diff --git "a/deduped/dedup_0127.jsonl" "b/deduped/dedup_0127.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0127.jsonl"
@@ -0,0 +1,36 @@
+{"text": "Background: We report a youngwoman who developed septic shock after operative delivery in the 32nd week ofpregnancy.Clinical features, treatment modalities and prognosis of this high-mortality-rate disorder are presentedand discussed.Case: A 24-year-old woman, gravida 1, para 1, was referred to our clinic in a confused state and immediatelyadmitted to our emergency unit. She apparently had eclampsia antenatally. Termination of pregnancy withinduction of labor and vacuum extraction had been employed in gestational week 32 of pregnancy. One day afterdelivery, her clinical and laboratory parameters worsened, so she was referred to our clinic. After a thoroughphysical examination and laboratory evaluation, the patient was diagnosed as having sepsis and disseminatedintravascular coagulation. After blood and urine cultures were taken, aggressive management included volumerepletion, antibiotics and positive inotropic therapy. Because she had persistent fever and unimproved laboratoryvalues despite these therapies, the uterus and ovaries were thought to be the source of sepsis, and total abdominalhysterectomy and bilateral salpingo-oophorectomy were performed. Neither clinical nor laboratory parametersimproved, and the patient died 28 days after delivery as a result of respiratory failure.Conclusion: It is our purpose to emphasize that a rapid and appropriate decision for surgery may prevent thematernal mortality in obstetric septic shock patients. Successful management depends on early identification andaggressive treatment."}
+{"text": "The transmembrane receptor \u2018ROR2\u2019 resembles members of the receptor tyrosine kinase family of signalling receptors in sequence but its' signal transduction mechanisms remain enigmatic. This problem has particular importance because mutations in ROR2 are associated with two human skeletal dysmorphology syndromes, recessive Robinow Syndrome (RS) and dominant acting Brachydactyly type B (BDB). Here we show, using a constitutive dimerisation approach, that ROR2 exhibits dimerisation-induced tyrosine kinase activity and the ROR2 C-terminal domain, which is deleted in BDB, is required for recruitment and activation of the non-receptor tyrosine kinase Src. Native ROR2 phosphorylation is induced by the ligand Wnt5a and is blocked by pharmacological inhibition of Src kinase activity. Eight sites of Src-mediated ROR2 phosphorylation have been identified by mass spectrometry. Activation via tyrosine phosphorylation of ROR2 receptor leads to its internalisation into Rab5 positive endosomes. These findings show that BDB mutant receptors are defective in kinase activation as a result of failure to recruit Src. Human ROR2 is one of two related ROR proteins, identified by sequence similarity to TRK receptors ROR2 cause two skeletal disorders in humans, autosomal recessive Robinow Syndrome (RS) and autosomal dominant Brachydactyly type B (BDB) ROR2 mutations causing RS frequently result in truncation of the receptor in either extra cellular or cytoplasmic regions and are predicted to be loss of function. ROR2-deficient mice exhibited severe skeletal defects which are analogous to those of human RS mutations including dwarfism as well as heart and lung malformation ROR2 mutations causing BDB result in truncation of the cytoplasmic region, either immediately before or after the kinase domain and, by virtue of their dominant acting functions, are predicted to be associated with gain of function or dominant negative activity.Mutations in Despite the significant role ROR2 plays in mammalian skeletogenesis the molecular mechanism by which it exerts its biological effects remain elusive. This study aimed to investigate the role of kinase activation in ROR2 signalling and to determine the role of the C terminal domain deleted in BDB.A growing body of evidence implicates members of the Wnt family of signalling molecules as endogenous ROR2 effectors. Functional studies in developing xenopus embryos have demonstrated the role of ROR2 in non-canonical Wnt pathways 755X) To evaluate the intrinsic kinase activity potential of ROR2, the cytoplasmic domain of ROR2 was fused to the dimeric Fc portion of human IgG to create Fc-ROR2 \u2018wild type\u2019 (WT), Fc-ROR2 \u2018Kinase dead\u2019 and an Fc-ROR2 truncation mutant  we were interested in discovering if Wnt ligands could elicit activation of the kinase activity of native ROR2 receptors. Chondrocytes transfected with full length myc-tagged ROR2 (ROR2-myc WT) were stimulated with either BSA carrier or Wnt5a for 5, 30 or 60 min. The receptor was immunoprecipitated and receptor phosphorylation was detected by phosphotyrosine immunoblotting  and an immunoreactive protein, at the predicted MW of Src, was recruited to the receptor upon 30 min of Wnt 5a stimulation  809PMVPPP) domain A notable feature of the anti-phosphotyrosine blots of immunoprecipitated native ROR2 stimulated with Wnt5a was a tyrosine phosphorylated protein of \u223c60 KDa (data not shown). Src family kinases have been directly implicated in signalling from a number of RTKs 747X, which not only resulted in lower Src activation even after Wnt5a stimulation, compared to either ROR2-myc WT or KD, but also exhibited far less co-localisation  or a kinase dead Src K295M/Y527F (Src MF). ROR2-myc WT, KD, and P860X receptors were tyrosine phosphorylated in a ligand-independent manner when co-expressed with Src Y527F  that are essential for Src kinase binding. Full length ROR2-myc WT, KD, Prc Y527F . PhosphoCollectively, results in 645/Y646 in the predicted activation loop of ROR2 and Y873 in the BDB domain.We next sought to identify the substrates for Src-mediated phosphorylation in ROR2. Full length ROR2-myc WT was co-expressed with Src A, immunoprecipitated and tryptic peptides subjected to CID MS/MS  would resemble loss of function homozygous RS mutants. This is clearly not the case as the phenotypes of the two syndromes are quite distinct. The alternative explanation is that BDB mutations represent a gain of function phenotype whereby ablation of the ROR2 tyrosine kinase pathway results in the activation (or relief of repression) of signalling pathways in the limb which leads to digit truncation 2 for up to six months in a mixture of Dulbecco's modified Eagle medium and Ham's F12  supplemented with 2 mM glutamine (Invitrogen), 0.1 mg/mL streptomycin, 0.2 U/mL penicillin, 4.5 g/L glucose (Sigma) and 10% fetal calf serum (v/v) . Cells were transfected with Lipofectamine 2000 (Invitrogen) according to manufacturer's instruction except using only half the amount of plasmid DNA and Lipofectamine 2000 reagent recommended.T/C-28a2 human chondrocytes  were cultured at 37\u00b0C, 5% CO416 ; the anti-phosphotyrosine cocktail used in western blotting comprised mouse anti-phospho-tyrosine clone 4G10\u2122 (Upstate) and clone pY20 ; rabbit anti-Rab5A and rabbit anti-cSrc (Santa Cruz). The secondary antibodies were anti-mouse- and anti-rabbit-IgG Horseradish Peroxidase conjugates (Amersham). The secondary antibodies for immunofluorescence studies were anti-mouse-Alexa 546 (Molecular Probe) and anti-rabbit-FITC (DAKO).Recombinant murine Wnt5a was obtained from R&D Systems. SU6656 Src inhibitor (used at 24 \u00b5M) was purchased from CALBIOCHEM. Primary antibodies used in this study were: mouse anti-IgG-Fc-HRP conjugate and mouse anti-IgG (Pierce); mouse anti-myc; rabbit anti-phospho-Src Y527F, Src A) and kinase dead Src  in pBabe Puro were generous gifts of Dr. Frame .The pcDNA3.1 mouse myc-tagged ROR2 was a generous gift of Dr. Minami . The chicken constitutively active Src (Src Y747X was amplified using a primer pair that introduced a XhoI restriction site at the point of truncation: XF (5\u2032-AAGGAAAAAAGCGGCCCTCGAGGTCGACCCACGCGTCCG-3\u2032) and L747XR (5\u2032-ATAATCCTCGAGGAGCCGGCTGTGGATGTC-3\u2032). The amplified product was digested with XhoI restriction enzyme and sub-cloned into pcDNA3.1-myc. Similarly, the ROR2 P860X mutant was constructed using XF and P860XR (5\u2032-CAGTTCCTCGAGCGGCTTGGGGACCATCTG-3\u2032) primers.ROR2 L755X truncation mutant was generated by overlap extension mutagenesis. Two PCR reactions using two mutagenic primers 6Lstop (5\u2032-CTTTCCAATTAAAACAGCTCGG-3\u2032) and 6Rstop (5\u2032-CCGAGCTGTTTTAATTGGAAAG-3\u2032) that introduced a stop codon at Y755 and a silent Mse1 restriction site for selection and two outside primers (5R: 5\u2032-GATCTGCACCGGGTAGAAGTTG-3\u2032 & 5L: 5\u2032-CAACCAGGATGTGGTGGAGATG-3\u2032). The kinase dead mutations  of both full length and Fc-conjugated ROR2 were generated using QuickChange\u00ae II XL Site-Directed Mutagenesis Kit (Stratagene) according to manufacturer instructions using primers 3K-3RF (5\u2032-GGCCGTGGCCATCAGGACGCTGAGAGACAGGGCTGAGGGGCCCC-3\u2032), and the second primer that was the reverse complementary sequence to 3K-3RF.The Fc-ROR2 WT in pEFBOS was constructed by inserting the transmembrane, cytoplasmic and the 3\u2032 flanking region of ROR2 , into ss-Fc-IRES-Tpz-pEFBOS vector. The Fc-ROR2 Y3VO4; 50 mM NaF and 1 tablet of complete protease inhibitor cocktail (Roche) per 10 ml of buffer, PH 7.5). For ROR2-myc immunoprecipitation, 200\u2013500 \u00b5g whole cell lysate was incubated with 0.5 \u00b5g anti-myc antibody for 1 hr at 4\u00b0C followed by incubating the mixture with 30 \u00b5l of a 50% protein A-sepharose slurry (Amersham Biosciences) for 1 hr hour at 4\u00b0C. The immunoprecipitates were washed excessively and boiled in 2 \u00d7 SDS sample buffer ; 2% SDS (w/v); 0.1% bromophenol blue (w/v); 200 mM DTT; pH 6.8) for 5 min at 95\u00b0C prior to running on SDS PAGE.Following serum starvation in Krebs Hepes Buffer (KHB) chondrocytes were stimulated with either carrier control (0.1% BSA in PBS (w/v)) or Wnt5a (1.0-1.6 \u00b5g/mL). The reaction was stopped by adding 10x volume cold PBS. Cells were lysed in lysis buffer ; 1 mM NaGels were transferred to PVDF membrane (Millipore) and blocked in TBS-T containing 5% bovine serum albumin . Primary antibodies (in TBS-T/5% BSA) were incubated with the membrane for 1 hr at room temperature or 4\u00b0C overnight. The membrane was washed (3\u00d715 min) in TBS-T and subsequently probed with the conjugated secondary antibody (in TBS-T/1% BSA) for 45 min at room temperature. The membrane was washed (5\u00d710 min) with TBS-T, before membranes were exposed to ECL reagents (Pierce) for visualization of immunoreactive proteins.T/C-28a2 chondrocytes were grown on acid scratched glass cover slips. Following Wnt5a stimulation, cells were washed in cold PBS and fixed in 4% paraformaldehyde (w/v) for 10 min at room temperature. Cells were then washed 3 times in PBS and permeabilised in 0.2% triton X-100 (v/v)/ 0.5% BSA (w/v) for 3-5 min, followed by washing with PBS. Non-specific binding sites were then blocked with 4% BSA/TBST (w/v) for 10 min. The cover slips were incubated in a cocktail of primary antibodies (1: 100 in 4% BSA/TBST (w/v)) for one hour, followed by incubation in each secondary antibody (1: 100 in 4% BSA/TBST (w/v)) separately with PBS washes between each staining. The cover slips were mounted onto glass slides using Mowiol and viewed by direct immunofluorescence using the Leica inverted confocal microscope (DM IRE2). Image J was used to analyse the images. Each experiment was repeated at least three times. 50 cells were counted for quantification purposes.ROR2-myc was co-expressed with active Src (Src A) or inactive Src (Src MF) for 24 h in T/C 28a2 chondrocytes. ROR2-myc was immunoprecipitated using anti-myc antibody and was separated by SDS-PAGE. Following Coomassie staining, the ROR2-myc band was excised. Cysteines were reduced (10 mM dithiothreitol) and alkylated (50 mM iodoacetamide) prior to overnight in-gel trypsin digestion  in 25 mM ammonium bicarbonate.2 affinity chromatography according to Larsen et al. (25), with minor modifications. Peptides were loaded onto TiO2 micro-columns in 2% TFA. Columns were washed with 100 mg/ml DHB, 80% MeCN, 2% TFA, then with the same buffer omitting DHB. Peptides were eluted in a two-step procedure with 50 mM Na2HPO4 followed by dilute NH4OH solution. Eluates were desalted using ZipTips (Millipore). The resulting peptide mixtures (eluates and un-bound fraction) were analysed by liquid chromatography mass spectrometry (LC-MS/MS).Phosphopeptides were enriched from the resulting mixture by TiO3 scan of the neutral loss ion. Survey scans were acquired in the ICR cell with a resolution of 100,000 at m/z 400. Precursor ions were isolated and subjected to CID in the linear ion trap. Isolation width was 3 Th. Only multiply-charged precursor ions were selected MS/MS. CID was performed with helium gas at normalized collision energy of 35%. Precursor ions were activated for 30 ms. Data acquisition was controlled by Xcalibur 2.0 software. Data were searched against the Swissprot database using the SEQUEST (Thermo Electron) and Mascot algorithms . Phosphorylation site localisation was assessed using the A-score algorithm (26), with manual validation.On-line liquid chromatography was performed by use of a Micro AS autosampler and Surveyor MS pump . Peptides were loaded onto a 75 \u00b5m  Integrafrit  C8 resolving column (length 10 cm) and separated over a 40 minute gradient from 0% to 40% acetonitrile . Peptides eluted directly (\u223c350 nL/min) via a Triversa nanospray source  into a 7 Tesla LTQ FT mass spectrometer (Thermo Electron). The mass spectrometer alternated between a full FT-MS scan (m/z 395-1600), subsequent CID MS/MS scans of the five most abundant ions, and, if a neutral loss of 98 Da from the precursor ion was observed in the CID mass spectrum, an MSFigure S1The annotated mass spectra of phosphorylation sites in the mouse ROR2 cytoplasmic regions. Eight Src-dependent phosphopeptides were identified by mass spectrometry.(0.50 MB TIF)Click here for additional data file.Table S1(0.07 MB DOC)Click here for additional data file.Table S2(0.06 MB DOC)Click here for additional data file."}
+{"text": "LMS method was used to fit percentile curves across age for each skinfold. Q tests for fit were used to assess the global goodness of fit of our final models. The study shows for the first time smoothed population-based values of body fat distribution indices for Polish children and adolescents 7\u201318\u00a0years of age. Reported skinfold centiles are higher compared to previously established for Warsaw children and very close to the actual US data. Conclusion Our study provided for the first time population-based values for skinfold thicknesses evaluation in a way allowing to calculate reliable Z scores. The early detection of abnormal fat stores, using our population-based values and respective Z scores, may be now implemented for practice.Skinfold thicknesses are used as valid anthropometric indicators of regional body fatness. Actual population-based values for skinfold thicknesses for Polish children are not available. The purpose of this study was to provide population-based values for triceps, subscapular, and abdominal skinfold thicknesses in healthy children and adolescents. A total number of 17,416 boys and girls aged 6.5\u201318.5\u00a0years, randomly selected from whole Polish population of children and adolescents, were enrolled in the study. Skinfold thicknesses  were measured using Harpenden skinfold caliper. All measurements were taken after the training of participating investigators. The  Skinfold thicknesses evaluation, due to its low cost and noninvasive procedure, is one of the most widely used anthropometric methods for assessment of nutritional status during growth and maturation period , 23, 25.Skinfold measurements have low precision error but should be done by well-trained personnel . In pracLMS method. Box\u2013Cox transformation allows transformation of data to normality by a suitable power transformation. Standardized Z scores can be calculated from transformed data [Reliable determination of references (medians and percentiles) for a given skinfold thicknesses requires a large set of healthy subjects . Previoumed data , 5.Z scores. The references from Cracow study were collected 9\u00a0years ago and as well as in Warsaw comprised only urban children. Although, the Cracow data were established by LMS method, Box\u2013Cox transformation power , median (M), and generalized coefficient of variation  were not published; therefore, calculation of Z scores was not available. Since skinfold thickness evaluation is still considered as useful method for assessment of nutritional status during growth and because actual and appropriately established references are missing for Polish population, the purpose of this study was to provide population-based values for triceps, subscapular, and abdominal skinfold thicknesses for children and adolescents aged 7\u201318\u00a0years.Actual population-based references for skinfold thicknesses are not available for Polish children, and local data are limited to urban regions, including the cities of Warsaw and Cracow , 18. FurThe analyzed data were collected in the course of the OLAF study in which the reference blood pressure ranges were elaborated for Polish children and adolescents. The study sample comprised data collected between November 2007 and November 2009. Study participants were randomly selected using two-stage sampling. Primary units (schools) were sampled from an all-schools-in-Poland sampling frame; sampling was stratified by urban/rural area. In the second stage, all pupils in the required age range within the sampled schools comprised the sampling frame. Pupils in schools were selected for the survey by stratified random sampling, the stratification variables being classes. The medical history of the study participants, including past and present diseases, as well as medications used, was taken from the parents. The general health status of each subject was assessed by a physician. Exclusion criteria was as follows: infection with diarrhea leading dehydration, absence of right upper limb or phocomelia, dwarfism, cachexia, Cushing syndrome, renal failure, heart failure, hepatic failure, etc., organ transplantation, systemic diseases, malignant cancer, Turner syndrome, Down syndrome, etc., systemic glucocorticoids use, and pregnancy.All subjects and their parents (in the case of subjects under 18\u00a0years of age) gave their informed consent to participate in the study (subjects over 16\u00a0years of age and parents gave written consent). Ethical approval was obtained from Ethical Committee of The Children\u2019s Memorial Health Institute before the study commenced.A total number of 17,416 boys and girls aged 6.5\u201318.5\u00a0years with measured at least one skinfold thickness were enrolled in the study. The response rate was 0.71. We excluded small number of outliers  following \u00b15 standard deviation criteria as was done by other authors . CharactThe OLAF study (PL0080) was carried out in 416 schools  covering all regions of Poland. Measurements were conducted in school nurses\u2019 offices from 8:00\u00a0a.m. to 3:00\u00a0p.m.; room temperature was in range 20\u201326\u00b0C. All measurements were taken by centrally trained staff: anthropologists, nurses, public health professionals, and physicians using the standard and calibrated equipment from the same manufacturer.Body height was measured in the standing position using stadiometer (SECA 214). Body weight was measured using medical scale (Radwag WPT 100/200). Body mass index was calculated as body weight divided by height in meters squared. The exact age of each participant was calculated from birth and observation dates.Skinfold thickness measurements were performed by lifting a fold of skin and subcutaneous fat away from the underlying muscle and bone. Each skinfold thickness was measured in duplicate with Harpenden skinfold caliper. When a difference between the first and the second measurement exceeded 6\u00a0mm, a third measurement was taken. The triceps skinfold was lifted parallel to the long axis of the body, midway on the back of the hanging freely right upper arm. The subscapular skinfold was lifted horizontally below the tip of right scapula. The abdominal skinfold was lifted diagonal midway between umbilicus and right anterior superior iliac spine.All measurements were taken by centrally trained staff. The training consisted of workshops for study teams, during which the standardized measuring technique was presented  and taught . Following the workshop, in-the-field standardization sessions were conducted according to the standardization protocol. Reliability of skinfold thickness measurements between the trainer and the study staff was recorded. After 10\u00a0months of conducting the study, re-training of study teams was carried out.LMS method [LMS method uses polynomial splines to fit smoothed curves: L (Box\u2013Cox transformation power), M (median), and S  across age by maximized penalized likelihood [L, M, and S parameters were derived from raw data, separately for each skinfold and sex, in a single-stage modeling. Q tests for fit [The S method  was usedS method  was usedkelihood . The smo for fit  were useThe smoothed percentiles for triceps, subscapular, and abdominal skinfold thicknesses are presented in Fig.\u00a0LMS parameters across age for all measured skinfold thicknesses by sex are shown in Tables\u00a0In boys, age-dependent changes and shape of percentile curves were more complex. Local maximums at age 11\u201312\u00a0years occurred for most of the percentiles of all skinfold thicknesses. For triceps skinfold thickness median increased from 9.2\u00a0mm 6.5\u00a0years) to 11.3\u00a0mm (11.5\u00a0years), then decreased to 9.1\u00a0mm (16.0\u00a0years), and then slightly increased to 9.4\u00a0mm at age 18.5\u00a0years. Ninety-seventh percentile increased from 19.9\u00a0mm (6.5\u00a0years) to 28.8\u00a0mm (11.5\u00a0years), then decreased to 22.8\u00a0mm (16.5\u00a0years), and then slightly increased to 23.2\u00a0mm at age 18.5\u00a0years. For subscapular skinfold thickness, median increased from 5.5\u00a0mm (6.5\u00a0years) to 9.5\u00a0mm (18.5\u00a0years), whereas 97th percentile increased from 13.9\u00a0mm (6.5\u00a0years) to 31.8\u00a0mm (11.5\u00a0years), then decreased to 21.4\u00a0mm (16.0\u00a0years), and then increased to 24.7\u00a0mm (18.5\u00a0years). For abdominal skinfold thickness, median increased from 5.9\u00a0mm (6.5\u00a0years) to 9.7\u00a0mm (12.5\u00a0years), then very slightly decreased to 9.5\u00a0mm (14.5\u00a0years), and then increased to 10.7\u00a0mm at age 18.5\u00a0years. Ninety-seventh percentile increased from 22.8 (6.5\u00a0years) to 39.1\u00a0mm (12.0\u00a0years) and then decreased to 33.3\u00a0mm at age 18.5\u00a0years. Smoothed \u00a0years toThis study is the first and the largest study of skinfold thicknesses based on a randomly selected sample of 17,416 boys and girls aged 6.5\u201318.5\u00a0years from both urban and rural areas of Poland. The study enabled to calculate and provide a reference data for skinfold thicknesses, as noninvasive estimators of fat stores in Polish children and adolescents aged 7\u201318\u00a0years.As expected, our results revealed gender-related differences between boys and girls for triceps, subscapular, and abdominal skinfold thicknesses. In girls, percentile curves showed constant increase with age. In boys, subscapular, triceps, and abdominal skinfold thicknesses also increased with age; however, in contrast to girls, maximum values were noted in groups aged 11\u201312\u00a0year and then skinfold thicknesses returned to the values preceding the pubertal spurt. The same finding was already reported in previous studies from Warsaw , Cracow Furthermore, skinfold thicknesses noted in our study appeared higher than in Dutch  and TurkThe main limitation of our study is related to its cross-sectional design. Body fat indices in growing children should be rather obtained in longitudinal studies showing longitudinal changes in individual growth and development.Z scores. In agreement with others [Z scores corresponding to the percentile rankings, using the following formula: Z\u2009=\u2009{(skt/M)L\u2009\u2212\u20091}/LS, where skt indicates actual skinfold thickness. In the case of L\u2009=\u20090, as noted for abdominal skinfold thickness in girls /S. The last formula should be also used for L between \u22120.01 and +0.01 [The strength of our study was that examined data were sampled in a random manner from whole population of Polish children and adolescents. Further, intra-observer as well as inter-observer measurement errors were considered as low and satisfactory (data not shown due to large number of investigators participating in this survey), and collected data were verified and checked for outliers. Moreover, the total number of subjects  allowed reliable determination of medians and percentiles [h others , we stros Tables\u00a0, Z scoreZ scores. In consequence, the early detection of abnormal fat stores, using our data and respective Z scores, may be now implemented for everyday clinical practice.In conclusion, our study based on randomly selected sample of 17,416 healthy children and adolescents from Poland provide for the first time population-based values for skinfold thicknesses evaluation in a way allowing to calculate reliable"}
+{"text": "A receptors (GABAARs) show behavioral, cognitive, neuroendocrine and pharmacologic features expected of a mouse model of melancholic anxious depression, including reduced survival of adult-born hippocampal neurons. Here we embarked on elucidating the developmental substrate underlying this phenotype, focusing on the Elevated Plus Maze and Forced Swim Test as relevant behavioral paradigms. In a first series of experiments using hemizygous tamoxifen-induced genetic inactivation of a floxed \u03b32 genomic locus we show that reducing the gene dosage at postnatal days (P)13/14 but not P27/28 results in altered behavior in both of these tests in adulthood, reminiscent of the anxious-depressive phenotype previously described for global heterozygous mice. However, in contrast to global heterozygous mice, the behavioral changes induced by \u03b32 subunit knockdown at P13/14 occurred without changes in adult hippocampal neurogenesis, indicating that altered neurogenesis is not an absolute prerequisite for anxiety- and depression-related behavior in this model. In a separate series of experiments using a pharmacological approach, acute but transient potentiation of GABAARs with diazepam uncovered distinct developmental vulnerabilities for altered behavior in the Elevated Plus Maze and Forced Swim Test, respectively. Specifically, diazepam given during P10-16 but not during later weeks resulted in increased anxiety-like behavior in adulthood, while diazepam administered during P29-35 but not earlier nor later resulted in increased immobility behavior in adulthood. We conclude that anxiety-like behavior in the Elevated Plus Maze and behavioral despair-like immobility in the Forced Swim Test are controlled by separate postnatal critical periods characterized by distinct developmental sensitivity to manipulation of GABAergic transmission via \u03b32 subunit-containing GABAARs.Vulnerability for anxiety and depressive disorders is thought to have origins in early life and is increasingly recognized to involve deficits in GABAergic neurotransmission. Mice that were rendered heterozygous for the \u03b32 subunit gene of GABA ARs) are increasingly implicated in both types of disorders ARs serve as the principal receptors mediating neural inhibition in the brain. Structurally they are heteropentameric chloride channels composed of \u03b11-6, \u03b21-3, \u03b31-3, \u03b4, \u03b5, \u03c0, \u03b8, and \u03c11-3 subunits ARs  are of particular interest as they mediate the behavioral actions of benzodiazepines (BZs) gabrg2, \u03b32+/\u2212) exhibit anxious-depression-related behavior, including cognitive, cellular, neuroendocrine and pharmacological alterations expected of a mouse model of melancholic major depression +/\u2212 mice have also been described for mice that lack the \u03b12 subunit of GABAARs Extensive comorbidity among major depressive disorder (MDD) and anxiety disorders suggests related disease etiologies +/\u2212 mice Conditional hemizygous inactivation of the \u03b32 gene in the embryonic telencephalon of mice results in an anxious-depressive-like phenotype in adulthood comparable to that of global \u03b32ARs plays a key role in regulating cell fate decisions in adult quiescent stem cell niches AR deficits show a marked reduction in the survival of adult-born hippocampal neurons, whereas hippocampal neurogenesis is unaffected in behaviorally normal mice with a developmentally delayed GABAAR deficit AR-deficient mice might involve deficits in adult hippocampal neurogenesis  Differences in the rate of activity-dependent maturation of neural circuits are thought to underlie brain function-specific critical periods, i.e. developmental periods during which a certain disturbance has a significantly greater impact than the same event later in life AR deficit-induced anxiety- and depression-related behavioral changes can occur independently of reduced hippocampal neurogenesis. Second, we used pharmacological potentiation of GABAARs with DZP to transiently but more abruptly perturb brain development during distinct postnatal temporal windows predicted to underlie normal anxiety- and depression-related behavior in adulthood. Our experiments show that genetic impairment and pharmacologic potentiation of GABAergic transmission between the second and fifth postnatal week of mice have comparable lasting and detrimental consequences on anxiety- and depression-related behavior in adulthood. Moreover, the DZP treatment experiments identify two distinct developmental critical periods that selectively underlie behavior in the EPMT and FST, respectively.Here we present the results from two independent studies designed to define critical developmental periods during which perturbations of intrinsic GABAergic neural activity in mice result in lasting behavioral changes in the Elevated Plus Maze (EPMT) and Forced Swim Test (FST), respectively. In addition, we extend our studies addressing the role of hippocampal neurogenesis in regulating such behavior. First, we employed tamoxifen-inducible heterozygous knockout of the \u03b32 subunit gene at different time points of postnatal brain development, using mice carrying a single copy of a floxed \u03b32 subunit gene locus f\u03b32/+,  and the AR \u03b32 subunit global knockout  \u2212/\u2212, \u03b32+/\u2212 and wild-type (WT) mice used to analyze cortical neurogenesis were produced by mating of \u03b32+/\u2212 mice with \u03b32+/\u2212 or WT mice. CAGGCre-ER\u2122 X f\u03b32/+, f\u03b32/+, CAGGCre-ER\u2122 and WT mice were produced by mating hemizygous CAGGCre-ER\u2122-transgenic mice with f\u03b32/+ mice. All mice were weaned between P20 and P22. The ages of mice given in postnatal days (P) refer to the exact age of all mice in a group at the time of treatment. The ages of mice indicated in weeks refer to the age of mice pooled from multiple litters in number of weeks \u00b13 days, at the time of testing. All animal experiments were performed in accordance with NIH guidelines and approved by the Institutional Animal Care and Use Committee  of the Pennsylvania State University.All mice used for this study were backcrossed onto the 129X1/SvJ genetic background  and produced in our own breeding colony with food and water available ad libitum, on a 12 h:12 h light-dark cycle. GABACre-mediated recombination of floxed target genes was induced by a total of two injections of tamoxifen , one day apart. The daily dosage was 180 mg/kg per day  and the drug was emulsified in ethanol:sunflower seed oil (1\u22369). As part of the drug treatment procedure the pups were temporarily transferred to a new cage  until all mice of a litter had been treated. For P13/14 TAM and vehicle treatment this procedure included temporarily separating the pups for maximally 5 minutes from their mother.CAGGCre-ER\u2122 X R26Y mice were injected with tamoxifen at P13/14 or P27/28 as described above and anesthetized and trans-cardially perfused with 4% paraformaldehyde in phosphate buffered saline (PBS) at six weeks of age. The brains were postfixed for 16 h in the same fixative, rinsed in PBS three times and stored in PBS containing 0.05% sodium azide at 4\u00b0C until all brains were ready for sectioning. Coronal sections (50 \u00b5m) were cut with a Vibratome  using a brain matrix  for reproducible positioning of brains and processed for immunofluorescent staining using rabbit anti-green fluorescence protein  antiserum and goat anti-doublecortin  antibody , developed with anti-rabbit Alexa 488 and anti-goat Cy3 secondary antibodies (1\u2236500. Jackson ImmunoResearch), and rinsed in nuclear stain DRAQ5  or DAPI . The percentage of DRAQ5- or DCX-positive cells that colocalized with YFP immunofluorescence in regions of interest was determined by counting of cells in confocal images. Optical Z-plane sectioning (1 \u00b5m steps) was used to ensure that colocalized signals belonged to the same cells. The method used for analyses of TAM-induced recombination of the f\u03b32 locus by PCR is provided in DZP  was administered p.o. as a suspension in 0.3% tween 80 in saline for a dosage of 1 mg/kg/day for treatment during P10-16 or 2 mg/kg/2 days for treatments during P14-28, P22-28, P29-35, and P50-56. Control mice were gavaged identically with vehicle alone. Drug and vehicle treated mice were briefly transferred to a new holding cage as was done for TAM treatment. The behavioral effects of DZP administered at 1 mg/kg/day from P10-16 were comparable to those of DZP administered at 2 mg/kg every other day during P14-28. Therefore, for practical reasons all other DZP treatments used a dose of 2 mg/kg every two days. Doses of 1\u20132 mg/kg DZP have acute anxiolytic but no sedative effects All experiments were performed with female mice, the gender that in humans is more vulnerable to anxiety and mood disorders +/\u2212 mice The OFT was used to assess possible alterations in baseline locomotion that might affect EPMT and FST measures. The mice were placed into the corner of a novel open field arena (50\u00d750 cm), and the total distance travelled over 15 min was recorded with an Ethovision system . Given that the OFT was performed under red light it cannot be used to assess neophobia. The EPMT 2B4O7) at room temperature followed by four times 5 min in PBS. They were stained with a rat antiserum against BrdU  and a monoclonal antibody for neuronal-specific nuclear protein (NeuN), followed by appropriate Cy3- and Alexa 488-coupled secondary antibodies . The number of BrdU and BrdU/NeuN positive neurons in the subgranule cell layer of confocal images across sections of the entire bilateral hippocampus were counted as described Female P13/14 TAM-treated CAGGCre-ER\u2122 X f\u03b32/+ mice and littermate controls were injected with the DNA synthesis marker 5-bromo-2\u2032deoxyuridine  at P63 and transcardially perfused at P91 with 4% paraformaldehyde in 0.1 M phosphate buffered saline  postfixed for 12 h in the same solution, and equilibrated in 30% sucrose for at least one day. Free-floating sections cut coronally (50 \u00b5m) by Vibratome  were permeabilized with 1% Triton X-100 in PBS, incubated in 2N HCl for 30 min at 37\u00b0C, and washed for 5 min in 0.1 M sodium borate  or Kruskal-Wallis tests (three groups). The latter were followed up by pairwise comparisons using Mann-Whitney tests.Statistical analyses were conducted using Minitab15 . Simple comparisons of two group means of behavioral tests were done by two-sample two-tailed t-tests. The latency to immobility data of FSTs and TSTs were all log transformed to satisfy the homogeneous variance assumption. One-way analyses of variance (ANOVAs) were used for comparison of behavioral data of multiple genotypes, followed by +/\u2212 and \u03b32\u2212/\u2212 mice were indistinguishable from values of WT littermates  +/\u2212 mice  was correlated with reduced survival of adult-born hippocampal neurons AR deficits induced at P13/14. CAGGCre-ER\u2122 X f\u03b32/+ mice and CAGGCre-ER\u2122 and f\u03b32/+ littermate controls were treated with TAM at P13/14, followed by metabolic labeling of replicating neural progenitor cells with BrdU at P63 and immunofluorescence analyses of brains at P91, allowing for four weeks of maturation of BrdU-labeled neurons. Interestingly, the numbers of BrdU-positive cells and BrdU positive hippocampal granule cells co-labeled with the mature neural marker NeuN in P13/14 TAM-treated CAGGCre-ER\u2122 X f\u03b32/+ mice were indistinguishable from corresponding cell counts in identically treated CAGGCre-ER\u2122 and f\u03b32/+ controls, indicating unaltered production and survival of adult generated granule cells  (We previously showed that the manifestation of heightened aversion to open arms in the EPMT and increased immobility in the FST of three different \u03b32-subunit-deficient mouse lines (\u03b32Whitney) . ConsistWhitney) . Thus, hARs between the end of the second and fifth postnatal week interferes with maturation of neural circuits underlying normal anxiety- and emotion-related behavior in adulthood. However, more precise mapping of critical periods by genetic means was hampered by the ill-defined temporal delay in loss of receptor function following TAM-induced gene deletion. Therefore, in a second study we tested whether the aforementioned results from genetic analyses could be corroborated by a pharmacological approach that is predicted to more abruptly perturb intrinsic neural activity-dependent developmental processes. Analysis of cortical ocular dominance plasticity indicates that critical developmental periods are not only sensitive to genetic reductions in GABA input but also to pharmacological potentiation of GABAARs with low, anxiolytic concentrations of DZP. Therefore, to test whether DZP treatment could be used to delimit critical periods for behavior in the EPMT and FST, WT mice were subjected to one- or two-week treatment with DZP or vehicle starting at different postnatal ages , followed by behavioral analyses starting at eight weeks of age at least four weeks after the end of DZP treatment, one test per week \u200a=\u200a3.49, p<0.01, immobility duration, t(20)\u200a=\u200a2.63, p<0.05; P10-16, 14-28, 22-28 and 55-56: n\u200a=\u200a8\u201313, p>0.05 for all comparisons, t-tests] . IncreasARs affect anxiety- and emotion-related behavior in adulthood.We have presented the combined results of two independent studies assessing postnatal developmental periods during which perturbations of GABAergic transmission via \u03b32-containing GABAAR \u03b32 subunit gene dosage identified a postnatal two-week period during which induction of a permanent GABAergic deficit led to increased anxiety- and depression-related behavioral measures in adulthood. Conditional TAM-induced recombination of the \u03b32 gene at P13/14 resulted in heightened anxious behavior in the EPMT and FST, similar to behavior previously reported for mice with global or embryonically reduced GABAAR expression ARs by 17%. However, in global \u03b32+/\u2212 mice \u03b32-containing GABAARs were reduced on average across brain regions by approximately 25% only, i. e. about half of what was expected ARs. Due to the known delay of TAM-induced and Cre-mediated recombination of floxed target genes (1\u20132 days) AR gene dosage affects adult behavior maps to in-between P14 and P35  of postnatal mouse development. Additional studies are needed to assess whether the phenotype of P13/14 TAM-treated CAGGCre-ER\u2122 X f\u03b32/+ mice includes depression-related hypercortisolism, pharmacological alterations and anhedonia-like deficits previously reported for global \u03b32+/\u2212 mice In the first study, irreversible TAM-induced knockdown of the GABAAR deficit-induced anxious-depression-related brain states. First, \u03b32+/\u2212 mice with a global reduction of the \u03b32 gene dosage revealed functional deficits in postsynaptic GABAARs mainly in hippocampus and cingulate, piriform and frontal cortex (\u221225 to \u221235%), while such deficits were below threshold for reliable quantitation in the amygdala (<13%) +/\u2212 mice. Here, we showed that selective knockdown of \u03b32 expression in two-week-old mice results in a comparable anxiety- and depression-related phenotype that did not involve altered production or survival of hippocampal granule cells. By extension, the aforementioned deficits in hippocampal neurogenesis of global \u03b32-deficient mice Our previous studies pointed to the hippocampus and cortex as likely substrates for GABAARs with low concentrations of DZP to more precisely map critical developmental periods involved in establishing anxiety- and depression-related behavior. These experiments identified P10-16 and P29-35 as two critical periods that separately and specifically control anxiety-related (EPMT) and immobility (FST) behavior, respectively in adulthood. The idea that critical periods may be sensitive to both a reduction and potentiation of GABAergic transmission refutes the intuitive presumption that opposite manipulations must have opposite outcomes. Previous studies of ocular dominance plasticity of the visual cortex suggested that both genetic reduction of GABA synthesis and pharmacological potentiation of GABAARs with diazepam perturb sensory input-mediated ocular dominance plasticity ARs. Both types of manipulations relied on altering the function of \u03b32-containing GABAARs and thereby likely targeted similar neuroanatomical substrates. We postulate that both genetic impairment and pharmacological potentiation of GABAARs interfered with neural activity-dependent processes that normally drive the development of neural circuits underlying anxiety and depression-related behavior.In a second study, we used potentiation of GABAOur study is subject to several limitations. First, it relied principally on the EPMT and FST as proxies of anxiety- and depression-related behavior. The EPMT has face and construct validity for generalized anxiety, as well as high predictive validity for anxiolytic drug action The incomplete correspondence of sensitive periods mapped by genetic and pharmacologic methods might in part reflect the fact that the first approach relied on gradually and modestly reducing GABAergic input, thereby allowing for compensatory adaptations of neural excitability, while DZP treatment affects GABAergic input instantaneously and probably more potently. The slower time course and reduced potency of the genetic vs. pharmacologic manipulation may also explain the unaltered behavior of TAM28/29-treated CAGGCre-ER\u2122 X f\u03b32/+ mice, which based on results of the DZP-treatment experiment would be predicted to show increased immobility in the FST.The anxiety\u2013related critical period identified here (P10-16) maps to within a larger temporal window (P5-21) previously implicated in the developmental programing of anxiety by analyses of 5-HT1A receptor knockout mice The critical period identified as important for immobility behavior in the FST (P29-35) matches a developmental period (P30-35) that is sensitive to social isolation stress in rats +/\u2212 and \u03b32\u2212/\u2212 embryos, thereby likely excluding developmental processes that overtly affect the majority of neocortical neurons of \u03b32+/\u2212 mice. However, these studies do not exclude deficits in numbers or activity-dependent differentiation of specific subtypes of GABAergic interneurons that have recently been implicated in MDD Our analyses of corticogenesis failed to detect overt changes in the genesis of embryo-derived neurons in both \u03b32AR function-dependent critical periods regulating anxiety- and emotion-related behavior in mice may help elucidate the developmental substrate of anxious depression in patients. Based on a large number of structural and functional parameters, the limbic and cortical brain areas of a ten day-old mouse (29 days post conception) correspond to those of a human fetus at the 143rd and 197th day of gestation, respectively The identification of GABAFigure S1\u2212/\u2212 and \u03b32+/\u2212 embryo-derived neocortical neurons. The density of neurons labeled with BrdU at different embryonic time points (E12.5 and 15.5) and accumulating in different embryonic and postnatal brain structures was determined using immunofluorescent staining of brain sections for BrdU or BrdU and NeuN and analyses by confocal microscopy. Timed pregnant females (\u03b32+/\u2212 x \u03b32+/\u2212 matings) were injected with BrdU at gestational day E12.5 (a) or E15.5 (b\u2013d) and the brains harvested at E18.5  or P21 . The density of BrdU-labeled neurons (cells/62500 \u00b5m2) that had migrated to the cortical subplate by E18.5 (a) and layer II/III (b) of \u03b32+/\u2212 and \u03b32\u2212/\u2212 vs. \u03b32+/+ embryos was independent of genotype. Similarly, the density of E15.5 derived BrdU-positive cells or BrdU/NeuN double positive neurons that had accumulated in the neocortex (C) or hippocampal CA1, CA3 and dentate gyrus (DG) regions (d) of 3-week-old \u03b32+/\u2212 vs. \u03b32+/+ mice was unaffected by genotype (c). Note that \u03b32\u2212/\u2212 mice exhibit a perinatal lethal phenotype that precluded their analyses in (c). Data indicate means \u00b1 SEM. n\u200a=\u200a5/genotype, p>0.05 for all comparisons [Kruskal-Wallis  and Mann-Whitney ].Unaltered proliferation, migration and survival of \u03b32(DOCX)Click here for additional data file.Figure S2a. Representative micrographs of sections through the dentate gyrus of CAGGCre-ER\u2122 X R26Y mice treated with tamoxifen at the ages indicated. Scale bar, 50 \u00b5m. b. Quantitation of YFP positive cells in the dentate gyrus as a percentage of cells visualized by staining with the nuclear stain DRAQ5 .Characterization of tamoxifen induced, CAGGCre-ER\u2122-mediated recombination. Tamoxifen was injected into CAGGCre-ER\u2122 X R26Y mice on P13 and P14 or P27 and P28 to induce recombination at the start of the third or fifth postnatal week, respectively and harvested at 6 weeks of age. (DOCX)Click here for additional data file.Figure S3gabrg2 locus containing exon 8; f\u03b32, corresponding pseudo-WT locus containing lox P sites upstream and downstream of exon 8; f\u03b32\u0394, gabrg2 locus following Cre-mediated recombination and deletion of exon 8.Analyses of TAM-induced recombination of the f\u03b32 locus in CAGGCre-ER\u2122 X f\u03b32/+ mice by PCR of genomic forebrain DNA. Duplicate CAGGCre-ER\u2122 X f\u03b32/+ mice were treated with TAM on P13/14 (lanes 1\u20134) or P27/28  and euthanized 24  or 48 h later (lanes 3\u20136) as indicated. Untreated Emx1Cre X f\u03b32/f\u03b32 (DOCX)Click here for additional data file.Materials and Methods S1GABAergic control of critical developmental periods for anxiety- and depression-related behavior in mice.(DOCX)Click here for additional data file."}
+{"text": "Nutrition and physical activity interventions have been effective in creating environmental changes in afterschool programs. However, accurate assessment can be time-consuming and expensive as initiatives are scaled up for optimal population impact. This study aims to determine the criterion validity of a simple, low-cost, practitioner-administered observational measure of afterschool physical activity, nutrition, and screen time practices and child behaviors.Directors from 35 programs in three cities completed the Out-of-School Nutrition and Physical Activity Observational Practice Assessment Tool (OSNAP-OPAT) on five days. Trained observers recorded snacks served and obtained accelerometer data each day during the same week. Observations of physical activity participation and snack consumption were conducted on two days. Correlations were calculated to validate weekly average estimates from OSNAP-OPAT compared to criterion measures. Weekly criterion averages are based on 175 meals served, snack consumption of 528 children, and physical activity levels of 356 children.OSNAP-OPAT validly assessed serving water (r\u2009=\u20090.73), fruits and vegetables (r\u2009=\u20090.84), juice >4oz (r\u2009=\u20090.56), and grains (r\u2009=\u20090.60) at snack; sugary drinks (r\u2009=\u20090.70) and foods (r\u2009=\u20090.68) from outside the program; and children\u2019s water consumption (r\u2009=\u20090.56) . Reports of physical activity time offered were correlated with accelerometer estimates . The reported proportion of children participating in moderate and vigorous physical activity was correlated with observations , as were reports of computer (r\u2009=\u20090.85) and TV/movie (r\u2009=\u20090.68) time compared to direct observations (both p\u2009<\u20090.01).OSNAP-OPAT can assist researchers and practitioners in validly assessing nutrition and physical activity environments and behaviors in afterschool settings.NCT01396473.Phase 1 of this measure validation was conducted during a study registered at clinicaltrials.gov The online version of this article (doi:10.1186/s12966-014-0145-5) contains supplementary material, which is available to authorized users. Public health researchers and practitioners have made the goals of increasing physical activity and improving healthy eating among youth a major national priority, recently through Michelle Obama\u2019s Let\u2019s Move Campaign . These oSome of the most impactful strategies for improving youth activity and diet aim to create changes in school and afterschool environments. Interventions targeting these environments have been effective at increasing children\u2019s physical activity and fitness -12, imprWe conducted this study in two phases. In phase 1, we tested the criterion validity of the observational practice assessment tool (OPAT) at follow-up data collection of the Out-of-School Nutrition and Physical Activity (OSNAP) randomized controlled trial in spring 2011 . Data weDuring both phases, afterschool staff completed OSNAP-OPAT during one week (up to five weekdays), and trained research staff collected concurrent criterion observational and physical activity monitor data. Program directors completed a written informed consent form and received $25 as compensation for completing the protocol. Parents (or guardians) completed written informed consent forms for collection of individual-level child data. The study was approved by the Harvard School of Public Health Office of Human Research Administration.The OSNAP-OPAT items were focused on measuring the 10 OSNAP intervention goals: provide all children with at least 30 minutes of moderate to vigorous physical activity every day; offer 20 minutes of vigorous physical activity 3 times per week; do not serve sugary drinks; do not allow sugary drinks to be brought in during program time; offer water as a drink at snack every day; offer a fruit or vegetable option every day at snack; when serving grains , serve whole grains; do not serve foods with trans fat; limit computer and digital device time to homework or instructional only; and eliminate use of commercial broadcast and cable TV and movies.Parents reported child race/ethnicity, age, and gender on the consent form. Attendance was recorded during each day of data collection to determine program size. We obtained the proportion of students who were eligible for free or reduced price meals at the school hosting the program (or the school nearest the program) from administrative records. In phase 1, directors reported their years of experience, age, gender, education, hours of employment, race/ethnicity, and the number of staff at the program on a questionnaire.Study staff designed a paper and pencil daily observational practice assessment tool to align with the OSNAP intervention goals, which included items on physical activity, foods, beverages, and screen time  response categories. For each food or beverage offered, consumption was measured on a four-point scale. Two items on foods and beverages brought in from outside the snack program had four response categories corresponding to the number of children who consumed them. Five physical activity items measured the amount of time offered to children with dichotomous (yes/no) response categories for each question, while one item on the proportion of children participating in physical activity had five response categories. In phase 2, new items were fielded at 15 different programs. We tested six revised OSNAP-OPAT items on children\u2019s physical activity with five response categories and three new dichotomous questions about serving sugar-sweetened beverages, 100% juice, and 100% juice >4oz.Child physical activity levels during the afterschool period were measured by Actigraph accelerometer , considered a reliable and valid criterion measure for physical activity  protocol during all physical activity periods on two days at each program ,27. At tThe criterion measure for all nutrition outcomes was direct observation by trained observers  Nutrient Database. Classification of foods and beverages was based the OSNAP intervention goals. Water served refers to water that was distributed as part of the program snack either via pitchers or coolers and cups in the snack area. It does not include water the children drank from water fountains or coolers outside the snack area or period. Sugary drinks were defined as beverages with added sugar and 100% juice greater than 4oz. Foods with trans fats were defined as items containing \u201cpartially hydrogenated\u201d oil on ingredients list. Whole grains were defined as foods containing a whole grain as the first ingredient. Fruits and vegetables included any fresh, frozen, canned, or dried produce. Grain products included breads, cereals, crackers, etc.Research assistants completed a minute-by-minute log of each program day that included the number of minutes children were offered screen time .We summarized daily estimates of all OSNAP-OPAT items and criterion measures into weekly averages for each program. Data from 5 days of observations were used except for cases where fewer days were observed using the criterion measures  or programs ran on fewer than 5 days per week. To assess the criterion validity of OSNAP-OPAT, we calculated Pearson correlations comparing the weekly averages estimated by the OSNAP-OPAT to corresponding estimates from the criterion measures described in the methods and in Table\u00a0All analyses were performed in 2013 using SAS 9.3 . For physical activity outcomes, we compared weekly average estimates from OSNAP-OPAT to weekly averages of SOPLAY observation data and accelerometer estimates. Midpoints of ranges in OSNAP-OPAT physical activity 5-point scales were used when computing minutes per day; for the 60+ minute category, 67.5 was used , we calculated Pearson correlations using only one day of OSNAP-OPAT data to predict average weekly criterion outcomes. For each day of the week (Monday-Friday), daily OSNAP-OPAT estimates were compared to the average weekly criterion measure, and the average Pearson correlations across the days were calculated.During phase 1, directors from 18 programs completed the practice assessment on five days each. One program completed OSNAP-OPAT on four days and another on only three days. In phase 2, most programs ran Monday-Thursday; thus, practice assessment and criterion data were usually collected on four days. Table\u00a0Directors who completed OSNAP-OPAT in phase 1 had an average of 3.5 (SD\u2009=\u20094.3) years in their role and an average age of 36 (SD\u2009=\u200910.6). Thirteen of 20 directors were women and 16 had a college degree. On average, the directors worked at the program 33 hours per week (SD\u2009=\u20099.4); some worked as full-time benefited employees, while other worked part-time.Pearson correlations summarizing the criterion validity of each OSNAP-OPAT item are reported in Table\u00a0In contrast, dichotomous OSNAP-OPAT items for offering 30 minutes or more of MVPA and 20 minutes or more of VPA were not correlated with accelerometer estimates. Serving foods with trans fats, serving sugary drinks, and limiting computer time to less than one hour per child were not correlated with observational criterion measures. No other OSNAP-OPAT reports of child consumption were significantly correlated with plate waste estimates  and more strongly correlated with the minimum number of minutes directors reported offering any group during the program day . Similarly, minutes of VPA were moderately correlated with reported vigorous activity time for a typical child  and more strongly correlated with the minimum number of vigorous minutes directors reported offering any group during the program day . When we separated the OSNAP-OPAT sugary beverage assessment into three distinct questions, juice  and juice >4oz  were correlated with snacks observed. No beverages with added sugar were served.http://osnap.org/tools/practice-assessment/introduction/. We estimated that collecting data on Monday-Friday at a typical program costs about $13, including cost of paper and staff time to complete the assessment.The final OSNAP-OPAT tool is available in Additional file This study establishes the criterion validity of a brief, low-cost, program-level observational measure of nutrition, physical activity, and screen time in afterschool programs that can be implemented by practitioners. When completed by afterschool directors, OSNAP-OPAT validly assessed serving water, fruits and vegetables, grains, and juice at snack as well as the amount of sugary drinks and snacks brought in from outside the program. Directors also validly assessed children\u2019s water consumption. Reported physical activity participation was correlated with the proportion of children observed participating in MVPA and the amount of physical activity time reported was correlated with MVPA and VPA accelerometer estimates. The instrument validly assessed whether computer and television or movie time was offered during the program. Using OSNAP-OPAT, program directors were able to accurately assess program and participant practices related to obesity risk factors\u2014healthy beverages, screen time, physical activity, and fruits and beverages\u2014which have become the core components of recommended evidenced-based community interventions and programs ,3.Findings from this multi-phase study highlight important measurement considerations. In phase 1, dichotomous questions on the amount of time physical activity offered were not correlated with accelerometer data since most programs offered the targeted 30 minutes of daily physical activity and little variation existed in responses. When we changed items to a scale with five time intervals, physical activity items were significantly correlated with corresponding accelerometer estimates. Afterschool directors\u2019 reports of the least amount of physical activity offered to any group of children were more highly correlated with children\u2019s objectively measured physical activity levels than their reports of the physical activity of a typical child at the program. In phase 2, splitting a single sugary beverage question into three distinct items on juice, large juice (>4oz), and beverages with added sugar yielded valid assessments.www.osnap.org.To date, limited research has sought to develop valid nutrition and physical activity measures that are easy for practitioners to use in free-living settings like afterschool programs with limited training and at low cost . HoweverThis study has several limitations. OSNAP-OPAT items completed by directors could not accurately assess the serving of snacks with trans fats nor children\u2019s consumption of foods and beverages other than water. These items have been removed from the final measure. We encourage future research on the best way to capture accurate data on these items from practitioners in the field. The generalizability of our findings is limited due to the small sample of programs all located in Massachusetts who agreed to participate in a nutrition and physical activity intervention. However, the instrument was tested in programs sponsored by a range of organizations and in low income, racially diverse settings. While we were able to establish criterion validity\u2014the extent to which OSNAP-OPAT performs similarly to \u201cgold standard\u201d measures of trained direct observation and accelerometry, assessing the measure\u2019s content and construct validity were outside the scope of this study. Finally, because we initialized accelerometers using one-minute epochs according to the guidelines from the National Cancer Institute to be consistent with methods used in national surveillance, we were unable to analyze shorter physical activity intervals that may have captured intermittent physical activity. Recent research indicates that the Actigraph accelerometers and one-minute intervals capture children\u2019s energy expenditure well compared to room calorimeters and doubly labeled water methods .OSNAP-OPAT is a measure that can be used to validly assess program performance as interventions are implemented and evaluated in real world afterschool settings. This brief assessment tool will help researchers and practitioners gain an accurate assessment of afterschool program practices and child behaviors and target specific areas for improvement as they initiate and evaluate obesity prevention initiatives."}
+{"text": "Pathophysiological investigation of disease in a suitable animal model is a classical approach towards development of a credible therapeutic strategy. This study examined appropriate insulin level in selecting animal model for type 2 diabetes (T2D) studies.Albino Wistar rats (150-200g) were divided into two groups fed with commercially available normal-diet-feed (NDF) and water or fortified diet feed (FDF) (10g NDF per gram of margarine) with 20% fructose solution as drinking water. After 6 weeks of dietary regimen both groups were divided into 5 sub-groups and injected intraperitoneally with a graded dose of streptozotocin (STZ) .25 and NDF35 groups with 75.7% and 64.4% serum insulin respectively presented relative normoglycemia, whereas the FDF35 (85.8% serum insulin) were notably hyperglycaemia (>300 mg/dL) throughout the 6weeks post diabetes confirmation. These FDF35 rats were sensitive to glibenclamide, metformin and pioglitazone in lowering hyperglycaemia, hypertriglyceridemia and hypercholesterolemiaThe result showed that the FDF-fed rats increased significantly in body weight, basal serum insulin, total cholesterol, triglycerides and blood glucose levels as compared to NDF-fed rats. Ten days post STZ induction, the groups treated with STZ (45 & 55 mg/kg) developed frank hyperglycaemia with < 46.8% serum insulin, a severe deficiency typical of diabetes type 1. The NDF35 rats (85.5% insulin) together with their sensitivity to 3 different hypoglycaemic drugs strongly suggests their suitability as a non-genetic model of T2D. Hence the study shows that circulating serum insulin \u2265 85.8% with overt hyperglycaemia may be utilized as the benchmark in selecting rat models for T2D studies.The hyperglycaemia stability of the FDF Diabetes is a lifestyle non-communicable disease of mankind considered as one of the most significant global health problems that afflict both young and old in all parts of the world irrespective of their gender . The disin vivo efficacy, and side effects of anti-diabetic plants and their bioactive constituents have been comprehensively studied using inapt animal model [One of the classical approaches towards the development of credible therapeutic strategy for the possible cure of a disease is the investigation of the pathophysiology of the disease in a suitable animal model , 8, 9. Dal model , 12.The development of vast majority of animal models of diabetes following high dose of chemical induction is primarily due to direct pancreatic beta cell destruction, resulting in insulin deficiency (which is the case for type 1 diabetes (T1D)) rather than the consequence of insulin resistance (IR) (as in the case for T2D).The use of this type of animal model would certainly not be effective in screening anti-diabetic plants/compounds intended for the management of T2D. This has been the case of many investigators \u201316.It is therefore imperative to find a solution to the problem of T2D. To achieve this aim, a careful choice of species/strain and dietary intervention coupled with adequate control over environmental variable will be of immense significance in developing a reproducible diet-induced model of T2D , 17\u201318. A prominent distinguishing feature between T1D and T2D is the residual amount of serum insulin or C-peptide level\u201322. Thesad libitum. Their weights were also noted. The experimental protocol was reviewed and approved by the Animal Research Ethics Committee of Nigerian Institute of Leather and Science Technology, Zaria Nigeria (Reference Number: AREC/EA15/038) All protocol was in conformity with the institutional guidelines that are in compliance with National and International Laws and Guidelines for Care and Use of Laboratory Animals in Biomedical Research. The rules and regulations in accordance with the Ethical Committee\u2019s directive were strictly adhered to. Efforts were made to minimize suffering. The criterion of anaesthesia was the lack of body or limb movement in response to a standardised tail clamping stimulus.Wistar Albino rats weighing 150-200g were used for the research. They were obtained from the animal house of the Department of Pharmacology, Ahmadu Bello University, Zaria-Nigeria. The rats were kept in properly ventilated cages where bedding was replaced daily, at a room temperature of about 27\u00b0C and 12 hours light/dark cycle. They were allowed to acclimatise for two weeks prior to experimentation. During this period, they were all provided with the same commercially available normal diet fed (NDF) and tap water Streptozotocin (STZ) was purchased from Adooq Bioscience, LLC, USA. Glucometer strips, Mission cholesterol Meter , fructose solution , Simas Margarine , Ultrasensitive rat insulin/ rat C-peptide ELISA kits and every other reagent were of available analytical grade purchased from the appropriate manufacturing company through BioRapid Diagnostics Nigeria Limited, Abuja.Two different protocols were used to induce diabetes in the rats. The rats were first allocated into two dietary groups of 40 rats namely the NDF and FDF groups.Protocol 1: The rats allocated to the NDF group were initially placed on NDF and water for 6 weeks. Thereafter divided into 5 subgroups of 8 rats and given single intra-peritoneal injection (ip) of 0, 25, 35, 45, 55 mg/kg b.w. STZ dissolved in 0.1 ml fresh cold citrate buffer pH 4.5 into overnight fasted rats. The rats were provided 5% glucose solution as drinking water in the first 24 hrs after STZ induction.Protocol 2: The other 40 rats allocated FDF group were treated with some modification of the combined methods described by Srinivasan et al., [et al., [ad libitum for 6 weeks. After which they were fasted overnight, divided into 5 subgroups of 8 rats and each rat was injected (ip) with a single dose of STZ  dissolved in a citrate buffer, pH 4.5.The rats were provided 5% glucose solution as drinking water in the first 24 hrs after STZ induction. et al., , Zhang e[et al., , Wilson [et al., . In brieThe mean food and fluid intake of all the experimental animals were taken daily and recorded.Confirmation was done 72 h after STZ induction, using glucose test strips and glucometer . Blood samples were obtained from the tail puncture of the rats.Validation of diabetes was done 7 days after initial confirmation. Firstly, by measuring blood glucose obtained by single prick on the tail tip  using glucometer in order to ensure stable hyperglycaemia. Animals with non-fasting blood glucose (NFBG) \u2265 300 mg/dL (16.7 mM) were considered diabetic and included in the study as diabetic animals , 26. SecThe ability of the animals to tolerate glucose loading was examined using the oral glucose tolerance test (OGTT) performed after an overnight fast. In this test, a single dose of glucose solution (2.0 g/kg bw) was orally ingested to each animal and the levels of blood glucose obtained via tail puncture were measured at 0 (just before glucose ingestion), 30, 60, 90 and 120 min after the ingestion of glucose.The stability of the experimental animal model of diabetes was investigated for 6 weeks post validation of diabetes (i.e. 8weeks post STZ induction).Thereafter, the suitability of the model for screening purposes and pharmacological testing was established using three confirmed anti-diabetic drugs with different mechanism of actions for type 2 diabetes. The diabetic rats were treated once daily for 7 days using pioglitazone (10 mg/kg bw), metformin (500mg/kg bw) or glibenclamide (5 mg/kg bw) orally. The drugs were dissolved in 1% sodium carboxymethyl cellulose as vehicle. After the one week of oral drug administration, blood sample was withdrawn for determination of blood glucose, total cholesterol, triglyceride and serum insulin level.Blood sample was drawn from the tip of the tail and tested using glucose test strips and glucometer  for blood glucose;3-in1cholesterol devise and mission cholesterol meter was used to determine the blood triglyceride and total cholesterol after overnight fast before and after the dietary regimen, and subsequently before and after STZ induction. At the end of the experimental period, animals were euthanized by halothane anaesthesia. The terminal blood collected was done after overnight fasting for the determination of Homeostatic Model Assessment (HOMA) score for insulin resistance and \u03b2-cell function (HOMA-IR and HOMA-\u03b2) which were calculated using the following formula :HOMA\u2212IRConversion factor: Insulin (1U/l = 7.174 pmol/l) and blood glucose (1 mmol/l = 18 mg/dl).The results obtained were expressed as mean \u00b1 standard deviation where applicable. The data were analyzed using analysis of variance (ANOVA) and significant differences among means were determined by Duncan's Multiple Range Test at p< 0.05 using SPSS software version 20 for windows.The mean fluid and feed intake per animal per day throughout the experimental duration is presented in p<0.05) body weight as compared to the NDF-fed group. The percentage change in body weight was approximately2 folds in the FDF-fed group as against the NDF-fed group indicating a state of obesity in the FDF-fed rats. Ten days post STZ induction it was observed that the groups treated with fairly high STZ dose (45 and 55 mg/kg bw.i.p.) had drastically reduced body weight; the percentage change in their body weight was between 4.57\u201311.97%. Whereas those administered low dose of STZ (25 mg/kg bw) had smaller in weight gained when compared to the control groups treated with vehicle alone (NDF and FDF). There was no significant difference (p >0.05) in the relative decrease in weight between the FDF-fed and NDF-fed groups treated with the same STZ dose of 35 mg/kg bw of STZ  when compared to values obtained on day-3 post-STZ induction indicating a form of reversal effect. However, the NDF55, FDF35, FDF45 and FDF55 groups had increased non-fasting blood glucose levels when compared to the values obtained on day-3 post-STZ induction.55, FDF45, FDF35 and NDF55groups.35glycaemia levels were maintained elevated >300 mg/dL nearly althrough the duration of 120 min glucose tolerance test with a peak at 60 min. The control groups (NDF and FDF) and the 25mg/kg bw STZ treated groups (NDF25 and FDF25) revealed a glycaemia peak at 30 min which fall sharply to almost baseline after 2 hours  to the rats after 6 weeks of dietary regimen resulted in significant decrease in insulin and C-peptide both in the NDF-fed and FDF-fed groups in an equivalent amount. However, the Fasting serum C-peptide and serum insulin levels in the FDF25and FDF35 groups where comparatively high when compared to the NDF25 and NDF35 groups but lower when compared to the NDF and FDF groups  decrease in circulating serum insulin and C-peptides, a severe decrease which is classical of type 1 diabetes. Interestingly, the NDF35 and NDF25 with 64.37% and 75.72% available circulating serum insulin respectively were relatively normoglycemia whereas the FDF35 with 85.75% circulating serum insulin had hyperglycaemia, which is distinctive feature seen among type 2 diabetic subjects.The percentage change in fasting serum C-Peptide and circulating serum insulin levels are presented in 35 group. The least value of insulin sensitivity was also noted shown by the FDF35 group.In 35rats group, it was observed that the basal hyperglycaemia was stable around 300 mg/dL from week 2 althrough the 6 weeks post validation duration of the experiment. The validation and suitability of the FDF35 rat model was established using oral administration of three confirmed type 2 diabetes anti-hyperglycaemic drugs. With metformin (500 mg/kg bw) once daily for one week, there was significantly (p<0.05) reduction in blood glucose (46.7%), TC (65.5%) and TG (68.1%) when compared to vehicle-treated diabetic rats. There was no significant (p>0.05) alteration in the insulin level and compared to the control group. Similarly, the glibenclamide (10 mg/kg bw) resulted in significant reduction in blood glucose (57.6%), TC (58.7%) and TG (74.8%). The circulating insulin levels were significantly (p<0.05) increased. The pioglitazone was observed to have also significantly reduced the blood glucose by 66.1%. The TC and TG were increased significantly (p<0.05) when compared to the vehicle treated diabetic rats  food intake (polyphagia) and excessive fluid intake (polydipsia) that was observed in the STZ treated rats in this study are characteristics symptoms of diabetes mellitus. These features are usually accomplished with reduction in body weight which was noticed also in this study in the STZ treated rats. Increased water and food consumption are direct result of the accumulation of glucose in the blood and are usually dependent on the energy expenditure, urinary excretion and catabolic processes [35 groups. Dietary fructose stimulates less insulin secretion but enhances food intake [The significantly increased  revealed during OGTT. Regrettably, no baseline exists for this parameter in Wistar rats . Reducedet al [et al [High-fat diet (HFD) is known to precipitate insulin resistance . Insulinet al  with 178l [et al  with 178When high percentages of endogenous \u03b2-cells are destroyed, there will be little endogenous insulin production hence hyperglycaemia and weight loss . The redet al[et al [et al [et al [et al., [et al (45.51% insulin) [et al.,  [et al in 2016 [25 and NDF35 groups with 75.7 and 64.4% serum insulin respectively presented relatively normoglycemia, whereas the FDF35 (85.75% serum insulin) were notably hyperglycaemia (>300 mg/dL). It is obvious from this result that the FDF35 group developed diabetes because they were already insulin resistant coupled with hyperinsulinemia, a condition needed to sustain normal blood glucose level. So, the insignificant low dose of STZ presenting normoglycemia in NDF-fed group resulted in compromise of the beta cell function in the FDF-fed group. In the NDF35 group, the effect of STZ (35mg/kg bw) could possibly have been compensated by the normal defense homeostasis mechanisms, unlike the FDF35 group which were already insulin resistant presenting mild hyperglycaemia.The evaluation of percentage change in serum c-peptide and available circulating serum insulin would be a contribution to knowledge from this study especially for researchers and investigators in the choice of a specific animal model for diabetic type. It was observed that the FDF-fed group treated STZ (35 mg/kg bw) had a 12.2% decrease in serum c-peptide which consequently resulted in 85.8% available circulatory serum insulin and frank hyperglycaemia. This was contrary to the model of T2D presented by Suman et al which haet al which hal [et al  with 88.l [et al  with 83.[et al.,  reported[et al., , 30. Theinsulin) , Wilson insulin)  and Dhaninsulin)  proved tinsulin) ,30. This in 2016  and that in 2016 . The NDF35 model were observed to be relatively stable throughout the 6weeks post diabetes validation of the study. This implies that the model could be valuable for chronic diabetes investigations like hypertension, neuropathy and nephropathy. The suitability of the model for pharmacological screening was validated using glibenclamide, metformin and pioglitazone. The ability of these drugs to reduce the total cholesterol, triglyceride and the blood glucose level justify the model for pharmacological screening. This is the first study in which three different drugs were used to validate a model.The blood glucose levels in the FDFet al., [et al., [et al., [35 model unlike >47.3% observed in the 45 and 55 STZ treated groups in NDF-fed and FDF-fed.Researchers in this part of the country and in the rest of the world would find the unique rat model of type 2 diabetes presented in this report exceptional as it addresses some key issues lacking in earlier reported model. Firstly, the diet composition described by Sasidharan et al., , Wang et[et al.,  and Srin[et al.,  are not [et al., ,24,25,47[et al., . For ins[et al., . In thisOne limitation in this study is the unavailable means to determine the amount of available \u03b2-cell mass and to perform insulin tolerance test. However, further investigation is in progress to determine the diabetogenic dose that would results in both hyperglycaemia and normoinsulinemia in animals.The present study has established a benchmark of residual insulin levels in selecting animal model for T2D studies. The experimental rat model of T2D presented in this study is a classical replica of the westernized unhealthy lifestyle seen in human T2D subjects, in which fructose (20%) in drinking water is supplied together with high fat diet (Margarine fortified diet feed) to produce insulin resistance. The subsequent injection of sub-diabetogenic dose of streptozotocin (35 mg/kg bw) elevated the blood glucose to the diabetic level. In view of the above observations, it was hereafter recommended that the animal model intended for diabetes studies should be examined in order to ascertain the percentage available circulating endogenous serum insulin and c-peptide as a measure of the type of diabetes. The results from this research strongly suggests that selection of animal model for T2D studies should be based on circulating endogenous serum insulin of not less than 85.7% of normal control groups in a hyperglycaemic condition of non-fasting blood glucose \u2265300mg/dL. In addition the serum C-peptide level should in relative term be insignificantly different from the normal control group. This study revealed that a combination of margarine and fructose fortified diet-fed with single low dose (\u226435 mg/kg bw.) STZ-treated rat is a suitable non-genetic model for T2D studies. The model mimics the natural history and metabolic features of human T2D. In addition, it is cheap, easy to develop and useful for evaluating and screening of therapeutic compounds intended for treatment of T2D."}
+{"text": "Dgcr8, which is involved in microRNA processing, and is mediated by the increased dopamine receptor Drd2 levels in the thalamus and by reduced probability of glutamate release from thalamic inputs. This deficit in thalamo-LA synaptic transmission is sufficient to cause fear memory deficits. Our results suggest that dysregulation of the Dgcr8\u2013Drd2 mechanism at thalamic inputs to the amygdala underlies emotional memory deficits in 22q11DS.Individuals with 22q11.2 deletion syndrome (22q11DS) are at high risk of developing psychiatric\u00a0diseases such as schizophrenia. Individuals with 22q11DS and schizophrenia are impaired in emotional memory, anticipating, recalling, and assigning a correct context to emotions. The neuronal circuits responsible for these emotional memory deficits are unknown. Here, we show that 22q11DS mouse models have disrupted synaptic transmission at thalamic inputs to the lateral amygdala . This synaptic deficit is caused by haploinsufficiency of the 22q11DS gene   \u2022Thalamic inputs to the lateral amygdala (LA) are impaired in 22q11DS mice\u2022Thalamo-LA disruption is sufficient to cause associative fear memory deficits\u2022Deficiency in microRNA-processing Dgcr8 causes thalamo-LA and fear memory deficits\u2022Fear memory deficits in 22q11DS mice are rescued by thalamic Drd2 inhibition Dgcr8 haploinsufficiency and Drd2 elevation in the auditory thalamus.Eom et\u00a0al. show that mouse models of schizophrenia-associated 22q11.2 deletion syndrome are deficient in synaptic transmission at thalamic inputs to the lateral amygdala (LA). Thalamo-LA synaptic deficits impair fear memory and are mediated by  Emotions provide information about the present state of an individual based on previous experience and help guide future courses of action. In healthy individuals, many action-related decisions are thought to be based on anticipation or recall of emotional experiences . Past poDf(16)1/+) carrying a hemizygous deletion of 23 genes in the syntenic region of chromosome 16 , which is the most common microdeletion syndrome in humans . Patientosome 16 . The symosome 16 . Emotionosome 16 , such asosome 16  and diffosome 16 . These iDgcr8  in the thalamus , which is part of the basolateral amygdala that is important for assigning emotional significance to discrete environmental cues and acquiring and storing emotional memories . In rodeBecause we have previously shown that microdeletion of 22q11DS genes increases Drd2 levels in the auditory thalamus  and thatDf(16)1/+ mouse models of 22q11DS (Df(16)1/+ mice) (Df(16)1/+ mice (Df(16)1/+ mice and wild-type (WT) mice did not differ in their freezing responses to the CS\u2013US pairings (Df(16)1/+ mice, compared to WT littermates, but no significant differences were seen in pre-CS freezing between the genotypes (Df(16)1/+ mice have a deficit in the retrieval of auditory cued fear memory but not in the acquisition. In the active avoidance task, Df(16)1/+ mice exhibited a significantly lower percentage of escape success than did WT littermates (Df(16)1/+ mice  /+ mice) A. We tes1/+ mice . In the pairings A or duripairings B. Howeveenotypes C. These termates D. Howeve1/+ mice E. This f1/+ mice C\u2013S1F. Se1/+ mice G.Figure\u00a0To explore whether the mechanisms of synaptic transmission and plasticity at thalamo-LA and cortico-LA projections are affected in mutant mice, we performed whole-cell voltage-clamp recordings from excitatory neurons in the LA in acute brain slices from both groups of animals F. RecordDf(16)1/+ mice, compared to WT littermates (Df(16)1/+ mice, compared to WT littermates (Df(16)1/+ mice might be presynaptic in origin. The thalamo-LA NMDAR/AMPAR (NMDA receptor/AMPA receptor) ratio, a measure of the postsynaptic function in thalamic inputs to LA, was normal in Df(16)1/+ mice (Df(16)1/+ mice, whereas there was no difference in the magnitude of LTP at cortico-LA synapses between the genotypes  at cortical inputs were not different between the genotypes G, but thtermates . The paitermates  in cortitermates I. Howevetermates  was lowetermates , indicat1/+ mice . Howeverenotypes .Dgcr8 in these phenotypes, we deleted it in thalamic neurons by crossing mice with the floxed Dgcr8 allele (Gbx2CreER mice (Dgcr8 (cDgcr8 KO [knockout])  developed normally and had no gross morphologic abnormalities (data not shown). To verify Cre expression, we crossed Gbx2CreER mice with Ai14 reporter mice (ROSA26-CAG-Stopfl/fl-tdTomato)  . Fourteei14 mice A and S5.ectively B.Figure\u00a0cDgcr8 KO mice had impaired fear conditioning 1/+ mice, PPD was also reduced in cDgcr8 KO mice 1/+ mice, we next asked whether these deficits are mediated by elevated levels of Drd2 in the thalamus. We observed a decrease in Dgcr8 protein level, accompanied by an increase in Drd2 in\u00a0the auditory thalamus of cDgcr8 KO mice (Drd2 (Drd2 shRNA) and GFP in the medial division of the medial geniculate nucleus (MGm) (Drd2 transcript levels were higher in Df(16)1/+ mice than in WT littermates (Df(16)1/+ mice was rescued by Drd2 shRNAs, which decreased the Drd2 mRNA level in\u00a0mutant mice to that in WT littermates. In WT littermates, Drd2 shRNAs did not affect Drd2 mRNA levels in the auditory thalamus (Because deletion of  KO mice . To furtus (MGm) A. The spus (MGm) . Neuronsus (MGm) B. Note ttermates C. This ithalamus C.Figure\u00a0Drd2 shRNA did not affect pre-CS freezing in WT or Df(16)1/+ mice. However, Drd2 shRNA rescued the deficit in 22q11DS mice in the fear conditioning task (Df(16)1/+ mice injected with Drd2 shRNA performed significantly better than did Df(16)1/+ mice injected with control shRNA. Moreover, the performance in fear conditioning was similar in Df(16)1/+ and WT mice injected with Drd2 shRNA (Df(16)1/+ mice injected with Drd2 shRNA into the MGm performed significantly better than did Df(16)1/+ mice injected with control shRNA and similar to WT mice injected with control or Drd2 shRNAs (Drd2 shRNA did not change locomotor activity between the genotypes injected with control or Drd2 shRNAs (ing task D. Df(16)d2 shRNA D. Drd2 sd2 shRNA E. In the2 shRNAs E. Howeve2 shRNAs F.Df(16)1/+ mice injected with control shRNA into the MGm compared to that in WT mice injected with control shRNA 1/+ mice injected with Drd2 shRNAs was similar to that of WT mice injected with control or Drd2 shRNAs (Df(16)1/+ deficit in PPD at thalamo-LA synapses was also rescued by injecting Drd2 shRNA. Compared with WT controls, Df(16)1/+ mice injected with control shRNA showed a deficit in PPD at all interpulse intervals (Df(16)1/+ mice injected with Drd2 shRNA into the MGm was similar to that of WT mice injected with Drd2 or control shRNAs . AAV-GFP was used as a control  encoding  control A. In\u00a0viv the MGm B. A qRT- AAV-GFP C. Drd2 tmparable D. In the AAV-GFP E, but sp AAV-GFP F.Figure\u00a0AAV-Drd2-GFP than in WT mice injected with AAV-GFP into the auditory thalamus 1/+ and WT mice to Drd2 inhibitors, we measured thalamo-LA EPSCs every 30\u00a0s before and after bath application of the Drd2 inhibitor L-741,626. EPSCs evoked by the thalamic input stimulation in Df(16)1/+ mice were smaller than those in WT mice (Df(16)1/+ mice. However, access resistance between the patch pipette and the recorded cell did not change in either genotype before or after L-741,626 application (Df(16)1/+ mice were sensitive to L-741,626 1/+ mice than in WT\u00a0littermates  was injected into the MGm of the thalamus. To ensure that only thalamo-LA projections express hM4Di, we used the retro-DREADD approach (CAV2-Cre) was injected into the LA. Thus, a combination of these two viruses injected into presynaptic  and postsynaptic (LA) sites led to the expression of hM4Di at only thalamo-LA projections, thereby reducing synaptic transmission at only these projections after hM4Di receptors interacted with the DREADD ligand clozapine-N-oxide (CNO)   to disruapproach . The cande (CNO) A. Three  the MGm B, indicater mice . The CAVeive CNO . Pre-CS nce task , but thence task E.Figure\u00a0CAV2-Cre;hM4Di mice treated with CNO than in slices from control mice at almost all stimulation intensities  of SCZ . AlthougDgcr8 that depletes levels of the thalamus-enriched microRNA miR-338-3p, which negatively regulates Drd2 in the auditory thalamus 1/+, Dgcr8 floxed, and miR338\u2212/\u2212 mouse lines has been reported previously (Gbx2CreER (JAX stock no. 22135) and Ai14 (JAX stock no. 007914) mouse strains were purchased from the Jackson Laboratory. For most experiments, the experimenters were blinded to the genotype or treatment. The care and use of animals were reviewed and approved by the Institutional Animal Care and Use Committee at St. Jude Children\u2019s Research Hospital.Both male and female mice (4\u20135\u00a0months old) were used for all experiments. The generation of eviously . Gbx2CreTo test auditory cued fear conditioning, a mouse was placed in a conditioning chamber with the white house light on and allowed to explore the testing chamber for 2\u00a0min before a discrete CS was delivered in the form of a tone . Within the last 2\u00a0s of the tone, a US was delivered in the form of a mild footshock . Mice were allowed to recover for 1\u00a0min, and then another three CS-US pairs were delivered. After the last CS-US pairing, mice remained in the conditioning chamber for 1\u00a0min and were then returned to the home cage. Approximately 1 or 24\u00a0hr later, mice were placed in a new environment with the light off and allowed to explore for 2\u00a0min, followed by exposure to only the CS tone for 30 s. After a recovery period of 30 s, the tone exposure and recovery period steps were repeated three times. The percentages of freezing times in the training period and during the pre-CS and post-CS periods on the test day were compared across groups using Video Freeze software (Med Associates).On the first day, mice were habituated in a chamber for 5\u00a0min. The total number of spontaneous crossings between compartments was recorded. On the second day, mice were given auditory cued fear conditioning training. Mice were placed in compartment A (unsafe compartment) with the gate closed, and a CS  was given while the gate between compartment A and compartment B (safe compartment) was open. Mice that did not cross to compartment B after 5\u00a0s of CS delivery received a US  for 25\u00a0s or until they crossed to compartment B. The escape success was measured as the percentage of entries into compartment B during the CS presentation. Each mouse was given 20 CS-US pairs each day  for 4 consecutive days.2, 6\u00a0mM MgCl2, 1.25\u00a0mM NaH2PO4, 26\u00a0mM NaHCO3, and 20\u00a0mM glucose (300\u2013310 mOsm), with 95% O2/5% CO2. After a 1-hr incubation in ACSF  at room temperature, slices were transferred to the recording chamber and superfused (2\u20133\u00a0mL/min) with 30\u00b0C\u201332\u00b0C ACSF. Whole-cell recordings of EPSCs were obtained from principal neurons in the LA under visual guidance (Dodt gradient contrast and two-photon imaging) with a Multiclamp 700B amplifier and pCLAMP 10.0 software (Molecular Devices). Synaptic responses were evoked by stimulating the fibers in the external capsule  or the internal capsule . Under our experimental conditions, thalamic and cortical inputs converging on the same LA neurons were stimulated independently, because the sum of thalamo-LA EPSCs and cortico-LA EPSCs, when they were triggered individually, was nearly identical to that of the EPSCs when both inputs were simultaneously stimulated (data not shown). The independence of inputs was further confirmed by the observation that stimulation of the cortical input did not affect the thalamo-LA EPSC (evoked with a 50-ms delay), and that of the thalamic input did not affect the cortico-LA EPSC (evoked with a 50-ms delay), which was consistent with the previous results  containing the amygdala were prepared as previously described . Briefly results .2 creatine phosphate, 5\u00a0mM QX-314 (adjusted to pH 7.4 with CsOH [290\u2013295 mOsm]). Synaptic responses were filtered at 5 kHz and digitized at 20 kHz. To evoke synaptic responses, square current pulses (100-\u03bcs duration of various intensities) were applied through a thin tungsten electrode. Membrane potential was held constant at \u221270\u00a0mV throughout the experiments in the voltage-clamp mode.Patch electrodes (3- to 5-M\u2126 resistance) contained the following internal solution: 125\u00a0mM cesium methanesulfonate, 2\u00a0mM CsCl, 10\u00a0mM HEPES, 0.1\u00a0mM EGTA, 4\u00a0mM MgATP, 0.3\u00a0mM NaGTP, 5\u00a0mM tetraethylammonium, 10\u00a0mM Na2 \u22c5 6H2O; 0.1\u00a0mM EGTA; 4\u00a0mM Na2ATP; 0.4\u00a0mM NaGTP; 10\u00a0mM Na2 creatine phosphate; and 30\u00a0\u03bcM Alexa Fluor 594, pH 7.3\u20137.4 (290\u2013295 mOsm). LTP at cortico-LA and thalamo-LA inputs was recorded in the voltage-clamp mode. LTP at the cortico-LA input was induced by 80 presynaptic pulses delivered at 2\u00a0Hz. An LA neuron was held at\u00a0+30\u00a0mV for the duration of presynaptic stimulation. Postsynaptically and presynaptically expressed LTPs at the thalamo-LA input were induced by 240 paired presynaptic stimuli  delivered at 2\u00a0Hz to the presynaptic fibers. An LA neuron was held at\u00a0+30\u00a0mV or \u221270\u00a0mV to express LTP post- or pre-synaptically, respectively  was used.Current-clamp recordings were conducted using the following internal solution: 115\u00a0mM potassium gluconate; 20\u00a0mM KCl; 10\u00a0mM HEPES; 4\u00a0mM MgClectively . In LTP G/R).The Ultima imaging system (Prairie Technologies), equipped with a titanium:sapphire Chameleon Ultra femtosecond-pulsed laser (Coherent) and a 60\u00d7\u00a0(0.9 NA) water-immersion infrared objective (Olympus), was used. Briefly, Alexa Fluor 594 (30\u00a0\u03bcM) and Fluo-5F (300\u00a0\u03bcM) were loaded into the principal LA neurons with the internal pipette solution. Alexa Fluor 594 and Fluo-5F were excited with laser pulses at 820\u00a0nm, and changes in both red and green fluorescence were simultaneously measured in the line-scan mode (500\u00a0Hz) in spine heads when an electrical stimulation was applied to the thalamic input of the LA. To measure calcium transient amplitudes and probabilities of success, 10\u201320 line scans were analyzed as changes in Fluo-5F fluorescence normalized to Alexa Fluor 594 fluorescence (\u0394Drd2 forward (5\u2032-GGATGTCATGATGTGCACAGC-3\u2032), Drd2 reverse (5\u2032-CGCTTGCGGAGAACGATG-3\u2032), Dgcr8 forward (5\u2032-CCACGACCATCCTCAGACATTG-3\u2032), Dgcr8 reverse (5\u2032-ATGAAAATCTCCCCTCCCCACAGCC-3\u2032), U6 forward (5\u2032-CGCTTCGGCAGCACATATAC-3\u2032), and U6 reverse (5\u2032-TTCACGAATTTGCGTGTCAT-3\u2032). Expression levels of Drd2 were normalized to the housekeeping gene U6 for each sample. Samples for each mouse were run in triplicate.Total RNA was isolated from brain regions  by using the mirVana microRNA Isolation Kit (Life Technologies). The iScript kit (Bio-Rad) was used to synthesize cDNA from mRNA. The qRT-PCR was performed using SYBR Green (Life Technologies), with the following primers: All statistical data were computed using the Sigma Plot 12.5 software. Parametric or nonparametric tests were chosen based on the normality and variance of data distribution. Independent or paired two-tailed t tests, a Mann-Whitney rank-sum U test, a one-way ANOVA/Kruskal-Wallis one-way ANOVA on ranks H test followed by a multiple comparison procedure (Dunn\u2019s method), and a two-way ANOVA/two-way repeated-measures ANOVA with one-factor repetition followed by a Holm-Sidak multiple comparison procedure were used. F values were reported for ANOVA. p\u00a0< 0.05 was considered significant.T.-Y.E. and S.S.Z. designed the study. T.-Y.E. performed behavioral, immunohistochemical, and molecular experiments. I.T.B. performed electrophysiological and two-photon imaging experiments. J.Y. assisted with qRT-PCR experiments. K.A. assisted with molecular and immunohistochemistry experiments. S.S.Z. provided reagents and equipment. S.S.Z. and T.-Y.E. wrote the manuscript."}
+{"text": "This article describes successful use of calcium-enriched mixture (CEM) cement and Biodentine in apexogenesis treatment in two 8-year-old patients, one with immature permanent molardiagnosed primarily with irreversible pulpitis and the other with partially vital maxillary centralincisor. After access cavity preparation, partial pulpotomy in molar and full pulpotomy incentral was performed, and the remaining pulps was capped with either Biodentine or CEMcement, in each tooth. The crowns were restored with composite filling material at the followingvisit. The post-operative radiographic and clinical examinations (approx. average of 16 months)showed that both treated teeth remained functional, with complete root development and apexformation. A calcified bridge was produced underneath the capping material. No furtherendodontic intervention was necessary. Considering the healing potential of immature vitalpulps, the use of CEM cement and Biodentine for apexogenesis might be an applicable choice.These new endodontic biomaterials might be appropriate for vital pulp therapies in animmature tooth. However, further clinical studies with longer follow-up periods arerecommended. Vital pulp therapy (VPT) of immature teeth is performed to encourage physiological development and formation of the root end and apical closure; this procedure is also referred to as apexogenesis , 2. The CEM cement  was introduced as an endodontic filling biomaterial. The significant components of the cement powder are calcium oxide (CaO), sulfur trioxide (SO3), phosphorous pentoxide (P2O5), and silicon dioxide (SiO2) .in vitro studies. Animal studies have shown that PDL regeneration, cementogenesis and dentinogenesis occur in contact with CEM cement as well [The physical properties of CEM cement such as flow, film thickness and primary setting time are favorable and its clinical applications are similar to those of MTA . CEM cem as well . CEM cem as well .Overall, comparing radiographic outcomes of VPT using CEM and MTA, apexogenesis occurred in 76.8% and 73.8% in CEM cement and MTA groups respectively, with no significant differences . HoweverBiodentine  is another calcium-silicate based material that has recently gained popularity and has been advocated to be used in various clinical applications. Biodentine is a bioactive inorganic calcium silicate-based cement that increases biomineralization and pulp cell proliferation . The BioIn clinical settings, Biodentine has shown a similar efficacy to MTA and can be considered as an alternative for pulp capping procedures. Complete dentinal bridge formation and absence of an inflammatory response were reported .The present manuscript, describes the report of two VPT cases on immature permanent teeth using both aforementioned biomaterials with long follow-up periods.Case 1: An 8 -year old girl was referred to Endodontic Department with the chief complaint of deep caries on the mandibular molar. No history of trauma was present and the patient was medically healthy. No spontaneous pain was reported by the patient. Intra-oral examination revealed extensive coronal caries, pain on percussion but not upon palpation on tooth #19. Radiographic examination revealed a cavitated tooth with immature apices with apical radiolucency around the mesial root of the tooth. She was diagnosed with irreversible pulpitis and symptomatic apical periodontitis of tooth #19. Under local anesthesia with 2% lidocaine and 1:80000 epinephrine  and rubber dam isolation, access cavity was prepared with a diamond fissure bur followed by a partial pulpotomy with round diamond bur #2. Hemostasis was achieved by gentle placement of a moistened sterile cotton pellet over the amputated pulp. According to the instructions, Biodentine powder and liquid were mixed to achieve a creamy consistency. A 2-mm-thick layer of the cement was placed over the pulp using an amalgam carrier followed by Cavite temporary filling . Later the tooth was restored by a composite restoration.Patient was recalled 3 weeks later for the first follow-up. Tooth was functional with no clinical signs or symptoms of pulpal disease. Formation of distal and mainly mesial root apex was evident. Clinical and radiographic examinations at 3, 6, and 18 months revealed the tooth was functional with no clinical signs or symptoms of pulpal disease. The final examination confirmed complete root development .Case 2: An 8 year-old boy was referred to the same department with a chief complaint of front tooth discoloration following trauma a month earlier. Intraoral examination revealed no swelling, no pain on palpation or percussion on tooth #9. The tooth was irresponsive to vitality and cavity tests. Radiographic examination showed immature apices with no apical lesion. The differential diagnosis was pulp necrosis or a vital pulp that was not responsive to tests after trauma and severance of nerve fibers. This final diagnosis was postponed to treatment session: Irreversible pulpitis which was not responsive to tests.Under local anesthesia with 2% lidocaine and 1:80000 epinephrine and rubber dam isolation access cavity was prepared. Coronal pulp was removed with a high-speed sterile round diamond bur with water cooling. Although tooth was initially irresponsive to vitality tests, following the insertion of file #50 to the length of 8 mm, bleeding was induced and presence of a vital pulp was confirmed; thus VPT was suggested. The area was rinsed with normal saline solution. Hemorrhage was controlled with placement of saline-damped sterile cotton pellet over the amputated pulp. According the instructions, CEM cement powder and liquid were mixed to achieve a creamy consistency. An approximately 2-mm thick layer of CEM was placed over the pulp using an amalgam carrier and was gently adapted to the dentinal walls of the access cavity with a dry cotton pellet. A moistened cotton pellet was placed lightly over it and followed by Cavite temporary filling. After 24 h the cotton pellet was removed and the tooth was filled with glass ionomer cement and restored with composite.The patient was recalled within 1-3 weeks of treatment and followed for a period of 3 years on 3, 6, 9, 12 and 36 months. Apex formation and root development was evident radiographically after one year. The tooth was asymptomatic and functional. A narrow canal was observed .VPT is the generally preferred treatment for immature teeth with vital pulps that are frequently exposed as a result of caries or trauma . NumerouCEM cement has been recently introduced as an applicable endodontic cement with similar clinical applications to MTA. Many desirable characteristics such as biocompatibility, integrity to pulpal tissue and positive handling characteristics have turned it to favorable cement. Considering the advantages of CEM cement over MTA, especially its improvement in tooth discoloration issue, handling and bactericidal effects, CEM cement might be an appropriate biomaterial to be used in VPT in open apex teeth . It setsSince healing occurs without any endodontic intervention, it is considered that CEM cement has the acceptable criteria to be used as a pulp capping material in various clinical applications.Advantages of Biodentine over MTA are shorter setting time, better compressive strength and sealing ability. Some of its improvements compared to other calcium-silicate materials are its bioactive properties and hard tissue regeneration capability. It has been further suggested that the material had the ability to maintain a successful marginal integrity due to the formation of hydroxyapatite crystals at the surface which enhances the sealing ability. Due to this superior sealing potential, there is almost no risk of microleakage , 19.et al. [It\u2019s been stated that a particular feature of Biodentine is its capacity to continue improving in terms of compressive strength with time until reaching a similar range with natural dentine. In the study by Grech et al. , BiodentThe main goal in treating immature teeth is to maintain pulp vitality so that apexogenesis can occur. The most significant indicator for success of VPT in immature permanent teeth is radiographic confirmation of root development and apex closure . In thisFavorable treatment outcomes have been achieved in VPT with calcium-silicate based materials in teeth diagnosed with irreversible pulpitis , 2. RootThe use of CEM cement and Biodentine seem to be valid choices in VPT cases. The authors believe that they might be appropriate biomaterials as pulp capping materials in VPT of immature permanent teeth with irreversible pulpitis. However, more clinical studies with longer follow-up periods are required."}
+{"text": "O6-methylguanine, and isoguanine were prepared and purified using standard methods. The title compounds were examined as potential substrates of purine-nucleoside phosphorylases from various sources in the reverse (synthetic) pathway. It was found that 1,N2-etheno-guanine and 1,N6-etheno-isoguanine are excellent substrates for purine-nucleoside phosphorylase (PNP) from E. coli, while O6-methyl-N2,3-etheno-guanine exhibited moderate activity vs. this enzyme. The latter two compounds displayed intense fluorescence in neutral aqueous medium, and so did the corresponding ribosylation products. By contrast, PNP from calf spleens exhibited only modest activity towards 1,N6-etheno-isoguanine; the remaining compounds were not ribosylated by this enzyme. The enzymatic ribosylation of 1,N6-etheno-isoguanine using two forms of calf PNP (wild type and N243D) and E. coli PNP (wild type and D204N) gave three different products, which were identified on the basis of NMR analysis and comparison with the product of the isoguanosine reaction with chloroacetic aldehyde, which gave an essentially single compound, identified unequivocally as N9-riboside. With the wild-type E. coli enzyme as a catalyst, N9-\u03b2-d- and N7-\u03b2-d-ribosides are obtained in proportion ~1:3, while calf PNP produced another riboside, tentatively identified as N6-\u03b2-d-riboside. The potential application of various forms of PNP for synthesis of the tri-cyclic nucleoside analogs is discussed.Etheno-derivatives of guanine,  N6-etheno-adenosine (\u03b5Ado), easily produced in the reaction of adenosine with chloroacetic aldehyde (CAA) in aqueous environment.Some tri-cyclic analogs of the natural purine bases and their glycosides show intense fluorescence, what enables their application as fluorescent probes in the investigations of structure and function of nucleic acids  and enzymes related to nucleic acid metabolism or utilizing nucleotide cofactors ,2. The mOther etheno-purine derivatives see  were alsTri-cyclic analogs and their ribosides are characterized by moderate biological activity, but some of them reveal promising anti-viral properties , recentlIn our laboratory, we are working on an enzyme purine-nucleoside phosphorylase , responsible for the regulation of the various nucleosides concentrations within the living cells, and a target of many types of pharmaceutical interventions ,14. It iE. coli, which is known to possess a broad specificity toward various base and nucleoside analogs [d-ribose-1-phosphate, R1P). This reaction runs similarly rapidly as the phosphorolytic process.Our introductory investigations have shown that PNP isolated from  analogs , is also analogs . The phoThe purpose of the present work was to examine other similar tri-cyclic nucleobase analogs, in particular guanine and isoguanine derivatives, as potential substrates of analogous reactions, and possibly obtain in this way highly fluorescent compounds, useful for the future research. We have also extended the spectral examination of the above-mentioned etheno-derivatives to include the respective ionic forms, which in some cases are important intermediates in enzymatic catalysis, occasionally identified in enzyme-substrate complexes .N2-ethenoguanine  is one of 2 isomeric etheno derivatives of guanine, its structure similar to one of the known rare t-RNA bases, the so-called Y-base  [N2-ethenoguanine is a main product of the slow reaction of CAA with guanine [1, guanine ,20,21,22 guanine , which gN2-ethenoguanine (1) was reported to be nonfluorescent in the neutral aqueous medium [1,s medium . Weak emE. coli (N2-ethgenoguanine (1) lesion in many organisms, particularly in bacteria [We found that this compound is an excellent substrate for PNP from E. coli a, with cE. coli . HPLC anE. coli . The revE. coli b. These bacteria .E. coli PNP (D204N) reacted in a qualitatively similar way as the wild-type enzyme, with similar spectral changes and comparable rate.The mutated form of the With the calf enzyme (wild-type or the N243D mutant) only very slow reaction was observed under typical conditions -1-piperazineethanesulfonic acid (HEPES) buffer, 25 \u00b0C). This reaction was ca. 100-fold slower than the ribosylation of guanine. There was also no marked phosphorolysis of the nucleoside by this enzyme in the phosphate buffer (data not shown). We conclude that PNP probably does not play any substantial role in the process of detoxication of etheno-guanosine in mammals, but this kind of degradation can be important in bacteria.N2,3-ethenoguanine (2), a non-linear isomer of 1,N2-ethgenoguanine (1), is a common and the most persistent lesion in DNA upon treatment with vinyl chloride [N2,3-ethenoguanine (2) is blue-shifted relative to 1,N2-ethenoguanine (1)  , but itsnine (1) , howeverN2,3-ethenoguanine (2) is not a substrate for PNP form E. coli and calf spleen. No reaction traces were observed even with 10-fold higher enzyme concentrations than those applied to the synthesis of 1,N2-ethenoguanosine (see previous section). Ribosides of N2,3-ethenoguanine are known to be relatively unstable [N7 or N2) cannot be utilized by the enzymes.We found that unstable ,27, and unstable . ProbablE. coli PNP by N2,3-ethenoguanine (2), with estimated Ki of 38 \u03bcM. This value is not far from the Km value for guanine . We conditions, .O6-methylguanine [N2,3-etheno-O6-methylguanine (3) [A known mutagenic guanine derivative, lguanine ,27, reacN2,3-etheno-O6-methylguanine (3) is also a substrate for PNP from E. coli, but the maximal velocity of its ribosylation is rather poor  of the latter, not possible for the riboside.her poor . The proher poor . The reaher poor , pointinm value, calculated from the progress curve  to the enzymatic ribosylation is probably unfavorable energetics.Although the ribosylation rate is slow, the apparent Kurve see , is marke analog , its lowN9, explaining spectral differences between this product and the parent base.The ribosylation reaction is fully reversible by the addition of a phosphate buffer up to a concentration of ~5 mM . We did not attempt to isolate the pure riboside due to the low efficiency of the synthetic process, but it would be interesting to check the ribosylation site, which may be different from the \u201ccanonical\u201d N2,3-etheno-O6-methylguanine (3) effectively competes with guanine in the ribosylation process, acting as quasi inhibitor of the E. coli PNP, with estimated Kiapp value 7.5 \u00b1 0.8 \u03bcM , in agreement with the Km value, estimated from kinetic data (see the previous paragraph). With the calf enzyme, no such inhibition is observed under similar conditions.Isoguanine  is a guanine isomer, found in several living species , and it E. coli PNP , and we did not see any such reaction catalyzed by the calf enzyme, in accordance with the general rule [N1 position, do not react with trimeric forms of PNP, including mammalian enzymes.The nucleoside of isoGua, isoguanosine, is rather slowly phosphorolysed by the ral rule , that 6-N6-etheno-isoguanine ). The etheno-isoguanine fluorescence was long ago proposed as a tool for analytical quantitation of 9-\u03b2-d-arabinofuranosyl-2-fluoroadenine  exists in the literature. Basic spectral data for this compound are given in Isoguanine reacts readily with CAA to produce a single, and highly fluorescent product, 1,arabine, ), but, tSpectrophotometric titrations of \u03b5isoGua (4) H\u2014N(7)H-N6H prototropic tautomerism is likely [Fluorescence properties of \u03b5isoGua (4) strongly suggest a ground-state tautomeric equilibrium. Fluorescence decay, measured at excitation 280 nm at pH 6.5 , is clearly nonexponential, but well approximated by a bi-exponential decay function (data not shown), with decay times of 5.1 and 3.4 ns see . Similarcleoside . Moreoves likely , while iN6-etheno-isoguanine (4) is a moderately good substrate for PNP from various sources, but reactions with various types of the enzyme vary not only in rates but also in products obtained, giving at least 3 types of ribosides , all three ribosylated species are also fluorescent, although with different yields and decay times  can be generated. One chemically from isoguanosine reacting with CAA, and all three enzymatically, using various types of PNP as a biocatalyst (N9-\u03b2-d-riboside (5) of \u03b5isoGua. Enzymatic ribosylation gave an additional 2 products, clearly not identical with (5). Ribosylation catalyzed by the enzyme from E. coli gave two products: The highly fluorescent N9-riboside , and another riboside with less intense fluorescence shifted to ~355 nm  H8 proton identified by elimination. The presence of C8-H1\u2019 and C1\u2019- H8 correlations in the HMBC spectrum allowed for the identification of two of three samples as either N7 (6) or N9- (5) ribosides. The former riboside (6) was identified by the presence of C6- H1\u2019 and C6-H8 correlations, where C6 was assigned based on its relatively low chemical shift , in agreement with chemo-enzymatic identification provided in the previous paragraph. The N6-riboside (7) was identified by the presence of the correlation of both etheno protons with C1\u2019 and  N6. Selected chemical shifts are given in NMR spectral analysis was necessary to identify the ribosylation sites . Identifeference ), comparFor (5) only one of the etheno protons is observable in 1H, 13C spectra, possibly due to (slow or intermediate) chemical exchange. N9-riboside (5) is not phosphorolysed by the calf PNP, but the reaction with the E. coli enzyme is fairly rapid (see N7-riboside (6) by the same type of PNP, while the N6-riboside (7) is only slowly deribosylated by the calf enzyme, but much more rapidly by the E. coli PNP (data not shown). This is to be compared with 1,N6-ethenoadenosine, resistant to the calf enzyme, but rapidly phosphorolysed by the E. coli PNP [N6-ethenoadenosine [In the 50 mM phosphate buffer, pH 6.5, the apid see . Even mocoli PNP . All thrcoli PNP ,33,36. FE. coli PNP and the \u201ccomplementing\u201d N243D mutant of the calf enzyme. Both mutations were previously shown to alter ribosylation specificity of PNP with 6-amino-purines [Various types of PNP mutated at the active site are known, some of them with qualitatively different catalytic characteristics ,37,38. W-purines ,38 as suE. coli PNP, where emission spectrum of the product mixture was shifted to the red, relative to the wild-type PNP reaction (N9-riboside (5) as a ribosylation product, with a possible contribution by other product(s). Reaction rates  were comparable to those obtained for the wild-type enzymes. These results are analogous to those reported for 1,N6-ethenoadenine as a substrate [In the case of \u03b5isoGua (4), the mutation effect is not very pronounced, with the exception of the reaction . This laubstrate .O6-methylguanine and 2-amino-6-chloropurine riboside were from Sigma-Aldrich. The ribose source for enzymatic ribosylation, \u03b1-d-ribose-1-phosphate (R1P) has been prepared as 100 mM solution as previously described [Isoguanine, isoguanosine, and their derivatives were obtained from Dr. Jerzy Sepio\u0142 (Polish Academy of Sciences). Chloroacetaldehyde, 7-methylguanosine, escribed  and keptEtheno-derivatives of guanine and guanosine were obtained analogously to Ho\u0159ej\u0161i et al. , from thN2-ethenoguanine (1) on the basis of UV spectra in various conditions and lack of fluorescence. The second isomer, N2,3-ethenoguanine (2), was identified on the basis of its fluorescence and UV spectra shifted to ~260 nm. The third major product was 1,N2-ethenoguanosine, which was proved by its UV absorption and ready enzymatic phosphorolysis to 1,N2-ethenoguanine  was obtained from the reaction of aqueous CAA with O6-methylguanine under weakly acidic conditions (ca. 3 days). There was essentially one product, easily crystallized after the neutralization of the reaction mixture. Demethylation of N2,3-etheno-O6-methylguanine (3) in boiling 1 N HCl [N2,3-ethenoguanine (2), identical to the previously obtained sample (see above).N6-etheno derivative, was obtained and purified using semi-preparative HPLC with methanol gradient as the main eluent (see Etheno derivatives of isoguanine (2-hydroxy-6-aminopurine) and isoguanosine were prepared in analogous ways, but the nucleoside was somewhat more reactive (reaction time was 2\u20133 days) then the base (7 days). In both cases only a single product, easily identified as the 1,uent see .4): Isoguanine (200 mg) dissolved initially in ~10 mL of 1 M HCl, added 1 mL of aqueous CAA, reaction pH elevated to ~2 by addition of bicarbonate, and left overnight. The next day, the reaction pH elevated to ~3, and after 24 h to 4-4.5 and was maintained by bicarbonate and/or acetic acid. After 7 days the crude precipitate was collected and dried. HPLC analysis showed ~70% progress of the reaction. The crude precipitate was used as such for the ribosylation experiments and aliquot purified using HPLC.The detailed procedure for  ribosides is as follows: 10 mg of substrate dissolved in diluted aqueous ammonia (ca. 10 mL) and stepwise added to ca. 5 mL of 100 mM HEPES buffer, pH~7, containing ca. 10 mM solution of R1P and 20 \u00b5L of concentrated (~2.6 mg/mL) E. coli PNP. The reaction was carried out at 30 \u00b0C for 3 days, the mixture concentrated, and products separated as described below. Typical HPLC profiles are shown on Product separation and purification used HPLC on a UFLC system from Shimadzu  equipped with UV (diode-array) detection at 260, 280 and 315 nm, and a fluorescence detector. The column used was a Kromasil reversed-phase a semi-preparative C-18 column . Elution was initially (10\u201315 min) isocratic, followed by water-methanol gradient .For kinetic analyses, enzymatic ribosylation reactions were carried out in 1 mL cuvettes (pathlength 4 mm) in ~50 mM HEPES buffer, pH 7.3, using ca. 0.5 mM R1P as a ribose source. On a larger scale, reactions were run in Eppendorf tubes, volume 2\u20133 mL, using either R1P or 7-methylguanosine as ribose sources. Phosphorolysis reactions were run in 50 mM phosphate buffer, pH 7.0 or 6.5. Data were analyzed by standard methods see .N6-ethenoadenosine in water , and UV absorption kinetic experiments were performed on a Cary 5000 (Varian) thermostated spectrophotometer. Fluorescence yields were determined relative to tryptophan (0.15) or 1,r . Spectrr  or 50 \u00b0C (the other two samples). For all samples the following spectra were acquired: A standard proton spectrum, a 1H, 1H gradient selected COSY, a gradient selected 1H, 13C HSQC and a gradient selected 1H, 13C HMBC tuned for 7 Hz J coupling with a double low pass J filter. For the sampled identified as the N7-riboside a gradient selected 1H, the 15N HMBC experiment tuned for 15 Hz J coupling was also acquired.NMR measurements were performed on a Bruker Avance III HD 800 MHz spectrometer equipped with a cryogenically-cooled H-C/N-D TCI probe at 25 \u00b0C  and inspected using the Sparky program [ft scale . 2D spec program  with manE. coli and calf spleen PNPs as well as their mutated forms were expressed in E. coli and purified according to the procedures described earlier [Recombinant  earlier ,43.A known chemical mutagen and carcinogen, vinyl chloride, acts as a modifier of nucleobases, in particular, adenine and guanine moieties , which uN9-\u03b2-d-riboside of (1) can be obtained quantitatively from (1), and N9-\u03b2-d- and N7-\u03b2-d-ribosides of (4) as a mixture, using the E. coli PNP as a biocatalyst. Additionally, a non-typical N6-\u03b2-d-riboside (7) of \u03b5isoGua (4) can be nearly quantitatively obtained from (4) using the calf enzyme.Another important application of PNP is in chemo-enzymatic synthesis of bioactive nucleoside analogs, utilizing, among others, various types of PNP ,17,46,47The next work (in preparation) shows that also various etheno-derivatives of the amino-purines, including etheno-2-aminopurine isomers, readily react with PNP to give various ribosides. The above results indicate need for further investigations on the enzymatic ribosylation of various nucleobase analogs to improve specificity and yields. Since the number of the known molecular forms of PNP  is large ,16, therO6-methylguanine and isoguanine. These compounds may be good candidates for the study of ligand-binding equillibria using various PNP forms and for analytical applications.Finally, attention should be drawn to the new, highly fluorescent nucleoside analogs, derived from mutagenic"}
+{"text": "Abnormal expression or distribution of connexin 32 (Cx32) is associated with hepatocarcinogenesis, but the role of Cx32 and the underlying mechanisms are still unclear.The expression level of Cx32 in 96 hepatocellular carcinoma (HCC) specimens was determined using western blotting and immunohistochemistry. The correlation between Cx32 expression and clinicopathological parameters was analyzed. The cell apoptosis rate was examined using flow cytometry and western blotting. The role of Cx32 in the Src kinase and epidermal growth factor receptor (EGFR) signaling pathways was measured by quantitative real-time PCR, western blotting and coimmunoprecipitation (CO-IP). The effect of Cx32 overexpression on the streptonigrin (SN)-induced tumor growth suppression and apoptosis was assessed in nude mice.Our study showed that overexpressed Cx32 accumulated in the cytoplasm and that Cx32-containing gap junctions (GJs) were nearly absent in HCC specimens. Upregulated Cx32 expression was highly correlated with advanced tumor-node-metastasis (TNM) stage and poor tumor differentiation and was an independent predictive marker for poor prognosis in HCC. Overexpression of Cx32 significantly inhibited SN-induced apoptosis by activating the EGFR signaling pathway in vitro and in vivo. Moreover, the expression levels of Cx32 and EGFR were positively correlated in HCC specimens. The CO-IP experiments demonstrated that Cx32 could bind to Src kinase, and the western blotting results revealed that Cx32 increased the levels of EGFR and p-EGFR by upregulating Src expression.and in vivo via interacting with Src and thus promoting the phosphorylation of EGFR, subsequently activating the EGFR signaling pathway. Cx32 may be a potential biomarker and a new therapeutic target for HCC.The present study demonstrated that overexpressed and internalized Cx32 was associated with advanced TNM stage and poor tumor differentiation and predicted poor prognosis in HCC. Cx32 facilitated HCC progression by blocking chemotherapy-induced apoptosis in vitro The online version of this article (10.1186/s13046-019-1142-y) contains supplementary material, which is available to authorized users. Connexins (Cxs) normally assemble into gap junction (GJ) channels on the surfaces of two adjacent cells  and partAlthough the diagnostic criteria and clinical therapeutic strategies have evolved in recent decades, hepatocellular carcinoma (HCC) remains the second most common cause of cancer-related death worldwide , 12. TheHere, we found that Cx32, which generally forms GJs on the surface of hepatocytes, was abnormally upregulated and internalized in HCC tissues and was closely associated with poor prognosis. Upregulated Cx32 suppressed chemotherapy-induced apoptosis by interacting with Src kinase and activating the epidermal growth factor receptor (EGFR) signaling pathway independent of GJs in vitro. These findings suggest that Cx32 proteins play a crucial role in the progression of HCC.Anti-Cx32, Cx43 and Cx26 antibodies for immunohistochemistry were purchased from BOSTER . PV-9000 DAB detection Kit was obtained from ZSGB-Bio . The DEME (high glucose) and RPMI-1640 media, Lipofectamine\u2122 3000, anti-Cx26 antibody were purchased from Invitrogen . 2-aminoethoxydiphenyl-borate (2-APB), streptonigrin (SN), polybrene, anti-Cx43, anti-\u03b2-tubulin antibodies, and HRP-conjugated secondary antibodies were acquired form Sigma-Aldrich . Polyethylenimine (PEI) was purchased from Polysciences, Inc. . Annexin V-FITC / PI apoptosis detection kit was from Biotool . TRIzol was obtained from Life Technologies . cDNA Synthesis SuperMix kit and qPCR SuperMix kit were purchased from Transgen Biotech . BCA protein assay kit was from Bio-Rad . Chemiluminescent HRP Substrate Kit was from Millipore Corporation . Anti-Cx32 antibody was purchased from Santa Cruz . Anti-GAPDH antibody was obtained from Ray Antibody Biotech . EGFR, p-EGFR (Tyr845), PARP, cleaved-Caspase3, Erk 1/2, p-Erk 1/2 (Thr202/Tyr204), STAT3, p-STAT3 (Tyr705), Bcl-2, Bak, Bax, and Src primary antibodies were obtained from Cell Signaling Technology . Nonspecific mouse or rabbit IgG was purchased from Beytime . Protein G Plus/Protein A Agarose Suspension was from Merck Millipore . HRP-conjugated secondary antibodies (light chain specific or heavy chain specific) were obtained from Abbikine .From May 2011 to November 2013, 96 HCC patients underwent hepatectomy at the Affiliated Cancer Hospital of Xinjiang Medical University, Xinjiang, China. All the flesh HCC specimens, corresponding peritumoral tissue (<\u20093\u2009cm distance from the tumor tissue), and remote normal liver tissues (5\u2009cm away from the tumor tissue) were collected within 10\u2009min after hepatectomy and then stored in liquid nitrogen for protein extraction and paraffin embedding. The cohort of 13 female and 83 male patients had a median age of 53.53\u2009\u00b1\u200910.88\u2009years (range 24 ~\u200978\u2009years), with a median follow-up time of 27.5\u2009months (range 2~ 44\u2009months). The mean tumor size was 7.50\u2009\u00b1\u20093.53\u2009cm (range: 1.5~20\u2009cm). All patients and their corresponding tissue samples had been confirmed by pathology. None of the patients had received any chemoradiotherapeutic agents in the preoperation. Clinical variables including age, sex, pathological differentiation, TNM stages, serum alpha-fetoprotein (AFP), presence of hepatitis B surface antigen (HBsAg), and tumor size were recorded. Histological grading, according to the Edmondson-Steiner (ES) criteria, showed that ES grade I (well-differentiated), II (moderately differentiated), III (poorly differentiated) and IV (undifferentiated) tumors were found in 21 (21.8%), 36 (37.5%), 24 (25.0%), and 15 (15.6%) cases. Cancer clinical staging was performed according to the AJCC/UICC tumor\u2013node\u2013metastasis (TNM) stage (2010), which showed that TNM stage I, II, and III tumors were found in 15 (15.6%), 18 (18.7%), and 63 (65.6%) cases.IHC was performed as described previously . Section2. For low-density cultures, 1\u2009\u00d7\u2009105 cells were seeded in a 150\u2009mm dish to physically inhibit GJ formation (the cells were not in direct contact with each other). For high-density cultures, 1\u2009\u00d7\u2009105 cells seeded in each well of a 6-well plate were allowed to form GJs [HCC cells were purchased from the American Type Culture Collection . HepG2 cells and SMMC-7721 cells were cultured in DMEM (high-glucose) and RPMI-1640 medium, respectively, supplemented with 10% fetal bovine serum (FBS), 100\u2009U/ml penicillin and 100\u2009U/ml streptomycin at 37\u2009\u00b0C in an atmosphere containing 5% COform GJs , 23. In form GJs \u201324.Apoptosis was induced in cells by stimulation with 1\u2009\u03bcM streptonigrin (SN) for 7\u2009h , 23. OveCells were seeded and grown to 30\u201350% confluence, and complexes of sequence-nonspecific siRNAs (NC) or targeted siRNAs (50\u2009nM)  and 5\u2009\u03bcl of Lipofectamine\u2122 3000 were added to cells in each well according to the manufacturer\u2019s instructions. Cells were incubated for an additional 48\u2009h for the experiments. The sequences of the synthesized Cx32, EGFR and Src siRNA were as follows, and siCx32_2, siEGFR_1, siSrc_1 were chosen for subsequent experiments.siCx32_1: 5\u2032-CCGGCATTCTACTGCCATT-3\u2032, siCx32_2: 5\u2032-GGCTCACCAGCAACACATA-3\u2032, siCx32_3: 5\u2032-GCAACAGCGTTTGCTATGA-3\u2032. siEGFR_1: 5\u2032-GGCTGGTTATGTCCTCATT-3\u2032, siEGFR_2: 5\u2032-CCTTAGCAGTCTTATCTAA-3\u2032, siEGFR_3: 5\u2032-GGAACTGGATATTCTGAAA-3\u2032. siSrc_1: 5\u2032-CAAGAGCAAGCCCAAGGAT-3\u2032, siSrc_2: 5\u2032-CAGGCTGAGGAGTGGTATT-3\u2032, siSrc_3: 5\u2032-GCAGTTGTATGCTGTGGTT-3\u2032.For transient transfection, cells were seeded and grown to 80% confluence. Following the manufacturer\u2019s instructions, 2.5\u2009\u03bcg of each DNA plasmid was mixed with 5\u2009\u03bcl of Lipofectamine\u2122 3000 and 5\u2009\u03bcl of P3000\u2122. Then, the mixture was added to the cell culture medium. Cells were incubated for an additional 48\u2009h for the experiments. Plasmid vectors overexpressing Cx32 (EX-A0514-M02\u20135), EGFR (EX-A0275-M98\u20135), or Src (EX-B0107-M09) along with the corresponding control vectors, were constructed by GeneCopoeia .To generate stably transfected cells, SMMC-7721 cells were transfected with lentiviral plasmids containing Cx32 (EX-A0514-Lv105) or with empty vector (pEZ-Lv105), which were constructed by GeneCopoeia, and HepG2 cells were transfected with lentiviral plasmids containing the shCx32 sequence or with the negative control vector (pLVX-shRNA-tdTomato-Puro), which were constructed by Landbiology . Lentiviral particles were produced by transfecting 293\u2009T cells with 6\u2009\u03bcg of lentiviral plasmid, 4.5\u2009\u03bcg of psPAX2 and 1.5\u2009\u03bcg of pMD2.G using 30\u2009\u03bcl of PEI (100\u2009\u03bcM) in a 10\u2009cm culture plate. Then, HCC cells were incubated in medium containing the virus and polybrene (6\u2009\u03bcg/ml) for 48\u2009h. After infection, cells were selected by culture with puromycin (2\u2009\u03bcg/ml) for 2\u2009weeks.The sequences for the short-hairpin RNA targeting Cx32 (shCx32) was as follows: 5\u2032-GCTGCAACAGCGTTTGCTACTCGAGTAGCAAACGCTGTTGCAGCTTTTTTT-3\u2032.-\u0394\u0394Ct). The following formula was used: 2-\u0394\u0394Ct\u2009=\u20092control group  - experiment group . All experiments were repeated 3 times. The primer sequences synthesized by Sangon Biotech Co., Ltd.  were as follows:After total RNA extraction using TRIzol, RNA concentrations were measuring using a Nanodrop 2000 . Reverse transcription to cDNA was performed using a cDNA Synthesis SuperMix kit on a C1000 Thermal Cycler . Next, cDNA samples (2\u2009\u03bcl) were used for qPCR with the qPCR SuperMix kit, and amplification was conducted for 40\u2009cycles on a StepOnePlus Real-Time PCR System . The cycle time (Ct) values of the selected genes were first normalized to the CT value for GAPDH for the same sample, and fold changes were calculated by relative quantification (2EGFR: 5\u2032-CCCACTCATGCTCTACAACCC-3\u2032 (Forward), 5\u2032-TCGCACTTCTTACACTTGCGG-3\u2032 (Reverse); Src: 5\u2032-TGGCAAGATCACCAGACGG-3\u2032 (Forward), 5\u2032-GGCACCTTTCGTGGTCTCAC-3\u2032 (Reverse); Cx32: 5\u2032-ACACCTTGCTCAGTGGCGTGA-3\u2032 (Forward), 5\u2032-AGGGACCACAGCCGCACATGG-3\u2032 (Reverse); GAPDH: 5\u2032-TGTGGGCATCAATGGATTTGG-3\u2032 (Forward), 5\u2032-ACACCATGTATTCCGGGTCAAT-3\u2032 (Reverse).w/v) skim milk and were then incubated with primary antibodies (1:1000) overnight at 4\u2009\u00b0C. Immunoreactive bands were visualized using a Chemiluminescent HRP Substrate Kit and scanned with an ImageQuant LAS 4000\u2122 . The expression values for each target protein were normalized to the corresponding GAPDH or \u03b2-tubulin expression values.Cells were washed with cold PBS and then harvested in cell lysis buffer. Whole cell lysates were sonicated and were then centrifuged at 12,000\u2009rpm for 30\u2009min at 4\u2009\u00b0C. The protein concentration was determined using a BCA protein assay kit. Fifteen micrograms of protein from each sample was separated by SDS-PAGE followed by transfer to a nitrocellulose membrane. Membranes were blocked with 5% . Additionally, a certain proportion of supernatant was incubated without any antibody as the positive control (input group). Next, 30\u2009\u03bcl of Protein G Plus/Protein A Agarose Suspension was added dropwise to bind to the antibodies overnight at 4\u2009\u00b0C. The beads were washed 5 times with lysis buffer and resuspended in sample buffer, followed by boiling for 5\u2009min. The samples were separated by SDS-PAGE and reacted with the corresponding primary antibodies (1:1000), followed by incubation with HRP-conjugated (light chain specific or heavy chain specific) secondary antibodies (1:5000).n\u2009=\u200912). These two groups were subcutaneously inoculated with stable cell lines, including SMMC-Vector cells and SMMC-Cx32 cells (5\u2009\u00d7\u2009106 in 200\u2009\u03bcl of PBS), near the right scapula. When the tumors had grown to an appropriate size (200\u2009mm3), each group was further randomized into 2 groups (n\u2009=\u20096) according to the tumor volume and body weight. The control group was orally administered vehicle (PBS), and the treatment group was orally administered 0.5\u2009mg/kg SN (dissolved in PBS) once every two days for a total of 7 treatment [2)/2, where V is the volume (mm3), A is the long diameter, and B is the short diameter (both in mm). Mice were sacrificed 24\u2009h after the final intragastric administration.BALB/c-nu mice  were purchased from Hunan SJA Laboratory Animal Co., Ltd. . All experimental procedures were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University. The nude mice were first randomly divided into 2 groups . The data were statistically analyzed by using the SPSS software package (version 16.0).All experiments were repeated at least three times. Parametric data were analyzed by one-way ANOVA or Student\u2019s t-test, and nonparametric data were analyzed by Fisher\u2019s exact test or the Chi-square test. The association between Cx32 expression and clinicopathological characteristics was statistically determined using the Pearson \u03c7n\u2009=\u200996), peritumoral tissues (n\u2009=\u200957) and remote normal liver tissues (n\u2009=\u200943) by western blotting. As shown in Fig. P\u2009<\u20090.01) and normal liver tissues (P\u2009<\u20090.01). In HCC tissues, the expression of Cx26 was unchanged (P\u2009>\u20090.05), whereas the expression of Cx43 was significantly decreased (P\u2009<\u20090.01). Notably, Cx32 expression increased with increasing tumor-node-metastasis (TNM) stage   and Cx32-high expression group (n\u2009=\u200948). The Pearson \u03c72 test showed that Cx32 expression was strongly correlated with clinical TNM stage  and tumor differentiation  (Table P\u2009=\u20090.014) , positive HBsAg status (P\u2009=\u20090.034) and high Cx32 expression (P\u2009=\u20090.001) were significantly correlated with poor OS  was an independent predictor of poor prognosis in HCC patients  tested by western blotting in 96 HCC specimens, the data were classified into the Cx32-low expression group . Furthermore, knockdown of Cx32 in HepG2 cells markedly reversed the anti-apoptotic effect of 2-APB . These results implied that under conditions of suppressed GJ function, Cx32 expression antagonized SN-induced apoptosis. Similarly, in HepG2 cells grown in low-density culture conditions (with no GJ formation), Cx32 silencing noticeably exacerbated SN-induced apoptosis   Fig.  c and d.P\u2009>\u20090.05), but Cx32 overexpression in SMMC-7721 cells significantly attenuated SN-induced apoptosis . More convincingly, Cx32 overexpression significantly suppressed apoptosis  in SMMC-7721 cells grown at a low cell density (with no GJ formation)  in 30 human HCC specimens . The tumor were allowed to grow to an appropriate size (200\u2009mm3), and each group was then further randomized to two groups: the control group (PBS) and the SN-treated group (0.5\u2009mg/kg). As shown in Fig. Given the above in vitro results that Cx32 overexpression protects HCC cells from SN-induced apoptosis, we next verified the anti-apoptotic function of Cx32 in an HCC xenograft model. Stable SMMC-Cx32 cells and the corresponding SMMC-Vector cells were subcutaneously injected into nude mice  domain of Cxs contains multiple sites for protein-protein interactions. For instance, the CT domain of Cx43 contains binding sites for the Src homology 3 (SH3) and SH2 domains of Src kinase . MoreoveIn conclusion, cytoplasmic Cx32 exerted nonjunctional effects to protect HCC cells from chemotherapy-induced apoptosis via binding to Src and activating the EGFR signaling pathway in vitro and in vivo. The elevated expression levels and cytoplasmic mislocalization of Cx32 in HCC indicate that Cx32 may be a biomarker for clinical prognosis and chemotherapy resistance. Identifying an approach to restore the abnormal localization of Cxs is thus important for oncotherapy and deserves further study.Additional file 1:Figure S1. The expression and distribution of Cx32 in HCC cell lines. Figure S2. The GJ function in HCC cell lines. Figure S3. The expression and distribution of Cx32 in HepG2-NC and HepG2-siCx32, SMMC-7721-vecotr and SMMC-7721-Cx32 cells. (ZIP 4027 kb)Additional file 2:Table S1. Cx32, Cx26 and Cx43 expression detected by immunohistochemical analysis in remote normal liver, peritumoral and HCC tissues. Table S2. Univariate Cox proportional hazard analysis for overall survival Variables. Table S3. Multivariate Analysis of Different Prognostic Parameters in Patients with HCC by Cox Regression Analysis. (DOCX 17 kb)Additional file 3:Supplemental Methods: immunofluorescence, cytomembrane protein extraction, parachute dye-coupling assay. (DOCX 14 kb)"}
+{"text": "By means of a hybrid density functional, we comprehensively investigate the energetic, electronic, optical properties, and band edge alignments of two-dimensional (2D) CdS/g-C Gaining hydrogen through photocatalytic water splitting by use of solar energy provides a new way to solve the problems of energy shortage and environmental pollution. A large number of semiconductors, such as TiO2 , ZnO [2]2 [3 [3  have dra2 [3 [3 , have su2 [3 [3 ,7, loadi2 [3 [3 , dye sen2 [3 [3  and coca2 [3 [3 ,11,12 arplitting  considerSince graphene was prepared, 2D materials including hexagonal boron nitride , graphitof water . g-C3N4 le pairs ,20,21. T ZnO/WS2 , AlN/WS2S2 [2 [2 , g-C6N6/6/g-C3N4 , g-C3N4/3N4/MoS2  and g-C3[3N4/C2N  exhibit [3N4/C2N  reports The purpose of this work is to investigate the energetic, electronic, optical property and band edge alignments of CdS/g-CThe CdS/g-Con (GGA)  of Perdeon (GGA)  and hybron (GGA) , as implon (GGA) . We adopon (GGA)  to descron (GGA)  to well on (GGA)  k-point v, c, k in reciprocal space, respectively, while the real part of the dielectric function p denotes the principal value of the integral.Finally, the optical absorption spectra of g-Ctionship (1)I(\u03c9)=lated as (2)\u03b52(\u210f\u03c9tionship .(3)\u03b51 and projected density of states (PDOS) of CdS monolayer and g-C reports . The VBMThe lattice mismatch is defined as: S is the area of CdS/g-CTo explore the thermodynamic stability, the interface binding energy (0 meV/\u00c52 .As an ideal water-splitting photocatalyst, its band edges must be located in proper positions. The CBM and VBM must straddle the water redox potentials to satisfy the thermodynamic criterion for overall water splitting. a and The appearance of strain can not be ignored due to the lattice mismatch between different 2D semiconductors. It is found that for 2D materials, the electronic and optical properties can be modulated through strain engineering ,41,42. WThe photocatalytic performance is affected by the pH of electrolyte. Particularly, the standard hydrogen electrode potential varies with the pH varies. The standard reduction (H0.059 eV . With thonolayer , CdS/ZnSonolayer , and (Buonolayer  with conThe band edge alignments of CdS/g-CNext, we plot the DOS, PDOS, and band structures of unstrained CdS/g-CZ direction, i.e., the vacuum direction. The g-CThe charge density difference of CdS/g-CAnother key indicator to the photocatalytic performance is the optical absorption. band see . The adsIn summary, the hybrid density functional HSE06 is employed to calculate the energetic, electronic and optical properties of CdS/g-C"}
+{"text": "MHY2233 treatment protected senescent EPCs from oxidative stress by decreasing cellular reactive oxygen species (ROS) levels, thus enhancing cell survival and function. The angiogenesis, proliferation, and migration of senescent EPCs were enhanced by MHY2233 treatment. Thus, MHY2233 reduces replicative and oxidative stress-induced senescence in EPCs. Therefore, this novel antiaging compound MHY2233 might be considered a potent therapeutic agent for the treatment of age-associated CVDs.Cardiovascular diseases (CVDs) are a major cause of death worldwide. Due to the prevalence of many side effects and incomplete recovery from pharmacotherapies, stem cell therapy is being targeted for the treatment of CVDs. Among the different types of stem cells, endothelial progenitor cells (EPCs) have great potential. However, cellular replicative senescence decreases the proliferation, migration, and overall function of EPCs. Sirtuin 1 (SIRT1) has been mainly studied in the mammalian aging process. MHY2233 is a potent synthetic SIRT1 activator and a novel antiaging compound. We found that MHY2233 increased the expression of SIRT1, and its deacetylase activity thereby decreased expression of the cellular senescence biomarkers, p53, p16, and p21. In addition, MHY2233 decreased senescence-associated beta-galactosidase- (SA- Cardiovascular diseases (CVDs) are the leading cause of death throughout the world \u20133. AmongEndothelial injury is associated with many CVDs, such as atherosclerosis, thrombosis, hypertension, and myocardial infraction. Circulating EPCs maintain endothelial integrity and neovascular functions; hence, they are candidates for cell therapy in CVDs , 5. EPCsvia DNA modulation have been reported [Sirtuin 1 (SIRT1) has been studied mostly in vascular aging and CVDs. SIRT1 is a nicotinamide adenine dinucleotide-dependent histone deacetylase, which aids in cell cycle regulation and apoptosis. SIRT1 is highly expressed in EPCs  and is areported . SIRT1 ireported , histonereported . It regureported . In replreported  and the reported . SIRT1 dreported . The SIRreported .in vitro SIRT1 activity assay, and MHY2233 induces more SIRT1 deacetylase activity than resveratrol [MHY2233 is a potent SIRT1 activator synthesized from 18 benzoxazole hydrochloride derivatives based on the structure of well-known SIRT1 activators, such as resveratrol and SRT1720. The binding capacity of MHY2233 to SIRT1 is 1.5-fold higher than that of resveratrol. MHY2233 was shown to suppress the acetylation of p53 in db/db mice. MHY2233 has been identified as the strongest SIRT1 activator using an veratrol . SurprisThe main purpose of this study is to examine the role of the novel compound, MHY2233, in preventing vascular senescence in human EPCs. Moreover, this study is aimed at evaluating the effect of MHY2233 on the biological functions of senescent EPCs.Human umbilical cord blood was provided by Pusan National University Yangsan Hospital. Mononuclear cells (MNCs) were isolated from the human umbilical cord blood by density gradient centrifugation through Ficoll . Isolated MNCs were seeded in 1% gelatin-  coated culture plates and cultured in endothelium growth medium-2 (EGM-2) : endothelium basal medium-2 (EBM-2) containing 5% fetal bovine serum (FBS), 1% penicillin-streptomycin (PS), human vascular endothelial growth factor (VEGF), human basic fibroblast growth factor (b-FGF), human insulin-like growth factor-1 (IGF-1), human epidermal growth factor (EGF), ascorbic acid, and GA-1000. The medium was changed daily, and colonies were cultured for further use. EPCs from passage 8 to passage 10 were used as young EPCs, and EPCs from passage 16 to passage 20 were used as senescent EPCs in the experiments.http://www.donginls.com). Before seeding, each 96-well plate was coated with 1% gelatin , incubated for 15 min at 37\u00b0C and then washed with 1x PBS . Seven thousand cells were seeded per well in the required number of wells and incubated for 24 h. Then, the medium was removed and the cells were treated with different concentrations of drug for another 24 h. After that, the medium was removed and diluted CCK-8 solution was added to each well and incubated for one hour at 37\u00b0C. The absorbance was measured at a wavelength of 450 nM using a SUNRISE-absorbance microplate reader  in order to assess cytotoxicity.Passage 10 EPCs were used for the cytotoxicity assay using the D-Plus Cell Counting Kit-8 (CCK-8), lot number DI1701-01  to determine the number of senescent cells, following the manufacturer's protocol. After staining, images from five random microscopic fields were acquired by using a light microscope .To measure SA-MHY2233 was provided by Prof. Hyung Ryong Moon, Laboratory of Medicinal Chemistry, College of Pharmacy, Pusan National University. The known SIRT1 activator, resveratrol , was used as a positive control. Similarly, the specific inhibitor of SIRT1, EX527 , was used as a negative control. MHY2233, resveratrol, and EX527 were dissolved in dimethyl sulfoxide . Because long-term or chronic treatments with the drugs were cytotoxic, low drug concentrations were used: 10 nM of MHY2233, 100 nM of resveratrol, and 100 nM of EX527.in vitro tube-forming assay, 7500 cells/well were seeded in 96-well plates coated with Matrigel\u00ae GFR  and incubated for 6 to 8 h. The tube formation capacity of EPCs was determined by counting the number of tubes formed and by measuring the total length of the tubes formed using a microscope . Images were captured in one microscopic field per well under 40x magnification.For the st Strand cDNA Synthesis Kit . SYBR\u00ae Green Real-Time PCR Mastermix  was used for determining the mRNA levels of different genes using the primers listed in For determining mRNA levels, total RNA was isolated using TRIZOL\u00ae , following the manufacturer's instructions. The concentration of RNA was measured by a NanoDrop\u2122 UV spectrophotometer. One microgram of total RNA was reverse transcribed using the PrimeScript\u2122 1http://www.thermofisher.com) containing a protease inhibitor cocktail , and protein concentration was quantified using a Bicinchoninic Acid Kit . Proteins were separated using 8\u201312% sodium dodecyl sulfate- (SDS-) polyacrylamide gel electrophoresis and were transferred to Immobilon\u00ae polyvinylidene fluoride (PVDF) membranes (Merck). The membranes were blocked with 5% skim milk for one hour at room temperature and were incubated with primary antibodies against SIRT1 , p53 acetylated on K382 (Ac-p53) , CDKN2A/p16INK4a , p21 , FOXO3a , cyclin D1 , cyclin E , eNOS , endothelial nitric oxide synthase (eNOS) phosphorylated on S1177 (p-eNOS) , and glyceraldehyde-3-phosphate dehydrogenase  at 4\u00b0C overnight. After washing with 1x TBST , the membranes were incubated with secondary antibodies at room temperature for one hour. Anti-rabbit horseradish peroxidase (HRP) conjugate  and anti-mouse HRP conjugate  were used as secondary antibodies. After washing the membranes again with 1x TBST, the bands were visualized using Luminata Crescendo Western HRP Substrate  and X-ray film. GAPDH was used as a loading control for all western blots.Total protein was extracted on ice with RIPA lysis buffer . The absorbance after treatment with CCK-8 was measured at 450 nM using a SUNRISE-absorbance microplate reader . Cell proliferation was also evaluated by cell counting after trypan blue (Welgene) staining. Senescent cells  were pretreated with DMSO, 10 nM MHY2233, 100 nM resveratrol, or 100 nM EX527, seeded in 6-well plates, and cultured in EGM2 medium for 6, 12, 24, or 48 h. The number of unstained cells at each time point was counted after trypsinization.EPCs (7000 cells/well) were seeded in 96-well plates coated with 1% gelatin and incubated for 6, 24, or 48 h. Cell proliferation was determined by WST-8 assay, using the D-Plus CCK-8  were pretreated with DMSO, 10 nM MHY2233, 100 nM resveratrol, or 100 nM EX527 and seeded in 6-well plates. Cell migration was assessed by the scratch wound healing method. After 24 h of culturing, at full confluence, a linear gap in the cell monolayer was created by scratching the surface with an SPLScar Scratcher . The cells were washed to remove detached cells and incubated at 37\u00b0C. Images were captured by using a light microscope  at 0, 2, 4, and 6 h. The migrated area was calculated using the following formula:Senescent EPCs . The upper sides of the inserts were coated with 1% gelatin and placed on a clean bench for 30 min. In each upper insert, 1 \u00d7 104 cells were seeded with EBM-2 containing 2% FBS; EGM-2 containing 5% FBS, 1% PS, and other endothelial cell growth supplements was placed in each lower chamber. The cells were incubated at 37\u00b0C for 6 h. Afterward, the cells were fixed for 10\u201315 min in 4% paraformaldehyde. The cells were then stained with 0.5% crystal violet  for one hour. The inserts were washed twice with distilled water, and the membranes were excised and mounted on glass slides. The cell migration capacity was quantified by counting the number of cells that had migrated in five random microscopic fields (100x magnification) using a microscope .Transwell\u00ae migration assays were performed using 24-well Transwell\u00ae inserts (8 \u03bcL NAD+ solution (cat. No. N1663) was added per well in white 96-well plates except for the blank wells. After adding a 5 \u03bcL activator (resveratrol), 5 \u03bcL inhibitor (EX527), or 5 \u03bcL sample drug (MHY2233) in the respective wells, 1.5 \u03bcg human SIRT1 recombinant protein expressed in Escherichia coli (cat. No. S8446) was added to each well. Then, a 10 \u03bcL SIRT1 substrate (cat. No. S9821) was added to each well. The final volume was brought to 50 \u03bcL by adding the required volume of assay buffer (cat. No. A6480). The plate was mixed in a horizontal shaker for 1 min. After incubating the plate at 37\u00b0C for 30 min, 5 \u03bcL developing solution (cat. No. D5068) was added and mixed by pipetting. The plate was again incubated at 37\u00b0C for 10 min. Then, the fluorescence signal was measured at excitation/emission wavelengths of 355/460 nM using a Multilabel Plate Reader (VICTOR3). Finally, the SIRT1 deacetylase activity was calculated using a standard curve.SIRT1 deacetylase activity was measured by using a commercial kit  following the manufacturer's protocol. In brief, 5 \u03bcg/mL). After washing four times, the coverslip was removed and mounted on a glass slide using Prolong\u00ae Diamond Antifade Mountant . Confocal images were acquired using a Confocal Laser Scanning Microscope-KM (ZEISS LSM 700).Senescent EPCs  that had been pretreated with DMSO or 10 nM MHY2233 were seeded on glass coverslips in 24-well tissue culture plates. The cells were fixed with 4% formaldehyde for 10 min and permeabilized with 0.1% Triton X-100 for 5 min. Then, the fixed cells were blocked for one hour at room temperature using 10% normal goat serum containing 0.3 M glycine in PBS. After washing with 1% BSA in PBS, the cells were incubated with specific primary antibody (1\u2009:\u2009100 dilution) overnight at 4\u00b0C. The cells were washed with 1% BSA in PBS four times and incubated with Alexa Fluor\u00ae 594 goat anti-mouse or Alexa Fluor\u00ae 594 goat anti-rabbit secondary antibody (Invitrogen) for 2 h at room temperature in the dark. After washing, the nuclei were stained with 4\u2032,6-diamidino-2-phenylindole  and Pyronin Y (1 \u03bcg/mL) for 20 min at room temperature in the dark. Cell cycle distribution was then analyzed by flow cytometry (BD FACSCanto M). Cell cycle distributions were assessed by using FlowJo single cell analysis software .For cell cycle analysis, passage 18 senescent EPCs pretreated with DMSO, MHY2233, resveratrol, or EX527 were trypsinized when cell confluence was approximately 60\u201370% and collected. The harvested cells were washed with 1x PBS, fixed in 70% cold ethanol at 4\u00b0C overnight, washed with FACS buffer (2% FBS and 2 mM EDTA in PBS), and stained with Hoechst 33342  in FACS buffer for 30 min at 37\u00b0C and washed with FACS buffer three times. ROS levels were determined using fluorescence-activated cell sorting .To determine cellular ROS levels, EPCs were treated with DMSO, 10 nM MHY2233, 100 nM resveratrol, or 100 nM EX527 for 24 h and then treated with 600 \u03bcL fluorescein isothiocyanate- (FITC-) annexin V and 5 \u03bcL PI. After gentle vortexing, the cells were incubated for 5 min at room temperature in the dark. Then, 400 \u03bcL of 1x binding solution was added to each tube. Finally, the percentage of apoptotic cells was measured by FACS (BD Accuri C6) and separated as live cells (FITC-annexin V\u2212/PI\u2212), apoptotic cells (FITC-annexin V+/PI\u2212), and dead cells (FITC-annexin V+/PI+).To measure the percentage of apoptotic cells, we harvested the cells and washed them twice with cold PBS. Then, the cells were suspended in 1x binding buffer followed by the addition of 5 t-tests were used to compare between two groups, and one-way analysis of variance (ANOVA) was used to analyze the difference among more than two groups using Tukey-Kramer multiple post hoc comparisons. A p value \u2264 0.05 was considered statistically significant .Data are presented as means \u00b1 standard\u2009error of the mean (SEM) of at least three replicates and analyzed by using GraphPad Prism 5.0 software. Unpaired Student's \u03b2-gal activity, senescence marker proteins, and mRNA expression levels between young and senescent EPCs were evaluated. The number of SA-\u03b2-gal-positive cells was significantly higher in senescent EPCs than in young EPCs . There was no significant change in the mRNA levels of SIRT2, SIRT3, and SIRT7  and enhances functional activities of senescent EPCs . Likewise, MHY2233 decreases ROS formation in senescent EPCs and decreases the percentage of apoptotic cells. Consistently, it reduces cellular ROS with H2O2-induced oxidative stress, protects EPCs from oxidative stress, and prevents premature senescence. Furthermore, MHY2233 minimizes SA-\u03b2-gal-positive cells and downregulates SASPs, such as IL-6, IL-8, IL-1\u03b1, and IL-1\u03b2, in senescent EPCs. This reveals the potential effect of MHY2233 in preventing vascular senescence.This study for the first time demonstrated a new potent SIRT1 activator, MHY2233, to prevent replicative senescence and oxidative stress-induced senescence in cultured human EPCs. The major finding is that MHY2233 not only increases SIRT1 activity but also increases SIRT1 gene expression in EPCs with chronic treatment. Moreover, it reduces the expression of cell cycle arrest proteins , such as resveratrol and SRT1720, to increase SIRT1 expression is unclear. There is still controversy whether STACs have a direct or indirect effect on SIRT1 expression \u201336. SRT1via SIRT1/eNOS pathways [Several studies have suggested the role of oxidative stress and ROS in cellular senescence and endothelial dysfunction , 46, 47.pathways . Resverapathways . Resverapathways , 52. The\u03b2-gal [\u03b1, and IL-1\u03b2 are key SASPs [\u03b2-gal enzyme and SASPs, such as IL-6, IL-8, IL-1\u03b1, and IL-1\u03b2, were upregulated in senescent EPCs. Upon treatment with MHY2233, there were significant reductions in the expression of SASPs and the number of SA-\u03b2-gal-positive cells. This suggests that MHY2233 prevents senescence in EPCs by stimulating SIRT1.Cellular senescence is the stage where cells can no longer replicate. It is characterized by irreversible cell cycle arrest in the G0/G1 phase. Senescent cells show different morphological characteristics, such as an increase in size, a flattened appearance, and the presence of large vacuoles. Another important characteristic of senescent cells is the expression of SA-\u03b2-gal . Senesceey SASPs , 54. TheSeveral previous studies mentioned that the functional activities of EPCs  were reduced in replicative aging or cellular senescence , 55. OurIn conclusion, to the best of our knowledge, this is the first study to demonstrate the role of MHY2233 in preventing senescence in human endothelial progenitor cells. The antiaging effect of MHY2233 is mainly due to SIRT1 deacetylase activity and upregulation of SIRT1 expression. MHY2233 was found to be highly effective in reducing replicative senescence and oxidative stress-induced senescence in EPCs. Moreover, MHY2233 increases the functional activities of senescent EPCs, such as cell proliferation, migration, and angiogenesis. This study reveals that MHY2233 is more potent than the commercially available SIRT1 activator, resveratrol. Therefore, the novel compound MHY2233 can be used as a potent therapeutic target for the treatment of aging- and age-associated cardiovascular diseases."}
+{"text": "Increasing work efficiency, improving psychological health, decreasing turnover, turnover intention, and absenteeism may be dependent on organizational commitment of an employee. This study was carried out to identify the predictors of organizational commitment among university nursing faculty within Kathmandu Valley, Nepal.A cross-sectional analytical study was conducted based on a sample of 197 nursing faculty selected from 18 nursing colleges affiliated to 5 universities in Kathmandu Valley by using a proportionate stratified random sampling technique. Structured questionnaires regarding socio-demographic information, perceived faculty developmental opportunity, job satisfaction, perceived organizational support, and organizational commitment were used for data collection. Double data entry and data cleaning were done by using Epi-data software; and data analysis was carried out with SPSS version 16 software. Binary regression analysis was used to identify the predictors of organizational commitment and the adjusted odds ratio (AOR) was also calculated.The findings of this study showed that a majority of respondents had moderate level of organizational commitment (68%) followed by high level (29%) and low level (3%). This study also revealed that the nursing faculty who had a master\u2019s degree in nursing, a permanent appointment, and job satisfaction had a high level of organizational commitment. On the contrary, this study also revealed that the nursing faculty who were in the position of assistant instructor to assistant lecturer level and more than 5\u00a0years of work experience within same organization were less likely to have a high level of organizational commitment.Nursing faculty within Kathmandu Valley have a moderate level of organizational commitment. The predictors of organizational commitment are higher education in nursing, position, type of appointment, current organizational tenure, and job satisfaction. Therefore, an organizational authority must pay attention to the modifiable predictors of organizational commitment to enhance organizational commitment of its nursing faculty. This will help to reduce faculty turnover, increase quality of teaching and student\u2019s satisfaction. Organizational commitment refers to employee commitment to an organization regarding desire-based (affective commitment), obligation based (normative commitment) and cost-based (continuance commitment) . These fJob satisfaction is the most dominant factor in organizational commitment  and a prA cross-sectional analytical study was conducted to identify the predictors of organizational commitment among university nursing faculty of Kathmandu Valley.The study population consisted of 279 nursing faculty who had completed at least six months of a full-time teaching in a bachelor program or higher level of 18 nursing colleges affiliated to 5 universities , Purbanchal University (PU), Pokhara University (PokU), Kathmandu University (KU) and National Academy for Medical Sciences (NAMS) of Kathmandu Valley). But, nursing faculty on long leave were excluded from the study. The campus chief, assistant campus chiefs, heads of departments, and visiting professors were excluded from the study population. The sample size was calculated by using the formula :\\documenZ\u2009=\u20091.96 for 95% confidence level,p\u2009=\u200968% [q\u2009=\u20091-p,p\u2009=\u200968% , q\u2009=\u20091-pME (Margin of Error)\u2009=\u20095%,n\u2009=\u2009Sample Size.N\u2009=\u2009Population Size .h\u2009=\u2009(Nh/N)\u2009\u00d7\u2009n*, where, nh: sample size for stratum h, Nh: population size for stratum h, N: total population size, n*: total sample size.The required sample size was 152 nursing faculty for 95% confidence level. Allowing non-response rate of 10% and maintaining the power of test , the final sample size was estimated to be 209 nursing faculty. The proportionate stratified random sampling technique was used to divide the population into 5 strata of affiliated universities  to 5 (strongly agree) with 5 negatively worded items. The minimum and maximum scores of this scale were 15 and 75 respectively. The perception level was categorized into five categories as Most Favorable Perception (75 score), Favorable Perception (46\u201374 score), Neutral Perception (45 score), Unfavorable Perception (16\u201344 score) and Most Unfavorable Perception (15 score) .Part three consisted of 36 items of job satisfaction survey (JSS) of nursing faculty measured on 6-point Likert scale ranging from 1 (Strongly disagree) to 6 (Strongly agree) with 19 negatively worded items. The minimum and maximum scores were 36 and 216 respectively. The level of job satisfaction was determined by the score of respondents. A mean item response \u22654 represented satisfaction, whereas mean response \u22643 represented dissatisfaction, and mean scores between 3 and 4 represented as ambivalence .Part four consisted of 8 items of perceived organizational support (POS)  of nursiPart five consisted of 18 items of organizational commitment questionnaire (OCQ) - affective, continuance, and normative . NegativThe OCQ tool has been already validated in the Nepalese context . To ensuWritten permission was taken from the authors for using OCQ and SPOS. JSS is a free tool for educational purposes. Data was collected from 23 January 2017 to 13 March 2017 by applying ethical procedure. The questionnaires were distributed to 209 nursing faculty selected in sample for self-response with provision of sufficient time as requested by the respondents (average 3\u00a0days\u2019 time) and regular follow-up. Within time frame of data collection period allocated for the study, 197 nursing faculty returned the completed questionnaire and 12 questionnaires were not returned. Thus, a valid response rate for this study was 94.3% and the data analysis was carried out using 197 completed questionnaires.p\u2009\u2264\u2009.05 for 95% confidence level.Questionnaire editing for completeness and consistency of responses was done at field and central level. Double data entry as well as data cleaning was done using Epi Data software and data analysis was done using SPSS software version 16. Descriptive statistics was used to describe the sample characteristics and binary logistic regression analysis was used to identify the predictors of organizational commitment and adjusted odds ratio was also calculated. Logistic regression adjusted for age, marital status, higher education in nursing, higher education besides nursing, position, type of appointment, positional tenure, professional tenure, current organizational tenure, family structure, perceived faculty developmental opportunity, job satisfaction and perceived organizational support. Variables were entered simultaneously in the model and significant results were denoted by an asterisk in the table. For each test, significance was considered at M\u2009=\u200936\u00a0years, SD\u2009=\u20098.3); 86.8% were married; 54.8% had a master\u2019s degree in nursing; 40.1% received education besides nursing; 49.7% had economically dependent family members; 46.2% had a permanent type of appointment; and 48.7% were lecturers. Majority of respondents had less than five years of positional tenure (76.6%) and organizational tenure (64.5%), and\u2009\u2265\u20099 years of professional tenure (74.1%).In this study, the nursing faculty were aged from 24 to 73\u00a0years , and type of appointment  contributed significantly to the prediction of a high level of organizational commitment, whereas position  contributed significantly to the prediction of a low to moderate level of organizational commitment. The contribution of other socio-demographic factors- age, marital status, and higher education besides nursing were not significant. However, the adjusted odds ratio reveals that respondents who were above 30\u00a0years old, unmarried, and had higher education besides nursing were 1.861, 1.598 and 1.348 times more likely to have a higher level of organizational commitment respectively. On the other hand, the respondents with position of Assistant Instructor to Assistant Lecturer were less likely to have higher level of organizational commitment than lecturer to Professor.Table\u00a0p\u2009=\u2009.044, AOR\u2009=\u20090.039, CI\u2009=\u20090.098, 0.967) contributed significantly to the prediction of a low to moderate level of organizational commitment, but, positional tenure and professional tenure did not. However, the adjusted odds ratio reveals that respondents with greater than 5\u00a0years of experience were 0.039 times less likely to have high level of organizational commitment than others; and respondents with more than 5\u00a0years of positional tenure were 1.632 times more likely to have high level of organizational commitment than others.Table\u00a0p\u2009=\u2009.032, AOR: 2.608, CI: 1.087, 6.255) contributed significantly to the prediction of high level of organizational commitment, but contribution of other variables \u2013 having economically dependent family members, perceived faculty developmental opportunity, and perceived organizational support were not significant. However, the adjusted odd ratio reveals that the respondents who did not have economically dependent family members, who had a favorable perception towards faculty developmental opportunity, and a high level of perceived organizational support had 2.001, 1.713, and 1.189 times more likely to have high level of organizational commitment than others.Table\u00a0This study reveals that a majority of respondents had a moderate level of organizational commitment (68%) and 29% had high level. The findings of a previous study on effect of organizational climate on organizational commitment among faculty of nursing in Egypt indicated that most faculty had a moderate level of organizational commitment . The finRegarding predictors of organizational commitment among respondents, the current study reveals that age did not contribute significantly to the prediction of a high level of organizational commitment. This finding is supported by a previous study on determinants of organizational commitment among the faculty of private tertiary institutions in the Philippines which showed that age did not significantly affect organizational commitment . A similThe present study shows that marital status did not contribute significantly to the prediction of high level of organizational commitment. The finding of the current study is inconsistent with the finding of a previous study on organizational commitment and turnover intention among private universities\u2019 employees in Nigeria, which revealed that marital status significantly predicted organizational commitment and turnover intention . The supThe recent study highlights that higher education in nursing contributed significantly to the prediction of high level of organizational commitment. The finding is consistent with a comparative study on qualification and organizational commitment among the faculty of private universities in Pakistan, which revealed that faculty holding a Master\u2019s degree were more dedicated than those holding MPhil and PhD degrees . The supThe current study also revealed that position contributed significantly to the prediction of low to moderate level of organizational commitment. The finding of the current study is consistent a previous study of Saudi Arabia which showed that academic rank was found to be significantly related to organizational commitment . The supThe current study shows that permanent type of appointment contributed significantly to the prediction of a high level of organizational commitment. This finding is inconsistent with the finding of a previous study conducted among nurses in Nepal, which did not reveal type of appointment as a predictor of organizational commitment . The supThe current study highlights that respondents with more than 5\u00a0years of work experience in current organization were less likely to have a high level of organizational commitment. However, positional tenure and professional tenure did not contribute significantly to the prediction of high level of organizational commitment. A previous study done among nurses in Nepal did not reveal work experience as a predictor of organizational commitment . The supThe present study shows that having economically dependent family members did not contribute significantly to the prediction of high level of organizational commitment. This finding is consistent with the previous study conducted among nurses in Nepal, which did not reveal economically dependent family members as a significant predictor of organizational commitment . The supThe current study shows that perceived faculty developmental opportunities did not contribute significantly to the prediction of high level of organizational commitment. This finding is similar to a previous study among nurses, which did not reveal staff developmental opportunity as a predictor of organizational commitment . The supThe present study shows that job satisfaction contributed significantly to the prediction of high level of organizational commitment. The previous study conducted in Jordan showed that job satisfaction was significantly related to faculty members\u2019 commitment . The supThe present study demonstrates that perceived organizational support did not contribute significantly to the prediction of high level of organizational commitment. This finding is different from previous findings on structural relationships between organizational commitment, job satisfaction, developmental experiences, work values, organizational support, and person-organization fit among nursing faculty in USA. That study revealed that perceived organizational support positively predicted nurse faculty\u2019s organizational commitment to the academic organization . AnotherIn conclusion, university nursing faculty have moderate level of organizational commitment. Higher education in nursing, position, type of appointment, current organizational tenure and job satisfaction are predictors of organizational commitment. Hence, human service organizations must focus on developing strategies to retain experienced employees by offering permanent appointments and provide professional and academic career development tools. They must do more to offer novel faculty developmental opportunities, provide organizational support, and improve job satisfaction. These cumulative actions will foster an environment for enhancing organizational commitment amongst nursing faculty. Effectively, such an ecosystem will reduce turnover, improve quality of teaching, lower absenteeism, improve the student\u2019s satisfaction level, and enhance organizational effectiveness.The limitations of this study were: the results were derived only from the self-reported techniques based on perceptions of nursing faculty using Likert items. There is a possibility of social desirability and central tendency biases, which may have distorted the true organizational commitment. Moreover, the generalizability of the study\u2019s findings is limited because of the study population, which was based on responses from nursing faculty of different nursing colleges within Kathmandu Valley. To obtain more generalizable results, future investigations should include nursing faculty working outside Kathmandu Valley as well. The findings were drawn from cross-sectional data obtained from self-administered questionnaires and this study had not included other variables that may influence organizational commitment i.e., organizational culture, job involvement, job stress, job insecurity, workplace harassment, organizational communication and so on. Therefore, this study was not able to present definitive conclusions about the direction of causality and reveal the factors, which have long-term effects on organizational commitment. Hence, prospective longitudinal research should be conducted to identify the antecedent and consequences factors associated with organizational commitment among nursing faculty in different colleges affiliated to different universities of Nepal.However, this study has methodological strengths. It was a large survey including major universities in Nepal with a range of nursing faculty using random sampling technique with precise sample size. In addition, a high response rate (94.3% after eliminating the missing data) strengthens the generalizability of the study findings within the nursing faculty of Kathmandu valley."}
+{"text": "To carry out the meta-analysis on the clinical safety of glycyrrhizic acid and the influencing factors between 18\u03b1-GL, and compound glycyrrhizin injection was used as the representative preparation of 18\u03b2-GL. The clinical control trial of magnesium isoglycyrrhizinate injection and compound glycyrrhizin injection was searched in a computer, which was published from January 2006 to December 2019 on the databases such as PubMed, China National Knowledge Infrastructure (CNKI), China Science and Technology Journal Database (CSTJ), and Wanfang Medical Network (Wanfang Data). The data associated with adverse drug reactions (ADRs) were extracted. RevMan5.3 was used for statistical analysis.  Magnesium isoglycyrrhizinate injection was used as the representative preparation of 18P < 0.00001). There was no heterogeneity among the studies .  Finally, 24 studies were included, and 2757 patients were involved, of which the experimental group was mainly treated with magnesium isoglycyrrhizinate, while the control group was mainly treated with compound glycyrrhizin. The results showed that the occurrence of ADRs was significantly lower in the experimental group than that in the control group, and the difference between two groups was statistically significant , \u03b2-GL, 18\u03b1-GL had a lower incidence of adverse reactions and better clinical safety. Compared with 18 Existing studies with small samples have shown that MI and CG have differing conclusions of the adverse drug reactions (ADRs). The studies of Ye et al. [\u03b2-hydroxysteroid dehydrogenase [\u03b2-hydroxysteroid dehydrogenase was directly associated with pseudo-aldosteronism-related symptoms. However, whether the difference in the structure of these two preparations has led to the occurrence of ADR difference has not been reported clinically. Therefore, in this study, meta-analysis was used to explore their relationship of ADRs and 11\u03b2-hydroxysteroid dehydrogenase in MI and CG in order to provide reference for clinical safe medication and new production preparations.Glycyrrhizin (GL) is one of the active ingredients in licorice, and it has been widely used in clinical diseases of abnormal liver function. Based on epimerism, GL is classified into 18e et al.  and Mao e et al.  showed trogenase ; conversWith the keywords of MI and CG, the literature from January 2006 to December 2019 was searched in the databases such as PubMed, China National Knowledge Infrastructure (CNKI), China Science and Technology Journal Database (CSTJ), and Wanfang Medical Network (Wanfang Data). And then, the references of the literature that met the inclusion criteria were carefully read to obtain the wanted articles. The selected literature was published in Chinese or English. This paper was retrieved by two researchers (Fangfang Zheng and Xu Wang).The subjects were patients with abnormal liver biochemical indicatorsThe case-control study on the experimental group treatment with MI injection and control group treatment with CG injection and other treatment measures in these two groups which were the same in patients with abnormal liver function was analyzedThese articles reported in detail the number and presentation of ADRs in the experimental and control groupsThe same article is in different databasesDifferent articles using the same data repeatedlyADR data are in doubtTwo researchers (Lu Ye and Qingqing Yang) extracted the papers. First of all, through reading the title and abstract of the literature retrieved, articles of magnesium isoglycyrrhizinate and compound glycyrrhizin were screened out. Articles that remained after the preliminary screening were screened again by reading the entire articles based on the provided ADR data. Finally, data extracted from all articles were compared to remove duplicate articles. Articles that only reported the number or the presentation of ADRs or articles in which the reported number did not match with the presentation were excluded.All the following information was extracted from the included literature: diagnosis, diagnosis and treatment cycle, MI dose (mg), MI origin, CG dose (mg), CG origin, MI sample size, CG sample size, MI-ADR number and presentation, and CG-ADR number and presentation. The quality of the literature was evaluated according to the Cochrane risk-of-bias tool . Low-quaI2 \u226450% indicated that the heterogeneity might not be important or that there was moderate heterogeneity. The fixed-effect model was used for the meta-analysis. I2 >50% indicated that heterogeneity was evident. If interference could not be excluded, the random-effect model was used for analysis.A meta-analysis was carried out by RevMan5.3 software. The publication bias was tested by Stata software. The development of ADRs was evaluated using the relative risk (RR) and 95% confidence interval (CI). Heterogeneity was examined using a homogeneity test (chi-square test). Databases were searched comprehensively, and then, the retrieval results were cross-checked . At the These 24 articles involved a total of 2,757 patients with 1,520 cases in the MI group and 1,237 cases in the CG group. The MI doses in these studies ranged from 50 to 200\u2009mg, and the CG doses ranged from 60 to 200\u2009mg. The MI preparations in these studies were from original manufacturers. Nine studies had labeled the origins of the CG injections, and five studies did not indicate the origin; therefore, a statistical analysis could not be performed .z\u2009=\u20090.64 (continuity corrected), pr\u2009>\u2009|Z |\u2009=\u20090.519 (continuity corrected), and 0.519>0.05, indicating that the results were not statistically significant. All of them are uniformly distributed in Three , 38, 57 The specific conditions of the number and symptoms of ADRs in the articles are shown in n\u2009=\u20091520/1237). To assess ADR development, the meta-analysis was performed using the fixed-effect model because the heterogeneity among all studies might not be important (I2\u2009\u2264\u200950%). The results showed that the RR of ADR development in the MI group was significantly lower than that in the CG group , P < 0.00001).The overall analytic results of the 24 studies are shown in \u03b1-GL content is only 1%. CG, as a representative drug of second-generation glycyrrhizic acid, mainly contains 18\u03b2-GL and a small amount of 18\u03b1-GL, and the proportion of 18\u03b2-GL ranged between 95% and 99%. This study compared the high-purity 18\u03b1-GL preparation of MI with the clinically extensively used CG preparation that mainly contained 18\u03b2-GL. Through a comprehensive analysis of the conditions of ADR development in many studies, the results showed that these two preparations had significant differences in the ADR.The mechanism of ADR development is very complicated. Molecular heterogenicity is one of the reasons for the difference ADR occurrence in glycyrrhizin preparations. MI is a single-ingredient preparation, in which the non-8\u03b1-GL preparation, pseudo-aldosteronism was still the main type of ADR reported; however, its incidence was lower than that from the CG presentation, which mainly contained 18\u03b2-GL. These results were consistent with the study of Li et al. [The statistical analysis of this study showed that the ADRs of GL primarily manifested as lower limb edema, facial edema, increased blood pressure, palpitation, and dizziness and headache. A total of 112 cases accounted for 78.87% of the 142 ADR cases. These frequent ADRs were all associated with pharmacological and toxicological effects of GL and were pseudo-aldosteronism reactions. Pseudo-aldosteronism reactions accounted for 67.86% of ADRs in the MI group and 81.58% of ADRs in the CG group. With MI as the 18i et al. .\u03b1-GL is 18\u03b1-glycyrrhetinic acid, and the metabolic product of 18\u03b2-GL is 18\u03b2-glycyrrhetinic acid. Existing preclinical studies have shown that the incidence of pseudo-aldosteronism reactions produced by 18\u03b1-glycyrrhetinic acid was lower than that produced by 18\u03b2-glycyrrhetinic acid. A possible reason is that 18\u03b1-glycyrrhetinic acid selectively inhibits type 1 11\u03b2-hydroxysteroid dehydrogenase, whereas 18\u03b2-glycyrrhetinic acid has inhibitory effects on both type 1 and type 2 11\u03b2-hydroxysteroid dehydrogenase [The current view considers that the pseudo-aldosteronism reaction of GL is associated with the drug itself or its metabolic product . Differerogenase . These rThe meta-analysis results were influenced by the quality and number of patients in the included articles. None of the articles included in this study described allocation concealment, which might influence the subjective judgments of doctors and patients, particularly the subjective symptoms of ADRs such as dizziness, headache, and palpitation."}
+{"text": "To compare the difference in central corneal thickness (CCT) measurements in normal eyes between a rotating Scheimpflug camera combined with a Placido-disk corneal topographer  and ultrasound pachymetry (USP).A systematic literature search was conducted for relevant studies published on PubMed, Medline, EMBASE, and the Cochrane Library and ClinicalTrials.gov from inception to August 1st, 2019. Primary outcome measures were CCT measurements between Sirius and USP. A random effects model was used to pool CCT measurements.P\u2009<\u20090.0001). The mean difference between Sirius and USP was \u221211.26\u2009\u03bcm with a 95% confidence interval (CI) . The heterogeneity was I2\u2009=\u200960% (P\u2009=\u20090.004).A total of twelve studies involving 862 eyes were included in this meta-analysis. The meta-analysis found CCT measurements between Sirius and USP to be statistically significantly different (CCT measurements with the Sirius Scheimpflug-Placido topographer were statistically significantly lower than USP. However, it may be argued that the mean difference of 11.26\u2009\u03bcm is not a clinically significant difference. The precise measurement of central corneal thickness (CCT) is important in daily ophthalmic practice, in particular in the fields of corneal refractive surgery, corneal diseases and glaucoma \u20134. UltraThe Sirius anterior segment analysis system  utilizes a single 360-degree rotating Scheimpflug camera combined with a Placido-disk topographer of 22 rings acquiring 25 radial sections of the cornea. A blue light-emitting diode (LED) light with a wavelength of 475\u2009nm measures 35,632 points on the anterior cornea and 30,000 points on the posterior cornea. The scanning process obtains 25 tomographic Scheimpflug images and one Placido corneal curvature in a single measurement \u201310.Some previous studies have compared CCT measurements directly between Sirius and USP , 11\u201321. This meta-analysis was conducted under the guidance of the Preferred Reporting Items for Systematic Review and Meta-Analysis (PRISMA) guidelines . ProspecTwo independent researchers (Y.L.J. and Y.R.W.) performed the article screening; any discrepancies were resolved by focused discussion or consultation with an additional researcher (B.H.S.). Studies meeting the following inclusion criteria were included in this meta-analysis: a) Adults 18\u2009years or older without any eye diseases or systemic diseases; b) CCT measurements were acquired both with Sirius and USP by the same clinician within 30\u2009min; c) Compared CCT measurements directly between Sirius and USP; d) Original research. The excluded criteria were studies with incomplete data or duplicate data. The full text was obtained and reviewed with articles whose abstracts are not clear to ensure we did not leave out any article that was eligible.For all selected studies, we designed a datasheet with the following information to collect data: first author and year of publication, country of the study, sample size, number of eyes, mean and standard deviation (SD) of patient age, gender ratio, refractive error, mean and SD of CCT measured by Sirius and USP, and device manufacturer.The Quality Assessment of Diagnostic Accuracy Studies (QUADAS) \u201325 scaleThe measurement results of the CCT by Sirius and USP were compared in normal eyes.2 parameter. I2 is a statistic for quantifying inconsistency and is calculated as follows: I2\u2009=\u2009(Q\u00a0\u2212\u00a0df/Q) \u00d7\u2009100%, where Q is the Chi-squared statistic and df is the degrees of freedom. In other words, I2 quantifies the percentage variability due to heterogeneity rather than by chance [2 was >\u200950%, the random effects model was used to pool the data for the relatively higher variance in clinical characteristics and sample sizes. A P-value of less than 0.05 was considered to be statistically significant. Sensitivity analysis was performed by omitting one study at a time and re-evaluating the effect of different statistical models (fixed effects model or random effects model). Ultrasonic velocity was likely to be one of the sources of heterogeneity, so we analysed the heterogeneity based on whether the ultrasonic velocity was reported and the reported speed. Subgroup analysis was carried out based on the different races included in studies. A funnel plot is a scatter plot to assess for publication bias. The x-axis of the funnel plot signifies the mean result  whereas the y-axis signifies the index of precision  or sample size. One would expect to observe an even scattering around the true result, however when significant publication bias exists, an asymmetry in the scatter is observed [Statistical analysis was performed with Review Manager  statistical analysis software. As CCT is a continuous outcome, weighted mean differences (WMD) with 95% confidence intervals (CI) were calculated and the difference was defined as CCT measurement of Sirius minus USP. The fixed effects model was used to analyse the data initially. Heterogeneity was assessed by the Iy chance . If the observed .The systematic search flowchart is showed in Fig.\u00a0P\u2009<\u20090.0001), with the forest plot displayed in Fig.\u00a02) was 60% (P\u2009=\u20090.004). Since two studies [2 was 66%  which is no different than the random effects model. The primary heterogeneity was high, so a sensitivity analysis was performed by excluding each study in turn. When the study by Gokcinar et al. [P\u2009<\u20090.00001) with the fixed effects model. The difference which excluded three articles has no difference with the primary group. In addition, we extracted studies which reported the ultrasonic velocity of USP were extracted. Five studies with 216 eyes reported ultrasonic sound velocity, all were 1640\u2009m/s. The difference between Sirius and USP was \u22129.19\u2009\u03bcm with 95% CI from \u221215.80\u2009\u03bcm to 2.59\u2009\u03bcm (P\u2009=\u20090.006), I2\u2009=\u200938% , which was not significantly different to the overall group; while the mean difference in the Asian group was \u22121.32\u2009\u03bcm with 95% CI from \u221217.37\u2009\u03bcm to 14.73\u2009\u03bcm (P\u2009=\u20090.87).According to the different races of the subjects included in these studies, they were divided into two groups of Caucasians , 15\u201321 aFunnel plots are displayed in Figs.\u00a0To the best of our knowledge, this study is the first meta-analysis to compare the Sirius with USP in terms of CCT measurements in normal healthy corneas. Most of the included studies have sample sizes ranging from 30 to 60 eyes. Our meta-analysis analysed 862 eyes by combining results of the included studies, which provides great statistical power than that of each study alone .Our study suggests that, in normal healthy eyes, CCT measured with the Sirius were statistically lower than that measured with USP; the mean difference was \u221211.26\u2009\u03bcm. A previous study  found thP\u2009=\u20090.45). Subsequent studies reported a CCT difference between the two between 0.05\u2009\u03bcm and 4.7\u2009\u03bcm [Other Scheimpflug based devices  were not included in this meta-analysis as a previous meta-analysis has been published comparing the Pentacam to USP, and only three articles compared the Galilei to USP. Wu et al.  conducted 4.7\u2009\u03bcm \u201333. Menad 4.7\u2009\u03bcm  evaluated 4.7\u2009\u03bcm , 36. Howd 4.7\u2009\u03bcm .2 decreased to 38% when analysing specifically studies which reported ultrasonic velocity. The ultrasonic velocity was 1640\u2009m/s in all these studies and the results had no difference with the primary group, and we could not determine its specific effect because other studies have not reported the exact ultrasonic velocity. We are still unclear about the causes of heterogeneity in CDVA differences [After reading the full text of articles carefully, we found that the difference in the refractive error of the sample may be one of the reasons for the heterogeneity. In the study by Huang et al. , the refferences . A possiCCT is an important step in preoperative screening and preoperative planning for corneal refractive surgery. Studies have shown that in order to avoid corneal ectasia, the absolute CCT needs to be greater than 450\u2009\u03bcm or a residual stromal bed thickness after ablation of >\u2009250\u2009\u03bcm . A previ51 used an optical corneal pachymeter and a Goldmann applanation tonometer to analyse the correlation between CCT and IOP in the Mongolian population. It was found that for every 10\u2009\u03bcm increase in CCT, the IOP only increased by 0.12\u2009mmHg to 0.31\u2009mmHg, but inter-individual difference may produce an IOP difference of 2.3\u2009mmHg to 3.1\u2009mmHg. Wolfs et al. [A large number of studies \u201350 have s et al.  reportedThere are several limitations in the current meta-analysis. First, we only included normal healthy adult populations and did not evaluate a variety of more complex situations such as children, cataracts, and keratoconus. This was mainly due to the lack of studies outside normal healthy eyes. Second, we did not include unpublished articles, such as posters or abstracts from conferences. Third, various USP devices were used in the studies included in this meta-analysis, although we assessed heterogeneity for studies reporting ultrasonic velocity. These USP devices are likely to vary in their precision (repeatability and reproducibility) which can have a knock-on effect on the agreement with the Sirius.In summary, the present meta-analysis suggests that there are statistically significant differences in the measurement of CCT between the Sirius Scheimpflug-Placido topographer and USP in normal adult eyes and the value of Sirius is lower than the value of USP. This difference is small and below normal diurnal variation and is not considered clinically significant."}
+{"text": "Four UWS patients (36%) provided high-complexity PCI values, which might suggest a covert capacity for consciousness. In conclusion, this study successfully replicated the performance of PCI in discriminating between UWS and MCS patients, further motivating the application of TMS-EEG in the workflow of DOC evaluation.The difficulties of behavioral evaluation of prolonged disorders of consciousness (DOC) motivate the development of brain-based diagnostic approaches. The perturbational complexity index (PCI), which measures the complexity of electroencephalographic (EEG) responses to transcranial magnetic stimulation (TMS), showed a remarkable sensitivity in detecting minimal signs of consciousness in previous studies. Here, we tested the reliability of PCI in an independently collected sample of 24 severely brain-injured patients, including 11 unresponsive wakefulness syndrome (UWS), 12 minimally conscious state (MCS) patients, and 1 emergence from MCS patient. We found that the individual maximum PCI value across stimulation sites fell within the consciousness range  in 11 MCS patients, yielding a sensitivity of 92% that surpassed qualitative evaluation of resting EEG. Most UWS patients ( Prolonged disorders of consciousness (DOC) represent a spectrum of syndromes occurring in patients who survive coma after severe brain injury. Their characteristic feature is the dissociation between preserved arousal and complete or partial absence of awareness . The cliTherefore, the search for methods capable of accurately detecting the presence of consciousness in unresponsive patients is one of the major goals in DOC research. Along these lines, the integration of the gold-standard behavioral assessment\u2014based on the Coma Recovery Scale Revised (CRS-R) \u2014with a mThese important findings led to the inclusion of PCI in the most recent guidelines for DOC diagnosis: in particular, this index\u2014which is based on TMS-EEG\u2014has been suggested to distinguish MCS from UWS patients to a mildly important degree . FurtherTo further increase the evidence and strengthen the level of recommendation in future guidelines, it is essential that different research groups may confirm the promising results of PCI by performing studies that match the strict methodological criteria requested by a systematic review . Indeed, the prospects of adopting TMS-EEG as an advanced diagnostic tool in the clinical practice would benefit from a confirmation about the accuracy of this technique in heterogeneous clinical contexts characterized by different clinical populations, equipment, and expert judgement in the data acquisition and analysis.In order to promote the application of PCI in future research and clinical settings, in the present study we tested the reliability of PCI as a diagnostic marker by applying the same experimental and computational procedure as well as the same empirical cutoff reported in  in prolon = 12, vascular n = 4, anoxic n = 6, other n = 2; for more details see Twenty-four severely brain-injured patients participated in this study , protocol 11/14, date of approval: 19 November 2014.In each patient, the state of consciousness was clinically evaluated following the validated Russian version  of the C3).Within a week from the clinical evaluation, each patient underwent a neurophysiological assessment including resting-state EEG and TMS-EEG data collection. The entire experimental procedure, including EEG montage, lasted approximately 2.5\u20133 h. During the recordings, the researcher always ascertained that patients kept their eyes open either spontaneously or after a behavioral stimulation , in ordeThe present study employed the same TMS-EEG equipment and followed similar experimental procedures as described in . Specifi2; eXimia TMS Stimulator, Nexstim Ltd., Helsinki, Finland). A Navigated Brain Stimulation (NBS) system  was used to set stimulation parameters on individual MRIs and to ensure their stability across trials in real-time. The coil was always placed tangentially to the scalp to maximize the impact of TMS on the cortex. Similar to [A physical reference electrode was located on the forehead. An electrooculogram (EOG) was bipolarly recorded using two additional electrodes with a diagonal montage. Impedance at all electrodes was kept below 5 k\u03a9. Raw data were band-pass filtered between 0.1 and 350 Hz and sampled at 1450 Hz with 16-bit resolution. During TMS stimulation, auditory potentials elicited by TMS-associated click sound were maximally reduced by continuously playing a masking noise through inserted earplugs. TMS was delivered with a Focal Bipulse 8-Coil  across stimulation sites was considered for diagnostic classification and compared with the previously published empirical cutoff PCI* = 0.31, validated in a large benchmark population to discriminate between unconsciousness and consciousness [TMS-EEG data analysis was performed as described in ,18 by twResting-state EEG data were pre-processed as described in  and analmax > PCI* was computed to assess the sensitivity of PCI, whereas the PCImax values observed in UWS patients were used to possibly detect the potentiality for consciousness in unresponsive patients. The Wilcoxon rank-sum test was applied to compare the PCImax values between MCS+ and MCS\u2212 patients and to compare the CRS-R total scores between low-complexity (PCImax \u2264 PCI*) and high-complexity (PCImax > PCI*) UWS patients. The percentages of high-complexity UWS patients obtained in this reproducibility study and in a previous reference study [max were integrated with qualitative evaluation of the EEG background. Specifically, the Kruskal\u2013Wallis test was applied to compare the PCImax values of MCS patients among mildly, moderately and severely abnormal EEG categories.As in , the frace study  were comn = 6) and \u22655 months for patients with other etiologies. Clinical diagnosis was UWS in 11 patients and MCS in 12 patients, including 4 MCS\u2212 and 8 MCS+ patients. One additional patient with traumatic etiology was diagnosed as emergence from MCS (EMCS). Traumatic etiology was prevalent among MCS patients . In UWS patients, etiology was distributed as follows: n = 4 anoxic, n = 4 traumatic, n = 2 vascular, n = 1 other.The 24 patients enrolled in this study  suffered from DOC following a severe brain injury. Time since injury was \u22652 months for patients with anoxic etiology .PCIpatients a, yieldimax = 0 was never found  constituted the low-complexity subgroup (PCImax \u2264 PCI*) and were characterized by a slow and stereotypical EEG responses to TMS, similar to the ones previously observed in healthy controls in the states of NREM sleep and anesthesia. Four UWS patients showed PCImax > PCI*, thus representing the high-complexity subgroup: in these patients, TMS was able to elicit a rapidly changing and spatially differentiated cortical response, comparable to the one obtained in MCS patients and conscious controls. The CRS-R total scores were not significantly different between low-complexity and high-complexity UWS patients .In the present UWS population, PCI allowed stratifying patients into two main subgroups (instead of three as in ), since er found a. Most omax, max, n = 9, 82%); conversely, most UWS patients  showed a severely abnormal EEG background. Considering MCS patients, PCImax was not significantly different among the three EEG categories   c. Thus, Outcome at 6 months was available for 7 patients: 4 high-complexity MCS patients recovered functional communication with the environment, 2 high-complexity UWS patients did not show any improvement and the high-complexity UWS patient with a mildly abnormal EEG background transitioned to MCS.In the present study, the sensitivity of PCI in the detection of minimal signs of consciousness was estimated at 92%; this result, although obtained on a relatively small patient population, is in line with the value of 94.7% reported in , thus comax values between MCS+ and MCS\u2212 patients is also consistent with [The lack of significant differences in PCIent with  and suggmax was not significantly different among the three EEG categories, in agreement with [max clearly showed higher sensitivity than the qualitative evaluation of resting EEG in both studies. This result seems to confirm a relative advantage of perturbations and causal measures of complexity over observational measures of brain dynamics [Most of the MCS patients (82%) showed either a moderately or a mildly abnormal background EEG, in agreement with the corresponding fraction (81.6%) reported in . In addient with . Importadynamics .At the same time, in accordance with recent reviews on the role of neurophysiology in the evaluation of DOC patients ,16, our max into a low-complexity subgroup of 7 patients (64%) and a high-complexity subgroup of 4 patients (36%). In comparison, an analogous subdivision performed in [max = 0, the absence of the no-response subgroup in the present study might be related to the small number of post-anoxic UWS patients in this sample (n = 4). The percentages of high-complexity patients among all the UWS patients are not significantly different between the two studies . The absence of significant difference in the CRS-R total scores between the low-complexity and high-complexity UWS subgroups is also consistent with the results of [max may provide novel information about UWS patients unavailable from the analysis of their behavior. Specifically, the similarity of the TMS-evoked potentials obtained in high-complexity UWS patients to those observed in conscious controls and MCS patients may indicate a covert capacity for conscious information processing.UWS patients were stratified by PCIormed in  yielded ormed in , anoxic sults of . These fn = 4) showed high-complexity TMS-evoked potentials (with PCImax > PCI*). Among the UWS patients, outcome data were available for two high-complexity patients, who did not show any improvement, as well as for the high-complexity UWS patient with a mildly abnormal EEG background, who transitioned to MCS. Although, in this sample, the rate of transitioning to MCS among the high-complexity UWS patients with known outcome (1 out of 3) was smaller than in [p = 0.5). The small sample size, the variable onset time from the brain injury and the incomplete information about the outcome for all patients do not allow proper testing of the potential of PCImax in recovery prediction.All the MCS patients for whom the outcome is known and who recovered functional communication within 6 months ( than in  (6 out oSimilarly to previous observations in healthy subjects during deep sleep and anesthesia ,27, in tThis study has successfully replicated the performance of PCI in discriminating between UWS and MCS patients, previously reported in . This re"}
+{"text": "Outcomes of the categorization task suggest that older adults have difficulties separating distinctive meanings of emotions more than young adults do. Results of this study indeed shows a decline in emotion recognition using both tasks, and suggests future studies to examine possible changes in conceptual knowledge of emotions, rather than the inability to perceive certain facial cues.Research suggests that aging comes with a decline in the ability to identify emotional expressions. In previous studies on emotion recognition and aging, participants were typically instructed to classify images of facial expressions using sets of lexical emotion labels. Yet, in daily life, when exposed to facial expressions by others, people match these with their conceptual knowledge of how emotions are visually presented , rather than recalling lexical labels . By comparing performances of young adults and older adults on an emotion sorting task based on visual categorization and a traditional labeling task based on lexical categorization, this research aimed to explore a different way of studying emotion recognition abilities over the lifespan. In line with earlier research, results of the labeling task showed that our older participants ( As we age, we seem to have more difficulties with recognizing emotional expressions with others . This paThe ability to recognize emotions by interpreting another person\u2019s non-verbal expression  is essential for effective communication e.g., . It is aOverall, studies indicate that emotion recognition changes over the lifespan  when communicating with others, as shown in emotion recognition studies using eye-tracking methods e.g., . TherefoHowever, these arguments seem unlikely to account for all decline in emotion recognition. For example, emotional expressions of anger and sadness, both defined as negative emotions, are not limited to upper face regions and expressed in the lower half of the face as well . AdditioThe current paper takes a different approach to clarify effects of aging on emotion recognition, exploring the possibility that the methodology used in emotion recognition research may account for these conflicting arguments. In daily life, we use categorization schemes to give meaning to facial expressions, we do not necessarily give them a lexical label. For example, when in conversation with someone, who frowns and presses his or her lips together, we know how to interpret these features without the necessity to name the emotion that these features belong to . This is because we use categorization strategies to give meaning to emotions. According to This research explores differences between young and older adults on their performance on recognizing facial expressions of emotions in a (semi-open) emotion categorization task, and compares any differences with their performance on an emotion-sorting task using lexical labels.Earlier studies using typical sorting tasks show differences in emotion recognition between young adults and older adults. Therefore, we expect older adults to be worse in their overall performance in the sorting task using lexical labels, compared to young adults. Moreover, based on earlier studies, we expect older adults to perform worse on negative emotion recognition, compared to positive emotion recognition. In the (semi-open) categorization task, we ask participants to form groups of existing images showing emotions. If older adults have more difficulties with categorizing emotions than young adults, they are expected to create more heterogeneous groups than young adults. That is, their groups of emotions are expected to contain more emotions than the groups of young adults, as they would make more mistakes in forming the groups. If older adults are as good in recognizing emotions as young adults, and their failing in labeling task is because of the nature and level of difficulty, a difference between the age groups is expected for the labeling task, similar to earlier studies, but not necessarily for the categorization task.SD = 4.27), and twenty older adults , with a mean age of 71.85 years (SD = 6.93), participated in this study. All young adults were undergraduate students of Western Sydney University, Australia, and partook in the experiment voluntarily. Senior participants were recruited at communal computer clubs for older adults located in different suburbs of Sydney, Australia, and were compensated accordingly for their efforts to travel to the campus of Western Sydney University. Prior to the experiment, participants were subjected to an extensive screening, including mental health assessments, cognitive tests, and sight and hearing examinations. We ensured all participants were cognitively and emotionally healthy at the time of participation, and no one showed any signals of substantial hearing and/or sight deficiencies. Beforehand, participants signed a consent form by which they gave permission their data to be used for scientific purposes. Approval for the study was obtained from the ethical committee of Western Sydney University; recruitment and experimental procedure followed the guidelines of the Institutional Review Board.A total of twenty young adults , with a mean age of 23.80 years  of groups, was chosen as pilot work showed both young and senior participants were uncomfortable with the difficulty of a completely open task. Telling participants how many groups actually presented different emotions helped them in completing the task in a reasonable time. Although participants were urged to complete the task as fast as possible, there was no time constraint.Next, in the labeling task, eight lexical labels were laid out on the table in front of the participant, each label describing an emotional expression . When handed out the second card deck, participants were asked to lay the cards, one by one, under one of the labels with the image facing down. They were not allowed to reconsider their choice. In this way, participants were forced to compare the cards with the lexical labels, and prevented them to compare them with other emotion expression cards. Similar to the categorization task, participants were urged to complete the task as quickly as possible.In the semi-open categorization task, participants were given a deck of 64 emotional expression cards and instructed to create eight groups, based on the emotions the faces on the cards expressed.SD = 110 s) to sort all cards into eight categories. Senior participants needed 536 s (SD = 182 s) to complete the semi-open categorization task. Young adults sorted the cards in groups varying in size from 2 to15 cards per group (SD = 1.73). Older adults\u2019 group sizes varied from 2 to 21 cards per group (SD = 2.66). Focusing on what emotional expressions participants categorized together, repeated measure analysis of variance showed that young adults grouped a smaller amount of different emotions together  than older adults did , F = 11.15, P = 0.002. This shows that older adults made more \u201cmistakes\u201d than young adults when categorizing the emotional expressions, considering the labels that the expression cards were given by the RAFD database (2010).On average, it took young adults 304 s , were exclusive to one cluster (1 of the 8 emotion categories), and clusters were predefined (as an emotion). In order to determine differences between young and older adults for how they clustered the 64 emotional expressions, we counted how many times an emotion card was matched with a specific other card, and calculated the percentage of which the particular emotion was clustered with other emotions. Using Pearson\u2019s chi-square, we found significant differences between age groups comparing differences between the main emotion clusters  and the other emotions . In the labeling task, participants were given a second deck of 64 emotional expression cards and were instructed to place them one by one under one of the eight lexical labels presented.SD = 47 s) to complete the labeling task. Senior participants took 340 s on average (SD = 117 s) to name all 64 emotional expressions in the card deck. A repeated measures analysis of variance with age group as a between factor and emotion as within factor showed a main effect of age group on emotion recognition accuracy (percentage correct responses), F = 16.88, P < 0.001 \u03b72 = 0.31 In general, young adults were more accurate than older adults, when labeling the emotions presented to them . We also found a main effect of emotion, F = 10.23, P < 0.001 \u03b72 = 0.21, and an interaction between emotion and age group, F = 2.3 P = 0.03 \u03b72 = 0.06. Post hoc simple effect analyses show that older adults are less accurate than young adults when labeling typical expressions of sadness, fear, anger and contempt. Young adult participants needed 242 s , we found in the semi-open categorization task similar large differences between young adults and older adults for all emotional expressions, including these four. Older adults seemed to have difficulties separating facial features. For example, while doing the semi-open categorization task, a number of senior participants thought they were tricked by the experimenter as they found cards showing fear and surprise expressions identical.Focusing on which specific emotional expressions got confused by participants, or were grouped as one emotion category, we find that those were not related based on facial features. For example, anger and contempt are very distinctively expressed, by different typical facial action units, so does sadness compared to disgust. However, anger and contempt, and sadness and disgust were often confused or grouped as one specific emotion by senior participants. This can be explained in different ways. We suggest an explanation can be sought in similar action tendencies of such emotions and future research should focus on categorization by the meaning of an emotion, rather than by its facial features. This suggestion is line with research by This study explored performances of young adults and older adults, using two different emotion recognition tasks with young adult emotional expression cards. Earlier studies on face recognition, using different paradigms and stimuli-modalities, showed inconsistencies around any in-group advantages related to age, possibly affecting performance of older adults when exposed to younger faces stimuli . In geneIn conclusion, this research contributes to the idea that the methodology used for examining emotion recognition in facial expressions may affect outcomes. This study explored differences between labeling and semi-open categorization paradigms. The attribution to found differences remains unclear and may urge researchers to take a different approach when studying emotion recognition, taking into account the effect of context on the interpretation of facial expressions and emotions, moving toward paradigms that come closer to representing real life emotion recognition.The datasets generated for this study are available on request to the corresponding author.The studies involving human participants were reviewed and approved by the Western Sydney University. The patients/participants provided their written informed consent to participate in this study.The author confirms being the sole contributor of this work and has approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "KO) and a novel FRET-based AURKA biosensor to investigate how AURKA activity is regulated in the absence of destruction. We found that AURKA activity in FZR1KO cells dropped at mitotic exit as rapidly as in parental cells, despite absence of AURKA destruction. Unexpectedly, TPX2 was degraded normally in FZR1KO cells. Overexpression of an N-terminal TPX2 fragment sufficient for AURKA binding, but that is not degraded at mitotic exit, caused delay in AURKA inactivation. We conclude that inactivation of AURKA at mitotic exit is determined not by AURKA degradation but by degradation of TPX2 and therefore is dependent on CDC20 rather than FZR1. The biosensor revealed that FZR1 instead suppresses AURKA activity in interphase and is critically required for assembly of the interphase mitochondrial network after mitosis.Activity of AURKA is controlled through multiple mechanisms including phosphorylation, ubiquitin-mediated degradation and allosteric interaction with TPX2. Activity peaks at mitosis, before AURKA is degraded during and after mitotic exit in a process strictly dependent on the APC/C coactivator FZR1. We used FZR1 knockout cells (FZR1This article has an associated First Person interview with the first authors of the paper. Summary: Destruction of AURKA plays no role in inactivating the kinase at mitotic exit but is required to keep AURKA activity low in interphase so that a mitochondrial network can be reassembled. Aurora kinase A (AURKA) is a major mitotic kinase required for multiple steps in mitosis, including centrosome maturation, microtubule nucleation and organization into a bipolar spindle and mitotic checkpoint function . Recent Widespread reports in the literature of interphase activity of AURKA, and of its activation through a number of interacting partners , can be In somatic cells, both AURKA protein and kinase activity are low or undetectable through much of the cell cycle but rise sharply in G2 phase, most prominently on the duplicated centrosomes and then on the bipolar spindle in mitosis. pT288 staining is almost entirely confined to the centrosomes, in line with the idea that autophosphorylation is just one route to activation of AURKA. Indeed, a conformational sensor of AURKA detects active kinase on spindle poles, as expected, but also in the cytoplasm, both during and after mitosis . MitoticThe APC/C is responsible for the destruction of dozens of substrates during mitotic exit and coordinates mitotic exit with the processes of chromosome segregation and cytokinesis through the concerted regulation of its coactivators . APC/C\u2013CGiven the complexity of AURKA regulation during the cell cycle, we investigated the contribution of AURKA destruction to its inactivation during mitotic exit using novel tools in the form of a CRISPR/Cas9 FZR1 knockout cell line and a FRET-based AURKA activity biosensor that we have recently generated. We conclude from our studies that FZR1-mediated destruction of AURKA plays no role in the timing of its inactivation during mitotic exit but is critical to suppress interphase activity and function of the kinase. We test this idea by demonstrating that re-establishment of mitochondrial connectivity after mitosis requires suppression of activity of undegraded AURKA.Fig.\u00a0S1)  . We quanFig.\u00a0S1) C,D. We cFig.\u00a0S1) . We furtFig.\u00a0S1) E. The faKO) in U2OS cells generated by CRISPR/Cas9  to study AURKA inactivation in the absence of its destruction at mitotic exit. Indeed, in FZR1KO cells, AURKA\u2013Venus protein levels measured in single-cell degradation assays remained constant after anaphase onset, compared to levels in the the parental U2OS cell line . We found that mitotic exit is in fact slightly accelerated in FZR1KO cells, as previously reported using siRNA-mediated suppression of FZR1 . AURKB was also stabilized but to a lesser extent, consistent with slower degradation of AURKB .We investigated whether AURKA destruction contributes to the fall in kinase activity at mitotic exit. Mitotic AURKA destruction is critically dependent on the FZR1 co-activator of APC/C, so we used a FZR1 knockout . Some sensitivity to inhibitors of AURKB at higher doses indicated that the biosensor might not be completely specific to AURKA  . This finding was not unexpected for a diffusible biosensor, since part of the specificity in substrate phosphorylation by Aurora kinases is proposed to reside in the co-localization of the kinase with its substrates , and when FRET signals were normalized to the anaphase onset value, the inactivation curves were directly superimposable . Because the AURKB sensor is insensitive to MLN8237 at the dose used , we concluded that there is increased AURKA activity in interphase in FZR1KO cells. Consistent with this conclusion, we observed pT288 signal at centrosomes in interphase FZR1KO but not parental U2OS cells . We measured reduced mean mitochondrial lengths in FZR1KO cells , consistent with data showing AURKA to be an upstream regulator of DRP1 . We found no alteration in DRP1 levels in FZR1KO cells . We then tracked individual cells through mitotic exit in the presence of MitoTracker\u2122 stain to label mitochondria. Treatment with MLN8237 interfered with mitochondrial fragmentation at mitosis, as expected from previously published findings  or wild-type (WT) versions of AURKA would show differential effects on mitochondrial dynamics . We usedfindings  Fig.\u00a06CCFig.\u00a0S6.AURKA activity increases in preparation for mitosis in parallel with increases in the protein level, and both progressively drop from anaphase onwards. This has led to the expectation that destruction contributes to regulation of AURKA activity at mitotic exit . In thisKO cells, since there are routes to generating active AURKA that do not depend on autophosphorylation \u2013 for example, through interaction with Nucleophosmin/B23 or TACC3  targeting the first exon of FZR1 were cloned into the AIO-GFP nickase vector, a gift from Steve Jackson  .KO cells have identical DNA content and are mycoplasma-free.U2OS cells were transfected with 2\u2005\u00b5g of plasmid by electroporation using the Neon Transfection System according to the manufacturer's instructions (Thermo Fisher Scientific). 48\u2005h after transfection, cells were sorted based on GFP fluorescence into 96-well plates at a single-cell-per-well density for clonal expansion. Single-cell clones were validated for loss of FZR1 by sequencing the genomic locus, immunoblotting and live-cell imaging of APC/C substrates. We tested that U2OS parental and FZR1KO cells were cultured in DMEM (Thermo Fisher Scientific) supplemented with 10% FBS, 200\u2005\u00b5M GlutaMAX-1 (Thermo Fisher Scientific), 100\u2005U/ml penicillin, 100\u2005\u00b5g/ml streptomycin, and 250\u2005ng/ml fungizone at 37\u00b0C with 5% CO2. For mitotic exit synchronizations, cells were collected in mitosis by treatment for 12 h with 10\u2005\u03bcM STLC  to trigger the spindle assembly checkpoint (SAC) and then released by treatment with 10\u2005\u03bcM AZ3146 , an inhibitor of the SAC kinase Mps1. Cells were synchronized at other cell cycle stages as follows. For G0, cells were starved for 48\u2005h in DMEM without serum. For G1, G0-arrested cells were released into serum-containing medium for 2\u2005h. For G1/S, cells were incubated with medium containing 2\u2005mM thymidine for 16\u2005h, washed with PBS, released into regular medium for 12\u2005h, and then incubated in medium containing 2\u2005mM thymidine for 15\u2005h. S-phase cells were prepared by releasing G1/S phase cells into regular medium minus thymidine for 5\u2005h. To prepare an M-phase cell population, cells were incubated with 10\u2005\u00b5M STLC for 12\u2005h. Mitotic cells were then collected by shake-off.U2OS and FZR1Aurora kinase inhibitors MLN8237 , MK5108 , ZM447439 (Generon) and AZD1152-HPQA (Sigma-Aldrich UK) were used at the doses indicated.RPE-1 cells, and RPE-1 FRT/TO cell lines expressing WT-AURKA\u2013Venus and nd-AURKA\u2013Venus were cultured as previously described .pVenus-N1-AURKA, AURKA-\u039432\u201366  and TPX2The non-targeted AURKB FRET biosensor was a kind gift from Michael Lampson  using the following parameters: pulse voltage 1500\u2005V, pulse width 10\u2005ms, and 2 pulses total on the transfection device, according to the manufacturer's protocol.g for 10\u2005min at 4\u00b0C. For immunoblotting, an equal amount of protein (20\u2005\u03bcg) was loaded into SDS\u2013PAGE 4\u201312% pre-cast gradient gels. Proteins were transferred to Immobilon-P or Immobilon-FL membranes  using an XCell II Blot Module (Thermo Fisher Scientific) according to the manufacturer's instructions. Membranes were blocked in PBS containing 0.1% Tween-20 and 5% bovine serum albumin (BSA) then processed for immunoblotting. Primary antibodies for immunoblot were as follows: anti-AURKA mouse mAb , anti-phospho-Aurora A (Thr288)/Aurora B (Thr232)/Aurora C , rabbit polyclonal anti-TPX2 antibody , anti-Cdh1 mouse mAb , anti-CDC20 mouse mAb , anti-AURKB rabbit polyclonal antibody , mouse monoclonal anti-cyclin B1 , anti-DRP1 rabbit polyclonal , rabbit polyclonal anti-tubulin , mouse mAb anti-vinculin , rabbit anti-GFP . Secondary antibodies used were HRP-conjugated, or IRDye 680RD- or 800CW-conjugated at 1:10,000 dilution for quantitative fluorescence measurements on an Odyssey Fc Dual-Mode Imaging System (LICOR Biosciences). Quantitative immunoblotting was carried out using IRDye 680RD and 800CW fluorescent secondary antibodies, scanned on an Odyssey Imaging System (LI-COR Biosciences).Cells were lysed in 1% Triton X-100, 150\u2005mM NaCl, 10\u2005mM Tris-HCl at pH 7.5, EDTA-free protease inhibitor cocktail (Roche) and PhosSTOP\u2122 inhibitor for phosphatases (Sigma-Aldrich). After 30\u2005min on ice, the lysate was centrifuged at 16,000 4 onto glass coverslips and then fixed with cold 100% methanol (\u221220\u00b0C), permeabilized with 0.5% Triton X-100 in PBS and incubated in 2% BSA, 0.2% Triton X-100 in PBS (blocking buffer) for 1\u2005h at room temperature. Cells were incubated overnight with primary antibodies  diluted in blocking buffer at 4\u00b0C, then washed three times with blocking buffer and incubated with secondary antibodies at 1:1000 dilution. Alexa Fluor 488 anti-mouse and Alexa Fluor 568 anti-rabbit (Thermo Fisher Scientific) were used as the secondary antibodies. DNA was stained with DAPI. Coverslips were mounted with Prolong Gold antifade reagent. Epifluorescence stacks were acquired using 500\u2005nm z step with 2\u00d72 bin using appropriate filter sets and a 40\u00d7 NA 1.3 oil objective. The best in-focus images were selected and integrated intensities were measured using ImageJ .Cells were seeded at 2\u00d7104 onto eight-well plastic-bottom slides  for live-cell imaging. To stain the mitochondria, the cells were incubated with 100\u2005nM MitoTracker\u2122 Red CMXRos  for 15\u2005min, which was then replaced with L-15 medium (Thermo Fisher Scientific) supplemented with FBS. Epifluorescence images were acquired with 40\u00d7 NA 1.3 oil objective on an Olympus IX81 motorized inverted microscope . The automated imaging platform included PE4000 LED illumination source , Retiga R6 CCD camera , motorized stage  and 37\u00b0C incubation chamber , all controlled by Micro-Manager , Optospin filter wheel , CoolSnap MYO CCD camera , automated XY stage  and climate chamber  and controlled using Micro-Manager. FRET imaging was performed using a 40\u00d7 NA 0.95 objective and ECFP/EYFP/mCherry beamsplitter  for ratiometric comparison of CFP and YFP emission upon excitation of CFP. ImageJ software  was used to quantify CFP and YFP signal across the whole cell, and AURKA activity was expressed as CFP/YFP ratio (1/FRET).t-test or Mann\u2013Whitney U-test (non-parametric) as indicated in figure legends. Significant results are indicated as P<0.05 (*), P\u22640.01 (**) or P\u22640.001 (***). Values are stated as the mean\u00b1s.d.Data analyses were performed using GraphPad 6.01 . Results were analysed with a Student's"}
+{"text": "Global environmental pollution has led to human exposure to ultraviolet (UV) radiation due to the damaged ozone layer, thereby increasing the incidence and death rate of skin cancer including both melanoma and non-melanoma. Overexpression and activation of V-akt murine thymoma viral oncogene homolog  and related signaling pathways are major factors contributing to many cancers including lung cancer, esophageal squamous cell carcinoma and skin cancer. Although BRAF inhibitors are used to treat melanoma, further options are needed due to treatment resistance and poor efficacy. Depletion of AKT expression and activation, and related signaling cascades by its inhibitors, decreases the growth of skin cancer and metastasis. Here we have focused the effects of AKT and related signaling (PI3K/AKT/mTOR) pathways by regulators derived from plants and suggest the need for efficient treatment in skin cancer therapy. Skin cancer is one of the most frequent cancers worldwide ,2, with The major environmental risk factors for skin cancer (melanoma and NMSC) include UVA, UVB and UVC ,8. UVC hGenetic mutation of p53, BRAF, RAS, CDKN2A and PTEN, and abnormal expression/activation of T-LAK cell-originated protein kinase (TOPK), mitogen-activated protein kinase kinase (MEK), 90 kDa ribosomal S6 kinase (RSK) and AKT in melanoma and NMSC induce cancer cell signal transduction thereby promoting skin carcinogenesis and cancer cell proliferation, migration and invasion ,12,13,14Strategies for the skin cancer management include surgery, radiation, chemotherapy and cutting-edge targeted therapies ,15. DacaV600E/Cdkn2aNull mice .,17.16,17ull mice . Thus, Ainvasion . The othNumerous phytomedicines derived from natural plant or fruit extracts exhibit anticancer activities against cell proliferation, survival, migration, metastasis and angiogenesis in vitro and in vivo. It has been previously reported that acacetin, isoangustone A, sulforaphane and tryptanthrin inhibited melanoma cell proliferation and tumor growth, and induced cell cycle arrest and apoptosis by directly or indirectly targeting PI3K/AKT/mTOR signaling pathways ,27,28,29The flavonoid 3\u2032-methoxy-3,4\u2032,5,7-tetrahydroxyflavone is derived from Persicaria thunbergii H. and Elaeagnus rhamnoides (L.) with reported anticancer effects on liver, colorectal, breast and lung cancers . In melaC15H24O2-)-octahydro-3-methyl-8-methylene-5-(1-methylethyl)-6h-3a,6-epoxyazulen-6-ol, is a polyphenol compound derived from Curcuma Wenyujin (ethanol fraction), with pharmacological anticancer activities in liver, lung and gastric cancer . CurcumoDiosgenyl alpha-L-rhamnopyranosyl-(1-2)-(beta-L-ara-binofuranosyl-(1-4)-beta-D-glucopyranoside), is a major component of Paris polyphylla and inhibits the growth of gastric and ovarian cancers, and osteosarcoma ,35. Trea2 UVA, 2.9 kJ/m2 UVB) as well as in a SK-MEL-5 cell xenograft mouse model in vivo following topical treatment (100 and 500 nmol) and i.p. injection (0.2 and 1 mg/kg) -2,3-dihydrochromen-4-one is derived from Silybum marianum (L.) and Gaertn. (Asteraceae) and inhibits melanoma and nasopharyngeal carcinoma by the downregulation of MEK/MAPK signaling pathways and PD-L1 expression ,55. SiliThe turmeric flavonoid compound 1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione is a from rhizome of Curcuma longa, regulating breast and bladder cancer development ,59. The \u03b2 together with the expression of related biomarkers including p27, cyclin D1, LC3, 4EBP1, Bax, Bcl-2 and MMPs. A375.S2 cells, which are investigated in studies involving metastasis, chrysin [The viability of human uveal melanoma UM-1 cells was inhibited by treatment with pristimerin, a quinine methide triterpenoid compound derived from Celastraceae and Hippocrateaceae and the apoptosis induction was mediated by disrupting the mitochondrial membrane potential and increasing the ROS production. Furthermore, pristimerin reduced migration and invasion by the regulation of pAKT and pFoxO3a expression with confirming the knock-down of AKT in UM-1 cells . In huma chrysin  and berb chrysin , signifi chrysin .Multisteps of skin carcinogenesis are processed by initiation, promotion and progression . UV is i"}
+{"text": "The traditional narrative that taurine cattle domestication occurred 8500 BC in the Euphrates valley, Syria is critiqued.Domestic cattle are argued to appear later than widely acknowledged in a wide area of Southwest Asia.The \u201cpre-domestic management\u201d of cattle preceded the appearance of a domestic phenotype perhaps prior to 8500 BC.Pre-domestic cattle management as well as early morphologically domestic cattle likely emerged in multiple regions of Southwest Asia rather than in one center.Bos taurus Linnaeus 1758) in prehistoric Southwest (SW) Asia focusing on archaeological and ancient DNA datasets. Although related, the histories of \u201ccattle management\u201d and \u201cdomestic cattle\u201d represent two separate questions. The former refers to a range of techniques including penning, foddering, dairying, mate selection, and selective culling which may vary in intensity, whereas the latter describes biological changes associated with human husbandry, reproductive isolation from progenitors, and selection pressures within an anthropogenic environment  (The dominant narrative describing cattle domestication places its origin within the early farming settlements of the Fertile Crescent region of SW Asia dating to the ninth millennium BC (a period known as the Early Pre-Pottery Neolithic B [PPNB]) ; Table 1PPNB]) .B. taurus Linnaeus 1758) are thought to derive from the extinct aurochs (Bos primigenius Bojanus 1827), subspecies of which inhabited a wide range of habitats across Eurasia and North Africa , which can be traced back to a South Asian population of aurochsen  domestic cattle from (large) wild aurochs at prehistoric sites :360. DemBos exploitation among early sedentary communities in a region where the river valley and adjacent grasslands must have supported a large endemic aurochs population   . Helmer MPPNB) .EPPNB), where Helmer argues morphologically domestic cattle are evident for the first time   .Bos remains are abundant in the earliest levels (PPNA) representing c. 20% of the mammalian remains and they exhibit large body size and a sex distribution reflecting the targeting of female aurochsen\u2014similar to the situation documented in the early layers of Mureybet. This pattern of exploiting morphologically wild females continues into the EPPNB and Bos remains increase dramatically in the subsequent MPPNB where smaller \u201cdomestic\u201d individuals appear for the first time (LPPNB]) followed by continued decrease in cattle size into the PN  have been documented for livestock progenitor species across the Fertile Crescent region in the early Holocene. At Ganj Dareh in Iran and A\u015f\u0131kl\u0131 H\u00f6y\u00fck in central Anatolia, evidence for selective culling patterns, foddering, and onsite penning and use of animal dung indicates that morphologically wild sheep and goats were intensely managed in the ninth millennium BC . These pproto-el\u00e9vage reflecting the husbandry of morphologically wild animals. Scholars working in central Anatolia, the Euphrates basin, the southern Levant, and Cyprus have all suggested that morphologically wild cattle were managed for centuries prior to the appearance of morphological features of the domestic syndrome  which compares archaeological measurements against those of a standard animal\u2014in this case, a cow aurochs from the Mesolithic site of Ullerslev, Denmark  \u00c7atalh\u00f6y\u00fck and K\u00f6\u015fk H\u00f6y\u00fck displaying very different LSI profiles and diminution continuing into the Chalcolithic and Bronze Age.In Central Anatolia, LSI values for nnium BC  and 3. ABos remains from Epipaleolithic, PPNA, EPPNB, and MPPNB sites are broadly comparable in size to Euphrates aurochs\u2014with \u201cmale\u201d and \u201cfemale\u201d LSI means from MPPNB Mishmar Ha-Emeq very similar to those from PPNA Jerf el-Ahmar  in the Upper Euphrates valley, the Upper Tigris valley, and in the Damascus basin. This correlates with regionwide increases in caprine pastoralism, agricultural productivity, and inter-regional connectivity  taking place within the so-called PPNB \u201cinteraction sphere\u201d . Howeverterminus ante quem for pre-domestic cattle management. This leads us to hypothesize that early cattle management was practiced in a variety of forms in early sedentary villages dating to the 10th and early 9th millennia BC (PPNA and EPPNB) and perhaps even extending back into the Younger Dryas (11th millennium BC). Geographically, we hypothesize that diverse, local management traditions emerged in multiple contemporary communities in the upper Euphrates and Tigris valleys, the Jordan Valley, Mediterranean coast, and central Anatolia.Early sedentary food-producing communities of the Fertile Crescent were centers of \u201cexperimental\u201d pre-domestic animal management practices at least as early as the ninth millennium BC . MoreoveBos suggests \u201cdeliberate manipulation\u201d of this population in the PPNA, suggesting that pre-domestic management may have been among the exploitation techniques applied to aurochs at this site.Likely candidates for loci of early management include sites such as Mureybet, Qarassa 3, and Tell Qaramel in Syria, and G\u00f6bekli Tepe, K\u00f6rtik Tepe, and Boncuklu in Anatolia where aurochs remains are abundant . At MureIn central Anatolia, it has been argued that aurochs were hunted prior to the appearance of domestic phenotypes in the mid seventh millennium BC . HoweverIf, as we hypothesize, pre-domestic cattle management was practiced in villages of the PPNA and EPPNB across the Fertile Crescent, why do phenotypic changes only become evident in the eighth millennium? We suggest that the answer is related to the nature of pre-domestic management regimes which may have been small in scale, discontinuously applied, and may not have involved the population isolation necessary to accumulate phenotypic changes associated with the domestication syndrome.Bos management was small at its inception and may have been applied intermittently. It was therefore a complement to, rather than a replacement for, the hunting of aurochs which continued in the region long after the emergence of domestic cattle.As Moreover, it is likely that the goals of early animal management taking place in the context of a hunting economy were not the same as those in later periods. In particular, an emphasis on large males for feasting and display is suggested by demographic profiles at many sites, as well as practices including the caching of cattle remains  and imagery of bulls, which are evident across SW Asia from the 10th through the early 7th millennia BC . A centrIf cattle were managed in PPNA and EPPNB villages, as we hypothesize, what management techniques were applied to pre-domestic livestock and how do we identify them if they coexisted with hunting techniques? Surprisingly, the practices of early cattle management have not been addressed in recent scholarship but were a lively topic in the past. For example, The symbolic importance of aurochs within PPNA settlements has been widely noted . AlthougBos relationships in early sedentary communities.The types of pre-domestic management strategies hypothesized for the 10th and 9th millennia BC, particularly when situated within a mosaic of other exploitation techniques, pose serious challenges in terms of identification and require a renewed and explicit research focus. Exploring the diets and mobility of individual cattle through isotopic analyses and changes in the skeleton associated with penning may provide indicators of human impact on individual animals e.g., . StudiesThe traditional narrative that domestic taurine cattle originated in a few villages in the upper Euphrates valley in northern Syria in the EPPNB is problematic. We argue that this narrative is a mirage based on inconsistent interpretations of biometric evidence for size change and geographically centered models of domestication. Instead, dramatic changes in cattle phenotype including body and horn size are evident in a wide arc including the Upper Euphrates, Upper Tigris, and southern Levant almost a thousand years later (eighth millennium BC).The breakwater points widely identified as the origins of domestic taurine cattle\u2014the EPPNB in Euphrates and its chronological equivalent on Cyprus, the PPNC or PN in the Jordan Valley, and the PN in central Anatolia\u2014are recognized as important inflection points in human\u2013cattle relationships, notably the widespread appearance of new domestic phenotypes, but they do not represent the beginning of close relationships between humans and aurochs which extend temporally in both directions. Rather, we argue that a long history of pre-domestic cattle management preceded the appearance of \u201cdomestic\u201d cattle, whose slow reproductive rates, combined with early herders \u201clearning by doing,\u201d and an apparent preference for the \u201caurochs aesthetic\u201d likely made it necessary for herders to draw from local aurochs populations thereby inhibiting the appearance of domestic phenotypes.proto-el\u00e9vage or pre-domestic management must have emerged in the centuries if not millennia prior to the EPPNB in communities such as Mureybet and G\u00f6bekli Tepe as well as contemporary settlements in the Jordan valley and Mediterranean coast where relationships of hunting slowly transformed into management and management, combined with population isolation, eventually transformed aurochs into cattle. Through the concentration of a suite of high-resolution analyses of archaeological and archaeogenetic material in these periods and places, we predict scholars in the next decade will produce a new chapter in the history of taurine cattle extending out of the Euphrates valley, past evidence for size change, and temporally beyond the PPNB.Instead of focusing on the Euphrates valley in the mid ninth millennium BC, we hypothesize that early cattle management was practiced in many sedentary communities of the PPNA across the Fertile Crescent region. Idiosyncratic and heterogenous systems of vfab015_suppl_Supplementary-MaterialClick here for additional data file."}
+{"text": "To report the long-term efficacy and complications of the augmentation uretero-enterocystoplasty (AUEC), including\u00a0augmentation cystoplasty with simultaneous ureteroplasty and ureteral anti-reflux implantation in a single center.We retrospectively reviewed clinical records, video-urodynamic data, and magnetic resonance urography of 210 patients who underwent the procedure for refractory lower urinary tract dysfunction (LUTD) from 2003 to 2019. International vesicoureteral reflux (VUR) and upper urinary tract dilatation (UUTD) grading systems were applied to assess upper urinary tract function, and post-operative complications were assessed.P\u2009<\u20090.05). VUR improvement rate was 97.7% and postoperative improvement of UUTD presented in 72.5% ureters. Mean serum creatinine (Scr) level was significantly improved compared to preoperative Scr values . The 1.0% patients had unacceptably postoperative urinary incontinence and 85.4% preoperative megaureters were improved. Primary complications included metabolic acidosis (9.5%), vesicoureteral anastomosis stenosis (6.2%), persistent VUR (2.7%), urinary calculi (6.6%), and intestinal dysfunction requiring laparotomy (3.3%).Mean age was 28.1\u00a0years, with a mean follow-up time of 57.4\u00a0months. A total of 338 ureters were simultaneously re-implanted, and ureteroplasty was performed on all ureters. There was a significant postoperative improvement in the bladder capacity, intravesical pressure, and compliance (In the study, a large series of patients treated with a complex surgical procedure was reported. It is novel, as this case series represents patients with aggressive surgical correction of VUR, ureteral tortuosity and upper tract dilation at the time of AC. AUEC was shown to have a positive role in treating patients with refractory LUTD associated with hydronephrosis and ureteral dilatation, stenosis or obstruction, with or without high- or low-pressure VUR. It was effective in improving renal function and protecting the UUT function from further deterioration in most patients with renal insufficiency. Augmentation cystoplasty (AC) was firstly performed in an experimental dog with ileum at the end of 19th century, then it was applied to the patients with neurogenic bladders and small tuberculous bladders . VariousTo improve LUTD and protect kidneys from damage, we performed a surgical procedure that combines AC with simultaneous ureteroplasty and ureteral anti-reflux implantation (UARI), which we called augmentation uretero-enterocystoplasty (AUEC). To describe and analyze the safety and efficacy of the procedure with simultaneous UARI, we carried out the retrospective study.This is a retrospective case series, from the urological surgeons leading by Limin Liao at China Rehabilitation Research Center. After obtaining Institutional Review Board approval from our center, we retrospectively reviewed the medical records of total patients underwent AUEC from 2003 to 2019. Preoperative anti-muscarinic administration and clean intermittent catheterization (CIC) worked poorly in all these patients. Some cases also adopted other therapies. Eight patients (3.8%) failed to manage urinary tract symptoms via botulinum toxin A (BTX-A), five patients (2.4%) underwent sacral neuromodulation, nineteen patients (9.1%) in ureteral stenting, five patients (2.4%) suffered ureteral re-implantation without AC, and 2 patients (1%) underwent somatic-visceral nerve reconnection procedure. Five patients (2.4%) had suffered the unilateral kidney resection. Most patients had decreased bladder capacity, low compliance, high intravesical pressure, and normal or high urethral pressure. All video-urodynamics (VUD) studies, magnetic resonance urography (MRU), and serum creatinine (Scr) levels were analyzed. VUD studies were performed according to Good Urodynamics Practice , 11 and 2O); (2) socially unacceptable urinary incontinence due to DO or severely decreased bladder capacity; (3) high-grade and/or low-pressure VUR with UUT deterioration; (4) high-grade UUTD with UUT deterioration; (5) infective or inflammatory disorders ; or (6) a significant decrease in the Scr level (>\u20091.5\u00a0mg/dL [132.6 umol/l]) after indwelling urethral catheterization in patients with chronic renal failure.To undergo AC, patients had to have at least one of the following conditions: (1) detrusor overactivity (DO) with high intravesical pressure (>\u200940\u00a0cm H2O) during urinary storage phrase or lower bladder compliance (<\u200910\u00a0ml/cm H2O); and (3) high-graded UUTD (grade 3\u20134) according to MRU-UUTD system combined with ureteral tortuosity; (4) vesico-ureteral junction (UVJ) stenosis. The indication for ureteroplasty (ureterolysis and tailoring/shortening) during AUEC included megaureter, severely tortuous ureter, and stenosing ureteric stenosis.The indications for UARI during AC included at least one of the following conditions: (1) high-grade VUR (grade III\u2013V) during urinary storage phrase ; (2) VURAUEC with concomitant unilateral ureter treatment was performed with patients in the supine position Fig.\u00a0. We idenThe ends of the original intestine are anastomosed end-to-end. Anhydrous alcohol was used to deal with the isolated intestinal segment. The segment was detubularized along the border of the mesentery and it was sutured in a \u201cU\u201d (sigmoid)  shape toUrinary bladder was longitudinally incised and megaureters, severe tortuous ureters, or stenosing ureteric stenoses were performed simultaneous ureteroplasty, including ureterolysis and tailoring/shortening. Ureterolysis refers to mobilization and straightening of the ureter. Tailoring refers to shortening the length of the ureter, and reducing the diameter of the megaureters, including ureterolysis and tailoring/shortening. Ureterolysis refers to mobilization and straightening of the ureter. Tailoring refers to shortening the length of the ureter, and reducing the diameter of the megaureters.\u00a0We made a hemi-Kock nipple valve with original ureter, and the plastic ureter was re-implanted on the native bladder or bowel depend on the fibrotic tissue and the thickness of bladder wall, and bladder contracture. Double-J catheters were inserted for postoperative urinary drainage. A suprapubic catheter and two tubes were respectively placed for the postoperative neobladder, intra-abdominal and retropubic drainage. If the Mitrofanoff procedure was acceptable, it can be performed simultaneously.P\u2009<\u20090.05 was considered statistically significant.Quantitative data are presented as the mean\u2009\u00b1\u2009SD. The paired Student's t-test was used to compare preoperative with postoperative values. SPSS 21.0 was used, and a Our study involved 153 males 72.9%) and 57 females (27.1%), and the mean age of these patients was 28.1\u00a0years (range: 4\u201367\u00a0years). The mean duration of their lower urinary tract symptoms was 13.5\u00a0years (range: 1\u201356\u00a0years). The mean follow-up was 57.4\u00a0months (range:1\u2013151\u00a0months). Table .9% and 5P\u2009=\u20090.001), and a significant increase presented in postoperative bladder capacity and compliance compared to preoperative VUD parameters: mean detrusor pressure was decreased from 36.0\u2009\u00b1\u200928.0\u00a0cm H2O to 17.2\u2009\u00b1\u200915.0\u00a0cm H2O (P\u2009=\u20090.0001); mean bladder capacity was increased from 220.8\u2009\u00b1\u2009168.4\u00a0ml to 443.1\u2009\u00b1\u2009161.2\u00a0ml (P\u2009=\u20090.001); and compliance was increased from 8.9\u2009\u00b1\u200911.1\u00a0ml/cmH2O to 42.7\u2009\u00b1\u200962.9\u00a0ml/cmH2O (P\u2009=\u20090.001). Mean intravesical pressure was decreased from 44.1\u2009\u00b1\u200926.3\u00a0cm H2O to 24.5\u2009\u00b1\u200915.8\u00a0cm H2O (P\u2009=\u20090.042).Postoperative detrusor pressure decreased significantly , unchanged UUTD was observed in 66 ureter units (19.5%), and deterioration in 27 ureter units (8.0%).Preoperative VUR was detected in 175 ureter units. According to postoperative VUD, residual VUR was observed in only 4 ureter units (2.3%), and the UARI improvement rate was as high as 97.7% (171 ureter units).P\u2009=\u20090.033). Two (1.0%) patients with preoperative chronic renal insufficiency and required dialysis after 3\u00a0years, and a patient diagnosed with new onset uremia.Fifty-nine LUTD patients reported preoperative chronic renal insufficiency, and 74.6% of them had postoperative improvement according to the latest checkups. Mean Scr level was significantly improved compared to preoperative Scr values  had unacceptably postoperative urinary incontinence. They were treated with artificial urethral sphincter (AUS) implantation after AUEC. Totally 219 preoperative megaureters were observed and they were improved with a rate of 85.4% (187 ureters).2 combining power <\u200922\u00a0mmol/L) accompanied by abnormally increased Scr values and serum chlorine (>\u2009110\u00a0mmol/L). Only 8 (2.2%) cases reported new-onset postoperative metabolic acidosis among them. These patients recovered uneventfully after the oral bicarbonate or infusion administration.Twenty cases (9.5%) developed metabolic acidosis . A postoperative vesicoureteral anastomotic stricture (VUAS) was observed in 14 ureters (4.1%) of 13 patients (6.2%). One of these cases had a large number of inflammatory polyps which obstructed the anastomosis of the bilateral ureteral orifices. Unilateral VUAS in the other 12 cases (3.6%). Among them, VUAS in 9 (2.7%) ureters was residual for incompletely solved obstruction and new onset VUAS in 5 (1.5%) ureters. The treatment included UARI again for 4 cases, the placement of D-J catheters or stents in 9 cases. Finally, VUAS in 12 ureters were improved apparently after above interventions. UUTD persisted for residual VUAS in 2 ureters of 2 cases and percutaneous nephrostomy was performed for.2O. After the treatment with anti-muscarinics and antibiotics or watchful waiting, VUR in 4 ureters solved and VUR in 5 ureters (1.5%) persisted at the final evaluation.There were 9 ureters (2.7%) with VUR within 1\u00a0year after the procedure, including residual VUR in 4 ureters (1.2%) and new-onset VUR in 5 ureters (1.5%). All these VUR was initiated at an intravesical pressure lower than 40\u00a0cm HPreoperatively recurrent symptomatic urinary tract infection (UTI) was reported in 97 (46.2%) cases. Cases suffered postoperative symptomatic UTI is less than 20%, and 3 (1.4%) cases were diagnosed as epididymitis. Urinary calculi occurred to 14 (6.6%) cases, including bladder calculi in 6 cases (2.9%) and ureteral or renal calculi in 8 cases (3.8%). Ten cases were treated with endoscopic lithotripsy or removal and recovered uneventfully, and the other 4 cases were still under watchful waiting.Postoperative intestinal obstruction occurred in 7 (3.3%) cases. They were treated with laparotomy and recovered without any events. Changes in bowel habits were reported in 10 (4.7%) cases, including fecal incontinence in a case (0.5%), diarrhea in 6 (2.9%) cases and improved constipation in 3 (1.4%) cases. Malignancy in neobladder was not detected during follow up.Due to similar proportions of etiology . As a fatal complication, spontaneous bladder perforation was not observed. Avoiding technical error and careful suture and fixation during the procedure was our experience. Although urinary bladder cancer has been reported, we didn\u2019t detect malignancy in these patients . We presWhatever it goes, preoperative estimations for the capacity of CIC and long-term dynamic evaluations are still very important for patients treated with the procedure. In younger patients, CIC is performed by the nurses or their parents. The volume of CIC referred to the maximum bladder capacity from VUD.We reported a large series of patients treated with a complex surgical procedure (AUEC). It is novel, as this case series represents patients with aggressive surgical correction of VUR, ureteral tortuosity and upper tract dilation at the time of AC. The results showed that AUEC procedure is safe and effective for most patients with refractory LUTD associated with hydronephrosis and ureteral dilatation, stenosis or obstruction, with or without high- or low-pressure VUR. It extends the indications for the AC. This technique played a positive role in stabilizing renal function and protecting the UUT function and residue renal function\u00a0from further deterioration in most patients with renal insufficiency."}
+{"text": "Iron deficiency anemia is the leading cause of anemia all over the world.\u00a0Iron deficiency is known to cause reactive thrombocytosis. However, arterial thrombosis secondary to reactive thrombocytosis is a rare entity. In this article, we present a case of a 37-year-old female with recurrent arterial thrombosis due to severe thrombocytosis caused by iron deficiency anemia. The patient developed spleen and kidney infractions, as well as\u00a0abdominal aortic thrombosis. She was subsequently treated with iron and aspirin with an improvement of the anemia and thrombocytosis, with no further thrombotic complications.\u00a0Arterial thrombosis is a very serious condition as the thrombus can embolize to carotid arteries leading to stroke or to peripheral blood vessels causing peripheral ischemia and gangrene.\u00a0Iron deficiency anemia is a reversible cause of thrombocytosis that can be treated very easily to avoid thrombotic complications. Approximately 10 million people in the United States have iron deficiency, and 5 million people have iron deficiency anemia\u00a0. This inA 37-year-old female with fibroid uterus and iron deficiency anemia presented with\u00a0right upper quadrant abdominal pain and one episode of non-bloody, non-bilious emesis. She also complained of chronic fatigue. The patient denied any fever, jaundice, and nausea.\u00a0On examination, the patient was vitally stable with blood pressure 141/82 mmHg, heart rate 97 beats per minute, respiratory rate 16 breaths per minute, oral temperature 36.4 degrees Celsius, and saturating 100% on room air. An abdominal exam elicited tenderness in the right hypochondriac as well as the right lumbar region. No organomegaly, abdominal distension, or mental status changes were noted.\u00a0A year ago, the patient had presented with a similar complaint of left upper quadrant abdominal pain and tenderness. At that time, the CT abdomen showed a 2.1 cm x 1.6 cm hypodense wedge-shaped area in the spleen, likely an infarct  64.0 FL, red cell distribution width (RDW) 36.9%, white blood cell (WBC) count 18.8 x 103/mm3, and platelet count of 1173 x 109/L. Iron studies showed an iron level of <10 ug/dL, an unsaturated iron-binding capacity of 674 ug/dL, and a ferritin level of 4.2 ng/mL, which established the diagnosis of severe iron deficiency anemia. Peripheral blood smear showed elevated platelet count, microcytosis, and hypochromasia  mutations, which came back negative. The treatment plan consisted of 81 mg aspirin and 325 mg ferrous sulfate daily with regular follow-up. Post-discharge, the patient has been following up regularly in the ambulatory clinic and showing gradual improvement in symptoms and laboratory findings. Her last hemoglobin level was 10.1 g/dL, hematocrit 36.1%, WBC count 7.7 x 103/mm3, and platelet count 227 x 109/L. There have been no reports of further thrombotic complications.Our patient presented with fatigue and abdominal pain due to severe iron deficiency anemia from menorrhagic uterine fibroids and had elevated platelet count indicating reactive thrombocytosis. The CT scan detected abdominal aortic thrombus and renal and splenic infarcts, which contributed to her presenting chief complaint of abdominal pain. Iron deficiency causes expansion of megakaryocyte progenitors and increases megakaryocyte differentiation\u00a0, thus reA population-based study by Hung et al. (2015) showed that patients with prior iron deficiency anemia are at an increased risk of venous thromboembolism\u00a0. AccordiArterial thrombosis usually occurs secondary to atherosclerotic plaque rupture. However, thrombus formation in this patient in the absence of atherosclerotic plaque points towards thrombocytosis and increased platelet coagulant activity as a prothrombotic risk factor for arterial thrombosis. In addition to stroke, reactive thrombocytosis secondary to iron deficiency anemia can also lead to peripheral vascular disease and gangrene. Moreover,\u00a0a high risk of venous thromboembolism increases the chances of pulmonary embolism.Our patient\u2019s symptoms improved after aspirin and ferrous sulfate treatment, and there was no life-threatening thrombotic complication. However, this case report points out that iron deficiency is a reversible cause for thrombocytosis and can be regarded as an indirect risk factor for both arterial and venous thromboembolism. Therefore, patients with concomitant anemia and thrombocytosis should be investigated for iron deficiency and should be treated promptly to prevent the development of thrombotic complications."}
+{"text": "To quantify changes in adherence to mask and distancing guidelines in outdoor settings in Philadelphia, PA before and after President Trump announced he was infected with COVID-19.We used Systematic Observation of Masking Adherence and Distancing (SOMAD) to assess mask adherence in parks, playgrounds, and commercial streets in the 10 City Council districts in Philadelphia PA. We compared adherence rates between August and September 2020 and after October 2, 2020.Disparities in mask adherence existed by age group, gender, and race/ethnicity, with females wearing masks correctly more often than males, seniors having higher mask use than other age groups, and Asians having higher adherence than other race/ethnicities. Correct mask use did not increase after the City released additional mask guidance in September but did after Oct 2. Incorrect mask use also decreased, but the percentage not having masks at all was unchanged.Vulnerability of leadership appears to influence population behavior. Public health departments likely need more resources to effectively and persuasively communicate critical safety messages related to COVID-19 transmission. Prior to widespread vaccine availability, the only way to prevent the spread of COVID-19 was by wearing a mask, maintaining a physical distance of at least six feet from others, and frequent handwashing. Multiple modeling studies of the spread of COVID-19 support the importance of wearing masks and maintaining a physical distance from others . One modThe science demonstrating the effectiveness of masking is very strong , yet thiUnderstanding adherence to mask and distancing guidelines may be critical to controlling disease spread in the absence of a vaccine or if a large proposal of the population refuses to accept vaccination. Most studies on adherence rely on either modeling \u20134, documGiven the controversy about mask use, we wondered whether President Trump\u2019s COVID-19 infection might influence adherence to recommendations to wear masks in public settings. We capitalized on our ongoing surveillance of mask wearing in Philadelphia, the city where most of our staff are located, to determine whether adherence changed after the President reported his disease state. Understanding which factors promote better adherence to masking and distancing guidelines is critical for controlling virus spread.https://www.kp-scalresearch.org/somad/).We employed Systematic Observation of Mask Adherence and Distancing (SOMAD), a direct observation tool to document the number of people wearing masks correctly and keeping at least six feet away from others. The reliability of SOMAD was assessed to have less than 10% measurement errors for each variable between two independent observers and less than 1.2% when aggregated by day . , child (3\u201312), teen (13\u201319), adult (20\u201359), and senior (> = 60); gender; apparent race/ethnicity , and mask adherence . Correct mask use was defined as having the mask covering both mouth and nose. Incorrect use was defined as either mouth or nose exposed. We also collected information simultaneously on each person\u2019s physical activity level , mode of transport (on wheels or not), group size , and physical distancing (>6 feet from others or not). At each location observers noted whether there was crowding, defined as having more people than would make it possible to stay at least 6 feet apart from others. All data were entered using a Google form. Given observers did not interact with human subjects, the study was deemed exempt by the RAND IRB.Observations took place between August 11 and August 30, 2020 and between September 23 and October 11, 2020. We compared mask adherence in August and September and after October 2, 2020, the date the President\u2019s COVID-19 infection was made public. Our analysis includes descriptive statistics as well as a Generalized Estimating Equations (GEE) model controlling for all the eight individual variables observed, as well as the setting, population density, percentage of households in poverty in the council district, and the time of the observation.During August 2020 we observed 4606 individuals across the 30 locations. Overall, 43.2% wore it correctly, 16.7% wore it incorrectly, and 40.2% did not wear a mask at all. See . PatternBetween September 23 and October 1, of 2641 people observed, 36.7% did not wear a mask, 44.1% wore it correctly, and 19.2% wore it incorrectly, a non-significant change from August, 2020 (p = .31). However, from October 2 through October 11, of 2473 observed, correct mask use increased to 51.4% while incorrect use dropped to 9.7% (p < .0001). Correct mask use was observed among males (17%), females (16%), younger adults (15%), seniors (18%), whites (24%), and those categorized as Latinx (53%). See .After controlling for individual characteristics, time and setting variables, multiple differences in mask adherence were seen . Across The City of Philadelphia Health Dept engaged in extraordinary efforts to promote mask use throughout the summer and issued additional detailed instructions on appropriate wear on September 15, 2020. In spite of these efforts, increased correct mask use was not seen until after the President\u2019s infection was announced on October 2, 2020.Although this is a serial cross-sectional observational study and the same people were not observed on each occasion, the increase in correct mask wearing appears to be among those who already had masks, because there was virtually no change in the proportion of those without a mask. It\u2019s possible that the news may have instilled increased fear of the disease, resulting in those having masks being more careful in their appropriate use  in public settings. The rise in correct mask use after the President\u2019s COVID-19 infection suggests that the behavior of our leaders has a significant impact on population adherence to public health guidelines.Although the City of Philadelphia did issue guidance about mask adherence, it is likely that this did not receive as much attention as the President\u2019s infections which made headlines in the national news for many days. It\u2019s possible that the prominence of the news was an even more likely trigger for increased adherence.Considering the contagiousness and virulence of COVID-19, the continued lack of mask use among 36% of those observed is concerning. Although outdoor settings are considered lower risk than indoor settings, the spaces observed were all public outdoor areas where people could come into contact with others and be exposed to aerosolized droplets. Even though outdoor settings provide better ventilation when one is not distanced or protected by masks, an increasing amount of time spent in close proximity to others also increases the risk of transmission, even in an outdoor setting .Because the risk of transmission is a function of both dosage and duration of exposure, settings where people spend time, like in parks or playgrounds are places where masks should be worn. Yet people were less likely to wear them in parks than on commercial streets, possibly because they may have more control over distancing in these settings.Meanwhile, important and yet unanswered questions include whether mask wearing in one setting is a good proxy for mask adherence in other areas and whether mask adherence in outdoor settings is its own predictor of transmission risk. Further, it is important to determine whether seeing others without masks establishes a norm or signals that mask adherence is unimportant, factors that could potentially undermine COVID-19 control efforts.The study has several limitations. All the data are based on observations and estimates from trained field staff. Although the methods have high reliability, there may have been some misclassifications. In outdoor settings the risk for transmission of COVID-19 is lower than indoors, so mask adherence in these settings may not predict transmission. We could not know the relationship of people who were not wearing masks and were not distanced from each other. It is possible they lived in the same household and thus the guidelines were not applicable to their situation. This is also an observational study, not a randomized controlled trial, so causal inferences are speculative.Our sample size was based on prior studies using direct observations, where anywhere between 6 to 50 sites , have been selected for direct observations. Each observation hour was expected to allow documentation of at least 60 individuals. We expected that we would need to observe at least 1000 individuals, and this did turn out to be sufficient. The number of locations and sample size was also influenced by the limited manpower available.Although we observed increased adherence after President Trump was infected and not after the City Health Dept issued additional mask adherence guidance, we can only hypothesize that the prominence of the news and the real-life example showing how non-adherence leads to infection is what inspired this change. Certainly, publicity and widespread dissemination of information and guidance has been shown to be a critical predictor of behavior change in many other public health interventions \u201319. PersThere are multiple implications of our findings. The relatively low adherence rates in commercial settings provided a strong rationale for the Dept. of Public Health to act, which they did. However, their resources did not match the avalanche of publicity that accompanied the news of President Trump\u2019s infection. This suggests that local public health agencies need more resources for information campaigns and enforcement activities. Given the multiple sources of misinformation about the pandemic, directing resources to disseminate clear and factual information about prevention is sorely needed. Given that the percentage of persons with no masks remained consistently high even after the President became infected, suggests that even widely disseminated information campaigns may be insufficient to obtain compliance.The need for mask wearing is likely to continue, not only due to variants of COVID-19, like Delta, but also due to the potential emergence of other viruses, given our recent experience with H1NI and MERS just in the past few decades ,22. Addi 7 Jul 2021PONE-D-20-38624Increased Mask Adherence after President Trump Infected with COVID-19PLOS ONEDear Dr. Cohen,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Your manuscript has undergone the peer-review process and the reviewers have provided their comments/suggestions. Kindly address these points/concerns before we make a decision.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Aug 21 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at\u00a0https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Kingston RajiahAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at\u00a0https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and\u00a0https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Thank you for stating the following in the Competing Interests/Financial Disclosure section:\u00a0No (Competing Interests) / This study was supported in part by NHLBI # R01HL145145\u00a0 (PI\u00a0 is DC). The study sponsor played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; and in the decision to submit the article for publication.\u00a0\u00a0https://www.nhlbi.nih.gov/. National Heart Lung Blood Institute\u00a0 \u00a0 \u00a0\u00a0We note that one or more of the authors are employed by a commercial company: RAND Corporation.\u00a0a. Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.Please also include the following statement within your amended Funding Statement.\u00a0\u201cThe funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the \u2018author contributions\u2019 section.\u201dIf your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.\u00a0b. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.\u00a0\u00a0http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and\u00a0 there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: \"This does not alter our adherence to\u00a0 PLOS ONE policies on sharing data and materials.\u201d , and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: 7. Please include your full ethics statement in the \u2018Methods\u2019 section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.\u00a08.We note you have included a table to which you do not refer in the text of your manuscript. Please ensure that you refer to Table 1 in your text; if accepted, production will need this reference to link the reader to the Table.http://journals.plos.org/plosone/s/supporting-information.\u00a09. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: [Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0PartlyReviewer #3:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0I Don't KnowReviewer #3:\u00a0Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The article presents a relevant and innovative theme. Some small adjustments must be made, they are:- Improve the introduction, putting an international panorama on the theme (how is the relation of the use of masks in other countries)?- Improve at the end of the discussion, what are the limitations of the study.- Create a paragraph at the end of the discussion with the practical / clinical implications of your study.- Improve completion by detailing in a topic.Reviewer #2:\u00a0I am pleased to share my comment, for the article entitled: Increased Mask Adherence after President Trump Infected with COVID-19Use the word leader or politicians instead of the names of people in the title.The necessity and importance of the study is not properly explained.Why Philadelphia was studiedWhat is the importance of the study results?Who will benefit from the research results?In the introduction, use more studies and explain the importance of study.The method part should be described step by step and in more detail.How was the correct use of the mask by people examined?Did people know they were being watched by the research team?People are constantly moving and reorienting, how did you measure the appropriate social distance?30 locations, why only parks, playgrounds and shopping streets? Are restaurants, passages  and entertainment centers less important?How can you verify the accuracy of your observations?How many days were the survey days? How many hours were observed each day?Were the weather conditions different between the review days and the days before?Mention study limitations?Conclusions should be based on the findings of the study.What are the benefits of the study for the health system?In the discussion section: in addition to describing the study and its important findings, Compare the findings with other studies and describe the solutions and challenges in this contextReviewer #3:\u00a0Title: appropriateAbstract: appropriate and adequateIntroduction: Authors have indicated the justification to do the study.Methodology: It was not stated the number of adequate sample size for this research. The justification in choosing the location to be observed was not clearly expelled in the methodology. The characteristics of observers in the study were not clearly stated and various background may promotes bias that may affect the findings of the study. It must be addressed as limitation if there is.The SOMAD protocol showing that authors made attempt in standardising the research tool and data collection.Results: appropriateDiscussion: the limitation of the study ie potential bias, limitation on generalisation of the findings were not discussed.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 17 Nov 2021We revised the cover letter to include the funding statement.  Reviewer #1: The article presents a relevant and innovative theme. Some small adjustments must be made, they are:- Improve the introduction, putting an international panorama on the theme (how is the relation of the use of masks in other countries)?We added Brazil as a country where mask adherence has been politicized. - Improve at the end of the discussion, what are the limitations of the study.We added additional limitations.- Create a paragraph at the end of the discussion with the practical / clinical implications of your study.We added this.- Improve completion by detailing in a topic. Not sure what this means, but hope we provided sufficient detail.Reviewer #2: I am pleased to share my comment, for the article entitled: Increased Mask Adherence after President Trump Infected with COVID-19Use the word leader or politicians instead of the names of people in the title. We changed to world leader. The necessity and importance of the study is not properly explained. The importance is due to prevention of spread of a deadly virus. Mask adherence is critical. Countries that have higher adherence have lower case rates. Why Philadelphia was studied. This was a matter of convenience, it is where our staff was located. We had instituted surveillance prior to President Trumps Covid-19 infection. What is the importance of the study results?The findings demonstrate the importance of messaging and media. People paid more attention when President Trump was infected than to health department warnings. Possibly giving examples and making the consequences more real maybe more effective. Who will benefit from the research results?Leaders, public health professionals and health care providers who want to increase adherence to public health guidance. In the introduction, use more studies and explain the importance of study.We added information on the importance of our study, but there are no similar studies that have used direct observation to monitor mask adherence. The method part should be described step by step and in more detail. We expanded. How was the correct use of the mask by people examined?By observation. Correct use was defined as covering both mouth and nose.Did people know they were being watched by the research team? This is unknown. We had no interaction with those being observed. People are constantly moving and reorienting, how did you measure the appropriate social distance?This was a visual estimate.30 locations, why only parks, playgrounds and shopping streets? Are restaurants, passages  and entertainment centers less important?We stuck to outdoor locations for safety of the data collectors. How can you verify the accuracy of your observations? We conducted reliability testing. The results have been published and these are now referenced. How many days were the survey days? How many hours were observed each day?Each site was observed for one hour on the day and time of day over time. Were the weather conditions different between the review days and the days before?Yes, weather follows the seasons and the summer is typically warmer than the fall. Mention study limitations? We added some more limitations. Conclusions should be based on the findings of the study. We agreeWhat are the benefits of the study for the health system?We added a paragraph on the implications. In the discussion section: in addition to describing the study and its important findings, Compare the findings with other studies and describe the solutions and challenges in this context.We are not aware of other published studies that have conducted serial observations of mask adherence. Nevertheless, there are multiple other studies employing direct observation that successfully document behavioral trends.Reviewer #3: Title: appropriateAbstract: appropriate and adequateIntroduction: Authors have indicated the justification to do the study.Methodology: It was not stated the number of adequate sample size for this research. The justification in choosing the location to be observed was not clearly expelled in the methodology. The characteristics of observers in the study were not clearly stated and various background may promotes bias that may affect the findings of the study. It must be addressed as limitation if there is.Because this is an innovative study there were no prior data informing sample size calculations. Our sample size was based on three considerations. First, the number of observation locations was similar to our previous studies of direct observations of human physical activity behavior in built environment. In many of our past studies, we usually selected anywhere between 6 to 50 sites , in a city for direct observations. Second, the number of observed subjects needs to be sufficient to draw inference for the outcome of interest. Since our outcome is a binary random variable in this paper, a total of 1000 or more subjects yielded sufficient power under the regular power setting of 2-sided p<.05 and power>.8 and for a small to medium effect size. As shown in Table 2, in retrospect we did have sufficient statistical power to declare significance for many substantive predictors. Third, the sample size was also constrained by the available manpower we could deploy during the critical study period. We were not able to further increase the number of locations given the available and trained observers. We added this to the limitations. The SOMAD protocol showing that authors made attempt in standardising the research tool and data collection.Results: appropriateDiscussion: the limitation of the study ie potential bias, limitation on generalisation of the findings were not discussed.We expanded the discussion of limitations.Attachmentresponse to reviewers.docxSubmitted filename: Click here for additional data file. 22 Nov 2021PONE-D-20-38624R1Increased Mask Adherence after World Leader Infected with COVID-19PLOS ONEDear Dr. Cohen,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.==============================The reviewer has suggested minor revision. Kindly address the comments==============================plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Jan 06 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.Please include the following items when submitting your revised manuscript:https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Kingston RajiahAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #2:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2:\u00a0I Don't Know**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #2:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #2:\u00a0The title of the study will become more general by changing the form below:Increased Mask Adherence after Important politicians Infected with COVID-19Other corrections appear to have been made.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 26 Nov 2021I changed the title as suggested.AttachmentResponse to reviewersPO.docxSubmitted filename: Click here for additional data file. 2 Dec 2021Increased Mask Adherence after Important Pollitician Infected with COVID-19PONE-D-20-38624R2Dear Dr. Cohen,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Kingston RajiahAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 20 Dec 2021PONE-D-20-38624R2 Increased Mask Adherence after Important Politician Infected with COVID-19 Dear Dr. Cohen:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Kingston Rajiah Academic EditorPLOS ONE"}
+{"text": "For some SARS-CoV-2 survivors, recovery from the acute phase of the infection has been grueling with lingering effects. Many of the symptoms characterized as the post-acute sequelae of COVID-19 (PASC) could have multiple causes or are similarly seen in non-COVID patients. Accurate identification of PASC\u00a0phenotypes will be important to guide future research and help the healthcare system focus its efforts and resources on adequately controlled age- and gender-specific sequelae of a COVID-19 infection.In this retrospective electronic health record (EHR) cohort study, we applied a computational framework for knowledge discovery from clinical data, MLHO, to identify phenotypes that positively associate with a past positive reverse transcription-polymerase chain reaction (RT-PCR) test for COVID-19. We evaluated the post-test phenotypes in two temporal windows at 3\u20136 and 6\u20139\u2009months after the test and by age and gender. Data from longitudinal diagnosis records stored in EHRs from Mass General Brigham in the Boston Metropolitan Area was used for the analyses. Statistical analyses were performed on data from March 2020 to June 2021. Study participants included over 96 thousand patients who had tested positive or negative for COVID-19 and were not hospitalized.We identified 33 phenotypes among different age/gender cohorts or time windows that were positively associated with past SARS-CoV-2 infection. All identified phenotypes were newly recorded in patients\u2019 medical records 2 months or longer after a COVID-19 RT-PCR test in non-hospitalized patients regardless of the test result. Among these phenotypes, a new diagnosis record for anosmia and dysgeusia , alopecia , chest pain , chronic fatigue syndrome , shortness of breath , pneumonia , and type 2 diabetes mellitus  is one of the most significant indicators of a past COVID-19 infection. Additionally, more new phenotypes were found with increased confidence among the cohorts who were younger than 65.The findings of this study confirm many of the post-COVID-19 symptoms and suggest that a variety of new diagnoses, including new diabetes mellitus and neurological disorder diagnoses, are more common among those with a history of COVID-19 than those without the infection. Additionally, more than 63% of PASC phenotypes were observed in patients under 65\u2009years of age, pointing out the importance of vaccination to minimize the risk of debilitating post-acute sequelae of COVID-19 among younger adults.The online version contains supplementary material available at 10.1186/s12916-021-02115-0. The onslaught of the COVID-19 pandemic in the USA and around the world was relentless. For many, recovery from the acute phase of the SARS-CoV-2 infection, the coronavirus that causes COVID-19, may be grueling with a debilitating second act. A collection of persistent physical , psychological , and neurocognitive  symptoms can appear and last for weeks or months in patients after acute COVID-19 . Many ofSo far, a number of studies have been published on PASC \u20137, 9, 10These studies are all case series, focusing only on patients with COVID-19. Additionally, prior PASC studies often focus on patients with severe COVID-19 symptoms after hospitalization. It is unclear whether the identified persistent symptoms hold true among COVID patients not hospitalized. Furthermore, many of the published studies are based on small cohorts  and relied on self-reported outcomes which can embody potential biases due to, for example, exaggeration of symptoms .Pseudomonas infections [There have also been a number of less commonly reported symptoms including ocular inflammation , cardiacfections , persistfections , micro-sfections , and Guifections . A largeWe present the results from a retrospective cohort study of over 97,000 patients with an RT-PCR test for COVID-19 in a Mass General Brigham (MGB) facility. We detected de novo phenotypes that appeared for the first time in EHRs at two temporal windows of 3\u20136 and 6\u20139\u2009months after a COVID-19 test for both COVID-positive and COVID-negative patients. Leveraging MLHO, a computational framework developed for knowledge discovery from electronic health records (EHRs) \u201325 with We utilized longitudinal EHR diagnosis records from all patients who tested for SARS-CoV-2 infection\u2014reverse transcription polymerase chain reaction (RT-PCR)\u2014between March 2020 and June 2021 in a Mass General Brigham (MGB) facility. We limited the patient cohort to those who were alive and not hospitalized. To increase the confidence that a patient in our cohort would likely seek care within MGB in the post-COVID era, we further narrowed the study population to patients who had two diagnosis records, 6\u2009months apart, in our electronic data repositories since 2010. We also excluded patients who had a diagnosis code referring to past COVID-19 but having a negative RT-PCR test in the MGB records due to our inability to approximate the infection date. The use of clinical data in this study was approved by the MGB Institutional Review Board with a waiver of informed consent.To construct the feature space, we utilized EHR diagnoses recorded in the ICD-9 and ICD-10 codes . To represent the phenotypes for the analyses, we mapped the ICD-9/10 diagnosis codes to a unique phenotype code (PheCode) from the phenome-wide association studies (PheWAS) , 29 grouTo robustly identify the phenotypes that are positively associated with a recent positive test for COVID-19, we applied a multivariate temporal approach to classify past RT-PCR test results from the post-test clinical data. The classification algorithm here is not intended for the purpose of classification. Rather, we performed \u201cpostdiction,\u201d which is the \u201cassertion or deduction about something in the past,\u201d  aiming tAll analyses were conducted in R statistical language.p-value  and 95% confidence intervals using a profiled log-likelihood.To increase specificity, we stratified the analyses by age and gender in a nested structure. This resulted in the following strata: (1) all patients, (2) 65 and older, (3) under 65, (4) 65 and older female, (5) 65 and older male, (6) under 65 female, and (7) under 65 male. In addition to stratifying the cohort, we controlled for the age and gender (in gender-agnostic models) of the patient. For the phenotypes identified by MLHO in each stratified model, we trained standard generalized logistic regression models controlling for age and gender and extracted multivariate odds ratios (ORs) along with Due to the known reliability issues of EHR diagnosis records , 34, we From over 397,000 patients who tested for COVID-19 in an MGB facility with a nasal swab, 210,949 met our inclusion/exclusion criteria, including 52,491 patients with positive test results. After applying the approach for keeping records, 96,025 patients remained in our final study cohort, which means 45.71% of the outpatient cohort who tested for the infection at an MGB facility had a new phenotype record in their EHRs 2 months or longer after the RT-PCR test. A total of 22,475 (23.41%) of these patients were positive for the SARS-CoV-2 virus  in eleven phenotypes, which in the overall cohort and/or one or more sub-cohorts associate with a positive past COVID-19 infection. Seven were very high among the entire population in the 3\u20136-month window. Alopecia was identified in all iterations of MLHO between months 3 and 6, in the overall cohort . It was also specifically seen in those younger and older than 65 cohorts and specifically in women both under and over 65. Similarly, a new diagnosis record of non-specific chest pain was indicative of past COVID-19 infection in the 3\u20136-month temporal window  and particularly among people under 65 . Anosmia and dysgeusia were identified in 100% of the MLHO iterations, in the 3\u20136-month window  and continued to be important in the 6\u20139-month window . The phenotype was indicative of past positive COVID-19 in those under 65 and women under 65.Among other identified phenotypes with 97 and higher confidence scores, chronic fatigue syndrome was seen in both the 3\u20136-month window  and the 6\u20139-month window , appearing more prominent in the patients less than 65 and women less than 65. Pneumonia, in the 3\u20136-month window, had a high confidence score among the overall population  and those older than 65 . Shortness of breath had high confidence scores in both the 3\u20136-month window  and the 6\u20139-month window . It also was identified as having a high confidence score among those under 65. Finally, palpitations  type 2 diabetes mellitus  also had high confidence scores both in the 3-6-month window.Several phenotypes had very high scores but only within certain time frames and in certain sub-cohorts, for example, iron deficiency anemia in the 6\u20139-month range for those under 65  and women under 65 . Men under 65 were identified with proteinuria  in the 3\u20136-month range and syncope and collapse  in the 6\u20139-month range.Among other COVID-19-related phenotypes identified as indicators of past COVID-19 infection with a 90 to 96 confidence score were a number of sub-groups. In the 3\u20136-month window, this includes anemia during pregnancy in women under 65, chronic kidney disease in the cohort older than 65 and women over 65, heart failure with preserved ejection fraction in the cohort older than 65, irregular menstrual cycle in women under 65, neurological disorders in those under 65, and rash and other non-specific skin eruptions in men under 65. In the 6\u20139-month range phenotypes, with a confidence score in the 90 to 96 window, this includes anemia of chronic disease in women 65 and older, disorders of the conjunctiva in men under 65, dizziness and lightheadedness in women older than 65, irregular menstrual cycle in the total cohort, sensorineural hearing loss in women greater than 65, and vascular dementias for those older than 65 and women older than 65.We identified 33 phenotypes that were indicative of long COVID among non-hospitalized COVID-19 patients. Phenotypes such as alopecia, anosmia, fatigue, shortness of breath, and chest pain have been well documented as common signs and symptoms of PASC , 35, 36.Interestingly, those aged less than 65 had more new phenotypes identified with greater confidence than the cohorts who were older than 65. Over 63% of the identified long COVID phenotypes were observed in past COVID-19 patients who were under 65\u2009years old. These findings have important implications for younger patients. Despite having not been hospitalized during the acute phase, the symptoms of long COVID are found with high confidence in this younger cohort population. This gives another reason for young patients to opt for having the vaccination since the long-term effects of the disease are clearly not limited to older patients. While the precise biological causes of the sequelae are still unknown and under investigation, the enrichment of these diagnoses among younger cohorts may indicate that the robustness of the immune response in these patients is driving some of the post-COVID sequelae. However, these results should be understood and qualified in the context that, on average, younger patients who are often healthier than 65 and older have fewer interactions with healthcare systems (and thus fewer diagnosis records), which may lead to greater ease in detecting a signal in this younger cohort compared to an older cohort.While the chart review\u2019s primary purpose was to determine if the clinical notes were in agreement with the ICD-9/10 labels, the reviewer also noted that physicians consistently attributed two of the phenotypes  to a previous history of COVID-19, whereas the physicians\u2019 notes did not specifically identify a connection between the phenotype and the previous infection for most of the other phenotypes, even those with high confidence like type 2 diabetes or non-specific chest pain. Our model indicates that even if these phenotypes are not explicitly identified or recognized by the clinician and patient at the individual level, many of these unrecognized phenotypes still have a high confidence score. While an ICD code on its own does not specify the time of onset, the chart review helped to confirm that the presented phenotypes were likely new since COVID-19. The majority of charts reviewed for each phenotype suggest that the symptoms or the diagnosis occurred after COVID-19. Our model identifies the relationships between COVID and a phenotype, where a healthcare provider and patient may otherwise miss that relationship.Several neurological phenotypes  were frequently diagnosed after COVID and appear to have an increased association with the infection. The neurological disorder phenotype includes several ICD codes, and in a random sampling of patients with this phenotype, the majority had the ICD code \u201cR41.89\u2014other symptoms and signs involving cognitive function and awareness.\u201d Collectively, these phenotypes suggest ongoing cognitive dysfunction. The earliest reports of acute COVID, such as Mao\u2019s retrospective analysis of 214 hospitalized patients in China, described neurological manifestations, including cerebrovascular complications, in nearly half of those with severe disease . Since tAnother important phenotype identified was type 2 diabetes. Several studies have pointed out possible pathophysiological relationships between COVID-19 and diabetes , 42. AndThe disease of the nail phenotype includes a variety of diagnoses including leukonychia, onycholysis, onychomadesis, Mees\u2019 lines, Muehrcke\u2019s lines, and Beau\u2019s lines all of which are markers of overall well-being and have been associated with infections and renal or hepatic dysfunction previously. Beau\u2019s lines have specifically been associated with COVID-19 infections , 44. OurProteinuria was also identified as having an association with COVID-19 among male patients less than 65. COVID-19 has previously been associated with acute kidney injury , and prop-value between 0.01 and 0.001) would have been dropped in a linear univariate PheWAS after p-value correction for multiple hypotheses. Two examples of such phenotypes are palpitations and non-specific chest pain, both of which have previously been described as common symptoms of PASC [The MLHO framework appears to be more powerful than univariate PheWAS. A small number of phenotypes that had a relatively high unadjusted statistical significance , MLHO\u2019s computational algorithms avoid a flood of false-positive discoveries while offering a more robust probabilistic approach than the standard PheWAS. We were able to evaluate over 1600 phenotypes and identify a small number of phenotypes (with confidence scores) that associate with a past COVID-19 infection. As a result, and along with the inclusion of COVID-negative patients, this study rules out some of the phenotype associations, which were previously identified through poorly controlled observational data, such as cutaneous eruptions outside of nail changes and alopecia.We acknowledge that this study\u2019s findings may present limitations due to the use of only diagnosis codes, which can result in missing signs and symptoms that are in clinical notes and laboratory results. In addition, given the intensity of the pandemic and spread of misinformation, EHR data may represent confirmatory bias between providers and patients. Replicating this study in other institutions would help elucidate if the clinical phenotypes seen at MGB reflect true characteristics of PASC or local healthcare utilization patterns. Additionally, we only included diagnoses that were used for the first time at least 2 months after the COVID-positive PCR date. This may have led to some missed diagnoses that began within 2 months of the start of the acute phase; however, it helps ensure that the new diagnoses detected were not related to the acute phase. Future studies can consider modifying this time buffer; however, there will remain a trade-off between capturing all subsequent diagnoses and increasing the confidence that the diagnoses are not part of the acute phase of the illness. Finally, we have excluded hospitalized COVID-19 patients. On the one hand, it would be difficult to match hospitalized coronavirus patients during the COVID era with non-COVID hospitalized patients. On the other hand, the post-COVID syndrome can still be observed in patients who were never hospitalized , 48\u201352. The COVID-19 pandemic in the USA raged nearly uncontrolled in 2020. While the exact number of people afflicted by the post-acute sequelae of SARS-CoV-2 infection is unknown, it represents a significant public health burden because of the large magnitude of the COVID-19 spread globally. We identified 33 phenotypes that were indicative of long COVID among non-hospitalized COVID-19 patients. Our understanding of COVID-19 and its chronic sequelae is evolving, and new risks are unknown. We do not know who might develop the post-COVID syndrome, how long the symptoms last, and whether COVID-19 prompts the presentation of chronic diseases. Accurate identification of phenotypes will be important to guide future research and the healthcare system to focus its efforts and resources on adequately controlled age- and gender-specific sequelae of a COVID-19 infection. The ever-increasing adoption and magnitude of clinical data stored in EHR repositories over the past decade provide exceptional opportunities for instrumenting healthcare systems to study evolving pandemic byproducts. EHR data offer a unique opportunity to understand the post-acute effects that can follow SARS-CoV-2 infection.Additional file 1: Figure S1. Schema for counting diagnosis records in the cases and controls. Figure S2. Patient population selection. Table S1. Demographic characteristics of the study cohort. Table S2. Manual chart review of the 42 phenotypes identified by MHLO. Table S3. Multivariate ORs for PASC phenotypes [enotypes \u201360."}
+{"text": "Here, we present newly acquired magnetic and deep wide-angle seismic data that require a fundamental re-evaluation of these concepts. The new data clearly define the onset of oceanic crust in the Enderby Basin and off southern Sri Lanka, and date its formation with unprecedented confidence. The revised timing indicates that India and Sri Lanka detached from Antarctica earlier in the east than in the west. Furthermore, no compelling evidence for an extinct spreading axis is found in the Enderby Basin. A refined plate motion model indicates that India and Sri Lanka departed from Antarctica without major rift jumps, but by the action of three spreading ridges with different timings and velocities that must have been accommodated by significant intracontinental deformation.Plate kinematic models propose that India and Sri Lanka (INDSRI) separated from Antarctica by extremely slow seafloor spreading that started in early Cretaceous times, and that a long-distance ridge jump left a continental fragment stranded off the Antarctic margin under the Southern Kerguelen Plateau  Models using these identifications currently feature two phases of separation. The first phase starts around 136 Ma (chron M11) at a mid-ocean ridge in the Enderby Basin3. This starting mid-ocean ridge is framed by the continental margins of East Antarctica in the south, and of Elan Bank and southern Kerguelen Plateau (SKP) in the north  large igneous province at the northern margin of the abandoned Enderby Basin in the Antarctic plate  lie embedded in the ocean floor that formed by the divergence of the Indian and Antarctic plates. The Mesozoic seafloor spreading isochrons on which the two-phase model is based are derived from widely spaced and unevenly distributed ship-borne data2. Another set of constraints, the locations of the onset of oceanic crust off INDSRI and East Antarctica, are similarly controversial because they are not constrained by any deep seismic data. Previously, dense aeromagnetic data9 were collected off western Enderby Land  and its conjugate region off East India11, Fig. Starting at 83\u00b0E in the Princess Elizabeth Trough (PET), the deep seismic line 20070200 images the onset of 7 km-thick oceanic crust at km 365 Fig. c. The ol12. Towards the south, the model shows an approximately 230 km-wide zone of transitional crust (km 470 to km 700 ). Continental crust is present south of profile km 700   in East Antarctica Fig. 1\u20133,15,1615. These new findings make it necessary to revise kinematic models for INDSRI breakup. Figure The new seismic wide-angle data along all three profiles confidently locate the onsets of oceanic crust off the rifted margins. The profiles in the Enderby Basin image as much as 160 km more oceanic crust than assumed for, and implied by, two-phase models of regional plate motions. Moreover, our dense helicopter magnetic data in the basin allow strongly different and more confident identifications of magnetic reversal isochrons than used in those models16. Breakup at the PAP was accompanied by eruption of the Bunbury Basalts in SW Australia , thin (4\u20137 km) oceanic crust formed at slow (40\u201360 km/Myr) rates in PET  and seaward dipping basalt flows below the Bangladesh plains24. Our data thus support previous suggestions23 that the Kerguelen plume did not trigger INDSRI breakup.In the next phase of INDSRI\u2019s northward drift, the Kerguelen Plume started to interact with the spreading centres off Enderby Land. Around 130 Ma (chron M4), both the PET and PB seismic transects Fig.  reveal t2. We note that previous suggestions of continental velocities under Elan Bank were based on wide-angle data from a profile oriented oblique to the proposed continent-ocean boundary, with receivers that were too-widely spaced to determine a reliable seismic velocity profile across the Elan Bank margins8. The geochemically-estimated 5% contamination of SKP lavas by continental material25 may be more simply explained by incorporation of Gondwana lithospheric material into the plume source from the Antarctic margin just 70 km further south26 than by intrusion of plume melt into a continental SKP.For times younger than chron M4, our kinematic model differs strongly from most previous scenarios in not featuring a second phase of spreading that starts with a northward ridge jump. This is firstly because our deep seismic data do not support the presence of a sliver of detached continental crust where they cross onto the SKP Fig. a. Second9. These rates are, in turn, comparable to the rate of northward propagation in Kerguelen LIP eruption ages (40\u201350 km/Myr)23 that record the Indian plate\u2019s northwards progress over the underlying mantle. The arrival of the KP mantle plume thus seems to have ushered in a phase of continuous and consistently moderately-fast northward motion of a single Indian plate.Extrapolation of the late-CNS full spreading rates of\u2009~\u200960 km/Myr south of Sri Lanka suggests that the INDSRI-Antarctic mid-ocean ridge system had only propagated to the LHB sector at the western end of the ANT-INDSRI plate boundary by\u2009~\u2009112 Ma Fig. . SimilarIn summary, our new data provide new constraints on the timing and geometry of early INDSRI-Antarctica plate divergence. The contrasting spreading rates at mid-ocean ridges in the PB and PET sectors imply intracontinental deformation of India and/or Antarctica that in turn makes it possible to reunite the revised continent-ocean boundary locations much more tightly than in the previous two-phase models. This intracontinental relative motion, on the order of 100\u2013155 km, now remains to be proved independently Fig. . Finally27. These were processed together with the remaining 130,330 km of legacy data downloaded from the NCEI (formerly NGDC) trackline database (https://maps.ngdc.noaa.gov/viewers/geophysics/). All processing was completed using tools in Seequent\u2019s Geosoft Oasis Montaj software (URL: https://www.seequent.com/products-solutions/geosoft-oasis-montaj/).The magnetic anomaly grid in Fig. The magnetic field data were generated over a period of six decades by multiple institutions and working groups using a wide range of equipment and acquisition parameters and procedures, and have experienced differing processing histories. It would be prohibitively difficult or impossible to reconstruct these details with the intention of accounting for them by reprocessing. It can be assumed that the data have not undergone meaningful diurnal correction because of the long distances to land, where any base station magnetometer or observatories could be deployed to generate the necessary data. The effects of all this are evident at 1528 cross-point, at which errors reach values as large as 733 nT with a mean value of 185 nT and standard deviation (\ufeff\u03c3) of 143 nT. From this it is evident that the profiles must be brought to a common level before gridding for visual interpretation.28 (http://www.geomag.org/models/MF7.html). For each track segment in the ship-based data set, we calculated the along-track differences to MF7. We filtered these differences at lengths less than or equal to the resolution of MF7 using a simple Gaussian filter, and then subtracted the filtered along-track difference from the measured along-track field variation. The effect of this is to replace long wavelengths in the measured data with those of the MF7 field. The choice of Gaussian filter is made on the basis of a trade-off between the self-consistency and waning power of MF7 at wavelengths decreasing towards its cutoff at 300 km, and the retained power but relative inconsistency of ship-track data at wavelengths increasing towards the cutoff. Guided by cross-over error analyses of the adjusted data  and visual assessment of grids calculated from them, we chose a Gaussian filter of 180 km length. In practice, this means that the magnetic anomaly grid in Fig. Because of the lack of any obvious population of tracks with mutually-consistent long-wavelength components to anchor the levelling process, we levelled the data to MF7. MF7 is a long-wavelength (>\u2009300 km) representation of the lithospheric magnetic anomaly field, based on data from the 2007\u20132010 CHAMP satellite missionModMag software32. A 0.5 km-thick magnetized layer was assumed with its top surface at the present seafloor. Its magnetization was fixed to 5 A/m. The mean latitude of the two profiles off East Antarctica during the formation of the initial ocean crust was assumed at 70\u00b0 S. The inclination of the Early Cretaceous magnetic field was set to \u2212\u200967\u00b0 in PB and \u2212\u200972.6\u00b0 in PET, and its declination to \u2212\u200969.6\u00b0 in PB and \u2212\u200973\u00b0 in PET. We assumed symmetrical spreading at all times for calculating the full spreading rates given in the text.For the modelling of the seafloor spreading anomalies/velocities, we used a modified version of the The three seismic P-wave velocity models presented in this paper are based on data acquired during three different scientific cruises , and partially also with OBHs (ocean bottom hydrophones) or land stations on Sri Lanka  were relocalized using direct wave arrivals. The source-receiver ranges were calculated and written into the segy header.zp . A bandpass filter of 4\u201315 Hz and AGCs of 0.7\u20131 s was applied for picking the first arrivals of different phases. The picked refracted and reflected phases were identified based on their amplitudes, curvatures, and velocities.Refracted and reflected P-wave arrivals were picked with the software rayinvr30 and the graphical interface PRay31. By forward modelling, the travel times were fitted with a top to bottom approach. MCS data were used to constrain sedimentary layering and the top basement surface for the P-wave velocity starting model. For the profile south of Sri Lanka, along which no coincident MCS data were gathered, the basement topography was extracted from the OBS data alone. Seismic velocities in the sedimentary and crustal layers were calculated from relevant phases in the seismic refraction data. Layer boundaries were based on picked reflections within the seismic refraction and MCS data. All this information was incorporated into the seismic velocity-depth models. One example of a seismic record section with picks and computed travel times for each profile is shown in Supplementary Figures 12 and continental crust35. This is the usual approach to define crustal-type boundaries in seismic refraction models.For all three models presented here, P-wave velocity-depth modelling was carried out with the forward modelling software 2 values for the three P-wave velocity models. The assigned pick uncertainties for the different phases increase with depth (Supplementary Table 2 value for the models ranges between 0.8 and 0.9, which is close to the ideal value of 1. The ray coverage and the travel time picks and computed travel times are shown in Supplementary Figures Supplementary Table Supplementary Information."}
+{"text": "It is revealed that in the Co/BiFeO3 heterostructure excited by femtosecond laser pulses, the magnetization precession amplitude follows a sinusoidal dependence on the laser polarization direction. This nonthermal control of coherent magnetization rotation is attributed to the optical rectification effect in the BiFeO3 layer, which yields a FE polarization depending on the light polarization, and the subsequent modulation of magnetic energy in Co by the electrostriction\u2010induced strain. This work demonstrates an effective route to nonthermally manipulate the ultrafast magnetization dynamics in metallic ferromagnets.Coherent optical control of the magnetization in ferromagnetic (FM) mediums using ultrafast nonthermal effect paves a promising avenue to improve the speed and repetition rate of the magnetization manipulation. Whereas previously, only heat\u2010induced or helicity\u2010dependent magnetization dynamics are demonstrated in metallic ferromagnets. Here, the linearly\u2010polarized light control of magnetization is demonstrated in FM Co coupled with ferroelectric (FE) BiFeO 3. The laser irradiation on the Co/BiFeO3 heterostructure leads to a sinusoidal dependence of ultrafast magnetic torque impinged upon the magnetization precession on the light polarization direction.A new strategy of ultrafast nonthermal control of magnetization is adopted by coupling the metallic ferromagnet with the ferroelectric material. It utilizes the advantages of pronounced optical rectification effect and ferroelastic response in BiFeO The magnetization dynamics induced by the non\u2010thermal optical effect usually show a strong dependence on the pump light polarization.Nonthermal optical stimulation of coherent magnetization dynamics has great value for fast\u2010speed information storage devices employing the magnetic medium owing to its negligible heat accumulation and high repetition rate.3, 4 and it can also induce the optical spin transfer torque as a result of the injection of spin\u2010polarized carriers in the ferromagnetic (FM) semiconductor involving the photon absorption. For these effects, the left\u2010handed and right\u2010handed circular\u2010polarized light pulses trigger transient magnetic moments or spin\u2010polarized electrons with opposite orientations. The non\u2010thermal excitation mechanisms correlated with the linearly polarized light interactions include the photoinduced magnetic anisotropy effect and the inverse Cotton\u2013Mouton effect, which exist mainly in the insulating magnetic oxides where the optically stimulated magnetization dynamics changes its phase or magnitude upon tuning the pump polarization direction.The circularly\u2010polarized light excitation can cause the inverse Faraday effect related to the impulsive stimulated Raman magnetic scattering independent of photon absorption,6, 7 it is remained to be demonstrated how to coherently control magnetization in the FM metals using the linearly polarized light. To this end, we propose to adopt a strategy of ultrafast nonthermal control of magnetization in FM metal Co coupled with the ferroelectric (FE) material BiFeO3 by taking into account the advantages of pronounced optical rectification effect (ORE) and ferroelastic response in BiFeO3. When the FE is under intense illumination, the second\u2010order optical response combined with a linear term is well known to induce an extra FE polarization, and this FE polarization can consequently generate electrostriction in the system to modulate the magnetic energy of Co, depending on the light polarization direction.Although the circular\u2010polarized femtosecond laser pulses can be used to nonthermally excite and coherently control the spin dynamics in FM metals via the inverse Faraday effect,22 it 3 crystals. It was also found that the BiFeO3 crystal exhibits a pronounced photostriction effect under linearly polarized light illumination, and its elongation critically relies on the polarization direction. In this case, the photostriction effect can be understood as the superposition of photovoltaic and converse piezoelectric effects. Recently, it was further demonstrated that the strain characteristics of the FE BiFeO3 impinged by the photostriction effect can modulate magnetic anisotropy of the adjacent FM Ni layer in a Ni/BiFeO3 heterostructure. This result confirms the scientific feasibility of the FM\u2010FE coupling system using the optical modulation scenario. However, until now, the magnetic dynamics response in FM\u2010FE systems by the light\u2010induced photostriction effect has been elusive.Actually, the photovoltaic response, induced by the ORE, depending on the light polarization direction was already observed in bulk rhombohedral FE BiFeOcrystals.23 It 3 by using linearly polarized femtosecond laser excitation. We utilized the time\u2010resolved magneto\u2010optical Kerr effect (TRMOKE) to monitor the excited spin precession in the FM Co layer coupled with the FE BiFeO3 for different pump laser polarizations. It was found that the amplitude of magnetization precession with the linear polarization (\u03b2E) of pump laser pulse follows a sinusoidal profile with a periodicity of 180o. In contrast, the magnetization precession amplitude in the pure Co film has no such angular dependence. We also measured the ultrafast laser\u2010induced dynamics of the single BiFeO3 film and thereby obtained its light\u2010induced transient FE polarization. Actually, these FE polarization\u2010related signals also appear in the Co/BiFeO3 bilayer, and they both display a sinusoidal dependence on \u03b2E, which is in agreement with the deduction from the ORE. We thus believe that the nonthermal optical control of the magnetization precession in Co/BiFeO3 originates from the FE layer BiFeO3 due to its photostriction effect.In this paper, we have demonstrated the ultrafast nonthermal control of the magnetization precession dynamics in Co/BiFeO22.1Figure\u00a03 heterostructure, the ORE in BiFeO3 first leads to the direct current (dc) polarization that depends on both the polarization of pump light and its spontaneous FE polarization, and the subsequent electrostriction effect causes the strain in the bilayer. This strain modulates the magnetic anisotropy in the Co layer, resulting in the various modulation of its magnetization precession for the different light polarization. Such scenario describes a linear polarization\u2010dependent magnetization precession excitation in FM metals, which may represent a promising route for ultrafast nonthermal control of magnetization in conventional FM materials.As illustrated in 2.23 bilayer used in this study was grown on (001) oriented Nb\u2010doped single crystal SrTiO3 (STO) substrate . From the XRD measurements, the BiFeO3 has a tetragonal\u2010like single crystalline structure . The probe laser pulses of 800\u00a0nm with p\u2010polarization are incident at a 45\u00b0 oblique angle and undergo the transient polarization rotation (\u03b8K) upon reflecting from the sample. A vector magnetic field is within the sample surface along a certain direction (\u03b8H). The sample surface is placed in the vertical x\u2010\u2010y plane and the surface normal parallel along [001] is defined as the z axis. The TRMOKE system was also used to measure the \u03b8K related to the pump pulse induced transient FE polarization and the resultant strain in the Co/BiFeO3 bilayer and the pure BiFeO3 film. Detailed TRMOKE experimental information can be found in the Experimental Section.The Co/BiFeO2.33, we measured the magnetization dynamics excited by an s\u2010polarized pump laser for different magnetic field orientations (\u03b8H) and strength to obtain the field impact on the magnetization precession excitation. From Figure\u00a0\u03b8K signals, corresponding to the uniform spin precessions excited in Co, strongly depend on \u03b8H. The precession amplitudes display a large variation with \u03b8H, and the precession phases switch 180\u00b0 for varying \u03b8H. With increasing field strength, the precession amplitudes first increase and then decrease, whereas the precession phases keep unchanged, even for opposite \u03b8H  + H2cos(2\u03b8M) and H\u03b2 = 4s\u03c0M + H4[2 \u2212 cos2(2\u03b8M)]/2 \u2212 H2sin2(\u03b8M), and \u03b3 is the gyromagnetic ratio (1.8\u00a0\u00d7\u00a0107\u00a0Hz/Oe for Co),\u00a0\u03b8M denotes the orientation angle of the magnetization in the Co layer with respect to the x axis. MS represents the saturated magnetization, and H2\u00a0=\u00a020 Oe\u00a0and\u00a0H4\u00a0=\u00a040 Oe\u00a0denotes the two and four\u2010fold anisotropy fields, respectively.The measured precession frequency with \u03b8H\u00a0=\u00a045o actually coincides with the direction of the external field applied along the [110] of the BiFeO3 layer during the sputtering of the Co layer. This indicates the importance of the in situ magnetic field during the growth for forming the cubic magnetic anisotropy in the Co layer, although it is not in a perfect single crystalline structure because of the lattice mismatch between the two layers. The emergence of the uniaxial magnetic anisotropy is likely due to the presence of a net spontaneous FE polarization in BiFeO3 along the y//[010] direction. This FE polarization component yields a strain along the [010] axis to make it as the uniaxial hard axis. Such in\u2010plane FE polarization was actually observed in BiFeO3 films with tetragonal\u2010like structures.The cubic magnetic easy axis along 2.4\u03b2E) dependent measurements were then performed at \u03b8H\u00a0=\u00a0120o and H\u00a0=\u00a01.5\u00a0kOe. Figure\u00a0\u03b2E, from which we can see an apparent difference in precession amplitude. Here, we should emphasize the constant pump fluence when rotating the half\u2010wave plate to tune \u03b2E. To get a deep insight into the relationship of the amplitude with \u03b2E, we fitted each \u03b8K(t) curve with the function ofA, f, \u03c6, and \u03c4 represent the amplitude, frequency, initial phase, and lifetime of the precession, respectively. B denotes the long\u2010lived dc signal.The linear pump polarization \u03b2E depende\u03b2E in the range of 360o. It clearly displays a sinusoidal oscillation with a period of 180o. The amplitude extrema appears for s or p\u2010polarized pump light. In addition, we note that the long\u2010lived dc signal (B) also has a sinusoidal variation with the same period of 180o, but it exhibits a phase difference of 45\u00b0 compared to the precession amplitude variation  on Nb(001)SrTiO3 for different \u03b2E. Roughly, the \u03b8K signals show a fast rising within 1\u00a0ps and then a fast decay at the time scale of 10\u00a0ps followed by a very slow decay of several hundred ps  at \u22480.2\u00a0ps . These small peak II signals are not present in Co/BiFeO3 is possibly due to the much weaker third\u2010order nonlinear optical response, because of the attenuation of light by the Co layer and the obscuration by the ultrafast demagnetization signals.In addition to this peak (peak I) at \u22480.5\u00a0ps, we note in the pure BiFeOs Figure\u00a0, which ps Figure\u00a0. The pea3 can stimulate a new macroscopic electric polarization described as follows:\u03b50 is the vacuum dielectric constant, \u03c7(3) and \u03c7(2) are the fourth\u2010 and third\u2010 susceptibility tensors of BiFeO3, respectively, E\u03c9(t) and E\u03c9\u2217(t) denote the laser fields, P denotes the spontaneous FE polarization, and P0(2) represents the direct current term of light\u2010induced polarization, in accordance with the ORE, while P2\u03c9(2)(t) represents the contribution to the second harmonic generation.An intensive laser pulse propagating in the FE BiFeO follows:39 due to the ORE. In the case of an in\u2010plane spontaneous polarization vector Py, P0(2) is expressed as:\u03b2E in the form of cos2\u03b2E or sin2\u03b2E. A similar result can be obtained for the case of Px. Whereas for the spontaneous polarization vector Pz, the in\u2010plane P0(2) component is zero and the out\u2010of\u2010plane P0(2) has no dependence of \u03b2E.According to the tetragonal crystal symmetry of BiFeOs Figure\u00a0, we can \u03b2E with the period of 180o in the presence of an in\u2010plane spontaneous FE polarization, in line with the corresponding \u03b8K peak values shown in Figures\u00a0s\u2010polarized probe light, yielding the \u03b8K signals. From Equations\u00a0\u03b2E=45o and 135o. Such \u03b2E values thus should correspond to the largest modulation of the probe light polarization, which actually explains the observed \u03b8K extrema at \u03b2E=45o and 135o. For the pure BiFeO3 film, the \u03b8K signals are all positive is likely due to the superposition of the contribution from the modulated spontaneous polarization independent of \u03b2E. Whereas for the Co/BiFeO3 bilayer, the ultrafast demagnetization signal from Co is further superimposed, thus affecting the sign of \u03b8K signals.The above calculations show that the ORE\u2010induced FE polarization has a sinusoidal dependence on 3 causes the strain in the bilayer system. This strain modulates the magnetic anisotropy in the Co layer and provides an extra magnetic torque, in addition to the demagnetization related torque as a result of the heating effect, to drive the magnetization rotation followed by the periodic precession after the torque is nearly vanished. However, in contrast to the FE polarization induced \u03b8K, the largest precession amplitude must appear when the magnetic energy difference between the local easy axis along 135o and the hard axis along 90o has the strongest modulation. This is because the magnetization is in a canted geometry as a consequence of the noncollinear alignment of the magnetic anisotropy fields and applied field when the latter is along \u03b8H\u00a0=\u00a0120o, and the strongest magnetic torque resulting in the largest precession amplitude is generated when the anisotropy fields undergo the strongest modulation. As mentioned above in the\u00a0Section\u00a03 owing to the strain along the [010] axis caused by the spontaneous FE polarization. From Equation\u00a0\u03b2E=0o or 90o. As a consequence, the uniaxial magnetic anisotropy may be modulated at the largest scale and the precession amplitude presents extrema at these \u03b2E values, as shown in Figure\u00a0\u03b8K peak with \u03b2E exhibit 45o phase shift.As described at the beginning of the results section, in the presence of light\u2010induced FE polarization, the electrostriction effect in the BiFeO\u03b2E. Actually, it was found in BiFeO3 film that the ORE\u2010induced strain affects the coherent acoustic phonons mainly within 50\u00a0ps. Nevertheless, we still observe a small long\u2010lived dc signal with the sinusoidal variation with \u03b2E, presenting opposite phase with that of the peak \u03b8K signal, as shown in Figures\u00a0\u03b8K as compared to that induced by the transient FE polarization. Furthermore, based on the overall shape and phase correlation between the \u03b2E dependences of precession relaxation time \u03c4 and the transient FE polarization and long\u2010lived dc signals, we infer that the damping of magnetization precession is affected by the residual strain proportional to the transient FE polarization.Although the modulated FE polarization plays an important role in generating the strain\u2010related transient anisotropy fields to trigger the magnetization precessions, it greatly attenuates within a few picoseconds as shown in Figure\u00a0 We believe that the relatively smaller nonthermal origin stems from the weak magnetic anisotropy relevant to the FE polarization as a result of the nonperfect single crystalline structure of the Co film and the existence of multidomain FE state in BiFeO3. We anticipate that the nonthermal modulation of the magnetization dynamics can be greatly enlarged in samples with the improved crystallinity and single domain structure of large in\u2010plane FE polarization. Actually, the helicity\u2010dependent magnetization modulation is much weaker compared to the heat\u2010driven demagnetization in the pure metallic ferromagnet under laser excitation. The deterministic magnetization reversal due to the inverse Faraday effect reported in reference  axis of BiFeO3. The metal Ta was chosen as the top protective layer with a thickness of 1.5\u00a0nm.To prepare the Co/BiFeO\u03b2E). The pump fluence on the sample was kept constant at \u22480.5\u00a0mJ\u00a0cm\u22122. The probe laser pulses of 800\u00a0nm were incident at a 45\u00b0 oblique angle, and the transient polarization rotation (\u03b8K) of the reflected probe pulses was detected by a balanced detector in the combination of a half\u2010wave retarder and a Wollaston prism. In the TRMOKE measurements, a vector magnetic field was applied within the sample plane along a certain direction (\u03b8H) to align the magnetization of Co to the desired orientation (\u03b8M).In the TRMOKE system, a Ti: Sapphire laser amplifier delivers laser pulses with the pulse width of \u2248100\u00a0fs, the laser repetition rate of 1\u00a0kHz, and central wavelength of 800\u00a0nm. The 400\u00a0nm laser pulses, used as the pump light incident perpendicularly on the sample, were generated by frequency doubling the 800\u00a0nm pulses in a beta barium borate (BBO) crystal. Before incidence on the sample, the pump laser transmitted a polarizer followed by a zero\u2010order half\u2010wave plate to tune its polarization angle (The authors declare no conflict of interest.Supporting InformationClick here for additional data file."}
+{"text": "Glycine max (L.) Merr.). In the M2 population, the flowering stage showed a considerable standard deviation compared to the wild type, confirming that the mutant populations had the expected DNA mutations. To identify the DNA mutations in the mutant populations, we used the targeting induced local lesions in genomes (TILLING) method, which is a reverse genetic method, to search for soybean flowering-related gene mutants. A total of 30 mutants from E1, E3, E4, and PhyA1 genes, which are known to be highly effective genes, or their homologous gene for flowering and maturation found in soybean quantitative trait locus analyses were isolated from our TILLING screening. Among these mutants, there were eleven nonsynonymous substitution mutants, one nonsense mutant, and two single nucleotide deletion mutants that could be expected to reduce or eliminate gene function. The e1, e3, and e4 mutants obtained in this study flowered considerably earlier than the wild type. In particular, the e1 mutant with a nonsynonymous substitution flowered approximately 1 month after sowing regardless of the sowing date, and its harvest date was approximately 1 month earlier than that of the wild type. Mutations identified using the TILLING method could not only be used as gel-based DNA markers with the same manipulation method, but the mutations could also be detected as DNA markers by the high-resolution melting method. These results indicate that mutations achieved without chromosome modification by crossbreeding are effective for early and practical improvement of superior varieties and that efficient selection of mutants by reverse genetics is an effective method for the identification of genetic modifications. The edamame mutant populations developed in this study are believed to possess various useful alleles which may be applicable in the search for mutations that lead to improved edamame yield and eating quality beyond the flowering stage.Induced mutation is a viable breeding strategy that is widely utilized in the development of elite plant varieties. We aimed to improve a variety of edamame by constructing novel mutant populations using the ethyl methanesulfonate in soybeans ( Glycine max (L.) Merr.) is one of the most important vegetable oil and protein producing crops in the world. The immature seeds of soybean are known as edamame; they can be boiled in their pods and the seeds can be eaten as they are, used in salads and other dishes or utilized as an ingredient in processed foods [Soybean  are effective agents of soybean mutagenesis [Genetic resource diversity is important for breeding improvements and when diversity is low, the creation of new mutations is required. Physical mutagens such as X- and gamma-rays and fast neutrons ,5,6 and agenesis ,7,8,9. Magenesis ,11 or geagenesis ,13,14,15agenesis , JTN-520agenesis , and Enragenesis ,19. TheyE1 to E11 and J loci on chromosomes as QTL controlling soybean flowering and maturity and the responsible genes have been identified for some of these loci. Of these, E1 is the most effective QTL and the isolated gene was reported to inhibit flowering as a soybean-specific transcription factor [E2 is GmGI, a clock gene [E3 and E4 is phytochrome A [Expanding genetic resources by inducing mutations in edamame cultivars, however, may not necessarily accelerate the breeding process. This is because finding mutants from the mutant population with target traits that can be used in breeding is a very complicated process. Moreover, it is difficult to pinpoint and isolate mutants with enhanced or lost function for a target gene using a mutant population with thousands of mutants. The targeting induced local lesions in genomes (TILLING) method is a reverse genetic analysis using mutants that can be used as a screening method to rapidly detect arbitrary gene mutations in a mutant population . In the n factor ; the genock gene  and the chrome A ,25. ThesIn this study, we generated mutant populations of Hiden, a good-tasting Japanese edamame variety using EMS, which is widely used as a chemical mutagen in plants and has a proven track record in soybeans, for use in edamame breeding. Forward genetic flowering studies and reverse genetic mutant screening using the TILLING method for the constructed mutant populations were also conducted to demonstrate the effectiveness of the mutant population for edamame breeding.To evaluate the effectiveness of the common mutagen EMS as an edamame mutagen, we tested its effects on the length of the aerial plant parts during the early growth stage. The EMS did not affect the length of the edamame seedlings below a concentration of 10 mM but lead to reductions up to 70 mM in a dose-dependent manner . At 70 m2 individuals in 2017 and 2018, respectively, and then investigated the variation in days to flowering as an index of their DNA mutations. The standard deviations for days to flowering in both the 2017 and 2018 populations were higher than those in the wild type Hiden   Mn = 190) . In the detected . These rE1, E3, E4, and PhyA1 genes that control flowering and maturity in soybean [E2 gene [e2. Following the TILLING method, we screened mutants of the 2,455 EMS-treated M2 individuals. Consequently, we isolated five e1, seven e3, twelve e4, and six phya1 mutants from the mutant populations, which contained one-base substitutions or one-base deletions  were transition mutations, whereas transition mutations and single nucleotide deletions occurred at a rate of approximately 10% (3/30 mutations) and 7% (2/30 mutations), respectively . EMS prie1 (17-0440) mutant and stop codon or frameshift mutants for the e3 (17-1035), e4 (17-0251), and phya1 (16-0340) mutants. Interestingly, the e1 mutant flowered approximately 35 days after sowing, regardless of the sowing date  grown in a glass room also exhibited accelerated flowering to the same extent as 17-0440 , mutant (e1/e1), or heterozygous (E1/e1) when using the TILLING method for a screening  having a single nucleotide deletion (e1 mutation. Using the heterozygous form (E1/e1) as a reference, we were able to clearly distinguish the genotypes of these three genotypes given that the wild type (E1/E1) showed maximum fluorescence at approximately 81 \u00b0C, whereas the mutant form (e1/e1) showed a minimum fluorescence at the same temperature . The mutant alleles of the creening . Neitherse pairs , and it deletion . Thus, uperature . The abiGmBIG Seed1 (GmBS1), GmBS2 [GmKinse-inducible Domain Interacting 8-1 (GmKIX8-1) [In this study, the improvement of flowering and maturity time was attempted as one of the breeding targets for edamame breeding. The mutant population developed in this study can also be used for the improvement of yield, grass type, and eating quality as new edamame breeding targets. Seed size is another important breeding target for edamame as larger seeds are preferred for eating. ), GmBS2 , and GmKmKIX8-1)  are the Glycine max (L.) Merr.) cultivar \u201cHiden\u201c  was selected for mutation breeding. We first conducted a kill curve analysis using a wide range of EMS  (0\u201370 mM) concentrations. Thirty dry seeds were soaked in EMS solutions while shaking at room temperature for 24 h. The seeds were then washed thoroughly with running water for at least 1 h. Then the seeds treated with EMS were placed in a 30 \u00b0C dark incubator. After 2 days, the seeds were sown into plastic mini pots. The shoot length of the soybean seedlings was measured after 14 days. The 25 mM EMS concentration was then chosen to generate the edamame soybean mutant population to observe mutation frequency. Seeds were soaked according to the method described for the kill curve analysis. Approximately 1500 and 2000 M1 plants were grown in an experimental field at the Field Science Center, Yamagata University in 2016 and 2017, respectively, under natural light conditions. The M1 plants were allowed to self-fertilize and individual M2 seeds were obtained.The edamame soybean  in 2017 and 2018. One-week-old seedlings were transplanted in early July. Days to the flowering of individual plants were scored as the number of days from seeding. As a control for the mutant populations, 200 wild type Hiden plants were grown in 2019 and scored for days to flowering. The M3 lines of the mutants for the flowering and maturity-related genes, e1, e3, e4, and phya1 from this study and the wild type Hiden as a control population, were grown in the field of the Field Science Center, Yamagata University with the exception of the e1 (16-0233) mutants. The e1 (16-0233) mutants were grown in plastic pots in a glass room. The e1 (17-0040) mutants and wild types as a control population were grown by sowing 10 individuals of each line once a week for four weeks starting in mid-May and scoring the days from sowing to flowering and harvest, respectively; they were photographed at their flowering and harvest stages. The e1 (16-0233), e3 (17-1035), e4 (17-0251), and phya1 (16-0340) mutants and wild types were sown in early June with 10\u201320 individuals of each line and scored for days from sowing to flowering.All plants from the Me1 (17-0040) mutation, the E1 sequences of the wild type Hiden and 17-0040 lines were amplified using sequence-specific primers  mutation, the AriaMx Real-Time PCR System  was used to detect the SNPs. The reaction mixtures consisted of either 10 \u03bcL of 2\u00d7 GoTaq Colorless Master Mix , 2.4 \u03bcL of 10 \u03bcM forward (5\u2032-CAAATTTTGCCTATGTTGGGTGCAT-3\u2032) and reverse (5\u2032-TGAAGACCATCGCTTTAGAACGAGT-3\u2032) primers, 0.006 \u03bcL of 5 mM SYTO9 green fluorescent nucleic acid stain  and 0.5 \u03bcL of the template DNA in a total volume of 20 \u03bcL. The PCR thermal cycler was programmed as follows: one cycle of initial denaturation at 95 \u00b0C for 2 min; 40 cycles of denaturation for 30 s at 95 \u00b0C; annealing and extension for 1 min at 60 \u00b0C. The thermal shift for HRM consisted of four steps: denaturation for 30 s at 95 \u00b0C; annealing for 30 s at 65 \u00b0C; then raising the temperature at a rate of 0.2 \u00b0C/10 s for denaturation and fluorescence data acquisition; and then 30 s at 95 \u00b0C. The AriaMx Real-Time PCR Software, v. 1.5 (Agilent Technologies) was used to obtain melting profiles of the PCR amplicons.For HRM analysis to detect the presence of the e1 mutant sown once a week for four weeks were determined by the Tukey HSD test (p < 0.05) using the multcomp package of the R programming language version 4.1.2. The significance differences of days to flowering between the wild type and e3, e4, and phya1 mutants were analyzed by the Student\u2019s t-test (p < 0.01) using Microsoft Excel for Mac version 16.60.For each measurement, the mean and standard deviation (SD) of the mean were calculated. The significant differences of days to flowering for the wild type and e1 mutant isolated using the TILLING method flowered approximately one month after sowing regardless of the sowing date and its harvest date was approximately one month earlier than that of the wild type. These results indicated that this mutation could be effectively used in edamame breeding, as it is in soybean breeding. The improvement of edamame varieties could also be realized by generating useful mutants using the same methods in elite edamame varieties other than the Hiden variety used in this investigation.We succeeded in isolating several edamame mutants related to flowering time, which is an important crop trait, from a mutant population constructed in this study. In particular, the"}
+{"text": "Cell-free DNA (cfDNA) has the potential to inform tumor subtype classification and help guide clinical precision oncology. Here we develop Griffin, a framework for profiling nucleosome protection and accessibility from cfDNA to study the phenotype of tumors using as low as 0.1x coverage whole genome sequencing data. Griffin employs a GC correction procedure tailored to variable cfDNA fragment sizes, which generates a better representation of chromatin accessibility and improves the accuracy of cancer detection and tumor subtype classification. We demonstrate estrogen receptor subtyping from cfDNA in metastatic breast cancer. We predict estrogen receptor subtype in 139 patients with at least 5% detectable circulating tumor DNA with an area under the receive operator characteristic curve (AUC) of 0.89 and validate performance in independent cohorts (AUC\u2009=\u20090.96). In summary, Griffin is a framework for accurate tumor subtyping and can be generalizable to other cancer types for precision oncology applications. Nucleosome profiling from cell-free DNA (cfDNA) represents a potential approach for cancer detection and classification. Here, the authors develop Griffin, a computational framework for tumour subtype classification based on cfDNA nucleosome profiling that can work with ultra-low pass sequencing data. Accurate cancer diagnosis and subtype classification are critical for guiding clinical care and precision oncology. Current approaches to determine tumor subtype require a tissue biopsy, which is often difficult to obtain from patients with metastatic cancer. Therefore, at the time of recurrence or metastatic cancer diagnosis, treatment options may often be informed by clinical diagnostics from the primary tumor. However, molecular changes in the tumor can emerge during metastatic progression and in the context of therapeutic resistance. Moreover, surveying molecular changes is challenging because repeated biopsies are problematic and not routine in clinical practice for solid tumors.1. In patients with cancer, a portion of this cfDNA is released from tumor cells, called circulating tumor DNA (ctDNA). The analysis of ctDNA can address the challenges in tissue accessibility and has demonstrated great potential for clinical utility9. Much of the current research and clinical efforts have focused on the detection of genetic alterations in ctDNA. Shallow coverage sequencing of cfDNA, including ultra-low pass whole genome sequencing , provides a cost-effective and scalable solution for estimating the tumor fraction (fraction of the cfDNA that is tumor derived) from the analysis of genomic copy number alterations13. Sequencing analysis of genomic alterations from ctDNA have helped to distinguish molecular subsets of tumors15. However, these genomic alterations, including somatic mutations, may not always fully explain treatment failure or identify therapeutic targets, exemplifying a major limitation of cancer precision medicine.Cell-free DNA (cfDNA) is DNA released into circulation by cells during apoptosis and necrosis20. For metastatic breast cancer (MBC), treatment is guided based on clinical subtypes determined by the expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2), often in the primary tumor21; endocrine therapies are prescribed to patients with ER-positive (ER\u2009+\u2009) or PR-positive (PR\u2009+\u2009) carcinomas while patients with HER2 positive tumors are prescribed anti-HER2 drugs. Patients with tumors absent for expression of all three receptors have triple negative breast cancer (TNBC) and receive chemotherapy22. However, receptor conversions during primary and metastatic disease progression have been frequently observed, including ~20% of patient tumors switching from ER\u2009+\u2009to ER-negative (ER-) subtypes28. Furthermore, similar to the presence of intra-tumor genomic heterogeneity in breast cancer, mixtures of clinical subtypes may also co-exist across or within metastatic lesions in the same patient, presenting major clinical challenges30. Therefore, accurate subtype classification and identification of transcriptional patterns underlying emergent clinical phenotype during therapy has critical implications for studying mechanisms of resistance and informing treatment decisions.Tumor subtypes are often characterized by distinct transcriptional regulation, which can change during treatment resistance, leading to different clinical tumor phenotypes. For example, prostate and lung cancers may undergo trans-differentiation from adenocarcinoma to small-cell neuroendocrine phenotypes36. When DNA is released into the peripheral blood following cell death, they are protected from degradation by nucleosomes1. At accessible genomic locations, such as at actively bound transcription factor binding sites (TFBSs) and open chromatin regions, nucleosomes are positioned in an organized manner that allows access for DNA binding proteins37  and lung cancer by analyzing fragmentation patterns45. However, patients with other cancer types may also benefit from non-invasive subtype prediction. Specifically, predicting receptor-based subtypes from cfDNA could enable patients with late-stage breast cancer to receive targeted treatment without the need for invasive biopsies. Furthermore, current cfDNA nucleosome profiling approaches have not been optimized for ULP-WGS data. Studying the clinical phenotype of tumors from ctDNA remains challenging due to lack of robust computational methods but has obvious potential clinical benefits for guiding treatment decisions in patients with metastatic cancer.Analysis of the protected and unprotected regions, termed nucleosome profiling, has been demonstrated for cancer detection and tumor tissue-of-origin prediction, including the analysis of shorter cfDNA fragments which tend to be enriched from tumor cellsIn this present study, we develop a computational framework called Griffin to classify tumor subtypes from nucleosome profiling of cfDNA. Griffin overcomes current analytical challenges to profile the nucleosome accessibility and transcriptional regulation from the analysis of standard cfDNA genome sequencing, including ULP-WGS (0.1\u00d7) coverage. Griffin employs a GC correction procedure that is specific for DNA fragment sizes and therefore uniquely suited for cfDNA sequencing data. We apply Griffin to perform cancer detection with high performance. Then, we demonstrate breast cancer ER subtyping from cfDNA, showing high classification accuracy and insights into tumor monitoring and heterogeneity, all achieved from analysis of ULP-WGS data. Overall, Griffin is a generalizable framework that can accurately profile chromatin accessibility from cfDNA for cancer subtype prediction and has the potential to direct personalized treatment to improve patient outcomes.We developed Griffin as an analysis framework with a GC correction procedure to accurately profile nucleosome occupancy from cfDNA. Griffin processes fragment coverage to distinguish accessible and inaccessible features of nucleosome protection Fig.\u00a0. GriffinThe analysis workflow begins with computing the genome-wide fragment-based GC bias for each sample. Then, for the region at each individual site of interest, the fragment midpoint coverage is computed and reweighted to remove GC biases (Methods). Midpoint coverage rather than full fragment coverage is used because it produces higher amplitude nucleosome protection signals  fragments and tumor fraction when using GC correction for multiple fragment lengths, which lead us to choose this correction strategy  due to the low number of short fragments (<100\u2009bp). For nucleosome sized fragments, we expected the tumor fraction to be negatively corrected with the central coverage around tumor-specific sites, and positively correlated for blood-specific sites. For a blood-specific TF, LYL1, we observed that the central coverage at TFBSs was positively correlated with tumor fraction before GC correction (Pearson\u2019s r\u2009=\u20090.41) as expected, but this correlation was much stronger after GC correction  predicted by ichorCNA. From analysis of WGS data for 14 CRPC, two MBC, and two healthy donor samples shorter 5\u2013100\u2009bp 48. For each factor, we compared the variability between the central coverage and tumor fraction using the root mean squared error (RMSE) from a linear regression fit before and after GC correction. For LYL1, the RMSE decreased (0.062 to 0.046), indicating less inter-sample variation in the data after GC correction , most correlations were in the expected direction, and that these correlations increased for blood TFs after GC correction ion Fig.\u00a0. Similar38 before and after GC correction. Because healthy donor samples have no tumor content, we evaluated the mean absolute deviation (MAD) for each TF to compare inter-sample variability. We found that the MAD\u00a0for central coverage decreased after GC correction for 365 (96.8%) TFs  and early-stage cancer patients (n\u2009=\u2009208) (DELFI cohort)38. We generated nucleosome profiles around the top TFBSs for each TF and extracted three features from each . Due to the large number of features, we used principal components analysis (PCA) to select the top components that explained 80% of the variance (Methods). Using logistic regression on these components, we determined that the best performance was achieved when using the top 30,000 TFBSs for each of 270 TFs that contained at least this many sites  dataset of cfDNA samples from healthy donors  or all (35\u2013500\u2009bp) fragments may improve our ability to detect cancer in this framework but observed a decreased performance  and ULP-WGS (AUC\u2009=\u20090.55) coverages.  dataset consisting of 129 lung cancer patients and 158 healthy individuals (LUCAS cohort)11. First, we inspected the Griffin profiles at TFBSs for key factors, including ESR1, FOXA1, and GATA3, which are known to be associated with ER positive tumors49. We observed that these TFBSs were more accessible in cfDNA samples from patients with ER\u2009+\u2009metastases compared to ER-; central coverage was significantly lower in ER\u2009+\u2009samples after accounting for tumor fraction  to quantify the expression of ER, but no ctDNA approach exists for this application. We set out to determine whether Griffin can be used to predict ER subtype status from ULP-WGS (0.1x) of cfDNA from MBC patients. We analyzed 254 samples with tumor fraction greater than 0.05 from 139 patients50, we identified open chromatin sites that were differentially accessible between ER subtype  were enriched for the TFBSs of ESR1, PGR, FOXA1 and GATA3, and ER- sites  were enriched for the TFBSs of STAT3 and NFKB1  with a higher performance for samples having high tumor fraction  compared to those with lower tumor fraction   n\u2009=\u200941,7 were enrely Fig.\u00a0, Methods.1) Fig.\u00a0. Systema53 (Methods). Using PCA, we did not observe batch effects between the cohorts, but rather signals could be attributed to the known ER status (by metastatic tumor IHC) and estimated tumor fraction  and 0.85 accuracy (AUC\u2009=\u20090.90) for lower tumor fraction  , the accuracy was 0.54 (AUC\u2009=\u20090.39), indicating the lower limit of accurate ER classification is likely 0.05 tumor fraction  Fig.\u00a0. For samp\u2009=\u20093.7\u2009\u00d7\u200910\u22124 and ER\u2009+\u2009group, p\u2009=\u20090.043, two-sided Fisher\u2019s exact test, Fig.\u00a0To further investigate the ER predictions, we inspected the classification results for 91 patients with known primary ER status and cfDNA tumor fraction of \u22650.1 Fig.\u00a0. In 40 p54. As an interesting example, MBC_1413 was initially diagnosed with an ER\u2212 metastatic pleural effusion but a second biopsy of the liver metastasis revealed ER expression in 5% of cells. The initial cfDNA sample was collected 178 days after and was predicted to have ER\u2009+\u2009status (0.74 probability), in agreement with the metastatic liver biopsy. A third biopsy from the pleural fluid was ER\u2212, which was consistent with the ER\u2212 prediction (0.23 probability) from a cfDNA sample taken 26 days prior. In another example, MBC_1009 had two ER\u2212 biopsies of the bone and liver, but a third biopsy had 5% ER expression, which was consistent with ER\u2009+\u2009predictions (>0.68 probability) for cfDNA samples taken 251 days before and 52 days after. These results suggest that Griffin may be detecting ER status changes or heterogeneity of tumor biopsies and that that subtype monitoring during therapy may be a potential application.To further investigate the ER status predictions and subtype heterogeneity, we examined eight patients who had ULP-WGS of cfDNA from plasma collected at different timepoints and ER expression by IHC available for one or more metastatic biopsies Fig.\u00a011,54. AsIn this study, we described the development of Griffin, a framework and analysis tool for studying transcriptional regulation and tumor phenotypes. Griffin applies a fragment length specific GC-correction procedure to remove the GC biases that obscure chromatin accessibility signals in cfDNA. We demonstrated that Griffin can be used to detect cancer from low pass WGS with high accuracy. We also developed an approach to perform ER subtyping in breast cancer from ULP-WGS of ctDNA.56, Griffin will be integral for advancing tumor phenotype studies from liquid biopsies.Griffin is versatile and can be used for various applications in cancer. We highlighted cancer detection and tumor subtype use-cases. However, Griffin can also be used for any biological comparison where transcriptional regulation and chromatin accessibility differences can be delineated. The applications described here use TFBSs from chromatin immunoprecipitation sequencing (ChIP-seq) and accessible chromatin sites from ATAC-seq. However, Griffin differs from existing frameworks due to its ability to analyze custom sites of interest that are specific to any biological context. These sites may be obtained from external sources and different assays, such as ChIP-seq, DHS, ATAC-seq or cleavage under targets and release using nuclease (CUT&RUN). As additional epigenetic data are collected by the cancer research community, including from single-cell experiments44. We showed that Griffin had better performance for both detecting cancer and predicting ER status from ULP-WGS data when compared to the Ulz method, likely because of its GC bias correction strategy and versatility to analyze any set of genomic regions. We observed improved performance after GC-correction consistently for all analyses, suggesting the benefit of the approach, although this improvement was minor for ER status prediction in ULP-WGS data. While the GC correction strategy was able to reduce inter-sample variability, we found that it was not able to eliminate batch effects between datasets potentially caused by different cfDNA processing and sequencing workflows, thus preventing cancer detection models from being compatible across all datasets. However, Griffin provides a framework to extract cfDNA features, enabling users to train models on new datasets, as we showed with the LUCAS and validation cohorts. Griffin can be applied to future large prospective studies using standardized plasma collection and workflows to carefully assess the performance of cancer detection in real clinical scenarios.Griffin is designed for the analysis of ULP-WGS (0.1\u00d7) of cfDNA, while other nucleosome profiling methods have focused on deeper coverage sequencing. Griffin takes advantage of analyzing the breadth of sites as opposed to individual loci, which was inspired by a similar strategy used by Ulz et al.31. While recent studies show the promise of cfDNA methylation and cfRNA analysis for tumor phenotype analysis and cancer detection63, these analytes may be challenging to isolate from clinical specimens or require specialized assays. Overall, Griffin provides a cost-effective and scalable framework requiring only standard low coverage WGS of cfDNA, which can be more rapidly incorporated into existing platforms to predict clinical cancer phenotypes.Although this study focused on the analysis of ULP-WGS (0.1\u00d7) of cfDNA, Griffin is not limited to low coverage data. Increased cfDNA sequencing coverage can allow for analysis of specific gene promoters and cis-regulatory elements and may enable gene expression prediction10, which highlights potential utility for this disease stage. TNBC patients with cfDNA tumor fraction \u2265 10% have poorer prognosis11 and would benefit more from tumor monitoring. It may be possible to improve performance of ER subtyping for lower tumor fraction samples with additional sequencing depth, using TFBSs identified directly from ER\u2009+\u2009/\u2212 tumors, or joint analysis of multiple cfDNA timepoints from the same patient.A limitation of the binary ER classification (ER\u2009+\u2009or ER\u2212) is the decreased accuracy for samples with lower tumor fraction (<10%) and a 5% limit for accurate prediction, suggesting that it may be challenging to use Griffin for early-stage and minimal residual disease settings. However, in MBC, previous reports have suggested that up to 34% of MBC patients may have at least 10% tumor fraction in plasmaThe application of Griffin to predict ER status from cfDNA of MBC patients led to interesting results for patients with ER loss, suggesting potential tumor heterogeneity. Intriguingly, we noticed that for the patients with ER\u2212 tumors by IHC, ER\u2009+\u2009predictions were significantly enriched when the primary tumor was ER\u2009+\u2009. Moreover, in some patients with multiple cfDNA biopsies we observed changes in predicted ER status that might be explained by the presence of metastatic tumors with both subtypes. This subtype heterogeneity and switching would typically not be captured from a single metastatic biopsy, but our results demonstrate the possibility of using the predicted ER probability to monitor subtype status over time during therapy using ctDNA. Future studies using synchronous tumor biopsy and plasma sequencing data for more patients will be needed to establish clinical utility.64. While PR expression is also determined in the clinic and ER\u2212/PR\u2009+\u2009tumors are considered hormone receptor positive, these are rare, not reproducible or less useful for prognosis65. In our cohort, only 2 out of 139 (1.4%) patients were ER\u2212/PR\u2009+\u2009. HER2 overexpression is important for prognosis and determining treatment such as with trastuzumab66. However, we were unable to identify sufficient number of open chromatin sites that were differentially accessible between HER2 positive and HER2 negative tumors. Since ERBB2 (encodes the HER2 protein) is amplified in ~20% breast cancers, one can instead assess ERBB2 copy number amplification from ctDNA genomic analysis67. Alternatively, a model to predict PAM50 status could be useful as this may be a better indicator of prognosis than ER/PR/HER2 IHC alone68.We focus our breast cancer subtyping on ER prediction because its status has important utility in predicting likely benefit to endocrine therapy10 Griffin joins a suite of tools for in depth analysis of ULP-WGS of cfDNA enabling cost effective, non-invasive monitoring of tumors. Griffin has the potential to reveal clinically relevant tumor phenotypes, which will support the study of therapeutic resistance, inform treatment decisions, and accelerate applications in cancer precision medicine.In summary, the Griffin framework enables prediction of tumor phenotypes from ULP-WGS. In this study, we demonstrate the use of this framework to detect cancer in early-stage cancer patients and to predict ER status in metastatic breast cancer patients. Combined with methods for predicting tumor fraction and copy number alterationsThe research described in this study complies with all relevant ethical regulations. New patient data (Independent MBC Cohort) was obtained under protocols which were approved by the institutional review board of the Dana Farber Cancer Institute (DFCI-09204) or Ohio State University . Use of additional clinical data for the previously published MBC ULP-WGS cohort was approved by an institutional review board . Patients in all studies provided written informed consent for the study in which they were enrolled. See descriptions of human subjects and datasets below.46 which was previously implemented in deepTools69. However, unlike the deepTools implementation, which assumes that all fragments have the same length, we used the \u2018fragment length model\u2019 which calculates a separate GC bias curve for each fragment length. This is helpful for cfDNA where different samples may have different fragment size distributions and different fragment lengths have biological significance32.GC content influences the efficiency of amplification and sequencing, leading to different expected coverages (coverage bias) for fragments with different GC contents and fragment lengths. This is called GC bias and is unique to each sample. We calculated the GC bias of each bam file using an implementation of the method developed by Benjamini and Speed 201270 (https://hgdownload.soe.ucsc.edu/gbdb/hg38/hoffmanMappability/k100.Umap.MultiTrackMappability.bw). We used pybedtools (0.8.0)71 to find the mappable regions (defined as mappability score\u2009=\u20091) and further excluded regions with known mapping problems including the encode unified GRCh38 exclusion list (https://www.encodeproject.org/files/ENCFF356LFX/), centromeres, fix patches, and alternative haplotypes for hg38 downloaded from UCSC table browser (https://genome.ucsc.edu/cgi-bin/hgTables).Prior to performing GC bias calculation, we identified all mappable regions of the genome (as described by Benjamini and Speed and implemented in deepTools) using the Umap multi-read mappability track for 100\u2009bp reads downloaded from UCSC genome browserhttps://github.com/pysam-developers/pysam)72. We counted the number of observed reads for each length and GC content, excluding reads with low mapping quality (<20), duplicates, unpaired reads, and reads that failed quality control. These read counts are the \u2018GC counts\u2019 for that sample. We then divided the GC counts for a sample by the GC frequencies for the genome to obtain the GC bias for that bam file and normalized the mean GC bias for each fragment length to 1, resulting in a GC bias value for every combination of fragment size and GC content (except those combinations that are never observed in the genome). We then smoothed the GC bias curves. For each fragment size we took all GC bias values for fragments of a similar length (\u00b110\u2009bp). We sorted these values by the GC content of the fragment to create a vector of GC bias values for similar sized fragments. We then smoothed this vector by taking the median of k nearest neighbors  and repeated for each possible fragment length. We then normalized to a mean GC bias of 1 for each possible fragment length (excluding GC contents that are never observed) to generate a smoothed GC bias value for every possible fragment length and GC content observed in the genome.We then examined all remaining regions of the genome and, for each fragment length, counted the observed GC content of every possible fragment overlapping those positions. The observed frequencies of each GC content for each fragment length are the \u2018genome GC frequencies\u2019 and are specific to the genome build. We then developed the \u2018griffin GC bias\u2019 pipeline to compute the GC bias in a given bam file. The pipeline takes a bam file, bedGraph file of valid  regions, and genome GC frequencies for those regions. For each given sample, we fetched all reads aligning to the valid regions on autosomes using pysam v0.15.4  around each site using pysam . We then filtered read pairs by fragment length and selected those in a range of fragment lengths . For each read pair, we determined the GC bias for the fragment and assigned a weight of 73) on the window \u00b1960\u2009bp from the site and taking the amplitude of the 10th frequency term. This window and frequency were chosen due to the observed nucleosome peak spacing at an active site (190\u2009bp) which results in approximately 10 peaks in the window \u00b1960\u2009bp.To quantify coverage profiles, we extracted 3 features from each coverage profile. First, we calculated the coverage value at the site (\u00b130\u2009bp). Second, we calculated the \u2018mean coverage\u2019 value \u00b11000\u2009bp from the site. And third, we calculated the amplitude of the nucleosome peaks surrounding the site by using a Fast Fourier Transform  and the number of reads overlapping that position . Sampled positions with read counts >5\u2009SD above the mean were excluded. After obtaining the mappability values and read counts for all sampled positions, we calculated the mappability bias for each mappability value within that 5\u2009Mbp bin by dividing the total number of reads observed at positions with a given mappability by the total number of positions with that mappability value. We repeated this procedure for all bins. Finally, we took the mappability biases for all mappability values in all bins and smoothed them using loess regression as implemented in python statsmodels (version 0.13.2)74. When calculating coverage profiles, we calculated the mappability value for each fragment as the mean mappability of all positions covered by the forward and reverse read. We then assigned a weight of To test the impact of mappability bias on Griffin profiles, we implemented a per fragment mappability bias correction. First, for each sample, we obtained an approximate coverage distribution by sampling 1000 random positions within the genome (excluding positions which overlapped regions with known mapping problems see \u2018Griffin: GC-content bias correction procedure\u2019) and determined the cutoff for extreme outliers >5 standard deviations above the mean. Next, we split the genome into 5Mbp segments resulting in 587 segments spanning the genome (autosomes only). For each segment, we sampled every 100To assess whether CNA correction improved Griffin performance, we performed CNA correction at each site prior to merging sites into composite coverage profiles. This correction was performed by dividing the coverage at each position in the profile by the mean coverage in the surrounding \u00b150\u2009Kbp window. We found that the addition of CNA correction had a minimal impact on coverage profiles and did not improve the correlations to tumor fraction or performance of the cancer detection model and resulted in only a small improvement in the ER status prediction model. We did not use CNA correction in our final Griffin models, however we did leave an option to turn it on for future users who might find it useful.In order to assess whether to use a single fragment length model or a multiple fragment length model was better able to correct GC biases around accessible sites in cfDNA, we implemented a GC correction model that assumes a single fragment length (165\u2009bp) for all fragments similar to the method implemented by deepTools. This model used the same procedure as described in Griffin: GC-content bias correction procedure, with a few modifications. When calculating the GC counts, it assumed that every read had a fragment length of 165\u2009bp (starting from the read start position). The resulting GC counts were then divided by the GC frequencies for 165\u2009bp to generate the GC biases for each GC possible GC content for 165\u2009bp fragments. Next, when generating coverage profiles, we found the GC content of each fragment and then found the GC bias for the 165\u2009bp fragment with the most similar GC content and used this value to reweight the fragment. This single fragment length procedure was found to not perform as well for short 35\u2013100\u2009bp) fragments . This data consisted of 1\u20132\u00d7 low pass whole genome sequencing from 100\u2009bp paired end Illumina sequencing reads. For our analyses, we used a subset of samples with 1\u20132\u00d7 WGS of cfDNA from 208 cancer patients with no previous treatment and 215 healthy donors. These were the same samples used for the cancer detection analysis in the original Cristiano et al. study. cfDNA tumor fraction was estimated using ichorCNA (github commit 15B1D336)10. An hg38 panel of normals (PoN) with a 1\u2009mb bin size was created using all 215 healthy donors in the dataset. ichorCNA was then run on all cancer and healthy samples to estimate tumor fraction. ichorCNA_fracReadsInChrYForMale was set to 0.001. Defaults were used for all other settings.Whole genome sequencing (WGS) cfDNA from patients with various types of early stage cancer and healthy donors were obtained from an existing dataset published in Cristiano et al.45. Bam files were downloaded from EGA (dataset ID: EGAD00001007796). This data consisted of 1\u20132\u00d7 low pass whole genome sequencing from 100\u2009bp paired end Illumina sequencing reads. For our analyses, we used the subset of samples described in the paper as the \u2018LUCAS\u2019 cohort and a second subset of samples described as the LUCAS validation cohort. The LUCAS cohort included 158 patients who had no history of cancer and no future cancer diagnosis and 129 patients who were diagnosed with lung cancer within days of blood draw (0\u201344 days). The LUCAS validation cohort included 46 patients with cancer and 385 patients without cancer. All samples were realigned to hg38 as described below in \u2018sequence data processing\u2019. Tumor fraction was determined using ichorCNA (as described for the DELFI cohort) with a new panel of normals constructed using 54 separate healthy donor samples  from the LUCAS study.Whole genome sequencing (WGS) cfDNA from a prospective study of patients with lung cancer and without cancer were obtained from an existing dataset published by Mathios and colleagues10. Bam files were downloaded from dbGaP (accession: phs001417.v1.p1). This data consisted of ~0.1\u00d7 ultra-low pass whole genome sequencing (ULP-WGS) from 100\u2009bp paired end Illumina sequencing reads. For our analyses, we used a subset of 254 ULP samples with >0.1\u00d7 coverage WGS,\u2009>\u20090.05 tumor fraction and known estrogen receptor (ER) status. Of these 254 samples 133 were ER positive (from 74 unique patients) and 121 were ER negative (from 65 unique patients). Coverage and tumor fraction metrics were obtained from the supplementary data in the publication10. Additionally, we used two deep (9\u201325\u00d7) WGS from two MBC patients (MBC_315 and MBC_288) from the same source and two deep (17\u201320\u00d7) WGS from two healthy donors (HD45 and HD46) from the same source for designing and demonstrating the pipeline.WGS of cfDNA from patients with metastatic breast cancer (MBC) and healthy donors were obtained from an existing dataset published by Adalsteinsson and colleaguesPrimary and metastatic ER status was determined by immunohistochemistry and obtained from pathological review. Metastatic survival time was also abstracted from the medical records. Use of this data was approved by an institutional review board .For training and assessing the ER status classifier we labeled each sample as ER\u2009+\u2009or ER\u2212 using information about the ER status from medical records. If metastatic ER status was not known, the sample was labeled according to the primary tumor ER status (20 samples from 11 patients). ER low (1\u201310% ER\u2009+\u2009staining) samples (15 samples from 6 patients) were labeled ER\u2009+\u2009for the purpose of the binary classifier. For eight patients  we had information about multiple metastatic biopsies, some with multiple ER statuses among the biopsies. In these cases, we used the last biopsy taken prior to the initial cfDNA collection for the purpose of training and testing the binary ER status classifier. In a partially overlapping set of 8 patients, we also had information about multiple primary biopsies, two with multiple ER statues among the primary biopsies. In these cases, we used the first ER status to determine if there had been a subtype switch  patients in Ghana with known ER status and ULP WGS (0.1\u00d7) sequencing (dbGaP accession: phs002387.v1.p1). ER status and tumor fraction were obtained from the publication. Samples were then realigned to hg38 as described in \u2018Sequence data processing\u2019. The second cohort was from the study by Bujak et al.53, which included WGS of cfDNA from 27 patients with ER\u2009+\u2009MBC (NCBI BioProject accession: PRJNA578569). ER status was obtained from the publication. The third cohort was the \u2018Independent MBC cohort\u2019 which consisted of ULP-WGS data generated as described below (Methods: Independent MBC cohort).Three independent validation cohorts were used to assess the performance of the ER status prediction model, two of these were from previously published studies. The first cohort was from the study by Ahuno et al.Tumor fraction for the Bujak et al cohort was estimated using ichorCNA. Samples were aligned to hg19 in order to use the default panel of normal provided with ichorCNA. \u2018ichorCNA_fracReadsInChrYForMale\u2019 was set to 0.001 and all other parameters were defaults. For Griffin analyses, samples from this cohort were aligned to hg38 as described in \u2018Sequence data processing\u2019 and downsampled to 0.1\u00d7 WGS as described in \u2018Downsampling cfDNA sequencing data to 0.1\u00d7 coverage\u2019 prior to Griffin analysis.Patients were enrolled on clinical data collection and biospecimen banking protocols. Eligible patients had biopsy-proven metastatic breast cancer. Hormone receptor status was performed using Clinical Laboratory Improvement Amendments (CLIA) approved assays. Estrogen receptor (ER) positivity was defined as \u22655% of cells positive by immunohistochemistry (IHC). Human epidermal growth factor receptor 2 (HER2) negativity was defined as IHC score 0 or 1+ and/or HER2:CEP17 fluorescent in situ hybridization (FISH) ratio <2.0. HER2 positivity was defined as IHC score 3\u2009+\u2009, or IHC score 2+ with HER2:CEP17 FISH ratio \u22652.0. Triple negative breast cancer (TNBC) was defined as <5% staining for ER and progesterone receptor (PR), as well as HER2 negativity as previously defined. The protocols were approved by the institutional review board of the Dana Farber Cancer Institute (DFCI-09204) or Ohio State University . All patients provided written informed consent for blood sample collection, genomic analyses, and collection of clinicopathologic data. A total of 103 samples from 30 patients were used for this study. This included 15 hormone receptor positive patients and 15 TNBC patients.Venous blood samples (10\u2009mL) were collected in EDTA , CellSave Preservative  or Cell-Free DNA BCT  tubes. EDTA tubes were processed within 4\u2009h of collection and Streck tubes within 48\u2009h. Whole blood was centrifuged at 1900\u2009g for 10\u2009min at room temperature with the brake off. Plasma was removed and transferred to Eppendorf DNA LoBind tubes, then centrifuged at 1900\u2009g for 10\u2009min at room temperature. Plasma was transferred to cryovials and frozen at \u221280\u2009\u00b0C for storage.Frozen aliquots of plasma were thawed at room temperature. cfDNA was extracted using the QIAsymphony DSP Circulating DNA Kit according to the manufacturer\u2019s instructions, with ~4\u2009mL of plasma as input and with a 60\u2009\u00b5L DNA elution.Initial DNA input is normalized to be within the range of 25\u201352.5\u2009ng in 50\u2009\u00b5L of TE buffer  according to picogreen quantification. Library preparation is performed using a commercially available kit provided by KAPA Biosystems (KAPA HyperPrep Kit with Library Amplification product KK8504) and IDT\u2019s duplex UMI adapters. Unique 8-base dual index sequences embedded within the p5 and p7 primers (purchased from IDT) are added during PCR. Enzymatic clean-ups are performed using Beckman Coultier AMPure XP beads with elution volumes reduced to 30\u2009\u00b5L to maximize library concentration.Library quantification was performed using the Invitrogen Quant-It broad range dsDNA quantification assay kit  with a 1:200 PicoGreen dilution. Following quantification, each library is normalized to a concentration of 35\u2009ng/\u00b5L, using Tris-HCl, 10\u2009mM, pH 8.0.In preparation for the sequencing of the ultra-low pass libraries (ULP), approximately, 4\u2009\u00b5L of the normalized library is transferred into a new receptacle and further normalized to a concentration of 2\u2009ng/\u00b5L using Tris-HCl, 10\u2009mM, pH 8.0. Following normalization, up to 95 ultra-low pass WGS samples are pooled together using equivolume pooling. The pool is quantified via qPCR and normalized to the appropriate concentration to proceed to sequencing. Cluster amplification of library pools was performed according to the manufacturer\u2019s protocol (Illumina) using Exclusion Amplification cluster chemistry and HiSeq X flowcells. Flowcells were sequenced on v2 Sequencing-by-Synthesis chemistry for HiSeq X flowcells. The flowcells are then analyzed using RTA v.2.7.3 or later. Each pool of ultra-low pass whole genome libraries is run on one lane using paired 151\u2009bp runs.15. Bam files were downloaded from dbGaP (accession: phs001417.v1.p1). Coverage and tumor fraction metrics were obtained from the supplementary data in the publications. These samples were used for designing and demonstrating the pipeline.Deep WGS (16-61x) of cfDNA from patients with castration resistant prostate cancer (CRPC) and healthy donors were obtained from an existing dataset published by Viswanathan and colleagues and Adalsteinsson and colleagueshttp://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz). Bam files were unmapped from their previous alignment using Picard (v2.18.29) SamToFastq. They were then realigned to the human reference genome according to GATK best practices75 using the following procedure. Fastq files were realigned using BWA-MEM (v0.7.17)76. Files were then sorted with samtools (v1.9)77, duplicates were marked with Picard, and base recalibration was performed with GATK (v4.1.0.0), using known polymorphisms downloaded from the following locations: https://console.cloud.google.com/storage/browser/genomics-public-data/resources/broad/hg38/v0/Mills_and_1000G_gold_standard.indels.hg38.vcf.gz and https://ftp.ncbi.nih.gov/snp/organisms/human_9606_b151_GRCh38p7/VCF/GATK/All_20180418.vcf.gz.All sequencing data used in this study was realigned to the hg38 version of the human genome . This contains meta peaks observed in one or more ChIP seq experiments. The GTRD database contains some ChIP seq experiments for targets that are not transcription factors (TFs). These were excluded by comparing against a list of TFs with known binding sites in the CIS-BP database78 (v2.00 downloaded from http://cisbp.ccbr.utoronto.ca/bulk.php). The site position was identified as the mean of \u2018Start\u2019 and \u2018End\u2019. For GC, mappability, and CNA correction analyses as well as TFBSs nucleosome profiling in MBC, TFs with less than 10,000 sites on autosomes were excluded resulting in 377 TFs. For each remaining TF, the top 10,000 sites were selected by choosing those with the highest \u2018peak.count\u2019 . For cancer detection we tried several cutoffs  and selected an optimal cutoff of 30,000 sites, resulting in 270 TFs . For the MBC ER status classifier shown in Supplementary Fig.\u00a0Transcription factor binding sites (TFBSs) were downloaded from the GTRD databasehttp://xena.ucsc.edu/)79 which uses the Appyter bulk RNA-seq analysis pipeline to run Limma-Voom differential gene expression analysis80. After launching the tool via a web browser, we selected the publicly available \u2018TCGA TARGET GTEX\u2019 study which includes RNA seq from TCGA tumors as well as RNA seq from GTEX healthy tissues. The version of the data was 2016-04-12. We selected the phenotypic variables \u2018main category\u2019 which groups samples by tissue or tumor type and \u2018study\u2019 which groups samples by study. We then ran a differential gene expression analysis on the \u2018main category\u2019 variable and selected GTEX Blood (337 samples) and TCGA_Breast_Invasive_Carcinoma (1099 samples) as the two subgroups to compare in the analysis. All other parameters were left as defaults. We used the outputs to determine which of the 377 TFs (see \u2018Transcription factor binding site (TFBS) selection\u2019 above) were differentially expressed between blood cells and breast cancer cells . This yielded 107 TFs that were upregulated in BRCA and 82 TFs that were upregulated in blood. We noted that some TFs shared a large number of binding sites with TFs that were upregulated in the opposite tissue type. For instance, MECOM  has previously shown to be more accessible in\u00a0blood\u00a0than in BRCA44 and we saw the same trend of increased accessibility in blood in our data. However, according to the differential RNA seq analysis, MECOM is actually upregulated in BRCA relative to blood. We suspected that this\u00a0discrepancy is due to the fact that MECOM shares almost half of its top 10,000 sites (4465 sites) with blood specific LYL1 and >15% of the top 10,000 sites each with of a number of other factors that are upregulated in blood including ZBTB16 (2884 sites), TBX21 (1837 sites), STAT5A (1936 sites), and SPI1 (2075 sites). Because of this type of extensive site overlap seen in some differential TFs, we implemented a filter to exclude differential TFs which shared too many sites with the opposite tissue type. For the top 10,000 TFBSs for each TF, we examined how many of them overlapped (binding site was within \u00b1 250\u2009bp) with the top 10,000 TFBSs for each TF of the opposite tissue type . If a TF overlapped with an average of 400 or more sites for the factors expressed in the opposite tissue type, it was excluded from the list of differentially expressed TFs because it was considered to share too many sites with the opposite class, potentially confounding tissue specific accessibility. This left us with 22 TFs that were upregulated in blood and 35 factors that were upregulated in cancer.To identify transcription factors that were differentially expressed between blood cells and breast cancer, we used the University of California Santa cruise (UCSC) Xena online differential gene expression analysis tool  and the top 10,000 most frequently observed sites were selected for each tissue type.DNase I hypersensitivity sites for a variety of tissue types were downloaded from https://gdc.cancer.gov/about-data/publications/ATACseq-AWG)50. A file containing raw counts for all cancer type specific sites were downloaded (\u2018All cancer type-specific count matrices in raw counts\u2019) and the file containing breast cancer specific sites was used (\u2018BRCA_raw_counts.txt\u2019). The locations of these sites and patient metadata were obtained from the supplementary tables in the paper50. Sites on autosomes were kept for further analysis for a total of 211,938 sites. Differentially accessible sites between ER\u2009+\u2009(n\u2009=\u200944) and ER\u2212 (n\u2009=\u200915) tumors were identified using the DESeq2 software82. The software was run using default settings described in the \u2018quick start\u2019 guide with no co-variates. A differential accessibility experiment was run using the \u2018DESeq\u2019 and \u2018results\u2019 functions followed by log fold change shrinkage using the \u2018lfcShrink\u2019 function. Sites with an adjusted p-value\u2009<\u20095\u2009\u00d7\u200910\u22124 were selected. Additionally, selected sites were further filtered based on the log2 fold-change between ER\u2009+\u2009and ER\u2212 tumors . Sites with a log2 fold change >0.5 were classified as ER\u2009+\u2009, while sites with a log2 fold change\u2009<\u2009\u22120.5 were classified as ER\u2212. These site lists were further split into sites shared with hematopoietic cells and those not shared with hematopoietic cells. Hematopoietic sites were obtained from a database of single cell ATAC-seq data51 . Hematopoietic sites were lifted over to hg38 using the UCSC liftover command line tool and sites that changed size during liftover (0.2% of sites) were discarded. ER differential ATAC-seq sites were overlapped with hematopoietic sites (Overlapping sites were defined as site centers being within 500\u2009bp of one another) using pybedtools intersect83. This resulted in a total of 4 differential site lists: ER positive sites that were not shared with hematopoietic cells , ER positive sites that were shared with hematopoietic cells (9930 sites), ER negative sites that were not shared with hematopoietic cells , and ER negative sites that were shared with hematopoietic cells .Assay for transposase-accessible chromatin using sequencing (ATAC-seq) site accessibility for primary breast cancer samples from The Cancer Genome Atlas (TCGA) were downloaded from the TCGA ATAC-seq hub  using pybedtools intersect. An overlapping pair of sites was defined as having <500\u2009bp between site centers. Each differential ATAC-seq site list was compared against each list of TFBSs and the total number of ATAC sites overlapping one or more TFBSs on the given list was recorded  while holding the adjusted p-value cutoff constant at 0.05. Second, we tried 3 additional p-value cutoffs while holding the log2 fold-change constant at 0.5. For each cutoff, we ran the griffin nucleosome profiling analysis on the selected ATAC-seq sites, using 100\u2013200\u2009bp fragments. We then extracted features and used these in a logistic regression model to predict ER status as described below  and calculated the mean accuracy across all bootstraps. We found that there was a relatively small difference between cutoffs (~2% accuracy) but chose the cutoff with the highest accuracy  for our final model.In order to select the optimal For 377 TFs (see Transcription factor binding site (TFBS) selection above), the GC content around the top 10,000 TFBSs was quantified  and line of best fit (scipy version 1.7.1). Pearson p-values for each feature type were adjusted using a Benjamini-Hochberg FDR correction. Root mean squared error (RMSE) was calculated from the line of best fit. This was performed both before and after GC correction as illustrated for LYL1 in Fig.\u00a0For 191 MBC ULP samples with >0.1 tumor fraction, nucleosome profiling with and without GC correction was performed on the top 10,000 sites for each of 377 transcription factors (TFs) using nucleosome sized fragments (100\u2013200\u2009bp). For each TF, the relationship between central coverage and tumor fraction was modeled using scipy.stats.linregressFor 215 healthy donors, nucleosome profiling with and without GC correction was performed on the top 10,000 TFBSs for each of 377 TFs. For each TF, the MAD of the central coverage values was calculated both before and after GC correction. For all 377 TFs, the MAD values before and after GC correction were compared using a Wilcoxon signed-rank test (two-sided).85. For this analysis, we used the 191 MBC samples with \u22650.1 tumor fraction and \u22650.1 coverage. Nucleosome profile feature  was the dependent variable, primary tumor status was the independent variable (\u2018between\u2019), and tumor fraction was a covariate. We performed this analysis on all 3 features for all 377 TFs with 10,000 or more sites. We then used Benjamini-Hochberg FDR correction to perform multi-test correction for on the p-values for ER status and tumor fraction for each feature.To determine whether nucleosome profiles around TFBSs were differentially accessible between ER\u2009+\u2009and ER\u2212 samples we performed an analysis of covariance (ANCOVA) as implemented in Pingouin (v0.5.1)We performed the same ANCOVA analysis on the features for the 4 types of ER differential ATAC sites but without FDR correction as there were only a total of 12 features .86. All feature values were scaled to a mean of 0 and a standard deviation of 1 prior to performing bootstrapping and fitting the models. We used the following bootstrapping procedure to train and assess the performance of our models. First, we selected n samples with replacement from the full set of n samples and used this as a training set. Samples that weren\u2019t selected were used as the test set. We then used 10-fold cross-validation on the training set to select the hyperparameter \u2018C\u2019 (inverse of the regularization strength). To account for class imbalances in the data we used set the \u2018class weight\u2019 parameter to \u2018balanced\u2019 to adjust the sample weighs inversely proportional to the class frequencies. We trained a final model on all the training data using the selected regularization strength. Finally, we tested this model on the test set and recorded the performance  and sample probabilities. Then, a new training set was selected, and the procedure was repeated for 1000 iterations. After completing the bootstrap iterations, we calculated the AUC and accuracy from each bootstrap iteration and used these to generate the mean and 95% confidence interval around each of these values and to create boxplots. To visualize the ROC curve, we used the median probability from all bootstraps where each sample was included in the test set. For further downstream analyses, including the comut plot, barplots, and timelines we used this same median probability.To detect cancer or predict ER subtype, we used logistic regression with Ridge regularization (i.e. L2 norm) as implemented in scikit-learn (v0.23.2)86 on the training set and selected the features that explained 80% of the variance. We then applied this same PCA transformation to the test set for that bootstrap. These PCA components were then used as the inputs for the logistic regression model which was trained on the training set, and tested on the test set.To detect cancer, we applied the logistic regression approach described above and built a logistic regression classifier on features extracted from the DELFI cohort cancer and healthy samples. First, we performed nucleosome profiling in these samples (selecting fragments 100\u2013200\u2009bp in length). For our finalized model we used 30,000 TFBSs each for 270 TFs with at least 30,000 sites in the GTRD database (see \u2018Selection of number of TFBSs for cancer detection\u2019 below). We extracted three features (as described above \u2018Griffin: nucleosome profile feature quantification\u2019) from each coverage profile for a total of 810 features. We then scaled these features to a mean of 0 and a SD of 1. Within each bootstrap iteration, we reduced the dimensionality of the feature using PCA as implemented in scikit learnFor the LUCAS cohort, we found that there were batch effects that prevented using the same model trained on the DELFI cohort. Because of this we trained and tested a new model on the LUCAS cohort using the same bootstrapping approach and performed a final validation of this model in the LUCAS validation cohort .Finally, we downsampled both the DELFI and LUCAS cohorts to ~0.1\u00d7 coverage (procedure described below) and performed the same cancer detection analysis in this lower coverage data.After training and testing a logistic regression model using the bootstrapping approach on the LUCAS cohort, we applied the final model to the previously unseen LUCAS validation cohort . To get this final model, first, we performed PCA on the full LUCAS cohort  and extracted 35 features that explained 80% of the variance in that cohort. Then, we used these 35 features to build a logistic regression model using the regularization strength most frequently chosen by the 1000 bootstraps on the LUCAS cohort (\u2018C\u2019\u2009=\u20090.01). Finally, we applied the PCA transformation and logistic regression model to the LUCAS validation cohort, extracted the same 35 features, and got a probability of cancer for each sample. We obtained confidence intervals for the AUC using a bootstrap procedure in which we selected 431 samples with replacement from the original 431 samples and calculated the AUC for the selected samples. We then repeated this 1000 times to get 1000 AUC values which we used to obtain confidence intervals and boxplots.We repeated this same procedure for the downsampled LUCAS validation cohort.In order to select the optimal number of TFBSs for cancer detection, we tried several different cutoffs for the number of sites . For each cutoff we identified all TFs with at least that many sites in GTRD resulting in 566, 446, 377, 316, 270, and 202 TFs respectively for the cutoffs above. We then picked the top sites by choosing those with the highest \u2018peak.count\u2019. We next used the logistic regression with bootstrapping and PCA dimensionality reduction described above  to train and test models on both the original 1\u20132\u00d7 WGS DELFI cohort samples and the downsampled 0.1\u00d7 DELFI cohort samples. We found that the number of sites had a greater impact on the downsampled data  and hg19 known polymorphic sites for base recalibration (downloaded from ftp://gsapubftp-anonymous@ftp.broadinstitute.org/bundle/hg37/Mills_and_1000G_gold_standard.indels.hg37.vcf.gz and ftp://ftp.ncbi.nih.gov/snp/organisms/human_9606_b151_GRCh37p13/VCF/GATK/All_20180423.vcf.gz).WGS data for the DELFI cohort, LUCAS cohorts , and Bujak et al. dataset was aligned to aligned to hg38 and subsequently downsampled using Picard DownSampleSam. The probability used by DownSampleSam was calculated based on a target of 2,463,109 read pairs which resulted in approximately 0.11x coverage as calculated by Picard CollectWgsMetrics. Downsampled bam files from the DELFI dataset were realigned to hg19 for use in the Ulz pipeline for comparison. The realignment procedure was the same as above but using the hg19 genome  with replacement from a full set of 139 patients. For each selected patient, all samples from that patient were added to the training set . This ensured that separate samples from the same patient  could not appear in both the training and test set. Samples from patients that weren\u2019t selected were used as the test set.For our model, we applied nucleosome profiling using 100\u2013200\u2009bp fragments to the 4 ER differential ATAC seq lists and extracted 3 features per profile for a total of 12 features. For evaluating the model, we only included the first timepoint for each patient in the test set when calculating the accuracy and AUC for each bootstrap iteration. This prevented a small number of patients with many samples from having a large impact on the scores.In order to assess whether ER status could be predicted from the nucleosome profiles around TFBSs, we performed nucleosome profiling for the top 30,000 sites for 270 TFs and extracted 3 features each for a total of 810 features. We then used the bootstrapping approach described above (\u2018ER status classification in the MBC cohort\u2019) to train and test the model. Because of the high dimensionality of the data, within each bootstrap, we performed PCA on the training set and selected the top PCA components that described 80% of the variance. We then used these components as the features in our logistic regression model. This model did not perform as well as the differential ATAC site model and was not used for further analysis.After training and testing a logistic regression model using the bootstrapping approach on the MBC cohort and features from griffin profiles around differential ATAC sites, we applied the final model to the three previously unseen validation cohorts. To get this final model, we trained a logistic regression model on the full MBC dataset (254 samples) using the regularization strength most frequently chosen by the 1000 bootstraps on the MBC cohort (\u2018C\u2019\u2009=\u20090.1). We then applied this model to the three validation cohorts and got the probability of ER\u2009+\u2009for each sample. For patients with multiple samples (in the independent MBC cohort) we used the first timepoint when evaluating performance, resulting in a total of 71 samples from unique patients across all three cohorts. We obtained confidence intervals for the accuracy and AUC using a bootstrap procedure in which we selected 71 samples with replacement from the original 71 samples and calculated the AUC and accuracy for the selected samples. We repeated this procedure 1000 times to get 1000 AUC and accuracy values which we used to obtain confidence intervals and boxplots.https://github.com/PeterUlz/TranscriptionFactorProfiling)44 and ran it using the following procedure as described in the paper. hg19 aligned bam files were used because the pipeline was written to for this version of the genome. Scripts were modified so that they worked in python3. We trimmed the reads in each bam to 60\u2009bp using \u2018trim from bam single end\u2019 with modifications to skip unaligned reads. We ran ichorCNA on the original (untrimmed) bam using the default ichorCNA settings for hg19 except the bin size, which was modified to 50,000\u2009bp and no panel of normals. We then ran the transcription factor profiling analysis on the trimmed bam using the script run_tf_analyses_from_bam.py with options \u2018-calccov\u2019 and \u2018-a tf_gtrd_1000sites\u2019 and the ichorCNA corrected depth file as the \u2018-norm-file\u2019. This ran transcription factor profiling on 1,000 sites for each of 504 TFs. Finally, we ran the scoring pipeline. We used the high frequency amplitude (\u2018HighFreqRange\u2019) for each of the 504 TFs in the accessibility output file (Accessibility1KSitesAdjusted.txt) as the features for a logistic regression model using the same bootstrapping with PCA dimensionality reduction as described for cancer detection and ER status prediction from TFBSs above.We downloaded the Transcription Factor Profiling pipeline published by Ulz and colleagues from Github (Further information on research design is available in the\u00a0Supplementary FiguresPeer Review FileDescription of Supplementary DataDataset 1Dataset 2Dataset 3Dataset 4Dataset 5Dataset 6Dataset 7Dataset 8Dataset 9Dataset 10Dataset 11Dataset 12Dataset 13Dataset 14Dataset 15Dataset 16Reporting Summary"}
+{"text": "Objective: To quantify the effect of taekwondo as an intervention on the indicators of metabolic syndrome and identify an intervention plan with the optimal effects.Methods: Combining the Cnki.net, Wanfang, PubMed, Web of Science, Embase, KISS, RISS, and DBPIA databases, this paper retrieved relevant references in Chinese, English, and Korean, applied Review Manager 5.4 software to evaluate the methodological quality of the included references according to the Cochrane manual, and utilized Comprehensive Meta-Analysis version 3.7 to perform statistical analyses.Result: A total of 45 references and 1079 related subjects were included in the analysis. The results of the meta-analysis showed that taekwondo has a beneficial effect on all indicators of metabolic syndrome . Subgroup analysis revealed the superior intervention effect of taekwondo on metabolic syndrome in women compared to men, middle-aged and elderly compared to other age groups, and abnormal metabolic syndrome indicators compared to normal values. Moreover, the best results were obtained for longer intervention durations\u201412\u00a0weeks\u2014three times per week, for 40\u201350\u00a0min per session. In addition, the combination of intervention types  showed optimal effects. The exercise intensity should consider the characteristics of the intervention object and be generally set to medium or high intensity.Conclusion: Taekwondo can effectively improve metabolic syndrome, as evidenced by decreased body mass index (BMI), systolic blood pressure (SBP), diastolic blood pressure (DBP), fasting blood glucose (FBG), and triglyceride (TG) levels and increased high-density lipoprotein cholesterol (HDL-C) level. Taekwondo had the greatest effect on quinquagenarian women with abnormal levels of metabolic syndrome indicators. To maximize the intervention effect of taekwondo on metabolic syndrome, an exercise prescription of high-intensity poomsae, kick, and taekwondo gymnastics performed in 40\u201350\u00a0min sessions, three times weekly for 12\u00a0weeks is recommended. Clinical Trial Registration:https://www.crd.york.ac.uk/prospero/, identifier CRD42022362495Metabolic syndrome (MS) is the physiological and metabolic accumulation of cardiovascular risk factors, as indicated by abdominal obesity and high triglyceride (TG), blood pressure (BP), fasting blood glucose (FBG), and high-density lipoprotein cholesterol (HDL-C) levels . CurrentTaekwondo has positive effects on obesity, BP, TG, FBG, HDL-C, and other MS indicators in addition to enhancing the physical fitness of participants . HoweverThe present meta-analysis was performed to quantify the effect of taekwondo interventions on MS indicators and identify intervention plans that can produce the optimized intervention effect. These results will serve as a reference for future research on MS interventions.This meta-analysis is based on the PRISMA 2020 checklist and was registered in PROSPERO (registration number: CRD42022362495).Chinese, Korean, and English databases, including CNKI, Wanfang Data, KISS, RISS, DBPIA, PubMed, Web of Science, and Embase databases, were searched to maximize literature retrieval. Articles that had been indexed as of 25 September 2022 were included. Using the \u201ckeyword\u201d + \u201ckeyword\u201d search strategy, we looked for terms using both their full names and their abbreviations. The detailed search strategies are included in the n and T) values of the control and intervention groups; 4) reported differences in means and sample size (n and T) values between the control and intervention groups; and 5) reported means, sample size (n), and p-values of control and intervention groups.Two researchers (ZH and HJ) separately searched the literature using the PICOS method. In cases of disagreement, a decision was reached after debate; in cases where discussion failed to produce a consensus, the supervising professor made the final call. The inclusion criteria were as follows: 1) unlimited research objects; 2) taekwondo training interventions of any kind, including poomsae, kick, and taekwondo gymnastics, other dietary interventions, and combined treatments were not included in the intervention group; 3) control groups performing regular activities according to everyday routines; 4) study indicators including BMI, SBP, DBP, FBG, TG, and HDL-C; and 5) randomized controlled studies (RCTs) study. Studies for which the effect size could not be calculated from the reported data were also eliminated. The data reported in the article only needed to meet one of the following conditions to calculate the effect size: 1) reported means, standard deviation (SD), and sample size (n) of the control and intervention groups; 2) reported differences in means, common SD, and sample size (n) between the control and intervention groups; 3) reported means and sample size (Two researchers independently completed data extraction (ZH and HJ). Duplicate references were first removed, and irrelevant studies were removed after reading the article\u2019s title and abstract. The studies included in the meta-analysis were then strictly screened by reading the whole text for compliance with the inclusion criteria. Information such as the article title, first author, publication year, sample size, major result details, subject characteristics, intervention type, and other details was retrieved during the screening process. Disagreements during the data extraction process were resolved through conversation. The supervising professor made the final judgment if a consensus could not be achieved following the discussion.Two researchers (ZH and HJ) independently evaluated the selection bias conduct bias, measurement bias, follow-up bias, reporting bias, and other biases of each included study, using Review Manager 5.4 software according to the Cochrane Review manual. Each bias\u2019s risk was divided into three categories: high, low, and unclear. Additionally, publication bias was assessed using the funnel plot and Egger\u2019s test.Review Manager 5.4 was used to assess the risk of bias. Comprehensive Meta-Analysis 3.7 was used to examine the remaining studies.2 and p of the heterogeneity test are typically used to determine heterogeneity, with I2 < 25%, 25% > I2 > 50%, and I2 > 75% typically used to denote low, moderate, and high heterogeneities  and highly  heterogeneous, respectively. The findings demonstrated that each MS indicator significantly improved because of the taekwondo intervention  than in women . According to age group, the intervention effect in children and adolescents  was greater than that in quinquagenarians  and was not significant in young people (p > 0.05). Regarding BMI, the intervention effect  was smaller than normal  in overweight or obese people. Regarding intervention cycle, the effects were strong for 12\u00a0weeks  and more than 12\u00a0weeks , indicating that the intervention effect increased with increased intervention cycles. Regarding intervention duration, the intervention effect of 60\u00a0min per session showed a moderate effect , while the intervention effect of 70\u201390\u00a0min per time was not significant (p > 0.05). Regarding intervention frequency, the effect of interventions performed three times a week  was greater than that of five times a week . Regarding intervention type, the intervention effect of poomsae was the best , followed by poomsae + kick  and poomsae + kick + taekwondo gymnastics . The intervention effect of poomsae + taekwondo gymnastics was not significant (p > 0.05). The intervention effect of moderate-intensity interventions  was lower than that of high-intensity interventions .The results of the BMI subgroup analysis are shown in p > 0.05) but was large in women . According to age group, the intervention effect in quinquagenarians  was much larger than that in children and adolescents . Regarding SBP, the intervention effect in the abnormal population  was much greater than that in the normal population . Regarding intervention frequencies, three times a week showed a moderate effect , while five times a week showed no significant effect (p > 0.05). Regarding intervention types, poomsae + taekwondo gymnastics showed the best effect , followed by poomsae + kick + taekwondo gymnastics  and poomsae + kick . The intervention effect of poomsae was not significant (p > 0.05). The intervention effect of moderate intensity intervention  was higher than that of high intensity .The results of the SBP subgroup analysis are shown in p > 0.05), while a large effect was observed in women . According to age groups, the intervention effect was not significant in children and adolescents (p > 0.05) but showed a large effect in quinquagenarians . Regarding DBP, the intervention effect was large for abnormal DBP  and not significant for normal DBP (p > 0.05). Regarding intervention frequencies, three times a week showed a moderate effect , while five times a week showed no significant effect (p > 0.05). No intervention type showed a significant intervention effect (p > 0.05). Regarding exercise intensities, the intervention effect was large for moderate intensity  but not significant for high intensity (p > 0.05).The results of the DBP subgroup analysis are shown in p < 0.001) than in women . According to age group, the intervention effect was large in children and adolescents  but was not significant in quinquagenarians (p > 0.05). Regarding FBG, the intervention effect was slightly higher in the abnormal population  than in the normal population . Regarding intervention duration, the effect of a 40\u201350\u00a0min intervention  was slightly greater than that of a 60\u00a0min intervention . The effect of interventions performed five times a week  was greater than that of interventions three times a week . Among different intervention types, the intervention effect of poomsae + kick + taekwondo gymnastics  was significantly higher than that of poomsae . The intervention effect of poomsae + kick was not significant (p > 0.05). The effect of high-intensity exercise  was significantly higher than that of moderate-intensity exercise .The results of the FBG subgroup analysis are shown in p < 0.05) than in women . According to age group, the intervention effect was greatest in quinquagenarian , followed by children and adolescents  and young subjects . Regarding TG, the intervention effect in the abnormal population  was greater than that in the normal population . Regarding intervention cycles, the effect of 12\u00a0weeks  was greater than that of more than 12\u00a0weeks . Regarding intervention duration, a single intervention of 70\u201390\u00a0min showed a moderate effect , while a single intervention of 60\u00a0min showed no significant effect (p > 0.05). Regarding intervention frequencies, three times a week had a moderate effect , while five times a week showed no significant effect (p > 0.05). Regarding intervention types, poomsae showed the best effect , followed by poomsae + kick + taekwondo gymnastics  and poomsae + kick . The effect of high-intensity exercise (ES = \u22120.74 (p < 0.001) was more significant than that of moderate-intensity exercise (ES = \u22120.55 (p < 0.001).The results of the TG subgroup analysis are shown in p > 0.05), while the intervention effect in females was moderate . According to age group, the intervention effect in quinquagenarian  was greater than that in children and adolescents , with no significant difference in the intervention effect in young people (p > 0.05). In the HDL-C group, the intervention effect in the abnormal population showed a large effect , while the intervention effect in the normal population was not statistically significant (p > 0.05). According to intervention duration, a single intervention of 60\u00a0min had a moderate effect , while the effect of 40\u201350\u00a0min was not statistically significant (p > 0.05). Regarding intervention frequencies, the effect of interventions performed five times a week  was slightly higher than that for three times a week . Among intervention types, the intervention effect of poomsae  was lower than that of poomsae + kick + taekwondo gymnastics , with no significant effects in other intervention types (p > 0.05). The effect of high-intensity interventions  was significantly greater than that of moderate-intensity interventions .The results of the HDL-C subgroup analysis are shown in The intervention effects of each indicator for various intervention characteristics were merged to identify the greatest intervention effect of taekwondo on each indicator after eliminating ineffective subgroups . This process required two steps. First, whether the intervention frequency, when used in the same intervention cycle, had the best effect on each indicator was assessed. Second, which exercise intensity and intervention type have the best results for each indicator when used for the same duration of effect throughout a single intervention were determined. The results are displayed in 2 = 13.1,48.49; p > 0.05), suggesting that sex and exercise intensity were sources of inter-study heterogeneity. Abnormal and normal heterogeneity became insignificant in the subgroup of HDL-C MS indicator characteristics , indicating that the source of heterogeneity in HDL-C studies may be related to these factors. The other indicators showed no significant subgroup heterogeneity.By assessing the heterogeneity between subgroups, this study investigated the source of heterogeneity in all indicators. Male and female heterogeneity in the FBG, sex, and exercise intensity subgroups was not significant (Ip < 0.05), indicating that the intervention effect of taekwondo on DBP may be influenced by age and DBP characteristics. HDL-C characteristics also showed a significant regulatory effect (p < 0.05), indicating that the intervention effect of taekwondo on HDL-C may be influenced by HDL-C characteristics. The moderating effects of each variable in the other indicators were not significant.Age and DBP characteristics showed significant regulatory effects . Numerous studies reported the necessity for consistent, long-term physical exercise to successfully alter body composition and lower cardiovascular risk factors . MoreoveRegarding intervention frequencies, omitting ineffective subgroups (containing fewer than three studies), the results of the present study showed the highest intervention effect for 40\u201350\u00a0min sessions performed three times. This prescription is close to the recommendation from the American College of Sports Medicine  . Kodama Our findings showed that high-intensity taekwondo had a greater impact on the other MS indicators except for SBP and DBP. In general, moderate to high aerobic exercise is advised to prevent or reduce cardiovascular risk factors . HoweverRegarding intervention types, it was challenging to determine which type of comprehensive intervention has the best effect from the results after omitting ineffective subgroups (those with fewer than three studies). Thus, a 3D bar chart was created using the intervention effect size of four different intervention types on each MS indicator . Poomsae1) This study included only studies in Chinese, Korean, and English. However, except for one Chinese study, all the experimental regions were in South Korea and the subjects were predominantly Korean, which limited the generalizability of the findings. 2) An excessive number of invalid subgroups in the subgroup analysis hindered the output of the research results. 3) The indicators of reported exercise intensity differed among the studies. Even if the units were unified through secondary classification, there remained some variations, particularly for some indicators close to the intensity threshold, which may lead to errors in grading and, ultimately, errors in the results.The results showed that taekwondo effectively improved MS, as manifested by decreased BMI, SBP, DBP, FBG, and TG levels and increased HDL-C level. To maximize the intervention effect of taekwondo on MS, high-intensity poomsae + kick + taekwondo gymnastics training is recommended as an exercise prescription three times weekly for 40\u201350\u00a0min per session for 12\u00a0weeks. In addition, for single indicators, the recommended exercise prescriptions are as follows: 1) BMI, three times weekly for 60\u00a0min per session, moderate-intensity poomsae training for >12\u00a0weeks; 2) SBP, moderate-intensity poomsae + kick + taekwondo gymnastics training for 12\u00a0weeks, three times per week, 60\u00a0min per session; 3) DBP, moderate-intensity taekwondo for 60\u00a0min three times per week for 12\u00a0weeks; 4) FBG, 60\u00a0min of high-intensity poomsae + kick + taekwondo gymnastics training five times per week for 12\u00a0weeks; 5) TG, high-intensity poomsae + kick + taekwondo gymnastics three times per week, 60\u00a0min per session, for 12\u00a0weeks; 6) HDL-C, moderate-intensity poomsae + kick + taekwondo gymnastics training for 60\u00a0min five times a week for 12\u00a0weeks. Given the limitations of this study, more well-designed RCTs and systematic reviews are needed to improve such studies in the future."}
+{"text": "Although the biosynthetic mechanisms of FA are established, its environmental degradation mechanism has not been fully elucidated. The present study aimed to identify bacteria in soil that degrade FA and the mechanisms involved.Folic acid (FA) is a synthetic vitamin (BVariovorax sp. F1 from sampled weed rhizospheres in a grassland and investigated its FA degradation mechanism. Cultured Variovorax sp. F1 rapidly degraded FA to pteroic acid (PA), indicating that FA hydrolysis to PA and glutamate. We cloned the carboxypeptidase G (CPG) gene and found widely distributed paralogs within the Variovorax genus. Recombinant CPG preferred FA and deaminofolic acid as substrates, indicating its involvement in FA degradation by Variovorax. Prolonged culture of Variovorax sp. F1 resulted in decreased rates of deaminofolic acid (DFA) and deaminopteroic acid (DPA) accumulation. This indicated that the deamination reaction also comprised a route of FA degradation. We also identified an F1 gene that was orthologous to the pterin deaminase gene (Arad3529) of Agrobacterium radiobacter. The encoded protein deaminated FA and PA to DFA and DPA, which was consistent with the deamination activity of FA and PA in bacterial cell-free extracts.We isolated the soil bacterium Variovorax sp. F1 comprise CPG and pterin deaminase, and that DFA and PA are intermediates in the generation of DPA.We discovered that the two enzymes required for FA degradation pathways in isolates of The online version contains supplementary material available at 10.1186/s12866-022-02643-6. C, D at rely Fig. E. These ely Fig. . Since tVariovorax F1 protein orthologous to A. radiobacter K84 PDA (Arad3529) which was the only PDA identified to date as an enzyme that deaminates FA to DFA. Database searches identified a predicted deaminase (WP 068679287) in many Variovorax spp. that has 36.0% amino acid sequence identity with Arad3529. We aimed to construct a set of primers with a conserved nucleotide sequence among V. paradoxus orthologs to clone the corresponding gene in F1 strain. However, we found a conserved sequence for the primer corresponding to the 5\u2032-, but not the 3\u2032-end of the gene. We therefore designed a 3\u2032-end primer with reference to conserved endoribonuclease genes located downstream of the predicted PDA genes in the V. paradoxus genome. The Variovorax sp. F1 PDA gene was amplified by PCR using the primers for the conserved nucleotide sequences and total DNA of Variovorax sp. F1. The DNA fragment contained a gene encoding 399 amino acid residues that were 76.7 and 37.0% identical, respectively, to the protein predicted from V. paradoxus S110 (Vapar5141) and Arad3529. These proteins were hydrolases that act on non-peptide carbon-nitrogen bonds (EC 3.5), which are diverse among bacteria. The Variovorax paradoxus S110 genome encodes 89 such hydrolases. Our phylogenetic analyses classified many of these enzymes based on the molecular structures of the substrates that they hydrolyze .The accumulation of DFA and DPA in culture medium of the F1 strain . The LC-MS findings showed a parent mass ion peak at m/z\u2009=\u2009441.2 ([M\u2013H]\u2212), which corresponded to the molecular mass (Mr 442) of DFA  from AGE Fig.\u00a0A. The reAGE Fig.\u00a0B, left. \u2212\u20091\u2009mg\u2212\u20091. The reaction kinetics fit the Michaelis-Menten equation, with Km and kcat values of 0.28\u2009\u00b1\u20090.06\u2009mM and 10.1\u2009\u00b1\u20090.4\u2009s\u2212\u20091 for FA, and 1.5\u2009\u00b1\u20090.6\u2009mM and 0.62\u2009\u00b1\u20090.06\u2009s\u2212\u20091 for PA , the latter of which shares a guanidine moiety with pterins that are deaminated by PDAs.The initial velocity of the PDA for deaminating FA and PA (1\u2009mM each) was respectively 11.7\u2009\u00b1\u20091.2 and 0.31\u2009\u00b1\u20090.05\u2009\u03bcmol\u2009min\u2212\u20091\u2009mg\u2212\u20091  and explains why FA breakdown generated PA as a major product at a relatively rapid rate . The F1 PDA was located in the same branch as other predicted Variovorax proteins and Arad3529  identified herein  have remained unexplored. The present study isolated the novel soil-bacterium 2PO4, 10\u2009mM KCl, 20\u2009mM NH4Cl, 10\u2009mM MgSO4, and 0.1% trace elements [Soil microorganisms that degrade FA were enriched by culture in Minimal M9 Medium comprising 10\u2009mM KHelements  (pH\u20097.2)g and 4\u2009\u00b0C for 5\u2009min to remove insoluble materials before separation by anion exchange HPLC under the following conditions: column, TSKgel SAX column (6.0\u2009mm\u2009\u00d7\u200915.0\u2009cm) ; linear gradient of 100 to a 60:40 ratio of aqueous 0.1\u2009M NaOH containing 1\u2009M NaCl (pH\u200912.5) to 50% acetonitrile in 0.1\u2009M NaOH; column temperature, 30\u2009\u00b0C; flow rate, 1.0\u2009mL\u2009min\u2212\u20091. Folic acid, PA, DFA and DPA were detected in eluates as absorption at 254\u2009nm using a 1260 Infinity system equipped with a photodiode array detector .Samples were dissolved in 0.1\u2009M NaOH containing 1\u2009M NaCl (pH\u200912.5), and centrifuged at 20,400\u00d7\u2212\u20091Variovorax sp. F1 rPDA at 30\u2009\u00b0C for 12\u2009h. The rPDA was denatured with 1\u2009M NaOH, then the pH of the reaction was reduced to <\u20094.0 with 1\u2009M HCl to precipitate DFA with >\u200999% purity. Deaminopteroic acid was produced by incubating the DFA (~\u20090.5\u2009g) with 5\u2009\u03bcg\u2009mL\u2212\u20091 rCPG in 0.1-L 50\u2009mM Tris-HCI (pH\u20097.5) containing 0.2\u2009mM ZnSO4 at 30\u2009\u00b0C for 6\u2009h, then purified as described above to >\u200999%. The DFA and DPA were confirmed by liquid chromatography-mass spectrometry (LCMS). An LCMS 8030 spectrometer  was equipped with a Purospher\u00ae STAR RP-18 endcapped column  and the flow rate of a 40-min linear gradient from 0 to 40% acetonitrile in 0.05% formic acid was 0.8\u2009mL\u2009min\u2212\u20091. Mass ions were detected in the negative mode under the following conditions: probe voltage, 3.5\u2009kV; detection range, m/z\u2009=\u200910\u2013500 for DFA (precursor m/z 441) and 10\u2013400 (precursor m/z 312) for DPA; column temperature, 40\u2009\u00b0C; desolvation line temperature, 250\u2009\u00b0C; heat block temperature, 400\u2009\u00b0C; nebulizer gas, 3\u2009L\u2009min\u2212\u20091; drying gas, 15\u2009L\u2009min\u2212\u20091.Folic acid (0.88\u2009g) in 0.1-L 50\u2009mM Tris-HCI (pH\u20097.5) was incubated with 5\u2009\u03bcg\u2009mLVariovorax paradoxus S110 proteins in the KEGG database.Amino acid sequences obtained from GenBank databases were aligned using CLUSTAL W . A phyloVariovorax bacteria were compared with conserved sequences among the genes using the Basic Local Alignment Search Tool (BLAST), and the (5\u2019\u21923\u2032) primers: ACCATCATCACCACAGCCAGGATCCGATGCGTCCGAGCATCCAT and TTAAGCATTATGCGGCCGCAAGCTTTCATTTGCCAGCAC. A DNA fragment encoding the CPG of the Variovorax sp. F1 CPG gene was amplified by PCR in a mixture containing these primers, bacterial total DNA, and Ex Taq\u00ae DNA Polymerase  at 94\u2009\u00b0C for 5\u2009min followed by 30\u2009cycles of 98\u2009\u00b0C for 10\u2009s, 55\u2009\u00b0C for 30\u2009s, 72\u2009\u00b0C for 1\u2009min with an additional 7\u2009min at 72\u2009\u00b0C for the final cycle. The amplified DNA was fused to pRSFDuet-1 (Merck KGaA) and digested with BamHI and HindIII using NEBuilder HiFi DNA Assembly Master Mix . Escherichia coli BL21 (DE3) (Merck KGaA), harboring the fused plasmid was incubated in LB medium for 12\u2009h, then portions (1\u2009mL) were cultured in 100\u2009mL of fresh LB medium at 37\u2009\u00b0C until the OD600 reached 0.5\u20130.6. Isopropyl \u03b2-d-1-thiogalactopyranoside  was added to induce rCPG production, then cultures were shaken for 18\u2009h at 80\u2009rpm and 28\u2009\u00b0C.Nucleotide sequences of putative CPG2 genes from various g for 10\u2009min at 4\u2009\u00b0C, washed twice with 5\u2009mL of 20\u2009mM sodium phosphate (pH\u20097.4) and 20\u2009mM imidazole, then sonicated on ice for 200\u2009s at 30% output on a 35% duty cycle using a Branson Sonifier\u00ae 250 . After centrifugation for 10\u2009min at 6,500\u00d7g, the supernatant was applied to a 1-mL HisTrap\u2122 FF crude column , washed with 20\u2009mM sodium phosphate (pH\u20097.4) containing 0.2\u2009M NaCl and 20\u2009mM imidazole, then rCPG was eluted with 20\u2009mM sodium phosphate (pH\u20097.4) containing 0.2\u2009M NaCl and 200\u2009mM imidazole. The eluates were concentrated to 1\u2009mL and the solvents were replaced with 20\u2009mM Tris-HCl (pH\u20097.4) using an Amicon\u00ae Ultra-4 Centrifugal Filter Unit Ultracel-30 (Merck KGaA). Proteins were resolved by SDS-PAGE as described by Laemmli [Cells were harvested by centrifugation at 6,500\u00d7 Laemmli .Variovorax species (WP 068679287) were compared with the predicted genes of V. paradoxus strains and their nucleotide sequences. Conserved sequences were extracted to design the (5\u2019\u21923\u2032) primers ATGAAGCTCGAGGCCGTCCGC and TACTCGTACCCGTTCGGTTAC respectively corresponding to the 5\u2032 ends of the V. paradoxus genes and the downstream endoribonucleotidase gene. We amplified a DNA fragment encoding the Variovorax sp. F1 PDA gene by PCR using the same primers, total DNA and other conditions used to amplify the CPG genes. The PDA genes were amplified using the rPDA primers ATTTCATATGAAGCTCGAGGCCGTCCGC and CTAACTCGAGTCATGCAATGT TCTCCTGTGA, then amplicons were digested with NdeI and XhoI, cloned into pET28a , and introduced into E. coli BL21 (DE3). Transformants were cultured in LB medium at 30\u2009\u00b0C until the OD600 reached 0.5\u20130.6, after which IPTG  was added to induce gene expression overnight at 25\u2009\u00b0C. The rPDA was purified as described for rCPG.Orthologs to the predicted deaminase conserved among multi-4 and appropriate amounts of rCPG at 30\u2009\u00b0C, then the outcomes were analyzed by HPLC as described above. Substrates in the reaction buffer were incubated at 30\u2009\u00b0C for 5\u2009min, followed by reactions with a final concentration of 5\u2009\u03bcg\u2009mL\u2212\u20091 rCPG for 5\u2009min. Enzyme reactions of rPDA proceeded in 50\u2009mM Tris-HCl (pH\u20097.5) with appropriate amounts of rPDA at 30\u2009\u00b0C, and were analyzed by HPLC under the same conditions. The enzyme concentration was determined by the Bradford method using Protein Assay Dye Reagent  as described by the manufacturer.Enzyme reactions of CPG proceeded in 50\u2009mM Tris-HCl (pH\u20097.5) containing 0.2\u2009mM ZnSOVariovorax sp. F1 was cultured in M9-FA medium at 28\u2009\u00b0C for 24\u2009h, harvested by centrifugation at 5100\u00d7g for 10\u2009min, and washed with ice-cold 20\u2009mM Tris-HCI (pH\u20097.2). Cells were resuspended in 5\u2009mL of 50\u2009mM Tris-HCI (pH\u20097.2) and disrupted as described above. The supernatants were filtered through a 0.45-\u03bcm CA syringe filter (Merck KGaA) to obtain cell-free extracts. The preparation  in 50\u2009mM Tris-HCl (pH\u20097.5) containing 0.2\u2009mM ZnSO4 was reacted with purified FA, PA, DFA and AGB that were subsequently quantified by HPLC as described above.Additional file 1: Fig. S1. Determination of DFA and DPA. Fig. S2. Dependence of rCPG activity on substrate concentration.Additional file 2: Supplementary Table S1. Bacteria isolated from grassland weed rhizosphere."}
+{"text": "In the past decades, the incidence of obesity has increased worldwide. This disease is often accompanied with several comorbidities and therefore, surgeons and anesthesiologists should be prepared to provide optimal management for these patients. The aim of this descriptive cross-sectional study was to map the criteria and routines that are used by Swedish knee arthroplasty surgeons today when considering patients with obesity for knee arthroplasty.A survey including 21 items was created and sent to all the Swedish centers performing knee arthroplasty. The survey included questions about the surgeons\u2019 experience, hospital routines of preoperative information given and the surgeons\u2019 individual assessment of patients with obesity that candidates for knee arthroplasty. Descriptive statistics were used to present the data.A total of 203 (64%) knee surgeons responded to the questionnaire. Almost 90% of the surgeons claimed to\u00a0inform their patients with obesity that obesity has been associated with an increased risk of complications after knee arthroplasty. Seventy-nine percent reported that they had an upper BMI limit to perform knee arthroplasty, a larger proportion of the private centers had a BMI limit compared to public centers. The majority of the centers had an upper BMI limit\u00a0of 35.The majority of the knee arthroplasty surgeons in Sweden inform their patients with obesity regarding risks associated with knee arthroplasty. Most centers that perform knee arthroplasties in Sweden have an upper BMI limit. Obesity has increased in the past few decades and is identified as a global epidemic , 2. PatiObesity is a prominent risk factor for osteoarthritis (OA) , 6 and hDespite the considerable benefits associated with knee arthroplasty, unfavorable outcomes do occur. Approximately 4% of patients with primary total knee arthroplasty due to OA experience an adverse event within 90\u00a0days  in SwedeTherefore, the aim of this descriptive cross-sectional study was to map the criteria and routines used for patients with obesity when considering knee arthroplasty among Swedish knee arthroplasty surgeons. Furthermore, we evaluated how these patients are informed preoperatively about the potential risk of pre- and postoperative complications.A survey\u00a0in Swedish, including 21 items, was developed and created by the authors. The survey was sent by mail to the 64 centers in Sweden performing knee arthroplasty in late April 2022 with a deadline to answer within one month. A reminder was sent by mail after approximately two weeks. The units performing knee arthroplasty in Sweden and a contact person of knee arthroplasty of each unit were obtained from Swedish Arthroplasty Register (SAR). Since the number of knee arthroplasty surgeons of each center was unknown, it was not possible to send the survey electronically.The survey took approximately 2\u20133\u00a0min to complete. The survey included questions about the surgeons\u2019 experience, routines of preoperative information of the hospital and the surgeons\u2019 individual assessment of patients with obesity that candidates for knee arthroplasty (Appendix 1). A five-point Likert scale was used when appropriate, and some of the questions was answered with yes or no. The surgeons were also asked to state which hospital they worked at. An attachment that included more detailed information about the study and questions regarding the number of knee arthroplasty surgeons working on each center was enclosed in the letter to the contact person. The aim of this attachment was to collect the total number of knee arthroplasty surgeons on each\u00a0center.In order to collect the total number of non-responders, a phone call was made to all the centers which had not sent back the attachment of the survey by the end of the deadline, to collect the total number of knee arthroplasty surgeons on each center.Descriptive statistics were used to present the data. Frequencies of the answers were presented in numbers and percentages, while Body Mass Index (BMI) limits were presented with median and interquartile range. Missing data were excluded from all analyses. Statistical Package for the Social Sciences was used for the statistical analyses.A total of 319 knee arthroplasty surgeons were reported to work at the 64 knee arthroplasty centers in Sweden. However, several of the surgeons work temporarily at several units and in those cases were counted more than once. The number of knee surgeons is in line with a previous study that sent out questionnaires to Swedish knee arthroplasty surgeons . In the All the responding knee arthroplasty surgeons reported that they inform the patients about surgical risks and complications after knee arthroplasty. Almost 90% of the surgeons inform their patients with obesity that obesity has been associated with an increased risk of complications after knee arthroplasty Table , Fig.\u00a01.We found similar answers in providing information preoperatively regarding obesity  depending on the surgeon\u2019s experience as an orthopedic specialist . Furthermore, we found similar answers in adherence to the BMI limits when scheduling\u00a0patients with BMI\u00a0\u226535 for knee arthroplasty depending on the surgeon\u2019s experience as an orthopedic specialist.This descriptive study indicates that all the responding knee arthroplasty surgeons provide their patients with general information preoperatively regarding the risks with knee arthroplasty, of whom almost 90% inform their patients about the increased\u00a0risks with obesity associated with knee arthroplasty. The majority of the clinics also had an upper limit of BMI for knee arthroplasty.Obesity has been linked to worse outcomes after TKA and patients with obesity have been shown to have an increased risk of revision after TKA in several studies \u201317. SezgA study published by Ledford et al.  reportedWeight loss is one of the first-line treatments of knee OA according to the Swedish national guidelines , and shoA cross-sectional study assessing preoperative nutritional status in patients who were candidates to BS found that malnutrition, particularly in vitamin D and iron, was pervasive in these patients . Mosli eA previous Swedish study analyzed patients operated with knee arthroplasty between 1981 and 1997 and found that 8% of the patients were not satisfied regarding their knee surgery 2\u201317\u00a0years postoperatively. The satisfaction was affected by the preoperative diagnosis leading to surgery, e.g. rheumatic disease and OA. However, preoperative BMI was not taken into consideration . AnotherWhen extracting the knee surgeons who answered that they refuse a patient for knee arthroplasty due to obesity, 83% reported that they based their decision on previous studies. There are limited prospective interventional studies available regarding obesity preoperatively to knee arthroplasty. The evidence is not clear regarding the use of an upper BMI limit as an inclusion criterion to perform knee arthroplasty in order to improve postoperative outcomes after TKA. The majority of surgeons in both the private and public centers answered that their center had 35 as an upper BMI limit. However, all private centers except one reported knee arthroplasties in patients with BMI\u2009\u2265\u200935, and only two of the public centers reported no knee arthroplasties in patients with BMI\u2009\u2265\u200935 in 2021. According to the SAR, the prevalence of performing knee arthroplasty in patients with morbid obesity (BMI\u2009\u2265\u200940) is low (1%) .This descriptive cross-sectional study based on a questionnaire has limitations of this type of design. In addition, the questionnaire was created by the authors which suffers from the absence of validation and psychometric analysis of the survey. However, to the authors knowledge,\u00a0there are no validated questionnaires that evaluate these type of questions. Furthermore, this is a hypothesis generating study with the aim to yield ideas for further studies. The responses obtained in this current study could be considered to be representative of the knee arthroplasty surgeons in Sweden due to a relatively high response rate. When the answers were compiled, it appeared from the comments at the end of the survey that several surgeons did not know the correct definition of revision and the difference between overweight and obesity, which could have been more clearly explained in the survey. This effects the answers in questions 5 and 6 (Appendix 1). Finally, this study evaluated the frequency of surgeons who provided information to their patients and excludes the quality of the information given. The exact information that is given by the surgeons or received by the patients could be of value as it possibly affects both the patients\u2019 expectations, and also their satisfaction rates. Considering that this is a descriptive cross-sectional study with the aim to map the criteria and routines using a questioner that has not been validated, the authors want to be careful to give any recommendations using only this paper. Further, studies with a higher grade of evidence are probably required before any type of recommendations are given regarding the management of this patient population.There is limited evidence on how to manage patients with obesity preoperatively to knee arthroplasty,\u00a0and whether to have an upper BMI limit or not. This descriptive study indicates that the majority of the knee arthroplasty surgeons in Sweden inform their patients with obesity regarding risks of knee arthroplasty. Furthermore, most centers that perform knee arthroplasties in Sweden have an upper BMI limit. Further studies on this topic are encouraged by the authors."}
+{"text": "TCF7 gene) can be used as a critical determinant of successful anti-tumor immunotherapy and a prognostic indicator in some solid tumors; however, the effects of TCF1 in CLL remain unclear. Here, we first analyzed the biological processes and functions of TCF1 and co-expressing genes using the GEO and STRING databases with the online tools Venny, Circos, and Database for Annotation, Visualization, and Integrated Discovery (DAVID). Then the expression and prognostic values of TCF1 and its partner gene B cell leukemia/lymphoma 11B (BCL11B) were explored for 505 CLL patients from 6 datasets and validated with 50 CLL patients from Henan cancer hospital (HNCH). TCF1 was downregulated in CLL patients, particularly in CD8+ T cells, which was significantly correlated with poor time-to-first treatment (TTFT) and overall survival (OS) as well as short restricted mean survival time (RMST). Function and pathway enrichment analysis revealed that TCF1 was positively correlated with BCL11B, which is involved in regulating the activation and differentiation of T cells in CLL patients. Intriguingly, BCL11B was highly consistent with TCF1 in its decreased expression and prediction of poor prognosis. More importantly, the combination of TCF1 and BCL11B could more accurately assess prognosis than either alone. Additionally, decreased TCF1 and BCL11B expression serves as an independent risk factor for rapid disease progression, coinciding with high-risk indicators, including unmutated IGHV, TP53 alteration, and advanced disease. Altogether, this study demonstrates that decreased TCF1 and BCL11B expression is significantly correlated with poor prognosis, which may be due to decreased TCF1+CD8+ T cells, impairing the effector CD8+ T cell differentiation regulated by TCF1/BCL11B.T cell immune dysfunction is a prominent characteristic of chronic lymphocytic leukemia (CLL) and the main cause of failure for immunotherapy and multi-drug resistance. There remains a lack of specific biomarkers for evaluating T cell immune status with outcome for CLL patients. T cell factor 1 (TCF1, encoded by the  CLL  contact , 6, and  contact . Exhaust contact , 8, 9. HTCF7) gene (T cell factor-1 (TCF1) is a transcription factor encoded by the transcription factor 7 (F7) gene . As one F7) gene , 12. ActF7) gene \u201317. AddiF7) gene , 18\u201320. F7) gene \u201324. UponF7) gene . RecentlF7) gene , 24, 26.F7) gene , 28. MulF7) gene , 30. HowTCF7-related co-expressing genes using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) database. Lastly, the above findings were validated with 50 CLL patients from our clinical center Henan Cancer Hospital (HNCH), revealing that both TCF1 and BCL11B participate in the regulation of T cell immunity and further determine the prognosis of patients with CLL.In this study, we first performed a variety of bioinformatic analysis of TCF1 expression and examined the effects of TCF1 on the time-to-first treatment (TTFT), overall survival (OS) and restricted mean survival time (RMST) for patients with CLL from public datasets. Furthermore, a protein-protein interaction (PPI) network of co-expressing genes was constructed using STRING, and we performed KEGG pathway and biological process analysis of significant, Peripheral blood samples from 50 patients with CLL, including 32 newly diagnosed patients and 18 refractory/relapsed (R/R) patients, and 8 age-matched healthy individuals (HIs) were analyzed after obtaining informed consent according to the hospital Medical Ethical Committee. Peripheral blood mononuclear cells (PBMCs) were isolated using Human Mononuclear Cell Separation Medium 1.077  density-gradient centrifugation, and they were cryopreserved until analysis. Clinical characteristics of 50 patients with CLL in the HNCH were listed in Cells were washed in phosphate-buffered saline containing 2% FBS and incubated at 4\u00b0C for 30\u00a0min with combinations of the following antibodies: CD3-APC-A750 , CD4-KrO , CD8-APC-A700 , and TCF1-PE . Relevant isotype control mAbs were purchased from BD Biosciences. After two washes in phosphate-buffered saline containing 2% FBS, cells were analyzed by FACS Calibur . Data were processed with Navios Flow Cytometer software .The gene expression profiles of CLL cells and HIs were queried in the Gene Expression Omnibus (GEO) database, and the GSE19147 , GSE6642\u00ae III RT SuperMix for real-time quantitative PCR (qPCR) (+gDNA wiper)  and analyzed by ChamQ Universal SYBR qPCR Master Mix. -\u0394\u0394CT (cycle threshold) method.To verify the data from the public datasets, total RNA was prepared from CLL patients and HIs using TRIzol Reagent  according to the manufacturer\u2019s instructions. cDNA was synthesized from equal amounts of total RNA (1 \u03bcg) using HiScriptThe TTFT of CLL patients was queried in the GSE39671 dataset , which iTCF7 in the GSE39671 and GSE22762 datasets were analyzed by the Spearman correlation coefficient. Additionally, the Venny 2.1.0 program was used to screen for common genes in the two databases (R > 0.3 and P < 0.05), and the DAVID version 6.8   database (rg/cgi/) , and therg/cgi/) . The cutP < 0.05), as found in the univariate analyses, were included in multivariate analysis based on a Cox proportional hazards model. P < 0.05 was considered statistically significant.Data were analyzed using GraphPad Prism 8.2.1. Results are presented as the mean \u00b1 SD. Student\u2019s unpaired t-test was used for differential expression analysis, the log-rank test was used to indicate the statistical significance of survival or TTFT correlation between groups, and the correlation of two genes was tested by the Spearman correlation coefficient. Survival curves were analyzed by the log-rank Kaplan-Meier method. Cox regression analysis was constructed to determine the hazard ratio (HR). All statistically significant variables  and GSE22762 datasets (903 genes)   and cluster 2 (including LCK and CD3E). It was evident that the genes in cluster 1 were closely related to TCF7 (BCL11B and RUNX3 in PBMCs from CLL patients (HNCH) and HIs by qPCR. Intriguingly, BCL11B expression was significantly decreased in CLL patients compared with that in HIs  and GSE39671 (R = 0.41\u00a0P < 0.001) datasets  (vs. 28%)  level, lactate dehydrogenase (LDH) level, gender, age, lymphocyte percentage, IGHV mutation status, cytogenetic abnormalities such as del(17p) or P53 mutation (TP53 aberration), del(11q), del(13q) and trisomy12, absolute lymphocyte count (ALC), and bulky disease (\u2265 5 cm) (P < 0.05) were included in the multivariate analysis, revealing that unmutated IGHV, TP53 aberration, trisomy12, Rai stage 3-4, R/R, low TCF1, and low BCL11B were independent risk factors for shortened TTFT. Thus, TCF1 is a potential clinical biomarker for predicting disease progression for CLL patients.Cox regression analysis demonstrated that low TCF1 and BCL11B expression are independent predictive factors for short TTFT of CLL patients Table\u00a01.P values are 0.004, < 0.001 and < 0.001, respectively), particularly for CD3+CD8+ T cells , the Foundation for Young Teachers\u2019 Basal Research of Zhengzhou University (jc202050015), and the Medical Science and Technology Research Project of Henan Province (LHGJ20220185).We are very thankful to Prof. Yangqiu Li  for outstanding manuscript edits and her advice on bioinformatics analyses.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "RYR1. Patients carrying recessive RYR1 mutations usually present from birth and are generally more severely affected, showing preferential involvement of fast twitch muscles as well as extraocular and facial muscles. In order to gain more insight into the pathophysiology of recessive RYR1-congential myopathies, we performed relative and absolute quantitative proteomic analysis of skeletal muscles from wild-type and transgenic mice carrying p.Q1970fsX16 and p.A4329D RyR1 mutations which were identified in a child with a severe congenital myopathy. Our in-depth proteomic analysis shows that recessive RYR1 mutations not only decrease the content of RyR1 protein in muscle, but change the expression of 1130, 753, and 967 proteins EDL, soleus and extraocular muscles, respectively. Specifically, recessive RYR1 mutations affect the expression level of proteins involved in calcium signaling, extracellular matrix, metabolism and ER protein quality control. This study also reveals the stoichiometry of major proteins involved in excitation contraction coupling and identifies novel potential pharmacological targets to treat RyR1-related congenital myopathies.Skeletal muscles are a highly structured tissue responsible for movement and metabolic regulation, which can be broadly subdivided into fast and slow twitch muscles with each type expressing common as well as specific sets of proteins. Congenital myopathies are a group of muscle diseases leading to a weak muscle phenotype caused by mutations in a number of genes including  Skeletal muscles constitute the largest organ, accounting for approximately 60% of the total body mass; they are responsible for movement and posture and additionally, play a fundamental role in regulating metabolism. Furthermore, skeletal muscles are plastic and can respond to physiological stimuli such as increased workload and exercise by undergoing hypertrophy. Broadly speaking muscles can be subdivided into different types depending on their speed of contraction, namely slow twitch muscles are characterized by level of oxidative activity, while fast twitch muscles show high content of enzymes involved in glycolytic activity. Fast- and slow-twitch muscle can be also identified based on the expression of specific myosin heavy chain (MyHC) isoforms . Fast twAlthough such a general classification based on MyHC isoform expression was used for many years by biochemists and physiologists, it has been recently improved thanks to the implementation of \u2018omic\u2019 approaches which have helped refine the phenotypic signature at the single fiber level. A great deal of data has shown that type 2 A fast fibers display a protein profile similar to type I fibers, namely a remarkable level of enzymes involved in oxidative metabolism. Interestingly, type 2 X fibers apparently encode proteins annotated to both oxidative and glycolytic pathways .RYR1 myopathies carrying a hypomorphic or null allele , jaw muscles and inner ear muscles that have a different embryonic origin and are made up of atypical fiber types . For exal allele .RYR1, the gene encoding the ryanodine receptor 1 (RyR1) calcium channel of the sarcoplasmic reticulum, are found in approximately 30% of all CM patients, making it the most commonly mutated gene in human CM  are a genetically heterogeneous group of early onset, non-dystrophic diseases preferentially affecting proximal and axial muscles. More than 20 genes have been implicated in CM, the most commonly affected being those encoding proteins involved in calcium homeostasis and excitation contraction coupling (ECC) and thin-thick filaments . Mutatiohuman CM . Within  and EOM . A commo and EOM  which cor allele . The musfunction . Interesfunction . Such reRyr1 mutations differentially impinge on the expression and function of proteins specific for different muscle types, we performed qualitative and quantitative proteomic analysis of EDL, soleus and EOMs from wild-type and dHT mice.In order to establish how and if Mus musculus , Myh2 and Myh13 from Trembl, the six calibration mix proteins  versus fast (condition 1) muscles. Reactome pathway analysis  versus fast EDL (condition 1) muscles. Interestingly, Reactome pathway analysis  versus slow soleus (condition 1) muscles. Reactome pathway analysis (Myh7) are enriched between 32 and 197-fold in soleus muscles, whereas \u03b1-actinin 3 and 4 and myomesin 1 are more abundant in EDL muscles and desmin is enriched in soleus muscles , as well as more cardiac muscle specific protein isoforms. For example, within the contractile and sarcomeric protein category, compared to EDL muscles, EOMs are particularly enriched in MyHC-slow (24-fold), MyHC-EO (29-fold) and Troponin C1 , whereas they contain very low amounts of \u03b1-actinin 3 (0.02-fold), MyHC 2b (0.07-fold) and MyHC 2 X (0.61-fold). Within the ECC coupling category, EOMs are enriched in calsequestrin 2 (21-fold), SERCA2 (3.6-fold) and junctin/junctate/aspartyl-\u00df-hydroxylase (3.5-fold) whereas their content of RyR1, the \u03b1-1 subunit of the dihydropyridine receptor (DHPR\u03b11s), calsequestrin 1, Stac3, junctophilin-1 and triadin is significantly reduced by more than 50% compared to EDL muscles , MyHC-EO (20-fold) and cardiac troponin T (3.10-fold), whereas compared to soleus muscles they contain very low amounts of slow- MyHC (0.0096-fold), myosin light chain 2 (0.01-fold), myozenin-2 (0.017-fold) and \u03b1-actinin 2 (0.017-fold). In the ECC category, EOMs are enriched in a number of proteins including SERCA1 (eightfold) and SERCA3 (sevenfold), Stim1 (fourfold), Junctin/junctate/Aspartyl-\u00df-hydroxylase (threefold), DHPR\u03b11s (1.4-fold) and junctophilin-1 (1.4-fold), whereas they contain very low amounts of SERCA2 and >50% lower amounts of Mitsugumin 53  and Hspa12a (7-fold higher in EOM vs soleus). Hspb6 has been implicated in protection against atrophy, ischemia, hypertensive stress, and metabolic dysfunction (RYR1 mutations show fiber type 1 predominance (Trim72), a protein involved in muscle membrane repair  of congenital muscle disorders carrying the p.Q1970fsX16 mutation in one allele and the mis-sense p.A4329D mutation in the other allele  increases 1.34-fold in EDLs from dHT mice. Additionally, the expression of type 2 fibers is impacted since MyHC 2 X and 2B as well as\u03b1-actinin 3   content between the two mouse genotypes.  fibers)  are decrWe applied a similar approach as described above (i.e. proteins showing significantly different (q<0.05)\u22650.2-fold change in content between the two mouse genotypes) to identify important components differing between dHT and WT soleus muscles . In the In EOMs, the proteins showing the greatest fold change (aside those involved in ECC and muscle contraction), are heat shock proteins, ribosomal proteins and proteins of the ECM, a variety of heat shock proteins and calcium/calmodulin-dependent protein kinases II\u03b2 and II\u03b4 and S100 family proteins .Ryr1 mutations on the protein composition of muscles is more prominent in fast twitch muscles such as EOMs and EDLs compared to the slow twitch soleus muscle and the proteomic approach revealed that the content of many proteins differs between dHT and WT EDL, soleus and EOM muscles. We next refined our analysis and searched for protein whose content variation is most strongly associated with the dHT genotype. In particular, we searched for proteins which show significant changes in content in all three muscle types, namely EDL, Sol, and EOM. The Venn diagram (Hspb6) are increased only in EDL and EOMs. Interestingly, the content of 39 proteins including Kelch-like protein 41, two annotated to calcium signaling such as calmodulin kinase 2\u03b4 and aspartyl-\u00df -hydroxylase are increased in all three muscle types from dHT mice , some ribosomal proteins and calmodulin kinase 2 delta. EDL and EOMs that are more severely affected, also share changes in the content of other proteins, including collagens, heat shock proteins, and CamK2b as well as additional ribosomal proteins. We believe that the reduced RyR1 calcium channel content has a domino effect leading to changes in content of many proteins, particularly in EDL and EOMs.To understand in greater detail the changes in skeletal muscle function in congenital myopathies caused by recessive STIM1 and ORAI1 are the underlying feature of several genetic diseases associated with muscle weakness , a severe congenital myopathy resulting in muscle weakness and skeleton alteration  and indeed the content of collagen I, II, IV, V, and XI was significantly reduced. The ECM plays an important role in muscle force transmission, maintenance and repair and collagen fibers account for 1\u201310% muscle dry weight, forming a highly ordered network surrounding individual muscle fibers and muscle bundles  suffer from Ulrich and Bethlem myopathies . Patients also exhibit joint laxity that may lead to dislocation of the patella, or, more rarely abnormal tightening of certain joints, resulting in contractures especially of the Achilles tendon  that are involved in protein folding, prevention of aggregation. In skeletal muscle, these small proteins have been shown to be involved in the maintenance of the cytoskeletal network and contractile elements and play a role in myogenic differentiation . Large HRyr1 mutations evoke a global adaptive response aimed at (i) preserving the integrity of intracellular protein compartments and (ii) increasing muscle protein turnover.An interesting observation of the present study is that the content of ribosomal proteins constituting the 40 S and 60 S subunits is significantly increased in the three muscle types from the dHT compared to WT. In skeletal muscle, up-regulation of ribosomal proteins accompanies hypertrophy and training, whereas ribosomal proteins decrease with age . Thus, oKLH41) have been identified in patients with nemaline myopathy . All experiments were performed in accordance with relevant guidelines and regulations.EDL, soleus and EOM muscles from 5 male WT and 5 male dHT, 12 weeks old mice were excised, weighed, snap frozen in liquid nitrogen and mechanically grinded. Approximately 10 mg of EDL, 8 mg for of Soleus and 6 mg of EOM muscle tissue was grinded and subsequently lysed in 200 \u00b5l of lysis buffer containing 100 mM TRIS, 1% sodium deoxycholate (SDC), 10 mM TCEP and 15 mM chloroacetamide, followed by sonication  and heating to 95 \u00b0C for 10 min. After cooling, protein samples were digested by incubated overnight at 37 \u00b0C with sequencing-grade modified trypsin . Samples were acidified using 5% TFA and peptides cleaned up using the Phoenix 96 x kit  following the manufacturer\u2019s instructions. After drying the peptides in a SpeedVac, samples were stored at \u201380 \u00b0C.Dried peptides were dissolved in 100 \u00b5l of 0.1% formic acid and the peptide concentration determined by UV-nanodrop analysis. Sample aliquots containing 25 \u00b5g of peptides were dried and labeled with tandem mass isobaric tags  according to the manufacturer\u2019s instructions. To control for ratio distortion during quantification, a peptide calibration mixture consisting of six digested standard proteins mixed in different amounts were added to each sample before TMT labeling as recently described . After pThe generated 12 peptide samples fractions were analyzed by LC-MS as described previously . ChromatMus musculus , Myh2 and Myh13 from Trembl, the six calibration mix proteins  assays  were genPeptide samples for PRM analysis were resuspended in 0.1% aqueous formic acid, spiked with iRT peptides and the heavy reference peptide mix at a concentration of 10 fmol of heavy reference peptides per 1 \u00b5g of total endogenous peptide mass and subjected to LC\u2013MS/MS analysis on the same LC-MS system described above using the following settings: The resolution of the orbitrap was set to 140,000 FWHM (at 200 m/z), the fill time was set to 500ms to reach an AGC target of 3e6, the normalized collision energy was set to 27%, ion isolation window was set to 0.4 m/z and the first mass was fixed to 100 m/z. A MS1 scan at 35,000 resolution (FWHM at 200 m/z), AGC target 3e6 and fill time of 50ms was included in each MS cycle. All raw-files were imported into SpectroDive for protein / peptide quantification. To control for variation in injected sample amounts, the total ion chromatogram (only comprising ions with two to five charges) of each sample was determined and used for normalization. To this end, the generated raw files were imported into the Progenesis QI software (Nonlinear Dynamics (Waters), Version 2.0), the intensity of all precursor ions with a charge of +2 to+5 were extracted, summed for each sample and used for normalization. Normalized ratios were transformed from the linear to the log-scale, normalized relative to the control condition and the median ratio among peptides corresponding to one protein was used for protein quantification.Total homogenates of EDL, soleus and EOM muscles from WT mice were prepared in cracking buffer as previously described . Proteinhttps://string-db.org/; Version 11.5).Matlab 2021b (Mathworks)  was used This is a fundamental study reporting a comprehensive proteomic analysis in three skeletal muscle types from wild-type and RYR1-related myopathy mice. It adds quantitative stoichiometry of several excitation-contraction coupling-related proteins. This valuable work compares the disease-related proteomes of the different skeletal muscle groups. public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Our editorial process produces two outputs: (i) Decision letter after peer review:Ryr1 mutations linked to congenital myopathies\" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Mone Zaidi as the Senior Editor.Thank you for submitting your article \"Quantitative proteomic analysis of skeletal muscles from wild type and transgenic mice carrying recessive The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. Reviewers (1) and (2) were enthusiastic about the work; reviewer (3) had reservations. Nevertheless we would like to offer you the opportunity to submit a revised version addressing the comments particularly of reviewers (2) and (3). I have worked through all the comments and hope the notes to follow may be useful in connection with this.Essential revisions:Reviewer (2) makes the following broad comments that may merit addressing:a) The main limitation of this study is that the results are primarily descriptive in nature, and thus, do not provide mechanistic insight into how Ryr1 disease mutations lead to the muscle-specific changes observed in the EDL, soleus and EOM proteomes.b) Results comparing fast twitch (EDL) and slow twitch (soleus) muscles from WT mice confirmed several known differences between the two muscle types. Similar analyses between EOM/EDL and EOM/soleus muscles from WT mice were not conducted.c) While a reactome pathway analysis for proteins changes observed in EDL is shown in Supplemental Figure 1, the authors do not fully discuss the nature of the proteins and corresponding pathways impacted in the other two muscle groups analyzed.Specific requestsReviewer (2) also makes the following specific requests:a) This study would be strengthened by inclusion of tables that summarize relative protein changes between EOM/EDL muscles and EOM/soleus muscles from WT mice as was done in Table 1 for soleus/EDL muscles from WT mice.b) As there are reliable antibodies for many of the selected proteins found to be significantly increased or decreased in muscle from dHT mice, it would seem important and feasible to validate at least a subset of the proteomic findings in western blot experiments. For example, the proteome studies found JP-1 levels to be reduced in both EDL and soleus, but not in EOM; Hspa5 (BIP) levels to be increased in EDL and EOM, but unaltered in soleus; collagen levels to be reduced in EDL, but unaltered in both soleus and EOM. Such findings could readily be validated in quantitative western blot experiments.c) Beyond the author-selected muscle-related processes shown in Tables 2-4, limited non-biased information is provided regarding other potential proteins and pathways altered in the different muscles evaluated from dHT mice. A more robust unbiased evaluation of all of the significantly increased/decreased proteins and the underlying pathways involved could be informative. A reactome pathway analysis comparison is shown for EDL muscles from WT and dHT mice in Supplemental Figure 1. It would be helpful if the authors could include similar reactome pathway analyses for the proteins found to be significantly increased/decreased in soleus and EOM of WT and dHT mice.d) The authors provide a Venn diagram in Supplemental Figure 2 to highlight overlap between proteins that are increased and decreased across all three muscles. Interestingly, for all three muscles evaluated , more proteins were found to be increased than decreased in dHT mice (e.g. 560 proteins are increased in EOM and only 117 are decreased). In addition, while only one protein (Ryr1) was found to be decreased across all muscles, 40 proteins were found to be increased in all three muscles. It would be helpful if the authors could provide a summary table that lists these 40 proteins that are upregulated in all three muscles. Does a GO pathway analysis of these 40 proteins provide any common theme that extends across all three types muscles? Are there any common themes to come out of separate GO pathway analyses of the 848 protein differences observed in EDL, 509 protein differences observed in soleus, and 677 protein differences observed in EOM? What about the union of common proteins changes observed between EDL and EOM (144 proteins), EDL and soleus (98 proteins), and EOM and soleus (106 proteins)?Reviewer (3) Broad comments:a) it would be useful to determine whether changes in protein levels correlated with changes in mRNA levels and whether or not the protein present was functional, and whether Stac3 was in fact stoichiometrically depleted in relation to Cacna1s.b) In the abstract, the authors stated that skeletal muscle is responsible for voluntary movement. It is also responsible for non-voluntary. The abstract needs to be refocused on the mutation and on what we learn from this study. Please avoid vague statements like \"we provide important insights to the pathophysiological mechanisms\u2026\" mainly when the study is descriptive and not mechanistic.c) The author should bring up the mutation name, location and phenotype early in the introduction.d) This reviewer also suggests that the authors refocus the introduction on the mutation location in the 3D RyR1 structure (available cryo-EM structure), if there is any nearby ligand binding site, protomers junction or any other known interacting protein partners. This will help the reader to understand how this mutation could be important for the channel's functionReviewer 3 raised the following specific critiques:a) The mass spec results were filtered based on very low confidence criteria: fold change 0.25 and q<0.05. which allows detection of a large number of proteins potentially irrelevant to the study. The authors should change their filtering threshold to a fold change of 0.58 (at least 50% change in the expression levels), q<0.05, and at least two unique peptides per protein.b) In the Results section (page 6), the authors compared the protein expression profiles between EDL and soleus in wild-type mice. It is unclear why this analysis was performed. It is expected to see differences in protein expression levels when comparing a glycolytic and oxidative muscle in wild type. This is due to the properties of each muscle type.c) The authors did not validate any of the detected changes, and whether these changes are contributing to the phenotype. Moreover, the phenotype of these mice has not been evaluated at this age. Do these mice have muscle weakness or muscle atrophy? Is there any detected protein that can be targeted by a drug?d) The fact that RyR1 expression is decreased in all muscle types could be simply explained by the decreased muscle content for all proteins of the contractile apparatus. The histopathology of these mice needs to be evaluated for markers of atrophy, autophagy, apoptosis, and necrosis.e) In addition to reconsidering the filtering criteria for the proteomic analysis, it is highly recommended to change the color of the heatmap to light colors to improve the readability of the figures (red and blue are very common color codes that could be used).f) The authors could perform a GSEA analysis to have a better understanding of the enriched pathways and maybe focus on the most relevant ones. The GO pathway analysis seems to not be very informative here and the changes are subtle considering that the filter threshold was set at 0.25.g) The discussion should be more organized and should address the pathological mechanism of the mutation and how the current study improves our understanding of the disease. For example, the section about the implication of the mutation in bone formation and remodeling is irrelevant to the current study and is an over-interpretation of the results found in skeletal muscle.Reviewer #1 (Recommendations for the authors):The subject matter is of clear scientific interest justifying full review. The objectives of the paper are clearly introduced, and the methods logically described and appropriate. The proteomic findings are striking and clear. There is a clear comparison between WT and mutant for the different muscle types. There is extensive and potentially useful reference information in the Tables and supplemental data. Subject to the detailed technical comments of the expert referee, this should be a potentially appropriate contribution for publication.Reviewer #2 (Recommendations for the authors):This study would be strengthened by inclusion of tables that summarize relative protein changes between EOM/EDL muscles and EOM/soleus muscles from WT mice as was done in Table 1 for soleus/EDL muscles from WT mice.As there are reliable antibodies for many of the selected proteins found to be significantly increased or decreased in muscle from dHT mice, it would seem important and feasible to validate at least a subset of the proteomic findings in western blot experiments. For example, the proteome studies found JP-1 levels to be reduced in both EDL and soleus, but not in EOM; Hspa5 (BIP) levels to be increased in EDL and EOM, but unaltered in soleus; collagen levels to be reduced in EDL, but unaltered in both soleus and EOM. Such findings could readily be validated in quantitative western blot experiments.Beyond the author-selected muscle-related processes shown in Tables 2-4, limited non-biased information is provided regarding other potential proteins and pathways altered in the different muscles evaluated from dHT mice. A more robust unbiased evaluation of all of the significantly increased/decreased proteins and the underlying pathways involved could be informative. A reactome pathway analysis comparison is shown for EDL muscles from WT and dHT mice in Supplemental Figure 1. It would be helpful if the authors could include similar reactome pathway analyses for the proteins found to be significantly increased/decreased in soleus and EOM of WT and dHT mice.The authors provide a Venn diagram in Supplemental Figure 2 to highlight overlap between proteins that are increased and decreased across all three muscles. Interestingly, for all three muscles evaluated , more proteins were found to be increased than decreased in dHT mice (e.g. 560 proteins are increased in EOM and only 117 are decreased). In addition, while only one protein (Ryr1) was found to be decreased across all muscles, 40 proteins were found to be increased in all three muscles. It would be helpful if the authors could provide a summary table that lists these 40 proteins that are upregulated in all three muscles. Does a GO pathway analysis of these 40 proteins provide any common theme that extends across all three types muscles? Are there any common themes to come out of separate GO pathway analyses of the 848 protein differences observed in EDL, 509 protein differences observed in soleus, and 677 protein differences observed in EOM? What about the union of common proteins changes observed between EDL and EOM (144 proteins), EDL and soleus (98 proteins), and EOM and soleus (106 proteins)?Reviewer #3 (Recommendations for the authors):1) The mass spec results were filtered based on very low confidence criteria: fold change 0.25 and q<0.05. which allows detection of a large number of proteins potentially irrelevant to the study. The authors should change their filtering threshold to a fold change of 0.58 (at least 50% change in the expression levels), q<0.05, and at least two unique peptides per protein.2) In the Results section (page 6), the authors compared the protein expression profiles between EDL and soleus in wild-type mice. It is unclear why this analysis was performed. It is expected to see differences in protein expression levels when comparing a glycolytic and oxidative muscle in wild type. This is due to the properties of each muscle type.3) The authors did not validate any of the detected changes, and whether these changes are contributing to the phenotype. Moreover, the phenotype of these mice has not been evaluated at this age. Do these mice have muscle weakness or muscle atrophy? Is there any detected protein that can be targeted by a drug?4) The fact that RyR1 expression is decreased in all muscle types could be simply explained by the decreased muscle content for all proteins of the contractile apparatus. The histopathology of these mice needs to be evaluated for markers of atrophy, autophagy, apoptosis, and necrosis.5) In addition to reconsidering the filtering criteria for the proteomic analysis, it is highly recommended to change the color of the heatmap to light colors to improve the readability of the figures (red and blue are very common color codes that could be used).6) The authors could perform a GSEA analysis to have a better understanding of the enriched pathways and maybe focus on the most relevant ones. The GO pathway analysis seems to not be very informative here and the changes are subtle considering that the filter threshold was set at 0.25.7) The discussion should be more organized and should address the pathological mechanism of the mutation and how the current study improves our understanding of the disease. For example, the section about the implication of the mutation in bone formation and remodeling is irrelevant to the current study and is an over-interpretation of the results found in skeletal muscle. Essential revisions:Reviewer (2) makes the following broad comments that may merit addressing:a) The main limitation of this study is that the results are primarily descriptive in nature, and thus, do not provide mechanistic insight into how Ryr1 disease mutations lead to the muscle-specific changes observed in the EDL, soleus and EOM proteomes.Ryr1 mutation are consistent with the high expression level of heat shock proteins in slow twitch muscles. However, as suggested by Reviewer 3, we have removed \"vague statements\" from the text of the revised manuscript, concerning major insights into pathophysiological mechanisms, since we are aware that the mechanistic information, if any, that we can extract from the data set, cannot go over the intrinsic limitation of the high-throughput proteomic technology.An intrinsic feature of the high-throughput proteomic analysis technology is the generation of lists of differentially expressed proteins (DEP) in different muscles from WT and mutated mice. Although the definition of mechanistic insights related to changes of dozens of proteins is very interesting, it is a difficult task to accomplish and goes beyond the goal of the high-throughput proteomic analysis presented here. Nevertheless, the analysis of DEPs may indeed provide arguments to speculate on the pathogenesis of the phenotype linked to recessive RyR1 mutations. In the unrevised manuscript, we pointed out that the fiber type I predominance observed in congenital myopathies linked to recessive b) Results comparing fast twitch (EDL) and slow twitch (soleus) muscles from WT mice confirmed several known differences between the two muscle types. Similar analyses between EOM/EDL and EOM/soleus muscles from WT mice were not conducted.We agree with the point raised by the Reviewer. In the revised manuscript we have changed figure 2. The new figure 2 shows the analysis of differentially expressed proteins in EDL, soleus and EOMs from WT mice. We have also added 2 new Tables (new supplementary 1b and 1c) and have inserted our findings in the revised Results section .c) While a reactome pathway analysis for proteins changes observed in EDL is shown in Supplemental Figure 1, the authors do not fully discuss the nature of the proteins and corresponding pathways impacted in the other two muscle groups analyzed.We have now included in the revised manuscript a new figure 2 which includes the Reactome pathway analysis comparing EDL with soleus, EDL with EOM and soleus with EOM . We have also inserted into the revised manuscript a brief description of the pathways showing the greatest changes in protein content . We agree that the data showing changes in protein content between the 3 muscle groups of the WT mice are important also because they validate the results of the proteomic approach. Indeed, the present results confirm that many proteins including MyHCIIb, calsequestrin 1, SERCA1, parvalbumin etc are more abundantly expressed in fast twitch EDL muscles compared to soleus. Similarly, our results confirm that EOMs are enriched in MyHC-EO as well as cardiac isoforms of ECC proteins. This point has been clarified in the revised version of the manuscript . Nevertheless, we would like to point out that the main focus of our study is to compare the changes of protein content induced by the presence of recessive RyR1 mutations.Specific requestsa) This study would be strengthened by inclusion of tables that summarize relative protein changes between EOM/EDL muscles and EOM/soleus muscles from WT mice as was done in Table 1 for soleus/EDL muscles from WT mice.In the revised version of the manuscript, we now include summary tables of relative protein changes between EDL/Soleus, EOM/EDL and EOM/Soleus .b) As there are reliable antibodies for many of the selected proteins found to be significantly increased or decreased in muscle from dHT mice, it would seem important and feasible to validate at least a subset of the proteomic findings in western blot experiments. For example, the proteome studies found JP-1 levels to be reduced in both EDL and soleus, but not in EOM; Hspa5 (BIP) levels to be increased in EDL and EOM, but unaltered in soleus; collagen levels to be reduced in EDL, but unaltered in both soleus and EOM. Such findings could readily be validated in quantitative western blot experiments.The unrevised manuscript and previous manuscripts  validate the proteomic data, namely Western blot analysis with Ab against Stim1, RyR1, Casequestrin 1, DHPRa1 are consistent with the proteomic data of this study. Nevertheless, to comply with the reviewer\u2019s request we have performed Western blot analysis to validate the differential expression of JPH1 and Col1a1 in the different muscles. As can be seen in c) Beyond the author-selected muscle-related processes shown in Tables 2-4, limited non-biased information is provided regarding other potential proteins and pathways altered in the different muscles evaluated from dHT mice. A more robust unbiased evaluation of all of the significantly increased/decreased proteins and the underlying pathways involved could be informative. A reactome pathway analysis comparison is shown for EDL muscles from WT and dHT mice in Supplemental Figure 1. It would be helpful if the authors could include similar reactome pathway analyses for the proteins found to be significantly increased/decreased in soleus and EOM of WT and dHT mice.As stated above in our answer to broad comments, the revised manuscript now includes the Reactome analysis comparison of EDL, EOM and Soleus muscles from WT mice. Figure 2 panels C, F and I of the revised manuscript now includes the Reactome pathway comparison between WT EDL, soleus and EOM muscles. Whereas Figure 3\u2014figure supplement 1 of the revised manuscript shows the Reactome pathway analysis of EDL and EOM from WT and dHT mice. Since the number of proteins changing between WT and dHT soleus muscles is relatively small it does not generate a Reactome pathway. We have nevertheless analyzed in more depth differences between WT and dHT EDL, soleus and EOM applying GO analysis of proteins annotated to Biological process and GO Cellular Compartments. The new data is shown in Figure 4\u2014figure supplement 1A and Figure 4B, C and E of the revised manuscript.d) The authors provide a Venn diagram in Supplemental Figure 2 to highlight overlap between proteins that are increased and decreased across all three muscles. Interestingly, for all three muscles evaluated , more proteins were found to be increased than decreased in dHT mice (e.g. 560 proteins are increased in EOM and only 117 are decreased).In Figure 4\u2014figure supplement 1 of the revised manuscript, we now analyze GO genes annotated to biological processes of up- and downregulated proteins in each muscles type, i.e. EDL, Soleus and EOM.In addition, while only one protein (Ryr1) was found to be decreased across all muscles, 40 proteins were found to be increased in all three muscles. It would be helpful if the authors could provide a summary table that lists these 40 proteins that are upregulated in all three muscles. Does a GO pathway analysis of these 40 proteins provide any common theme that extends across all three types muscles? Are there any common themes to come out of separate GO pathway analyses of the 848 protein differences observed in EDL, 509 protein differences observed in soleus, and 677 protein differences observed in EOM? What about the union of common proteins changes observed between EDL and EOM (144 proteins), EDL and soleus (98 proteins), and EOM and soleus (106 proteins)?In the revised version of the manuscript, we now provide a list of the shared up-regulated proteins in the three muscle types from dHT mice (figure 4D of the revised manuscript). We also complied with the Reviewer\u2019s request and provide GO pathways of differentially expressed protein intersects of the Venn diagram in dHT EDL, Soleus and EOM .Reviewer (3) Broad comments:a) it would be useful to determine whether changes in protein levels correlated with changes in mRNA levelsStac3 and Cacna1s in EDL, Soleus and EOM from WT mice  the expression level of both transcripts and proteins is higher EDL compared to EOM and soleus muscles, respectively, (ii) the expression level of transcripts encoding Stac3 correlate with those encoding Cacan1s and confirm proteomic data. In addition, the level of Stac3 transcript does not changes between WT and dHT, confirming our proteomic data which show that Stac3 protein content in muscles from dHT is similar to that found in WT littermates. Altogether these results support the concept that the differences in Stac3 content between EDL and soleus occur at both the protein and transcript levels, namely high Stac3 mRNA level correlates with higher protein content (EDL) and low mRNA levels correlated with low Stac3 protein content in Soleus muscles .b) In the abstract, the authors stated that skeletal muscle is responsible for voluntary movement. It is also responsible for non-voluntary. The abstract needs to be refocused on the mutation and on what we learn from this study. Please avoid vague statements like \"we provide important insights to the pathophysiological mechanisms\u2026\" mainly when the study is descriptive and not mechanistic.The abstract of the revised manuscript has been rewritten. In particular, we removed statements referring to important \u201cpathophysiological mechanistic insight\u201d.c) The author should bring up the mutation name, location and phenotype early in the introduction.In the revised manuscript we provide the information requested by the Reviewer .d) This reviewer also suggests that the authors refocus the introduction on the mutation location in the 3D RyR1 structure (available cryo-EM structure), if there is any nearby ligand binding site, protomers junction or any other known interacting protein partners. This will help the reader to understand how this mutation could be important for the channel's functionThe residue Ala4329 is present inside the TMx (Auxiliary transmembrane helices) domain which spans from residue 4322 to 4370 and interposes structurally . Although the structural resolution of the region has been improved , parts of the domain still remain with no defined atomic coordinates, especially the region encompassing a.a. E4253 \u2013 F4540. Because of such undefined atomic coordinates of the region E4253-F4540, we are not able to determine the real orientation and the disposition of the amino acids in this region, including the A4329 residue. As reference, structure PDB: 5TAL of des Georges et al., 2016 was analyzed with UCSF Chimera (production version 1.16) .Reviewer 3 raised the following specific critiques:a) The mass spec results were filtered based on very low confidence criteria: fold change 0.25 and q<0.05. which allows detection of a large number of proteins potentially irrelevant to the study. The authors should change their filtering threshold to a fold change of 0.58 (at least 50% change in the expression levels), q<0.05, and at least two unique peptides per protein.We chose to filter our data with the FDR q<0.05, since it is the parameter most commonly adopted by the proteomic community to statistically validate changes in protein expression. The q<0.05 filter provides statistical confidence on the statistical validity of observed changes regardless of the extent of the fold change , Quantitative Methods in Proteomics, Methods in Molecular Biology, vol. 2228, https://doi.org/10.1007/978-1-0716-1024-4_1).The reviewer proposes to set a fold change of 0.5 to detect proteins relevant to the study. We think that such a filter will miss relevant proteins. One example for all: if we set the filter for fold change of protein expression level to 0.5 we will filter out the RyR1 in the comparison between Soleus WT and Soleus from dHT mice. This result would be inconsistent with a set of data obtained by different experimental approaches including western blot analysis and qPCR  showing that the muscle phenotype of the soleus from dHT mice is in agreement with a decrease of the RyR1 protein and transcript expression level, even though it does not reach the threshold of 0.5. For this reason, we think that filtering the fold changed to 0.5 has the plausible risk of missing proteins which might be relevant to this study.b) In the Results section (page 6), the authors compared the protein expression profiles between EDL and soleus in wild-type mice. It is unclear why this analysis was performed. It is expected to see differences in protein expression levels when comparing a glycolytic and oxidative muscle in wild type. This is due to the properties of each muscle type.We performed the comparison of the proteome of EDL and soleus muscles, to validate the procedure of the proteomic analysis. As shows in figure 2 and Table 1 of the unrevised manuscript, our proteomic analysis indeed picked up not only the major molecular signatures of each muscle type, but also its relevance for the functional phenotype of fast and slow twitch muscles. Figure 2 and Table 1 of the unrevised manuscript confirm the molecular signatures of fast and slow twitch muscles, thus validating the functional sub-specialization of these muscle types. Therefore, we are confident of our proteomic approach results and further proceeded to analyze the proteome of EDL vs EOM, soleus vs EOM as well as the muscles from dHT mice.c) The authors did not validate any of the detected changes, and whether these changes are contributing to the phenotype. Moreover, the phenotype of these mice has not been evaluated at this age. Do these mice have muscle weakness or muscle atrophy?The proteomic analysis of the dHT mice is validated by published data  concerning the skeletal muscle phenotype of dHT mice. In these publications, we showed that the decrease of the RyR1protein content is consistent with the decrease of force developed both in vivo and in vitro and with the smaller electrically evoked calcium transients. EDL from dHT showed a 10% decrease of wet weight, suggesting a small degree of muscle atrophy, which does not correlate with the much larger decrease of RyR1 content in the skeletal muscle homogenate. The muscle weakness is mostly explained mostly by reduction of RyR1 expression and in part by the small degree of muscle atrophy. In Elbaz et al., 2019 and Eckhardt et al., 2020 papers, mice having an age range between 8-12 weeks were characterized and in the present paper, muscles were harvested from 12 weeks old mice . See also reply to Reviewer 2, point b.Is there any detected protein that can be targeted by a drug?We interrogate the Drug Gene Interaction Database to analyze the differentially expressed proteins in EDL, Soleus and EOM (dHT vs WT). For example, the DGID list indicates CamKIId as potential target in EDL, Soleus and EOM. Although there are available inhibitors of this potential pharmacological target, we believe that addressing this issue goes beyond the scope of this manuscript.d) The fact that RyR1 expression is decreased in all muscle types could be simply explained by the decreased muscle content for all proteins of the contractile apparatus. The histopathology of these mice needs to be evaluated for markers of atrophy, autophagy, apoptosis, and necrosis.The proteomic analysis of the dHT mice is validated by data  concerning the skeletal muscle phenotype of the dHT mice. Elbaz et al. (2019) showed that in EDL and Soleus muscle from dHT mice there are ultrastructural changes referable to core-like structures, but no major signatures of atrophy and or necrosis . We woule) In addition to reconsidering the filtering criteria for the proteomic analysis, it is highly recommended to change the color of the heatmap to light colors to improve the readability of the figures (red and blue are very common color codes that could be used).We used yellow blue for the heat maps because such colors are more compatible for people with impaired color vision .f) The authors could perform a GSEA analysis to have a better understanding of the enriched pathways and maybe focus on the most relevant ones. The GO pathway analysis seems to not be very informative here and the changes are subtle considering that the filter threshold was set at 0.25.The reviewer suggests to use the GSEA tool to explore enrichment pathway since GO pathway was not informative. We believe that the use of the GSEA tool and other tools will face the same problem, i.e. the enrichment terms are not informative for EC coupling and other muscle physiology terms because most of the annotated terms in these tools are related to cancer or immunological pathways regardless of the filter threshold relative to fold changes. We did use GSEA tool and we did not pick up significant terms relating to EC coupling and neuromuscular disorders linked to RyR1 mutationsg) The discussion should be more organized and should address the pathological mechanism of the mutation and how the current study improves our understanding of the disease. For example, the section about the implication of the mutation in bone formation and remodeling is irrelevant to the current study and is an over-interpretation of the results found in skeletal muscle.The discussion of the revised manuscript has been reorganized with new paragraphs. In addition, in the revised manuscript we removed the sentence referring to the effects of RyR1 mutations on bone formation and remodeling."}
+{"text": "Irritable bowel syndrome (IBS) has a global prevalence of around 4.1% and is associated with a low quality of life and increased healthcare costs. Current guidelines recommend that IBS is diagnosed using the symptom-based Rome IV criteria. Despite this, when patients seek medical attention, they are usually over-investigated. This issue might be resolved by novel technologies in medicine, such as the use of Artificial Intelligence (AI). In this context, this paper aims to review AI applications in IBS. AI in colonoscopy proved to be useful in organic lesion detection and diagnosis and in objectively assessing the quality of the procedure. Only a recently published study talked about the potential of AI-colonoscopy in IBS. AI was also used to study biofilm characteristics in the large bowel and establish a potential relationship with IBS. Moreover, an AI algorithm was developed in order to correlate specific bowel sounds with IBS. In addition to that, AI-based smartphone applications have been developed to facilitate the monitoring of IBS symptoms. From a therapeutic standpoint, an AI system was created to recommend specific diets based on an individual\u2019s microbiota. In conclusion, future IBS diagnosis and treatment may benefit from AI. Irritable bowel syndrome (IBS) is a common gastrointestinal disorder, which is estimated to affect around 4.1% of the global population . Even thIn the clinical setting, establishing a definitive IBS diagnosis can sometimes be rather challenging. IBS is frequently diagnosed following multiple investigations to rule out organic lesions. However, the Rome criteria have provided a basis for a definitive diagnostic process based mainly on symptoms. Currently, the latest Rome IV criteria represent guideline recommendations for diagnosing IBS . The ecoThe lack of a specific biomarker for IBS diagnosis and management represents a major reason behind these costs. Furthermore, persistent symptoms despite numerous treatment strategies, drive the patient towards more invasive additional investigations, such as colonoscopy. Despite the recommendation of both the American College of Gastroenterology (ACG)  and the Undoubtedly, IBS is one of the most difficult conditions to diagnose and manage; however, with the rapid development of technology in medicine, there is an increasing potential for novel tools and strategies to diagnose and treat this disease.Artificial Intelligence (AI) was first defined in 1950 by Alan Turing in his work entitled \u201cComputing Machinery and Intelligence\u201d. He stated that \u201cArtificial intelligence is the science and engineering of making intelligent machines, especially intelligent computer programs\u201d . OmnipreMany classic methods were used in the early days of AI, such as rule-based systems, neural networks, statistical methods, signal, image and video processing. Some of them used fuzzy, probability, possibility, and chaos theories. The majority of these were conducted offline as a result of time-consuming computations. In the last decade, the development of parallel computing and multi-core graphics processing devices (GPUs) has paved the way for the diversification of machine learning and deep learning structures to take a giant leap forward ,14.Recently, AI technology has made significant progress, allowing the use of real-time tools to provide assistance in a variety of medical procedures. Additionally, AI technology is now capable of performing a wide range of tasks. These include assisting the decision-making process in diagnosis and therapy, reducing medical errors, improving productivity, stratifying diseases and predicting risks ,16.The potential role of AI in the clinical setting may be immense. Fundamentally, there are three levels on which AI could be implemented in the clinical context.Firstly, AI can work as a screening tool by identifying individuals who might benefit from a referral for an in-person examination. This might theoretically reduce the burden on healthcare systems .The second role that AI can fulfill is performing an activity previously carried out by humans. Although fully replacing healthcare providers with machines is quite unlikely to ever be possible, certain repetitive time- and resource-consuming tasks can be automated and performed by a well-trained AI system .The third and possibly the most significant role of AI in the medical field is to augment the abilities of human healthcare providers, thus enabling them to maximize the effectiveness of their care. It has been shown that when clinicians and AI work together, the results are significantly better than when they work separately ,17.Even though the Rome IV symptom-based criteria are the current gold standard for diagnosing IBS, many physicians still perform invasive testing to rule out organic lesions before confirming this diagnosis. This is mainly because of the similarity in clinical presentation between IBS and other organic diseases such as Crohn\u2019s disease, ulcerative colitis and celiac disease . Only a Colonoscopy is considered the gold standard for diagnosing organic lesions of the colon. Direct visualization of the lesion and the ability to take biopsies represent the two greatest advantages of this investigation. Colorectal cancer (CCR) remains a major public health problem, responsible for over 900,000 deaths worldwide in 2020. According to GLOBOCAN 2020, it represents the second most common cause of cancer-related death ,8. AccorFor a positive diagnosis of IBS, conventional colonoscopy has not proved to be of significant benefit. The results of a recent meta-analysis demonstrated that there is no difference in the yield of CRC or inflammatory bowel disease between individuals with or without IBS .Recently, Tabata K et al. published a paper in which they used a free AI algorithm created with \u201cGoogle Cloud Platform AutoML Vision\u201d . Their aTo enhance the colonoscopy examination, several other AI systems were developed and approved for use. Nonetheless, most of them were aimed at detecting and diagnosing organic lesions  13,23].,23.13,23Additionally, AI technologies were developed in order to increase quality assurance in colonoscopy. These AI systems were specifically trained to evaluate quality indicators in colonoscopy such as the rate of cecum intubation and total colonoscopy, withdrawal time, as well as the degree of bowel cleansing according to established bowel preparation scales . In the near future, we might be able to ensure that the colonoscopic investigation is of adequate quality by utilizing a tool that can objectively evaluate bowel preparation. In addition to that, AI is associated with a very low risk of missing an adenoma. As a result, both clinicians and patients can rest assured knowing that the IBS diagnosis is indeed accurate, and no further investigation is warranted.In a paper published by Young Lee et al.  an AI syFurthermore, artificial intelligence technology has been developed to indirectly assist colonoscopy in a laboratory setting. Baumgartner et al.  publisheThe study, which included 1112 patients from two European medical centers, examined the association between IBS and endoscopically visible biofilms. Out of them, 117 patients  were selected for molecular and microscopic analyses. Biopsy samples were retrieved from both biofilm-positive and biofilm-negative patients. When no biofilm was present, the biopsies were taken from similar areas of the intestine (cecum or ascending colon) . The AI Briefly, several studies suggest that AI-assisted biofilm analysis could be a potential novel diagnostic tool for IBS.Over the past few years, there has been a growing interest in research into the sounds of the bowel as a possible non-invasive, reliable, replicable and cost-effective diagnostic test for IBS. The paper published by Craine et al. at the beginning of the twenty-first century was a pivotal study on the topic. In their study, the researchers investigated bowel sounds from both healthy and IBS individuals using computer analysis. According to their findings, fasting sound-to-sound intervals were significantly different between groups. The sensitivity and specificity of this method for detecting IBS were 89% and 100%, respectively . The stuBased on a systematic review of bowel sound analysis methods published in 2018, Inderjeeth et al. concluded that the methods available up to that point were not suitable for evaluating bowel sounds in the clinical setting . A studyFurther studies are still needed before automated bowel sound identification procedures can be routinely applied in clinical practice.IBS is therapeutically challenging, which is reflected in the patients\u2019 numerous medical appointments. Given the fact that multiple factors are suspected to contribute to disease progression and severity, alongside widely varying symptoms, it is often difficult to design a targeted treatment plan. A specific dietary approach is frequently one of the key components of IBS management, which has been shown to be effective and safe. Certain diets may lead to symptomatic improvement, such as the low fermentable oligosaccharides, disaccharides, monosaccharides, and polyols (FODMAP) diet . UnfortuConstructing a targeted, specific diet for IBS patients seems a promising strategy. The human microbiome is influenced by ingested foods and may play a significant role in the pathogenicity of the disease. Therefore, it should constitute an essential factor to consider when choosing the right diet for the treatment of IBS. In their work published in Gut Microbes in November 2022, Karakan and his team focused their research on this topic . HoweverKarakan et al. developed an AI system (ENBIOSIS) that may optimize the personalized nutritional strategy based on a patient\u2019s individual microbiota. Their system is a machine learning classifier that uses XGBoost, a stochastic gradient-boosting classification model. For training purposes, two databases were needed. Firstly, they compiled a microbiota database using available open-source data from the American Gut Project , the HumThe IBS severity scoring system (IBS-SSS) was used to evaluate the clinical status of the participants both pre- and post-intervention. Additionally, changes in the microbiota were followed pre- and post-intervention with the help of a microbiome-derived IBS index score created using a machine learning technique. Even though the microbiota-derived IBS index score and the IBS-SSS improved in both groups , the results were more substantial in subjects receiving an AI-personalized diet .Therefore, it seems that in the future AI is likely to play a significant role in the treatment of a variety of diseases, including difficult-to-treat conditions such as IBS.In today\u2019s world technology is practically ubiquitous, also reflected in the presence of gadgets at every step. Leaving home without a smartphone, a smartwatch, or even smart headphones seems almost inescapable. Nowadays, these gadgets are being used to provide medical assistance and monitor health conditions. Wearable devices and apps can help track heart rate, blood pressure, and other important health metrics. They can also be used to alert medical personnel in case of an emergency. For instance, the Apple Watch Series 6 includes a feature that can detect if the user has suffered a hard fall and will alert emergency services if they are immobile for more than a minute.Integrating AI technology into these gadgets may also give rise to new opportunities in regard to monitoring and tailoring IBS treatment. In 2022, Pimentel et al. published a study on this topic in the American Journal of Gastroenterology . They deIn conclusion, AI may be able to provide a more objective assessment of stool characteristics, allowing for a more efficient diagnosis and treatment follow-up of IBS patients.Although IBS has been a significant healthcare and economic problem for some time, little progress has been made regarding the paraclinical investigation of this disease. As new technologies are developed in medicine, some potential new tools may become available. To the best of our knowledge, there has only been one systematic review published on AI and IBS in 2022 by Marzieh Kordi et al. . They weAs AI is becoming capable of performing more complex tasks with similar accuracy to human counterparts and a higher level of computing power, there is increasing potential to develop new tools that may aid with everyday tasks. The use of AI is becoming increasingly prevalent in many areas, particularly in the medical field. This will further improve the quality of not only the diagnostic process but also of individualized therapeutic strategies.\u27a2Diagnose IBS early by analyzing patient data, symptoms and patterns, allowing for a more accurate and timely diagnosis.\u27a2A personalized treatment plan can be developed by AI, based on a patient\u2019s personal data, lifestyle and preferences, thereby optimizing symptom management.\u27a2An AI-powered application can continuously monitor symptoms, providing real-time feedback and suggesting changes to diet or lifestyle.\u27a2AI chatbots and virtual assistants can provide instant answers to IBS patients\u2019 questions and assist them in managing their symptoms.\u27a2By using Natural Language Processing (NLP) algorithms, it is possible to extract valuable insights from patients\u2019 descriptions of their symptoms and experiences, which in turn can be used to assist in diagnosis and treatment.\u27a2AI can provide personalized dietary advice, helping patients identify trigger foods and create IBS-friendly meal plans.\u27a2Incorporating AI into telemedicine consulting can enhance the quality of telemedicine consultations by providing physicians with decision support and assisting them in making better treatment recommendations.\u27a2By analyzing vast datasets and identifying potential therapeutic targets, AI can accelerate IBS treatment discovery.\u27a2An AI-driven platform can facilitate the connection between patients with IBS and support communities and resources, fostering a sense of camaraderie and sharing coping strategies for IBS.A few ideas for future AI developments in the management of IBS patients are presented below:A particularly interesting approach for understanding IBS through the use of AI is to analyze the microbiome, which has been suggested to play an important role in IBS pathophysiology. Studies of microbiomes can be challenging due to the large number of different types of data available. AI can play an important role in processing these data at high speeds and establishing connections between the information presented. There have already been some studies in this field that have produced promising results. In one study, Hirokazu Fukui et al., 2020 investigated the relationship between IBS patients and the gut microbiota using Machine Learning-Based Microbiome Analysis. Using machine learning, they developed a prediction model for identifying IBS patients with a sensitivity of >80% and specificity of >90% .In the future, it may be possible to use an AI system in order to evaluate an individual\u2019s lifestyle, external factors, social interactions, as well as working and daily habits. Consequently, some potential causes of bowel disorders may be identified. Additionally, AI might also be able to provide personalized recommendations on dietary and therapeutic strategies. Integrating AI algorithms into portable gadgets such as smartphones or smartwatches could be a promising approach. Based on a continuous stream of data from daily life, the AI will potentially be able to recommend lifestyle changes tailored to the person\u2019s individual circumstances.Given its recent rapid advancement, it appears that technology development will keep on expanding in the years to come. Some concerns have been raised regarding the fact that humans are becoming increasingly dependent on machines and less able to perform certain activities without the use of these tools. However, it is essential to note that technology has enabled us to accomplish so much more in a fraction of the time, while at the same time maintaining the highest possible standard of quality in our activities. Undoubtedly, this is particularly prevalent in the field of medicine. Although this delicate balance between the dependence on machines and computers and our personal development must be carefully maintained, technology, including AI systems, can be greatly beneficial if properly used.To sum up, IBS is unquestionably a rather challenging disease to diagnose and treat. Nevertheless, recent progress in AI development hints at the fact that many of our questions may be answered once a certain technological threshold is reached."}
+{"text": "Despite emphasis for emergent surgical treatment of Stanford type A aortic dissections, pregnant patients that are clinically stable may safely receive a staged approach instead, with delivery followed by delayed dissection repair. An initial CT demonstrating a Stanford type A aortic dissection in a pregnant patient. Nonetheless, gravidity remains a critical consideration, as approximately 50% of the dissections seen in women under 40\u2009years of age actually occur during pregnancy.22 99% on room air. She was initially kept under observation and treated with fluids and antiemetics. Two days later, in conjunction with persisting abdominal pain, the patient was found to have significantly lower blood pressures in the right upper extremity (65/48\u2009mm Hg) compared to the left upper extremity (122/58\u2009mm Hg). CT Angiogram revealed a Stanford type A AD involving the ascending aorta, aortic arch, descending thoracic aorta, and abdominal aorta with a dissection flap just below the origin of the superior mesenteric artery  was performed and showed preserved left ventricular systolic function (ejection fraction 60%), mild aortic regurgitation, and moderate mitral and tricuspid regurgitation. Importantly, the TEE indicated no pericardial effusion. The newborn was healthy and transferred to the NICU as a precaution. The patient was extubated and recovered from the cesarean delivery and 3\u2009days later, the patient underwent a hemiarch replacement to repair the type A dissection, accomplished using 26\u2009mm Gelweave tube graft. This repair was limited to the ascending and proximal aortic hemiarch; a CTA of the repair can be seen in Figure\u00a02 98% on room air. Retention sutures were left in place after the dissection repair and subsequently removed on an outpatient basis with no complications reported. Written informed consent was obtained from the patient for their anonymized information to be published in this article. A timeline of our patient's admission, transfer, and subsequent hospital course can be found in Table\u00a0The patient was transferred to our institution where a multidisciplinary team of obstetricians, cardiac surgeons, and anesthesiologists decided to use a staged approach due to her clinical stability. Vitals at admission to our institution were as follows: blood pressure 131/57\u2009mm Hg, pulse 67 beats per minute, respirations 22/min, temperature 98.5\u2009\u00b0F, and SpO3Classically, ADs present with widened pulse pressure, unequal blood pressures in upper extremities, and pathognomonic \u201ctearing\u201d chest pain radiating to the back.To expand on the pathophysiology of ADs in pregnant patients, increased sympathetic activity and activation of the renin\u2010angiotensin\u2010aldosterone system contribute to increased cardiac output and overall blood volume; this in turn puts more stress on blood vessels, especially the aorta, increasing susceptibility for AD during pregnancy and in the postpartum period.One of the challenges in diagnosing AD during pregnancy is imaging. While the gold standard for AD diagnosis has traditionally been CTA, both radiographs and CT scans are discouraged in pregnancy due to the potentially harmful effects of radiation to the fetus.The majority of pregnancy\u2010related AD are Stanford type A (57%\u201380%), necessitating surgical management; type B can be managed medically but may still require endovascular or surgical repair.Staged repair of type A ADs in pregnant patients has been reported in the past, patients with gestational ages ranging from 24 to 36\u2009weeks and the interval between delivery and repair of the aortic defect occurring in the context of patient stability.Our study is a limited analysis of the optimal management of pregnancy\u2010related AD, in that we present a singular case. This adds to the literature regarding AD but is not a substitute for more rigorous analysis. Additionally, there was extended discussion on the risk\u2013benefit of surgery with the fetus still in utero, as the patient was at 31\u2009weeks' gestation and considered viable with cesarean delivery. Future studies should systematically investigate the efficacy and outcomes  for both staged delivery and AD repair, and risk benefit of screening and/or prophylactic repair of patients with aortopathies/predisposing conditions for dissection. Many women with an aortopathy condition are not diagnosed until pregnancy or the postpartum period, in part due to many such conditions not having associated readily apparent physical characteristics, and in part also due to the inconsistency of patients with a pregnancy\u2010related AD having definitive genetic testing that shows risk for developing an AD.4We present a case of successful surgical treatment of an AD in a pregnant patient after an initial delay in diagnosis treated with a staged approach of delivery followed by delayed dissection repair. ADs represent a potentially catastrophic complication of pregnancy. Although ADs are thought to have the hallmark easily identifiable tearing chest pain, atypical presentations may delay accurate diagnosis and clinical management. Increased clinical suspicion for AD is warranted in patients with corresponding risk factors, especially pregnancy. Treatment aims to mitigate the risk of both fetal and maternal demise, and typically includes emergent cesarean section and AD defect repair, though consensus regarding the timing of repair is currently lacking. While AD in the general population is well studied, future studies should aim to better describe how AD may present during pregnancy and how management differs in the gravid patient from that of nonpregnant patients.Julian A. Gordon: Conceptualization; formal analysis; investigation; writing \u2013 original draft; writing \u2013 review and editing. Michael C. Larkins: Formal analysis; writing \u2013 original draft; writing \u2013 review and editing. Melisa Pasli: Formal analysis; writing \u2013 original draft; writing \u2013 review and editing. Sunny R. Cai: Conceptualization; formal analysis; project administration; resources; supervision; writing \u2013 original draft. Adam C. Celio: Formal analysis; project administration; writing \u2013 original draft. Michael J. Bates: Formal analysis; project administration; supervision; writing \u2013 original draft.This research received no specific grant from any funding agency in the public, commercial, or not\u2010for\u2010profit sectors.The authors declare that there is no conflict of interest.Written informed consent was obtained from the patient for their anonymized information to be published in this article."}
+{"text": 
\ No newline at end of file