have never undergone systemic treatments (NST). Given their na\u00efve condition, the comparison of Ps NST and PsA NST patients could be considered as the most useful. This set comprises of MMP10 and CHI3L1 whose levels are, moreover, reciprocally correlated. CHI3L1 is an inactive chitinase due to the lack of the catalytic domain whose physiological functions have not been fully clarified, although it may play a role in inflammation ,18,19. BNail psoriasis is, among others, a risk factor for the development of PsA, especially within the distal interphalangeal joints, as suggested by McGonagle and colleagues ,25. RemaIn those subjects presenting onychopathy signs, MMP8 concentrations were higher in Ps than in PsA. Being a collagenase, MMP8 preferentially cleaves the interstitial type I collagen and is the first collagenase that appears during dermal wound-healing ,32. MMP8The cross-sectional nature of this study and the somehow limited sample size (pilot study) represent the main limitations, although this is compensated by the great homogeneity of the selected cohorts that limits the number of variables potentially affecting the circulating levels of the analyzed biomarkers. Remarkably, due to the exiguity of the sample, it was not possible to evaluate the influences of drugs and severity on the biomarker\u2019s levels. Future studies are mandatory to assess the osteoimmunological biomarker specificity for PsA and further compare the present findings with other autoimmune diseases involving joints, such as RA or gout.clinicaltrials.gov (NCT03455166). The study was carried out following the rules of the Declaration of Helsinki of 1975, revised in 2008 .The clinical trial was approved by the ethical committee , and registered at A written consent to the use of clinical data was obtained from all patients after being informed about the study procedures, their benefits, and eventual risks.n = 50) and patients with Ps and PsA were enrolled at the department of dermatology and venereology of the IRCCS Istituto Ortopedico Galeazzi , starting from June 2015 until April 2017, during routine clinical activities. Inclusion criteria for Ps patients were plaque psoriasis for more than six months, neither current nor previous treatment with biological drugs, and no joint involvement.Patients with a diagnosis of plaque psoriasis criteria were actPsoriatic onychopathy was included only if nail psoriasis severity index (NAPSI) \u2265 3 poinExclusion criteria, common to the two groups, included pregnancy, current or previous malignancies, other acute or chronic inflammatory diseases, infectious diseases (human immunodeficiency virus (HIV), hepatitis B and C , tubercuDuring the outpatient visit, Ps history, disease onset and evolution were evaluated. The most prevalent type of Ps was determined, along with the body sites involved and the presence of the onychopathic trait. A psoriasis area and severity index (PASI) score was assigned by two independent board-certified dermatologists. PsA diagnosis was formulated by two independent board certified rheumatologists prior to the dermatological examination, based on anamnestic and clinical evaluations of the patient\u2019s inflammatory and imaging indexes. In particular, based on CASPAR criteria and ultrFinally, laboratory analyses completed the diagnostic path by investigating markers useful in the differential diagnosis with other forms of inflammatory arthritis .\u00ae . Blood was immediately centrifuged at 1300\u00d7 g and serum was aliquoted and stored at \u221280 \u00b0C until assayed. Serum samples from 20 healthy Caucasian age- and sex-matched subjects were used as a control (CTRL).Blood samples were collected by standard venipuncture of the antecubital vein in SST II Advance Vacutainer\u00ae Multiplex System .Serum matrix metalloproteinases and their tissue inhibitors were quantified using a multiplex assay on a Bio-Plex\u00a9, Houston, TX, USA). Serum markers of cartilage degradation and inflammation, CTx-II and CHI3L1, also known as YKL-40, were measured by a competitive enzyme immunoassay (Cloud-Clone Corp\u00a9) and a sandwich enzyme immunoassay (BioVendor-Laboratorni Medicina A.S.), respectively. Inhibitors of the Wnt signaling pathway, DKK1, and SOST, were assayed in serum by a solid-phase ELISA .Osteoimmune markers, OPG, and RANKL, concentrations were measured in serum using monoclonal antibody-based immunoassays (ELISA) . A marker of bone resorption, CTx-I, and a marker of bone formation, PINP, were measured in serum by monoclonal antibody-based immunoassays (Cloud-Clone Corpw) and inter-assay (CVb) variations were: 2.5\u20134.9% and 1.7\u20139.0% for OPG, 7.25\u201311.51% and 11.21\u201312.77% for RANKL, <10% and <12% for CTx-I, PINP, CTx-II, CHI3L1, 4.2% and 7.6% for DKK1, 2.1% and 10.8% for SOST.The lower limits of detection (LOD) were 0.03 pmol/L for OPG, 0.4 pmol/L for RANKL, 44.3 pg/mL for CTx-I, 12.4 pg/mL for PINP, 52.3 pg/mL for CTx-II, 5.0 pg/mL for CHI3L1, 4.20 pg/mL for DKK1, and 1.78 pg/mL for SOST. Intra-assay in order to limit variability in the final analytical output ,13.Shapiro\u2013Wilk\u2019s normality test was performed on data from the entire cohort. Since the non-parametrical distribution of the values, quantitative parameters are expressed as the median and the interquartile range in the descriptive analysis. The within-group comparisons were performed using Mann\u2013Whitney U-test. Kruskall\u2013Wallis test was used for multiple comparison. Spearman\u2019s rank correlation test was applied to evaluate correlations that were considered significant when r \u2265 0.25. Diagnostic accuracy of those markers displaying a statistically significant difference in the subgroup\u2019s comparison was determined by the ROC (receiver operating characteristic) curves analysis. The AUC (area under curve)-based accuracy was classified according to Swets JA .p < 0.05. Analyses were performed using SPSS software .The significance was set at This study, comparing a large panel of osteoimmunological biomarkers, highlighted profound differences between Ps, PsA, and healthy controls. These phenotypic differences, which are attenuated in the comparison between Ps and PsA, reinforces the thesis according to which these two diseases belong to the same pathological spectrum. However, we also identified important differences in the expression of specific tissue-remodeling associated enzymatic activities in selected sub-cohorts of Ps and PsA subjects that seem to be dependent upon the treatment (systemic vs. topic) and the presence nail involvement (onychopathy)."} +{"text": "During head and neck cancer treatment, the radiation response of the oral mucosa represents a\u00a0frequent early side effect. Besides radiation-induced inhibition of proliferation, various other cellular responses occur. The radiation response of adherens and tight junction proteins was so far mostly investigated with large single-dose irradiation protocols, in vivo and in vitro. Therefore, the current study was initiated to investigate the impact of daily fractionated irradiation on the expression of adherens and tight junction proteins in vivo.Fractionation with 5\u202f\u00d7\u20093\u202fGy/week was given to the snouts of mice. Groups of 5\u00a0animals per day were euthanized every second day between day\u00a00 (unirradiated controls) and day\u00a014, and their tongues subjected to histological processing. Adherens junction marker (\u03b2-catenin and E\u2011cadherin) and tight junction marker (claudin-1 and occludin) expression was analysed in the oral mucosa of unirradiated controls and during two weeks of fractionated irradiation.Adherens as well as tight junction marker proteins were rapidly and consistently upregulated in both the germinal as well as the functional layer of the oral mucosa. This represents a\u00a0previously unknown parameter of the epithelial radiation response to clinically relevant fractionation protocols.Fractionated irradiation significantly enhanced the expression of all proteins investigated. This study revealed a\u00a0new parameter of the epithelial radiation response to fractionated irradiation.The online version of this article (10.1007/s00066-018-1302-6) contains supplementary material, which is available to authorized users. The epithelial radiation response often represents a\u00a0dose-limiting early side effect, experienced by the majority of head and neck cancer (HNC) patients as confluent oral mucositis \u20133. Oral Oral mucosa is a\u00a0typical turnover tissue, with a\u00a0precise equilibrium of continuous proliferation in the germinal tissue compartments and cell loss at the surface. Radiation abolishes epithelial proliferation but does not influence the rate of superficial cell shedding. This leads to epithelial hypoplasia and subsequently denudation, which represents the primary cause of oral mucositis . ImportaAll experiments were performed according to the current animal welfare legislation with approval by the respective authorities (file no. BMWF 66.009/0039-II/3b/2014).2 , maximum 5\u00a0animals per cage, on aspen wood bedding . The mice had free access to standard maintenance diet and fresh water from standard Perspex drinking bottles ad libitum. The age of the mice at the onset of the experiments ranged from 8 to 12\u00a0weeks.For all experiments, mice of the inbred C3H/Neu strain from the breeding colony of the Department of Biomedical Research, MedUni Vienna, were used. Mice of both genders were included in the experiments, since earlier studies excluded gender effects on the mucosal radiation response . Mice weOver the course of 14\u00a0days, animals received fractionated irradiation with 5\u202f\u00d7\u20093\u202fGy per week. Irradiation was administered daily between 10 and 12\u202fam over a\u00a0course of 2\u00a0weeks, Mondays to Fridays (days 0\u20134 and 7\u201311). On the weekends (days 5\u20136 and 12\u201313), no irradiation was given to the animals, similar to conventional patient protocols.n\u202f=\u20095) were sacrificed and their tongues excised at the base for analyses of irradiation-induced epithelial marker expression changes. Five unirradiated mice served as a\u00a0control group.In 2\u2011day intervals, groups of animals was used. Dosimetric commissioning was performed for all used set-ups . StandarFractionated irradiation with 3\u202fGy per day was given to the whole snouts of the animals. Un-anaesthetized animals were guided into a\u00a0set-up of plastic tubes (inner diameter 2\u202fcm). The snouts were positioned in conical holes (10\u202fmm \u2192 6\u202fmm) of a\u00a0Perspex block at the front end of the tubes. The rear ends were closed to prevent withdrawal of the animals. The bodies of the mice were shielded caudally from a\u00a0plane from the eyes to the throat with 12\u202fmm of the Pb-Bi-Sn alloy MCP-96. The treatment volume thus included the snouts with the entire tongue. The set-up for simultaneous irradiation of 8\u00a0animals was positioned in a\u00a0standardized way in the central beam of the irradiation device. For fractionated irradiation, the YXLON Maxishot device was operated at 200\u202fkV with a\u00a0tube current of 20\u202fmA and a\u00a0focus size of 5.5\u202fmm. An additional 4\u202fmm Al and 0.6\u202fmm Cu beam filter was used, which resulted in a\u00a0dose rate of ca.\u00a01\u202fGy/min at the focus-to-skin distance of 45.5\u202fcm. The dose homogeneity between the individual snout positions was 3.2\u202f\u00b1\u20090.5%. The beam direction was vertical.Histological preparation procedures have been reported in detail previously . StaininMicroscopic analyses were performed field by field with an Axio Lab.A1 HAL 35 at 400\u00d7 magnification. The lower mouse tongue epithelium was analysed from the tip to the end of the tongue. A\u00a0minimum of five visual fields were evaluated. In each visual field the number of marker-positive cells was normalized to the total number of cells, visualized by haematoxylin nuclear staining. The fraction of marker-positive cells was evaluated separately for the germinal and the functional epithelial layer. Additionally, the staining intensity, corresponding to the amount of protein expressed, was assessed semi-quantitatively with an arbitrary score from\u00a00 , 1\u00a0, 2\u00a0 to\u00a03 . Staining intensity was scored per visual field, not for each marker-positive cell individually. Staining homogeneity was good. Marker-positive cells and their respective staining intensity were evaluated by two independent and experienced researchers in a\u00a0blinded fashion after extensive training. Intra-observer variability was found to be negligible. Inter-observer variability was low and results in good agreement.p-value of <0.05 was regarded as statistically significant.For statistical analysis and graphical representation, the SPSS statistical software and GraphPad Prism\u00a05 , respectively, were used. Mean values and standard deviation (SD) were calculated for each experimental group. The analysis of variance (one-way ANOVA) was used to test for the significance of a\u00a0difference between the mean values. A\u00a0Representative histophotographs of immunohistochemical staining for \u03b2\u2011catenin, E\u2011cadherin, claudin-1 and occludin in untreated control mucosa and on day\u00a014 after 10\u202f\u00d7\u20093\u202fGy are presented in Fig.\u00a0p\u202f\u2264\u20090.001 for all days investigated). E\u2011cadherin expression increased from 85 to 94% on day\u00a02 (p\u202f=\u20090.007) and further to values between 96% on day\u00a04 and 99% on day\u00a014, resulting in p\u202f\u2264\u20090.001 from day\u00a04 onwards . Likewise, E\u2011cadherin staining intensity increased from 1.8\u202fa.\u202fu. in untreated samples to values between 2.7\u202fa.\u202fu. on day\u00a02 and 2.9\u202fa.\u202fu. on day\u00a014 , day\u00a04 (p\u202f=\u20090.002), day\u00a06 (p\u202f\u2264\u20090.001), day\u00a08 (p\u202f=\u20090.004) and from day\u00a010 to day\u00a014 with p\u202f\u2264\u20090.000. E\u2011cadherin expression was significantly potentiated (p\u202f\u2264\u20090.001) on days investigated and on days\u00a08 (p\u202f=\u20090.047), day\u00a010 (p\u202f=\u20090.003), day\u00a012 (p\u202f=\u20090.002) and day\u00a014 (p\u202f=\u20090.008) for E\u2011cadherin and from day\u00a06 with p\u202f\u2264\u20090.001 until the end of the study period. Occludin expression was significantly upregulated from day\u00a02 onwards (p\u202f=\u20090.002). From day\u00a04 until day\u00a014, occludin expression was observed in 95\u201399% of the germinal layer , day\u00a04 (p\u202f=\u20090.005), day\u00a06 (p\u202f=\u20090.037), day\u00a08 (p\u202f=\u20090.033), day\u00a012 (0.004) and day\u00a014 (p\u202f=\u20090.005) for claudin-1. For occludin, significant differences were found from day\u00a06 onwards with p\u202f=\u20090.017 on day\u00a06, p\u202f=\u20090.02 on day\u00a08 and p\u202f=\u20090.001 on days\u00a010 to\u00a014 . Occludin expression was significantly enhanced on all days throughout the study period with p\u202f=\u20090.005 on day\u00a02 and p\u202f\u2264\u20090.001 from day\u00a04 \u201350% (claudin-1) of cells expressed the tight junction markers. During fractionation, the expression of both markers gradually increased until an expression maximum was observed for both proteins at the end of the study period. On day\u00a014, 76% of functional epithelial cells expressed claudin-1 and 83% were occludin positive. Significantly increased claudin-1 expression was observed on all days (day\u00a02: p\u202f=\u20090.031) to\u00a014 (p\u202f\u2264\u20090.001) and for occludin on day\u00a04 (p\u202f=\u20090.009) and day\u00a08 (p\u202f=\u20090.033) and from day\u00a010 to day\u00a014 from day\u00a010 to day\u00a014 with p\u202f\u2264\u20090.001 normal tissue side effects occur frequently during curative radio(chemo)therapy. Although accepted for the benefit of an optimal tumour treatment, early normal tissue side effects are associated with substantially reduced quality of life . Hence, This study was initiated to characterize the role of epithelial junctions during the development of oral mucositis, which is the most frequently occurring early side effect during radio(chemo)therapy of head and neck tumours. Primarily, oral mucositis manifests as a\u00a0response to radiation-induced inhibition of epithelial proliferation. As the physiological superficial cell loss in the epithelium, characteristic for turnover tissues, continues independent of the treatment, epithelial hypoplasia and denudation, i.\u202fe. ulcerative lesions, develop. These are associated with a\u00a0breakdown of the epithelial barrier function and therefore an increased risk for local and systemic infections , 31. EpiWhile the physiological roles of E\u2011cadherin, occludin and claudin-1 are based on their functions within junctional complexes , 37, \u03b2\u2011cThe radiation-induced upregulation of epithelial cell contacts described in this study has, to our knowledge, not been demonstrated before and appears to be a\u00a0new parameter of epithelial tolerance to fractionated irradiation. In our model, fractionated irradiation progressively increased the expression of tight as well as adherens junction proteins. In contrast to large single doses, conventional fractionation doses, as used in this study, seem to trigger responses other than cell death, i.\u202fe. changes in cell function. Similar findings have been reported for the central nervous system and skin \u201344. We hOur findings highlight the importance of choosing a\u00a0biologically relevant irradiation scheme for the radiation response being investigated. Clearly the response to single-dose irradiation is highly relevant for multiple scenarios, e.\u202fg. accidental exposure or stereotactic radiosurgery. However, the response to large single-dose irradiation does not necessarily reflect the same tissue\u2019s response to clinically more relevant fractionation schemes.This study demonstrated a\u00a0previously unknown response of junction proteins to fractionated irradiation with conventional daily doses. The expression of adherens junction marker proteins \u03b2\u2011catenin and E\u2011cadherin as well as the tight junction marker proteins claudin-1 and occludin rapidly increased during the course of 2\u00a0weeks of fractionation. The augmented expression was found in all epithelial layers and was highly significant for all proteins.Mean Occludin and Claudin-1 expression values per animal, figure\u00a03Mean beta-catenin and e-cadherin expression values per animal, figure\u00a02"} +{"text": "Ex vivo purified CD8+ and CD4+ T cells both constitutively expressed luciferase, whereas B cells showed no detectable signal. We cross-bred TbiLuc mice to T cell receptor-transgenic OT-I mice to obtain luciferase-expressing na\u00efve CD8+ T cells with defined antigen-specificity. TbiLuc*OT-I T cells showed a fully antigen-specific induction of the T cell activation-dependent luciferase. In vaccinated mice, we visualized T cell localization and activation in vaccine-draining lymph nodes with high sensitivity using two distinct luciferase substrates, D-luciferin and CycLuc1, of which the latter specifically reacts with the PpyRE9 enzyme. This dual-luciferase T cell reporter mouse can be applied in many experimental models studying the location and functional state of T cells.Non-invasive imaging technologies to visualize the location and functionality of T cells are of great value in immunology. Here, we describe the design and generation of a transgenic mouse in which all T cells constitutively express green-emitting click-beetle luciferase (CBG99) while expression of the red-emitting firefly luciferase (PpyRE9) is induced by Nuclear Factor of Activated T cells (NFAT) such as during T cell activation, which allows multicolor bioluminescence imaging of T cell location and function. This dual-luciferase mouse, which we named TbiLuc, showed high constitutive luciferase expression in lymphoid organs such as lymph nodes and the spleen. It has been extensively used to study gene expression, using genetic constructs in which expression of the luciferase is driven by the promoter of the gene of interest . A commoing cell , 4. Commin vivo, because it allows real-time visualization of the typically strong dynamics of many immune cells, which often change location and expand or contract in number over short periods of time. These characteristics are particularly true for T cells, which are found in high numbers in lymphoid organs such as the spleen and lymph nodes, but also circulate in the bloodstream to patrol the body and enter peripheral tissues in case these harbor their target. These properties make T cells an attractive target for BLI. Thus far, many attempts to create luciferase-expressing T cells have used viral transduction of T cells. However, T cells in their untouched natural state, immunologically referred to as \u2018na\u00efve T cells\u2019, are practically impossible to transduce. Therefore, in order to allow their transduction, T cells are first activated in vitro to facilitate their transduction, and then rested for several days before use in an experiment with D-l*C57BL/6 mice. In the pups born the presence of the transgene was determined by a specific PCR using genomic DNA from tail biopsy and its activity/function was measured by evaluation of light emission from tail-vein blood after addition of the luciferase substrate D-luciferin. Mice were back-crossed to the C57BL/6 strain for several generations before use in experiments. Albino B6 mice (tyrosinase-deficient immunocompetent C57BL/6 mice), TbiLuc mice , OT-I mice (T cell receptor-transgenic mice carrying the CD45.1 congenic marker) and crossed TbiLuc*OT-I mice were bred in the animal breeding facility of the Leiden University Medical Center, the Netherlands. All experiments were approved by the animal ethical committee of Leiden University. D1 is a GM-CSF-dependent immature dendritic cell line derived from C57BL/6 mice, and B3Z is an OVA-specific CD8 T cell hybridoma carrying the lacZ reporter gene induced by NFAT . Cells were suspended in 100 \u03bcL PBS containing 1 mM D-luciferin potassium salt or 0.1 mM CycLuc1 , incubated for 5 min at 37\u00b0C. BLI imaging was performed using an IVIS Spectrum small animal imager that measured the light signal using open filter and a series of 20 nm wavelength band filters from 500 to 700 nm, with an acquisition time of 30 s. Accompanying LivingImage 4.2 software (Perkin Elmer) was used for spectral unmixing of the full-spectrum measurement to identify individual signals in vitro.Cell samples were prepared for For characterization of the TbiLuc model, a group of 3 TbiLuc mice were injected intraperitoneally with 150 mg/kg D-luciferin, anesthetized by isoflurane inhalation and imaged after 10 min (peak of emission) using an IVIS Spectrum imager set at the \u201copen\u201d filter with an exposure time of 60 s. Another group of 3 TbiLuc mice were injected intraperitoneally with 7,6 mg/kg CycLuc1, left for 5 min and anesthetized by isoflurane inhalation for IVIS imaging. Next, organs from TbiLuc mice were taken out and rinsed in PBS before BLI analysis, using an acquisition time of 30 s. Signal quantification in specific regions of interest (ROIs) was performed depicting regions of interest (ROIs) corresponding to the whole organ and signals were corrected for background by subtracting the signal from the same size of ROIs placed at irrelevant positions. Data are reported as photons flux per mg of tissue.n = 8) were injected with 150 mg/kg D-luciferin, anesthetized by isoflurane inhalation and imaged after 10 min (peak of emission) using the \u201copen\u201d filter and 560 nm filter with an exposure time of 30 seconds. After 3 h, mice were imaged to assure that no D-luciferin-mediated signal was present anymore, and mice were subsequently injected intraperitoneally with 7,6 mg/kg CycLuc1, left for 5 min and anesthetized by isoflurane inhalation. This concentration of CycLuc1 was chosen as a maximum injectable dose given its low solubility. Mice were imaged using open filter and 620 nm filter with an exposure time of 30 s. Signal quantification in specific regions of interest (ROIs) was performed by using fixed-size and fixed-position ROIs throughout the experiments, and signals were corrected for background by subtracting the signal from ROIs placed at irrelevant positions.Mice (+ and CD8+ T cells were isolated separately by negative magnetic selection (BD IMag enrichment kits), B cells by positive magnetic selection of B220+ cells (BD IMag), while NK cells and myeloid cells were obtained by FACS-sorting for CD3\u2212/NK1.1+/NKp46+ (NK cells) and CD3\u2212/CD11b+ (myeloid cells).Immune cells were obtained from the spleen by mashing on 70 \u03bcm cell strainers to create single-cell suspensions, followed by erythrocyte lysis. Then, CD4*OT-I mice were stimulated overnight with 100 ng/mL Phorbol 12-myristate 13-acetate (PMA) + 1500 ng/mL ionomycin , with agonistic anti-CD3 and anti-CD28 antibodies (BD Biosciences) pre-coated at 1 \u03bcg/mL (unless indicated otherwise) at 37\u00b0C for 30 min, or with 50,000 D1 dendritic cells pre-loaded with OVA immune complexes. OVA immune complexes were formed by incubating a 1:300 mass ratio of OVA protein and anti-OVA antibody for 30 min at 37\u00b0C, after which the immune complexes were added to D1 dendritic cells and incubated overnight. Unloaded D1 cells were incubated overnight in parallel to serve as control cells.T cells isolated from spleens of TbiLuc or TbiLuc+ OT-I cells (unless stated otherwise) isolated as described above, injected intravenously in 200 \u03bcL PBS in the tail vein. Vaccination consisted of subcutaneous injection of 1 million (unless indicated otherwise) D1 cells pre-loaded with OVA immune complexes, or unloaded control D1 cells, in 50 \u03bcL PBS in the tail-base region.Adoptive transfer consisted of 1 million purified CD8*106 cells were lysed and the total protein content of each sample was determined by a Pierce BCA protein assay kit . Next, 20 \u03bcg of total cell extract was applied to a 10% SDS-PAGE and transferred onto a nitrocellulose membrane. After washing, the membrane was incubated overnight with rabbit anti-luciferase polyclonal antibody in TPBS at 1/500 dilution . The GAPDH antibody was used to correct for the amount of total protein. The blots were washed, exposed to an HRP-conjugated secondary antibody for 1 h, and detected using enhanced chemiluminescence (ECL) reagents (Thermo Scientific). Detection of ECL signals was performed with the IVIS Spectrum and quantification of bands using Living Image Software 4.2.Expression of PpyRE9 luciferase by activated T cells was confirmed by Western Blot. T cells were isolated and stimulated overnight as described above. Then, 3Before adoptive transfer of CD8 T cells, their CD8-purity and na\u00efve phenotype was assessed by flow cytometry. In short, spleen cells were suspended in FACS buffer (PBS with 0.5% FCS and 0.02% sodium azide), surface-stained with antibodies against CD8\u03b2, CD44, CD45.1, and CD62L and analyzed on a BD Accuri C6 flow cytometer. Analysis was performed on FlowJo software .t-test. Statistical differences were considered significant at p < 0.05.Statistical analysis was performed using GraphPad Prism 6.0 software. Data are shown as the mean \u00b1 SEM for each group, and comparison of groups was performed by two-tailed Student's in vivo BLI and upon dissecting lymphoid and non-lymphoid organs showing on average a 1,000-fold higher signal in lymphoid organs than in non-lymphoid organs sequence under the control of the human CD2 (hCD2) promoter and the red-emitting firefly luciferase (PpyRE9) sequence under the control of the nuclear factor of activated T cells (NFAT) minimal promoter Figure . BackgroNext, we analyzed in more detail which cells in the lymphoid organs express luciferase by isolating CD4 T cells, CD8 T cells, B cells, NK cells and myeloid cells from the spleens of TbiLuc mice. Constitutive expression of CBG99 luciferase in unstimulated cells was completely restricted to T cells, as the other cell types showed no detectable bioluminescence signal , which we have previously reported as an efficient CD8 T cell vaccine as presented in H-2Ke Figure . To stud vaccine . This le vaccine . We calc vaccine . Western vaccine . Althougciferase . In vivo*OT-I T cell activation could be performed using the two substrates, D-luciferin and CycLuc1. Addition of a single substrate per sample allowed efficient detection of the constitutive signal from CBG99 green luciferase by D-luciferin, and the activation-induced signal from PpyRE9 red luciferase by CycLuc1 measuring CBG99 luciferase activity, followed by measurement of PpyRE9 luciferase activity using the CycLuc1 substrate. This order was chosen based on the longer half-life of the second substrate CycLuc1 compared to the first substrate D-luciferin photons, as we have described before transgenic mouse strains, which brings many possibilities to further fine-tune the reporter system for the biomedical experimental model of interest. Future studies using TbiLuc mice to study T cell dynamics and functionality in diverse experimental (disease) models will help determine the breadth of its applicability. Taken together, this proof-of-concept manuscript introduces the TbiLuc dual-luciferase T cell transgenic mouse that allows to track activation and expansion of T cell populations in naturally organized lymphoid tissue, with full retention of T cell naivety and antigen-specific functionality. Many biomedical research fields can potentially benefit from this advanced live T cell imaging model.in vitro experiments and analyzed the data. MF helped with experimental design and revised the manuscript. JV developed the transgenic mouse. LC and AC advised on and funded the project. FO and CL supervised the project, revised the manuscript and provided funding.JK, LM, FO, and CL designed the transgenic mouse and all experiments. JK and LM performed the experiments, analyzed the data and wrote the manuscript. GZ performed GZ was employed by Medres, Cologne, Germany. AC was employed by Percuros BV, Enschede, Netherlands. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."} +{"text": "The purpose of this paper is to measure income-related health inequality among middle-aged and elderly patients with diabetes in China from 2011 to 2015 and to investigate factors that might be related to this inequality.The data for this study were obtained from the China Health and Retirement Longitudinal Study that was carried out in 2011, 2013 and 2015. In total, 48,519 Chinese middle-aged and elderly population were included . A principal component analysis was performed to measure asset-based economic status. The concentration index was used to measure income-related inequality in patients with diabetes. Additionally, by used generalized linear model, we decomposed the concentration index to identify factors that explained wealth-related inequality in patients with diabetes.The prevalence of self-reported diabetes among middle-aged and elderly Chinese was 5.61, 7.49 and 8.99% in 2011, 2013 and 2015, respectively. The concentration indices and 95% confidence intervals for diabetes were 0.1359 (0.0525\u20130.0597), 0.1207 (0.0709\u20130.0789), 0.1021 (0.0855\u20130.0942) in 2011, 2013, and 2015, respectively, which are indicative of inequality that favors the rich. The decomposition of the concentration index showed that residence (39.38%), BMI (31.16%), education (7.28%), and region (6.09%) had positive contributions to the measured inequality in diabetes in China in 2015. Age (\u2212\u200929.93%) had a negative contribution to inequality.The findings confirm a health inequality in diabetes that favor the rich. Furthermore, the inequality declined from 2011 to 2015. We suggest that policy and intervention strategies should be developed to alleviate this health inequality, such as narrow the gap between urban and rural areas by improving the urban-rural medical insurance scheme, implementing strategies to enhance hygiene health education, control obesity rate. Diabetes is a significant public health issue, which adversely influence the lives of millions of individuals global . In ChinA number of recent studies have demonstrated that socioeconomic status (SES) is the most decisive factor affecting health \u20136. A relAlthough there is a study that evaluated influence factors and inequality with respect to the prevalence of diabetes , there in\u2009=\u20091104, 6.7%). After excluding missing values, there is no statistical difference in the basic characteristics of the sample, which does not affect the representativeness of the sample.The data of this study is from the China Health and Retirement Longitudinal Study (CHARLS), which is a national panel data set, conducted by China Center for Economic Research of Peking University . The CHAEach new survey respondent was queried, \u201cHave you ever been diagnosed with diabetes by a doctor?\u201d In follow-up interviews, participants were asked, \u201cOur records from your last interview show that you have had/not had diabetes, is this right?\u201d and \u201chave you been diagnosed with diabetes by a doctor since your last interview in the last 2 years?\u201d Participants recorded yes or no responses to all questions. Respondents who answered \u201cyes\u201d to any questions were required to provide medical or hospital records. People who answered\u201cyes\u201d were classified as having diabetes.Ten categories of factors, which may be related to the prevalence of diabetes were used in this study , includiTo measure inequalities in the prevalence of chronic disease among people with different standards of living, data on household assets and housing characteristics were used to construct a proxy index to measure living standards . In thisAi for individual i is defined as follows:Principal component analysis (PCA) was used to measure the SES of households. PCA is a standard factor analysis method used to describe variation in a set of variables as linear combinations of the original variables, in which each continuous linear combination is derived, to explain variation in the original data as much as possible, while being uncorrelated with other linear combinations . To perfy is whether an individual has diabetes, \u03bc represents the mean of the prevalence of diabetes, and r represents the fractional rank of income distribution.The CI was used to quantify income-related disparity in the self-reported prevalence of diabetes. The scope of CI was \u2212\u20091 to 1, where 0 represents no income-related inequality. A positive CI means that health inequality is more pronounced among rich people; a negative CI means that health inequality is more pronounced among poor people . The forGLM with a binomial distribution and an identity link, which was used to decompose the CI to obtain the contribution rate of each influencing factor to diabetes health inequality, as Y is a binary variable. The GLM is an extension of the linear modelling process that allows models to be fitted to data that follow probability distributions other than the normal distribution, such as the binomial distribution . The linXk as the socioeconomic factor related to diabetes prevalence. Thus, the linear regression analysis model of diabetes prevalence and related factors is as follows [Y denotes the prevalence of self-reported diabetes; the Xk are related to socioeconomic factors, and \u03b5i is the error term.The CI was decomposed to determine the selected contributors to inequality in diabetes. In this study, we defined follows :\\documeXk; CIk is the CI for Xk; and GCI\u03b5 is the generalized CI for the error term \u03b5.The CI may consist of contributions of individual factors to diabetes prevalence inequality. Each contribution is the product of the sensitivity of diabetes prevalence related to the factor and the degree of inequality in that factor. The CI decomposition was calculated as follows :\\documeAll data preparation and analyses were performed in SAS version 9 . The CI and the 95% confidence interval were calculated using the bootstrap method. Furthermore, concentration curves in Fig.\u00a0The demographic characteristics in Table\u00a0P\u2009<\u20090.05). The estimated coefficients for the urban variable in 2011, 2013, and 2015 are 0.0229, 0.0312, and 0.0318, respectively, which suggests that urban dwellers are more likely to develop diabetes than their rural counterparts. The estimated coefficients of education for 2011, 2013, and 2015 are \u2212\u20090.0108, \u2212\u20090.0131, and\u2009\u2212\u20090.0109, respectively, which suggests that a higher education level is associated with a reduced likelihood of diabetes. The values of the estimated coefficients of urban and BMI suggest that the inequality increased over time. The coefficients of income were 0.0029 and 0.0036 in 2011 and 2013, respectively; however, for 2015, it was \u2212\u20090.0041.The regression results are presented in Table\u00a0In 2015, the majority of the observed inequalities in the prevalence of self-reported diabetes among middle-aged and elderly adults can be positively attributed to urban 39.38%), BMI (31.16%), education (7.28%), central and eastern region (6.09%), and married (0.95%) was adopted, and the GLMs with binomial distribution and identity link was used to decompose the CI to obtain the contribution rate of each influencing factor. GLM method can generate effective estimates that do not change with the selection of the reference group, so as to obtain the stable contribution rate of each influencing factor to determine the contribution degree of various factors to health inequality.n\u2009=\u20091104, 6.7%). Furthermore, we compared the deleted data with the remaining data and found no significant differences in their characteristics. Therefore, missing data not enough to affect the proportion of missing data in the study was low, and did not affect the objectivity and correctness of the overall results. Third, the data we utilized is based on self-reports of diabetes, no distinction between types of diabetes. However, type 2 diabetes accounts for about 90% of diabetic patients. Therefore, the results of this study are objective. Finally, whether patients with diabetes used anti-diabetic medications was not considered in this study, which might result in some biases.This study also has several limitations. First, we used a subjective evaluation indicator of self-reported health instead of objective indicators such as clinical examination, the true diabetes prevalence might have been underestimated to some extent. Because of the inadequate understanding of health status in a self-assessment questionnaire, some people with diabetes do not know that they have diabetes. Second, a percentage of our sample of individuals was excluded from the analysis due to missing data. However, the missing data make up a small amount of overall data, participants with missing data were (In conclusion, the findings confirmed a health inequality in diabetes that favor the rich, and the inequality declined from 2011 to 2015. Furthermore, a substantial portion of the inequality was explained by residence, BMI, and education. Thus, to reduce inequality in diabetes, intervention policies should focus on these factors, such as narrow the gap between urban and rural areas by improving the urban-rural medical insurance scheme, strengthen hygiene health education, promote healthy lifestyles to control obesity rate. In addition, the active collaboration of the health system with other social and economic sectors could be an effective strategic policy for overcoming the barriers of socioeconomic inequalities in diabetes."} +{"text": "Rheumatoid arthritis (RA) is an autoimmune disorder with systemic inflammation and may be induced by oxidative stress that affects an inflamed joint. Our objectives were to examine isotypes of autoantibodies against 4-hydroxy-2-nonenal (HNE) modifications in RA and associate them with increased levels of autoantibodies in RA patients.1211\u20131230, haptoglobin (HPT)78\u2013108, immunoglobulin (Ig) kappa chain C region (IGKC)2\u201319, and prothrombin (THRB)328\u2013345, were re-analyzed using tandem mass spectrometric (MS/MS) spectra (ProteomeXchange: PXD004546) from RA patients vs. HCs. Further, we determined serum protein levels of CFAH, HPT, IGKC and THRB, HNE-protein adducts, and autoantibodies against unmodified and HNE-modified peptides. Significant correlations and odds ratios (ORs) were calculated.Serum samples from 155 female patients were obtained. Four novel differential HNE-modified peptide adducts, complement factor H (CFAH)78\u2212108 HNE, IgM anti-IGKC2\u221219, and IgM anti-IGKC2\u221219 HNE may be considered as diagnostic biomarkers for RA. Importantly, elevated levels of IgM anti-HPT78\u2212108 HNE, IgM anti-IGKC2\u221219, and IgG anti-THRB328\u2212345 were positively correlated with the disease activity score in 28 joints for C-reactive protein (DAS28-CRP). Further, the ORs of RA development through IgM anti-HPT78\u2212108 HNE , IgM anti-IGKC2\u221219 , and IgG anti-THRB328\u2212345 showed an increased risk. Lastly, we incorporated three machine learning models to differentiate RA from HC and OA, and performed feature selection to determine discriminative features. Experimental results showed that our proposed method achieved an area under the receiver operating characteristic curve of 0.92, which demonstrated that our selected autoantibodies combined with machine learning can efficiently detect RA.Levels of HPT in RA patients were greatly higher than the levels in HCs. Levels of HNE-protein adducts and autoantibodies in RA patients were significantly greater than those of HCs. IgM anti-HPT78\u2212108 HNE, IgM anti-IGKC2\u221219, and IgG anti-THRB328\u2212345 may play heavy roles in RA development.This study discovered that some IgG- and IgM-NAAs and anti-HNE M-NAAs may be correlated with inflammation and disease activity in RA. Moreover, our findings suggested that IgM anti-HPT Rheumatoid arthritis (RA) is an autoimmune disorder with systemic inflammation and may be induced by oxidative stress that affects inflamed joints . Age, seHNE has two reactive electrophilic groups, an aldehyde group and an alkene bond, and can react with residues in amino acid. The C\u2009=\u2009C double bond in HNE can be targeted via Michael addition and has a mass addition at 156\u00a0Da in its non-reduced form or 158\u00a0Da in its reduced form (CHKRQ) \u201313. The . indicated that HNE-protein adducts present OSEs and are excellent immunogens to induce autoantibodies were obtained from the Division of Allergy, Immunology, and Rheumatology, Department of Internal Medicine and the Department of Laboratory Medicine, Shuang-Ho Hospital . Patients with RA had received a diagnosis from a rheumatologist and followed the appropriate criteria for classification\u2014either the 2010 American College of Rheumatology (ACR)/European League Against Rheumatism classification criteria or 1987 http://www.uniprot.org/) containing 157,433 protein entities , and those sequences are shown in Additional file 3, and b-H2O ions. Details are provided in the \"Additional file The Peaks PTM module of PEAKS 7 software (Bioinformatics Solutions) was used to identify sequences of HNE-modified peptide from acquired MS/MS spectra against the Universal Protein Resource Knowledgebase, a human protein database . All sam1211\u22121230, HPT78\u2212108, IGKC2\u221219, and THRB328\u2212345. HNE-modified peptides, marked as CFAH1211\u22121230 HNE, HPT78\u2212108 HNE, IGKC2\u221219 HNE, and THRB328\u2212345 HNE, were prepared using HNE [1211\u22121230 HNE and HPT78\u2212108 HNE were reductively stabilized using NaBH4 [Polypeptides were synthesized and used in the ELISA . UnmodifGermany) . Then, Ct-test. A one-way analysis of variance (ANOVA) was used to examine levels of autoantibody isotypes against unmodified and HNE-modified peptides between RA and OA patients and HCs. Scheffe\u2019s post-hoc test was applied to evaluate the difference of mean between any two groups, as well as a post-hoc test using the Bonferroni method with a 0.0167 adjusted significance level. We used GraphPad Prism to evaluate differences in Student's t-test between groups, correlations between measurements, and generated receiver operating characteristic (ROC) curves to evaluate the diagnostic performance of autoantibodies. Pearson\u2019s or Spearman\u2019s rank correlation coefficients were used to assess correlations among different parameters. To estimate multivariate-adjusted odds ratios (ORs) and their 95% confidence intervals (CIs) for RA risk, Logistic regression models were performed in this study. The positivity of autoantibody isotypes and HNE-protein adducts was decided by ROC curves. The cut-off value for an ROC curve was determined by Youden index, which represents the sum of sensitivity and 1-specificity, and the maximum value of Youden index is the suitable cut-off point for that curve. Pair-wise comparisons of ROC curves were assessed using MedCalc Statistical Software . One-way ANOVA and power were determined using SAS , and power estimations were calculated according to the ROC analysis. The area under the ROC curve (AUC), sensitivity, and specificity were calculated at a 95% confidence level. The significance level of all statistical tests was set to p\u2009<\u20090.05. For feature selection, we first used \u2018Information Gain\u2019 as the attribute evaluator with \u2018Ranker\u2019 as the search method in WEKA (version 3.8) [The significance of blot densitometric differences, and levels of serum proteins and HNE-protein adducts were determined using Student's ion 3.8) to selecion 3.8) , random ion 3.8) , and supion 3.8) in scikiion 3.8) . Paramet1211-SHTLRTTCWDGKLEYPTCAK-1230 and HCs and HCs , and HCs by 1.32-fold higher (p\u2009=\u20090.0001) and 1.26-fold (p\u2009=\u20090.0003) greater in patients with RA than the levels in OA patients and HCs and 1.35-fold (p\u2009=\u20090.0002), respectively greatly higher in RA patients than HCs , while RA patients versus HCs was 3.83-fold higher (p\u2009<\u20090.0001) and HCs and HCs by 1.46-fold (p\u2009=\u20090.0002) and HCs by 2.48-fold (p\u2009<\u20090.0001) and 2.12-fold (p\u2009<\u20090.0001) greater in RA patients than in OA patients and HCs, respectively and HCs and 1.35-fold (p\u2009<\u20090.0001) greater in RA patients than in OA patients and HCs and 1.52-fold (p\u2009<\u20090.0001) greater in RA patients than in OA patients and HCs, respectively , IgM anti-IGKC2\u221219 , and IgG anti-THRB328\u2212345 . RF vs. autoantibodies exhibited significant positive correlations, including IgM anti-HPT78\u2212108 HNE , IgM anti-IGKC2\u221219 , IgM anti-IGKC2\u221219 HNE , IgG anti-THRB328\u2212345 , IgG anti-THRB328\u2212345 HNE , and IgM anti-THRB328\u2212345 HNE . Anti-CCP versus autoantibodies exhibited significant positive correlations, including IgG anti-HPT78\u2212108 HNE and IgG anti-THRB328\u2212345 HNE . ESR vs. autoantibodies exhibited significant positive correlations, including IgM anti-IGKC2\u221219 , IgM anti-IGKC2\u221219 HNE , and IgM anti-THRB328\u2212345 HNE . Moreover, HNE-protein adduct vs. autoantibodies exhibited significant positive correlations, including IgM anti-IGKC2\u221219 and IgM anti-IGKC2\u221219 HNE . However, autoantibodies exhibited significant negative correlations between DAS28-CRP scores, including IgG anti-IGKC2\u221219 and IgG anti-IGKC2\u221219 HNE . HNE-protein adducts vs. IgM anti-THRB328\u2212345 had a significantly negative correlation. Otherwise, there were no significant correlations between CRP and the other autoantibodies in patients with RA. In Table 1121\u22121230 , IgG anti-CFAH1121\u22121230 HNE , IgM anti-CFAH1121\u22121230 , IgM anti-CFAH1121\u22121230 HNE , IgM anti-HPT78\u2212108 , IgM anti-HPT78\u2212108 HNE , IgG anti-IGKC2\u221219 , IgM anti-IGKC2\u221219 HNE , IgM anti-IGKC2\u221219 , IgM anti-IGKC2\u221219 HNE , IgG anti-THRB328\u2212345 , IgG anti-THRB328\u2212345 HNE , and IgM anti-THRB328\u2212345 HNE . IgM anti-IGKC2\u221219 carried the highest risk of RA also demonstrated a high risk of RA development , IgM anti-IGKC2\u221219(HC vs. RA 0.2967), and IgM anti-IGKC2\u221219 HNE (HC vs. RA 0.2921) showed discriminative power in identifying RA patients from HC and OA patients and pathogenic autoantibodies (IgG\u2009>\u2009IgM\u2009>\u2009IgA) [. proved that inhibition of Toll-like receptor (TLR) and IgG-immune complex-mediated inflammatory responses mediate anti-inflammatory features of IgM-NAAs [1211\u22121230, HPT78\u2212108, IGKC2\u221219, and THRB328\u2212345 . HoweverM\u2009>\u2009IgA) . FurtherM\u2009>\u2009IgA) , 52. CheIgM-NAAs . MoreoveIgM-NAAs , 54, and. reported that complement activation contributes to the pathological process of RA [. indicated that CFAH is able to bind MDA, and as an MDA-binding protein, it blocks the proinflammatory effects that induced by MDA in vivo in mice [. identified three linear epitopes on serum CFAH in atypical hemolytic uremic syndrome (aHUS) [1211\u22121230 is also an autoantigen in RA , IgG anti-CFAH1121\u22121230 HNE (OR 2.808), IgM anti-CFAH1121\u22121230 (OR 5.204), and IgM anti-CFAH1121\u22121230 HNE (OR 2.700) showed risks for RA development . Interes0 OR 5.20, and IgM. indicated that serum HPT was an acute-phase protein and significantly correlated with disease activity in patients with RA [78\u2013108 in RA patients (Table . reported that the level of the anti-HPT antibody in serum increased and the level of HPT decreased after febrile non-hemolytic transfusion reactions (FNHTRs) [p\u2009=\u20090.041) in RA patients than in HCs and RF (r\u2009=\u20090.614), and IgG anti-HPT78\u2212108 HNE was greatly positively correlated with anti-CCP (r\u2009=\u20090.2782), but IgG anti-HPT78\u2212108, IgG anti-HPT78\u2212108 HNE, and IgM anti-HPT78\u2212108 were not significantly correlated with DAS28-CRP, RF, anti-CCP, CRP, ESR, or HNE-protein adducts (Table 78\u2212108 (OR 2.695) and IgM anti-HPT78\u2212108 HNE (OR 5.235) exhibited a risk of RA development (Table HPT is a hemoglobin-binding protein that can prevent oxidative damage to organs and participates in activating innate and adaptive immune responses . Increas with RA . In this(FNHTRs) . In thisHCs Fig.\u00a0b. IgG anHCs Fig.\u00a0e\u2013h. Thusr\u2009=\u20090.270 and RF (8 OR 2.69 and IgM . found that the human regulatory RF (regRF) can be induced by the hinge region of Fc fragments of homologous IgG and can prevent rheumatic diseases [2\u221219, which is located on the IgG light chain in RA patients , RF (r\u2009=\u20090.5674), ESR (r\u2009=\u20090.2692), and HNE-protein adducts (r\u2009=\u20090.2667). However, IgM anti-IGKC2\u221219 HNE was significantly correlated with RF (r\u2009=\u20090.5404), ESR (r\u2009=\u20090.2985), and HNE-protein adducts (r\u2009=\u20090.2709) (Table 2\u221219 (r\u2009=\u2009\u2212\u20090.3538) and IgG anti-IGKC2\u221219 HNE (r\u2009=\u2009\u2212\u20090.3432) were significantly negatively correlated with DAS28-CRP (Table 2\u221219 (OR 4.679), IgG anti-IGKC2\u221219 HNE (OR 3.206), IgM anti-IGKC2\u221219 (OR 12.665), and IgM anti-IGKC2\u221219 HNE (OR 8.095) showed risks for RA development region of IgG that, via antigenic stimulation, acts against an abnormal immune response from the host\u2019s natural antibody repertoire . The IgMdiseases . RF proddiseases , 68. In HCs Fig.\u00a0i\u2013l. Thus9) Table . Interes r\u2009=\u2009\u2212\u20090.538 and Ir\u2009=\u20090.567, ESR and SLE [328\u2013345 in RA patients were identified and RF (r\u2009=\u20090.6140), IgG anti-THRB328\u2212345 HNE was significantly positively correlated with RF (r\u2009=\u20090.3072) and anti-CCP (r\u2009=\u20090.2549), IgM anti-THRB328\u2212345 HNE was greatly positively correlated with RF (r\u2009=\u20090.2845) and ESR (r\u2009=\u20090.2597), but IgM anti-THRB328\u2212345 was significantly negatively correlated with the HNE-protein adduct (r\u2009=\u2009\u2212\u20090.2796) as shown in Table 328\u2212345 (OR 5.761), IgG anti-THRB328\u2212345 HNE (OR 9.542), and IgM anti-THRB328\u2212345 HNE (OR 5.043) exhibited risks for RA development , and patients with osteoarthritis (OA) and rheumatoid arthritis (RA).Additional file 2: Fig. S1. Differential 4-hydroxy-2-nonenal (HNE)-modified peptide adducts were re-analyzed through PEAKS 7 using previous MS/MS spectra (ProteomeXchange: PXD004546). Acquired MS/MS spectra were obtained through pooled concanavalin (Con) A-captured serum proteins (nine rheumatoid arthritis (RA) and nine healthy control (HC) pooled samples), 1-D SDS-PAGE, in-gel digestion, and nano-LC-MS/MS (A). HNE reacts with amino acid residues of proteins to form HNE-protein adducts by Michael addition and Schiff base adducts, respectively (B). Representative MS/MS spectrum of the 1211-SHTLRTTCWDGKLEYPTCAK-1230 peptide sequence and the modified peptide bearing an HNE modification at the K1230 residue in RA patients (C). A representative MS/MS spectrum of the peptide sequence 78-AVGDKLPECEADDGCPKPPEIAHGYVEH SVR-108 and the modified peptide bearing the HNE modification at the C92 residue in RA patients (D). The MS/MS spectrum 2-TVAAPSVFIFPPSDEQLK-19 and the modified peptide bearing the HNE modification at the A5 residue in RA patients ; 2-TVAAPSVFIFPPSDEQLK-19 and the modified peptide bearing the HNE modification at the A4 residues in RA patients and HCs . Representative MS/MS spectrum of 328-TFGSGEADCGLRPLFEKK-345 and the modified peptide bearing the HNE modification at the K344 residue in RA (F). The MS/MS spectrum 284-HRTGDEITYQCRNGFYPATRGNTAK-308 and the modified peptide bearing the HNE modification at the K308 residue in HCs (G). A representative MS/MS spectrum of the peptide sequence 162-ILGGHLDAK-170 and the modified peptide bearing the HNE modification at the A169 residues in HCs (H). Representative MS/MS spectrum of 83-VYACEVTHQGLSSPVTKSFNR-103 and the modified peptide bearing the HNE modification at the Q91 residue in HCs (I). The MS/MS spectrum 328-TFGSGEADCGLRPLFEK-344 and the modified peptide bearing the HNE modification at the C336 and L341 residues in HCs (J).Additional file 3. Supplementary methods.Additional file 4: Fig. S2. Comparison of receiver operating characteristics (ROC) curves from unselected features and selected features in (A) decision tree, (B) random forest classifier, and (C) support vector machine classifier.Additional file 5: Table S2. Sequences of unmodified and 4-hydroxy-2-nonenal (HNE)-modified peptides."} +{"text": "This thesis aimed to elucidate the role of informal caregiver subjective well-being in explaining formal long-term care service (LTCS) use. A systematic review and meta-analysis of literature found that elevated caregiver burden, caregiver depression, and poorer caregiver health status are associated with increased formal LTCS use. Quantitative analyses of longitudinal data collected from stroke survivors and their caregivers revealed that increased caregiving burden and caregiver depression are prospective and concurrent predictors of stroke rehabilitation use at 12-month post-stroke, and that non-distressed caregivers at 3-month post-stroke and 12-month post-stroke are likely to have cared for stroke rehabilitation users at 12-month post-stroke. Lower than expected formal long-term healthcare service demand and unrelenting deleterious effects of informal caregiving on caregivers\u2019 subjective well-being are evolving socioeconomic issues faced by many urban societies. These phenomena run counter to the needs of ageing populations, that presents challenges of a rise in chronic degenerative illnesses and long-term disabilities, and associated crowding at acute treatment facilities. The limited effectiveness of simply increasing formal long-term care service (LTCS) supply to meet these challenges has led to an expansion of demand-influencing strategies, which involve health and social care integration. This thesis aimed to elucidate the role of informal caregiver subjective well-being in explaining formal LTCS use.Study 1 conceptualized informal caregiver subjective well-being as caregiver psychosocial needs, and asked if these needs are associated with formal LTCS use 1. Study 23Due to equivocal literature on the topic, a systematic review and meta-analysis of reported empirical data of moderate to high quality sampled from 31 journal articles and six theses was conducted. Study 1 found that research studies that involved fewer than 70% female informal caregivers reported 86% higher odds of caregivers experiencing higher depression levels associated with LTCS use by patients. Studies involving nursing homes reported 70% lower odds of caregivers experiencing higher burden associated with LTCS use. That only two non-USA studies contributed to the finding of 50% lower odds of caregivers experiencing poorer health status in relation to LTCS use suggest that a confirmation of this finding was required. That elevated burden and depression and poorer health status of the informal caregiver indicated a need for LTCS use beg an examination of their importance in influencing LTCS use in the presence of other known factors.Using a longitudinal Singapore sample of stroke survivors and their primary informal caregivers, Study 2 showed that caregiver depression and caregiving burden were concurrent and prospective predictors of LTCS use, respectively. With other known factors controlled for, caregivers who experienced more burden at 3-month post-stroke, and those who were more depressed at 12-month post-stroke were respectively found to be 4% and 12% more likely to have cared for stroke rehabilitation users at 12-month post-stroke. Using the same sample, Study 3 showed that caregiver burden, depression and health status were useful indicators of psychosocial health latent profiles that differed regarding LTCS use. After controlling for other factors, non-distressed caregivers at 12-month post-stroke were found to have greater likelihood of having cared for stroke rehabilitation users at the same time point. Stroke rehabilitation users at 3-month post-stroke tended to continue using rehabilitation at 12-month post-stroke only when their caregivers were not distressed at 3-month post-stroke, but not when their caregivers were distressed. Distressed caregivers at baseline had a 24% probability of remaining distressed at 12-month post-stroke.This thesis shows that informal caregiver characteristics should be distinguished from patient characteristics, and that they individually and collectively explain LTCS use. It challenges assumptions of the established Behavioural Model of Health Services Use , that seThis thesis provides evidence that supports the premise that formal LTCS use decisions are made by the caregiver-patient dyad, rather than by the individual patient 89. It ch8This thesis suggests the possibility of a coexistence of positive and negative caregiving experiences by finding that caregiver depression was predictive of stroke rehabilitation use at 12-month post-stroke in Study 2, but that non-distressed caregivers were more likely to have cared for rehabilitation users at 12-month post-stroke in Study 3. A depressed caregiver may not experience distress due to resilience , effectiThe probabilities of transition between distressed and non-distressed caregiver profiles over a 12-month duration found indicate the importance of integrating caregiver assessment early in the care continuum, such as during a patient\u2019s hospital discharge planning and referral to community-based care. These transition probabilities also suggest the importance of incorporating and sustaining caregiver education and intervention as part of community-based care [https://hdl.handle.net/10356/139476.The results presented in this article are based on the author\u2019s thesis presented at Nanyang Technological University, Singapore, on 4 May 2020. The full text is available from"} +{"text": "Following the publication of this article , concernThe bands presented in Fig 6A appear to have been spliced from the underlying gel and arranged into Fig 6A as presented in the published article. The preparation and presentation of the bands raises concerns regarding the reliability of the data presented in the published figure. The authors have informed the journal that the uncropped blots for Fig 6A are no longer available.The authors have indicated that the original data underlying other results from this study are also not available. In light of this, the article is not in compliance with the journal\u2019s Data Availability policy in place at the time of the article\u2019s publication.PLOS ONE Editors issue this Expression of Concern to notify readers of the unresolved concerns pertaining to the reliability of the data presented in Fig 6A and the unavailability of underlying data to support the results presented in the article.The"} +{"text": "Lactobacillus plantarum, x3\u20103b L. plantarum, 30x\u201011 Staphylococcuspentosans, and 37x\u20108 S. pentosans), during storage of room temperature (20\u00b0C) and refrigeration storage (4\u00b0C). Tryptamine (TRM), 2\u2010phenylethylamine (PHE), putrescine (PUT), cadaverine (CAD), histamine (HIM), and tyramine (TYM) contents of all samples were increased storage at 20\u00b0C, and the content of TRM, PUT, CAD, and HIM of all samples storage at 20\u00b0C was higher than that storage at 4\u00b0C after 42\u00a0days. The content of BA with 37x\u20106, x3\u20103b, and 37x\u20108 was obviously decreased at 4\u00b0C storage. The storage temperature has a significant effect on BA content (p\u00a0<\u00a0.05) for TYM and other BAs tested. Finally, x3\u20103b, 37x\u20106, and 37x\u20108 should be used to produce fermented sausages on the basis of the concentration of BAs.The biogenic amines (BAs), water activity, pH, thiobarbituric acid\u2010reactive substances (TBARS), and nitrite were, respectively, tested in dry fermented sausage with starter cultures (37x\u20106 In summary, the effect of the storage temperature and starter culture on BAs content was significant, the starter culture of x3\u20103b, 37x\u20106, and 37x\u20108 and low temperature storage would be optimum for producing and storing fermented sausage regarding biogenic amine concentrations. Other parameters that might provide further information on the product under study were also determined.The aim of the present work was to study the effect of different starter culture of 30x\u201011 22.1S. pentosans, 37x\u20106 L. plantarum, 37x\u20108 S. pentosans, and x3\u20103b L. plantarum were isolated from fermented beef jerky from Mongolian and fermented sausage from Meat Laboratory . All of the meat and fat were weighed in advance and cut. Five different sample groups of fermented mutton sausages were produced with various of starter cultures. (a) CO: without starter culture; (b) 30x\u201011: with 30x\u201011 Pentose Staphylococcus; (c) 37x\u20106: with 37x\u20106 L. plantarum; (d) 37x\u20108: with 37x\u20108 Staphylococcus pentosae; and (e) x3\u20103b: with x3\u20103b L. plantarum.The materials used including raw meat from the hindquarter of sheep and fat from the tail of sheep in this research obtained from Bayannur City were directly transferred to Meat Laboratory . Standard amines, containing TRY, PHE, PUT, CAD, HIS, SPD, and TYR, were purchased from Sigma, acetonitrile, acetone, n\u2010hexane, acetic acid and ammonium acetate , other chemicals used were of analytical grade. 30x\u201011 The sausage was prepared according to the following formulation lean mutton meat (90% w/w), fat (10% w/w), sucrose (0.5% w/w), sodium nitrate (0.01% w/w), trite (0.007% w/w) glucose (0.5% w/w), and starter (2% w/w) that was calibrated with 4.01, 6.86, and 9.18 pH solutions. 36\u00a0ml of distilled water was added to 4\u00a0g of each sample, stirred for 30\u00a0min, and pH values were measured. Water activity was determined with a moisture activity meter .2.2.2Colors of fermented sausages were tested using a Chroma Meter HPC\u2010226 which was standardized with a white plate. Color was showed as L* (brightness/darkness), a* (greenness/redness), b* (blueness/yellowness), and e (chromatic aberration parameter).2.2.3The content of TBARS was determined to assess the lipid oxidation levels in fermented sausages storage at different temperatures, using the method of Sinnhuber and Yu . Simply,2.2.4The content of nitrite was tested to assess the safety of fermented sausages storage at different temperatures, using the method of GB 2.2.5The content of BAs in sausages was determined with reference to GB 2.2.6p\u00a0<\u00a0.05. Correlations between variables were determined by correlation analyses using the Pearson linear correlation coefficient with the above statistical software package.Excel and SPSS 18.0 software were used for data statistics and significant difference analysis. The obtained data were analyzed by the general linear model procedure considering treatment as the main effect. Means were compared using Duncan's multiple range test, with a significance of 33.1w and pH determinations are reported during storage of all samples at four starter cultures and two storage temperatures are listed in Table\u00a0w values was small and the low of change was not obvious. The free degree of water in sausage was high and the combination degree with sausage was low storage at 4\u00b0C, so the aw values were higher than storage at 20\u00b0C, which indicated that the storage temperature had a big impact on the aw values of fermented mutton sausage.The results for ar\u00a0=\u00a0.337, p\u00a0<\u00a0.05), PUT , CAD , HIM , SPD , and total amine contents . The pH values of sausage stored at 20\u00b0C are slightly lower than that sausage stored at 4\u00b0C at 21th day of storage. This pattern of pH values was similar with the study on sausage production of Peng, Wu, Jia, and Tang from the 21th day to the 63th of storage at 4\u00b0C. In the whole storage process, the a* value of the experimental group was always greater than that sample CO, and there was a significant difference between the four groups of sausages (p\u00a0<\u00a0.05), which indicated that addition of starter cultures could effectively improve the a* value of fermented sausages. A different trend was noted for b* value in the whole storage process, which indicate that starter cultures have no significant effect on b* value in color difference (p\u00a0>\u00a0.05).The color values of fermented sausages are shown in Table\u00a0p\u00a0<\u00a0.05). It showed that the starter can effectively improve the color of fermented mutton sausages, which is the same as the research results of Lorenzo, G\u00f3mez, and Fonseca were found between content of total BAs and PUT. Throughout the whole storage process, it can be seen intuitively from the figure that the content of PUT in sausage stored at room temperature was always higher than that in cold storage for all samples. It can be seen that the storage temperatures have great influence on the content of PUT. It is possible that the growth and reproduction of most microorganisms are limited, their metabolic capacity is reduced, and the accumulation of PUT is relatively reduced during low\u2010temperature storage. This is due to the slow metabolism of bacteria and low enzyme activity at low temperature, so the yield of amines is very small for BAs tested during the storage. In addition, the pH value of the treatment groups was significantly below the content of sample CO (p\u00a0<\u00a0.05), the a* value of the treatment groups was greater than that of sample CO (p\u00a0<\u00a0.05), but the water activity value, L* and b*of each group, had no significant difference (p\u00a0>\u00a0.05). The producer should select appropriately the starter cultures to reduce the content of BA in fermented sausages. Consumers should store fermented sausages in refrigerated conditions. Products stored at room temperature may produce more BAs. It is suggested that legislators should establish the limit of BA content in fermented sausage.In our study, different amounts of BAs can be produced in different groups under the influence of four starter cultures. In terms of decarboxylase activity, x3\u20103b, 37x\u20106, and 37x\u20108 are declared negative and 30x\u201011 was positive. The content of BAs with 37x\u20106, x3\u20103b, and 37x\u20108 was obviously decreased at 4\u00b0C storage, the content of TRM, PUT, CAD, and HIM of all samples storage at 20\u00b0C was higher than that storage at 4\u00b0C after 42\u00a0days. The effect of temperature was significant (All coauthors declare that they have no conflict of interest.This study does not involve any human or animal testing."} +{"text": "A young bullock cart driver was pushing bulls hard in stunt and frolic. The cart sped up and he lost control and toppled in front of the iron wheel, which ran over his lower limb around the knee. Concomitant hemophilia further complicated the popliteal artery bleed, and the patient succumbed within hours of injury, despite medical aid. Sudden death is rare in congenital or acquired hemophilia. Popliteal artery injuries usually threaten the limb in high-velocity blunt or penetrating trauma in comparison to other peripheral arteries. However, fatality after popliteal artery injury in low-velocity blunt trauma is rare. Bullock cart is a very slow mode of transport. But animals can show unpredictable and aggressive behavior when driven in carts, which poses considerable risk of fatality to driver and occupants if they sustain vascular or regional injuries. As there is scarce literature about bullock cart-related injuries, this paper focuses on bullock cart run-over fatalities and sudden death in young hemophiliacs. Popliteal artery is the main vascular supply of the knee and leg. It is juxtaposed to the femur, tibia, and knee joint and is in a \u201ctethered\u201d position behind the knee and between the adductor hiatus proximally and the soleal arch distally. This makes the vessel relatively fixed, and it rarely\u00a0escapes injury in high-velocity blunt or penetrating trauma, for example, tibial or supracondylar fracture dislocation, gunshot, or stabbing of the leg and knee . Its traSynovial vessels bleed badly after injury in hemophiliacs due to altered coagulation. The synovium gets thickened by default iron absorption in these bleeds because of physiological function. Angiogenesis in thickened synovial lining potentiates further bleeds forming a vicious cycle. The elbows, ankles, and knees are commonly affected joints in hemophiliacs .Arterial injury in hemophiliacs is difficult to treat owing to inadequate coagulation combined with bony deformities due to alternate bleeding and fibrosis . IncreasPoor roads, low economic status of farmers, unaffordable running, and maintenance cost of motorized vehicles are factors making bullock carts socially and culturally the most acceptable mode of transportation in developing countries. Bullock cart races are also organized as sporting events in different parts of the world. However, speed control is a problem in these animal-driven vehicles. This sometimes requires constrained or reflex application of unscientific and dangerous braking methods, putting the life of the rider or occupants in danger.This case presents an alleged history of sustaining run-over injury to the left thigh by the iron wheel of a bullock cart driven by a 21-year-old young hemophiliac, with no other medical comorbidities. A splint was applied and he was immediately referred to a higher center for expert management. Factor VIII value of 3.44% with no autoantibodies revealed him to be a moderate hemophiliac-A. The patient presented in a hypovolemic shock, with swelling and deformity of the left distal thigh and knee, with absent ipsilateral distal pulsations. Doppler of the left lower limb revealed turbulence at the popliteal artery with distal monophasic flow. The case was diagnosed as a closed comminuted distal femoral fracture and patella fracture with proximal tibial fracture of the left side (Figure Factor VIII concentrate and blood was infused owing to falling hemoglobin and hematocrit levels. However, the patient succumbed to his injuries within 24 hours.The external fixator was removed before autopsy, and extensive bruising of the left lower limb over the knee and superolateral aspect of the thigh was seen Figure .Stitch removal at the popliteal fossa showed extensive effusion in both heads of gastrocnemius and tissues. Polypropylene 6-0 interrupted sutures were present over the anterior wall at the distal end of the popliteal artery in upper third just before bifurcation. The removal revealed corresponding rents of size 0.4 \u00d7 0.3 cm and 0.7 \u00d7 0.5 cm (Figure Internal organs were pale. The spleen was enlarged. Death occurred due to hemorrhagic shock upon blunt force trauma to the popliteal artery in a hemophiliac.Sports, traffic, or falls cause disruptions and occlusions of the popliteal artery posing risk to the limbs, which become more frequent with age with a male predominance owing to more outdoor pursuits . VasculaClinching cases of popliteal artery injury complicating amputation following blunt trauma knee without dislocations or limb Mortality is associated with penetration causing early hemorrhagic shock from the injured proximal arterial segment. In contrast, early limb loss is more common with blunt distal vascular injury of popliteal and tibial arteries. However, hemophilia complicating death following blunt injury due to fracture of the knee joint with associated popliteal injury is quite rare and has not been reported before. A hemophiliac road traffic accident victim died on the sixth day due to head injury and retroperitoneal hematoma despite successful limb revascularization for blunt trauma to the knee .The bullock cart is a relatively slow moving vehicle. There is astonishingly scant literature describing bullock cart-related accidental strangulation , impact A three-year-old boy accompanying his father on a bullock cart slipped and was crushed to death after being run over by a cart wheel .\u00a0A rare The hemophiliac patient sustaining blunt trauma succumbed to hemorrhagic shock owing to popliteal artery injury, despite optimum surgical management instituted on time. Catastrophic bleeding through any other viscera, especially an enlarged spleen, though present in this case, was ruled out.\u00a0Thrombosis, otherwise less common in comparison to injuries of intima and media in hemophiliacs vis-\u00e0-vis the normal population, would have substituted death with amputation by default in the present case if the patient would not have been a hemophiliac. Similar blunt trauma with coexistent hemophilia causing sudden unexpected death has not been reported. The mode and setting of sustaining trauma in low-velocity bullock cart vehicular accident is highly unusual.Surgeons need to have a high index of suspicion to diagnose arterial injury and bleeding disorder unless proven otherwise in blunt lower extremity trauma. A simple, fast, and inexpensive test to estimate bleeding and clotting time can rule out various coagulopathies and save lives. Because award of punishment may become complicated in sudden unexpected deaths in hemophiliacs, medicolegal opinion should be furnished in light of a thorough review of clinical records. Forensic pathologists carry the utmost responsibility to explain aggravation of the nature of injury sustained either accidentally or intentionally in those with pre-existing conditions."} +{"text": "Despite its proven effectiveness and safety profile, the XEN Gel Stent has a small lumen and is therefore likely to become occluded by fibrin, a blood clot, or even the iris. However, few studies have investigated XEN-iris occlusion and how to manage this condition. We describe the first case report of recurrent XEN gel stent obstruction by iris incarceration, which was resolved following a combined treatment with argon laser peripheral iridoplasty (ALPI) and low-energy neodymium-doped yttrium aluminum garnet (Nd: YAG) laser shock wave treatment.A 74-year-old Korean male underwent uncomplicated XEN gel stent implantation and presented with low intraocular pressure (IOP) with a well-functioning filtering bleb during the first postoperative week. On postoperative day 10, the XEN lumen was occluded by the iris and demonstrated an IOP spike of 33\u200ammHg. Despite the use of pilocarpine, the iris incarceration persisted. Therefore, surgery to reposition the XEN stent was attempted using a gonio-prism and intraocular forceps. After the first revision surgery, the IOP and stent position were stable for 2 weeks. However, recurrent partial obstruction of the stent by the iris, pigment dispersion into the intraluminal space, and an elevated IOP of 24\u200ammHg were observed later.Recurrent XEN gel stent occlusion by the iris and intraluminal pigment dispersion.Combined ALPI and low energy Nd: YAG laser shock wave therapy.IOP dropped from 24\u200ammHg to 10\u200ammHg immediately and continued to be well-controlled until 3 months later (range: 8\u201312\u200ammHg).To the best of our knowledge, this is the first case report of the efficacy of combined laser treatment for relieving recurrent XEN implant occlusion by the iris. This combination laser treatment might be a relatively safe rescue treatment to restore the patency of a XEN gel stent occluded by the iris, even in cases with recurrent XEN stent obstruction after surgical repositioning. The XEN implant decreases intraocular pressure (IOP) by creating a permanent drainage shunt from the anterior chamber (AC) to the subconjunctival space through a scleral channel; many previous studies have demonstrated a reasonable IOP-lowering effect. To minimize the risk of postoperative hypotony, the internal diameter is designated as 45\u200a\u03bcm.,4 Despite its proven effectiveness and safety profile, the XEN gel stent may still become occluded by fibrin, a blood clot, or the iris due to its design with a small internal lumen.\u20138Glaucoma is the leading cause of irreversible vision loss globally.,8 Herein, we describe the first case report of a recurrent XEN gel stent obstruction by a \u201cplug\u201d shaped iris incarceration, which effectively resolved after combined treatment with argon laser peripheral iridoplasty (ALPI) and low energy neodymium-doped yttrium aluminum garnet (Nd: YAG) laser shock wave treatment.To date, few studies have explored XEN-iris occlusion and how it should be managed.2This study adhered to the principles of the Declaration of Helsinki. Written informed consent for the report and photographs were obtained from the patient. This case study was approved by the Institutional Review Board of Daegu Veterans Health Service Medical Center.2.1A 74-year-old Korean male was referred to the Daegu Veterans Health Service Medical Center for progressive loss of vision in his left eye. The patient had been diagnosed with advanced primary open-angle glaucoma. Two years prior to presentation, the patient had undergone uneventful cataract surgery in the left eye at another hospital. He had been receiving maximal medical treatment, including a combination of dorzolamide and timolol , 0.15% brimonidine tartrate , latanoprost , and 250\u200amg acetazolamide 3 times daily. At the time of presentation, his best-corrected visual acuity in the left eye was 20/200, and the IOP in the same eye was 24\u200ammHg. Slit lamp examination revealed a deep and quiet AC and a well-positioned intraocular lens. The cup-to-disc ratio was 0.95, with superior and inferior notching, diffuse retinal nerve fiber layer (RNFL) thinning, and a slightly pale optic disc in the left eye. Visual field testing revealed tunnel vision . Spectral domain optical coherence tomography also demonstrated a generally reduced RNFL thickness was injected with a 30-gauge needle in the supero-nasal quadrant. The intended area of placement in the supero-nasal quadrant, which was 3\u200amm from the limbus, had previously been marked. Next, the ab-interno XEN gel stent was implanted using a mirrored goniolens following the rule of 1\u200amm in the AC, 2\u200amm tunneled through the sclera, and 3\u200amm in the subconjunctival space. The injector was withdrawn gently, and the optimal XEN placement was confirmed. Subsequently, the viscoelastic material was removed from the AC. Finally, we checked the bleb formation and its function with the forced infusion of a balanced salt solution. The patient was started on levofloxacin and prednisolone acetate 4 times daily on the next day.The XEN gel stent was implanted 2.3The IOP was 6\u200ammHg on day 1 and 8\u200ammHg on day 5 with a well-functioning bleb Fig. A and B. Topical anti-glaucoma treatment was restarted (dorzolamide/timolol combination), and 2% pilocarpine was added in an attempt to relieve the obstruction with miosis. Despite these attempts, the iris occlusion did not resolve. Therefore, the author planned a repositioning surgery.Under the surgical microscope, an ophthalmic viscoelastic device was injected via a side port incision to deepen the AC and to release the iris incarceration. We identified the XEN implant using a modified Swan-Jacob surgical gonioprism. The XEN implant was repositioned into the AC using a 25-gauge long intraocular forceps . To ensure the flow through the implant, the eye was pressurized with a balanced salt solution, and a relatively well-elevated conjunctival bleb was noted. A bandage contact lens was placed at the end of the surgery to prevent transient hypotony was observed on AS-OCT examination. During the first 2 weeks after the revision surgery, the IOP was stable between 6 and 12\u200ammHg were made in a C-shaped configuration surrounding the occluded XEN implant tip to retract the tissue against the flow into the XEN tip. 4 This XEN stent has been designated to have small diameter of 45\u200a\u03bcm to prevent early postoperative hypotony.,4 In contrast, the XEN gel stent also carries a risk of occlusion by fibrin, a blood clot, or the iris due to its small internal lumen.\u20138 A relatively shallow AC and a crowded anterior segment in the Asian eye might increase the possibility of anatomical obstruction of the XEN implant by the iris. In these contexts, Sng et al estimated a 3.2% risk of developing XEN stent iris occlusion. However, there are limited reports of XEN iris occlusion and its management in the literature.,8The XEN45 gel stent has been recognized as a safe and effective minimally invasive glaucoma surgery procedure even in advanced and refractory glaucoma. However, in our patient, the internal ostium of the XEN gel stent was not observed on office-based gonioscopy. Thus, we decided to attempt revision surgery to identify and reposition the implant, if needed. Although intraoperative gonioscopy confirmed the positioning of the implant and the release of iris incarceration during the revision surgery, the tip of the stent was partially re-occluded by the iris 2 weeks later.In our patient, the first iris occlusion was observed on postoperative day 10. Similarly, Tadrosse and Khouri also reported XEN iris occlusion at 10\u200adays after surgery.Possible explanations for the first occlusion are as follows:1.a slightly low (posterior) position of the XEN gel implant,2.the relatively short length of the protruded implant into the AC,3.excessive filtration and a local turbulence effect in the early postoperative phase,4.rubbing the eye with the hands of the patient, and5.floppy nature of the subject's iris. The relatively short length of 679\u200a\u03bcm and the presence of early postoperative hypotony-induced AC shallowing together might bring the iris closer to the stent tip. Moreover, an impaired outflow function via the trabecular meshwork, which is typically seen in advanced glaucoma, might have made the fluid dynamics to become more dependent on the XEN gel stent. Based on the AS-OCT examination, we thought that all these mechanisms might induce \u201cplug-in\u201d shape incarceration and secondary iris steepening of the surrounding iris that resembled peripheral anterior synechiae.In this patient, the gonioscopic examination revealed a slightly lower position of the XEN gel implant, which could have resulted in steepening between the implant and the iris root. Recently, Rafael et al reported that a more posterior stent placement was associated with an increased rate of early complications.Surgical revision was only able to resolve the possible mechanisms for the relatively short length of the protruded implant into the AC. Other factors may have led to the recurrent partial occlusion of the XEN gel stent. Argon laser iridoplasty can induce thermal-induced iris contracture. This contracture resulted in1.distancing the iris from the stent and2.a new wider configuration of the peripheral angle itself by minimizing irido-corneal contact.Finally, the laser procedure resolved the occlusion and restored the flow through the XEN gel stent. Our favorable result was also supported by Tadrosse and Khouri. In addition, Scantling-Birch et al suggested that YAG-laser fibrinolysis could lead to successful clearing of lumen obstructions. On the basis of these previous reports,,11 we also performed the peri-lumen Nd: YAG shock wave treatment for re-canalization. As a result, we were able to re-establish the flow of the iris-occluded XEN implant with this combined laser treatment.In our patient, mild pigment dispersion into the intraluminar portion of the XEN implant was also observed. Eagle and Razeghinejad reported XEN occlusion with a pigmented epithelium early in the postoperative period.5To the best of our knowledge, this is the first case report of the efficacy of combined laser treatment (ALPI and Nd: YAG laser shock wave) for recurrent XEN implant occlusion by the iris. ALPI and Nd: YAG laser shock wave therapy might be a relatively safe rescue treatment for XEN iris occlusion, even in cases with a history of previous surgical repositioning of the XEN implant.The authors wish to thank eWorldEditing and Paperpal Preflight for language editing.Conceptualization: Seungsoo Rho, Su-Ho Lim.Data curation: Seungsoo Rho, Su-Ho Lim.Formal analysis: Seungsoo Rho, Su-Ho Lim.Funding acquisition: Su-Ho Lim.Resources: Su-Ho Lim.Writing \u2013 original draft: Seungsoo Rho, Su-Ho Lim.Writing \u2013 review & editing: Seungsoo Rho, Su-Ho Lim."} +{"text": "Salmo salar), and also have a role in epigenetics as environmental factors that alter DNA methylation status. It is important to understand whether micronutrients in the paternal diet can influence the offspring through alterations of DNA methylation signatures in male germ cells.DNA methylation has an important role in intergenerational inheritance. An increasing number of studies have reported evidence of germline inheritance of DNA methylation induced by nutritional signals in mammals. Vitamins and minerals as micronutrients contribute to growth performance in vertebrates, including Atlantic salmon , when the fish are fed both medium and high doses of micronutrients. Furthermore, two transcription factors, histone deacetylase 2 (hdac2) and a zinc finger protein, bind to the hyper-methylated site in the grin3a-like promoter. An estimated function of hdac2 together with a zinc finger indicates that grin3a-like has a potential role in intergenerational epigenetic inheritance and the regulation of embryonic development affected by paternal diet.Here, we show the effect of micronutrient supplementation on DNA methylation profiles in the male gonad through a whole life cycle feeding trial of Atlantic salmon fed three graded levels of micronutrient components. Our results strongly indicate that micronutrient supplementation affects the DNA methylation status of genes associated with cell signalling, synaptic signalling, and embryonic development. In particular, it substantially affects DNA methylation status in the promoter region of a glutamate receptor gene, The present study demonstrates alterations of gene expression patterns and DNA methylation signatures in the male gonad when Atlantic salmon are fed different levels of micronutrients. Alterations of gene expression patterns are of great interest because the gonads are supposed to have limited metabolic activities compared to other organs, whereas alterations of DNA methylation signatures are of great importance in the field of nutritional epigenetics because the signatures affected by nutrition could be transferred to the next generation. We provide extensive data resources for future work in the context of potential intergenerational inheritance through the male germline.The online version contains supplementary material available at 10.1186/s12864-022-08348-4. Salmo salar) . T. T12]. TAs summarised in previous studies , 12, botFor gene expression and DNA methylation analyses, we used male gonads and male liver collected at the final harvest stage Fig.\u00a0a and then\u2009=\u20096) except for L2 gonads (n\u2009=\u20095).To study the influence of micronutrient supplementation on gene expression profiles, we performed differential expression analysis (DEA) by pair-wise comparisons with two data sets, defined as L2:L1 and L3:L1 showed no noticeable separations in gonads, regardless of using the top 500 high variance genes Fig.\u00a0a or all p-value\u2009<\u20090.1) than L2 in gonads, with having only 6 DEGs for L2:L1 but 97 DEGs for L3:L1 affected more genes than medium dosages of micronutrients (L2) when compared to the control diet (L1) in both liver and gonads.Even though there were too few DEGs for L2:L1 gonads (6 DEGs) for a\u00a0robust functional annotation, L3:L1 gonads had enough DEGs (~\u2009100 DEGs) for over-representation analysis (ORA) on the KEGG (Kyoto encyclopedia of genes and genomes) and the Gene set enrichment analysis (GSEA) is another functional annotation method that relies on the whole gene set instead of using only DEGs, and its NESs indicate the trend of either up- or down-regulation of the identified pathways. GSEA on KEGG revealed in total 15, 16 and 29 enriched pathways for gonads, liver and G&L, respectively Table . These fn\u2009=\u20093).In a similar way to differential expression analysis with RNA-seq samples, we performed differential methylation analysis by pair-wise comparisons with L2:L1 and L3:L1 datasets see on uniquPrior to differential methylation analysis, we extensively performed clustering analysis to investigate the overall as well as regional DNA methylation patterns by diet. The result of PCA showed no distinct clusters by diet for both gonads and liver Fig.\u00a0a. SimilaTo elucidate regional DNA methylation patterns, we first separated the genome into three main regions: regulatory sequence (RS), gene body (GB), and intergenic region (IGR), which were further divided into four sub-regions: flanks (flanking regions both 10\u00a0K upstream and downstream around mRNAs) and promoter (P) within RS, and exon and intron within GB (see Comparisons of the average methylation rates between genomic regions showed P250 had the lowest rates (~\u200922%) followed by P1K (~\u200957%) and exon (~\u200976%) in gonads Fig.\u00a0b. There Interestingly, the result of PCA with sub-regions showed distinct clustering for P250 and P1K in gonads, with having both L2 and L3 largely separated from L1 defined by q-values\u2009<\u20090.01 and methylation rate differences\u2009>\u200925% for both L2:L1 and L3:L1 in male gonads Table . The dis\u20096 Table , which wWe defined differentially methylated genes (DMGs) as protein-coding genes that contained at least one DMC, which led to the identification of over 9 500 DMGs in gonads Table . Unlike Like\u00a0functional annotation analysis with DEGs, we performed functional annotation analysis on DMGs. The number of identified DMGs was much higher than the corresponding DEGs. For instance, 97 DEGs vs. 9647 DMGs for gonad L3:L1, which could be a potential issue with functional annotation since the identified DMGs occupied a large part of the whole transcriptome. To investigate the regional contribution to enrichment, we labelled DMGs with 10 different regions as gene body (GB), intron, exon, promoter (P), P250, P1K, P5K, flanks, P\u2009+\u2009GB, and RS\u2009+\u2009GB (regulatory sequence\u2009+\u2009GB), depending on the locations of the corresponding DMCs. Also, one DMG could belong to multiple regional groups in case of having multiple DMCs.Over-representation analysis (ORA) on KEGG identified 20 and 12 enriched KEGG pathways, whereas ORA on GO identified 107 and 95 enriched terms respectively for L2:L1 and L3:L1 in gonads had two hypo-methylated DMCs had one hypo-methylated DMC with and liver along with linear regression lines with positive slopes and liver again with positive regression lines between L2:L1 and L3:L1 showed strong positive correlations for gonads and medium (L2) doses of micronutrients still affected both gene expression and DNA methylation consistently in terms of down/up gene regulation and hyper/hypo methylation.To make a list of candidate genes for potential intergenerational epigenetic inheritance in the male lineage, we merged L2:L1 and L3:L1 and then applied several filters to reduce the number of potential false positives. The first step was to merge common DMCs from L2:L1 (27 433 DMCs) and L3:L1 26 995 DMCs) with the same direction in terms of hypo/hyper-methylation and exclude the sites in IGR see , which p 995 DMCspotassium voltage-gated channel subfamily a member 2 (KCNA2), which mediates transmembrane transport mainly in the brain and the central nervous system [putative uncharacterized protein DDB_G0286901 (DDB_G0286901), which encodes a putative recombinant protein [nucleoporin 50 (NUP50), which encodes a component of the nuclear pore complex that plays a role in nuclear protein import [DDB_G0286901 and NUP50 are unknown, but DNA methylation in the promoter of KCNA2 is associated with attenuation of neuropathic pain in humans [In Exon150, the corresponding orthologues are s system , putativ protein , and nucn import . Epigenen humans .glutamate ionotropic receptor NMDA type subunit 3a (GRIN3A), which encodes a subunit of N-methyl-D-aspartate (NMDA) receptor, which further belongs to the superfamily of glutamate-regulated ion channels [GRIN3A is unknown, but DNA methylation in the promoter of glutamate ionotropic receptor NMDA type subunit 2a (GRIN2A), which is another subunit of NMDA, is strongly associated with major depressive disorder in humans [glutamate ionotropic receptor NMDA type subunit 2b (GRIN2B) is associated with anxiety-like behaviour in mice when juvenile mice were fed a methyl-donor-deficient diet [dnaj heat shock protein family (HSP40) member C16 (DNAJC16), which is a member of the heat-shock protein (HSP40) family [DEAD-box helicase 43 (DDX43), which encodes an ATP-dependent dual RNA\u2013DNA helicase [DNAJC16, a cohort study has reported that tea consumption in women epigenetically changes the gene expression of DNAJC16 through DNA methylation of a single CpG site [DDX43 promoter is known to be\u00a0associated with human cancers including acute myeloid leukemia [In P250, the corresponding orthologue of the most affected gene is channels . The pren humans . Moreoveent diet . The othamily HSP member Chelicase . As for CpG site . Aberrantransmembrane protein 35a (TMEM35A), which encodes a soluble peptide that may modulate neurite outgrowth [phospholipase C beta (PLCB4), which encodes an enzyme that uses calcium as a cofactor to play an important role in extracellular signals [scribble planar cell polarity protein (SCRIB), which encodes a membrane protein involved in cell migration and cell polarity [TMEM35A and SCRIB are unknown, aberrant DNA methylation status in the PLCB4 promoter affects hippocampal neurogenesis in mouse offspring upon maternal hexachlorophene (HCP) exposure [In P1K, the corresponding orthologues are utgrowth , phospho signals , and scrpolarity . While eexposure .NUP50 and DDX43 are highly expressed in testis, and DNAJC16 is highly expressed in the\u00a0oviduct epithelium in humans [GRIN3A is expressed in fetal brain in humans [glutamate receptor ionotropic, NMDA 3A-like (grin3a-like) in Atlantic salmon potentially has a role in embryonic brain development.Our differential expression analysis indicated that none of the nine common DMGs were DEGs in gonads. Nevertheless, n humans . Hence, n humans , suggestgrin3a-like contained a locus with two hypo-methylated DMCs for gonads and a zinc finger protein, zinc finger protein 206 (ZFP206), had almost identically matched motifs to this locus cells [As an alternative to DMCs, differentially methylation regions (DMRs) are widely used to detect genomic regions with different DNA methylation status instead of considering only single CpG sites. Nonetheless, most DMGs in the present study were supported by single DMCs Fig.\u00a0b, and DMhistones , whereasS) cells and contS) cells .HDAC2 is from humans, and ZFP206 is from both humans and mice. While HDAC2 has a corresponding orthologue, histone deacetylase 2 in Atlantic salmon, ZFP206 has no orthologues identified in Atlantic salmon as well as any other fish species. Since zinc finger proteins are one of the most abundant groups of proteins [ZFP206 in fish.Most entries in SalMotifDB are based on model organisms as proteins , there cgrin3a-like and hdac2 were expressed in male gonads, but neither of them were DEGs. No expression was detected for grin3a-like in liver, but hdac2 showed weak expression in liver. Moreover, hdac2 had one common DMC in its intron for gonads but no common DMCs for liver. Hence, micronutrient supplementation substantially affected DNA methylation status in the grin3a-like promoter but without alternating its gene expression in gonads.Transcripts of both https://doi.org/10.6084/m9.figshare.14177015.v1), and also created a website (https://nutrepi.github.io/wp1gonad) for fast and easy online data access specifically for gonads binding motifs were hypo-methylated in the sperm of aged fathers, and hypo-methylated sperm DNA negatively affected neurodevelopment in offspring [zinc finger protein 217 (Zfp217) and zinc finger protein 516 (Zfp516), controlled the concise epigenetic states on active embryonic stem cell (ESC) genes [Zfp217 were largely overlapped with the target sites of a limited number of transcription factors, including HDAC2 and REST [grin3a-like together with hdac2 in the male gonad of Atlantic salmon could be one of the prime candidates for studying intergenerational epigenetic inheritance that affects early cell development stages in offspring.Establishing a robust method of analysing binding motif enrichment on multiple DMC sites could be useful to understanding intergenerational epigenetic regulation. A study about the effect of parental age on offspring in mice reported that genomic regions enriched in ffspring . MoreoveC) genes . Interesand REST . Hence, n\u2009=\u20093 for each group, and therefore, we utilized the liver samples, as verification, from one of our previous studies that used the fish from the same experiment with a larger number of replicates (n\u2009=\u20096 for two treatments and n\u2009=\u20099 for control) for the DNA methylation analysis [Major limitations of the present study are (i) usage of the F0 gonads, (ii) the limited number of replicates in the DNA methylation analysis, and (iii) sparsely located DMCs. First, a feeding trial over generations to study intergenerational effects of micronutrient supplements is expensive and takes many years. In addition, most of the fish were too young to get fully matured even at the final sampling stage of the feeding trial, and therefore we focused on the male gonad to study the potential epigenetic inheritance affected by micronutrients. As the gonads are primary reproductive organs, the male gonad is the most suitable organ to study intergenerational epigenetic effects of the male linage especially when sperm cells are scarcely available. Second, the number of replicates used for the DNA methylation analysis was analysis . Since tanalysis , false panalysis , DSS [57analysis , can be Our study also has a potential impact on reconsidering the optimised composition of broodstock diet in the aquaculture industry. Genetic and epigenetic regulations modulated by nutrients in broodstock of cultured fish have been less well studied compared to its offspring. Given that different micronutrient levels affect gene expression and DNA methylation profiles that may contribute to intergenerational inheritance in the male linage, micronutrients in male broodstock can be one of the key environmental factors that control the healthy growth and fish welfare of its offspring.grin3a-like gene, where two transcription factors, HDAC2 and ZFP206, were predicted to bind. The functional roles of HDAC2 and ZFP206 in humans and mice suggest that DNA methylation of the grin3a-like promoter may intergenerationally affect the early neurodevelopment of embryonic cells in offspring. To obtain a good understanding of the epigenetic inheritance triggered by nutrient signals in Atlantic salmon, we also provide a wide range of easy access datasets as important resources for future work.The present study was aimed to unravel the impact of adding micronutrient supplementation in Atlantic salmon feed that potentially affected epigenetic regulations, specifically for DNA methylation. Although the feeding trial used in the present study was limited to one generation, we extensively analysed multiple types of data, such as different omics, different tissue types, human and mouse orthologues, and graded levels of nutrients, to examine overall and regional patterns of DNA methylation affected by micronutrients. The most heavily affected DNA methylation sites by micronutrient supplementation were mainly associated with cell signalling, neurodevelopment, and synaptic signalling. We also identified an epigenetically influenced genomic region in the promoter of the Atlantic salmon were obtained from SalmoBreed AS (Norway), and the whole feeding trial took place in the UK. During the freshwater phase, 500 salmon parr were kept in nine tanks at the Niall Bromage Freshwater Research Facility . After smoltification, the fish were transferred to the Mowi Marine Harvest Feed Trial Unit and kept there for 12\u00a0months in sea pens. A nutrient package (NP) was used to supplement experimental diets to meet the required levels for Atlantic salmon as reported by the Advanced Research Initiatives for Nutrition & Aquaculture (ARRAINA) EU project , 23. L1,At each sampling point in freshwater, 50 fish per tank were anaesthetised and measured, while in seawater, all fish per tank were counted and individually measured; all fish were subjected to recovery in aerated water prior to letting them back to their original tanks. At the termination, six fish per tank were euthanised by lethal anaesthesia for sequencing and molecular analyses. Among them, 17 gonad and 18 liver samples were used for gene expression analysis at the termination of the trial, and the fish that were not involved in this study were used in the ARRAINA EU project and reported elsewhere , 12, 59.At the harvest stage of the trial, both gonads and liver were dissected followed by snap freezing in liquid nitrogen for RNA and DNA extraction. The same fish were used for both RNA and DNA samples, and ceramic beads were used to homogenise tissue samples. See Additional file Both gonads and liver samples were sent to the DeepSeq sequencing facility at Nord University for RNA-sequencing (RNA-seq) where libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The libraries were subsequently sequenced by the NextSeq500 machine (Illumina). See Additional file Both gonads and liver samples were sent to the CeMM Biomedical Sequencing Facility for reduced representation bisulfite sequencing (RRBS) where enzyme digestion by MspI and TaqI were performed followed by size selection and bisulfite conversion. RRBS was subsequently performed using the HiSeq 3000/4000 instruments (Illumina). See Additional file https://www.ncbi.nlm.nih.gov/assembly/GCF_000233375.1).The genome data of the Atlantic salmon genome (ICSASG_v2) were obtained from the NCBI assembly site , gene body (GB), and intergenic region (IGR). RS contained four sub-regions: P250, P1K, P5K, and flanks. P250 P1K, and P5K were promoter regions separated by the distances from TSS (transcription start site) as P250 (1\u2009~\u2009250\u00a0bp), P1K (251\u2009~\u20091\u00a0K\u00a0bp), and P5K (1001\u2009~\u20095\u00a0K\u00a0bp), whereas flanks were defined as 10\u00a0K up and downstream around mRNAs with excluding the regions defined as P250, P1K, and P5K. GB contained two sub-regions: exon and intron. IGR had no sub-regions. In case of overlapping, a site was exclusively assigned to one region or sub-region as the highest precedence given for exon followed by intron, P250, P1K, P5K, flanks, and IGR.https://CRAN.R-project.org/package=factoextra).Raw reads were initially trimmed using Cutadapt to removp-values\u2009<\u20090.1.Differential gene expression analysis was performed using the DESeq2 package that proThe analysis was performed in a pair-wise manner using L1 as control for two datasets, termed L2:L1 and L3:L1 for each treatment group. In addition, samples of both gonads and liver were combined to generate the G&L dataset separately for L2:L1 and L3:L1. To perform a multifactorial analysis for the G&L dataset, tissue types (either gonads or liver) were added to the design matrix in addition to diet groups.The functional analysis of DEGs was perfhttps://www.babraham.ac.uk) and MultiQC [FastQC .Bismark with theDifferential methylation calling was completed with the methylKit R package by calcuSimilar to differential gene expression analysis, differential methylation analysis was performed in a pair-wise manner using L1 as control for two datasets, termed L2:L1 and L3:L1 for each treatment group. G&L datasets were formed in the same way as differential gene expression analysis separately for L2:L1 and L3:L1. Again, tissue types (either gonads or liver) were added to the design matrix in addition to diet groups to perform differential methylation analysis with G&L.The plots of the genomic features with methylation differences and average methylation rates were generated by the Gvis R package .p-values\u2009<\u20090.05 and a minimum gene counts of 20, whereas enriched GO terms were defined by adjusted p-values\u2009<\u20090.001 and a minimum gene counts of 10.Differentially methylated genes (DMGs) were defined when genes contained at least one DMC in the corresponding region. Like functional enrichment analysis with DEGs, over-representation analysis (ORA) for DMGsDEGs and DMCs were merged to produce DEG:DMCs, which were defined as the DEGs that had at least one DMC. DEG:DMCs were produced for all nine possible pairs from the three datasets . A pair of the datasets comprised of one DEG dataset and one DMC dataset, for instance, , , , and so on so forth. DMCs were used instead of DMGs to provide additional information for subsequent analyses.To find statistically unexpected counts (too few or too large), a linear regression analysis with the formula of #DEG:DMCs\u2009~\u2009#DEGs\u2009+\u2009#DMGs was performed in R. Feature/variable-wise normalization on all the counts were performed by using the maximum counts before linear regression.DMGs from L2:L1 and L3:L1 were merged to produce common DMGs identified in both datasets. Only matched directions of methylation differences were merged. DMGs in IGR were eliminated from the common DMGs. DMGs in exon were split into Exon150 and Exon. Exon150 was to cover the DMCs located near TSS (~\u2009150\u00a0bp downstream).The website of UniProtKB was usedAs resources for further analyses, 13 tabular format files were generated and uploaded to Figshare \u2013 (1) DEGs for L2:L1, (2) DEGs for L3:L1, (3) DMCs and CpG sites for L2:L1, (4) DMCs and CpG sites for L3:L1, (5) DMCs by region for gonad L2:L1, (6) DMCs by region for gonad L3:L1, (7) DMGs for L2:L1, (8) DMGs for L3:L1, (9) DEG:DMCs for gonads (10) DEG:DMCs for liver, (11) DEG:DMCs for G&L, (12) common DMCs, (13) common DMGs. See Additional file https://jekyllrb.com) and hosted on GitHub pages (https://nutrepi.github.io/wp1gonad).In addition, a website with data for gonads was created by Jekyll (Both RNA-seq and RRBS pipelines were organised using Snakemake to combiAdditional file 1."} +{"text": "In complex and deformed knees, soft tissue release (STR) is required to obtain symmetry in the femorotibial gap. The objective of this study was to attempt to predict the need for soft tissue release using surgical navigation in total knee replacement (TKR).Prospective and non-randomized study. One hundred thirty knees. At the start of navigation, an attempt was made to correct the femorotibial mechanical axis by applying force to the medial or lateral side of the knee . A gap balanced technique with computer-assisted surgery (CAS) was performed in all cases. The ligaments were tensioned, and using CAS visualization and control, progressive STR was performed in the medial or lateral side until a symmetry of the femorotibial gap was achieved.P\u2009<\u20090.001). STR was performed under navigation control in 38.5% of cases, lateral release (LR) in 12 cases, and medial release (MR) in 38 cases. After performing the varus-valgus stress angle test (VVSAT), the axis of 0\u00b0 could be restored at some point during the manoeuvre in 28 cases. STR was required in 44.6% of varus cases and 27% of valgus cases (P\u2009=\u20090.05). A significant relationship was found between the previous deformity and the need for MR (P\u2009<\u20090.001) or LR (P\u2009=\u20090.001). STR was more common in male patients (P\u2009=\u20090.002) and as obesity increased.Eighty-two patients had a varus axis\u2009\u2265\u20093\u00b0 and 38 had a valgus axis (This study shows that pre-operative factors favouring the need to perform STR in a TKR implant can be defined. The objective of the total knee replacement (TKR) is to achieve a well-aligned and well-balanced knee . CreatioIn the search for dynamic soft tissue assessment, application of force in extension using the varus-valgus stress angle test (VVSAT) and confAdditionally, it has been attempted to relate the preoperative deformity measured in a frontal long X-ray to the asymmetry of the gap in extension, and therefore to the need for STR in the surgical procedure . HoweverThe surgical procedures required to obtain symmetry of the gap are well defined in the literature, but since standard surgery does not offer the possibility to verify its effectiveness, they are often arbitrary and dependent on the surgeon\u2019s experience and subjective impression. Computer-assisted surgery (CAS) provides mechanical, anatomical, and kinematic alignment of the knee, as it dynamically assesses the axis of the limb throughout the range of motion of the knee . In addiTo determine if the preoperative axis of the limb obtained by forcing the knee (VVSAT) can be related with the need for MR or LR. If at any time during this manoeuvre a femorotibial axis of\u2009\u00b1\u20093\u00b0 is obtained, could this mean that STR would not be required?To determine whether MR or LR is related to BMI, patient sex, or prior radiographic deformity, and whether release is more common in knees with varus or valgus deformity.The objectives of this study were as follows:Our study was based on CAS findings but was aimed at helping the surgeon who performs TKR implantation using a conventional procedure. To sum up, it was intended to determine whether the possibility of correcting the deformity using varus-valgus stress manoeuvres will make STR unnecessary, and to determine if it was possible by a preoperative long X-ray to measure the asymmetry in the gap that the surgeon will encounter during surgery, and therefore, whether STR would be required. If our objectives were achieved, they would provide guidance to the surgeon, who could pre-operatively plan the best soft tissue treatment.This study was a prospective, non-randomized study. The series consists of 130 cases. There were 86 female and 44 male patients, 13 cases were bilateral. The mean age was 71.08 (SD 9.53). All patients in the study were subjected to X-rays of the knee and frontal long X-ray of the limb in a standing position, with complete knee extension and including a metallic calliper of known diameter located close to the knee. From the PACS (Picture Archiving and Communication System) and using a computer program , images were sent to the surgical planning software (Agfa Orthopaedics Tools v 2.06). This tool was used to first calculate the anatomical and mechanical axes of the femur and tibia, and then the anatomical and mechanical axes of the limb. Measurements were done by two of the authors, who had a wide experience with use of this planning system. Cases in which full knee extension could not be obtained were not included in this study. Varus angulation was considered as positive and valgus angulation as negative. Informed consent was obtained from all individual participants included in the study. Approval for this study was granted by the Regional Ethics Committee (PI12/01098).All patients were operated on by the same surgical team, and all had the Apex TKR implanted. In all cases, a closed navigation system with no previous images was used, which employs kinematic analysis of the hip, knee, and ankle and anatomical mapping of the knee to construct a working model . At the A gap balanced technique with CAS was performed in all cases. After removing the osteophytes, a tibial cut at 90\u00b0 on the mechanical axis of the tibia was made in the coronal plane with 5\u00b0 of posterior slope in the sagittal plane Fig.\u00a0; the iniAll variables were studied descriptively. Adjustment of variables to normal was studied. Multiple regression analysis was performed for the dependent variable gap and the independent variables varus and valgus deformity and BMI. A multiple regression equation was obtained with the weight of independent variables as beta coefficients and their corresponding 95% confidence intervals. SPSS statistical packages for Windows version 20.0 and MedCalc version 9.3.1 were used.P\u2009=\u20090.013), but only a weak correlation was found between BMI and the degree of pre-operative deformity . The pre-operative mechanical axis of the limb was a mean of 4.13\u00b0 with oscillations between 27.4\u00b0 varus and 26.0\u00b0 valgus (SD: 11.93). Three groups were defined according to the pre-operative deformity of the mechanical axis measured in the long X-ray. Neutral axis was considered when angulation was 0\u00b0\u2009\u00b1\u20092.9\u00b0, valgus deformity was less than\u2009\u2212\u20093\u00b0, and varus deformity was greater than 3\u00b0. The largest group (83 patients) had a varus axis\u2009\u2265\u20093\u00b0 and 37 had a valgus axis (P\u2009<\u20090.001). There were more males with varus or valgus deformity (P\u2009<\u20090.465).Mean BMI of the series was 31.17 (SD 5.55). Over half of patients (55.3%) were included in one the WHO-defined obesity categories. Cases with prior varus deformity were seen to have a significantly higher BMI than cases with valgus or neutral alignment (P\u2009<\u20090.001). When\u2009\u00b1\u20093\u00b0 post-VVSAT was achieved, release was performed in 19 cases and when angulation does not correct was achieved, release was required in 31 cases (P\u2009<\u20090.001) , ranging from 23\u00b0 varus to 19\u00b0 valgus. There were 38 knees with valgus deformity and 83 knees with varus deformity (Table P\u2009<\u20090.001). MR was performed in 38 cases (20 women and 18 men) and LR in 12 (9 women and 3 men). A significant relationship was found between the previous deformity and the need for MR (P\u2009<\u20090.001) or for LR (P\u2009=\u20090.001).If we exclude out cases without radiological pre-operative deformity (10 cases), we find that 44.6% of varus cases and 27% of valgus cases required release (P\u2009=\u20090.002). In patients with an elevated BMI, the need for release was more common (P\u2009=\u20090.079) with an increasing frequency as the degree of obesity increased. In almost 70% of cases with type III obesity, STR was required (Fig.\u00a0Significant differences were found when MR was compared by patient sex, which was more common in males (red Fig.\u00a0.Fig. 5STOur work was based on data from the CAS and was aimed at surgeons who do not use this technique when implanting a TKR. In this regard, its main findings were, firstly, that if normalisation of the pre-operative axis of the limb was achieved after a varus-valgus forced manoeuvre, soft tissue release may not be required when TKR was implanted, and secondly, that from the pre-operative coronal mechanical axis of the limb and depending on deformity, sex, and BMI, the need for lateral or medial release may be predicted until symmetry of the femorotibial gap in extension was achieved.To create a symmetrical gap, sequential medial and lateral releases were required depending on the deformity and previous ligament balance. There are two ways to perform the gap balancing technique: extension first or flexion first. Balancing in extension first, as was done in our study, was considered more reliable, as releases were more precise . AlthougAn attempt has been made to determine the factors influencing the reducibility of deformities by varus-valgus forced manoeuvres before TKR surgery. For some authors , the preWe found no studies like ours in the literature where the relationship between axis correction by VVSAT and the need to perform STR can be determined using CAS. Lee O-S et al. performeAlthough the relationship between gap asymmetry and pre-operative X-rays has been partially studied , we alsoBMI and sex also influenced the need for STR. Release was more common in males. In patients with high BMI, STR was more common, increasing in frequency as the degree of obesity increased, reaching 70% in patients with type III obesity. The variables sex and BMI were not evaluated in any study on STR and TKR deformities.Our study has limitations. First, gap measurement after varus-valgus stress manoeuvres was performed manually. The final value was obtained by finding the mean of measurements taken by two different surgeons. Manual performance of this manoeuvre is widely referenced in the literature , 19\u201321 bOur results, found after CAS use, may be useful in conventional surgery. From these findings, the group of patients who will require soft tissue release to obtain a normal femorotibial axis after TKR can be defined. If it is verified after applying the VVSAT that a normalisation of the axis was obtained, it can be predicted that release will not be necessary. The degree of pre-operative frontal radiographic deformity, patient sex, and BMI were also factors influencing the need to perform STR to obtain symmetry of the femorotibial gap."} +{"text": "Biological activity regulation by protein post-translational modification (PTM) is critical for cell function, development, differentiation, and survival. Dysregulation of PTM proteins is present in various pathological conditions, including rheumatoid arthritis (RA). RA is a systemic autoimmune disease that primarily affects joints, and there are three main types of protein PTMs associated with the development of this disease, namely, glycosylation, citrullination, and carbamylation. Glycosylation is important for the processing and presentation of antigen fragments on the cell surface and can modulate immunoglobulin activity. The citrullination of autoantigens is closely associated with RA, as evidenced by the presence of antibodies specific to citrullinated proteins in the serum of patients. Carbamylation and dysregulation have recently been associated with RA development in humans.In this study, we performed an overview analysis of proteins with post-translational modifications associated with the development of RA adverted in peer-reviewed scientific papers for the past 20 years. As a result of the search, a list of target proteins and corresponding amino acid sequences with PTM in RA was formed. Structural characteristics of the listed modified proteins were extracted from the Protein Data Bank. Then, molecular dynamics experiments of intact protein structures and corresponding structures with PTMs were performed regarding structures in the list announced in the ProtDB service. This study aimed to conduct a molecular dynamics study of intact proteins and proteins, including post-translational modification and protein citrullination, likely associated with RA development. We observed another exhibition of the fundamental physics concept, symmetry, at the submolecular level, unveiled as the autonomous repetitions of outside the protein structural motif performance globule corresponding to those in the whole protein molecule. Rheumatoid arthritis (RA) is a heterogeneous disease characterized by a variable disease course in different people ,2. The pPorphyromonas gingivalis infection, and high consumption of caffeine [A positive test for the rheumatoid factor (RF) is a marker of negative prognosis in clinical practice and likely indicates a severe form of the disease and the presence of a common epitope, HLA DRB . Researccaffeine .Anti-citrullinated protein or peptide antibodies (ACPA) are the hallmark of RA and are present in 60-70% of patients . ACPA isThe discovery of antibodies against citrullinated protein antigens (ACPAs) has been an important step in RA treatment. These antibodies have been found to be beneficial from a diagnostic perspective. This analysis is characterized by high specificity and low sensitivity compared to the test for the presence of RA. Early research showed that the appearance of ACPA autoantibodies is several years ahead of clinical onset and assoTransformation of arginine to citrulline is a physiological process of deamination that occurs during apoptosis and is orchestrated by peptidyl arginine deiminase (PAD).Polymorphisms in PAD2 and PAD4 genes likely increase the risk of RA ,15. The Bang et al. discovered an isoform of the vimentin, in which glycine replaces arginine residues and named it mutant or modified vimentin . Innala In this study, based on the analysis of published data, we formed a list of citrullinated proteins found in biosamples of RA patients. To characterize the geometry of structural changes caused by the modification of arginine, we formed a sample of three-dimensional structures based on the analysis of the Protein Data Bank (PDB) database and AlfaFold .Next, we analyzed the structures of listed proteins for the presence of small and compact structural motifs, including the modification site, which are limited to two or three elements of the secondary structure. Such motifs are characterized by autonomy and high stability and allow for molecular dynamics (MD) experiments with high productivity. Moreover, we proposed and tested a hypothesis of symmetry about the autonomous stability of structural motifs and whole molecular structure in computational experiments of MD. At the final stage, the MD experiment was performed to confirm the stability of the revealed compact structural motifs , and changes in the geometry of motif structure caused by citrullination.We selected proteins with citrullination localized in a compact structural element that could be stable independently of the entire macromolecule. Protein structures were obtained from the RCSB PDB and AlphaFold Protein Structure Database (AF-H9GXR8-F1). Super secondary elements were cut using PyMol software for the following steps of the present study.+) and chlorine (Cl\u2212) ions. Protein and non-protein atoms were coupled to their temperature baths set at 311 K using the V-rescale algorithm [The MD simulations were performed using the GROMACS 2020.4 softwarelgorithm . The prelgorithm . A time lgorithm . A 1.4 nlgorithm with a 0gmx\u2019 cluster module, where the backbone atoms of all residues were superimposed. The Gromos clustering method [MD trajectories were analyzed using the standard GROMACS utilities. The root-mean-square deviation (RMSD), solvent-accessible surface area (SASA), and pairwise distances were calculated using GROMACS built-in tools. Cluster analysis was performed for all structural elements using the \u2018g method was applg method in the Sg method .https://www.rcsb.org/)(accessed on 17 September 2021). The gathered data annotate 14 proteins and 23 corresponding peptides, the citrullinated forms of which were identified in biosamples of RA patients.Literary overview analysis was followed through to identify a list of proteins, the modifications of which are probably associated with the RA development. The summarized information covers pThe presented proteins can be classified primarily as globular and are characterized by a rich content of \u03b1-helices and \u03b2-strands . The molNotably, the biological role of the selected proteins corresponds to molecular mechanisms that make a significant contribution to RA pathogenesis, including the implementation of a nonspecific immune response and cell migration is called an \u03b1-\u03b1-corner. In proteins, \u03b1-\u03b1-corners occur in the form of a left-handed superhelix. Their sequences are arranged in a special way in a chain of hydrophobic, hydrophilic, and glycine residues.\u03b2-\u03b1-\u03b2-motif: a supersecondary structure , found in almost every protein structure with a parallel \u03b2-form, folding of the polypeptide chain according to Rossman . The \u03b2-sThe 3\u00df-corner is a structural motif that can be represented as a triple-stranded \u00df-sheet folded on to itself so that its two \u00df-\u00df-hairpins are packed approximately orthogonally in different layers and the central strand bends by ~90\u00b0 in a right-handed direction when passing from one layer to the other . All theTwisted right \u03b1-helices. In the complex, they lie parallel to each other and are slightly twisted around each other such that each of them forms a left superhelix. The \u03b1-helices entering the supercoil are generally parallel, and they are intertwined two, three, or four times in different proteins. The \u03b1-helix has a period of 3.6 residues per turn. In intertwined helices, the frequency is 7 residues per two turns of the \u03b1-helix, i.e., 3.5 remainder per turn.In this study, MD experiments were carried out to study the isolated structural motifs containing amino acids, the modification of which is associated with RA development. Intact and modified forms of structural motifs were tested during the study. This study aimed to identify the possible influence of modifications on the structure of motifs (change or even disintegration), that is, to identify structural differences between intact motifs and motifs after modifications .2; The MD experiment involved five structural motifs with specific folding of the polypeptide chain, which were isolated from five target proteins , includiIndirectly, the stability preservation of intact structural motifs and after PTM mounting is evidenced by a long major conformation lifetime varied from 41% to 85%. Additionally, RMSD values during MD simulations did not fluctuate significantly see a,b.We observe minor changes of other geometric indicators characterizing the spatial parameters of isolated structural motifs in an experimental study using the circular dichroism method . Using aThe hypothesis of autonomous stability of small and compact structural motifs is extremely important in studies involving resource-extensive computational experiments using MD methods . Earlier2-C=NH) is replaced by an oxo-group (=O) resulting in carbamoyl function and ammonia as a by-product. This leads to a mass difference of less than 1 Da and a loss of one positive charge [In the present study, we carried out the MD study of 2- and 3-component structurally intact motifs of proteins and motifs with PTM. The results of the study showed great stability of the selected intact motifs and the preservation of the motif geometry following-up citrullination . Recentle charge . In thise charge . Althouge charge . In thisRA is a chronic inflammatory disease, the molecular basis of which has been the subject of extensive research over the past few decades. The key processes in RA development are modulation of the immune response and rearrangement of the actin cytoskeleton. Different immune and non-immune cell types are involved in the development of chronic destructive inflammation in joints, including synovial fibroblasts, which are key effector cells involved in joint destruction and the spread of inflammation . ReorganEven though citrullination of arginine does not cause structural changes, which we demonstrated in our work, the biological effect in RA development is undeniable ,50,54. TIndeed, the protein AMBP is an inhibitor of inter-alpha-trypsin and inhibits the activity of trypsin, plasmin, and lysosomal granulocytic elastase . In a stThe citrullation site of AMBP is located in a supersecondary structure (SSS) of the \u03b2-hairpin type, in an unstructured region, i.e., a connector between two \u03b2-strands. We have proposed the MD experiment and observed that this structure is characterized by a high stability due to definite hydrophobic core, which is in compliance with the previously reported data ,61. BetaCitrullinated proteins, including actin, have been repeatedly identified in the synovial tissue of RA patients using PAGE-MALDI-MS . NotablyIn contrast to AMBP protein, citrullination site of actin is localized in \u03b1-\u03b1-corner structures, which are also stable outside the protein globule ,68. If tReinout Raijmakers associated the role of citrullinated proteins of the fibrinogen family with RA development and considered them as the most striking autoantigens that are found in the inflamed tissues of the affected joints ,74,75. CAlbumin is known to be the most abundant circulating serum protein and is known for its wide range of ligands, including xenobiotics (drugs). Albumin binds Ozoralizumab and methotrexate, which are used in anti-RA drug therapies. In the mouse model of collagen-induced arthritis, it was shown that the formation of the methotrexate complex with albumin was accompanied by a significant decrease in the invasion of synovial fibroblasts and cartilage degradation ,80. SuchCitrullinated proteins are autoantigens as are. ACPAs are present in the majority of RA patients and are specific for this disease . AutoantRheumatoid arthritis (RA) is a common autoimmune disease that afflicts the synovium of diarthrodial joints. The pathogenic mechanisms inciting this disease are not fully characterized, but may involve the loss of tolerance to posttranslationally modified (citrullinated) antigens . In the Protein citrullination usually occurs in cells undergoing apoptosis when citrullinated proteins are cleared from the body and are not detected by the immune system. Citrullination labels intracellular proteins for degradation . HoweverHence, citrullinated proteins are not cleared efficiently during RA. It is assumed that during RA the dysregulation of apoptosis ultimately in combination with inefficient clearance of apoptotic material, is involved in the accumulation of dying cells and the exposure of autoantigens . The maiOur results complement the understanding of the epigenetic molecular basis of RA development and indicate that post-translational modification does not always lead to structural changes in the protein. However, despite the preservation of the high stability of structural motifs containing a citrullination site, the biological effect is pronounced."} +{"text": "Making low GI of the Chinese steamed bread (CSB) with acceptable eating quality is a challenge. A CSB prepared from wheat flour partially substituted by lotus root powder (LRP) showed good prospects. RVA profile and texture profile were determined to evaluate the texture, while animal test were used to confirm the bio-functional attributes. The addition of LRP effectively changed the RVA profile of lotus-wheat incorporated flour (LWIF). CSB prepared from 30% LWIF showed acceptable eating quality with higher springiness, cohesiveness, and recovery while lower hardness. After 12\u00a0weeks of 30% LWIF administrating, the fast blood glucose of diabetic rat decreased from 17.6 to 5.8\u00a0mmol/L together with the reduction of serum TC, TG and LDL-C. The hepatic histopathological examination and serum levels changes of SOD, CAT and FFA confirmed LWIF could effectively protect the liver of the diabetic rats from damage caused by oxidative stress. Nelumbo nucifera) is a very popular food native to some tropical Asian countries, and Australia2. The rhizome of lotus has been found to be rich in protein, starch, phosphorus, copper, potassium, manganese, vitamins C, B1, B2 and B6, while very low in saturated fat1. Furthermore, lotus root contains abundant dietary fiber, polyphenolic compounds, and polysaccharide4. Such health-beneficial properties as hypoglycemic, anti-allergy, anti-inflammatory, and antioxidant activities have been widely reported8.Lotus root (9. Lotus root powder (LRP) is another usual product which is consumed as breakfast, fast food, traditional confectionery and food additives by Asian people1. However, the consumption of LRP as the above form is limited for its infrequently eaten. Due to rich in starch and abundant functional components, health-benefit staple foods can be the important development way for LRP. However, there is less information about the application of LRP in staple foods.Lotus root often used as vegetable for its hard and crispy texture, special aroma and mouth feel10. Nowadays, steamed bread is steadily increasing for its comfortable texture. However, CSB has a high glycemic index (GI) which is about 8610, and not suitable for most hyperglycemia, insulin resistance, and metabolic syndrome population. Therefore, some functional ingredients such as sorghum flour, potato, sweet potato flour are used to substitute wheat flour to improve the health attributes14. However, there are no reports that low GI steamed bread can be obtained by adding cereal or rhizome flour.Chinese steamed bread (CSB) is the principal foods for many people in the world15. Therefore, strategies to maintain the sensory quality while increasing the nutritional quality of CSB should be developed10.The selection of appropriate substitution level and methods to maintain or improve the textural and sensory quality has become an important research direction for the preparation of CSB with low GI. However, there are no related reports about LRP substitution together with texture evaluation of CSB can be obtained.Furthermore, functional ingredient addition tends to decrease the specific volume of CSB, while lead to weak taste such as increased hardness and chewinessTherefore, the objectives of the present study were to evaluate the sensory and healthy beneficial value of CSB prepared from wheat flour partially substituted by LRP. Sensory related parameters such as pasting, textural properties of different substitution levels were investigated to select suitable proportion. In addition, glycemic index (GI) of CSB was calculated to conclude the substitution level further. Finally, animal experiments were conducted to assess the hypoglycemic, hypolipidemic and antioxidative stress effect of CSB prepared from wheat flour partially substituted by LRP. We want to provide a CSB with good sensory and bio-functional attributes to help the treatment of chronic disease.Lotus root powder was contributed by Dongying Shengyuan agricultural ecosystem Co., Ltd. Wheat flour was purchased from a local market in Jinan, Shandong, China. All plant material is in compliance with Plant Material Collection Guidelines of Shandong Academy of Agriculutral Sciences of China. Streptozotocin (STZ) was purchased from Sigma Chemical Co. . All other reagents used were of analytical grade.16 with some modification. Suspensions were prepared by 3\u00a0g WF or LWIF in 25\u00a0mL distilled water and analyzed by a Rapid Visco Analyzer . The slurry was held at 50\u00a0\u00b0C for 1\u00a0min, heated to 95\u00a0\u00b0C in 3.75\u00a0min with a fixed speed of 60\u00a0rpm and then at 95\u00a0\u00b0C for 2.50\u00a0min. Then, it was cooled down to 50\u00a0\u00b0C for3.75\u00a0min and held at 50\u00a0\u00b0C for 2\u00a0min. The data were recorded as the average of duplicate measurements.Formulations of lotus-wheat incorporating flour (LWIF) were composed of 100% wheat flour (WF) as control, or by substituting lotus root powder (LRP) for WF at 10%, 20%, 30%, and 40% (w/w). Pasting property was determined according to Muna et al.16 using a TA-XT Plus texture analyser equipped with a P/36R cylindrical probe. Two slices of 25\u00a0mm thickness were cut from each loaf of steamed bread for testing. Instrument were set in TPA mode and the test parameters as follows: pretest speed of 2.0\u00a0mm/s, test speed of 1.0\u00a0mm/s, posttest speed of 1.0\u00a0mm/s, deformation level of up to 50%, deformation time interval of 5.0\u00a0s, trigger type of AUTO, starting point induction force of 5\u00a0g, data acquisition rate of 200pps. From the TPA experimental curve, six parameter values could be obtained: hardness, elasticity, cohesiveness, adhesiveness, chewiness, and recovery.The texture profile of steamed bread was analysed according to previous reportsWistar male rats weighing 250\u2009\u00b1\u200920\u00a0g were obtained from the Experimental Animal Centre of Shandong University . All animals were kept in an environmentally controlled room with a natural light\u2013dark cycle. The animals had free access to water and were fed with standard laboratory diet. The study was approved by Preventive Medicine Ethics Committee of Shandong University and was carried out in compliance with the ARRIVE guidelines.Rats were adaptively fed for one week before modeling and randomly divided into 3 groups (n\u2009=\u20098). 1 normal control group fed with basic diet. The other 2 model groups were fed with high fat and sugar diet. The composition of the experimental diet was shown in Table Rats were fasted for 12\u00a0h and then were anesthetized with 3% sodium pentobarbital before sacrifice at the end of 12\u00a0weeks. Whole blood of 2\u00a0mL was taken from the abdominal aorta and added to test tubes in which anticoagulants were placed in advance. Chromatographic determination of HBA1c was carried out. The remaining blood was centrifuged at 3000 r/min for 15\u00a0min. The serum TC, TG, HDL-C, LDL-C, T-SOD, CAT, FFA, and hs-CRP contents were determined according to the instructions of the analysis kit. Total cholesterol assay kit, triglyceride assay kit, high-density lipoprotein cholesterol assay kit, low-density lipoprotein cholesterol assay kit, total superoxide dismutaseassay kit (hydroxylamine method), catalase assay kit (visible light) and high-sensitivity C -reactive protein assay Kit was purchased from Nanjing Jiancheng Bioengineering Institute .The hepatic of each group of rats were quickly taken after blood collection and rinsed with physiological saline. A part of the hepatic homogenate was prepared to measure the MDA content. The remainder was fixed with tissue fixation solution, and liver HE staining was performed. The histopathological characters were observed and recorded under HM 325 colorized pathology image analyzer .All of the experimental procedures were performed in accordance with the guidelines issued by the Shandong University and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.P\u2009<\u20090.05 were considered significant.All the statistical analyses comprised one-way analysis of variance (ANOVA) using SAS 9.2 statistical software . The data presented were the means of three experiments, along with the standard error of the mean. The means were compared by Fisher's least significant difference (LSD) test, and differences at 17. The addition of LRP effectively changed the RVA profile of LWIF compared with WF also confirmed the response in test group. After 12\u00a0weeks of administration, the HbA1c level (8.98\u2009\u00b1\u20091.58%) of the test group rats was significantly (P\u2009<\u20090.05) lower than the model control group (11.23\u2009\u00b1\u20091.63%) and equally with normal control group (8.65\u2009\u00b1\u20091.39%). Measurement of the HbA1c value is commonly used to assess long-term diabetic control in laboratoryP\u2009<\u20090.05), and the HDL-C contents were significantly (P\u2009<\u20090.05) reduced (Table P\u2009<\u20090.05), while the content of HDL-C increased significantly (P\u2009<\u20090.05). From Table 32 reported that the reduction of serum TG and increase of HDL-C was due to flavonoids extracted from lotus. These effects of flavonoids supplementation from lotus may be due to low activity of cholesterol biosynthesis enzymes and or low level of lipolysis which is under the control of insulin33. The results suggested that long-term LWIF administration improved the lipid metabolism of diabetic rats.Compared with the normal control group, the serum TC, TG and LDL-C contents of the model control group were significantly increased lower than those in the normal control group and test group differences in hs-CRP of the three (Table 37. Administration of LWIF for 12\u00a0weeks was helpful for suppressing oxidative stress by decreasing the levels of FFA (Table P\u2009<\u20090.05) than that in normal control group. This indicated that LWIF could improve the body's antioxidant defense system and protect the body from oxidative stress.High sensitivity C-reactive protein (hs-CRP) is a systemic, non-specific inflammatory marker associated with insulin resistance and metabolic syndromeee Table . ElevateFA Table . FurtherThe hepatic histopathological examination further confirmed the protective effect of the LWIF administration in the diabetic rats Fig.\u00a0. There wLotus root powder incorpated with wheat flour could prepare Chinese steamed bread with good sensory and bio-functional attributes. CSB prepared from 30% LWIF showed higher springiness, cohesiveness, and recovery and fluffy texture, which possessed good eating quality. After 12\u00a0weeks of 30% LWIF administration, average FBG of diabetic rats dropped from 17.6 to 5.8\u00a0mmol/L, while serum lipid of TG, TC, LDL, and HDL were close to the level of normal control group. Furthermore, it could improve serum SOD and CAT level, reduce serum FFA content, and reduce hepatocyteapoptosis and infiltration of inflammatory cells. Therefore, 30% LWIF possessed good hypoglycemic, hypolipidemic and antioxidative stress effect. CSB prepared from wheat flour substituted by 30% LRP will be a promising food product especially in complementary treatment of chronic disease."} +{"text": "The examination of very small fetal hearts requires special equipment and a specialist that are not available in many general pathology laboratories. Compared to conventional examination, the four-chamber cardiac dissection (4CCD) method can be performed by any pathologist using instruments generally available in pathology services. The aim of this study is to evaluate the efficiency of the 4CCD method in the examination of small fetal hearts using post-mortem magnetic resonance imaging (pm-MRI) at 7T as the standard. Twelve fetuses with gestational ages between 13 and 19 weeks have been included in this study. All fetuses underwent pm-MRI examination prior to pathologic examination. The 4CCD method was used for the cardiac examination in all cases following the same guidelines for cardiac sectioning. The 4CCD was able to identify all cardiac anatomic structures as compared to pm-MRI at 7T, demonstrating a sensibility of 95.8% and specificity of 100% . The overall accuracy in identifying cardiac anatomic structures was 95.8% . Additionally, the 4CCD method was able to detect cardiac anomalies with an overall diagnostic accuracy of 91% , sensibility of 67.6% , and specificity of 97% as compared to pm-MRI at 7T. The four-chamber view dissection method can be considered as an alternative to the conventional inflow\u2013outflow dissection method in selected cases. Fetal cardiac examination is an important step in evaluating the presence of malformations during fetal autopsy and may present unique challenges. The combination of small-sized organ and complex malformative lesions require expertise, experience, and appropriate medical instruments in order to perform post-mortem examination of the fetal heart. Detailed clinical data and good communication with the obstetrician and cardiologist are crucial for a correct assessment of cardiac malformations .A generally accepted method for cardiac dissection of the fetal heart is the inflow\u2013outflow method. The sections for opening the atria and ventricles follow the course of blood flow through the heart. Another widely used method for cardiac dissection is the short axis method which is the election method for evaluating ischemic heart disease and is mostly used in children and adult patients .The inflow\u2013outflow cardiac dissection method can show any structural anomaly of the fetal heart and is the election method in evaluating fetal hearts by sequential segmental analysis . HoweverCardiac examination is a time-wise demanding procedure and represents a significant reason for increasing the examination time for small gestational-age fetuses.Due to these facts, we considered introducing another cardiac dissection method, namely the 4CCD method, as an examination tool for small gestational-age fetuses .To our best knowledge, the utility of the four-chamber view method for fetal cardiac examination was not evaluated until now. Although it was described previously as a dissection technique, its use was considered to bring less information compared to other dissection techniques .Autopsy has been generally accepted as the gold standard when evaluating the accuracy of any diagnostic tool. To evaluate a new dissection method, it is required to have a different examination tool proven to give diagnostic results comparable to standard examination. The inflow\u2013outflow method is the accepted standard pathologic examination of the fetal heart .Since applying two different dissection methods on the same organ will not allow for proper assessment of the organ, we took into consideration post-mortem fetal cardiac imaging. Considering that conventional 1.5T and 3T magnetic resonance imaging (MRI) magnets currently used in clinical setting have shown lower accuracy in examining fetuses below 16 weeks of gestation ,9, we coThe proved diagnostic accuracy of 7T MRI in examining fetal hearts lead to the decision of using fetal pm-MRI examination at 7T as the standard to evaluate the efficiency of the post-mortem examination of small fetal hearts using the 4CCD method.The aim was to evaluate if the 4CCD method can visualize standard cardiac structures compared to pm-MRI examination at 7T. Considering that the 4CCD method can examine only few transversal sections of the fetal heart, a second objective was to verify the ability of the 4CCD method to assess the malformative status of the evaluated cardiac structures compared to pm-MRI cardiac examination at 7T. Twelve consecutive second trimester fetuses with a gestational age ranging from 13 to 19 weeks of gestation (WG), calculated from the date of the last menstrual cycle, were included in this study. All fetuses resulted from therapeutic termination of pregnancy (TOP) due to plurimalformative syndromes or chromosomal anomalies carried out using prostaglandins administered locally and orally in 1st Clinic of Obstetrics and Gynecology Cluj-Napoca, Emergency County Clinical Hospital Cluj-Napoca, Romania, according to the internal protocol of the department. None of the pregnancies referred for therapeutic termination of pregnancy were for antepartum fetal death. After delivery, all cases were referred to IMOGEN\u2014the Medical Research Institute within Emergency County Clinical Hospital Cluj-Napoca, Romania\u2014between January 2015 and December 2017 for fetal autopsy and imagistic post-mortem examination.The study protocol was approved by the \u201cIuliu Hatieganu\u201d University of Medicine and Pharmacy Ethics Committee, Romania (no. 306/12 July 2017). Written informed parental consent for the scientific use of patient data was obtained before the imagistic and conventional autopsy procedures. All cases were handled according to the Human Tissue Act (2004).Prior to pathological examination, all fetuses were immersed in 10% formalin solution at room temperature for 48 h to 1 week for proper fixation according to the internal protocol of the Pathology department of IMOGEN and stored in a refrigerator at 4\u00b0 Celsius until transportation at the National Magnetic Resonance Centre for whole-body analysis using a 7 Tesla Bruker Biospec 70/16 USR with a high magnetic field gradient unit , using a turbo spin-echo high-resolution T2-weighted imaging (T2 WI) protocol.In the present study, we included fetuses without autolysis scanned at 7T with interpretable pm-MRI images of the heart and in which pathologic examination of the fetal heart was performed using the four-chamber view cardiac dissection method . The post-mortem fetal imaging scan at 7T required a medium time of 2 h and 30 min. The images were acquired in axial, sagittal, and coronal sections for 3 regions: the head and neck, thorax and abdomen, and pelvis. A 1H volume coil with an inner diameter of 60 mm was used. Details regarding fetuses\u2019 positioning and the pilot protocol used for pm-MRI at 7T were described in previous research . The seqAll images were analyzed by one radiologist with expertise in fetal and pediatric examination and by one embryologist with experience in embryo and fetal imaging blinded to the prenatal ultrasound results. The images were processed with the GE AW Workstation 4.6 . Each specialist analyzed all images separately and the final diagnosis was approved by both specialists. The agreement index was not considered due to the different specialties of the imaging evaluators. According to Anderson and Shirali in the sFourteen distinct anatomical structures were evaluated by both examination methods: caval veins, pulmonary veins, the right atrium, the left atrium, the interatrial septum, the tricuspid valve, the mitral valve, the right ventricle, the left ventricle, the interventricular septum, the infundibulum, the pulmonary artery, the aorta, and the arterial duct.For each structure, the imagists examined normal or abnormal morphological aspects and mentioned the observed abnormal morphological aspects. The data set included 168 structures (12 cases \u00d7 14 structures for each case). All items included were properly visualized using pm-MRI.Following the post-mortem MRI examination, all fetuses were submitted for pathologic examination. Cardiac examination using the 4CCD method included two steps: first, a macroscopic external examination of the fetal heart and, second, a four-chamber view dissection followed by microscopic examination of the four chamber view sections. External heart examination and assessment of great vessels were performed using an Olympus SZ61 stereomicroscope with standard specifications, a magnification from 0.67\u00d7 to 4.5\u00d7, a zoom ratio of 6.7, a working distance of 110 mm, and a tube tilting angle of 45\u00b0, without auxiliary objectives. Macroscopic images were captured using a Canon EOS 1200D camera and EOS Digital Solution Software for image acquisition. After external examination, two longitudinal sections were performed parallel with the diaphragmatic surface of the heart, as depicted in For very small fetal hearts weighting below 1 g, due to the very soft consistency of the cardiac tissue even after proper fixation, following macroscopic examination and prior to sectioning, the whole heart was submitted to the tissue processing protocol described previously, thus obtaining a firm consistency that allowed for proper sectioning of the fetal heart. The longitudinal sections followed the same landmarks we used for hearts with weights equal or above 1 g.Three serial sections were obtained from each paraffin block and stained with hematoxylin-eosin. For the microscopic examination, we used an Olympus BX46 clinical microscope with an LED illuminator configured with a 2\u00d7 plan apochromatic objective and dedicated image acquisition camera as well as software. To obtain panoramic views, representative slides were scanned using a slide scanner with 20\u00d7 Plan-Apochromat objective. The images were acquired using dedicated digital slide viewer software . Due to inclusion and sectioning techniques, microscopic sections of the inferior side of the heart were a mirrored view of the macroscopy because the section was flipped over during the paraffin embedding. For the other two sections, the left\u2013right sides corresponded to the external cardiac view, as depicted in The pathologic four-chamber examination protocol is described schematically in \u00ae, the R package add-in for R Commander [For statistical analysis Microsoft Excel 2016ommander were useIn order to evaluate the efficiency of the four-chamber view cardiac dissection method of small fetal hearts compared to pm-MRI at 7T, the Sensitivity (Se), Specificity (Sp), Positive Predictive Value (PPV), Negative Predictive Value (NPV), accuracy, and their 95% confidence intervals were calculated using the R package add-in for R Commander and the The data supporting the findings described in this study are available from the corresponding author upon reasonable request.The cases comprised in our group had a median gestational age (WG) of 16.5 weeks and mean gestational age of 16.08 weeks \u00b1 2.07SD, with a median fetal weight of 89 g and mean fetal weight of 118.33 g \u00b1 98.52SD, as well as a median fetal heart weight of 1 g and mean fetal heart weight of 1.2 g \u00b1 1.1SD. The detailed characteristics of all the cases included in our study, pm-MRI findings, and 4CCD findings, along with the complete autopsy findings, are presented in In all the studied cases, 4CCD identified the superior and inferior vena cava, pulmonary veins, right and left atria, right and left ventricles, interventricular septum, aorta, and arterial duct.The 4CCD failed to completely visualize four structures out of the 168 examined structures, representing 2.38% of all the examined structures, as follow: in one case of 17 WG with 1 g of the heart the interventricular septum; in one case of 13 WG and a fetal heart weight of 0.26 g, the interatrial septum; and in another 13 WG fetuses with 0.12 g of the heart, the interventricular septum and tricuspid valve. In all cases, the examination of these structures was compromised by oblique sectioning of the fetal heart. Pm-MRI at 7T confirmed the normal anatomy in the first two cases (case No. 5 and case No.10). In the third case, the incorrect macroscopic sectioning led to an incorrect diagnosis of the hypoplastic left ventricle (case No. 9). k = 0.45, revealing a moderate agreement between the two methods.The 4CCD method has identified the anatomic cardiac structures of interest as compared to pm-MRI at 7T with an overall accuracy of 95.8% , demonstrating a Se of 95.8% and Sp of 100% , as well as a PPV of 100% and PNV of 30% . Additionally, the Cohen\u2019s kappa coefficient of correlation was k = 0.7, underlining an excellent concordance between the two methods.When we assessed the malformative status of the examined cardiac structures, the overall diagnostic accuracy of 4CCD compared to pm-MRI at 7T (used as the golden standard) in detecting cardiac anomalies of the examined structures was 91% , with a Se of 67.6% , Sp of 97% , PPV of 85.2% , and NPV of 92.2% . Cohen\u2019s kappa coefficient of agreement was All hearts diagnosed as normal by pm-MRI at 7T were also diagnosed as normal by 4CCD. Most differences were related to the subjective interpretation of diameters and wall thickness, as follows: In case No.7, pm-MRI diagnosed pulmonary artery stenosis and arterial duct stenosis, while 4CCD interpreted the heart as normal. In case No.8, both methods visualized aortic stenosis but pm-MRI also diagnosed a left ventricle hypertrophy and dilation of the left atrium, which 4CCD failed to diagnose. In this case, 4CCD diagnosed a millimetric ventricular septal defect. In case No.11, both methods diagnosed the complete atrioventricular canal but pm-MRI also diagnosed a hypoplastic left ventricle as well as an overriding aorta and arterial duct agenesis. Comparative images with observed lesions are depicted in The present study demonstrates that the 4CCD method can properly visualize standard cardiac structures and evaluate their malformative status in late first and second-trimester fetuses with an average weight of 89 g.As expected, there was a difference between the efficiency markers, with the 4CCD method having a higher accuracy in detecting anatomic cardiac structures ) and a lower accuracy of 91% in assessing their malformative status. As opposed to pm-MRI, the 4CCD method allows for examination of only few cardiac sections and some small cardiac anomalies could be missed at microscopic examination. Additionally, as further presented, an incorrectly performed section could lead to misdiagnosis or incomplete diagnosis.In our study, we observed overall good Se ) and Sp ) in identifying cardiac anatomic structures. The effectiveness of the method was increased due to the combination of macroscopic and microscopic examinations since the anatomic structures evaluated macroscopically had a Sensitivity and Specificity of 100%.When assessing diagnostic accuracy, the lowest sensitivity rate of 25% (95% CI 0.63\u201380.59) was observed in examining the arterial duct. Even though it was one of the structures examined mostly macroscopically, due to a normally extremely small diameter of the arterial duct and lack of normal standards for the vascular diameter according to gestational age, macroscopic evaluation of a slightly dilated arterial duct (1.4 mm measured by pm-MRI) is difficult to assess. Other small sensitivity rates were observed in the evaluation of the right atrium, right ventricle, interventricular septum, left ventricle, and pulmonary artery. In all cases, the discordance was due either to difficulties in the pathologic evaluation of the diameter and thickness of the cardiac structures due to the lack of normal standards for gestational age, or misdiagnosis due to the oblique macroscopic sectioning of the fetal heart. In seven out of the 14 examined anatomic structures, the Se was above 80%.Pm-MRI images at different levels give a useful overview of vascular and cardiac chambers\u2019 diameters that can easily highlight a dilated or stenotic structure . As oppoA complete diagnostic agreement between pathology and pm-MRI was only of 33.33% in cases with a gestational age of 13 weeks and higher in cases with a gestational age above 16 weeks. This was due mostly to the fact that in the group with fetuses of 13 weeks of gestation, two out of the three cases had complex cardiac anomalies. Additionally, partial agreement was observed mostly in cases with either complex cardiac anomalies or with dilation or stenosis of diverse structures. We had no case of complete disagreement between the pathology and pm-MRI diagnosis in our study. Although the time needed for the microscopic examination of the cardiac sections was longer than the microscopic evaluation of the myocardium after conventional cardiac dissection, we empirically observed an overall shorter time for the cardiac evaluation in very small fetal hearts. Additionally, the fetal cardiac examination using the 4CCD method retrieved good results, did not require any special equipment, and was performed using standard dissection equipment found in any pathology service.Compared to the standard inflow\u2013outflow dissection method, which is considered to be the gold standard for fetal cardiac examination as it can evidentiate any structural cardiac anomaly, the 4CCD method had an accuracy of 91% in detecting cardiac anomalies. We consider that conventional dissection should be used whenever possible. However, when the examination of small fetal hearts by conventional dissection is difficult due to maceration or increased tissular friability, or impossible due to the absence of specific medical instruments and trained specialists, the 4CCD method is a suitable alternative for the post-mortem evaluation of the fetal heart. The proposed 4CCD method has the merit to be easily performed following easily identifiable anatomic landmarks, does not require trained fetal pathology specialists, and can be performed even on extremely friable or small fetal hearts where the inflow\u2013outflow method is difficult, if not impossible, to perform. In our study the prolonged formalin fixation time was required to allow for pm-MRI examination at 7T without tissue damage, especially for very small fetuses (15). Prolonged formalin fixation is known to cause an increased tissue consistency that, in the case of the 4CCD method, would facilitate proper cardiac sectioning (19). In our study, we had only fetuses with a low degree of maceration. We consider that the 4CCD method could be appliable even to severely macerated small fetal hearts that maintain soft consistency and increased friability even after prolonged formalin fixation using the adapted 4CCD protocol for fetal heart weights below 1 g. However, further studies are required to assess its accuracy considering the tissular changes that appear secondary to maceration that could influence the microscopic examination of the cardiac sections.The main limitation of this study was represented by the small number of cases and the lack of normal values for the fetal cardiac structures according to the gestational age, which made the appreciation of slightly dilated or stenotic anatomic structures difficult since it was highly subjective. A limitation of the method is the fact that a good evaluation is highly dependent on correct macroscopic sectioning of the fetal heart. As observed previously, an oblique macroscopic sectioning can lead to incomplete visualization of several structures and to the possibility of either a misdiagnosis of lesions or overdiagnosis of normal structures as pathologic. Still, we observed that in all cases where correct sectioning of the fetal heart was achieved, all targeted anatomical structures were well visualized and properly evaluated morphologically. This study showed that the 4CCD method can be used as an alternative to the conventional inflow\u2013outflow dissection method of fetal hearts with a median weight of 1 g. Compared to pm MRI, the 4CCD method of fetal hearts showed very good efficiency in identifying all the targeted anatomical structures. More reserved results were obtained for the evaluation of the malformative status, though most discrepancies were related to the subjective appreciation of diameters."} +{"text": "In this paper, we present a case study of Pakistan documenting the use of antimicrobial drugs in poultry flocks in the VetCAb-ID database. Unlike other databases, this system allows international users to upload their data directly. Based on expert interviews and a review of the latest publications on the topic, we provide an alternative approach to harmonizing data collection among countries. This paper will provide impetus to formulate joint requirement documentation for an AMU database on a global level that international users can adapt for their own purposes and projects. In recent years, Pakistan has upsurged its ambitions to combat the antimicrobial resistance (AMR) of bacterial pathogens. Monitoring antimicrobial drug usage (AMU) at the farm level is the first and indispensable step to achieving this goal. This case study presents how the international VetCAb-ID database was used and adapted for the digital monitoring of AMU in Pakistan. Monitoring AMU in the database presented here involves the systematic documentation of data such as frequency, amount and active components of antibiotics, animal species treated, periods of harvesting and other additional data points. Bringing data together facilitates the analysis of metrics such as treatment incidence and daily dose of drugs used, providing benchmarking measures for farms, regions and countries with regard to AMU .Part of this study focuses on organizing the direct data input of VetCAb-ID users and thus follows a recent shift in perspective within the community. While analyzing AMU/AMR was used to develop corresponding policies for collective action, discussions are now moving towards elaborating how to generate a common digital infrastructure to collect data on a global scale or the World Organisation for Animal Health (WOAH) global databases ,3,4,5). This study elaborates on this assumption and aims to share experiences of using the international VetCAb-ID database in Pakistan. For example, challenges, benefits, sketches from the database, user roles and examples of data from two farms in Pakistan are provided and discussed. To compare and contrast the findings of this case study with the results of previous case studies, a literature review was conducted. Here, we have found that VetCAb-ID is one of the few databases that allows users to collect primary data through direct entry. Hence, the challenges and solutions presented may be seen and discussed as an alternative data collection approach to consider for future shared global databases.The results of this study begin with findings from the literature review, which describe the types of shared databases and related challenges and benefits that have already been discussed in the literature. Subsequently, results from our case study, including the expert interview and descriptive analysis of the poultry data of Pakistan in VetCAb-ID, are provided.In general, publications evaluate databases for AMU/AMR at the farm or natioA feasibility study of a data collection system in Germany was published at the national level. The system was considered adequate when the data allowed for comparisons among specific entities, the calculation of descriptive statistics and the analysis of how to generalize upon the results . HoweverSimilarly to the German study , the benAnother topic that is frequently discussed is the quality of the collected data. Lastein et al. focus onWith regard to data quality, another aspect that is discussed is how illiteracy influences the data collection process, impacting both the ability to read and understand the importance of reporting certain details about the process or antibiotics administered for database documentation ,14. BesiIn a joint study by the University of Agriculture in Faisalabad (UAF) and the Department for Biometry, Epidemiology and Information Processing (IBEI), the feasibility of monitoring AMU using VetCAb-ID was assessed. This section begins with a description of the basic features of the database. In the next section, interview results regarding the documentation process, starting at the farm level, will be presented.VetCAb-ID is a database used at a global level that aims at providing a web-based infrastructure to users in the field of AMU in the veterinary field (see more context information in the \u201cMethods\u201d section). As one of the first steps, the administrators of the IBEI set up a domain for users to enter and analyze data jointly. A domain can be a project at a national, regional or university level and may or may not allow other domains to view or use the data within that domain. The database offers a set of basic forms to file farms , harvesting periods and treatments for these animals. To file treatments, animals and farms, the database offers predefined items that can be modified if they are incomplete for a domain. For each user, the database provides an overview of filed farms, veterinarians supervising the farms, animals and therapies (treatments) filed during a certain period see .Preparing the VetCAb-ID database for international users requires extensive translation and discussions about appropriate terminology and the extent to which data input is compulsory. Moreover, defining roles and distributing rights in the database for administrators, domain or data editors and readers of entries in the database is needed to establish data security issues.To overcome the common challenges faced by new users, three paper-based manuals and online training videos have been created and shared to explain how to use the VetCAb-ID database. The manuals address project norms, rights, legacies and data structures. They provide a checklist for what to consider when setting up the database and which user roles may be distributed. Roles include, for example, administrators , domain editors , data editors (who are project members and may enter therapy data for farms) and readers .Besides written manuals, learning videos are available to explain and demonstrate how to use VetCAb-ID and how to analyze and export data from the platform . Figure Once users are familiarized with VetCab-ID, the database supports correct data input through the use of automated and manual quality checks. These checks comprise the provision of lists for entries of drugs, animals, dose units and indications, among other prefilled entry fields . In cases of false entries, the user is informed see and may In summary, the main challenge during the development of VetCAb-ID for international users was to balance adaptive and predefined entry functionalities needed to harmonize data across domains on the one hand, while being responsive to domain/country-specific needs on the other. Furthermore, a balance between the administrative leadership of the IBEI (as the provider of the platform), the data sovereignty of the domain leaders and the distribution of rights across domains had to be found.In the joint study by the UAF and IBEI, AMU documentation begins with field veterinarians in Pakistan (poultry consultants), who first take notes and record data on-site at farms. The objective of documenting data on-site at farms is to overcome the lack of antimicrobials sales data, a common challenge in low- and middle-income countries (LMICs) . The vetThe team at the UAF consists of several researchers. Two people enter the data from the forms into the VetCAb-ID database and the other people collect the information on antimicrobial product details from the retail market or through online searching. Since data can be entered into VetCAb-ID directly, the database is used as a project repository without the need for additional infrastructure or systems. The database allows for data to be exported in interchangeable formats so it can be further used in analysis systems.Due to the challenges that appeared during the use of VetCAb-ID in Pakistan, administrative aspects need to be mentioned. One example is IBEI\u2019s decision to keep the right to edit or remove incorrect entries to maintain database consistency. The UAF considered not having the right to edit and remove incorrect entries in the VetCab-ID platform a challenge. Small typos could not be corrected independently. Instead, an email needed to be sent to ask the administrator to solve the issue.In general, the UAF indicated that additional, more predefined forms would be needed in order to standardize data monitoring in the field. One reason is that the required information for AMU/AMR is not readily available in Pakistan, and the more information that is filed at the farm level, the more complete the records that are filed online can be. A second reason is that a harmonized form would enable it to be shared across multiple projects if this approach were to be scaled on a national level. For example, duplications of entries could be avoided.Concerning the documentation process, another challenge for the UAF was explaining to farmers (and veterinarians) why information such as the brand and the total amount of active ingredients in an antimicrobial drug needed to be recorded in detail. Explaining why recording is significant touches upon the common understanding of the importance of how AMU is protecting both local and global health. Related to this point, the UAF indicated that a commitment to report in a timely manner was a challenge:\u201cFor field veterinarians the collection of antimicrobial usage data on our given preforms was not their main priority. Since data collection was voluntary, sometimes we faced difficulties in getting data timely as it was not compulsion. Furthermore, the COVID-19 outbreak also affected the logistics and slowed the data collection and entry\u201d\u2014Expert.To overcome the aforementioned challenges, the UAF suggested shifting from paper-based data gathering to a digital application to report data directly. The system would create entries in the local languages and farmers would be able to create entries themselves. Real-time, direct reporting is considered an incentive, which leads to increased commitment:\u201cIt helps farmers to keep the farm records and to compare among different flocks and months\u201d\u2014Expert.To increase support, urging the Government of Pakistan to devise legislation and to direct farmers to record and report the AMU data was considered a step to overcome these challenges.Regarding the VetCab-ID database, a simpler web-based database with a holistic approach is the target. However, when asked about the benefits of using the platform, an expert summarized them as follows:\u201cEarlier studies from our research group in Pakistan have studied antimicrobial usage data using treatment record and garbage-bins studies from food animals. Now our pilot VetCAb-ID project has provided us the first digital database of common antimicrobials brands, products and their indication in dairy and poultry farms in Pakistan. We are able to see descriptive results at the end of analysis.\u201d\u2014Expert.More information about entering and using specific data and their related benefits will be outlined in the next section.For the UAF, using the VetCAb-ID platform is their first time using an international platform for recording data on AMU. As outlined in the previous section, using the database presented a challenge because the requested data were not readily available and needed to be generated first:\u201cWe added more than 146 antibiotics brands, composition, and dosage forms in the database.\u201d\u2014Expert.On the other hand, having this data filed offers benefits due to the resulting depth of information and results over time. Moreover, the antibiotics filed can be shared across domains , which reduces the need to generate new data. Further reported benefits relate to descriptive outputs such as:\u201cThe number of therapies, treatment frequencies (TF) and indications (diseases/prophylaxis). As researchers, this helped us in better understanding of collecting and reporting AMU data and the very details to consider in implementing AMU surveillance at farm-level or national level.\u201d\u2014Expert.In previous papers, AMU data were estimated on the basis of import/export data from the Pakistan Customs Authority . As showA beneficial feature of the database that can be observed in this respect is that entries are linked automatically to a corresponding identification number (ID) in the VetCAb-ID platform. Since the ID lists can be accessed, modified and exported with the domain database sheets, this documentation eases later data processing and analysis . Moreover, IDs such as the drug name are linked to other information in the VetCAb-ID database . Hence, based on the drug name, the database allows the user to analyze related information that has not yet been manually entered from a single data point entry.Here, we present a case study of VetCAb-ID being used for documenting poultry data in Pakistan. Although Pakistan uses the database for more than one animal species, and despite the fact that VetCAb-ID is used by several countries, we chose to begin with this focused and qualitative case study in order to highlight the process of data entry and specific system features. To avoid the risk of presenting incomparable results, we conducted a screening literature review to align our results with the findings in other projects. In this regard, we found that our case study provides one of the first user reviews of an international database for AMU documentation. While previous publications have focused on comparing the functionalities between databases across different countries or methods, this study elaborates on the feasibility of monitoring starting in stables. Future studies should provide systematic literature reviews and multiple case studies to increase the generalizability of the findings. Specific topics related to the discussion of our results are addressed in the following section.Regarding the documentation process, our study found that a paper-and-pen approach to recording data in stables is sufficient in Pakistan. Although commitment to submit related documents in a timely manner is an issue, data can be uploaded online regularly by the UAF team. In the future, current users in Pakistan aim to document AMU in stables with the help of digital systems. Since infrastructure may be a severe challenge to documentation as outlined in previous studies ,17 and sIn relation to the digital input of primary data, another surprising result of this study is that VetCAb-ID seems to be one of the few global databases that allows users to collect, save, export and use their data independently . Hence, regarding the discussions in the literature on whether to extend the harmonization of data records ,4,8, thiThis case study does not provide a discussion on how AMR or One Health data can be integrated and documented in a joint approach e.g., ,20). Fur. Fur20])This publication is embedded in the project \u201cVeterinary Consumption of Antibiotics-International Documentation\u201d (VetCAb-ID). The project runs under the umbrella of the WHO Collaboration Center for research and training on health at the Human\u2013Animal\u2013Environment Interface (WHO CC HAEI) at the IBEI of the University of Veterinary Medicine Hannover (TiHo). The long-term goal is to establish a concept for a One Health approach and to report AMU and AMR data jointly online. The database (VetCAb-ID) for this project is hosted by the IBEI. It was built in response to a sentinel approach of collecting antimicrobial usage data in German farms . CurrentThe data for this publication stems from a joint feasibility study of the UAF in Pakistan and Germany. The key research question is: What can we learn from using an internationally shared database for documenting the use of antimicrobial drugs across countries? The study design to answer this question is a mixed-method case study.A case study is a systematic compilation of entities bound, for example, by a project ,22. In tThe UAF in Pakistan has been one of the active partners using VetCAb-ID since the end of 2020. In LMICs, documenting the use of antimicrobial agents is rare. Pakistan has expanded its activities to address the overuse of antibiotics, especially since a significant part of the WHO-classified high-priority critically important antimicrobial (HPCIA) agents in human medicine are used in farm animals. In 2017, a National Action Plan was lauTo consider the latest publications on the topic, a screening literature review was performed following Webster and Watson . KeywordTo provide an adequate account of the experiences with the VetCAb-ID database in particular, the UAF team acted as experts in an interview . A briefTo illustrate the functionalities of VetCAb-ID, extracts from the database and a descriptive analysis of the data in VetCAb-ID for poultry farms in Pakistan were generated. The study population stems from two large-scale commercial broiler farms with more than 25,000 chicken birds. The farms are providing AMU data on a voluntary basis. In total, two or three poultry production passages at each farm were documented. The type of poultry is defined as chickens (age: 0\u201342 days) raised for meat production. While the information about the farm, species and periods is filed in advance by the UAF, the data about therapies are filed by veterinarians, provided to the UAF, entered by UAF members in the database and cross-checked by IBEI members. The main calculations focus on the average treatment frequency (TF). The TF is calculated by adding up the number of recorded therapies, considering the active substance in drugs, and dividing by the population size :TF = \u2211 nThis definition (1) is in line with treatment incidence, but it assumes UDD instead of DDD and body weight under therapy instead of average body weight ."} +{"text": "Physician wellness is critical for patient safety and quality of care. Coaching has been successfully and widely applied across many industries to enhance well-being but has only recently been considered for physicians. This review aimed to summarize the existing evidence on the effect of coaching by trained coaches on physician well-being, distress and burnout. MEDLINE, Embase, ERIC, PsycINFO and Web of Science were searched without language restrictions to December 21, 2022. Studies of any design were included if they involved physicians of any specialty undergoing coaching by trained coaches and assessed at least one measure along the wellness continuum. Pairs of independent reviewers determined reference eligibility. Risk of bias was assessed using the Cochrane Risk of Bias Tools for Randomized Controlled Trials (RCTs) and for Non-randomized Studies of Interventions (ROBINS-I). Meta-analysis was not possible due to heterogeneity in study design and outcome measures as well as inconsistent reporting. The search retrieved 2531 references, of which 14 were included . There were 1099 participants across all included studies. Risk of bias was moderate or serious for non-RCTs, while the 5 RCTs were of lower risk. All quantitative studies reported effectiveness of coaching for at least one outcome assessed. The included qualitative study reported a perceived positive impact of coaching by participants. Evidence from available RCTs suggests coaching for physicians can improve well-being and reduce distress/burnout. Non-randomized interventional studies have similar findings but face many limitations. Consistent reporting and standardized outcome measures are needed. Physician burnout represents a profound and longstanding epidemic in healthcare, with rates reported to be 1.5 times higher than the general US working population (37.9% vs. 27.8%) ) and 5 reported a decrease in overall burnout (n participants = 505 [48%]) . Four ofIncreased resilience of coaching participants was observed by three studies (n participants = 193 [18%]). Each of the outcomes\u2014psychological capital (n participants = 172 [16%]), work engagement (n participants = 172 [16%]), emotional well-being (n participants = 279 [26%]) and job retention (n participants = 190 [18%])\u2014were reported to improve after participation in the coaching intervention by 2 studies . ImproveIn the sole included qualitative study by de Lasson et al., participThis systematic review identified 14 studies assessing the effect of coaching on physician wellness and burnout. Five of these studies were RCTs at relatively low risk of bias, while the included non-randomized interventional studies were mostly at moderate or serious risk of bias. Across all studies, coaching was observed to improve several outcomes related to wellness, including work/life balance, quality of life, resilience, job satisfaction, work engagement, empowerment at work, and psychological capital. Coaching was also generally observed to decrease emotional exhaustion, distress, and burnout.The definition of coaching used in included studies was relatively homogeneous, as could be expected based on our inclusion criteria which rigorously adhered to the International Coaching Federation definition of coaching . AlthougIn order to effectively make comparisons, standardized reporting and outcome measures are also needed. The included studies assessed a wide range of outcome measures and designs. Baseline and post-intervention proportions of the outcome measures were also not regularly reported. The heterogeneity in outcome measures among the included studies may reflect the lack of consensus in the broader literature regarding the best way to conceptualize and assess physician wellness . Given tAnother consideration for reporting is to disaggregate results by relevant participant characteristics, such as sex, gender, and ethnicity. One of the included studies observed differential effectiveness of coaching by sex and ethnicity of participants, while other studies did not report results across these variables. Recent studies document that the prevalence, presentation, and factors contributing to burnout can vary by race/ethnicity, gender, and sexual orientation \u201348. ConsThis review identifies five RCTs at relatively low risk of bias that show evidence supporting the effectiveness of coaching for physicians. There are some limitations based on inconsistent and incomplete reporting were common across the included studies. In addition, most studies were not RCTs, and these were all at moderate to serious risk of bias. Nevertheless, this review addresses an emerging and promising intervention for physician wellness at a time when levels of distress and burnout are on the rise. It also identifies key gaps for future research on coaching to address.Based on the available evidence, coaching may be a promising intervention for improving physician wellness but requires further study to precisely determine its optimal delivery and effectiveness. Additional RCTs with standardized reporting and outcome measures, sub-group analyses, and qualitative exploratory work are needed. At the same time, coaching may be an appealing intervention to clinicians given its flexibility and strengths-based approach. Should future research conclusively support its effectiveness for improving physician wellness, healthcare organizations may wish to facilitate coaching as part of their wellness programs for physicians.Evidence from available RCTs suggests coaching for physicians can improve well-being and reduce distress/burnout. Non-randomized interventional studies have similar findings but face many limitations. Consistent reporting and standardized outcome measures are needed.S1 Appendix(DOCX)Click here for additional data file.S1 Checklist(DOCX)Click here for additional data file."} +{"text": "The treatments included a vertical shoot position (VSP), two modified VSPs (VSP60 and VSP80), a single high wire (SH), a high quadrilateral (HQ), and a Guyot pruned VSP (GY) combined with 25%, 50%, and 100% ETc water replacement. The SH had greater yields, whereas HQ was slower to reach full production potential. At harvest in both years, the accumulation of anthocyanin derivatives was enhanced in SH, whereas VSPs decreased them. As crown porosity increased (mostly VSPs), berry flavonol concentration and likewise molar % of quercetin in berries increased. Conversely, as leaf area increased, total flavonol concentration and molar % of quercetin decreased, indicating a preferential arrangement of leaf area along the canopy for overexposure of grape berry with VSP types. The irrigation treatments revealed linear trends for components of yield, where greater applied water resulted in larger berry size and likewise greater yield. 25% ETc was able to increase berry anthocyanin and flavonol concentrations. Overall, this study evidenced the efficiency of trellis systems for optimizing production and berry composition in Californian climate, also, the feasibility of using flavonols as the indicator of canopy architecture.Grape growing regions are facing constant warming of the growing season temperature as well as limitations on ground water pumping used for irrigating to overcome water deficits. Trellis systems are utilized to optimize grapevine production, physiology, and berry chemistry. This study aimed to compare 6 trellis systems with 3 levels of applied water amounts based on different replacements of crop evapotranspiration (ET Grapes are profitable fruit crop that are widely grown in the state of California, with an increasing need to accomplish cultural tasks mechanically . HoweverGrape berry and wine quality are determined by the composition and concentration of secondary metabolites accumulated in berries. Flavonoids are the most abundant secondary metabolites and contribute to many quality-determining traits, including color, mouthfeel, and aging potential of wine . There aIn viticulture, trellis system selection is a critical aspect grower needs to consider when establishing a vineyard. An ideal trellis can promote grapevines\u2019 photosynthetic capacity through optimizing light interception by the grapevine canopy. Most importantly, a suitable trellis can optimize canopy microclimate by providing sufficient solar penetration into canopies since solar radiation is necessary to enhance the berry composition without c) can significantly modify polyphenolic and aromatic profiles in wine . In someulation) . Moreoveulation) . On the ulation) . As a reTherefore, the objectives of this study were to evaluate and compare 6 different trellis systems in combination with 3 irrigation strategies to understand the impact of trellis system and applied water amount on canopy architecture, grapevine physiology and berry composition. We hypothesized that traditional VSP systems would not be as efficient as the other trellis systems in terms of yield production and flavonoid accumulation, leading to greater berry flavonoid degradation and overall lower flavonoid concentrations.Vitis vinifera `Cabernet sauvignon\u00b4 (Clone 8) grapevines grafted on 3309C rootstock (V. riparia \u00d7 V. rupestris). The vineyard for this study was located at the University of California Oakville Experimental Station in Oakville, Napa County, CA, USA and planted in 2016. Grapevines were spaced at 1.52\u00a0m \u00d7 2.13\u00a0m (vine \u00d7 row). The rows had NE-SW orientation.The experiment was conducted in 2020 and 2021 on Weather data at this vineyard was obtained from the California Irrigation Management Information System (CIMIS) . The weather station was located approximately 100\u00a0m from the experimental vineyard block. Growing Degree Days (GDD) were used to assess the accumulated heat units at the experimental site, and calculated with the following equation :where negative values were not included in the accumulated GDD value, and the time period recorded for the calculation was from 1 April until harvest in each year.The study was conducted in a split-plot factorial design that utilized 2 separate sets of factors. The main factors of the experiment were 6 trellis systems randomly combined with 3 different water amounts applied at random to each row with 4 replications in each treatment, which consisted of seven vines. There were 72 treatment-replicates in total. The main plot factor (trellis systems) was applied to every row, and the sub-plot (applied water amounts) was applied randomly to 7 consecutive vines within each row so that 3 separate irrigation sub-plot factors were contained in every row within the vineyard block. The 5 middle vines in each treatment-replicate were used for on-site measurements as well as berry sampling.6 trellising systems were used for the measurements in this experiment . The applied water amounts used in this study were to replace 100% crop evapotranspiration (ETc), 50% ETc and 25% ETc. These treatments were applied by varying the emitter numbers per vine with irrigation duration determined based on 100% ETc treatment. NETAFIM\u2122 pressure compensating on-line button drippers were installed to apply different rates of irrigation: 2 drippers with a rate of 4 L/h at each vine to simulate 100% ETc replacement, 2 drippers with a flow rate of 2 L/h at each vine to simulate 50% ETc replacement, and 2 drippers with a flow rate of 1 L/h to simulate 25% ETc. In total, 100% ETc treated grapevines received 308\u00a0mm and 246\u00a0mm of water in 2020 and 2021, respectively.where ET-1 (mean \u00b1 one standard deviation from the mean) in 2020 and 1764.85 \u00b1 287.84 \u03bcmol mol-1 (mean\u00a0\u00b1 one standard deviation from the mean) in 2021. CIRAS-3 was set to a relative humidity at 40% and a reference CO2 concentration at 400 \u03bcmol mol\u22121. From the measurement, leaf net carbon assimilation (Anet) and stomatal conductance (sg) were assessed directly. Intrinsic water use efficiency (WUEi) was calculated as the ratio between gs to Anet.At mid-day (between 12:00 \u2013 14:00 h), leaf gas exchange measurements were taken bi-weekly in both seasons to assess leaf photosynthetic activities as well as plant water status by using a portable infrared gas analyzer CIRAS-3 . Each time, three different fully sun-exposed leaves were selected from the main shoot axis on the middle three grapevines in each treatment-replicate. In both years, the measurements were taken when sunlight condition were at photosynthesis saturation levels, where the average photosynthetic active radiation (PAR) was approximately at 1708.43 \u00b1 282.81 \u03bcmol mol2).Canopy microclimate was assessed using digital photography as previously reported . Crown pClusters were harvested by hand at approximately 23 - 25 \u00b0CBrix, and all clusters in each treatment-replicate were harvested, counted, and weighed on a single harvest day each season . Yield components were assessed or calculated for cluster number per vine, cluster weight, berry fresh weight, leaf area to fruit ratio, and yield per vine.-1 of tartaric acid at the titration end point of pH 8.2 was recorded in the unit of \u00b0CBrix with a digital refractometer . Measurements of the berry must pH and titratable acidity (TA) were determined with an autotitrator and were recorded as g Lf pH 8.2 .g for 15 minutes, and the supernatants were separated from the solids and transferred into HPLC vials after being filtered by PTFE membrane filters . Then, the samples were injected into HPLC for chromatographic analysis.The second subset of 20 berries was used for the determination of skin flavonoids from each individual treatment-replicate. Skins were manually removed from the subset of 20 berries and subsequently lyophilized . After lyophilization, dry skin weights were recorded and then, the dried skins were ground into fine powder with a mixing mill . 50 mg of the freeze-dried berry skin powder were collected, and the skin flavonoids were extracted with 1 mL of methanol:water:7M hydrochloric acid to simultaneously determine flavonol and anthocyanin concentration and profile as previously described by 2, 5\u00a0mm particle size, Agilent Technologies, Santa Clara, CA, United States). The flow rate of the mobile phase was 0.5 mL min-1 and the flow gradient started with 91.5% A with 8.5% B, 87% A with 13% B at 25\u00a0min, 82% A with 18% B at 35\u00a0min, 62% A with 38% B at 70\u00a0min, 50% A with 50% B at 70.01\u00a0min, 30% A with 70% B at 75\u00a0min, 91.5% A with 8.5% B from 75.01\u00a0min to 90\u00a0min. The column temperature was maintained at 25\u00b0C on both left and right sides of the column. All chromatographic solvents were of high-performance liquid chromatography (HPLC) grade, including acetonitrile, methanol, hydrochloric acid, formic acid. These solvents were purchased from Thermo-Fisher Scientific . Detection of flavonols and anthocyanins was recorded by the diode array detector (DAD) at 365 and 520 nm, respectively. Investigated anthocyanin derivatives included di-hydroxylated forms: cyanidin and peonidin, and tri-hydroxylated forms: delphinidin, petunidin, and malvidin; investigated flavonols included a mono-hydroxylated form: kaempferol, di-hydroxylated forms: quercetin and isorhamnetin, and tri-hydroxylated forms: myricetin, laricitin, and syrigintin.Anthocyanin and flavonol concentrations (expressed in the unit of mg per g of berry fresh weight) in berry skin tissues were analyzed with a reversed-phase HPLC with the use of two mobile phases: (A) 5.5% formic acid in water and (B) 5.5% formic acid in acetonitrile. The specific method used for this study required a C18 reversed-phase HPLC column for the analysis . Myricetin-3-O-glucuronide, myricetin 3-O-glucoside, quercetin 3-O-glucuronide, quercetin 3-O-galactoside, quercetin 3-O-glucoside, kaempferol 3-O-glucoside, isorhamnetin 3-O-glucoside, and syringetin 3-O-glucoside used for flavonol identification were purchased from Sigma-Aldrich . Flavonol molar abundant (molar %) was calculated as the percentage of specific flavonol derivatives\u2019 concentration over total flavonols\u2019 concentration.Post-run chromatographic analysis was conducted with Agilent OpenLAB software and identification of individual anthocyanins and flavonols was made by comparison of the commercial standard retention times found in the literature . Malvidipost-hoc test was performed to analyze the degree of significance among the various measurements. The levels of significance \u2264 0.10 were the results that were considered for the Tukey\u2019s post hoc tests. Season-long measurements of leaf gas exchange variables were analyzed for each year via three-way Analysis of Variance using the MIXED procedure of SAS using REPEATED option for measurement dates. A regression analyses was performed between variables of interest and, p values were acquired to present the significances of the linear fittings, as well as the regression coefficient (as R2).The statistical analysis for the experiment was performed using MIXED procedure of SAS . All the datasets were first checked for normal distribution using a Shapiro-Wilkinson test before running the two-way MIXED procedure. A Tukey\u2019s HSD Both seasons were considerably arid as the experimental site only received 233.9\u00a0mm and 276.9\u00a0mm of precipitation from the previous dormant season until harvest in 2020 and 2021, respectively Table\u00a01.LAI and crown porosity were assessed in both seasons, and leaf areas were calculated based on the unit ground area and LAI Figure\u00a02c had higher leaf area than 25% ETc, but there was no difference between 100% ETc with either 25% or 50% , stomatal conductance (gs), and intrinsic water use efficiency (WUEi) . Leaf areas were negatively correlated with these two variables (2 = 3.86E-04, p = 0.870, The relationships between berry skin flavonol concentrations and canopy architecture were investigated in both seasons Figure\u00a05A trellis system selected in grapevine vineyard is usually aimed at optimizing canopy architecture to further maximize canopy photosynthetic activity and improve canopy microclimate, which can yield desirable production and berry composition . In histIn this study, yield per vine was not constantly determined by the trellis systems in both years, although similar bud densities at pruning were achieved. Furthermore, more leaf area did not account for more yield at harvest, despite it was well established that a sufficient leaf area would support fruit development , and in Previous studies have shown that greater leaf area can also contribute to higher TSS accumulation , which wRegarding the applied water amounts, the results were clear and consistent, with increased water status in grapevines irrigated with higher water amounts, and consequently, greater berry weight, cluster weight, and yield. These results agreed with previous studies on the relationships between grapevine water status and yield components . HoweverThere were two flavonoid classes monitored in this study, anthocyanins and flavonols. They are highly sensitive towards environmental conditions . This stAs for flavonols, previous studies have shown that flavonols are very sensitive to solar radiation, especially UV radiation, where more light will often increase flavonol concentration in berry skins . The resc was able to increase anthocyanin and flavonol concentrations in grape berries. One previous study at the same experimental site showed that 25% ETc could potentially increase the possibility for flavonoid degradation and decrease the wine antioxidant capacity (c was able to decrease berry weights, which resulted in higher concentrations in anthocyanins and flavonols.Water deficits, achieved by manipulating applied water amounts through irrigation, can significantly improve flavonoid concentrations in grape berries . Similarcapacity . Howevercapacity . Hence, capacity , but 25%Positive relationships between flavonols and solar radiation, especially UV-B, have been consistently observed in previous research, clearly indicating that more solar radiation penetrating into the canopy interior promotes flavonol concentration in berry skins . Furthervice versa. This approach is not limited only to red cultivars and can also be applied to white cultivars since flavonols are still synthesized in their skin tissues (When the high air temperature or drought conditions became extreme, flavonoids in berry skins started to degrade . For all tissues . Also, fAs growing season temperatures continue to rise in viticultural regions, grape growers are looking for ways to adapt to maintain consistent production volume and quality. However, legislative pressure on grape growers harnessing their ability to extract ground water for irrigation purposes will limit this adaptation. Overall, this study provided evidence of how different trellis systems combined with irrigation strategies affected grapevine physiological development and berry chemical profiles. Our results indicated that SH and HQ trellis systems could enhance the efficiency of grapevine canopy in promoting TSS accumulation and yield as well as higher capacity for flavonol and anthocyanin accumulation in berry skins with less chemical degradation compared to the traditional VSPs. Additionally, we purposely aimed to study the relationships between flavonols and canopy architecture. We observed strong correlations between molar % quercetin, and total flavonol concentration and content with leaf area and canopy porosity, indicating that berry skin flavonols can be feasible indicators for canopy architecture to register berry development in response to solar radiation.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.SK conceptualized and designed the trial. RY, NT, JG, LM, MZ, JT, and SK executed the trial, curated the data. RY and NT wrote the first version of the manuscript. GG and SK revised the manuscript. All authors contributed to the article and approved the submitted version.UC Davis Library has provided partial funding to defray publication costs.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."} +{"text": "Epidemiological, clinical and neuroscientific studies support a link between psychobiological stress and multiple sclerosis. Neuroimaging suggests that blunted central stress processing goes along with higher multiple sclerosis severity, neuroendocrine studies suggest that blunted immune system sensitivity to stress hormones is linked to stronger neuroinflammation. Until now, however, no effort has been made to elucidate whether central stress processing and immune system sensitivity to stress hormones are related in a disease-specific fashion, and if so, whether this relation is clinically meaningful. Consequently, we conducted two functional MRI analyses based on a total of 39 persons with multiple sclerosis and 25 healthy persons. Motivated by findings of an altered interplay between neuroendocrine stress processing and T-cell glucocorticoid sensitivity in multiple sclerosis, we searched for neural networks whose stress task-evoked activity is differentially linked to peripheral T-cell glucocorticoid signalling in patients versus healthy persons as a potential indicator of disease-specific CNS\u2013immune crosstalk. Subsequently, we tested whether this activity is simultaneously related to disease severity. We found that activity of a network comprising right anterior insula, right fusiform gyrus, left midcingulate and lingual gyrus was differentially coupled to T-cell glucocorticoid signalling across groups. This network\u2019s activity was simultaneously linked to patients\u2019 lesion volume, clinical disability and information-processing speed. Complementary analyses revealed that T-cell glucocorticoid signalling was not directly linked to disease severity. Our findings show that alterations in the coupling between central stress processing and T-cell stress hormone sensitivity are related to key severity measures of multiple sclerosis. et al. report that the link between stress-induced brain activity and stress hormone T-cell sensitivity in multiple sclerosis patients differed from that in controls. Simultaneously, this activity was linked to patients\u2019 disease severity. This might suggest that an altered CNS\u2013immune system crosstalk in multiple sclerosis is clinically meaningful.Brasanac The hypothalamic\u2013pituitary\u2013adrenal (HPA) axis and the autonomic nervous system (ANS) are regulators of the key peripheral stress hormones cortisol (HPA) and (nor-) adrenaline (ANS) and both, the HPA and ANS receive regulatory inputs from higher-level brain regions including prefrontal, (para-) limbic and cerebellar regions.21 Furthermore, they found that PwMS has reduced sensitivity to stress hormone regulation in T cells,22\u201324 which may contribute to neuroinflammation. Neuroimaging studies investigated potential mechanisms of disease severity from a systems neuroscience perspective and found that blunted neural stress processing in the anterior insula (AI), a key interface between neural and immune functions,25 is associated with higher clinical disability in a cross-sectional study.10 Additionally, we showed that blunted neural stress processing in limbic brain networks is linked to heightened future brain atrophy accumulated across roughly 1000 days in PwMS in a longitudinal study.26 Thus, although these studies provided first insights into the potential contribution of individual stress (-related) mechanisms, they did not investigate their interplay.Until now, biological mechanisms potentially mediating the association between multiple sclerosis and stress were investigated in an isolated, discipline-specific fashion. Neuroendocrine studies found that impaired regulation of the HPA axis is linked to disease severity.27 impairment of this regulation in stroke28 and the impaired interplay between neuroendocrine stress processing and T-cell GC sensitivity in multiple sclerosis,22\u201324 we first asked whether an altered CNS\u2013immune system crosstalk exists in multiple sclerosis. We tested the corresponding hypothesis (H1) by evaluating whether neural networks exist, whose stress-induced activity is differentially linked to GC-related T-cell gene expression in both groups. Second, we asked whether such an altered CNS\u2013immune system interplay is also clinically meaningful. Following studies underlining the importance of psychobiological stress processing for heterogenous multiple sclerosis severity measures, we thus hypothesized and tested associations between the activity of (i) network(s) fulfilling H1 and four important disease severity measures, i.e. grey matter (GM) fraction (H221), T2-weighted lesion load (H38), clinical disability (H420) and information-processing speed (H529).Consequently, we conducted a study employing an fMRI stress paradigm comprising mental arithmetic with feedback to measure stress-induced alterations in FC reflected by alterations in neural network activity. Additionally, we measured glucocorticoid (GC)-related gene expression in CD4+ and CD8+ T cells as a cellular measure of immune system responsivity to stress hormones. We aimed at answering two key questions. Motivated by findings demonstrating CNS regulation of peripheral inflammation in healthy persons (HPs),Forty-five persons with relapsing-remitting multiple sclerosis (RRMS) were recruited via the Charit\u00e9 outpatient clinics of the NeuroCure Clinical Research Center and the Experimental and Clinical Research Center. Thirty HPs were recruited by advertisements and newsletters. Recruitment and data collection took place between May 2017 and December 2018. Brain imaging took place in the Berlin Center for Advanced Neuroimaging. All participants provided written informed consent before enrolment and received financial reimbursement for their time and effort. Patients visited the outpatient/brain imaging centre for 2 days within a 2-week period .30; (ii) stable treatment with immunomodulatory drugs for the last 3 months [or no disease-modifying treatment (DMT)]; (iii) age \u226518\u2005years; (iv) the physical and mental capability to use the test devices without restriction. Patients were excluded if they (i) were pregnant; (ii) met diagnostic criteria for psychiatric disorders (other than affective disorders including major depression or anxiety disorders); (iii) had a diagnosis or history of neurological disorders (other than multiple sclerosis); (iv) multiple sclerosis relapse or steroid treatment in the last 4 weeks; or (v) had contraindications for MRI scanning. Except for RRMS diagnosis, relapses and treatments, the inclusion and exclusion criteria were the same for controls.Inclusion criteria for patients were (i) meeting diagnostic criteria for RRMSNMS\u2009=\u200939; NHP\u2009=\u200925). This data set serves as a reference for characterizing clinico-demographic sample characteristics. Please see individual analyses for further information on respective sample sizes. The sample size is highly compatible with the sample size in our recent study investigating associations between central stress processing and disease severity measures in multiple sclerosis irrespective of a potential interplay with T-cell GC sensitivity based on independent data set.10 The study was conducted in accordance with relevant guidelines (Helsinki Declaration of 1975) and approved by the ethics committee of Charit\u00e9\u2014Universit\u00e4tsmedizin Berlin (EA1/208/16).After the application of inclusion and exclusion criteria, the sample comprised 66 participants. Following quality assurance steps (preprocessing), 64 had high-quality data for either fMRI or gene expression 32]. Additionally, participants completed the Beck-Depression Inventory (BDI-I33).Patients underwent neurological examination by experienced neurologists . Clinical disability was assessed using Expanded Disability Status Scale (EDSS) and its functional subscales.26 which was derived from previous studies.34 The paradigm comprised five consecutive stages. In three rating periods , the participants reported their current degree of feeling stressed, relaxed, anxious and frustrated on a nine-point scale ranging from \u2018not at all\u2019 to \u2018strongly\u2019 with an MR-compatible response box . Each of these stages had a duration of 2\u2005min. In the second stage , resting ASL fMRI scans and heart rate signals were acquired fMRI stress task comprising mental arithmetic and performance feedback that corresponds to a shortened version of the one used in our work,In Stage 4, the participants were asked to perform a series of subtraction tasks with two operands X and Y depicted in the upper part of a computer screen as fast as possible. In order to solve a task, the participants had to select the single correct answer included in a set of four possible answers depicted in the lower part of the screen with the response box. At the beginning of the paradigm, operand X was equal to 43\u2009521 across all participants. Y ranged from 1 to 99 and was randomly determined across all trials. The stress task was divided into two consecutive stages, i.e. the \u2018Evaluation\u2019 stage (4a) implemented to assess the participants\u2019 personal performance capability (4\u2005min) and the \u2018Feedback\u2019 stage (4b) included to derive neural and peripheral stress-processing parameters (8\u2005min). In the Evaluation stage, all participants had 8\u2005s time to select an answer across all trials, no feedback was provided but response times were recorded. For trials following correctly solved trials, X was equal to the difference X minus Y in the preceding trial. In case of false/too slow answers, X remained unchanged. The Feedback stage differed from the Evaluation stage in three important points. First, the participants\u2019 performance was rated additionally. Specifically, depending on the difference between the fastest correct response of the participant in the Evaluation stage and the response time in a given trial of the Feedback stage, the trial performance was evaluated in terms of school grades ranging from \u20181\u2014sehr gut\u2019(very good) to \u20185\u2014ungen\u00fcgend\u2019 (insufficient). Second, the time provided for response selection (which was 8\u2005s at the beginning of the Feedback stage) was decreased (increased) by 10 per cent in case of correct answers in preceding trials. Finally, third, X was reset to 43\u2009521 in case of false/too slow answers. Before the experiment, the participants were told that they will take part in an arithmetic task comprising feedback and that this feedback will evaluate their output in terms of performance markers established in the overall population. After task participation, they were informed that the feedback was computed by relating their trial performance to their performance in the Evaluation stage. 1-weighted 3D-magnetization prepared rapid gradient echo sequence \u2009=\u20091900\u2005ms; echo time (TE)\u2009=\u20093.03\u2005ms; flip angle (FA)\u2009=\u20099\u00b0; field of view (FOV)\u2009=\u2009256\u2005mm\u2009\u00d7\u2009256\u2005mm; matrix size\u2009=\u2009256\u2009\u00d7\u2009256; 4\u2005min 26\u2005s) and a T2-weighted fluid-attenuated inversion recovery sequence . Functional scans were measured with a pseudo-continuous ASL EPI sequence35 with 22 ascending transversal slices covering the whole brain . In the Rest condition (8\u2005min), 60 control and 60 label ASL images were acquired, in the Stress condition (12\u2005min) 90 control and 90 label scans. Two spin-echo EPI reference volumes with matching read-out and geometry were acquired in advance to the rest and the stress ASL measurements to facilitate a distortion correction.Anatomical brain scans were acquired with a T1-weighted images, as well as a determination of a GM group mask for the fMRI analyses were performed. For details, see A manual mapping of focal lesions, a tissue segmentation of Thttp://www.fil.ion.ucl.ac.uk/spm). In (i), we corrected the raw ASL images for head motion using the ASL toolbox.36 In (ii), we used the SPM12 coregistration algorithm to map both spin-echo EPI reference images with opposing phase-encoding direction to the average motion-corrected image determined in (i). In (iii), we used the HySCO toolbox37 and both coregistered spin-echo EPI reference images to correct the realigned fMRI images computed in (i) for inhomogeneity of the main magnetic field. In (iv), we linearly coregistered the images determined in (iii) to the high-resolution anatomical T1-weighted images. After coregistration, (v) the images were smoothed with a Gaussian kernel . In (vi), we used the ASL toolbox to compute voxel images of the average regional cerebral blood flow for the Rest (2) and the Feedback-Stress stage (4b) based on control\u2013label pairs. Finally, (vii) we used the coregistration parameters determined in the segmentation of anatomical T1-weighted scans (see 38 (voxel size 3\u2005mm\u2009\u00d7\u20093\u2005mm\u2009\u00d7\u20093\u2005mm). Finally, we identified ASL data of individual participants with insufficient quality separately for both conditions using the framewise displacement (FWD) metric, an established data quality marker evaluating participants\u2019 head (i.e. whole brain) motion.39 FWD scores across all participants in individual conditions more extreme than the first (third) quartile\u2014(+) 1.5\u2009\u00d7\u2009inter-quartile range (IQR) were considered outliers and excluded.The fully automatized fMRI preprocessing pipeline comprised seven steps which were performed with (toolboxes for) SPM12 using singular value decomposition (SVD). SVD is a widely established data processing method frequently used in genetic and neuroimaging studies,41 which is closely related to principal component analysis . SVD is well suited to evaluate FC42 as it characterizes a large set of input variables reflecting the similarity between all components and input variables. Based on these similarities, the input variables can be assigned to groups of functionally connected regions or neural networks, respectively (see below). Each component can be understood as single variable encoding the activity of a corresponding network for each participant with a single number. Moreover, SVD allows computing (iii) the proportion of variance explained in the input variables by the individual components to compute component variables for the Rest condition. Furthermore, we subtracted the component variables for Rest from those for Stress to obtain measures of differential network activity which were then evaluated in subsequent fMRI group analyses. VStress) was larger than that of any other component.In practical terms, we first calculated measures of regional rCBF for each participant by averaging rCBF across all voxels located in a region included in an anatomical atlas and covered by a GM mask (see GR), FK506-binding protein 4 (FKBP4), FK506-binding protein 5 (FKBP5) and glucocorticoid-induced leucine zipper (GILZ). The GR is the main intracellular receptor for GCs including cortisol and plays a key role in immunoregulation.43 FKBP5 acts as a co-chaperon that modulates GR activity and mediates the stress response in the immune system (and other tissues44). Upon GC binding of GR, FKBP5 is exchanged for FKBP4, thereby initiating nuclear translocation and downstream transcriptional activity. Finally, GILZ is transcriptionally induced by GR and mediates major anti-inflammatory actions of GCs, particularly in T cells.45 To quantify the expression of these eight markers, complementary DNA was amplified using a real-time PCR System. Then, gene expression of the eight markers was normalized to the expression of housekeeping genes and delta cycle threshold (\u0394CT) values were calculated by subtracting the mean CT values of the gene of interest from geometric mean of housekeeping genes. For details, e.g. on isolation of peripheral blood mononuclear cells and sorting of CD4+ and CD8+ T cells, RNA isolation, cDNA synthesis and Real-Time Reverse Transcription PCR, see We quantified gene expression of four major components of the GC signalling in CD4+ and CD8+ T cells: glucocorticoid receptor for whom non-outlier data for all eight markers were available. In the next step, we centred the remaining data and performed a SVD based on all eight individual markers as input variables. Because the first component explained 70% of the variance in all eight individual markers, this component was used as a single summary measure of T-cell GC signalling in all subsequent analyses. The variation in the summary marker was most similar to GILZ and least similar to FKBP4 .Because the eight individual markers were considerably inter-correlated , we then used the individual markers to compute one characteristic summary marker of GC-related T-cell gene expression to avoid redundant statistical analyses. Specifically, in a first data quality assurance step, we searched for outliers among gene expression data in each of the individual markers and retained only the data of those 49 participants implemented in MATLAB 2014a . Each LMM included three fixed effects regressors or covariates of interest (CI). One main effect regressor for task stage, one for group and a regressor coding their interaction computed as their element-wise product. Sex, age, disease duration since first signs of multiple sclerosis, task load (RestX and StressX before centring) served as criterion variables. We determined the probability to obtain the observed t-statistics by chance with a permutation method for repeated measures (10\u2009000 within-subject permutations of each CI). A significance threshold for undirected tests of \u03b1\u2009=\u20090.05 was applied for perceived stress and heart rate. A multiple comparison or family-wise error (FWE) corrected significance threshold for undirected tests of \u03b1\u2009=\u20094.2\u2009\u00d7\u200910\u22124 was applied for tests of brain responses. Standardized regression coefficients \u03b2 are reported as effect size measures with |\u03b2|\u2009<\u20090.2 indicates a weak, 0.2\u2009\u2264\u2009|\u03b2|\u2009<\u20090.5 a moderate and |\u03b2|\u2009\u2265\u20090.5 a strong effect.47To test the main effects of task stage/stress exposure, group and their interaction on stress response measures . Again, we report \u03b2 coefficients as effect size measures for the CI.Robust regression is much less affected by outliers than standard (i.e. ordinary least square) regression and has consequently been proven to increase the statistical power of tests conducted.Importantly, we repeated this analysis by replacing the T-cell GC expression summary marker once with parameters of the average diurnal salivary cortisol levels and once with the daytime decline in salivary cortisol to evaluate a differential coupling between stress-related neural network connectivity and salivary cortisol in PwMS versus HPs. Additionally, we tested group differences in salivary cortisol, and differential associations between the T-cell GC-summary marker and salivary cortisol across groups in supplementary analyses .differential coupling of brain activity and gene expression in patients and controls would identify an altered interplay between CNS stress processing and immunologic functioning in PwMS, we evaluated whether the activity of the identified network(s) fulfilling H1 is associated with four important multiple sclerosis disease severity outcome markers in patients to evaluate its clinical importance. In particular, we evaluated whether activity of this/these network(s) is associated with GM fraction (H2), T2-weighted lesion load (H3), clinical disability and information-processing speed . To test hypotheses H2\u2013H5, activity of networks fulfilling the criterion of H1 was entered into robust regression analyses as CI and used to model the patients\u2019 GM fraction, T2-weighted lesion load, SDMT and EDSS in independent analyses. Lesion load was log-transformed [i.e. log(number of lesion voxels\u2009+\u20090.001)] before the analysis to account for the skewness in its distribution. Permutation testing (10\u2009000 permutations49) was used for inference. In order to test H2\u2013H5, we applied a significance threshold of \u03b1\u2009=\u20090.05 for undirected tests. No multiple comparison correction was necessary, because (i) specific hypotheses could be derived from the literature for predicting each of the four specific severity markers and (ii) only a single predictor/CI was used to model each of them.50 Again, we report coefficients \u03b2 as effect size measure for the CI. Additionally, we report the strength of the association between the activity of the network selected for severity prediction based on its differential link to T-cell GC sensitivity across groups (i.e. via testing H1) and the four severity measures relative to the strength of this association computed for all other 58 networks\u2019 activity to estimate the relative clinical importance of altered CNS\u2013immune crosstalk in multiple sclerosis. Finally, we also tested associations between the activity of neural networks showing a differential link between stress-related neural network connectivity and salivary cortisol in PwMS vs. HPs with disease severity in patients as well as direct associations between cortisol and disease severity markers as CNI. All other aspects were as reported for brain activity-based severity prediction.The in-house software used in the study will be made available by the corresponding author without restrictions on request.Structural MRI (sMRI) images will not be made available due to privacy issues of clinical data. Moreover, all data used in this research were collected subject to the informed consent of the participants. Consequently, access to all other (i.e. non-sMRI) data will be granted by the corresponding author on request only in line with that consent, subject to approval by the project ethics board and under a formal Data Sharing Agreement.Demographic and clinical descriptors of the study sample are provided in t\u2009=\u20094.24, P\u2009<\u200910\u22124, \u03b2\u2009=\u20090.17).The task induced a stress response in perceived stress and heart rate. However, neither main effects of group, nor interaction effects of task stage and group were found. Analyses of neural stress responses revealed several areas with stronger activity during Stress than Rest including right AI and fusiform gyrus FG; . An intet\u2009=\u2009\u22124.49, W\u2009=\u200920.20, P\u2009=\u20090.0004, \u03b2\u2009=\u2009\u22120.76; see t\u2009=\u20091.93, W\u2009=\u20093.74, P\u2009=\u20090.048, \u03b2\u2009=\u20090.47).The factorial analyses conducted for each of the 59 neural networks to test an altered coupling between stress-triggered network activity and T-cell GC gene expression in PwMS vs. HPs showed a strong interaction effect for a network comprising right AI, right FG, left midcingulate and lingual gyrus on an FWE-corrected significance level , and information-processing speed (SDMT). The relative strength of the association between the 58th network/component and GM fraction was low as it had the 25th closest association among all 59 networks (i.e. Rank 25 of 59). However, the relative association was strong for the three other measures . Brain network activity found in the above analysis showing a differential link to GC-related T-cell gene expression in PwMS vs. HPs showed a significant association with Tt\u2009=\u2009\u22121.50, W\u2009=\u20092.26, P\u2009=\u20090.145, \u03b2\u2009=\u2009\u22120.30). Also for the other three parameters, no significant associations were found .Despite the size of the negative association between the GC-summary marker and clinical disability/EDSS was moderate, it did not reach statistical significance , as well as AI. This regional pattern strongly overlaps with areas found in similar studies.10 and that neural activity associated with dampened psychological stress experience is linked to higher future brain atrophy.26 Neuroendocrine animal research has underlined the importance of (non-blunted) T-cell GC sensitivity for regulation of autoimmune neuroinflammation by demonstrating that T cells downregulate GR expression and dynamically develop functional GC insensitivity during the early phase of experimental autoimmune encephalomyelitis, the animal model of multiple sclerosis.22 Consistently, Engler et al.51 could show that GC sensitivity is reduced in PwMS, Gold et al.22 that blunted GC sensitivity of T cells in PwMS is associated with neuroinflammation as GC sensitivity was lower in patients with vs. without active MRI lesions. Thus, together, these studies argue that the interplay between neuroendocrine stress processing and T-cell GC sensitivity is altered in multiple sclerosis. Aiming to test a disease-specific CNS\u2013immune interplay that might resemble this altered neuroendocrine-immune one, we tested H1 in our first main analysis and searched for neural networks whose stress task-evoked activity is differentially linked to peripheral T-cell GC signalling in PwMS vs. HPs as a potential indicator of a disease-specific CNS\u2013immune crosstalk. The analysis revealed a strong (\u03b2\u2009=\u2009\u22120.76) differential link for the activity of a neural network comprising right AI, right FG, left midcingulate and lingual gyrus. Inferred from the right graph in In our first main analysis, we tested whether CNS stress processing and T-cell GC sensitivity are linked in a disease-specific fashion, as both factors showed a similar pattern of associations with multiple sclerosis severity in prior studies which, however, addressed these associations in an isolated, discipline-specific fashion only. In particular, neuroimaging studies found that blunted CNS stress-processing goes along with higher multiple sclerosis severity53 and that measures stress-related inflammatory parameters.54 Importantly, animal studies revealed that insular cortex can also efferently regulate immunologic processes by demonstrating that lesions induced to the rat insular cortex disrupt the ability to acquire conditioned immunosuppression (i.e. an immune response learned via Pavlovian conditioning56). Thus, although observational studies do not allow drawing causal inference, these findings on (\u2018efferent\u2019) conditioned immunosuppression argue that the differential link between stress-related CNS activity and T-cell GC-sensitivity across groups found in our study might potentially indicate an impaired CNS regulation of immune functioning in multiple sclerosis.AI is a key hub between the CNS and the immune system that is sensitive to GC administration25 Specifically, insula is the key area for measuring, signalling, encoding and remembering affectively relevant internal bodily states , a domain impaired in PwMS.59 Thus, when considering frequent insula atrophy in PwMS60 and their impaired ability to perceive and evaluate peripheral stress signals,62 one might speculate that altered immunological and affective processes in multiple sclerosis might be connected via AI functioning.Importantly, AI does not only measure and potentially regulate immunological functions, it is also involved in a variety of cognitive and affective processes.\u03b2\u2009=\u20090.43; EDSS: \u03b2\u2009=\u20090.36; SDMT: \u03b2\u2009=\u2009\u22120.33). These findings show that the altered CNS\u2013immune system crosstalk in multiple sclerosis may be clinically meaningful.In the second main analysis, we investigated whether the activity of the network identified in testing H1 is associated with disease severity. This analysis supported the majority of the four corresponding hypotheses (H2\u2013H5), as it showed that three of four key severity measures were related. In particular, the network\u2019s activity was linked to lesion load (H3), clinical disability and information-processing speed . The effect size of each of the three associations was moderate a differential link between cortisol and brain activity across groups for a network comprising both frontal poles and (ii) a link between salivary cortisol and network activity in HP but not PwMS will be needed to further strengthen the confidence in a link between psychological stress and multiple sclerosis.Another point might relate to the question of whether receiving the diagnosis of multiple sclerosis, a severe neurological disease, or subsequent structural alterations might drive differences in central stress-responsivity between patients and controls and whether these differences underly the findings made in the study. Although we agree that structural alterations might lead to alterations in central stress processing, no differences in regional central stress processing between PwMS and HPs were found in the corresponding analysis conducted in this study . Moreover, missing differences in regional neural stress responses between PwMS and HPs are consistent with findings made in our recent studyGR, FKBP5, FKBP4 or GILZ.66\u201369 Moreover, PwMS taking steroid treatment in a period of 4 weeks preceding a potential study participation were not included in the study.Additionally, one might wonder whether DMTs applied might have influenced GC-related gene expression in T cells. Human studies addressing this question for the DMTs used in this study, however, did not report significant changes in gene expression for our genes of interest 70 FKBP4,71 FKBP5,72 GILZ73). Moreover, analyses of the transcription of GC target genes can add important information as responsiveness of GC-inducible genes such as GILZ also depends on chromatin accessibility of the regulatory regions (enhancers and promoters). Thus, our approach is a composite measure that captures GC signalling on various levels (including epigenetic regulation) and we, therefore, believe that our choice of mRNA targets provides an excellent estimate of the GC signalling within each cell population studied. Having said that, future studies should expand these read-outs by adding analyses on the protein level as well as functionally probing GC sensitivity.It should be noted that our assays focused on T-cell gene expression as measured by quantitative PCR (qPCR) and we did not include measures of protein levels of these targets. It has been shown that mRNA expression measured by qPCR closely reflects protein levels , as some authors proposed the heuristic that only components explaining a lot of variation can be useful in follow-up regression analyses.4 and clinical observation5\u20137 as well as treatment studies.8In conclusion, our study shows that stress-related CNS functioning is linked to T-cell stress hormone sensitivity in a disease-specific fashion and simultaneously related to disease severity in multiple sclerosis. Thus, it might have helped to increase our knowledge on factors contributing to the importance of psychological stress for multiple sclerosis reported in large epidemiological studiesfcac086_Supplementary_DataClick here for additional data file."} +{"text": "However, fatty acids do also form an essential nutrient source for the oocyte and embryo, which indicates that these good and bad effects of fatty acids should be in subtle balance to optimize the developmental competence of the oocyte and embryo.In the cow a major characteristic of metabolic stress is an elevated level of plasma free fatty acid, due to increased lipid mobilization from adipose tissue. Elevated levels of free fatty acids in blood are associated with increased lipotoxicity in non-adipose tissue. An overview is provided on the negative impact of free fatty acids and the metabolic stress imposed on the oocyte and early embryo and thus on bovine fertility. There is increasing evidence that This manuscript presents an overview of the current knowledge of fatty acid transfer from blood to the follicle, from the follicular fluid towards the cumulus-oocyte-complex and distribution and use of fatty acids in the oocyte. Cumulus cells appear to play an important role in both fatty acid transfer towards the oocyte and protection of the oocyte against elevated levels of free fatty acids during metabolic stress conditions yields 5-6 x more energy in the form of ATP. Fatty acids also form the main building blocks of cell membranes and lipid breakdown products can function as cell signalling molecules. In the oocyte, fatty acids can be packed as neutral lipid in the form of TAG (3 fatty acids esterified to glycerol) in lipid droplets. TAG, followed by phospholipids, form the most abundant class of lipid stored in the oocyte, furthermore, in contrast to most other cell types, TAG stored in the oocyte mostly contains saturated fatty acids . The fatCumulus cells surrounding the oocyte form a natural barrier between follicular fluid and the oocyte. Before fatty acids can reach the oocyte, passage via cumulus cells appears to be unavoidable . The quein vivo maturing COCs form a molecular filter that only allows restricted transfer of specific metabolites in the direction of the oocyte . This observation suggests that saturated FFA induce lipotoxic responses of granulosa cells and the COC during obesity. Apart from inducing ER stress in COCs, saturated fatty acids also increase the level of the apoptosis inducer ceramide and ROS stress response, demonstrated by a rise in ER stress markers Atf4, Atf6, Xbp1s and Hspa5 and a reduced mitochondrial membrane potential, indicative for mitochondrial damage inhibition of ER stress by salubrinal in the presence of palmitic acid during IVM results in improved mitochondrial function and cumulus cell morphology and prevents a negative impact on oocyte developmental competence .The role of CD36 for COCs in relation to their response to palmitic acid may be of interest for future research. Inhibition of CD36 in somatic cell types reduces ROS formation and prevents lipotoxic events during exposure to palmitic acid ; moreover, the oocytes of the exposed COCs remain fully competent to develop into an embryo and cumulus cells into harmless mono-unsaturated FFA (oleic acid), which is safely stored in lipid droplets of cumulus cells. At this point it is unknown whether and how presumptive oocytes during stages of early follicular development, which lack the presence of cumulus cells, are protected during metabolic stress and in the presence of elevated FFA levels. These observations are important directions for future research."} +{"text": "There is still much controversy about whether transforaminal or interlaminar fully endoscopic spine surgery can better treat lumbar 4/5 disc herniation. Therefore, this study intends to compare the clinical efficacy of fully endoscopic spine surgery through transforaminal and interlaminar approaches in the treatment of lumbar 4/5 disc herniation.Seventy-six patients with lumbar 4/5 disc herniation admitted from March 2019 to June 2020 were divided into the transforaminal approach group and the interlaminar approach group according to different surgical methods. The general clinical data and clinical evaluation scale of the patients were compared.P\u2009<\u20090.05). The VAS and ODI scores of patients with upper-shoulder and sub-axillary types in the EILD group were superior to those in the ETLD group (P\u2009<\u20090.05), while the VAS and ODI scores of patients with the pre-radicular type were better when they underwent ETLD rather than EILD (P\u2009<\u20090.05). Patients with Lee zone III type in the EILD group had better post-operative ODI scores than those in the ETLD group (P\u2009<\u20090.05), but there was no significant difference in VAS scores (P\u2009>\u20090.05). Patients with Lee zone IV type who underwent EILD had better VAS and ODI scores than those who underwent ETLD (P\u2009<\u20090.05).The post-operative ODI and VAS scores were significantly better in the EILD group (For patients with a prolapsed intervertebral disc that belongs to the upper-shoulder type, sub-axillary type, or Lee III or IV type, EILD can achieve better outcomes. As minimally invasive spinal techniques have advanced, fully endoscopic spine surgery (FESS) has received more attention worldwide due to its advantages of less bleeding, small operation wound, rapid post-operative recovery, and satisfactory efficacy in the treatment of lumbar disc herniation . FESS isCurrently, ETLD is mainly used to treat lumbar 4/5 intervertebral disc herniation, and EILD is mainly used to treat lumbar 5/sacral 1 intervertebral disc herniation. Reports on the analysis of the efficacy of the above two approaches are mostly limited to lumbar 5/sacral 1, while there are few studies on the treatment of intervertebral disc herniation of the lumbar 4/5 segments . In addiIn this study, we retrospectively analysed the efficacy and complications of ETLD and EILD in the treatment of intervertebral disc herniation of the lumbar 4/5 segments, aiming to provide a reference for selecting the appropriate surgical approach for clinical treatment of intervertebral disc herniation of the lumbar 4/5 segments.The clinical data of 76 patients with intervertebral disc herniation of the lumbar 4/5 segments who underwent routine treatment in the Department of Spinal Orthopedics of our hospital from March 2019 to June 2020 were selected for analysis. The male:female ratio of the patients was 40:36. The age ranged from 15 to 89\u00a0years, with an average of 49.37\u2009\u00b1\u200914.05\u00a0years. The details of the general data are shown in Table All patients selected in this study mainly come from two time periods. The first was from March 2019 to March 2020. All patients with lumbar disc herniation in this time period were treated with ETLD. The second time period was from April 2020 to June 2020. All patients with lumbar disc herniation in this time period were treated with EILD. All patients were classified into zones I-IV according to the sagittal zoning method for intervertebral disc herniation by Lee et al. . There wThe patients underwent local anaesthesia and were given intravenous adjuvant drugs . With the patient in the jackknife position, the ipsilateral iliac crest line, midline of the spinous process, and responsible disc space were marked. After routine disinfection and draping, the puncture needle was inserted at 8\u201310\u00a0cm away from the midline of the spinous process with a 5\u201310\u00b0 angle to the horizontal line of the intervertebral space towards the head. The puncture needle sequentially penetrated the locally anaesthetized skin, subcutaneous tissue, deep fascia, and muscle until reaching the ventral side of the articular process of lumbar 5. After the puncture needle was in place, we made an 8-mm incision on the skin and expanded the soft tissue using a gradually expanding cannula. A visual trephine was used to remove part of the bone on the ventral side of the superior articular process to enlarge the area of the intervertebral foramen. After a satisfactory visual field was achieved, a working cannula was inserted to remove the dorsal ligamentum flavum tissue, expose the nerve root, and enter the ventral side of the nerve root. The prolapsed intervertebral disc tissue was removed with nucleus pulposus forceps, and radiofrequency was used to fully stop bleeding Fig.\u00a0.Fig. 3ETThe patients underwent general anaesthesia or spinal anaesthesia and took the jackknife position. Routine disinfection and draping were performed, and an incision with the length of approximately 1\u00a0cm was made on the skin at the intersection point of the line between the inner edge of adjacent upper and lower pedicles on the operated side and the horizontal line of the intervertebral space. After the skin and subcutaneous fascia were incised with a sharp knife, the visual trephine cannula was placed through the dilator, with its opening facing the upper vertebral lamina. The soft tissue was cleaned to fully expose the upper and lower vertebral laminae and ligamentum flavum fossa under the endoscope, and then the upper and lower vertebral laminae were opened in a \u201cU\u201d shape with a visual trephine in the counterclockwise direction under the endoscope to expose the upper, lower, and lateral stop points of the ligamentum flavum on the operated side. Under the endoscope, the medial margin of the superior articular process was treated with a bone rongeur to expose the lamina fenestration. A microscopic nerve stripper was used to separate the surrounding adhesive tissue along the outer edge of the nerve root. The nerve root was pushed inward and the outer working cannula was pushed into the spinal canal to reach the outside of the nerve root. The outer working cannula was moved up and down, inside and outside, to look for the rupture of the annulus fibrosus and remove the prolapsed intervertebral disc tissue Fig.\u00a0.Fig. 4EIRelevant examinations were done before surgery to rule out surgical contraindications. For 6\u201312\u00a0h after the operation, the patient wore a hard waist brace to get out of bed under the guidance of a physician. The patient was discharged 1\u00a0days after the operation and returned to normal work and home life 6\u00a0weeks later. All patients were followed up for 12 to 27\u00a0months, with an average of 20.37\u2009\u00b1\u20093.81\u00a0months. The patients were evaluated by Oswestry Disability Index (ODI) and visual analogue scale (VAS) scores before the surgery and at the last follow-up after surgery. All patients had no complications or reoperation during post-operative follow-up.\u03c72 test. P\u2009<\u20090.05 was considered statistically significant.SPSS 18.0 statistical software was used for statistical analysis. All measurement data were tested for normal distribution characteristics. Measurement data were compared between the two groups by the independent-sample t test, and count data were compared by the P\u2009>\u20090.05). The post-operative ODI score of the patients in the ETLD group was 7.81\u2009\u00b1\u20092.17 and post-operative VAS score 1.87\u2009\u00b1\u20090.72, while the post-operative ODI score of the patients in the EILD group was 5.73\u2009\u00b1\u20092.07 and their post-operative VAS score 1.50\u2009\u00b1\u20090.59 (both P\u2009<\u20090.05). See Table The preoperative ODI score was 71.37\u2009\u00b1\u20095.23 and 71.73\u2009\u00b1\u20095.49 for the ETLD group and EILD group, respectively, and the VAS score was 6.06\u2009\u00b1\u20090.73 and 6.09\u2009\u00b1\u20090.68 (P\u2009>\u20090.05); the post-operative ODI score was 8.67\u2009\u00b1\u20091.73 and the post-operative VAS score 2.33\u2009\u00b1\u20090.86 in the sub-axillary ETLD patients, while the post-operative ODI score was 5.63\u2009\u00b1\u20092.21 and the post-operative VAS score 1.56\u2009\u00b1\u20090.62 in the sub-axillary EILD patients (P\u2009<\u20090.05). See Table There were 25 patients with sub-axillary type, nine of whom underwent ETLD, 16 EILD. The preoperative ODI score was 71.11\u2009\u00b1\u20095.92 and 72.63\u2009\u00b1\u20095.73, and the VAS score was 6.11\u2009\u00b1\u20090.60 and 6.19\u2009\u00b1\u20090.65 in the sub-axillary ETLD and sub-axillary EILD group, respectively (P\u2009<\u20090.05). The preoperative VAS score was 6.17\u2009\u00b1\u20090.77 and the post-operative score was 1.67\u2009\u00b1\u20090.63 (P\u2009<\u20090.05). See Table There were 36 patients with the pre-radicular type underwent ETLD. The preoperative ODI score was 71.50\u2009\u00b1\u20095.24 and the post-operative ODI score was 7.50\u2009\u00b1\u20092.26 (P\u2009>\u20090.05). The post-operative ODI score was 8.22\u2009\u00b1\u20092.10and the post-operative VAS score was 2.22\u2009\u00b1\u20090.66 in upper-shoulder ETLD patients, and these numbers were 6.00\u2009\u00b1\u20091.78(P\u2009>\u20090.05) and 1.33\u2009\u00b1\u20090.51(P\u2009<\u20090.05) in the upper-shoulder EILD patients. See Table There were 15 patients with the upper-shoulder type, 9 of whom underwent ETLD, 6 EILD. The preoperative ODI score was 71.11\u2009\u00b1\u20095.11 vs. 69.33\u2009\u00b1\u20094.32, and the VAS score was 5.56\u2009\u00b1\u20090.52 vs. 5.83\u2009\u00b1\u20090.75 in the upper-shoulder ETLD vs. upper-shoulder EILD group, respectively (P\u2009>\u20090.05). The post-operative ODI score was 7.76\u2009\u00b1\u20092.22 in the Lee zone III ETLD group and 4.86\u2009\u00b1\u20091.06 in the EILD group (P\u2009<\u20090.05). The post-operative VAS score was 1.80\u2009\u00b1\u20090.70 in the Lee zone III ETLD group and 1.86\u2009\u00b1\u20090.69 in the EILD group (P\u2009>\u20090.05). See Table There were 56 patients with Lee zone III, 47 of whom underwent ETLD, 7 EILD. The preoperative ODI score was 71.43\u2009\u00b1\u20095.08 vs. 72.29\u2009\u00b1\u20095.58, and the VAS score was 6.12\u2009\u00b1\u20090.72 vs. 6.29\u2009\u00b1\u20090.48 in Lee zone III ETLD group vs. Lee zone III EILD group, respectively (P\u2009>\u20090.05). The post-operative ODI score was 8.40\u2009\u00b1\u20091.67 and the post-operative VAS score was 2.60\u2009\u00b1\u20090.54 in the Lee zone IV ETLD group, while the post-operative ODI score was 5.60\u2009\u00b1\u20091.72 and the post-operative VAS score was 1.33\u2009\u00b1\u20090.48 in the Lee zone IV EILD group (P\u2009<\u20090.05). See Table There were 20 patients with Lee zone IV, 5 of whom underwent ETLD, 15 EILD. The preoperative ODI score was 70.80\u2009\u00b1\u20097.29 vs. 71.47\u2009\u00b1\u20095.63 and the VAS score was 5.40\u2009\u00b1\u20090.54 vs. 6.00\u2009\u00b1\u20090.75 in the Lee zone IV ETLD group vs. Lee zone IV EILD group, respectively (In recent years, with the continuous development and improvement in minimally invasive concepts in spinal surgery, the application of visualization technology to the treatment of lumbar disc herniation has gradually become more widespread. FESS not only greatly improves surgical efficiency and safety but also minimizes harmful radiation exposure to surgeons and patients compared with previous blinded operations . At presIn this study, we retrospectively compared the difference in the clinical efficacy between ETLD and EILD in the treatment of lumbar 4/5 disc herniation. The results showed that both ETLD and EILD significantly relieved the symptoms of low back and leg pain, with no significant difference in the post-operative hospital stay or recurrence rate. ETLD has a longer operation time, more fluoroscopies, and higher incidence of residuals than EILD, while EILD has more post-operative skin paraesthesia and a higher probability of nerve injury in relevant reports, which is mainly due to cannula misplacement or interference with ligamentum flavum identification by structures such as facet joint cysts, muscles, and ligaments \u201313.To further explore the differences in the treatment of disc herniation between the above two surgical methods, we divided and compared the 76 included patients according to the position of the prolapsed intervertebral disc in the cross section and sagittal section. Specifically, in the sagittal plane, grouping was performed according to the zones proposed by Lee et al. Zones I and II type were upward herniation of the disc, and zones III and IV type were downward herniation. In the transverse plane, according to the relative position of the intervertebral disc and nerve roots, they were divided into the sub-axillary type, pre-radicular type, and upper-shoulder type. Since the volume of the spinal canal decreases as it moves up, patients with Lee zone I type are rarely found, and only four patients belong to Lee zone II type in this study, so they were not studied. Comparison of the 56 patients with Lee zone III type revealed that EILD patients yielded better post-operative ODI scores than ETLD, with no difference in VAS scores. Comparison of the 20 patients with Lee zone IV type revealed that the post-operative ODI and VAS scores of the EILD patients were superior to those of the ETLD patients. We believe that this may have been due to the excessive downward herniation of the intervertebral disc. When ETLD is performed, it requires more work for facetoplasty and pediculoplasty, and the procedure is long. If the prolapsed intervertebral disc is not one piece, it is difficult to remove completely. On the other hand, prolonged cannula placement for the removal will inevitably disturb the nerve roots and affects the post-operative outcome . AlthougEILD can also achieve better surgical outcomes than ETLD for patients with upper-shoulder and sub-axillary type. For patients with the upper-shoulder type, the intervertebral disc is often less prolapsed, and most of these patients belong to Lee zone III type. For patients with the sub-axillary type, the intervertebral disc is often more prolapsed, and most of these patients belong to Lee zone IV type at the same time. In the upper-shoulder type, the prolapsed intervertebral disc is hidden at the medial edge of the pedicle and forms a 90\u00b0 angle with the working cannula, which is in the blind area of the field of view, so cryptoplasty and pediculoplasty are required in ETLD. However, this kind of pediculoplasty is technically difficult and prone to bleeding or damage of the pedicle. In addition, once the prolapsed disc is broken into multiple fragments, it is highly prone to residual and incomplete removal in ETLD , 18. EILOverall, for lumbar 4/5 disc herniation, although both ETLD and EILD have good surgical outcomes, for patients with Lee zone III or IV type and a upper-shoulder or sub-axillary type, EILD can achieve better efficacy."} +{"text": "A range of highly functionalized polycyclic fragments have been synthesized, employing a catalytic dehydrative cyclization. A range of nucleophiles are shown to be successful, with the reaction producing numerous high value motifs. Access to diverse polycyclic scaffolds via an efficient calcium catalyzed dehydration\u2010cyclization strategy is described. This approach provides a range of small molecule fragments bearing a range of medicinally relevant functional groups. Both Lewis and Bronsted acid pathways are in use, with the ability to fine tune the reactivity depending on the choice of solvent. Fragment\u2010based drug discovery (FBDD) has undoubtedly made a large and sustained positive impact on medicinal chemistry campaigns since its inception.3 rich small molecules. This increased concentration towards more complex scaffolds is not unfounded, with several elegant studies showing that shape is arguably one of the more important factors affecting biological activity. Furthermore, 3D scaffolds have improved physicochemical properties including solubility as well as improving specific ADMET properties.Fragment libraries have traditionally focused on flat, aromatic scaffolds with notable successes, however, these libraries have struggled to identify hits for new and complex biological targets.As mentioned, fragment diversity is intrinsically linked to advances in synthetic methodology, and access to novel fragments has remained a focus of the synthetic chemistry community. In particular, the development of methodology to access novel or less explored scaffolds continues to attract considerable effort.Isoindolinones represent an important class of biologically active small molecules,Their synthesis often relies upon a linear strategy to build the tricyclic core, which somewhat impedes its use in modular synthesis, with low yielding condensation reactions routinely employed.2)2).Calcium catalysis, once thought to be a curiosity, has seen swift growth over the last decade.We began our investigation focusing on the dehydration\u2010cyclisation of sulfur nucleophiles, given the ready accessibility of the starting materials, as well as the fact that these thioazoloindoline motifs have a range of important biological activity. Optimization of the process focused on varying catalyst loading, temperature and solvent, and we quickly found that the reaction was amenable to low catalyst loadings in a variety of solvents Table\u2005. In part2\u2009b, 2\u2009c) and electron donating (2\u2009d) groups, providing the fused tricyclic in excellent yield. Differing (2\u2009e) and multiple substitution is also well tolerated, as are oxygen (2\u2009h) and nitrogen (2\u2009i) based heterocyclic systems, providing the thiazoles in moderate to excellent yield.With these optimized conditions in hand, we probed the substrate scope of the reaction. We were particularly interested in ensuring that the 6/5/5 ring system was substituted at the thiazole junction, given the lack of general methods to access these in the literature. As shown Figure\u2005, the reaFinally, attempts at employing alkylated species in the reaction was unsuccessful, instead undergoing complex fragmentation reaction in all cases.Given our success in accessing 6/5/5 ring systems, we next turned our attention towards the formation of 6/5/6 scaffolds. We also decided to expand the range of nucleophiles within the study, and therefore moved onto the use of indole as reactive partner. This not only allows for the synthesis of complex motifs from readily available starting materials, but provides novel fused diazapolycyclics for inclusion in in\u2010house fragment libraries.3\u2009a to our previously optimized conditions afforded 4\u2009a in excellent yields, albeit with slightly longer reaction times and donating groups having moderate to no effect on efficiency the reaction. Furthermore, aromatic heterocycles were well tolerated, with the reaction providing both furan (4\u2009g) and pyridine (4\u2009h) analogues in high yield. Subjecting the acid sensitive acetal to our reaction conditions, only a small amount of the described product (4\u2009i) was isolated, with the mass balance being unreacted starting material.With this simple optimization complete, we explored the differing functionality at Rn Figure\u2005, the reaAlthough we envisaged the reaction to proceed via Lewis acid catalysis, with hidden Br\u00f8nsted acid catalysis previously ruled out, the fact that the reaction works with improved reproducibility in HFIP suggests Br\u00f8nsted acidity is playing a key role. Elegant computational studies by Leb\u0153uf and co\u2010workersI preferentially protonates the hydroxyl functionality of the hydrozylisoindolinone, to afford protonated II and complex III. Loss of water affords the desired N\u2010acyliminium ion IV, which undergoes intramolecular trapping with the tethered nucleophile and subsequent re\u2010complexation with III to provide V. Protonation of the NTf2 ligand and internal proton transfer gives the thiazolidine product and regenerates the catalyst.Given that the reaction with the Lewis acid salt proceeds more slowly, it is reasonable to assume that the Br\u00f8nsted acid type pathway is the favored one. We therefore propose the following mechanism based on previous studies Figure\u2005. The Br\u00f85\u2009a, readily available in two steps, with our previously described conditions resulted in decomposition, regardless of the temperature used. Careful reaction monitoring did not provide useful data, with decomposition occurring rapidly in all cases. A survey of previously successful solvents showed that the reaction could indeed progress (Entry\u20053). Increasing the temperature provided the desired product in high yield, and further investigation showed that increasing the catalyst loading gave a more reproducible yield and cleaner product.We next turned our sights towards amine nucleophiles, given their importance in target synthesis and their ubiquity in medicinal chemistry. From our previous experience, we knew that in all likelihood, simple primary and secondary amines would not be amenable as reaction partners, and this turned out to be the case. However, switching to the more easily accessible, and modular, amide, proved to be much more successful. Optimization of this process was also relatively smooth, with a summary provided in Table\u20051 and R2 produced the desired product in high yield, while a noticeable drop was observed in electron withdrawing aniline derivatives (6\u2009h). Mixed electronics however worked well providing the fused ring system in high yields (6\u2009i). Finally, alkyl substitution also worked well, with cyclic (6\u2009j) and acyclic (6\u2009k) being produced in high yield.Once again, we wanted to probe the tolerance of the reaction, and in particular, wanted to vary both R2 Figure\u2005. As expeWe have described a facile, high yielding and green methodology to access highly functionalized polycyclic fragments. The reaction is tolerant to a wide range of useful functional groups, providing fused scaffolds rapidly. We envisage this methodology to be of importance to both natural product and medicinal chemists alike, and have been included in our in\u2010house fragment libraries.All experimental details are given in the Supporting Information.4\u2009a)2154226 should be addressed to the authors.Supporting InformationClick here for additional data file."} +{"text": "Depression is a complex clinical disorder associated with poor outcomes. Electroacupuncture (EA) has been demonstrated to have an important role in both clinical and pre-clinical depression investigations. Evidence has suggested that the P2X7 receptor (P2X7R), NLRP3, and IL-1\u03b2 play an important role in depressive disorder. Our study is aimed at exploring the role of EA in alleviating depression-like behaviors in rats. We therefore investigated the effects of EA on the prefrontal cortex and liver of rats subjected to chronic unpredictable mild stress (CUMS) through behavior tests, transmission electron microscopy, Nissl staining, HE staining, immunohistochemistry and Western blotting. Five weeks after exposure to CUMS, Sprague-Dawley (SD) rats showed depression-like behavior. Three weeks after treatment with brilliant blue G (BBG) or EA, depressive symptoms were significantly improved. Liver cells and microglia showed regular morphology and orderly arrangement in the BBG and EA groups compared with the CUMS group. Here we show that EA downregulated P2X7R/NLRP3/IL-1\u03b2 expression and relieved depression-like behavior. In summary, our findings demonstrated the efficacy of EA in alleviating depression-like behaviors induced by CUMS in rats. This suggests that EA may serve as an adjunctive therapy in clinical practice, and that P2X7R may be a promising target for EA intervention on the liver\u2013brain axis in treatment of depression. Depressive disorder is a crippling condition that substantially affects psychosocial functioning and reduces life quality . It invoThe intricate interplay between emotions and the brain is facilitated by a number of neural systems spanning from the brainstem to the prefrontal cortex (PFC). The PFC, as a significant nerve center of thinking and behavior regulation in the brain, involves the regulation of emotions, and mediation of cognitive processes, such as the formation of intentions, goal-directed behavior, and attentional control , and hasThe connection between chronic liver disease and depression has been well established for a long time . As a meIn recent years, the activation of microglia and macrophages is mediated by purinergic signaling, which is via the membrane-bound adenosine triphosphate (ATP) receptor, such as the P2X7R ,27,28. PFew researchers have addressed the problem of pathological changes in the liver in patients with depression. The current research focus is not only on the role of EA in the PFC of depressive-like rats but also on pathological changes in the liver. Furthermore, EA may be engaged in the liver\u2013brain axis via P2X7R affecting rats with depressive-like behavior.In 1996, the World Health Organization added depression to acupuncture indication. Electroacupuncture (EA) combines traditional acupuncture with modern scientific techniques to generate a stable output pattern that overcomes individual differences between therapists. Several existing meta-analyses support EA\u2019s safety and significant clinical efficacy in alleviating depressive symptoms. In addition, patients with depression prefer complementary therapy to drugs when a previous drug treatment has been invalid. Considering the above, our hypotheses are as follows: 1. the physiological function of the liver also alters with depressive-like behavior exposed by CUMS; 2. this alteration is related to the simultaneous activation of P2X7R/NLRP3/IL-1\u03b2 expression in the prefrontal cortex and the liver; 3. EA alleviates depressive-like behavior and physiological changes in the liver and prefrontal cortex by inhibiting P2X7R/NLRP3/IL-1\u03b2 expression.Rat husbandry and animal strategies were carried out in accordance with the recommendations and protocols authorized by the Institutional Animal Care and Use Committee of Chongqing Medical University. Male SD rats weighing 150\u2013180 g were used in all experiments. These rats were housed in a temperature-controlled (22 \u00b1 2 \u00b0C) and light-controlled (12:12-h light:dark cycle) room and provided with free admission to food and water except on the experimental days. Before the experiment started, the rats were habituated to the experimental conditions for one week. There were control, CUMS, BBG, and EA groups. We used the CUMS ,38,39 meEighty SD rats in the model group were housed in 80 cages. They were exposed to one of 7 mild stressors daily in a random sequence for 5 weeks . The folThe rats were lightly restrained by hand to minimize stress during EA treatment. Acupuncture needles were inserted bilaterally at the Baihui (GV20), Yintang (GV29), and Ganshu (BL18) acupoints ,44 to a The body weight and sucrSucrose preference test (SPT) was perfThe open field test (OFT) was performed in a 100 cm \u00d7 100 cm \u00d7 40 cm black plexiglass box with a black floor as previously described . At the In the forced swimming test (FST) ,49, the After the end of the behavior tests, rats from each group were fasted for 24 h. After isoflurane inhalation anesthesia, rats were fixed on the operating table, the chest was opened to expose the heart. A perfusion needle was obliquely inserted into the aorta along the apex of the heart, and the right atrial appendage was open and perfused with 0.09 mol/L PBS solution. When the liquid being pumped from the right atrial appendage became clear, the brain was removed on ice, and the prefrontal cortex and right lobe of the liver were separated. The right brain tissue and right liver lobe of 3 rats from each group were fixed with 4% paraformaldehyde. The remaining prefrontal cortex and liver tissues were quickly placed in a liquid nitrogen tank and then stored in a \u221280 \u00b0C freezer. Three rats from each group were randomly selected, and perfusion with 1% glutaraldehyde solution was performed until the limbs and tail of the rats were stiff. After decapitation, the brains were removed, and the right prefrontal cortex was trimmed to obtain an approximately 1 \u00d7 1 \u00d7 1 mm sample, and fixed in 2.5% glutaraldehyde at 4 \u00b0C.The prefrontal cortices were rinsed with 0.1 mol/L phosphoric acid solution 3 times and fixed with 1% osmic acid solution 3 times, then dehydrated in graded alcohol and acetone solutions at 4 \u00b0C, and again with 100% acetone at room temperature. After embedding, the tissues were cured in the oven. The tissues were sectioned with an ultrathin slicer at 70 nm thickness and stained with 3% uranium acetate and lead citrate to observe microglia in the prefrontal cortex.The right lobe of the liver was fixed with 4% paraformaldehyde for 24\u201348 h, and was then dehydrated in gradient ethanol solutions, embedded in wax, sliced into paraffin sections with a thickness of 5 \u03bcm, dewaxed in water, stained with hematoxylin and eosin successively, and sealed. Ten fields were randomly selected from each section, and the liver morphology was observed under a light microscope.Paraffin-embedded tissues were cut at a thickness of approximately 5 \u03bcm. After drying, the slides were dewaxed with xylene, dehydrated in gradient ethanol solutions, stained in toluidine blue solution at 56 \u00b0C for 20 min, rinsed with distilled water for 5 min, bathed in xylene until transparent for 10 min, sealed with neutral gum, and dried in a ventilated place. Ten fields were observed from each group under an optical microscope, and the results were analyzed by a researcher who did not know the grouping information.Paraffin-embedded tissues were cut at a thickness of approximately 4 \u03bcm. The sections were dried, dewaxed with xylene, dehydrated in gradient ethanol solutions, and washed with distilled water. Next, the sections were cooled, washed with PBS, incubated with 3% hydrogen peroxide solution for 25 min, washed with PBS, and blocked with 3% BSA at room temperature for 30 min. Paraffin sections of the prefrontal cortex were incubated with an Iba1 (1:1000) primary antibody, and paraffin sections of the liver were incubated with a CD68 (1:500) primary antibody, overnight at 4 \u00b0C. The sections were incubated with secondary antibody at room temperature for 50 min after washing with PBS. DAB color development was performed under a microscope after washing in PBS. When the staining was obvious, the sections were washed with tap water, and color development was terminated. After dehydration with anhydrous ethanol and clearing with xylene, the sections were sealed with neutral gum. At least 10 visual fields were randomly observed under a microscope with a 10\u00d7 lens, and brown CD68- or Iba1-positive cells were observed in the cytoplasm. The optical density of the staining was analyzed with Image Plus software.Western blotting was used to measure the expression of P2X7, NLRP3, pro-caspase-1, cleaved-caspase-1, pro-IL-1\u03b2, cleaved-IL-1\u03b2, and ASC in the prefrontal cortex and liver. Twenty-four hours after the end of the behavioral experiment, the rats were anaesthetized by intraperitoneal injection of pentobarbital sodium., and PBS was perfused through the apex of the heart. The bilateral prefrontal cortex, hippocampus and right lobe of the liver were completely removed. Total protein was extracted from the prefrontal cortex and liver with a tissue protein extraction kit (lysate:phenylmethylsulfonylfluoride = 99:1). The protein concentration was determined by the BCA method, the concentration of each sample was adjusted, and the samples were denatured for 10 min. A total of 25 \u03bcg of each protein sample was separated by 12% polyacrylamide gel electrophoresis, and then transferred onto a 0.45 \u03bcm or 0.2 \u03bcm nitrocellulose membrane. The membrane was incubated with a rabbit anti-NLRP3 monoclonal antibody (3:1000), rabbit anti-P2X7 monoclonal antibody (1:1000), rabbit anti Caspase-1 monoclonal antibody (1:500), rabbit anti-ASC monoclonal antibody (1:1000), or rabbit anti-IL-1\u03b2 monoclonal antibody (1:1000) overnight at 4 \u00b0C, 3 times in TBST for 10 min each the next day, incubated with secondary antibody , for 1 h at room temperature, rinsed 3 times with TBST for 10 min each, then developed with chemiluminescence reagent and imaged using an imaging system. Software was used for absorbance analysis.p < 0.05 was considered significant. The data are reported as the mean \u00b1 SD. The data of body weight and SPT data were tested by repeated-measures two-way ANOVA, and the OFT, SPT, immunohistochemistry, and Western blotting data were analyzed by one-way ANOVA. Tukey\u2019s post-hoc test was used to compare the different groups.All experiments were conducted in a randomized manner. The data sets were analyzed for normality and homogeneity of variance, and parametric post hoc statistical analysis was performed to confirm a priori power calculations. GraphPad Prism 8.0 software and SPSS 25.0 were used for analysis, and The depressive and anxiety-like behaviors\u2014including those in the SPT, FST, and OFT\u2014and body weight of the different groups were examined, to explore the effects of EA on the CUMS rat model. The SPT and body weight measurements were performed nine times, and the FST and OFT were performed only once before execution.p < 0.01, 2 =\u03b7 0.998), a statistically significant effect of time points , and a statistically significant interaction between time points and group .As shown in p < 0.05), but there was no difference in SPT between the EA group and the CUMS group (p > 0.05). At the 8th week, the SPT of the two groups was markedly higher than that of the CUMS group (p < 0.01), and the SPT of the BBG group was clearly greater than that of the EA group (p < 0.01). Rats in the CUMS group, BBG group, and EA group displayed decreased sensitivity to reward stimulation and pleasure when they were exposed to CUMS. However, both the BBG and EA exhibited a significant reversal of the decreased sucrose consumption compared to the CUMS group at the 7th week and 8th week of the experiment, as demonstrated by statistically significant results.At the end of the 3rd week of CUMS exposure, the SPT of the CUMS group, BBG group and EA group was decreased by approximately 30%. At the 4th and 5th weeks, the SPT of the CUMS group, BBG group and EA group did not decrease further. At the 6th week, i.e., the week after BBG or EA treatment for 1 week, the SPT of the BBG group was significantly higher than that of the EA group , a statistically significant effect of time points , and a statistically significant interaction between time points and group . After 5 weeks of CUMS exposure, the weight gain of the rats in the CUMS group, BBG group and EA group was slow, but there was no difference among the groups (p > 0.05). After BBG or EA treatment for 1 week, there was no difference in body weight between the rats in the CUMS group, BBG group and EA group, this being significantly lower than the control group (p < 0.01). After BBG and EA treatment for 3 weeks, the body weight of the BBG group and EA group was significantly higher than that of the CUMS group (p < 0.01), but still significantly lower than that of the control group (p < 0.01), and there was no difference in body weight between the two groups (p > 0.05), as shown in The results of repeated-measures analysis of variance showed a statistically significant effect of group . Compared with the CUMS group, the immobility time and total distance travelled of the BBG group and EA group were significantly lower . Of note, there was no significant difference between the BBG group and EA group (p > 0.05), as shown in Rats among different groups exhibited significant differences in FST which tests for behavioral despair, including immobility time and total distance. The immobility time and total distance of the CUMS group was significantly greater compared with that of the control group (p < 0.01). Compared with the CUMS group, the activity ability of the rats in the BBG group and EA group to adapt to a new environment was significantly increased . There was no difference between BBG and EA treatment in the percentage of resting time (p > 0.05); however, percent of time spent in the center zone and average speed of the rats in the two groups were notably elevated following the BBG and EA treatment , as shown in Results of the OFT showed that compared with the CON group, rats in the CUMS group exhibited significant differences in locomotor activity , and the number of Nissl bodies in the BBG and EA groups was higher than in the control group . However, there was no significant difference in the number of Nissl bodies between the BBG group and EA group (p > 0.05). These results are shown in Nissl staining showed that in the control group, neurons exhibited a normal morphology, there were a large number of Nissl bodies, and neurons showed a uniform distribution and dark blue staining. In the CUMS group, the shape of neuronal cells was irregular, the number of Nissl bodies was decreased, neurons were lightly stained, and some Nissl bodies were unevenly distributed. The morphology of neurons in the BBG group and EA group was irregular. Image collection and Nissl body counting were performed by investigators blinded to the group information. The number of Nissl bodies in the CUMS group was significantly lower than that in the control group (p < 0.05). Compared with that in the CUMS group, the expression of Iba1-positive cells in the BBG group and the EA group was decreased (p < 0.05). These results are shown in The results showed that, compared with that in the control group, the expression of Iba1-positive cells in the prefrontal cortex of the CUMS group was increased (p < 0.01), and the protein expression of NLRP3, pro-IL-1\u03b2, and cleaved-IL-1\u03b2 was increased in the CUMS group (p < 0.05). Compared with that in the CUMS group, the protein expression of P2X7R in the BBG group was significantly decreased (p < 0.01), and the protein expression of NLRP3, pro-caspase-1, cleaved-caspase-1, pro-IL-1\u03b2, and cleaved-IL-1\u03b2 in the BBG group was decreased (p < 0.05). The protein expression of NLRP3, P2X7R, pro-caspase-1, pro-IL-1\u03b2, and cleaved-IL-1\u03b2 were decreased in the EA group (p < 0.05), but the protein expression of cleaved-caspase-1 and ASC did not change significantly (p > 0.05). These results can be seen in In the prefrontal cortex, the protein expression of P2X7R, pro-caspase-1, cleaved-caspase-1, and ASC were significantly increased in the CUMS group compared with those in the control group , suggesting that macrophage infiltration was increased. Compared with that in the CUMS group, the expression level of CD68 in liver tissue of the EA group and the BBG group was significantly lower, suggesting that macrophage infiltration was decreased (p < 0.05) as shown in Immunohistochemistry showed that, compared with that in the control group, the expression level of CD68 in the liver tissue of the CUMS group was significantly increased (p < 0.01), and the protein expression of cleaved-caspase-1, pro-IL-1\u03b2, and cleaved-IL-1\u03b2 were increased in the CUMS group compared with the control group (p < 0.05). Compared with that in the CUMS group, the protein expression of NLRP3, P2X7, pro-caspase-1, leaved-caspase-1, pro-IL-1\u03b2, cleaved-IL-1\u03b2, and ASC in the BBG group was decreased (p < 0.05). The protein expression of NLRP3, P2X7, pro-caspase-1, and cleaved-IL-1\u03b2 were decreased in the EA group (p < 0.05), but there was no difference in the protein expression of cleaved-caspase-1, or ASC (p > 0.05). There was no significant difference in NLRP3, P2X7, pro-caspase-1, cleaved-caspase-1, pro-IL-1\u03b2, cleaved-IL-1\u03b2 or ASC protein expression between the BBG group and the EA group (p > 0.05) as shown in In the liver, the protein expression of NLRP3, P2X7, pro-caspase-1, and ASC were significantly increased in the CUMS group (p > 0.05). The results showed that EA inhibited the expression of inflammatory factors in the prefrontal cortex and liver of rats exposed to CUMS.There was no significant difference in NLRP3, P2X7, pro-caspase-1, cleaved-caspase-1, pro-IL-1\u03b2, cleaved-IL-1\u03b2 or ASC protein expression between the BBG group and the EA group in PFC and liver , Yintang (GV29), and Ganshu (BL18) have positive effects on behavior, the prefrontal cortex, and liver cell function in CUMS-induced depression-like behavior in rats. Baihui (GV20) and Yintang (GV29) are the core acupoints according to the latest research, which is based on data mining technology, on the acupoint characteristics in the treatment of depression by modern acupuncture ,77. Howeevidence , we seleOur experiment confirmed our hypothesis, but there are some limitations. The amygdala, hippocampus, thalamus and prefrontal cortex play a synergistic role in cognitive function, learning, memory, emotion, and other functions. However, we did not study in detail the relationship between the hippocampus and prefrontal cortex in depression. As technology continues to advance, the use of brain imaging techniques and real-time brain function recording has become increasingly prevalent in assessing the effects of different therapies on brain function in individuals with depression. This objective evidence provides greater validation for the effectiveness of electroacupuncture (EA) in the treatment of depression. Further investigation is required to determine the extent to which EA can improve depression-related neural circuits through the application of advanced neuroimaging methods, and to evaluate whether EA can enhance liver metabolism and mitigate metabolic changes in CUMS-induced depression-like behavior in rats. While the current findings are derived in a laboratory setting, additional randomized controlled trials will be necessary to establish clinical efficacy.In conclusion, the results of the study provide evidence to support the hypothesis that rats displaying CUMS-induced depression-like behavior exhibit damage to the prefrontal cortex and liver, characterized by an inflammatory state triggered by microglia and macrophages. The antidepressant effect of EA may be achieved through its ability to modulate inflammation by downregulating the expression of P2X7R/NLRP3/IL-1\u03b2 and reducing the release of IL-1\u03b2. This study highlights the potential role of EA in alleviating depression symptoms associated with CUMS and provides new experimental evidence for the use of EA as an add-on therapy in the treatment of depression and the co-occurrence of chronic liver disease and depression."} +{"text": "Many chemical modifications of starch are realized in organic (mostly methanol) phase, allowing high degrees of substitution (DS). Some of these materials are used as disintegrants. To expand the usage of starch derivative biopolymers as drug delivery system, various starch derivatives obtained in aqueous phase were evaluated with the aim to identify materials and procedures which would generate multifunctional excipients providing gastro-protection for controlled drug delivery. Chemical, structural and thermal characteristics of anionic and ampholytic High Amylose Starch (HAS) derivatives under powder (P), tablet (T) and film (F) forms were evaluated by X-ray Diffraction (XRD), Fourier Transformed Infrared (FTIR) and thermogravimetric analysis (TGA) methods and correlated with the behavior of tablets and films in simulated gastric and intestinal media. At low DS, the HAS carboxymethylation (CMHAS) in aqueous phase, generated tablets and films that were insoluble at ambient conditions. The CMHAS filmogenic solutions, with a lower viscosity, were easier to cast and gave smooth films without the use of plasticizer. Correlations were found between structural parameters and the properties of starch excipients. Compared to other starch modification procedures, the aqueous modification of HAS generated tunable multifunctional excipients that may be recommended for tablets and functional coatings for colon-targeted formulations. Starch is a biopolymer of interest due to its capacity of self-assembly . low cosRegarding the starch origin, the ratio between the two components (amylose and amylopectin) present in the starch granule will define many of its properties . Certain\u00ae have been described as candidates for clinical translation [Between chemical modifications that can be operated on the polysaccharidic chains of starch, the cross-linking and the grafting of various functional groups are frequent. Cross-linked high amylose starch (CLHAS-CL) devices loaded with ciprofloxacin have been proposed as an option for long-lasting implants in the treatment of osteomyelitis . Transarnslation . Other nnslation , bone scnslation ,10, wounnslation , tumor tnslation and molenslation . For bonnslation . Lactobacillus rhamnosus) [Grafting of anionic groups (carboxymethyl CM) on starch is usually performed in organic phase to obtain high yields and elevated degree of substitution (DS) ,18,19,20amnosus) ,27,28. Aamnosus) . The proStarch may also be used under film form with pharmaceutical applications i.e., oral fast-disintegrating films ,31, tranIn this study, different excipients were obtained by aqueous-phase modifications of HAS and it was interesting to investigate their matrix-forming and filmogenic properties. The report is focused on the physical-chemical characterization of different starch derivatives and on the correlation of their properties under powder, tablet and film forms. A more complete understanding of such structural modifications will be useful to expand the range of applicability of starch-based materials in the pharmaceutical field. Such correlations can also be important tools for formulators in selection of type of starch and modification level, depending on specific application.\u00ae (~70% amylose), Melojel\u00ae (~28% amylose) and PenPure60\u00ae native potato starch were generous gifts from Ingredion . Potato amylose (100%) and potato amylopectin (100%) were purchased from BDH Biochemicals . Vivastar\u00ae was a gift from JRS Pharma . Chloroethylamine hydrochloride (CEA), glycidyl trimethylammonium chloride (GTMAC), sodium carboxymethyl cellulose (CMC) with a MW of 90,000 g/mol, sodium monochloroacetate (SMCA), sodium trimetaphosphate (STMP) and other chemicals were all reagent grade and used as received from Millipore Sigma . Pancreatin from porcine pancreas (8\u00d7 concentrated) was purchased from Millipore Sigma. The proposed time to simulate gastric transit is 2 h in simulated gastric (SGF) followed by simulated intestinal fluid (SIF) The SGF was made with 7 mL HCl (37% w/w) and 2 g NaCl for 1 L . The precipitate was washed with aqueous methanol (60% v/v) until the conductivity was below 50 \u03bcS and finally dried with acetone and filtered. Starch carboxymethylation (CMHAS#1) was doneCMHAS#2 was obtained by heating the HAS suspension at 90 \u00b0C for 1 h before adding NaOH and proceeding with carboxymethylation as for CMHAS#1 except that the amount of SMCA directly in powder form was doubled. CMHAS#3 was synthesized as the CMHAS#1 but with a gelatinization time extended to 1 h.HAS was cross-linked (HAS-CL20) using the same gelatinization parameters as for CMHAS by adding sodium trimetaphosphate (STMP) at 20 g/100 g of starch.CMHAS was also cross-linked to obtain CMHAS-CL10. The crosslinking was repeated with the slurry method using only half the volume of water, thereby obtaining the hereto called CMHAS-CL10#2. Corn (CS) and potato starch (PS) were carboxymethylated and cross-linked to generate CMCS-CL10 and CMPS-CL10, for comparison. Two different ampholytic derivatives (carrying both aminoethyl and CM-groups) were also synthesized . The sta\u22121 corresponding to carboxylate group was absent, triggering the appearance of the band at 1650 cm\u22121 attributed to the carboxylic acid group. For each sample, approximatively 100 mg were accurately weighed and dissolved in 0.05 M NaOH (with little heating if needed) and then titrated with 20 mL of 0.05 M HCl using phenolphthalein as indicator. The DS was calculated from Equation (1), where 162 g/mol is the molecular weight of a glucose unit, 58 g/mol is the increase in molecular weight accounted for each CM group substituted and mdry is the mass of the dry sample.The degree of substitution (DS) of the CM-starch is defined as the number of substituted hydroxyls on each glucose unit (maximum 3). Determination of the DS by back titration was done as per literature . A samplCOOH) is given by Equation (2), where Vb is the volume of HCl used for the titration of the blank, V is the volume of titration of the sample and CHCl is the concentration of the HCl.The amount of CM groups (nX-ray diffraction (XRD): Diffractograms were recorded on a Bruker D8 , from 5 to 35\u00b0 (2\u03b8). Powders were flattened in the sample holders, tablets were fitted with the height of the holder and the films were fixed to a glass square with tape on the sides. Baselines were fitted with 8 points and the relative crystallinity (RC) was calculated as the percentage of peak area from the total area under the curve (by the software). A new parameter, the percentage of V-type (%V), was calculated as the intensity of V-type peaks (13.4 and 19.8 \u00b02\u03b8) from the total intensity of the cumulative peaks.\u22121 may be used to estimate changes in ordered and amorphous starch chains (Fourier-transformed infrared (FTIR) spectroscopy was used to evaluate the short-range order in starch structures. The C-O-H bending bands 1044, 1035, 1022 and 995 cmh chains . The amoh chains .w/v) aqueous solutions at 25 \u00b0C \u00b1 2 \u00b0C , with a small sample adaptor for 40 mL. Vivastar\u00ae is very hydrophilic and consequently its viscosity (higher than that of HAS and of CS) was measured at 1% (w/v).Viscosity was evaluated for each starch material in 2% (w50) was previously reported to be representative of the amylose content of starch samples [w50. For this reason, Tw50 was also compared with Tw60 (the temperature at 60% weight loss), and to the main peaks of the differential thermogravimetric curves (DTGmax). Thermogravimetric analysis. Approximately 3 mg of each sample were analyzed without further conditioning. The thermogravimetric curves were recorded on a TGA Q500 from 25 to 375 \u00b0C under nitrogen conditions. The degradation onset was determined by intersection of the slope line with the linear part of the curve. The water content was estimated by the weight loss measured at 150 \u00b0C (end of the slope). The temperature for 50% weight loss (T samples . In this640). The apparent amylose content (AAC) was calculated from a linear regression using pure amylose and pure amylopectin [525/A640, representative of the amylose:amylopectin ratio [The blue value (BV) is a parameter related to the capacity of starch to form helical complex with iodine. It was used to estimate the impact of the modifications on the structure. The BV test was done as previously reported . Absorbalopectin . The ratin ratio ,49, was The starch powders (300 mg) were compressed in a 9.54 mm diameter cylindrical mold with a manual hydraulic press at 2 tons for 10 s. The powders were conditioned at ambient environment without further treatment prior to compression. Tablet hardness was evaluated on a BenchSaver\u2122 Series hardness tester . Structural parameters were evaluated by XRD and FTIR, as described in Tablet water uptake\u2014The tablets (300 mg) were incubated in an incubator shaker at 37 \u00b0C, 100 rpm, 2 h in 40 mL SGF followed by 2 h in 40 mL SIF and weighed after each step. Results are expressed as the mass of the wet tablets.Disintegration test\u2014A disintegration bath was used following the recommendation of the United States Pharmacopeia (USP <701>) on physical testing (chapter 701-disintegration). The containers were first filled with simulated gastric fluid (SGF) for 2 h and then replaced by simulated intestinal fluids (SIF) for the remaining time. Initially, tablets were allowed to hydrate 4\u20135 min prior to placing the floating disks in the cylinders.w/w starch derivatives in distilled water, without plasticizers. For better homogenization, solutions were heated in a boiling water bath and then agitated slowly on a rotary agitator. After heating, the viscosity was lower, generating filmogenic formulations with an average density of 0.99 \u00b1 0.02 g/mL. The hexagonal molds were filled with 14 g of each filmogenic preparation (0.37 g/mm\u00b2) and left to stand on a leveled surface at ambient conditions for 2 days. Preparation: the films were obtained in hexagonal polystyrene molds by casting (evaporation of the filmogenic compositions) in ambient conditions. The preparations were made with 3.5% Testing of the films. The films were analyzed by TGA, XRD and FTIR methods, as previously described. w/v) RH, respectively. Films were kept in the chambers for at least 3 days and their water uptake was expressed as percentage of their change in weight. Moisture absorption\u2014Chambers were equilibrated with controlled relative humidity (RH) using different saturated salt solutions (200 mL) for at least one week. NaI, NaBr and Nal were used for 40, ~60 and 75% , removed and air-dried at 60 \u00b0C until a constant weight was reached (about 3 days). Solubility was calculated as the percentage of weight loss based on the initial film weight.2 at 37 \u00b0C. HRT-18 cells (3 \u00d7 105) were treated with CMHAS, AECMHAS or Vivastar\u00ae, all at a final concentration of 0.05 mg/mL, in addition to H2O2 (positive control) and after two days, assayed for cell viability using XTT -2H-tetrazolium-5-carboxanilide salt). The XTT tetrazolium assay is based on the reduction of XTT by mitochondrial NADH enzymes converting XTT to formazan crystal . Briefly, the medium was removed followed by addition of 125 \u00b5L XTT solution for a 3 h incubation. Absorbances were measured at 450 nm. Untreated cells (Mock) were set at the 100% viability value. The HRT-18 is an epithelial cell line derived from a colorectal adenocarcinoma. Cells were maintained in alpha MEM supplemented with 10% fetal bovine serum and antibiotics (1% penicillin-streptomycin) in 5% COIt was of interest to correlate the structural data of the obtained starch derivatives in powder, tablet and film form to theirUnder a powder form, derivatives were mainly evaluated in relation to the degree of organization of polysaccharidic chains in crystalline or amorphous regions. The X-ray diffractometry is a reference method in starch structural analysis, allowing to observe the crystallinity resulting from the organization in ordered layers and allows quantification of the relative crystallinity (% RC). In aqueous phase, the crystallinity of a starch excipient is related to its retrogradation. This reorganization phenomenon may induce twisting or cracking of the cast films. The crystallinity may also be related to the chemical modification: the new functional groups grafted on the starch chains will hinder the retrogradation/crystalline forms. The ratio of type A or B peaks to the V-type peaks may be indicative of the amylose to amylopectin ratio in the large crystalline regions. The diffractograms are presented in For CMHAS-CL10, the slurry method with higher concentration of NaOH may haveIn HAS, it was proposed that amylose could be organized in crystalline structures ,51 and e\u22121 of the tested samples renders analysis even more difficult. In the new prepared derivatives, after carboxymethylation of HAS, a new band was observed around 1590 cm\u22121 , attribu data in . CI valu data in . CI may W60, TW50 and DTGMAX) showed a decrease corresponding to the extent of the modifications can give insights on the starch structure integrity. The absorbance spectra of the native starches showed a good correlation with the amylose:amylopectin ratio. The BV, the apparent amylose content (AAC) and Astarches and detaLow density modified starches gave strong monolithic matrices. The water content of the starch influences the compression behavior (reorganization) and the cohesiveness (H-bonding) of the resulting materials , modulatThe XRD profiles of starch tablets B showed The weight of the tablets during immersion is reported in The powders with lower levels of organized polysaccharidic chains (resulting from the gelatinization step) generated strong tablets and denser granules, whereas aggregated powders gave friable tablets. Many modified HAS did not swell , some swelled slightly whereas others swelled greatly (CMPS and TMACMHAS derivatives without cross-linking). The CMPS had a high solubility due to the presence of potato starch. The solubility of TMACMHAS was related to the functional groups. Both were also obtained with cross-linking and tablets based on CMPS-CL10 or TMACMHAS-CL10 formed outer gel layers after immersion in SGF, showing that cross-linking created a stronger network. Furthermore, phosphate groups from the STMP can be easily protonated thereby contributing to the outer gel layer formation.The CMCS-CL10 (based on corn starch) was gel-forming and its weight increased constantly in both media. The water uptake of ampholytic starches AECMHAS and TMACMHAS-CL10 was slower in SGF than in SIF due to the ionic stabilisation of ammonium with carboxylic groups. The weight gain was faster in SIF due to deprotonation of carboxylic functions. The higher solubility of ampholytic materials carrying ammonium salt groups resulted from protonation of amine in acidic medium.The drug-free starch tablets were evaluated for 2 h in SGF and than in SIF in the presence of pancreatic amylases . When ex\u00ae suspension was not filmogenic, even after moderate heating due to its high amylose content generating strong H-bonds and crystallinity. CMHAS#1 and HAS-CL20 powders kept B-type and V-type crystallinity; they were not soluble and required heating to generate filmogenic solutions. The films were rigid and not completely flat when cast from solution without heating.By using amorphous powders, it was possible to obtain films with interesting visual aspects A. The amw/v) and 9% (w/v).Water content of the films\u2014Initial water content (at room condition), measured by TGA, was between 8% , changes in weight of the films were noted . A slighThe diffractograms of the films are presented in \u22121. They were similar for HAS, potato, or corn starch films, suggesting that the organization after casting was similar, irrespective of the starch source or derivatives.Band ratios were meaFor the films, the maximal values of DTG increased in the following order: CMHAS#2 < TMACHAS-CL10 < AECMHAS < CMHAS#3 < CMHAS-CL10#2 < CMCS, showing a good correlation with their solubility increased, while the long-range order decreased suggestiWater uptake\u2014The weight of the films after immersion in SGF were compared with their weight after immersion in SIF B. CMHAS-Solubility of the films made of HAS-CL20, CMHAS#1 or CMHAS#3 remained unchanged in the enzyme-free SGF/SIF system . CMHAS#2This shows that the films based on CMHAS with low DS obtained from aqueous synthesis would be stable at acidic pH during the gastric transit and would be mainly degraded in SIF in the presence of \u03b1-amylase.Highly viscous potato starch required dilution and hence longer evaporation time for similar film thickness, and could not be of interest for large scale film production. In addition, potato starch gelatinizes faster, forming soluble films. Corn starch generated homogeneous films, but were disintegrated in SGF. Amylose-rich starches were reported to form better films due to their capacity to orient in any direction was cytotoxic at equivalent concentrations, as expected. For CMHAS (DS 0.15) no toxicity was found, even at higher concentrations (0.1 mg/mL).Cytotoxicity of starch derivatives. CMHAS at a degree of substitution DS 0.15 showed no loss in cell viability , whereasCorrelations between structure and properties of analyzed excipients was examined in powders, tablets and films. Powders with minor chemical modifications all showed a residual crystallinity. Due to the precipitation method with acetone or alcohol that are slowly reducing the water content by dehydration, the hydroxyl groups are water-free.They can be involved in intra-chain (helices) or inter-chain (network) hydrogen bonding with neighboring hydroxyl, carboxyl, amine or ammonium groups that will induce the starch chains to reorganize forming helices or hydrogels. In the film form (after water evaporation during drying), the amylose remained in the network, reducing the V-type crystallinity (XRD) and increasing the stability to thermal degradation (TGA) due to new starch-starch hydrogen bridges created during the casting process A. The poFilms had less V-type crystallinity than powders (as shown by XRD), whereas B-type peaks remained unchanged. If the amylose is reorganized outside the amylopectin, its crystallinity could be changed by compression of the crystal size. The CMCS powder showing a V-type crystallinity was completely amorphous once cast as films.\u22121 resulting in increased CI after tableting or processing into films .The DTGmax of the powders was a good parameter to predict the solubility of the corresponding tablets and films, but only in the frame of similar starch sources . DTGmax The starch types were determinant for the solubility of their powders, tablets and films. They also had a role in the viscosity of the filmogenic solutions. The modification of HAS required longer gelatinization time than for potato or corn starch, but generated filmogenic solutions with low viscosity and films with low solubility. The films of HAS derivatives were also more resistant during hydration compared to those of CMCS that were broken in pieces or to those based on modified potato starch that were too fragile.Amylose-rich starches were reported to form better films due to the amylose\u2019s capacity to orient in any direction, in comparison to amylopectin that is too bulky to change its chain orientation and has a favored orientation for the small chains in its structure . This loThe solubility of the films was increased by various chemical modifications. By increasing ionicity and reducing crystallinity, starch modifications increased the solubility of the powders, tablets and films. The gelatinization time before the reaction influenced the crystallinity and was a more important parameter for modification of HAS than for other starches. A longer gelatinization time improved the gelatinization, and the powder was soluble in cold water.The study shows that the synthesis in aqueous phase consists in the complete disorganization of the starch granules and generating powders with low density and unique film- and matrix-forming features. The process is safe, affordable, green and could be further exploited in pharmaceutical industry.The HAS is less crystalline and less soluble than other starches and appropriate derivatization may improve its tableting, gel-forming or filmogenic capacity.Several avenues to modify starch structure were explored and their impact on the functionality of the obtained materials was investigated. As novelty, for certain starch excipients the correlations between characteristic features under powder, tablet, and film form may be the key predictive parameters that could facilitate the choice for a specific application. Thus, if the grafting of ionic groups (CM) increased the gel-forming capacity of the materials, the cross-linking increased the film strength. The DS 0.2 generated insoluble films that were degraded only in presence of \u03b1-amylase. The gel formation was clearly increased for ampholytic HAS, comparable to that of potato and corn starch derivatives.Cross-linked carboxymethyl high-amylose starch could be considered as a multifunctional excipient for tablets and films with the added feature of tunable solubility of relevance in the gastric and enteric media.The relationship between the parameters of the powders for all starches and HAS MAX, with the relative crystallinity (%RC) and with the amylose crystallinity (%V).From the correlation established between the different powder, film or tablet parameters it was fIn summary, key parameters to modulate functionality of derivatives are starch source, thermal treatment, and the presence of ionic groups.As perspective, the tunable solubility of the starch films could be a great feature to various formulations for functional coatings based on natural polymers."} +{"text": "Intravenous (IV) iron supplementation is the preferred treatment option for managing severe iron deficiency (ID) and ID anemia (IDA). Three of the available IV iron preparations are ferric derisomaltose (FDI), ferric carboxymaltose (FCM), and iron sucrose (IS). The objective of the present work was to review the published literature about the efficacy, safety, quality of life (QoL), and economic outcomes of using FDI, FCM, and IS for the treatment of ID. A systematic literature search was performed following Preferred Reporting Items for Systematic Reviews and Meta-Analyses\u00a0(PRISMA) guidelines. Eligible studies were assessed for quality using appropriate tools, and data were extracted and analyzed for key outcomes. The evidence synthesis was based on published systematic literature reviews (SLRs), meta-analyses (MAs), indirect treatment comparisons (ITCs), and health technology assessments (HTAs); we also included economic evaluations performed from a Chinese perspective. Out of 337 initial hits, the review included 12 studies. The findings indicated that FDI, FCM, and IS had comparable efficacy in terms of hemoglobin (Hb) improvement. FDI showed a better safety profile with a lower risk of hypophosphatemia, hypersensitivity reactions, and cardiovascular adverse events (AEs) compared to IS and FCM. FDI also demonstrated better cost-effectiveness compared to IS, with potential cost savings attributed to fewer infusions and improved compliance. None of the included studies evaluated QoL after IV iron administration for ID. FDI offers a safe, efficacious, and cost-effective treatment option for ID. It exhibits comparable efficacy to FCM and IS but presents a better safety profile and economic advantage. FDI fulfills the criteria of efficacy, safety, economy, innovation, suitability, and accessibility, making it a promising choice for ID management in China. Iron deficiency (ID), characterized by insufficient iron levels in the body, is the most common nutritional deficiency worldwide. In 2016, it was estimated that ID and its associated ID anemia (IDA) affected more than 1.2 billion people across the world .Iron is an essential micronutrient: sufficient iron levels are required for numerous physiological functions, including the formation of oxygen-carrying hemoglobin (Hb) in red blood cells, myoglobin in muscle cells, and energy formation processes in all cells . As a reOral iron is the recommended first-line treatment for ID primarily because of its convenience. However, only small amounts can be absorbed orally, and oral iron is associated with a high incidence of gastrointestinal (GI) side effects. Thus, oral iron might not be effective in patients with poor gastrointestinal (GI) absorption of or intolerance to oral iron, or if they require rapid repletion of iron stores ,14. On tIV iron preparations with iron encapsulated in a carbohydrate shell or bound to a carbohydrate matrix have revolutionized iron therapy over the last decades, in comparison to the early toxic IV iron formulations, which are no longer available. The ability of IV iron preparations to delay the release of iron, thereby increasing the allowed maximum dose, depends on how tightly the iron is bound to the carbohydrate, because the stability due to this bonding limits the release of free iron during the transport of the drug via the blood to its destination in the liver macrophages . Iron suIS has been the traditionally used IV iron formulation in China . The abiWhile FCM and FDI are both high-dose IV irons, multiple randomized controlled trials (RCTs) have reported a high incidence of hypophosphatemia, including severe and persisting hypophosphatemia, with FCM and not with FDI -29. FurtFDI, which was previously approved in Europe (2009), Canada (2018), and the United States (2020), received approval in China in February 2021 and was included in the National Reimbursement Drug List (NRDL) in January 2023. On the other hand, FCM received approval in China in November 2022. Given this background of recent approvals of FDI and FCM and NRDL inclusion of FDI and the widespread use of IS in China, we compared these three IV iron preparations through a rapid health technology assessment (HTA). While a comprehensive HTA provides a thorough understanding of the efficacy, safety, and economic endpoints of health technologies, it can be resource-intensive and time-consuming. A rapid HTA has the advantage of being robust and evidence-driven to support informed clinical and policy-level decision-making while simultaneously not compromising on the time required for evidence synthesis and reporting\u00a0. TherefoMethodologyThe entire rapid HTA was performed following the 2020 Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) statement .Eligibility CriteriaFor our rapid HTA, we drafted the eligibility criteria based on the population, intervention, comparators, outcomes, and study design (PICOS) framework. \u201cPopulation\u201d was all patients with any form of iron deficiency, regardless of etiology, age, and sex; \u201cintervention\u201d was FDI monotherapy; \u201ccomparator\u201d was therapy with FCM or IS; and \u201coutcomes\u201d were efficacy , safety and tolerability (incidence of adverse events (AEs) and serious AEs, treatment withdrawals due to AEs, special AEs such as hypophosphatemia, and mortality), patient-reported outcomes , and economic outcomes gained, incremental cost-effectiveness ratio (ICER), and costs per utility gains). For the \u201cstudy design,\u201d we focused on secondary analyses such as systematic literature reviews (SLRs), meta-analyses (MAs), network meta-analyses (NMAs), indirect treatment comparisons (ITCs), and HTAs; for economic outcomes, we considered all forms of economic evaluations. To ensure the applicability to the Chinese context, a country restriction was applied to the economic evaluations wherein we considered only those economic evaluations that were reported from a Chinese perspective; for other types of outcomes, country restrictions were not imposed. We excluded studies that included patients without iron deficiency, pre-clinical or animal studies, and all other forms of studies not involving human participants\u00a0and studies published before January 1, 2009.Literature Search, Data Extraction, Quality Assessment, and Data SynthesisFollowing the eligibility criteria described above, we developed a literature search strategy using a combination of search terms and Boolean operators, for MEDLINE/PubMed, which was modified and finalized after internal discussion. The same search strategy was adopted for Chinese National Knowledge Infrastructure (CNKI), Wanfang, and VIP databases. The detailed PubMed search strategy is available in\u00a0Table The pooled list of eligible articles was deduplicated and screened for eligibility over two levels. First, the titles and abstracts of all initial records were screened, and second, the full texts of all potentially eligible articles were retrieved and screened. All ineligible articles were excluded after giving reasons for exclusion, which was also based on the PICOS framework. We additionally scanned the bibliography sections of relevant articles to identify any potential articles that were missed by the search strategy. Once all the eligible records were identified and pooled, relevant data from these records were extracted from all records using a pre-drafted data extraction table. The methodological quality of the included articles was assessed using the A MeaSurement Tool to Assess systematic Reviews 2 (AMSTAR 2) scale for SLRs , ConsoliAll data were entered in Microsoft Excel 2019 , and the same program\u00a0was used for performing screening, data extraction, and quality assessment. Both levels of literature search, data extraction, and quality assessment of the included articles were independently performed by two researchers, and disagreements in decisions were resolved through the mediation of a third\u00a0independent researcher. As the included study types were highly heterogenous, descriptive methods were used to assess outcomes, and statistical synthesis was not performed for the same reason. Since this research does not involve the collection of fresh prospective or retrospective clinical data from human subjects and is rather a systematic compilation of previously published literature, an ethics committee approval was deemed unnecessary by the authors.ResultsStudy Selection and Baseline CharacteristicsFrom an initial pool of 337 potentially eligible records from different sources, 12 studies fulfilled the eligibility criteria and were included in this HTA -58. FiguOf the 12 included studies, 10 studies performed a systematic literature search; meta-analysis, network meta-analysis, and indirect treatment comparison were performed by four, four, and three studies, respectively. There was one economic evaluation and one rapid HTA among the included studies. The number of included studies within the SLRs ranged from two to 42, and the number of unique patients ranged from 594 to 11,700. Efficacy and safety were evaluated by five and nine studies, respectively; while two studies evaluated cost-effectiveness, only one study evaluated QoL. The main characteristics of the included studies are summarized in Table Quality of the Included StudiesThe nine studies having an SLR component were assessed through AMSTAR 2 for methodological quality. All these studies had more than two critical flaws and were judged to have a \u201ccritically low\u201d confidence in results as per AMSTAR 2. While most studies used adequate statistical methods for meta-analysis and accounted for risk of bias (RoB) in the individual studies, none of the nine studies provided a list of excluded studies, and only two\u00a0studies ,56 invesThe assessment of the economic evaluation by Hu et al. using thFinally, the rapid HTA by Liu et al. satisfieClinical EfficacyFive of the 12 studies included in this HTA evaluated efficacy endpoints ,53,57,58Pollock et al. conducteIn an NMA reported by Adler et al.\u00a0 in 2020,The NMA reported by Aksan et al.\u00a0 in 2017 In 2022, Huang et al. conducteA rapid HTA reported by Liu et al.\u00a0 in 2022 SafetyOf the 12 included studies, safety outcomes were evaluated by eight studies. Specifically, hypophosphatemia and hypersensitivity reactions were evaluated by three and two studies, respectively;\u00a0one study focused on cardiovascular safety, and the remaining studies elaborated on all adverse effects. The NMA published in 2019 by Pollock et al.\u00a0 could noThe NMA reported by Bellos et al.\u00a0 in 2020 In 2021, Schaefer et al.\u00a0 reportedFukumoto et al. reportedIn 2020, Pollock et al. reportedNext, the meta-analysis reported in 2023 by Kennedy et al.\u00a0 used botIn 2022, Pollock et al.\u00a0 reportedThe\u00a0SLR/NMA reported by Aksan et al.\u00a0 in 2017 The rapid HTA reported by Liu et al. \u00a0in 2022 Quality of LifeIn 2022, Liu et al. in theirCost-EffectivenessThe cost-utility analysis (CUA) reported by Hu et al. in 2022 It was observed that from a healthcare system perspective, FDI was associated with an incremental cost-utility ratio (ICUR) of RMB 24,901 per QALY gained relative to IS. Probabilistic sensitivity analysis suggested that at a willingness-to-pay threshold of RMB 72,477 , which was also equal to the 2020 Chinese GDP per capita, there was a 100% likelihood that FDI would be cost-effective compared to IS. Further, from a societal perspective, FDI was associated with lower total costs than IS, indicating greater cost-effectiveness with FDI than with IS in China. Basically, while FDI had higher drug acquisition costs than IS, the cost-effectiveness of FDI was better compared to IS, primarily because of the higher iron delivered per treatment resulting in fewer IV administrations, lower administration-related costs, and lower infusion-related QoL reduction. FDI was also associated with fewer ADRs including hypersensitivity reactions. With these observations, the authors concluded that compared to IS, FDI was estimated to reduce costs associated with IV iron administration\u00a0and improve infusion-related QoL outcomes, regardless of the perspective of analysis, and that by reducing societal costs associated with IDA, FDI provides good value for money in China .The rapid HTA by Liu et al. \u00a0in 2022 DiscussionThe main findings of this rapid HTA are that while there is little difference in efficacy between the three IV iron formulations, FDI is associated with a lower risk of hypophosphatemia, serious or severe hypersensitivity reactions, and cardiovascular adverse effects compared to FCM and IS. Further, from a Chinese health system and societal perspective, FDI appears to be more cost-effective and offers better value for money than IS in the management of IDA.The quality of the included studies in our rapid HTA was assessed by three different scales, based on the study design. All eight studies that were assessed using the AMSTAR 2 tool received a \u201ccritically low confidence in results\u201d grading. However, it is important to note that the AMSTAR 2 scale employs stringent criteria for the quality assessment of SLRs. This aspect of AMSTAR 2 has been previously criticized\u00a0since it was found to assign low grades to highly cited SLRs published in high-impact journals\u00a0. FurtherAmong the five studies that assessed efficacy, the study by Adler et al. (2020)\u00a0 primarilThe Bayesian NMA reported by Aksan et al.\u00a0(2017)\u00a0 also sugThe apparently biased interpretation of the efficacy difference between FCM and FDI in the paper by\u00a0Aksan et al.\u00a0(2017)\u00a0 formed tIn addition to these studies, there have been other economic analyses of different designs that have considered perspectives outside China, such as a resource impact model for preoperative iron deficiency anemia in Ireland reported\u00a0in 2020 , two budThe decision to focus on economic evaluations reported from a Chinese perspective only was because of the challenges associated with comparing the results of health economic evaluations across geographies, which emerge as a result of differences in costs, clinical practice, prevalence, perspectives, and reimbursement considerations. Thus, this decision enhanced the relevance of the economic evaluation in the Chinese context. Our analysis showed that FDI has the potential to be cost-saving compared to IS in the Chinese healthcare and societal setting, based on the CUA by Hu et al. , which wAs demonstrated in our analysis of three different systematic reviews, FCM was found to have higher rates of hypophosphatemia in patients with normal renal function and in patients with CKD ,50,56. WIn our analysis, we also observed an increase in the incidence of cardiovascular adverse events with FCM, which may, at least in part, be explained by the higher incidence of iFGF23-mediated hypophosphatemia with FCM. Hypophosphatemia-induced depletion of adenosine triphosphate (ATP) and 2,3 diphosphoglycerate may lead to cardiomyopathy and arrhythmia , while eThe superior safety profile of FDI can be attributed to an innovation in its chemistry and structure. Unlike most other IV irons, including FCM, which use branched polymers to form a carbohydrate shell, FDI consists of derisomaltose, a carbohydrate with a short linear structure of unbranched hydrogenated isomalto-oligosaccharides, with an average molecular weight of 1 kDa ,86. ThisIn addition to demonstrating considerable efficacy, safety, economy, and innovation, FDI also meets the \u201csuitability\u201d dimension recommended by the Chinese National Health Commission\u2019s Guidelines for the Management of Comprehensive Clinical Evaluation of Drugs, since it fulfills the criteria for \u201cappropriateness of indications,\u201d \u201coptimal interval between drug doses,\u201d and \u201ccompliance with medication\u201d guidelines. Moreover, to alleviate the disease burden on patients, China has actively pursued a national drug negotiation policy, wherein the national health insurance authorities engage in negotiations with pharmaceutical companies to establish more reasonable and affordable prices for medications. FDI has been included in China\u2019s 2022 National Health Insurance Drug catalog. Additionally, China has implemented a \u201cdual-channel policy\u201d to enhance the availability of the drugs that have undergone negotiation, and many provinces have already included FDI in the list of \u201cdual-channel\u201d managed drugs. Given these policies, FDI also appears to meet the \u201caccessibility\u201d dimension.While our rapid HTA has provided valuable insights, it is not without limitations. Some of these include the lack of prospective registration of the review protocol, the exclusion of relevant databases such as Embase or Cochrane Library, and the inclusion of only articles reported in English and Chinese languages. Furthermore, we were unable to evaluate the impact of the included interventions on humanistic outcomes such as QoL or symptom relief, as none of the included studies assessed patient-reported outcomes in detail. However, based on beneficial aspects such as lower incidence of hypersensitivity reaction and hypophosphatemia\u00a0and better treatment compliance due to fewer infusion sessions, it is anticipated that FDI will be associated with better QoL outcomes compared to FCM and IS.Due to its unique chemistry, structure, and innovative molecular characteristics, FDI appears to be a safe, effective, and cost-effective treatment option for patients with ID in China. While published SLRs do not indicate significant differences in efficacy among IV iron formulations, FDI demonstrates a better safety profile in terms of a lower incidence of hypophosphatemia, serious and severe hypersensitivity reactions, and cardiovascular adverse events. Compared to IS, FDI has advantages due to larger dosing per infusion, which translates to fewer infusions, cost savings, and better compliance. Compared to FCM, FDI has equal efficacy but higher maximum dosing as well as better safety in terms of lower incidence of hypophosphatemia and related better cardiovascular safety, resulting in both QoL and cost advantages. FDI was also more cost-effective than IS, which may be attributed to its innovative characteristics and safety profile that enable the correction of iron deficits with fewer infusions, thus reducing costs and improving compliance.\u00a0According to these observations, FDI appears to be the best IV iron preparation compared to IS and FCM, which can lower the clinical, humanistic, and economic burden of patients with ID and IDA. FDI thus fulfills the six dimensions outlined in the National Health Commission\u2019s Guidelines for the Management of Comprehensive Clinical Evaluation of Drugs and presents as a promising treatment option for ID and IDA in China."} +{"text": "USH2A mutations), safety, efficiency, and in vivo delivery potential with the intention of guiding future research investment.This review considers research into the treatment of Usher syndrome, a deaf-blindness syndrome inherited in an autosomal recessive manner. Usher syndrome mutations are markedly heterogeneous, involving many different genes, and research grants are limited due to minimal patient populations. Furthermore, gene augmentation therapies are impossible in all but three Usher syndromes as the cDNA sequence exceeds the 4.7 kb AAV packaging limit. It is, therefore, vital to focus research efforts on alternative tools with the broadest applicability. The CRISPR field took off in recent years following the discovery of the DNA editing activity of Cas9 in 2012. New generations of CRISPR tools have succeeded the original CRISPR/Cas9 model to enable more sophisticated genomic amendments such as epigenetic modification and precise sequence alterations. This review will evaluate the most popular CRISPR tools to date: CRISPR/Cas9, base editing, and prime editing. It will consider these tools in terms of applicability (in relation to the ten most prevalent Research into rare diseases often encounters barriers to funding due to the lack of commercial interest in small patient populations. Consequently, it is important to develop tools that have broad applicability. Usher syndrome is a rare disease with a prevalence that varies according to locality\u2014in the USA, estimated at ~4.4:100,000 [Usher Syndrome, first described by Charles Usher in 1914 , is a deUSH2A account for over 50% of Usher Syndrome cases and up to 79% of Usher 2 patients [USH2A, ADGRV1, and WHRN, which together comprise the periciliary membrane complex at the junction between the inner and outer photoreceptor segment [USH2A result in a non-functional protein. The function of usherin, encoded by the USH2A gene, is not fully understood. However, some purported ideas include a role in transducing mechanical stress, docking/membrane fusion of post-Golgi vesicles, structural maintenance, or acting as a diffusion barrier between the cell body and connecting cilium [USH2A result in the defective development of cochlear hair cells and the maintenance of photoreceptor cells [The focus of the review is Usher Syndrome Type 2A since mutations within patients . Three gg cilium . RegardlMYO7A cDNA within a lentiviral vector into Usher type 1 patients. The trial reached phase 1/2a (NCT 01505062), however, was prematurely terminated. The ProQR trial has made more headway: the antisense oligonucleotide (QR-421a) binds to an mRNA splice site, causing the translation machinery to skip over exon 13 in the USH2A gene. This trial has progressed to phase 1/2 with evidence of effectiveness (NCT 03780257). However, the ProQR treatment has limited applicability, only targeting mutations within exon 13. Additionally, skipping certain exons results in a deleterious frameshift, and the treatment effect is temporary. A widely applicable, safe, and effective treatment does not currently exist for patients with Usher Syndrome.Some gene therapeutics targeting Usher syndrome have progressed to clinical trials. The gene replacement therapy \u2018UshStat\u2019 delivers USH2A gene (15.7 kb) exceeds the 4.7 kb packaging limit of AAV, eliminating the possibility of previously characterised gene augmentation approaches. Consequently, CRISPR treatments that edit the mutation at the DNA or RNA level are being explored. Moreover, there are limitations to gene replacement therapies that encourage the exploration of alternative treatments. Exogenously expressed transgenes demonstrate a declining treatment effect, and theories for this include the silencing of the exogenous transgene and cellular stress from products of the mutant allele [The cDNA sequence of the t allele ,10.USH2A mutations, safety, efficiency, and ease of in vivo delivery.This review evaluates the three CRISPR technologies in most frequent use: CRISPR/Cas9, base editing, and prime editing, for their potential to secure research funding for Usher Syndrome. The review will provide a summary of each tool, then proceed to explore their therapeutic potential in terms of applicability to combat thousands of described pathogenic CRISPR represents a form of prokaryotic adaptive immunity employed by bacteria and archaea, which has been repurposed for use in gene therapeutics. Prokaryotes store short DNA sequences derived from invading bacteriophages. A variety of species-specific Cas proteins use the short DNA sequences as a guide to bind and cleave complementary bacteriophage DNA in the event of repeat invasions. The CRISPR/Cas9 system is the original prototype that has undergone successive modifications to generate other popular gene therapy tools such as CRISPR interference/activation, base editors, and prime editors. All three CRISPR technologies have strong potential to treat patients with Usher Syndrome.Streptococcus pyogenes and induces a double-stranded break 3 base pairs 5\u2032 of an NGG PAM recognition site. Two pathways mediate repair: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ ligates the broken ends in a template-independent manner, resulting in unpredictable indel events. HDR mediates much more precise correction, utilising single-stranded oligodeoxynucleotides (ssODN) for templated repair.In the basic CRISPR/Cas model, a sgRNA guides a Cas nuclease to the target DNA, where it initiates a double-strand break A. The sgCRISPR/Cas9 has been adapted to generate the base editing system by catalytically inactivating the Cas nuclease and fusing it with a deaminase enzyme that mediates nucleotide transitions B. CriticThe use of a Cas nickase, which only cuts one strand of a double-stranded DNA template, and further modifications to the sgRNA allow the reconstruction of a DNA sequence through a repair mechanism on the cut strand in a process known as prime editing C. A reveUSH2A gene mediated skipping of exon 13 . This isLimitationsIt is unclear whether the other mutations located within different exons would be treatable by the same method. Research would have to evaluate the functional implications of each exon knockout. Alternatively, the point mutations: c.11864G>A, c.1256G>T, c.11156G>A, c.9799T>C, and the duplication c.920_923dup could theoretically be excised by two sgRNA\u2019s flanking the affected codon. However, NHEJ in nondividing cells is likely to introduce unpredictable indels at the excision sites and could induce a frameshift. HDR would be the only feasible option. Excision of the mutated splice acceptor site in the c.8559-2A>G mutation is not a viable strategy unless a cryptic splice site further downstream in the exon could be used instead, or the exon is not essential to protein function.Targetable MutationsUSH2A mutations [USH2A mutations: c.8559-2A>G, c.9799T>C, and c.7595-2144A>G. A CBE could also correct the c.2276G>T mutation via the conversion of TTC (F) to TTT (F). Similarly, ABEs can correct the c.11156G>A and c.11864G>A mutations via direct A>G transitions. The other USH2A mutations can feasibly be solved by the replacement of the mutated codon with a conservative amino acid change (as opposed to a direct correction) that should not theoretically affect protein folding and function. Conservative amino acid changes are possible for the c.1256G>T, c.2276G>T, and c.2802T>G mutations: an ABE editor can mediate a TTT (F) to CTT (L) conversion for the c.1256G>T mutation; a TGG (W) to TCG/TCC (S) conversion for the c.2802T>G mutation; and a TTC (F) to CTC (L) conversion for the c.2267G>T mutation.Base editing enables precise nucleotide transitions (purine to purine or pyrimidine to pyrimidine). Around 30% of human pathogenic mutations are correctable by cytosine and adenine base editors; this extends to 37.3% of pathogenic utations ,21. CBEsLimitationsUSH2A mutations: c.920-923dup or c.2299del.Nonetheless, it is important to note that this analysis does not take bystander effects into consideration. Each base editing enzyme has a unique editing window when tethered to a unique species of Cas protein. This window will initially need to be validated to assess whether a suitable PAM site exists that positions the target base within the editing window without generating undesirable bystander events. Base editing has greater flexibility in the context of RNA editing, which does not require a PAM site. A notable limitation of base editing in contrast to CRISPR/Cas9 is the inability to mediate insertions or deletions. Consequently, base editors have no capability against the remaining two Targetable MutationsUSH2A gene: c.2276G>T, 2802T>G, c.11864G>A, c.1256G>T, c.11156G>A, c.7595-2144A>G, c.8559-A>G, and c.9799T>C. Additionally, targeted deletion within exon 6 enables correction of the c.920_923dup and targeted insertion can precisely correct the c.2299del.Prime editing offers a much broader applicability compared to CRISPR/Cas9 and base editing since it can mediate all base transitions in addition to small deletions of up to 80 base pairs and insertions of up to 44 base pairs ,22. MoreAlthough prime editing has the greatest potential in terms of applicability for treating Usher Syndrome Type 2, it is vital to consider its practicality in a therapeutic setting. The review will now compare the tools in terms of efficiency, safety, and in vivo delivery.It is important that the tool selected can accomplish levels of genomic editing sufficient for therapeutic rescue in vivo. The review will now discuss the potential of each tool in this respect.AdvantagesDMD restored dystrophin protein levels to ~8% of normal levels [CRISPR/Cas9 editing via the NHEJ pathway likely enables sufficient correction for phenotypic rescue in vivo, and several successful studies provide proof of principle evidence in favour of CRISPR/Cas9\u2019s therapeutic potential. Large gene deletions in l levels . High lel levels or reducl levels . Additiol levels . The usel levels .LimitationsUSH2A mutations in vivo as it targets nondividing cells such as photoreceptors very poorly [TNFa gene [Fah gene in 1/250 murine liver cells was adequate for alleviating disease symptoms of hereditary tyrosinemia [Nonetheless, some studies have not achieved sufficient levels of correction via the NHEJ pathway for significant phenotypic results: 5% editing of stem cells in a patient with HIV and ALL was not enough to mitigate HIV infection . The HDRy poorly . AdditioNFa gene ,30. It iAdvantagesBase editing has also demonstrated proficiency for phenotypic rescue in vivo: constructs packaged within both single or dual vectors have shown levels of editing greater than 50% when delivered to animal models ,32. MoreThe resounding evidence suggests that efficiency is not a limiting factor of base editing, and successive generations of base editing enzymes have successfully increased efficiencies further. Second-generation cytosine base editors (BE2) enhanced efficiencies threefold by tethering a uracil glycosylase inhibitor (UGI) to the construct to protect the uracil intermediate . InosineLimitationsSimilar to CRISPR/Cas9 studies, editing rates show significant variability across different tissue types, ranging from 9-66% when targeting skeletal muscle compared to liver tissue ,35. ConsLimitationsDnmt1 [Low efficiency is a more significant limitation of prime editing compared to other CRISPR tools. Similar to base editing and CRISPR/Cas9, editing rates are highly variable across different genomic loci and cell lines (ranging from 0.3 to 80%) . In vivoDnmt1 .Advantages/SolutionsPah model of phenylketonuria [Nonetheless, good levels of in vitro editing exceeding 50% have been demonstrated, and some studies have achieved more promising in vivo efficiencies: 11.1% correction in a etonuria ,38, 11.5etonuria , and 6.4etonuria . Moreoveetonuria . The HDRetonuria . An addietonuria . Even soFurthermore, prime editing is a more recent development than base editing, and efforts are ongoing to fully understand its mechanism and enhance efficiency. Second-generation prime editors increased editing efficiencies via an engineered reverse transcriptase, while PE3 variants nick the non-edited strand to increase efficiencies to 20\u201350% in HEK293T cells . PE4 andConcerns are constantly raised over the safety implications of permanently editing patient DNA, particularly when considering vertical transmission (germline modification). Concerns typically relate to unwanted, often cumulative, off-target effects that could have serious unpredictable consequences, including tumorigenesis. It is important to weigh the cost/benefit related to a patient with a severely debilitating condition, and informed personal choice should play a role. It is also vital to select a tool that minimises off-target modifications with predictable action.LimitationsThe CRISPR/Cas9 technology has significant safety implications that are poorly characterised. Indel events mediated by the NHEJ pathway may lead to undesirable frameshifts or frequent sequence changes within coding regions . Three mSeveral in vivo studies to date have reported substantial unintended genomic changes as a result of CRISPR/Cas9. In an in vivo model of ALS , CRISPR/Cas9 frequently induced large DNA deletions of hundreds to thousands of base pairs, mediated by proximally located identical sequences . The ratSolutionsSolutions to the safety ramifications of CRISPR/Cas9 include self-inactivation of the vector as a function of editor accumulation (showing therapeutic effect) and using the Cas9 nickase variant to create a staggered double-strand break to improve specificity . HoweverLimitationsBase editors have generally been promoted for their enhanced safety relative to CRISPR/Cas9, largely due to the avoidance of double-stranded breaks. However, off-target effects are a considerable limitation of base editing. The off-targets induced by base editors are classified as sgRNA-independent or sgRNA-dependent. Independent off-targets involve the interaction of the deaminase with genomic DNA: this rate can be concerningly high. The CBE BE3 was found to generate tens of thousands of off-target RNA editing events: rAPOBEC1 mutants with reduced binding ability and narrowed editing windows reduced but could not eliminate these events . The ABEImportantly, none of the sgRNA-independent off-target edits overlapped with software-predicted mutations, and SNVs were identified within both proto-oncogenes and tumour suppressor genes, highlighting an oncogenic risk. Notably, several papers have claimed to find no or low vectors that lack the n events . In mousn events . A smalln events . Doses uMoreover, AAV is not applicable to all patients due to pre-existing neutralising antibodies against certain AAV serotypes, limiting the treatment effect . AdditioWhen considering the applicability of CRISPR/Cas9 delivery into the retina, AAV2/8 serotypes, in particular, show good levels of photoreceptor transduction . The difAdvantagesUSH2A mutations alongside the packaging limitations of AAV encourages the exploration of alternative delivery approaches. Retinal electroporation involves passing an electrical current across the retina using subretinal tweezer electrodes. The negatively charged DNA travels into the retina and enters the photoreceptors through temporary cell membrane pores. Electroporation has shown in vivo efficacy to date: rodents receiving CRISPR/Cas9 therapy via retinal electroporation displayed a successfully edited rhodopsin gene in a model of autosomal dominant retinitis pigmentosa [The broad applicability of prime editing for the correction of gmentosa . Additiogmentosa .USH2A. The limitations of exogenous transgene expression are a consideration, although this does avoid permanent DNA editing.Therapeutic electroporation in vivo would rely on minicircle DNA (plasmid DNA with the prokaryotic elements removed from the backbone) to avoid transgene silencing . MinicirLimitationsHowever, electroporation is likely to require extensive optimisation if intended for in vivo use in the human retina, especially since the high voltage shock required to permeabilise cell membranes can be toxic . It is cAdvantagesNanoparticles have some distinct advantages compared to viral delivery: they are more economical, enable high loading levels, do not trigger an immune response, and there are no concerns over mutagenesis. They may be useful in patients with pre-existing neutralising antibodies to AAV or in patients receiving RNA editing treatments where it would be useful to avoid a mounting immune response with repeated injections. Successful in vivo editing has been demonstrated with this approach: RNPs encased within lipid nanoparticles restored dystrophin expression in DMD mice and significantly reduced serum PCSK9 levels in C57BL/6 mice . As in eLimitationsUSH2A editing in the retina.However, lipid nanoparticles generally demonstrate low editing efficiencies, and the packaging of CRISPR/Cas9 plasmids within LNPs has not met clinical thresholds . Gold naUSH2A mutations. However, prime editors cannot currently be packaged within a single AAV. Further research is required to optimise and authenticate in vivo delivery of prime editors via electroporation or nanoparticles. The output could be very widely applicable for improving human health in conditions that have a strong genetic basis. The efficiency, safety and in vivo delivery potential for each CRISPR tool are compared in AAV delivery is currently the best option for the delivery of gene therapy into the retina: the safety has been extensively validated through clinical trials, and transduction is organ-specific. However, it has notable drawbacks, specifically the potential for oncogenesis and immunogenicity in addition to strict packaging requirements. Prime editing arguably has the greatest potential for the treatment of Many genetic diseases, including Usher Syndrome, are characterised by a markedly heterogeneous database of mutations. The result is that clinical trials will struggle to acquire funding for treatments with a narrow reach directed toward rarer variants. An approach to maximise funding would be to focus on treatments with broad applicability that can be easily adapted to different mutations.USH2A gene due to its ability to mediate all base transitions as well as small deletions and insertions. In contrast, the CRISPR/Cas9 system can only definitively correct four of the ten most common USH2A mutations via intronic deletions and has the potential to correct five more depending on the importance of the involved exon to protein function. The precise correction is possible with prime editing but is unlikely to be a viable option with CRISPR/Cas9 strategies since HDR is very inefficient in non-dividing cells such as photoreceptors. Base editing can correct eight of the ten most common USH2A mutations, although some of these edits would mediate a conservative amino acid change rather than an exact reversion to the original codon. The remaining two mutations are not targetable with base editors since they are unable to correct deletions or insertions.Prime editing has the broadest applicability of all current CRISPR technologies and represents a promising focus for future research efforts. It can correct all ten of the most common mutations in the In terms of therapeutic potential, safety and efficiency are also important considerations. Prime editing has superior safety and precision of editing relative to other tools. CRISPR/Cas9 mediates double-stranded breaks that can lead to indel events and catastrophic chromothripsis. The NHEJ process favoured in non-dividing cells repairs the broken DNA ends in an unpredictable manner. HDR has a much more precise mode of action but is generally only effective ex vivo. HDR of autologous stem cells and subsequent differentiation into retinal progenitor cells is a possibility, however, the tumorigenic potential is a real concern, and retinal stem cell therapy has not proven to be a viable strategy to date. The safety of base editing is also dubious: new SNVs are frequently introduced, and bystander editing entails unpredictable genomic changes that limit the precision of this technique.Despite the clear advantages of prime editing from the perspectives of applicability and safety, the tool is hampered by its efficiency and delivery in vivo. CRISPR/Cas9 and base editors are both packageable within a single AAV vector, whereas prime editors are only packageable within dual vectors, which considerably lowers activity due to the recombination step following transfection. AAV is a relatively safe, FDA-approved vector that is readily available. Other delivery tools, such as electroporation, still require extensive optimisation for use in human patients, prompting the reconsideration of other CRISPR tools in favour of prime editing. Nonetheless, further research would still be required to improve the safety of CRISPR/Cas9 and base editing tools.Research efforts would perhaps be better directed towards creating more compact prime editing constructs or developing more robust delivery methods with greater capacity, with a focus on maximising the size of the treatment population. This would ultimately generate tools that are highly attractive to investors and maximise funding for research into rare diseases."} +{"text": "With the advent of recombinant DNA technology in the 1970s, the idea of using gene therapies to treat human genetic diseases captured the interest and imagination of scientists around the world. Years later, enabled largely by the development of CRISPR-based genome editing tools, the field has exploded, with academic labs, startup biotechnology companies, and large pharmaceutical corporations working in concert to develop life-changing therapeutics. In this Essay, we highlight base editing technologies and their development from bench to bedside. Base editing, first reported in 2016, is capable of installing C\u2022G to T\u2022A and A\u2022T to G\u2022C point mutations, while largely circumventing some of the pitfalls of traditional CRISPR/Cas9 gene editing. Despite their youth, these technologies have been widely used by both academic labs and therapeutics-based companies. Here, we provide an overview of the mechanics of base editing and its use in clinical trials. Base editing, first reported in 2016, is a genome editing technology capable of installing point mutations with high efficiency and precision. This Essay discusses base editing technologies and their development from bench to bedside. Precision medicine has long been a major focus of biological application-based research, and the development of CRISPR-derived genome editing tools has propelled progress in this area forward in recent years. In particular, base editors have demonstrated their worth as especially powerful tools for the development of genome editing therapies. Base editing technologies were derived from CRISPR/Cas9 systems but avoid the use of double-strand breaks (DSBs) that traditional genome editing systems use. Bypassing the use of DSBs largely prevents the introduction of stochastic genome editing byproducts (such as indels). However, the trade-off for this enhancement in genome editing precision is that base editors can only perform certain types of single base pair edits (transition mutations\u2014purine to purine or pyrimidine to pyrimidine mutations), rather than the insertion, deletion, or replacement of any stretch of DNA desired. Fortunately, the ability to install transition point mutations with high precision and efficiency can be leveraged for a variety of therapeutical applications (not only the correction of monogenic disease-causing point mutations), making base editors fitting tools for the clinic.In this Essay, we describe the initial development of base editors and discuss their limitations and the subsequent improvements made to the original base editor constructs. We focus on modifications made to improve the efficiency, precision, and specificity of base editors, particularly in the context of therapeutics. We then provide an overview of the four current base editing clinical trials, focusing on the general genome editing strategies employed by each trial. We finish with a brief commentary on future base editing clinical trials in the immediate pipeline, additional emerging next-generation genome editing tools, and ethical considerations to consider as genome editing therapeutics become more prevalent.Rattus norvegicus) [Streptococcus pyogenes Cas9 (spCas9), the PAM sequence is 5\u2032-NGG-3\u2032, which has been calculated to occur once every approximately 42 bases throughout the human genome [Currently, two classes of base editors exist: cytosine base editors (CBEs) and adenine base editors (ABEs). In the first example of targeted point mutation introduction via a non-DSB mechanism, the original CBE named BE1) was created by fusing a catalytically inactive or \u201cdead\u201d Cas9 (dCas9) enzyme with the naturally occurring cytidine deaminase enzyme APOBEC1 (rAPOBEC1 sourced from was creavegicus) . For theFollowing formation of the Cas9:gRNA:DNA ternary complex, a subset of one DNA strand is now single-stranded and accessible to rAPOBEC1 for deamination chemistry . CytidinTo address this, a second-generation CBE was developed, BE2, which incorporated a uracil glycosylase inhibitor (UGI) peptide to temporarily block BER, thus preventing uracil excision and increasing C\u2022G to T\u2022A conversion efficiencies. One last modification to the system was to exchange dCas9 for a nickase version of the enzyme (nCas9) and produced the final original CBE, named BE3. BE3 installs a DNA nick on the strand opposite the uracil-containing strand. This in turn manipulates the cell\u2019s native DNA repair processes to preferentially replace this strand and use the uracil-containing strand as a template, thus increasing editing efficiency even more . ShortlyUsing CBEs as a model, researchers sought to expand the base editor toolbox to include ABEs, which would use adenosine deamination chemistry to install A\u2022T to G\u2022C base pair conversions using an inosine-containing intermediate. ABEs would be capable of correcting the most common pathogenic single nucleotide variant (SNV), making them a vital tool for therapeutic genome editing ,7. WhileAs a first step, several RNA adenosine deaminase enzymes were installed into the CBE architecture in place of rAPOBEC1 and assessed for A\u2022T to G\u2022C activity levels. With no activity observed, researchers began the arduous process of using directed evolution to create an ssDNA-specific adenosine deaminase enzyme to produce the first ABE .Escherichia coli, which shares partial structural homology with the rAPOBEC1 enzyme employed by CBEs, was selected as a starting point. Over the course of seven rounds of directed evolution, ecTadA accumulated fourteen mutations to produce ABE7.10, which demonstrated on average 58% A\u2022T to G\u2022C editing efficiency across a variety of target sites with various sequence contexts [Directed evolution facilitates the enhancement or alteration of the activity of a given protein \u201311. The We focus here on the limitations of base editing tools from a therapeutic perspective and the corresponding modifications to the original ABE and CBE constructs that have been engineered to overcome these limitations. The most obvious and major restriction of base editing technologies is the limited types of base pair conversions (C\u2022G to T\u2022A and A\u2022T to G\u2022C only) achievable with CBEs and ABEs. Expansion of the base editor toolbox in this area has been via the development of \u201cglycosylase base editors,\u201d which utilize the basic CBE architecture with additional enzyme components that facilitate excision of the uracil intermediate. Specifically, a suite of \u201cCGBEs\u201d (C\u2022G to G\u2022C base editors) has been developed, which exclude the UGI component of the CBE architecture and instead incorporate a uracil glycosylase enzyme and/or error-prone polymerases \u201316. In tAn additional major limitation of early base editors was their targeting scope. Due to the restrictive editing window (positions 4 through 8 in the most widely used editors), many times a requisite PAM sequence could not be located at the necessary location. After establishing the architectural framework of the first CBE, subsequent efforts found that replacing the Cas9 enzyme with Cas9 variants with relaxed or altered PAM requirements, or Cas homologs from different species, resulted in editors with high editing efficiencies and significantly increased the targeting scope ,19. WithAn important characteristic of a therapeutic genome editor is high editing efficiency. Additional directed evolution efforts have been undertaken on both CBEs and ABEs to improve their overall efficiencies and remove sequence context biases that the deaminases possessed. Architectural engineering efforts on the original BE3 construct produced BE4, which has higher editing efficiencies and product purities than BE3 . In factFinally, arguably the most important limitation of base editors from a therapeutic perspective are unintended edits. Unintended edits include any modification to the cell\u2019s genome other than the intended edit. These may include \u201cbystander edits\u201d (which occur within the same protospacer as the intended edit), the wrong type of edit being installed at the target nucleotide (such as C\u2022G to non-T\u2022A conversions by CBEs) or \u201coff-target edits\u201d (which occur at other genomic loci in the cell), and it is important to note that these unintended editing events aren\u2019t necessarily deleterious, and in fact many times can be benign. Bystander editing occurs as a consequence of deaminase processivity; if multiple target Cs or As are accessible within the ssDNA window, the deaminase will modify some or all. However, extensive deaminase engineering efforts have resulted in less-active deaminases that have narrower activity windows. Additionally, alteration of the overall architecture can manipulate the activity window. Furthermore, with the development of PAM-relaxed Cas9 variants, multiple gRNAs can be designed for a given target base, some of which will \u201cpush\u201d the bystander bases outside of the editing window. These efforts are more thoroughly outlined in several key publications ,25,29\u201331Extensive work has been done to characterize the off-target editing efficiencies of base editors, and three different types have been observed: gRNA-dependent off-targets; gRNA-independent DNA off-targets; and gRNA-independent RNA off-targets \u201338. gRNANotably, delivery of base editors as mRNA rather than plasmid DNA significantly reduces all forms of off-target editing . A relatTranslating the broad efforts of base editor development, mentioned above, into the clinical space requires an influx of support. To this end, many biotechnology companies have been founded or have sublicensed key base editor intellectual property since the development of the inaugural CBE to accomplish this lofty goal, with Beam Therapeutics and Verve Therapeutics dominating the base editor clinical trial space in the United States . In the Translating optimized base editing tools to the clinic requires viable delivery strategies, which has long been a bottleneck in the field of gene therapy. A variety of delivery strategies exist, with the choice of which one to use entirely dependent on the disease that is being treated. Delivery modalities can be roughly broken down by whether treatment will occur in vivo or ex vivo. In the case of in vivo delivery, the base editor is delivered directly into the target tissue(s) of the patient, while in the case of ex vivo delivery, cells are extracted from the patient, treated with the desired base editor, and subsequently redelivered into the patient via autologous transfer. Both strategies have a unique set of risks, challenges, and advantages. We expand on several relevant delivery avenues below.In vivo gene editing must be used in cases where the treatment is designed to address a genetic disease afflicting an internal organ . Given that genetic modification takes places within the body, in vivo therapies are subject to metabolic clearance and native immune responses . Given tCircumventing potentially dangerous immuno-side effects can be achieved using nonviral delivery vehicles such as a lipid nanoparticles (LNPs), inorganic nanoparticles, or polymer-based nanoparticles . In addiEx vivo genome editing is particularly well suited for treating blood disorders, such as hemoglobinopathies and leukemias. In addition to largely bypassing immune response issues, as genetic modification occurs outside of the patient, with ex vivo therapies, cells can be quality checked for accuracy before autologous transplantation . While vOnce a proposed therapeutic has been put through rigorous testing and optimization, the transition from the preclinical to clinical phase (I to IV) begins . It is iPCSK9 splice donor at the exon 1/intron 1 boundary in PCSK9 [PCSK9-targeting gRNA, resulting in LNP delivery mainly to the liver of patients [VERVE-101 is a single-course treatment for HeFH that will permanently knock out in PCSK9 . Followiin PCSK9 ,76,77. Vpatients ,78,79. Tpatients . In this0, and HbS\u03b2+) of severe sickle cell disease (SCD) (HBB) gene, which encodes for the \u03b2-globin protein [HBB alleles, which is an A\u2022T to T\u2022A mutation that causes a Glu6Val substitution in the \u03b2-globin protein. This hydrophobic amino acid substitution causes \u03b2-globin proteins to \u201cstick\u201d to each other and polymerize to form long fibers. These polymers in turn distort the shape of erythrocytes, causing \u201csickling\u201d of the cells. Individuals with the HbSS form of SCD are homozygous for this mutation (this is known as \u201csickle cell anemia\u201d). Individuals with the HbS\u03b20 and HbS\u03b2+ forms of SCD have the HbS mutation on one allele and another mutation in HBB on the other allele that impacts expression of the \u03b2-globin protein. Those with HbS\u03b20 have no expression of \u03b2-globin from this second allele, and those with HbS\u03b2+ have reduced production of \u03b2-globin from this second allele [In July 2022, Beam Therapeutics announced patient enrollment had begun for its BEACON trial NCT05456880), which aims to assess its BEAM-101 therapy as a treatment for three forms . These t, which ad allele . In all d allele . This coHBG1 and HBG2, which encode the same protein but have different regulatory sequences) naturally decreases to very low levels within a year of birth. Reactivation of HbF can compensate for low levels of \u03b2-globin and inhibit polymerization of HbS proteins [HBG1 and HBG2 enhancers) into patient-derived hematopoietic stem and progenitor cells (HSPCs) ex vivo [+ HSPCs are harvested from the patient and electroporated with ABE8-encoding mRNA and HBG1/2-targeting gRNA. The resulting mutation prevents the BCL11A repressor from binding to the HBG1/2 enhancers. To facilitate efficient engraftment of the edited cells, patients must be conditioned prior to reintroduction of the edited cells. Beam has previously reported the successful, high-efficiency editing and subsequent robust reactivation of HbF in ex vivo-edited patient-derived CD34+ HSPCs [Beam\u2019s approach to treat SCD is to \u201creactivate\u201d expression of fetal hemoglobin (HbF), which is comprised of two \u03b1-globin subunits and two \u03b3-globin subunits. HbF is involved in transporting oxygen in fetuses, and expression of \u03b3-globin , began patient enrollment for its BE-CAR7 trial (NCT05397184), which aims to assess the safety of this treatment for relapsed and refractory T cell leukemia in patients aged 6 months to 16 years . T cellsCD7, TRAC, and CD52 for knock-out. The CD7-targeting gRNA targets the CBE to a Gln codon (CAG codon) in CD7 and converts it to a premature stop codon (TAG) via C\u2022G to T\u2022A base editing, resulting in nonsense-mediated decay of the mRNA transcript and knock-out of the gene. It should be noted that bystander mutations are also concurrently introduced but are benign due to knock-out of the gene. TRAC and CD52 knock-out is accomplished similarly. Multiplexing gene knock-outs using traditional, DSB-reliant genome editing methods is accompanied by large-scale chromosomal rearrangements and cytotoxicity, which are avoided when using base editors to install premature stop codons or splice site disruptions [Unfortunately, both the engineered CAR-T cells and the malignant T cells express CD7, resulting in CAR-T cell \u201cfratricide,\u201d in which the CAR-T cells target and destroy themselves. To prevent this, the endogenous CD7 gene must first be knocked out. Additionally, the T cell receptor \u03b1 chain (TRAC) gene must also be knocked out to prevent graft-versus-host disease (which occurs when donor T cells recognize the patient\u2019s cells as foreign and destroy host tissue). Finally, the CD52 gene must also be knocked out, to enhance the lifetime of the CAR-T cells in the presence of the lymphocytic leukemia medication alemtuzumab (which is an antibody that binds to CD52). Therefore, in the BE-CAR7 trial, prior to lentiviral transduction of the CAR7, the T cells are electroporated with CBE-encoding mRNA and three synthetic gRNAs, which target ruptions . TherefoCD7 knock-out CAR-T cells against CD7+ T-ALL cells both in vitro and an in vivo humanized mouse model [The GOSH and UCL team recently reported specific cytotoxicity of engineered se model . In thisHBB that cause reduced or no expression of \u03b2-globin. \u03b2-Thalassemia major is caused by mutations in both HBB alleles and symptoms typically include severe anemia. Without treatment, patient death typically occurs before age 20. Treatment includes periodic blood transfusions and chelation of iron overload that is caused by the repeated blood transfusions.In July 2022, Bioray Laboratories announced its BRL-103 clinical trial (NCT05442346), which is an autologous cell therapy for patients with \u03b2-thalassemia major . \u03b2-ThalaBCL11A enhancer [HBG1/2 expression. Disruption of BCL11A expression would therefore reactivate HBG1/2 expression. The use of a base editor to mutate the BCL11A enhancer rather than wtCas9 has a variety of benefits including fewer genotype outcomes, lower risk of chromosomal rearrangements due to DSBs, and lower cytotoxicity. While no publications have been reported on BRL-103 yet, preliminary results from their Phase I/II clinical trial NCT04211480 in which Cas9 was used to mutate the BCL11A enhancer have been published and showed increased hemoglobin production and a high persistence of edited cells in the bone marrow [BRL-103 is similar to BEAM-101 and involves harvesting HSCs from patients, reactivating HbF using base editing, and reintroducing the edited cells into the patients after conditioning. A major distinction from the BEAM-101 trial is BRL-103\u2019s use of a glycosylase base editor, which presumably is used to mutate the l trial) . As mente marrow . In thisANGPTL3 in the liver for permanent silencing. This treatment is for individuals with homozygous familial hypercholesterolemia (HoFH). In theory, this treatment could also be used for patients with HeFH who do not receive sufficient results from the PCSK9 therapy. VERVE-201 is still preclinical in the investigational new drug (IND) enabling phase but is expected to be rolled out in the clinic in 2024. The news of this development accompanied reporting that the VERVE-101 clinical trial in the US has been put on hold; however, studies are still ongoing in New Zealand and the UK.In addition to the VERVE-101 and BEAM-101 clinical trials, other base editor-based therapies are earlier in the clinical pipeline from both companies. For Verve, their second drug, VERVE-201, targets HBG1/2 and CD117 can treat SCD and \u03b2-thalassemia with less toxic conditioning of the patient; BEAM-201 in which multiplexed gene knock-out will be used for T-cell leukemia and lymphoma treatment; BEAM-301 in which in vivo correction of the R83C mutation in G6PC1 in the liver will be used to treat glycogen storage disease 1a; and BEAM-302 in which in vivo gene correction of the E342K mutation in SERPINA1 will be used to treat alpha-1 antitrypsin deficiency. ESCAPE-1, BEAM-201, and BEAM-301 are all in the IND enabling phase, while BEAM-302 is still relatively early in the optimization phase. It is important to note that additional therapies are also in development at both Verve and Beam; however, for proprietary reasons, further details on these technologies are not presently available.Similarly, Beam has forged ahead on several new drugs: ESCAPE-1 in which ex vivo multiplexed editing of Given the fast pace of genome editing therapeutics, and the quick turnaround time from the development of the first base editor to base editor clinical trials, ethical discussions and considerations are imperative. This is particularly timely given the events of 2018, when CRISPR/Cas9 was used to perform germline genome editing on two embryos, causing members of the general public to feel mistrust and apprehension about therapeutic genome editing in general. Therefore, transparency and open discussions among scientists, bioethicists, policy makers, clinicians, and patient advocacy groups is necessary to ensure productive progress forward and avoid the dissemination of misinformation. Given the short timespan from base editor discovery in 2016 to the initiation of clinical trials now, it is also important to expand our basic understanding of how base editors function, which will ultimately aid base editor drug development and potentially clinical approval.In addition to the candidate therapies in clinical trials underway, more work is being done to expand the host of potentially curative genomic medicines. These efforts are both inside and outside the base editor field. For example, prime editors are one such next step in the evolution of genomic medicine and have addressed some of the limitations of base editors . This neExciting new work within the base editor field has yielded mitochondrial genome editing agents, which have the potential to cure genetic disorders caused by mitochondrial mutations . MitochoThe fast timeline (6 years) for the progression of base editors from bench to bedside was supported by the concurrence of several factors, including the robustness of the technology, an influx of support to both academic research on base editors, as well as to the biotechnology sector, and the knowledge gained from therapeutic efforts on other genome editing agents, particularly in the area of delivery. Fervent research in the space of base editing uncovered limitations of the technology (including undesired editing events) almost as quickly as it developed solutions to these limitations, allowing for the evolution of base editors from research tools to therapeutic agents. We described here this development, and the four current examples of base editing clinical trials. With several more on the horizon, we are excited to see additional creative applications of these technologies to human health.S1 TableInformation presented is an extension of (PDF)Click here for additional data file." \ No newline at end of file